WorldWideScience

Sample records for blue gene duplication

  1. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  2. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Molecular mechanisms of gene duplication. Duplicated genes may be produced by unequal crossing over, retrotransposition, duplicated DNA transposition and polyploidization. Unequal crossing over. Unequal crossing over produces tandem repeated sequences,. i.e. continuous repeats of DNA sequence. Depending on.

  3. Repositioning-dependent fate of duplicate genes.

    Science.gov (United States)

    Rodin, Sergei N; Parkhomchuk, Dmitri V; Rodin, Andrei S; Holmquist, Gerald P; Riggs, Arthur D

    2005-09-01

    Gene duplication is the main source of evolutionary novelties. However, the problem with duplicates is that the purifying selection overlooks deleterious mutations in the redundant sequence, which therefore, instead of gaining a new function, often degrades into a functionless pseudogene. This risk of functional loss instead of gain is much higher for small populations of higher organisms with a slow and complex development. We propose that it is the epigenetic tissue/stage-complementary silencing of duplicates that makes them exposable to the purifying selection, thus saving them from pseudogenization and opening the way towards new function(s). Our genome-wide analyses of gene duplicates in several eukaryotic species combined with the phylogenetic comparison of vertebrate alpha- and beta-globin gene clusters strongly support this epigenetic complementation (EC) model. The distinctive condition for a new duplicate to survive by the EC mechanism seems to be its repositioning to an ectopic site, which is accompanied by changes in the rate and direction of mutagenesis. The most distinguished in this respect is the human genome. In this review, we extend and discuss the data on the EC- and repositioning-dependent fate of gene duplicates with the special emphasis on the problem of detecting brief postduplication period of adaptive evolution driven by positive selection. Accordingly, we propose a new CpG-focused measure of selection that is insensitive to translocation-caused biases in mutagenesis.

  4. Yeast genome duplication was followed by asynchronous differentiation of duplicated genes

    DEFF Research Database (Denmark)

    Langkjær, Rikke Breinhold; Cliften, P.F.; Johnston, M.

    2003-01-01

    Gene redundancy has been observed in yeast, plant and human genomes, and is thought to be a consequence of whole-genome duplications(1-3). Baker's yeast, Saccharomyces cerevisiae, contains several hundred duplicated genes(1). Duplication(s) could have occurred before or after a given speciation....... To understand the evolution of the yeast genome, we analysed orthologues of some of these genes in several related yeast species. On the basis of the inferred phylogeny of each set of genes, we were able to deduce whether the gene duplicated and/or specialized before or after the divergence of two yeast...

  5. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Abstract. Gene duplication is an important mechanism for acquiring new genes and creating genetic novelty in organisms. Many new gene functions have evolved through gene duplication and it has contributed tremendously to the evolution of developmen- tal programmes in various organisms. Gene duplication can result ...

  6. Faster Evolving Primate Genes Are More Likely to Duplicate.

    Science.gov (United States)

    O'Toole, Áine N; Hurst, Laurence D; McLysaght, Aoife

    2018-01-01

    An attractive and long-standing hypothesis regarding the evolution of genes after duplication posits that the duplication event creates new evolutionary possibilities by releasing a copy of the gene from constraint. Apparent support was found in numerous analyses, particularly, the observation of higher rates of evolution in duplicated as compared with singleton genes. Could it, instead, be that more duplicable genes (owing to mutation, fixation, or retention biases) are intrinsically faster evolving? To uncouple the measurement of rates of evolution from the determination of duplicate or singleton status, we measure the rates of evolution in singleton genes in outgroup primate lineages but classify these genes as to whether they have duplicated or not in a crown group of great apes. We find that rates of evolution are higher in duplicable genes prior to the duplication event. In part this is owing to a negative correlation between coding sequence length and rate of evolution, coupled with a bias toward smaller genes being more duplicable. The effect is masked by difference in expression rate between duplicable genes and singletons. Additionally, in contradiction to the classical assumption, we find no convincing evidence for an increase in dN/dS after duplication, nor for rate asymmetry between duplicates. We conclude that high rates of evolution of duplicated genes are not solely a consequence of the duplication event, but are rather a predictor of duplicability. These results are consistent with a model in which successful gene duplication events in mammals are skewed toward events of minimal phenotypic impact. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  8. Molecular trajectories leading to the alternative fates of duplicate genes.

    Directory of Open Access Journals (Sweden)

    Michael Marotta

    Full Text Available Gene duplication generates extra gene copies in which mutations can accumulate without risking the function of pre-existing genes. Such mutations modify duplicates and contribute to evolutionary novelties. However, the vast majority of duplicates appear to be short-lived and experience duplicate silencing within a few million years. Little is known about the molecular mechanisms leading to these alternative fates. Here we delineate differing molecular trajectories of a relatively recent duplication event between humans and chimpanzees by investigating molecular properties of a single duplicate: DNA sequences, gene expression and promoter activities. The inverted duplication of the Glutathione S-transferase Theta 2 (GSTT2 gene had occurred at least 7 million years ago in the common ancestor of African great apes and is preserved in chimpanzees (Pan troglodytes, whereas a deletion polymorphism is prevalent in humans. The alternative fates are associated with expression divergence between these species, and reduced expression in humans is regulated by silencing mutations that have been propagated between duplicates by gene conversion. In contrast, selective constraint preserved duplicate divergence in chimpanzees. The difference in evolutionary processes left a unique DNA footprint in which dying duplicates are significantly more similar to each other (99.4% than preserved ones. Such molecular trajectories could provide insights for the mechanisms underlying duplicate life and death in extant genomes.

  9. Epigenetic silencing may aid evolution by gene duplication.

    Science.gov (United States)

    Rodin, Sergei N; Riggs, Arthur D

    2003-06-01

    Gene duplication is commonly regarded as the main evolutionary path toward the gain of a new function. However, even with gene duplication, there is a loss-versus-gain dilemma: most newly born duplicates degrade to pseudogenes, since degenerative mutations are much more frequent than advantageous ones. Thus, something additional seems to be needed to shift the loss versus gain equilibrium toward functional divergence. We suggest that epigenetic silencing of duplicates might play this role in evolution. This study began when we noticed in a previous publication (Lynch M, Conery JS [2000] Science 291:1151-1155) that the frequency of functional young gene duplicates is higher in organisms that have cytosine methylation (H. sapiens, M. musculus, and A. thaliana) than in organisms that do not have methylated genomes (S. cerevisiae, D. melanogaster, and C. elegans). We find that genome data analysis confirms the likelihood of much more efficient functional divergence of gene duplicates in mammals and plants than in yeast, nematode, and fly. We have also extended the classic model of gene duplication, in which newly duplicated genes have exactly the same expression pattern, to the case when they are epigenetically silenced in a tissue- and/or developmental stage-complementary manner. This exposes each of the duplicates to negative selection, thus protecting from "pseudogenization." Our analysis indicates that this kind of silencing (i) enhances evolution of duplicated genes to new functions, particularly in small populations, (ii) is quite consistent with the subfunctionalization model when degenerative but complementary mutations affect different subfunctions of the gene, and (iii) furthermore, may actually cooperate with the DDC (duplication-degeneration-complementation) process.

  10. The effect of functional compensation among duplicate genes can ...

    Indian Academy of Sciences (India)

    Gene duplicates have the inherent property of initially being functionally redundant. This means that they can compensate for the effect of deleterious variation occurring at one or more sister sites. Here, I present data bearing on evolutionary theory that illustrates the manner in which any functional adaptation in duplicate ...

  11. Gene duplication in the genome of parasitic Giardia lamblia

    Directory of Open Access Journals (Sweden)

    Flores Roberto

    2010-02-01

    Full Text Available Abstract Background Giardia are a group of widespread intestinal protozoan parasites in a number of vertebrates. Much evidence from G. lamblia indicated they might be the most primitive extant eukaryotes. When and how such a group of the earliest branching unicellular eukaryotes developed the ability to successfully parasitize the latest branching higher eukaryotes (vertebrates is an intriguing question. Gene duplication has long been thought to be the most common mechanism in the production of primary resources for the origin of evolutionary novelties. In order to parse the evolutionary trajectory of Giardia parasitic lifestyle, here we carried out a genome-wide analysis about gene duplication patterns in G. lamblia. Results Although genomic comparison showed that in G. lamblia the contents of many fundamental biologic pathways are simplified and the whole genome is very compact, in our study 40% of its genes were identified as duplicated genes. Evolutionary distance analyses of these duplicated genes indicated two rounds of large scale duplication events had occurred in G. lamblia genome. Functional annotation of them further showed that the majority of recent duplicated genes are VSPs (Variant-specific Surface Proteins, which are essential for the successful parasitic life of Giardia in hosts. Based on evolutionary comparison with their hosts, it was found that the rapid expansion of VSPs in G. lamblia is consistent with the evolutionary radiation of placental mammals. Conclusions Based on the genome-wide analysis of duplicated genes in G. lamblia, we found that gene duplication was essential for the origin and evolution of Giardia parasitic lifestyle. The recent expansion of VSPs uniquely occurring in G. lamblia is consistent with the increment of its hosts. Therefore we proposed a hypothesis that the increment of Giradia hosts might be the driving force for the rapid expansion of VSPs.

  12. Monocephalus dipygus parapagus: a suspected case of complete caudal duplication in a British Blue kitten.

    Science.gov (United States)

    Seavers, Aine M

    2009-04-01

    Complete caudal duplication is an extremely rare type of conjoined twinning. This communication reports the birth and gross features of a live conjoined British Blue kitten born naturally to a healthy queen. The monocephalic dipygus kitten exhibited a normal skull and upper body, two separate pelves, four hind limbs and two tails. A cleft palate and bifurcation of rostral mandible were also noted. The absence of maternal dystocia was unusual for conjoined twinnings.

  13. Does negative auto-regulation increase gene duplicability?

    Directory of Open Access Journals (Sweden)

    Lercher Martin J

    2009-08-01

    Full Text Available Abstract Background A prerequisite for a duplication to spread through and persist in a given population is retaining expression of both gene copies. Yet changing a gene's dosage is frequently detrimental to fitness. Consequently, dosage-sensitive genes are less likely to duplicate. However, in cases where the level of gene product is controlled, via negative feedback, by its own abundance, an increase in gene copy number can in principle be decoupled from an increase in protein while both copies remain expressed. Using data from the transcriptional networks of E. coli and S. cerevisiae, we test the hypothesis that genes under negative auto-regulation show enhanced duplicability. Results Controlling for several known correlates of duplicability, we find no statistically significant support in either E. coli or S. cerevisiae that transcription factors under negative auto-regulation hold a duplicability advantage over transcription factors with no auto-regulation. Conclusion Based on the analysis of transcriptional networks in E. coli and S. cerevisiae, there is no evidence that negative auto-regulation has contributed, on a genome-wide scale, to the variability in gene family sizes in these species.

  14. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Gene duplication can provide new genetic material for mutation, drift and selection to act upon, the result of which is specialized or new gene functions. Without ... The domain part of the email address of all email addresses used by the office of Indian Academy of Sciences, including those of the staff, the journals, various ...

  15. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    BACKGROUND: Menkes disease (MD) is an X-linked, fatal neurodegenerative disorder of copper metabolism, caused by mutations in the ATP7A gene. Thirty-three Menkes patients in whom no mutation had been detected with standard diagnostic tools were screened for exon duplications in the ATP7A gene. ME...

  16. Familial Lymphoproliferative Malignancies and Tandem Duplication of NF1 Gene

    Directory of Open Access Journals (Sweden)

    Gustavo Fernandes

    2014-01-01

    Full Text Available Background. Neurofibromatosis type 1 is a genetic disorder caused by loss-of-function mutations in a tumor suppressor gene (NF1 which codifies the protein neurofibromin. The frequent genetic alterations that modify neurofibromin function are deletions and insertions. Duplications are rare and phenotype in patients bearing duplication of NF1 gene is thought to be restricted to developmental abnormalities, with no reference to cancer susceptibility in these patients. We evaluated a patient who presented with few clinical signs of neurofibromatosis type 1 and a conspicuous personal and familiar history of different types of cancer, especially lymphoproliferative malignancies. The coding region of the NF-1 gene was analyzed by real-time polymerase chain reaction and direct sequencing. Multiplex ligation-dependent probe amplification was performed to detect the number of mutant copies. The NF1 gene analysis showed the following alterations: mosaic duplication of NF1, TRAF4, and MYO1D. Fluorescence in situ hybridization using probes (RP5-1002G3 and RP5-92689 flanking NF1 gene in 17q11.2 and CEP17 for 17q11.11.1 was performed. There were three signals (RP5-1002G3conRP5-92689 in the interphases analyzed and two signals (RP5-1002G3conRP5-92689 in 93% of cells. These findings show a tandem duplication of 17q11.2. Conclusion. The case suggests the possibility that NF1 gene duplication may be associated with a phenotype characterized by lymphoproliferative disorders.

  17. The effect of functional compensation among duplicate genes can ...

    Indian Academy of Sciences (India)

    Abstract. Gene duplicates have the inherent property of initially being functionally redundant. This means that they can compensate for the effect of deleterious variation occurring at one or more sister sites. Here, I present data bearing on evolutionary theory that illustrates the manner in which any functional adaptation in ...

  18. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  19. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  20. Root hairs, trichomes and the evolution of duplicate genes.

    Science.gov (United States)

    Kellogg, E A

    2001-12-01

    The MYB-class proteins WEREWOLF and GLABRA1 are functionally interchangeable, even though one is normally expressed solely in roots and the other only in shoots. This shows that their different functions are the result of the modification of cis-regulatory sequences over evolutionary time. The two genes thus provide an example of morphological diversification created by gene duplication and changes in regulation.

  1. On the origins of Mendelian disease genes in man: the impact of gene duplication.

    Science.gov (United States)

    Dickerson, Jonathan E; Robertson, David L

    2012-01-01

    Over 3,000 human diseases are known to be linked to heritable genetic variation, mapping to over 1,700 unique genes. Dating of the evolutionary age of these disease-associated genes has suggested that they have a tendency to be ancient, specifically coming into existence with early metazoa. The approach taken by past studies, however, assumes that the age of a disease is the same as the age of its common ancestor, ignoring the fundamental contribution of duplication events in the evolution of new genes and function. Here, we date both the common ancestor and the duplication history of known human disease-associated genes. We find that the majority of disease genes (80%) are genes that have been duplicated in their evolutionary history. Periods for which there are more disease-associated genes, for example, at the origins of bony vertebrates, are explained by the emergence of more genes at that time, and the majority of these are duplicates inferred to have arisen by whole-genome duplication. These relationships are similar for different disease types and the disease-associated gene's cellular function. This indicates that the emergence of duplication-associated diseases has been ongoing and approximately constant (relative to the retention of duplicate genes) throughout the evolution of life. This continued until approximately 390 Ma from which time relatively fewer novel genes came into existence on the human lineage, let alone disease genes. For single-copy genes associated with disease, we find that the numbers of disease genes decreases with recency. For the majority of duplicates, the disease-associated mutation is associated with just one of the duplicate copies. A universal explanation for heritable disease is, thus, that it is merely a by-product of the evolutionary process; the evolution of new genes (de novo or by duplication) results in the potential for new diseases to emerge.

  2. The Phenotypic Plasticity of Duplicated Genes in Saccharomyces cerevisiae and the Origin of Adaptations

    Directory of Open Access Journals (Sweden)

    Florian Mattenberger

    2017-01-01

    Full Text Available Gene and genome duplication are the major sources of biological innovations in plants and animals. Functional and transcriptional divergence between the copies after gene duplication has been considered the main driver of innovations . However, here we show that increased phenotypic plasticity after duplication plays a more major role than thought before in the origin of adaptations. We perform an exhaustive analysis of the transcriptional alterations of duplicated genes in the unicellular eukaryote Saccharomyces cerevisiae when challenged with five different environmental stresses. Analysis of the transcriptomes of yeast shows that gene duplication increases the transcriptional response to environmental changes, with duplicated genes exhibiting signatures of adaptive transcriptional patterns in response to stress. The mechanism of duplication matters, with whole-genome duplicates being more transcriptionally altered than small-scale duplicates. The predominant transcriptional pattern follows the classic theory of evolution by gene duplication; with one gene copy remaining unaltered under stress, while its sister copy presents large transcriptional plasticity and a prominent role in adaptation. Moreover, we find additional transcriptional profiles that are suggestive of neo- and subfunctionalization of duplicate gene copies. These patterns are strongly correlated with the functional dependencies and sequence divergence profiles of gene copies. We show that, unlike singletons, duplicates respond more specifically to stress, supporting the role of natural selection in the transcriptional plasticity of duplicates. Our results reveal the underlying transcriptional complexity of duplicated genes and its role in the origin of adaptations.

  3. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  4. Ancestral duplications and highly dynamic opsin gene evolution in percomorph fishes.

    Science.gov (United States)

    Cortesi, Fabio; Musilová, Zuzana; Stieb, Sara M; Hart, Nathan S; Siebeck, Ulrike E; Malmstrøm, Martin; Tørresen, Ole K; Jentoft, Sissel; Cheney, Karen L; Marshall, N Justin; Carleton, Karen L; Salzburger, Walter

    2015-02-03

    Single-gene and whole-genome duplications are important evolutionary mechanisms that contribute to biological diversification by launching new genetic raw material. For example, the evolution of animal vision is tightly linked to the expansion of the opsin gene family encoding light-absorbing visual pigments. In teleost fishes, the most species-rich vertebrate group, opsins are particularly diverse and key to the successful colonization of habitats ranging from the bioluminescence-biased but basically dark deep sea to clear mountain streams. In this study, we report a previously unnoticed duplication of the violet-blue short wavelength-sensitive 2 (SWS2) opsin, which coincides with the radiation of highly diverse percomorph fishes, permitting us to reinterpret the evolution of this gene family. The inspection of close to 100 fish genomes revealed that, triggered by frequent gene conversion between duplicates, the evolutionary history of SWS2 is rather complex and difficult to predict. Coincidentally, we also report potential cases of gene resurrection in vertebrate opsins, whereby pseudogenized genes were found to convert with their functional paralogs. We then identify multiple novel amino acid substitutions that are likely to have contributed to the adaptive differentiation between SWS2 copies. Finally, using the dusky dottyback Pseudochromis fuscus, we show that the newly discovered SWS2A duplicates can contribute to visual adaptation in two ways: by gaining sensitivities to different wavelengths of light and by being differentially expressed between ontogenetic stages. Thus, our study highlights the importance of comparative approaches in gaining a comprehensive view of the dynamics underlying gene family evolution and ultimately, animal diversification.

  5. Ancestral duplications and highly dynamic opsin gene evolution in percomorph fishes

    Science.gov (United States)

    Cortesi, Fabio; Musilová, Zuzana; Stieb, Sara M.; Hart, Nathan S.; Siebeck, Ulrike E.; Malmstrøm, Martin; Tørresen, Ole K.; Jentoft, Sissel; Cheney, Karen L.; Marshall, N. Justin; Carleton, Karen L.; Salzburger, Walter

    2015-01-01

    Single-gene and whole-genome duplications are important evolutionary mechanisms that contribute to biological diversification by launching new genetic raw material. For example, the evolution of animal vision is tightly linked to the expansion of the opsin gene family encoding light-absorbing visual pigments. In teleost fishes, the most species-rich vertebrate group, opsins are particularly diverse and key to the successful colonization of habitats ranging from the bioluminescence-biased but basically dark deep sea to clear mountain streams. In this study, we report a previously unnoticed duplication of the violet-blue short wavelength-sensitive 2 (SWS2) opsin, which coincides with the radiation of highly diverse percomorph fishes, permitting us to reinterpret the evolution of this gene family. The inspection of close to 100 fish genomes revealed that, triggered by frequent gene conversion between duplicates, the evolutionary history of SWS2 is rather complex and difficult to predict. Coincidentally, we also report potential cases of gene resurrection in vertebrate opsins, whereby pseudogenized genes were found to convert with their functional paralogs. We then identify multiple novel amino acid substitutions that are likely to have contributed to the adaptive differentiation between SWS2 copies. Finally, using the dusky dottyback Pseudochromis fuscus, we show that the newly discovered SWS2A duplicates can contribute to visual adaptation in two ways: by gaining sensitivities to different wavelengths of light and by being differentially expressed between ontogenetic stages. Thus, our study highlights the importance of comparative approaches in gaining a comprehensive view of the dynamics underlying gene family evolution and ultimately, animal diversification. PMID:25548152

  6. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  7. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  8. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  9. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  10. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  11. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  12. A limited role for gene duplications in the evolution of platypus venom.

    Science.gov (United States)

    Wong, Emily S W; Papenfuss, Anthony T; Whittington, Camilla M; Warren, Wesley C; Belov, Katherine

    2012-01-01

    Gene duplication followed by adaptive selection is believed to be the primary driver of venom evolution. However, to date, no studies have evaluated the importance of gene duplications for venom evolution using a genomic approach. The availability of a sequenced genome and a venom gland transcriptome for the enigmatic platypus provides a unique opportunity to explore the role that gene duplication plays in venom evolution. Here, we identify gene duplication events and correlate them with expressed transcripts in an in-season venom gland. Gene duplicates (1,508) were identified. These duplicated pairs (421), including genes that have undergone multiple rounds of gene duplications, were expressed in the venom gland. The majority of these genes are involved in metabolism and protein synthesis not toxin functions. Twelve secretory genes including serine proteases, metalloproteinases, and protease inhibitors likely to produce symptoms of envenomation such as vasodilation and pain were detected. Only 16 of 107 platypus genes with high similarity to known toxins evolved through gene duplication. Platypus venom C-type natriuretic peptides and nerve growth factor do not possess lineage-specific gene duplicates. Extensive duplications, believed to increase the potency of toxic content and promote toxin diversification, were not found. This is the first study to take a genome-wide approach in order to examine the impact of gene duplication on venom evolution. Our findings support the idea that adaptive selection acts on gene duplicates to drive the independent evolution and functional diversification of similar venom genes in venomous species. However, gene duplications alone do not explain the "venome" of the platypus. Other mechanisms, such as alternative splicing and mutation, may be important in venom innovation.

  13. Pattern of gene duplication in the Cotesia congregata Bracovirus.

    Science.gov (United States)

    Friedman, Robert; Hughes, Austin L

    2006-07-01

    Polydnaviruses (PDVs) are a family of double-stranded DNA viruses genetically linked to their wasp hosts. These viruses utilize the transcriptional machinery of the wasp cells to manufacture viral particles which contain circular segments of DNA. The female wasp, hosting the polydnavirus, lays its eggs along with the viral particles inside a caterpillar. Because no replication of the virus occurs while inside the caterpillar, fixed genetic changes occur solely inside the female wasp, as an integrated portion of its genome. Therefore, evolution of the polydnavirus is expected to parallel that of the wasp. Phylogenetic analysis of the polydnavirus genome showed a pattern of gene duplication consistent with the "birth-and-death" process frequently observed in eukaryotic genomes. Phylogenies provided no unequivocal evidence of horizontal gene transfer between the wasp host and the polydnavirus, but in some cases there were suggestions of such gene transfer.

  14. Impact of duplicate gene copies on phylogenetic analysis and divergence time estimates in butterflies

    Directory of Open Access Journals (Sweden)

    Liswi Saif W

    2009-05-01

    Full Text Available Abstract Background The increase in availability of genomic sequences for a wide range of organisms has revealed gene duplication to be a relatively common event. Encounters with duplicate gene copies have consequently become almost inevitable in the context of collecting gene sequences for inferring species trees. Here we examine the effect of incorporating duplicate gene copies evolving at different rates on tree reconstruction and time estimation of recent and deep divergences in butterflies. Results Sequences from ultraviolet-sensitive (UVRh, blue-sensitive (BRh, and long-wavelength sensitive (LWRh opsins,EF-1α and COI were obtained from 27 taxa representing the five major butterfly families (5535 bp total. Both BRh and LWRh are present in multiple copies in some butterfly lineages and the different copies evolve at different rates. Regardless of the phylogenetic reconstruction method used, we found that analyses of combined data sets using either slower or faster evolving copies of duplicate genes resulted in a single topology in agreement with our current understanding of butterfly family relationships based on morphology and molecules. Interestingly, individual analyses of BRh and LWRh sequences also recovered these family-level relationships. Two different relaxed clock methods resulted in similar divergence time estimates at the shallower nodes in the tree, regardless of whether faster or slower evolving copies were used, with larger discrepancies observed at deeper nodes in the phylogeny. The time of divergence between the monarch butterfly Danaus plexippus and the queen D. gilippus (15.3–35.6 Mya was found to be much older than the time of divergence between monarch co-mimic Limenitis archippus and red-spotted purple L. arthemis (4.7–13.6 Mya, and overlapping with the time of divergence of the co-mimetic passionflower butterflies Heliconius erato and H. melpomene (13.5–26.1 Mya. Our family-level results are congruent with

  15. The birth of a human-specific neural gene by incomplete duplication and gene fusion.

    Science.gov (United States)

    Dougherty, Max L; Nuttle, Xander; Penn, Osnat; Nelson, Bradley J; Huddleston, John; Baker, Carl; Harshman, Lana; Duyzend, Michael H; Ventura, Mario; Antonacci, Francesca; Sandstrom, Richard; Dennis, Megan Y; Eichler, Evan E

    2017-03-09

    Gene innovation by duplication is a fundamental evolutionary process but is difficult to study in humans due to the large size, high sequence identity, and mosaic nature of segmental duplication blocks. The human-specific gene hydrocephalus-inducing 2, HYDIN2, was generated by a 364 kbp duplication of 79 internal exons of the large ciliary gene HYDIN from chromosome 16q22.2 to chromosome 1q21.1. Because the HYDIN2 locus lacks the ancestral promoter and seven terminal exons of the progenitor gene, we sought to characterize transcription at this locus by coupling reverse transcription polymerase chain reaction and long-read sequencing. 5' RACE indicates a transcription start site for HYDIN2 outside of the duplication and we observe fusion transcripts spanning both the 5' and 3' breakpoints. We observe extensive splicing diversity leading to the formation of altered open reading frames (ORFs) that appear to be under relaxed selection. We show that HYDIN2 adopted a new promoter that drives an altered pattern of expression, with highest levels in neural tissues. We estimate that the HYDIN duplication occurred ~3.2 million years ago and find that it is nearly fixed (99.9%) for diploid copy number in contemporary humans. Examination of 73 chromosome 1q21 rearrangement patients reveals that HYDIN2 is deleted or duplicated in most cases. Together, these data support a model of rapid gene innovation by fusion of incomplete segmental duplications, altered tissue expression, and potential subfunctionalization or neofunctionalization of HYDIN2 early in the evolution of the Homo lineage.

  16. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Predominant gain of promoter TATA box after gene duplication associated with stress responses.

    Science.gov (United States)

    Zou, Yangyun; Huang, Wei; Gu, Zhenglong; Gu, Xun

    2011-10-01

    TATA box, the core promoter element, exists in a broad range of eukaryotes, and the expression of TATA-containing genes usually responds to various environmental stresses. Hence, the evolution of TATA-box in duplicate genes may provide some clues for the interrelationship among environmental stress, expression differentiation, and duplicate gene preservation. In the present study, we observed that the TATA box is significantly overrepresented in duplicate genes compared with singletons in human, worm, Arabidopsis, and yeast genomes. We then conducted an extensive functional genomic analysis to investigate the evolution of TATA box along over 700 yeast gene family phylogenies. After reconstructing the ancestral TATA-box states (presence or absence), we found that significantly higher numbers of TATA box gain events than loss events had occurred after yeast gene duplications-the overall gain-loss ratio is about 3-4 to 1. Interestingly, these TATA-gain duplicate genes on average have experienced greater expression divergence from the ancestral expression states than their most closely related TATA-less duplicate partners, but only under environmental stress conditions (asymmetric evolution); indeed, under normal physiological conditions, they have similar expression divergence (symmetric evolution). Moreover, we showed that TATA-gain duplicates are enriched in stress-associated functional categories but that is not the case for TATA-ancestral duplicates (those inherited from their ancestors prior to duplication). Together, we conclude that after the gene duplication, gain of the TATA box in duplicate promoters may have played an important role in yeast duplicate preservation by accelerating expression divergence that may facilitate the adaptive evolution of the organism in response to environmental changes.

  18. Duplication and retention biases of essential and non-essential genes revealed by systematic knockdown analyses.

    Directory of Open Access Journals (Sweden)

    Shane Woods

    2013-05-01

    Full Text Available When a duplicate gene has no apparent loss-of-function phenotype, it is commonly considered that the phenotype has been masked as a result of functional redundancy with the remaining paralog. This is supported by indirect evidence showing that multi-copy genes show loss-of-function phenotypes less often than single-copy genes and by direct tests of phenotype masking using select gene sets. Here we take a systematic genome-wide RNA interference approach to assess phenotype masking in paralog pairs in the Caenorhabditis elegans genome. Remarkably, in contrast to expectations, we find that phenotype masking makes only a minor contribution to the low knockdown phenotype rate for duplicate genes. Instead, we find that non-essential genes are highly over-represented among duplicates, leading to a low observed loss-of-function phenotype rate. We further find that duplicate pairs derived from essential and non-essential genes have contrasting evolutionary dynamics: whereas non-essential genes are both more often successfully duplicated (fixed and lost, essential genes are less often duplicated but upon successful duplication are maintained over longer periods. We expect the fundamental evolutionary duplication dynamics presented here to be broadly applicable.

  19. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  20. CG gene body DNA methylation changes and evolution of duplicated genes in cassava.

    Science.gov (United States)

    Wang, Haifeng; Beyene, Getu; Zhai, Jixian; Feng, Suhua; Fahlgren, Noah; Taylor, Nigel J; Bart, Rebecca; Carrington, James C; Jacobsen, Steven E; Ausin, Israel

    2015-11-03

    DNA methylation is important for the regulation of gene expression and the silencing of transposons in plants. Here we present genome-wide methylation patterns at single-base pair resolution for cassava (Manihot esculenta, cultivar TME 7), a crop with a substantial impact in the agriculture of subtropical and tropical regions. On average, DNA methylation levels were higher in all three DNA sequence contexts (CG, CHG, and CHH, where H equals A, T, or C) than those of the most well-studied model plant Arabidopsis thaliana. As in other plants, DNA methylation was found both on transposons and in the transcribed regions (bodies) of many genes. Consistent with these patterns, at least one cassava gene copy of all of the known components of Arabidopsis DNA methylation pathways was identified. Methylation of LTR transposons (GYPSY and COPIA) was found to be unusually high compared with other types of transposons, suggesting that the control of the activity of these two types of transposons may be especially important. Analysis of duplicated gene pairs resulting from whole-genome duplication showed that gene body DNA methylation and gene expression levels have coevolved over short evolutionary time scales, reinforcing the positive relationship between gene body methylation and high levels of gene expression. Duplicated genes with the most divergent gene body methylation and expression patterns were found to have distinct biological functions and may have been under natural or human selection for cassava traits.

  1. A cure for the blues: opsin duplication and subfunctionalization for short-wavelength sensitivity in jewel beetles (Coleoptera: Buprestidae).

    Science.gov (United States)

    Lord, Nathan P; Plimpton, Rebecca L; Sharkey, Camilla R; Suvorov, Anton; Lelito, Jonathan P; Willardson, Barry M; Bybee, Seth M

    2016-05-18

    Arthropods have received much attention as a model for studying opsin evolution in invertebrates. Yet, relatively few studies have investigated the diversity of opsin proteins that underlie spectral sensitivity of the visual pigments within the diverse beetles (Insecta: Coleoptera). Previous work has demonstrated that beetles appear to lack the short-wavelength-sensitive (SWS) opsin class that typically confers sensitivity to the "blue" region of the light spectrum. However, this is contrary to established physiological data in a number of Coleoptera. To explore potential adaptations at the molecular level that may compensate for the loss of the SWS opsin, we carried out an exploration of the opsin proteins within a group of beetles (Buprestidae) where short-wave sensitivity has been demonstrated. RNA-seq data were generated to identify opsin proteins from nine taxa comprising six buprestid species (including three male/female pairs) across four subfamilies. Structural analyses of recovered opsins were conducted and compared to opsin sequences in other insects across the main opsin classes-ultraviolet, short-wavelength, and long-wavelength. All nine buprestids were found to express two opsin copies in each of the ultraviolet and long-wavelength classes, contrary to the single copies recovered in all other molecular studies of adult beetle opsin expression. No SWS opsin class was recovered. Furthermore, the male Agrilus planipennis (emerald ash borer-EAB) expressed a third LWS opsin at low levels that is presumed to be a larval copy. Subsequent homology and structural analyses identified multiple amino acid substitutions in the UVS and LWS copies that could confer short-wavelength sensitivity. This work is the first to compare expressed opsin genes against known electrophysiological data that demonstrate multiple peak sensitivities in Coleoptera. We report the first instance of opsin duplication in adult beetles, which occurs in both the UVS and LWS opsin classes

  2. Epigenetic changes and repositioning determine the evolutionary fate of duplicated genes.

    Science.gov (United States)

    Rodin, S N; Parkhomchuk, D V; Riggs, A D

    2005-05-01

    Consideration of epigenetic silencing, perhaps by DNA methylation, led to an epigenetic complementation (EC) model for evolution by gene duplication (Rodin and Riggs (2003) J. Mol. Evol., 56, 718-729). This and subsequent work on genome-wide analyses of gene duplicates in several eukaryotic species pointed to a fundamental link between localization in the genome, epigenetic regulation of expression, and the evolutionary fate of new redundant gene copies, which can be either non- or neo-functionalization. Our main message in this report is that repositioning of a new duplicate to an ectopic site epigenetically alters its expression pattern, and concomitantly the rate and direction of mutations. Furthermore, comparison of syntenic vs. non-syntenic pairs of gene duplicates of different age unambiguously indicates that repositioning saves redundant gene duplicates from pseudogenization and hastens their evolution towards a new development-time and tissue-specific pattern of function.

  3. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  4. Gene duplication and concerted evolution of mitochondrial DNA in crane species.

    Science.gov (United States)

    Akiyama, Takuya; Nishida, Chizuko; Momose, Kunikazu; Onuma, Manabu; Takami, Kazutoshi; Masuda, Ryuichi

    2017-01-01

    The gene duplication in mitochondrial DNA (mtDNA) has been reported in diverse bird taxa so far. Although many phylogenetic and population genetic analyses of cranes were carried out based on mtDNA diversity, whether mtDNA contains duplicated regions is unknown. To address the presence or absence of gene duplication in cranes and investigate the molecular evolutionary features of crane mtDNA, we analyzed the gene organization and the molecular phylogeny of mtDNA from 13 crane species. We found that the mtDNA in 13 crane species shared a tandem duplicated region, which consists of duplicated sequence sets including cytochrome b (Cytb), NADH6, control region (CR) and three genes of tRNA. The gene order in the duplicated region was identical among all the 13 crane species, and the nucleotide sequences found within each individual showed high similarities. In addition, phylogenetic trees based on homologous sequences of CR and Cytb indicated the possibility of concerted evolution among the duplicated genes. The results suggested that the duplication event occurred in the common ancestor of crane species or some older ancestors. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  6. Circular DNA intermediate in the duplication of Nile tilapia vasa genes.

    Directory of Open Access Journals (Sweden)

    Koji Fujimura

    Full Text Available vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes.

  7. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  8. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  9. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  10. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Gene duplication and the origins of morphological complexity in pancrustacean eyes, a genomic approach

    Directory of Open Access Journals (Sweden)

    Serb Jeanne M

    2010-04-01

    Full Text Available Abstract Background Duplication and divergence of genes and genetic networks is hypothesized to be a major driver of the evolution of complexity and novel features. Here, we examine the history of genes and genetic networks in the context of eye evolution by using new approaches to understand patterns of gene duplication during the evolution of metazoan genomes. We hypothesize that 1 genes involved in eye development and phototransduction have duplicated and are retained at higher rates in animal clades that possess more distinct types of optical design; and 2 genes with functional relationships were duplicated and lost together, thereby preserving genetic networks. To test these hypotheses, we examine the rates and patterns of gene duplication and loss evident in 19 metazoan genomes, including that of Daphnia pulex - the first completely sequenced crustacean genome. This is of particular interest because the pancrustaceans (hexapods+crustaceans have more optical designs than any other major clade of animals, allowing us to test specifically whether the high amount of disparity in pancrustacean eyes is correlated with a higher rate of duplication and retention of vision genes. Results Using protein predictions from 19 metazoan whole-genome projects, we found all members of 23 gene families known to be involved in eye development or phototransduction and deduced their phylogenetic relationships. This allowed us to estimate the number and timing of gene duplication and loss events in these gene families during animal evolution. When comparing duplication/retention rates of these genes, we found that the rate was significantly higher in pancrustaceans than in either vertebrates or non-pancrustacean protostomes. Comparing patterns of co-duplication across Metazoa showed that while these eye-genes co-duplicate at a significantly higher rate than those within a randomly shuffled matrix, many genes with known functional relationships in model organisms

  12. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  13. Modification of gene duplicability during the evolution of protein interaction network.

    Directory of Open Access Journals (Sweden)

    Matteo D'Antonio

    2011-04-01

    Full Text Available Duplications of genes encoding highly connected and essential proteins are selected against in several species but not in human, where duplicated genes encode highly connected proteins. To understand when and how gene duplicability changed in evolution, we compare gene and network properties in four species (Escherichia coli, yeast, fly, and human that are representative of the increase in evolutionary complexity, defined as progressive growth in the number of genes, cells, and cell types. We find that the origin and conservation of a gene significantly correlates with the properties of the encoded protein in the protein-protein interaction network. All four species preserve a core of singleton and central hubs that originated early in evolution, are highly conserved, and accomplish basic biological functions. Another group of hubs appeared in metazoans and duplicated in vertebrates, mostly through vertebrate-specific whole genome duplication. Such recent and duplicated hubs are frequently targets of microRNAs and show tissue-selective expression, suggesting that these are alternative mechanisms to control their dosage. Our study shows how networks modified during evolution and contributes to explaining the occurrence of somatic genetic diseases, such as cancer, in terms of network perturbations.

  14. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  15. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  16. Reconstruction of ancestral metabolic enzymes reveals molecular mechanisms underlying evolutionary innovation through gene duplication.

    Directory of Open Access Journals (Sweden)

    Karin Voordeckers

    Full Text Available Gene duplications are believed to facilitate evolutionary innovation. However, the mechanisms shaping the fate of duplicated genes remain heavily debated because the molecular processes and evolutionary forces involved are difficult to reconstruct. Here, we study a large family of fungal glucosidase genes that underwent several duplication events. We reconstruct all key ancestral enzymes and show that the very first preduplication enzyme was primarily active on maltose-like substrates, with trace activity for isomaltose-like sugars. Structural analysis and activity measurements on resurrected and present-day enzymes suggest that both activities cannot be fully optimized in a single enzyme. However, gene duplications repeatedly spawned daughter genes in which mutations optimized either isomaltase or maltase activity. Interestingly, similar shifts in enzyme activity were reached multiple times via different evolutionary routes. Together, our results provide a detailed picture of the molecular mechanisms that drove divergence of these duplicated enzymes and show that whereas the classic models of dosage, sub-, and neofunctionalization are helpful to conceptualize the implications of gene duplication, the three mechanisms co-occur and intertwine.

  17. Duplicated growth hormone genes in a passerine bird, the jungle crow (Corvus macrorhynchos).

    Science.gov (United States)

    Arai, Natsumi; Iigo, Masayuki

    2010-07-02

    Molecular cloning, molecular phylogeny, gene structure and expression analyses of growth hormone (GH) were performed in a passerine bird, the jungle crow (Corvus macrorhynchos). Unexpectedly, duplicated GH cDNA and genes were identified and designated as GH1A and GH1B. In silico analyses identified the zebra finch orthologs. Both GH genes encode 217 amino acid residues and consist of five exons and four introns, spanning 5.2 kbp in GH1A and 4.2 kbp in GH1B. Predicted GH proteins of the jungle crow and zebra finch contain four conserved cysteine residues, suggesting duplicated GH genes are functional. Molecular phylogenetic analysis revealed that duplication of GH genes occur after divergence of the passerine lineage from the other avian orders as has been suggested from partial genomic DNA sequences of passerine GH genes. RT-PCR analyses confirmed expression of GH1A and GH1B in the pituitary gland. In addition, GH1A gene is expressed in all the tissues examined. However, expression of GH1B is confined to several brain areas and blood cells. These results indicate that the regulatory mechanisms of duplicated GH genes are different and that duplicated GH genes exert both endocrine and autocrine/paracrine functions. Copyright 2010 Elsevier Inc. All rights reserved.

  18. Transcriptional behavior of DMD gene duplications in DMD/BMD males.

    Science.gov (United States)

    Gualandi, F; Neri, M; Bovolenta, M; Martoni, E; Rimessi, P; Fini, S; Spitali, P; Fabris, M; Pane, M; Angelini, C; Mora, M; Morandi, L; Mongini, T; Bertini, E; Ricci, E; Vattemi, G; Mercuri, E; Merlini, L; Ferlini, A

    2009-02-01

    DMD gene exons duplications account for up to 5-10 % of Duchenne (DMD) and up to 5-19% of Becker (BMD) muscular dystrophies; as for the more common deletions, the genotype-phenotype correlation and the genetic prognosis are generally based on the "reading frame rule". Nevertheless, the transcriptional profile of duplications, abridging the genomic configuration to the eventual protein effect, has been poorly studied. We describe 26 DMD gene duplications occurring in 33 unrelated patients and detected among a cohort of 194 mutation-positive DMD/BMD patients. We have characterized at the RNA level 16 of them. Four duplications (15%) behave as exception to the reading frame rule. In three BMD cases with out-of-frame mutations, the RNA analysis revealed that exon skipping events occurring in the duplicated region represent the mechanism leading to the frame re-establishment and to the milder phenotype. Differently, in a DMD patient carrying an in-frame duplication the RNA behaviour failed to explain the clinical phenotype which is probably related to post-transcriptional-translational mechanisms. We conclude that defining the RNA profile in DMD gene duplications is mandatory both for establishing the genetic prognosis and for approaching therapeutic trials based on hnRNA modulation. (c) 2008 Wiley-Liss, Inc.

  19. Subfunctionalization reduces the fitness cost of gene duplication in humans by buffering dosage imbalances

    Directory of Open Access Journals (Sweden)

    Fernández Ariel

    2011-12-01

    Full Text Available Abstract Background Driven essentially by random genetic drift, subfunctionalization has been identified as a possible non-adaptive mechanism for the retention of duplicate genes in small-population species, where widespread deleterious mutations are likely to cause complementary loss of subfunctions across gene copies. Through subfunctionalization, duplicates become indispensable to maintain the functional requirements of the ancestral locus. Yet, gene duplication produces a dosage imbalance in the encoded proteins and thus, as investigated in this paper, subfunctionalization must be subject to the selective forces arising from the fitness bottleneck introduced by the duplication event. Results We show that, while arising from random drift, subfunctionalization must be inescapably subject to selective forces, since the diversification of expression patterns across paralogs mitigates duplication-related dosage imbalances in the concentrations of encoded proteins. Dosage imbalance effects become paramount when proteins rely on obligatory associations to maintain their structural integrity, and are expected to be weaker when protein complexation is ephemeral or adventitious. To establish the buffering effect of subfunctionalization on selection pressure, we determine the packing quality of encoded proteins, an established indicator of dosage sensitivity, and correlate this parameter with the extent of paralog segregation in humans, using species with larger population -and more efficient selection- as controls. Conclusions Recognizing the role of subfunctionalization as a dosage-imbalance buffer in gene duplication events enabled us to reconcile its mechanistic nonadaptive origin with its adaptive role as an enabler of the evolution of genetic redundancy. This constructive role was established in this paper by proving the following assertion: If subfunctionalization is indeed adaptive, its effect on paralog segregation should scale with the dosage

  20. Temporal pattern of loss/persistence of duplicate genes involved in signal transduction and metabolic pathways after teleost-specific genome duplication

    Directory of Open Access Journals (Sweden)

    Sato Yukuto

    2009-06-01

    Full Text Available Abstract Background Recent genomic studies have revealed a teleost-specific third-round whole genome duplication (3R-WGD event occurred in a common ancestor of teleost fishes. However, it is unclear how the genes duplicated in this event were lost or persisted during the diversification of teleosts, and therefore, how many of the duplicated genes contribute to the genetic differences among teleosts. This subject is also important for understanding the process of vertebrate evolution through WGD events. We applied a comparative evolutionary approach to this question by focusing on the genes involved in long-term potentiation, taste and olfactory transduction, and the tricarboxylic acid cycle, based on the whole genome sequences of four teleosts; zebrafish, medaka, stickleback, and green spotted puffer fish. Results We applied a state-of-the-art method of maximum-likelihood phylogenetic inference and conserved synteny analyses to each of 130 genes involved in the above biological systems of human. These analyses identified 116 orthologous gene groups between teleosts and tetrapods, and 45 pairs of 3R-WGD-derived duplicate genes among them. This suggests that more than half [(45×2/(116+45] = 56.5% of the loci, probably more than ten thousand genes, present in a common ancestor of the four teleosts were still duplicated after the 3R-WGD. The estimated temporal pattern of gene loss suggested that, after the 3R-WGD, many (71/116 of the duplicated genes were rapidly lost during the initial 75 million years (MY, whereas on average more than half (27.3/45 of the duplicated genes remaining in the ancestor of the four teleosts (45/116 have persisted for about 275 MY. The 3R-WGD-derived duplicates that have persisted for a long evolutionary periods of time had significantly larger number of interacting partners and longer length of protein coding sequence, implying that they tend to be more multifunctional than the singletons after the 3R-WGD. Conclusion

  1. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  2. Novel noncontiguous duplications identified with a comprehensive mutation analysis in the DMD gene by DMD gene-targeted sequencing.

    Science.gov (United States)

    Xu, Yan; Wang, Huanhuan; Xiao, Bing; Wei, Wei; Liu, Yu; Ye, Hui; Ying, Xiaomin; Chen, Yingwei; Liu, Xiaoqing; Ji, Xing; Sun, Yu

    2018-03-01

    Genomic rearrangements, such as intragenic deletions and duplications, are the most prevalent types of mutation in the DMD gene, and DMD mutations underlie Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD). Using multiplex ligation dependent probe amplification (MLPA) and DMD gene-targeted sequencing, we performed a molecular characterization of two cases of complex noncontiguous duplication rearrangements that involved inverted duplications. The breakpoint sequences were analyzed to investigate the mechanisms of the rearrangement. The two cases shared the same duplication events (Dup-nml-Dup/inv), and both involved microhomology and small insertions at the breakpoints. Additionally, in case 1, SNP sequencing results indicated that the de novo duplication mutation arose in the allele that originated from the grandfather. This study has identified a novel type of DMD complex rearrangement and provides insight into the molecular basis of this genomic rearrangement. Copyright © 2017. Published by Elsevier B.V.

  3. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  4. Molecular evolution accompanying functional divergence of duplicated genes along the plant starch biosynthesis pathway.

    Science.gov (United States)

    Nougué, Odrade; Corbi, Jonathan; Ball, Steven G; Manicacci, Domenica; Tenaillon, Maud I

    2014-05-15

    Starch is the main source of carbon storage in the Archaeplastida. The starch biosynthesis pathway (sbp) emerged from cytosolic glycogen metabolism shortly after plastid endosymbiosis and was redirected to the plastid stroma during the green lineage divergence. The SBP is a complex network of genes, most of which are members of large multigene families. While some gene duplications occurred in the Archaeplastida ancestor, most were generated during the sbp redirection process, and the remaining few paralogs were generated through compartmentalization or tissue specialization during the evolution of the land plants. In the present study, we tested models of duplicated gene evolution in order to understand the evolutionary forces that have led to the development of SBP in angiosperms. We combined phylogenetic analyses and tests on the rates of evolution along branches emerging from major duplication events in six gene families encoding sbp enzymes. We found evidence of positive selection along branches following cytosolic or plastidial specialization in two starch phosphorylases and identified numerous residues that exhibited changes in volume, polarity or charge. Starch synthases, branching and debranching enzymes functional specializations were also accompanied by accelerated evolution. However, none of the sites targeted by selection corresponded to known functional domains, catalytic or regulatory. Interestingly, among the 13 duplications tested, 7 exhibited evidence of positive selection in both branches emerging from the duplication, 2 in only one branch, and 4 in none of the branches. The majority of duplications were followed by accelerated evolution targeting specific residues along both branches. This pattern was consistent with the optimization of the two sub-functions originally fulfilled by the ancestral gene before duplication. Our results thereby provide strong support to the so-called "Escape from Adaptive Conflict" (EAC) model. Because none of the

  5. A duplicated coxI gene is associated with cytoplasmic male sterility ...

    Indian Academy of Sciences (India)

    which have been implicated in male sterility (reviewed in. Keywords. Brassica juncea; coxI gene; cytoplasmic male sterility; somatic hybrid; transcript variation. ... drial recombination has led to duplication of coxI gene which appears to be associated with the CMS. Materials and methods. Plant material. B. juncea cv.

  6. QCD on the BlueGene/L Supercomputer

    Science.gov (United States)

    Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

    2005-03-01

    In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented.

  7. QCD on the BlueGene/L Supercomputer

    International Nuclear Information System (INIS)

    Bhanot, G.; Chen, D.; Gara, A.; Sexton, J.; Vranas, P.

    2005-01-01

    In June 2004 QCD was simulated for the first time at sustained speed exceeding 1 TeraFlops in the BlueGene/L supercomputer at the IBM T.J. Watson Research Lab. The implementation and performance of QCD in the BlueGene/L is presented

  8. Blue Genes : Sharing and Conserving the World's Aquatic Biodiversity

    International Development Research Centre (IDRC) Digital Library (Canada)

    Blue Genes : Sharing and Conserving the World's Aquatic Biodiversity. Couverture du livre Blue Genes: Sharing and Conserving the World's Aquatic Biodiversity. Auteur(s) : David Greer et Brian Harvey. Maison(s) d'édition : Earthscan, CRDI. 31 août 2004. ISBN : 1844071065. 246 pages. e-ISBN : 1552501574.

  9. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  10. Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Kamei

    2008-08-01

    Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

  11. Pinda: a web service for detection and analysis of intraspecies gene duplication events.

    Science.gov (United States)

    Kontopoulos, Dimitrios-Georgios; Glykos, Nicholas M

    2013-09-01

    We present Pinda, a Web service for the detection and analysis of possible duplications of a given protein or DNA sequence within a source species. Pinda fully automates the whole gene duplication detection procedure, from performing the initial similarity searches, to generating the multiple sequence alignments and the corresponding phylogenetic trees, to bootstrapping the trees and producing a Z-score-based list of duplication candidates for the input sequence. Pinda has been cross-validated using an extensive set of known and bibliographically characterized duplication events. The service facilitates the automatic and dependable identification of gene duplication events, using some of the most successful bioinformatics software to perform an extensive analysis protocol. Pinda will prove of use for the analysis of newly discovered genes and proteins, thus also assisting the study of recently sequenced genomes. The service's location is http://orion.mbg.duth.gr/Pinda. The source code is freely available via https://github.com/dgkontopoulos/Pinda/. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  13. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  14. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

    Science.gov (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

    2016-09-02

    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  16. Gene duplication and divergence produce divergent MHC genotypes without disassortative mating

    Science.gov (United States)

    Dearborn, Donald C.; Gager, Andrea B.; McArthur, Andrew G.; Gilmour, Morgan E.; Mandzhukova, Elena; Mauck, Robert A.

    2016-01-01

    Genes of the major histocompatibility complex (MHC) exhibit heterozygote advantage in immune defense, which in turn can select for MHC-disassortative mate choice. However, many species lack this expected pattern of MHC-disassortative mating. A possible explanation lies in evolutionary processes following gene duplication: if two duplicated MHC genes become functionally diverged from each other, offspring will inherit diverse multilocus genotypes even under random mating. We used locus-specific primers for high throughput sequencing of two expressed MHC Class II B genes in Leach's storm-petrels, Oceanodroma leucorhoa, and found that exon 2 alleles fall into two gene-specific monophyletic clades. We tested for disassortative versus random mating at these two functionally diverged Class II B genes, using multiple metrics and different subsets of exon 2 sequence data. With good statistical power, we consistently found random assortment of mates at MHC. Despite random mating, birds had MHC genotypes with functionally diverged alleles, averaging 13 amino acid differences in pairwise comparisons of exon 2 alleles within individuals. To test whether this high MHC diversity in individuals is driven by evolutionary divergence of the two duplicated genes, we built a phylogenetic permutation model. The model showed that genotypic diversity was strongly impacted by sequence divergence between the most common allele of each gene, with a smaller additional impact of monophyly of the two genes. Divergence of allele sequences between genes may have reduced the benefits of actively seeking MHC-dissimilar mates, in which case the evolutionary history of duplicated genes is shaping the adaptive landscape of sexual selection. PMID:27376487

  17. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  18. Preferential duplication of intermodular hub genes: an evolutionary signature in eukaryotes genome networks.

    Directory of Open Access Journals (Sweden)

    Ricardo M Ferreira

    Full Text Available Whole genome protein-protein association networks are not random and their topological properties stem from genome evolution mechanisms. In fact, more connected, but less clustered proteins are related to genes that, in general, present more paralogs as compared to other genes, indicating frequent previous gene duplication episodes. On the other hand, genes related to conserved biological functions present few or no paralogs and yield proteins that are highly connected and clustered. These general network characteristics must have an evolutionary explanation. Considering data from STRING database, we present here experimental evidence that, more than not being scale free, protein degree distributions of organisms present an increased probability for high degree nodes. Furthermore, based on this experimental evidence, we propose a simulation model for genome evolution, where genes in a network are either acquired de novo using a preferential attachment rule, or duplicated with a probability that linearly grows with gene degree and decreases with its clustering coefficient. For the first time a model yields results that simultaneously describe different topological distributions. Also, this model correctly predicts that, to produce protein-protein association networks with number of links and number of nodes in the observed range for Eukaryotes, it is necessary 90% of gene duplication and 10% of de novo gene acquisition. This scenario implies a universal mechanism for genome evolution.

  19. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  20. A duplicated coxI gene is associated with cytoplasmic male sterility ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 86; Issue 2. A duplicated coxI gene is associated with cytoplasmic male sterility in an alloplasmic Brassica juncea line derived from somatic hybridization with Diplotaxis catholica. Aruna Pathania Rajesh Kumar V. Dinesh Kumar Ashutosh K. K. Dwivedi P. B. Kirti P. Prakash V. L. ...

  1. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

    2007-01-01

    In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...

  2. Duplication, divergence and persistence in the Phytochrome photoreceptor gene family of cottons (Gossypium spp.

    Directory of Open Access Journals (Sweden)

    Abdukarimov Abdusattor

    2010-06-01

    Full Text Available Abstract Background Phytochromes are a family of red/far-red photoreceptors that regulate a number of important developmental traits in cotton (Gossypium spp., including plant architecture, fiber development, and photoperiodic flowering. Little is known about the composition and evolution of the phytochrome gene family in diploid (G. herbaceum, G. raimondii or allotetraploid (G. hirsutum, G. barbadense cotton species. The objective of this study was to obtain a preliminary inventory and molecular-evolutionary characterization of the phytochrome gene family in cotton. Results We used comparative sequence resources to design low-degeneracy PCR primers that amplify genomic sequence tags (GSTs for members of the PHYA, PHYB/D, PHYC and PHYE gene sub-families from A- and D-genome diploid and AD-genome allotetraploid Gossypium species. We identified two paralogous PHYA genes (designated PHYA1 and PHYA2 in diploid cottons, the result of a Malvaceae-specific PHYA gene duplication that occurred approximately 14 million years ago (MYA, before the divergence of the A- and D-genome ancestors. We identified a single gene copy of PHYB, PHYC, and PHYE in diploid cottons. The allotetraploid genomes have largely retained the complete gene complements inherited from both of the diploid genome ancestors, with at least four PHYA genes and two genes encoding PHYB, PHYC and PHYE in the AD-genomes. We did not identify a PHYD gene in any cotton genomes examined. Conclusions Detailed sequence analysis suggests that phytochrome genes retained after duplication by segmental duplication and allopolyploidy appear to be evolving independently under a birth-and-death-process with strong purifying selection. Our study provides a preliminary phytochrome gene inventory that is necessary and sufficient for further characterization of the biological functions of each of the cotton phytochrome genes, and for the development of 'candidate gene' markers that are potentially useful for

  3. [Genetic diagnosis for a family without exonic deletions and duplications of dystrophin gene].

    Science.gov (United States)

    Li, Tao; Hou, Qiaofang; Wu, Dong; Wang, Hongdan; Liu, Hongyan; Yang, Yangli; Zhang, Chaoyang; Ding, Xuebing; Liao, Shixiu

    2015-02-01

    To conduct genetic diagnosis for a family in which no exonic deletions and duplications of the dystrophin gene were detected. Potential exonic deletions and duplications of the dystrophin gene were initially analyzed with using multiplex ligation-dependent probe amplification (MLPA). Subsequently, all of the 79 exons of the dystrophin gene of the proband and a pregnant woman from the family were analyzed with PCR amplification and DNA sequencing. Following identification of the causative mutation, prenatal diagnosis was provided. MLPA analysis had detected no exonic deletions and duplications of the dystrophin gene. Sequence analysis has identified a C>T mutation on the 22nd nucleotide position of the 70th exon of the dystrophin gene (c.10108 C>T), which has replaced the codon CGA to a stop codon (TGA). The patient's mother and sister were both heterozygous for the same mutation. Upon prenatal diagnosis, the fetus was found to be positive for the Y chromosome sex-determining gene (SRY) and has carried above mutation. The result of short tandem repeat linkage analysis also confirmed that the fetus has inherited the mutant X chromosome. The causative mutation of the dystrophin gene has been discovered in an affected family, which has enabled prenatal diagnosis of the disease.

  4. Papain-like cysteine proteases in Carica papaya: lineage-specific gene duplication and expansion.

    Science.gov (United States)

    Liu, Juan; Sharma, Anupma; Niewiara, Marie Jamille; Singh, Ratnesh; Ming, Ray; Yu, Qingyi

    2018-01-06

    Papain-like cysteine proteases (PLCPs), a large group of cysteine proteases structurally related to papain, play important roles in plant development, senescence, and defense responses. Papain, the first cysteine protease whose structure was determined by X-ray crystallography, plays a crucial role in protecting papaya from herbivorous insects. Except the four major PLCPs purified and characterized in papaya latex, the rest of the PLCPs in papaya genome are largely unknown. We identified 33 PLCP genes in papaya genome. Phylogenetic analysis clearly separated plant PLCP genes into nine subfamilies. PLCP genes are not equally distributed among the nine subfamilies and the number of PLCPs in each subfamily does not increase or decrease proportionally among the seven selected plant species. Papaya showed clear lineage-specific gene expansion in the subfamily III. Interestingly, all four major PLCPs purified from papaya latex, including papain, chymopapain, glycyl endopeptidase and caricain, were grouped into the lineage-specific expansion branch in the subfamily III. Mapping PLCP genes on chromosomes of five plant species revealed that lineage-specific expansions of PLCP genes were mostly derived from tandem duplications. We estimated divergence time of papaya PLCP genes of subfamily III. The major duplication events leading to lineage-specific expansion of papaya PLCP genes in subfamily III were estimated at 48 MYA, 34 MYA, and 16 MYA. The gene expression patterns of the papaya PLCP genes in different tissues were assessed by transcriptome sequencing and qRT-PCR. Most of the papaya PLCP genes of subfamily III expressed at high levels in leaf and green fruit tissues. Tandem duplications played the dominant role in affecting copy number of PLCPs in plants. Significant variations in size of the PLCP subfamilies among species may reflect genetic adaptation of plant species to different environments. The lineage-specific expansion of papaya PLCPs of subfamily III might

  5. Transcriptional rewiring of the sex determining dmrt1 gene duplicate by transposable elements.

    Directory of Open Access Journals (Sweden)

    Amaury Herpin

    2010-02-01

    Full Text Available Control and coordination of eukaryotic gene expression rely on transcriptional and posttranscriptional regulatory networks. Evolutionary innovations and adaptations often require rapid changes of such networks. It has long been hypothesized that transposable elements (TE might contribute to the rewiring of regulatory interactions. More recently it emerged that TEs might bring in ready-to-use transcription factor binding sites to create alterations to the promoters by which they were captured. A process where the gene regulatory architecture is of remarkable plasticity is sex determination. While the more downstream components of the sex determination cascades are evolutionary conserved, the master regulators can switch between groups of organisms even on the interspecies level or between populations. In the medaka fish (Oryzias latipes a duplicated copy of dmrt1, designated dmrt1bY or DMY, on the Y chromosome was shown to be the master regulator of male development, similar to Sry in mammals. We found that the dmrt1bY gene has acquired a new feedback downregulation of its expression. Additionally, the autosomal dmrt1a gene is also able to regulate transcription of its duplicated paralog by binding to a unique target Dmrt1 site nested within the dmrt1bY proximal promoter region. We could trace back this novel regulatory element to a highly conserved sequence within a new type of TE that inserted into the upstream region of dmrt1bY shortly after the duplication event. Our data provide functional evidence for a role of TEs in transcriptional network rewiring for sub- and/or neo-functionalization of duplicated genes. In the particular case of dmrt1bY, this contributed to create new hierarchies of sex-determining genes.

  6. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  7. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  8. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  9. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  10. Assessment and reconstruction of novel HSP90 genes: duplications, gains and losses in fungal and animal lineages.

    Directory of Open Access Journals (Sweden)

    Chrysoula N Pantzartzi

    Full Text Available Hsp90s, members of the Heat Shock Protein class, protect the structure and function of proteins and play a significant task in cellular homeostasis and signal transduction. In order to determine the number of hsp90 gene copies and encoded proteins in fungal and animal lineages and through that key duplication events that this family has undergone, we collected and evaluated Hsp90 protein sequences and corresponding Expressed Sequence Tags and analyzed available genomes from various taxa. We provide evidence for duplication events affecting either single species or wider taxonomic groups. With regard to Fungi, duplicated genes have been detected in several lineages. In invertebrates, we demonstrate key duplication events in certain clades of Arthropoda and Mollusca, and a possible gene loss event in a hymenopteran family. Finally, we infer that the duplication event responsible for the two (a and b isoforms in vertebrates occurred probably shortly after the split of Hyperoartia and Gnathostomata.

  11. Structure and evolution of protein interaction networks: a statistical model for link dynamics and gene duplications

    Directory of Open Access Journals (Sweden)

    Wagner Andreas

    2004-11-01

    Full Text Available Abstract Background The structure of molecular networks derives from dynamical processes on evolutionary time scales. For protein interaction networks, global statistical features of their structure can now be inferred consistently from several large-throughput datasets. Understanding the underlying evolutionary dynamics is crucial for discerning random parts of the network from biologically important properties shaped by natural selection. Results We present a detailed statistical analysis of the protein interactions in Saccharomyces cerevisiae based on several large-throughput datasets. Protein pairs resulting from gene duplications are used as tracers into the evolutionary past of the network. From this analysis, we infer rate estimates for two key evolutionary processes shaping the network: (i gene duplications and (ii gain and loss of interactions through mutations in existing proteins, which are referred to as link dynamics. Importantly, the link dynamics is asymmetric, i.e., the evolutionary steps are mutations in just one of the binding parters. The link turnover is shown to be much faster than gene duplications. Both processes are assembled into an empirically grounded, quantitative model for the evolution of protein interaction networks. Conclusions According to this model, the link dynamics is the dominant evolutionary force shaping the statistical structure of the network, while the slower gene duplication dynamics mainly affects its size. Specifically, the model predicts (i a broad distribution of the connectivities (i.e., the number of binding partners of a protein and (ii correlations between the connectivities of interacting proteins, a specific consequence of the asymmetry of the link dynamics. Both features have been observed in the protein interaction network of S. cerevisiae.

  12. Dissecting the structure and mechanism of a complex duplication-triplication rearrangement in the DMD gene.

    Science.gov (United States)

    Ishmukhametova, Aliya; Chen, Jian-Min; Bernard, Rafaëlle; de Massy, Bernard; Baudat, Frédéric; Boyer, Amandine; Méchin, Déborah; Thorel, Delphine; Chabrol, Brigitte; Vincent, Marie-Claire; Khau Van Kien, Philippe; Claustres, Mireille; Tuffery-Giraud, Sylvie

    2013-08-01

    Pathogenic complex genomic rearrangements are being increasingly characterized at the nucleotide level, providing unprecedented opportunities to evaluate the complexities of mutational mechanisms. Here, we report the molecular characterization of a complex duplication-triplication rearrangement involving exons 45-60 of the DMD gene. Inverted repeats facilitated this complex rearrangement, which shares common genomic organization with the recently described duplication-inverted triplication-duplication (DUP-TRP/INV-DUP) events; specifically, a 690-kb region comprising DMD exons from 45 to 60 was duplicated in tandem, and another 46-kb segment containing exon 51 was inserted inversely in between them. Taking into consideration (1) the presence of a predicted PRDM9 binding site in the near vicinity of the junction involving two inverted L1 elements and (2) the inherent properties of X-Y chromosome recombination during male meiosis, we proposed an alternative two-step model for the generation of this X-linked DMD DUP-TRP/INV-DUP event. © 2013 WILEY PERIODICALS, INC.

  13. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

    2012-01-01

    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  14. Prevertebrate Local Gene Duplication Facilitated Expansion of the Neuropeptide GPCR Superfamily.

    Science.gov (United States)

    Yun, Seongsik; Furlong, Michael; Sim, Mikang; Cho, Minah; Park, Sumi; Cho, Eun Bee; Reyes-Alcaraz, Arfaxad; Hwang, Jong-Ik; Kim, Jaebum; Seong, Jae Young

    2015-11-01

    In humans, numerous genes encode neuropeptides that comprise a superfamily of more than 70 genes in approximately 30 families and act mainly through rhodopsin-like G protein-coupled receptors (GPCRs). Two rounds of whole-genome duplication (2R WGD) during early vertebrate evolution greatly contributed to proliferation within gene families; however, the mechanisms underlying the initial emergence and diversification of these gene families before 2R WGD are largely unknown. In this study, we analyzed 25 vertebrate rhodopsin-like neuropeptide GPCR families and their cognate peptides using phylogeny, synteny, and localization of these genes on reconstructed vertebrate ancestral chromosomes (VACs). Based on phylogeny, these GPCR families can be divided into five distinct clades, and members of each clade tend to be located on the same VACs. Similarly, their neuropeptide gene families also tend to reside on distinct VACs. Comparison of these GPCR genes with those of invertebrates including Drosophila melanogaster, Caenorhabditis elegans, Branchiostoma floridae, and Ciona intestinalis indicates that these GPCR families emerged through tandem local duplication during metazoan evolution prior to 2R WGD. Our study describes a presumptive evolutionary mechanism and development pathway of the vertebrate rhodopsin-like GPCR and cognate neuropeptide families from the urbilaterian ancestor to modern vertebrates. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  16. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  17. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  18. A rare case of plastid protein-coding gene duplication in the chloroplast genome of Euglena archaeoplastidiata (Euglenophyta).

    Science.gov (United States)

    Bennett, Matthew S; Shiu, Shin-Han; Triemer, Richard E

    2017-06-01

    Gene duplication is an important evolutionary process that allows duplicate functions to diverge, or, in some cases, allows for new functional gains. However, in contrast to the nuclear genome, gene duplications within the chloroplast are extremely rare. Here, we present the chloroplast genome of the photosynthetic protist Euglena archaeoplastidiata. Upon annotation, it was found that the chloroplast genome contained a novel tandem direct duplication that encoded a portion of RuBisCO large subunit (rbcL) followed by a complete copy of ribosomal protein L32 (rpl32), as well as the associated intergenic sequences. Analyses of the duplicated rpl32 were inconclusive regarding selective pressures, although it was found that substitutions in the duplicated region, all non-synonymous, likely had a neutral functional effect. The duplicated region did not exhibit patterns consistent with previously described mechanisms for tandem direct duplications, and demonstrated an unknown mechanism of duplication. In addition, a comparison of this chloroplast genome to other previously characterized chloroplast genomes from the same family revealed characteristics that indicated E. archaeoplastidiata was probably more closely related to taxa in the genera Monomorphina, Cryptoglena, and Euglenaria than it was to other Euglena taxa. Taken together, the chloroplast genome of E. archaeoplastidiata demonstrated multiple characteristics unique to the euglenoid world, and has justified the longstanding curiosity regarding this enigmatic taxon. © 2017 Phycological Society of America.

  19. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  20. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase

    Directory of Open Access Journals (Sweden)

    Ming-Yue Ma

    2016-07-01

    Full Text Available The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3′ splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals.

  1. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  2. Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids.

    Science.gov (United States)

    Dong, Shaowei; Adams, Keith L

    2011-06-01

    Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  3. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

    2014-01-01

    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  4. Evolution of MicroRNA Genes in Oryza sativa and Arabidopsis thaliana: An Update of the Inverted Duplication Model

    Science.gov (United States)

    Zhang, Yun; Jiang, Wen-kai; Gao, Li-zhi

    2011-01-01

    The origin and evolution of microRNA (miRNA) genes, which are of significance in tuning and buffering gene expressions in a number of critical cellular processes, have long attracted evolutionary biologists. However, genome-wide perspectives on their origins, potential mechanisms of their de novo generation and subsequent evolution remain largely unsolved in flowering plants. Here, genome-wide analyses of Oryza sativa and Arabidopsis thaliana revealed apparently divergent patterns of miRNA gene origins. A large proportion of miRNA genes in O. sativa were TE-related and MITE-related miRNAs in particular, whereas the fraction of these miRNA genes much decreased in A. thaliana. Our results show that the majority of TE-related and pseudogene-related miRNA genes have originated through inverted duplication instead of segmental or tandem duplication events. Based on the presented findings, we hypothesize and illustrate the four likely molecular mechanisms to de novo generate novel miRNA genes from TEs and pseudogenes. Our rice genome analysis demonstrates that non-MITEs and MITEs mediated inverted duplications have played different roles in de novo generating miRNA genes. It is confirmed that the previously proposed inverted duplication model may give explanations for non-MITEs mediated duplication events. However, many other miRNA genes, known from the earlier proposed model, were rather arisen from MITE transpositions into target genes to yield binding sites. We further investigated evolutionary processes spawned from de novo generated to maturely-formed miRNA genes and their regulatory systems. We found that miRNAs increase the tunability of some gene regulatory systems with low gene copy numbers. The results also suggest that gene balance effects may have largely contributed to the evolution of miRNA regulatory systems. PMID:22194805

  5. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher

    2007-08-01

    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  6. Preimplantational genetic diagnosis and mutation detection in a family with duplication mutation of DMD gene.

    Science.gov (United States)

    Ye, Yinghui; Yu, Ping; Yong, Jing; Zhang, Ting; Wei, Xiaoming; Qi, Ming; Jin, Fan

    2014-01-01

    Duchenne muscular dystrophy (DMD) is an X-linked recessive neuromuscular disease caused by mutation in the DMD gene. A 38-year-old woman was referred to our hospital with her son who was diagnosed with DMD. Multiplex PCR failed to detect DMD mutations in the affected child. The female carrier underwent preimplantation genetic diagnosis by linkage analysis and gender determination. Eight embryos were biopsied after in vitro fertilization. Two healthy embryos determined both as females (E1 and E3) were transferred. Although the paternal allele was absent in E3, it was considered to be a result of allele dropout for the STR-49 marker. Surprisingly, a female and a male baby were delivered at 38 gestational weeks, suggesting that E3 was a male embryo with the allele dropout occurring at the SRY gene. Exon 2 duplication was detected in the DMD patient and the carrier mother using next-generation sequencing and multiple ligation-dependent probe amplification. Next, we verified the duplication of exon 2 by real-time PCR, using a special primer at 3' of intron 1, very close to exon 2. Finally, we confirmed that both newborns inherited the normal allele, using quantitative real-time PCR and linkage analysis. © 2014 S. Karger AG, Basel.

  7. Evolution of the ability to modulate host chemokine networks via gene duplication in human cytomegalovirus (HCMV).

    Science.gov (United States)

    Scarborough, Jessica A; Paul, John R; Spencer, Juliet V

    2017-07-01

    Human cytomegalovirus (HCMV) is a widespread pathogen that is particularly skillful at evading immune detection and defense mechanisms, largely due to extensive co-evolution with its host. One aspect of this co-evolution involves the acquisition of virally encoded G protein-coupled receptors (GPCRs) with homology to the chemokine receptor family. GPCRs are the largest family of cell surface proteins, found in organisms from yeast to humans, and they regulate a variety of cellular processes including development, sensory perception, and immune cell trafficking. The US27 and US28 genes are encoded by human and primate CMVs, but homologs are not found in the genomes of viruses infecting rodents or other species. Phylogenetic analysis was used to investigate the US27 and US28 genes, which are adjacent in the unique short (US) region of the HCMV genome, and their relationship to one another and to human chemokine receptor genes. The results indicate that both US27 and US28 share the same common ancestor with human chemokine receptor CX3CR1, suggesting that a single host gene was captured and a subsequent viral gene duplication event occurred. The US28 gene product (pUS28) has maintained the function of the ancestral gene and has the ability to bind and signal in response to CX3CL1/fractalkine, the natural ligand for CX3CR1. In contrast, pUS27 does not bind to any known chemokine ligand, and the sequence has diverged significantly, highlighted by the fact that pUS27 currently exhibits greater sequence similarity to human CCR1. While the evolutionary advantage of the gene duplication and neofunctionalization event remains unclear, the US27 and US28 genes are highly conserved among different HCMV strains and retained even in laboratory strains that have lost many virulence genes, suggesting that US27 and US28 have each evolved distinct, important functions during virus infection. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  9. Population genetics of duplicated alternatively spliced exons of the Dscam gene in Daphnia and Drosophila.

    Directory of Open Access Journals (Sweden)

    Daniela Brites

    Full Text Available In insects and crustaceans, the Down syndrome cell adhesion molecule (Dscam occurs in many different isoforms. These are produced by mutually exclusive alternative splicing of dozens of tandem duplicated exons coding for parts or whole immunoglobulin (Ig domains of the Dscam protein. This diversity plays a role in the development of the nervous system and also in the immune system. Structural analysis of the protein suggested candidate epitopes where binding to pathogens could occur. These epitopes are coded by regions of the duplicated exons and are therefore diverse within individuals. Here we apply molecular population genetics and molecular evolution analyses using Daphnia magna and several Drosophila species to investigate the potential role of natural selection in the divergence between orthologs of these duplicated exons among species, as well as between paralogous exons within species. We found no evidence for a role of positive selection in the divergence of these paralogous exons. However, the power of this test was low, and the fact that no signs of gene conversion between paralogous exons were found suggests that paralog diversity may nonetheless be maintained by selection. The analysis of orthologous exons in Drosophila and in Daphnia revealed an excess of non-synonymous polymorphisms in the epitopes putatively involved in pathogen binding. This may be a sign of balancing selection. Indeed, in Dr. melanogaster the same derived non-synonymous alleles segregate in several populations around the world. Yet other hallmarks of balancing selection were not found. Hence, we cannot rule out that the excess of non-synonymous polymorphisms is caused by segregating slightly deleterious alleles, thus potentially indicating reduced selective constraints in the putative pathogen binding epitopes of Dscam.

  10. High time for a roll call: gene duplication and phylogenetic relationships of TCP-like genes in monocots

    Science.gov (United States)

    Mondragón-Palomino, Mariana; Trontin, Charlotte

    2011-01-01

    Background and Aims The TCP family is an ancient group of plant developmental transcription factors that regulate cell division in vegetative and reproductive structures and are essential in the establishment of flower zygomorphy. In-depth research on eudicot TCPs has documented their evolutionary and developmental role. This has not happened to the same extent in monocots, although zygomorphy has been critical for the diversification of Orchidaceae and Poaceae, the largest families of this group. Investigating the evolution and function of TCP-like genes in a wider group of monocots requires a detailed phylogenetic analysis of all available sequence information and a system that facilitates comparing genetic and functional information. Methods The phylogenetic relationships of TCP-like genes in monocots were investigated by analysing sequences from the genomes of Zea mays, Brachypodium distachyon, Oryza sativa and Sorghum bicolor, as well as EST data from several other monocot species. Key Results All available monocot TCP-like sequences are associated in 20 major groups with an average identity ≥64 % and most correspond to well-supported clades of the phylogeny. Their sequence motifs and relationships of orthology were documented and it was found that 67 % of the TCP-like genes of Sorghum, Oryza, Zea and Brachypodium are in microsyntenic regions. This analysis suggests that two rounds of whole genome duplication drove the expansion of TCP-like genes in these species. Conclusions A system of classification is proposed where putative or recognized monocot TCP-like genes are assigned to a specific clade of PCF-, CIN- or CYC/tb1-like genes. Specific biases in sequence data of this family that must be tackled when studying its molecular evolution and phylogeny are documented. Finally, the significant retention of duplicated TCP genes from Zea mays is considered in the context of balanced gene drive. PMID:21444336

  11. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  12. Structure, expression differentiation and evolution of duplicated fiber developmental genes in Gossypium barbadense and G. hirsutum.

    Science.gov (United States)

    Zhu, Huayu; Han, Xiaoyong; Lv, Junhong; Zhao, Liang; Xu, Xiaoyang; Zhang, Tianzhen; Guo, Wangzhen

    2011-02-25

    Both Gossypium hirsutum and G. barbadense probably originated from a common ancestor, but they have very different agronomic and fiber quality characters. Here we selected 17 fiber development-related genes to study their structures, tree topologies, chromosomal location and expression patterns to better understand the interspecific divergence of fiber development genes in the two cultivated tetraploid species. The sequence and structure of 70.59% genes were conserved with the same exon length and numbers in different species, while 29.41% genes showed diversity. There were 15 genes showing independent evolution between the A- and D-subgenomes after polyploid formation, while two evolved via different degrees of colonization. Chromosomal location showed that 22 duplicate genes were located in which at least one fiber quality QTL was detected. The molecular evolutionary rates suggested that the D-subgenome of the allotetraploid underwent rapid evolutionary differentiation, and selection had acted at the tetraploid level. Expression profiles at fiber initiation and early elongation showed that the transcripts levels of most genes were higher in Hai7124 than in TM-1. During the primary-secondary transition period, expression of most genes peaked earlier in TM-1 than in Hai7124. Homeolog expression profile showed that A-subgenome, or the combination of A- and D-subgenomes, played critical roles in fiber quality divergence of G. hirsutum and G. barbadense. However, the expression of D-subgenome alone also played an important role. Integrating analysis of the structure and expression to fiber development genes, suggests selective breeding for certain desirable fiber qualities played an important role in divergence of G. hirsutum and G. barbadense.

  13. GPAW optimized for Blue Gene/P using hybrid programming

    DEFF Research Database (Denmark)

    Kristensen, Mads Ruben Burgdorff; Happe, Hans Henrik; Vinter, Brian

    2009-01-01

    In this work we present optimizations of a Grid-based projector-augmented wave method software, GPAW for the Blue Gene/P architecture. The improvements are achieved by exploring the advantage of shared and distributed memory programming also known as hybrid programming. The work focuses on optimi......In this work we present optimizations of a Grid-based projector-augmented wave method software, GPAW for the Blue Gene/P architecture. The improvements are achieved by exploring the advantage of shared and distributed memory programming also known as hybrid programming. The work focuses...... on optimizing a very time consuming operation in GPAW, the finite-different stencil operation, and different hybrid programming approaches are evaluated. The work succeeds in demonstrating a hybrid programming model which is clearly beneficial compared to the original flat programming model. In total...

  14. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  15. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  16. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.

    Science.gov (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe

    2015-11-01

    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  17. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  18. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

    Science.gov (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

    2012-07-01

    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  19. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  20. Repeated Whole-Genome Duplication, Karyotype Reshuffling, and Biased Retention of Stress-Responding Genes in Buckler Mustard.

    Science.gov (United States)

    Geiser, Céline; Mandáková, Terezie; Arrigo, Nils; Lysak, Martin A; Parisod, Christian

    2016-01-01

    Whole-genome duplication (WGD) is usually followed by gene loss and karyotype repatterning. Despite evidence of new adaptive traits associated with WGD, the underpinnings and evolutionary significance of such genome fractionation remain elusive. Here, we use Buckler mustard (Biscutella laevigata) to infer processes that have driven the retention of duplicated genes after recurrent WGDs. In addition to the β- and α-WGD events shared by all Brassicaceae, cytogenetic and transcriptome analyses revealed two younger WGD events that occurred at times of environmental changes in the clade of Buckler mustard (Biscutelleae): a mesopolyploidy event from the late Miocene that was followed by considerable karyotype reshuffling and chromosome number reduction and a neopolyploidy event during the Pleistocene. Although a considerable number of the older duplicates presented signatures of retention under positive selection, the majority of retained duplicates arising from the younger mesopolyploidy WGD event matched predictions of the gene balance hypothesis and showed evidence of strong purifying selection as well as enrichment in gene categories responding to abiotic stressors. Retention of large stretches of chromosomes for both genomic copies supported the hypothesis that cycles of WGD and biased fractionation shaped the genome of this stress-tolerant polypolyloid, promoting the adaptive recruitment of stress-responding genes in the face of environmental challenges. © 2016 American Society of Plant Biologists. All rights reserved.

  1. Need-based up-regulation of protein levels in response to deletion of their duplicate genes.

    Directory of Open Access Journals (Sweden)

    Alexander DeLuna

    2010-03-01

    Full Text Available Many duplicate genes maintain functional overlap despite divergence over long evolutionary time scales. Deleting one member of a paralogous pair often has no phenotypic effect, unless its paralog is also deleted. It has been suggested that this functional compensation might be mediated by active up-regulation of expression of a gene in response to deletion of its paralog. However, it is not clear how prevalent such paralog responsiveness is, nor whether it is hardwired or dependent on feedback from environmental conditions. Here, we address these questions at the genomic scale using high-throughput flow cytometry of single-cell protein levels in differentially labeled cocultures of wild-type and paralog-knockout Saccharomyces cerevisiae strains. We find that only a modest fraction of proteins (22 out of 202 show significant up-regulation to deletion of their duplicate genes. However, these paralog-responsive proteins match almost exclusively duplicate pairs whose overlapping function is required for growth. Moreover, media conditions that add or remove requirements for the function of a duplicate gene pair specifically eliminate or create paralog responsiveness. Together, our results suggest that paralog responsiveness in yeast is need-based: it appears only in conditions in which the gene function is required. Physiologically, such need-based responsiveness could provide an adaptive mechanism for compensation of genetic, environmental, or stochastic perturbations in protein abundance.

  2. The role of gene duplication and unconstrained selective pressures in the melanopsin gene family evolution and vertebrate circadian rhythm regulation.

    Directory of Open Access Journals (Sweden)

    Rui Borges

    Full Text Available Melanopsin is a photosensitive cell protein involved in regulating circadian rhythms and other non-visual responses to light. The melanopsin gene family is represented by two paralogs, OPN4x and OPN4m, which originated through gene duplication early in the emergence of vertebrates. Here we studied the melanopsin gene family using an integrated gene/protein evolutionary approach, which revealed that the rhabdomeric urbilaterian ancestor had the same amino acid patterns (DRY motif and the Y and E conterions as extant vertebrate species, suggesting that the mechanism for light detection and regulation is similar to rhabdomeric rhodopsins. Both OPN4m and OPN4x paralogs are found in vertebrate genomic paralogons, suggesting that they diverged following this duplication event about 600 million years ago, when the complex eye emerged in the vertebrate ancestor. Melanopsins generally evolved under negative selection (ω = 0.171 with some minor episodes of positive selection (proportion of sites = 25% and functional divergence (θ(I = 0.349 and θ(II = 0.126. The OPN4m and OPN4x melanopsin paralogs show evidence of spectral divergence at sites likely involved in melanopsin light absorbance (200F, 273S and 276A. Also, following the teleost lineage-specific whole genome duplication (3R that prompted the teleost fish radiation, type I divergence (θ(I = 0.181 and positive selection (affecting 11% of sites contributed to amino acid variability that we related with the photo-activation stability of melanopsin. The melanopsin intracellular regions had unexpectedly high variability in their coupling specificity of G-proteins and we propose that Gq/11 and Gi/o are the two G-proteins most-likely to mediate the melanopsin phototransduction pathway. The selection signatures were mainly observed on retinal-related sites and the third and second intracellular loops, demonstrating the physiological plasticity of the melanopsin protein group. Our results provide new

  3. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  4. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Science.gov (United States)

    Guo, Yong; Qiu, Li-Juan

    2013-01-01

    The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  5. Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

    LENUS (Irish Health Repository)

    Vacic, Vladimir

    2011-03-24

    Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

  6. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  7. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  8. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  9. Porting Ordinary Applications to Blue Gene/Q Supercomputers

    Energy Technology Data Exchange (ETDEWEB)

    Maheshwari, Ketan C.; Wozniak, Justin M.; Armstrong, Timothy; Katz, Daniel S.; Binkowski, T. Andrew; Zhong, Xiaoliang; Heinonen, Olle; Karpeyev, Dmitry; Wilde, Michael

    2015-08-31

    Efficiently porting ordinary applications to Blue Gene/Q supercomputers is a significant challenge. Codes are often originally developed without considering advanced architectures and related tool chains. Science needs frequently lead users to want to run large numbers of relatively small jobs (often called many-task computing, an ensemble, or a workflow), which can conflict with supercomputer configurations. In this paper, we discuss techniques developed to execute ordinary applications over leadership class supercomputers. We use the high-performance Swift parallel scripting framework and build two workflow execution techniques-sub-jobs and main-wrap. The sub-jobs technique, built on top of the IBM Blue Gene/Q resource manager Cobalt's sub-block jobs, lets users submit multiple, independent, repeated smaller jobs within a single larger resource block. The main-wrap technique is a scheme that enables C/C++ programs to be defined as functions that are wrapped by a high-performance Swift wrapper and that are invoked as a Swift script. We discuss the needs, benefits, technicalities, and current limitations of these techniques. We further discuss the real-world science enabled by these techniques and the results obtained.

  10. A duplicate gene rooting of seed plants and the phylogenetic position of flowering plants.

    Science.gov (United States)

    Mathews, Sarah; Clements, Mark D; Beilstein, Mark A

    2010-02-12

    Flowering plants represent the most significant branch in the tree of land plants, with respect to the number of extant species, their impact on the shaping of modern ecosystems and their economic importance. However, unlike so many persistent phylogenetic problems that have yielded to insights from DNA sequence data, the mystery surrounding the origin of angiosperms has deepened with the advent and advance of molecular systematics. Strong statistical support for competing hypotheses and recent novel trees from molecular data suggest that the accuracy of current molecular trees requires further testing. Analyses of phytochrome amino acids using a duplicate gene-rooting approach yield trees that unite cycads and angiosperms in a clade that is sister to a clade in which Gingko and Cupressophyta are successive sister taxa to gnetophytes plus Pinaceae. Application of a cycads + angiosperms backbone constraint in analyses of a morphological dataset yields better resolved trees than do analyses in which extant gymnosperms are forced to be monophyletic. The results have implications both for our assessment of uncertainty in trees from sequence data and for our use of molecular constraints as a way to integrate insights from morphological and molecular evidence.

  11. The Role of Gene Duplication in the Evolution of Purine Nucleotide Salvage Pathways

    Science.gov (United States)

    Becerra, Arturo; Lazcano, Antonio

    1998-10-01

    Purine nucleotides are formed de novo by a widespread biochemical route that may be of monophyletic origin, or are synthesized from preformed purine bases and nucleosides through different salvage pathways. Three monophyletic sets of purine salvage enzymes, each of which catalyzes mechanistically similar reactions, can be identified: (a) adenine-, xanthine-, hypoxanthine- and guanine-phosphoribosyltransferases, which are all homologous among themselves, as well as to nucleoside phosphorylases; (b) adenine deaminase, adenosine deaminase, and adenosine monophophate deaminase; and (c) guanine reductase and inosine monophosphate dehydrogenase. These homologies support the idea that substrate specificity is the outcome of gene duplication, and that the purine nucleotide salvage pathways were assembled by a patchwork process that probably took place before the divergence of the three cell domains (Bacteria, Archaea, and Eucarya). Based on the ability of adenine PRTase to catalyze the condensation of PRPP with 4-aminoimidazole-5-carboxamide (AICA), a simpler scheme of purine nucleotide biosynthesis is presented. This hypothetical route requires the prior evolution of PRPP biosynthesis. Since it has been argued that PRPP, nucleosides, and nucleotides are susceptible to hydrolysis, they are very unlikely prebiotic compounds. If this is the case, it implies that many purine salvage pathways appeared only after the evolution of phosphorylated sugar biosynthetic pathways made ribosides available.

  12. Ancestral gene duplication enabled the evolution of multifunctional cellulases in stick insects (Phasmatodea).

    Science.gov (United States)

    Shelomi, Matan; Heckel, David G; Pauchet, Yannick

    2016-04-01

    The Phasmatodea (stick insects) have multiple, endogenous, highly expressed copies of glycoside hydrolase family 9 (GH9) genes. The purpose for retaining so many was unknown. We cloned and expressed the enzymes in transfected insect cell lines, and tested the individual proteins against different plant cell wall component poly- and oligosaccharides. Nearly all isolated enzymes were active against carboxymethylcellulose, however most could also degrade glucomannan, and some also either xylan or xyloglucan. The latter two enzyme groups were each monophyletic, suggesting the evolution of these novel substrate specificities in an early ancestor of the order. Such enzymes are highly unusual for Metazoa, for which no xyloglucanases had been reported. Phasmatodea gut extracts could degrade multiple plant cell wall components fully into sugar monomers, suggesting that enzymatic breakdown of plant cell walls by the entire Phasmatodea digestome may contribute to the Phasmatodea nutritional budget. The duplication and neofunctionalization of GH9s in the ancestral Phasmatodea may have enabled them to specialize as folivores and diverge from their omnivorous ancestors. The structural changes enabling these unprecedented activities in the cellulases require further study. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  14. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  15. Duplication in the microtubule-actin cross-linking factor 1 gene causes a novel neuromuscular condition

    DEFF Research Database (Denmark)

    Jørgensen, Louise H; Mosbech, Mai-Britt; Færgeman, Nils J

    2014-01-01

    . These findings suggest that changes in the MACF1 gene is implicated in this neuromuscular condition, which is an important observation since MACF1 has not previously been associated with any human disease and thus presents a key to understanding the essential nature of this gene....... is associated with developmental retardation and embryonic lethality. Here we present a family with a novel neuromuscular condition. Genetic analyses show a heterozygous duplication resulting in reduced MACF1 gene product. The functional consequence is affected motility observed as periodic hypotonia, lax...

  16. Effects of Gene Duplication, Positive Selection, and Shifts in Gene Expression on the Evolution of the Venom Gland Transcriptome in Widow Spiders.

    Science.gov (United States)

    Haney, Robert A; Clarke, Thomas H; Gadgil, Rujuta; Fitzpatrick, Ryan; Hayashi, Cheryl Y; Ayoub, Nadia A; Garb, Jessica E

    2016-01-05

    Gene duplication and positive selection can be important determinants of the evolution of venom, a protein-rich secretion used in prey capture and defense. In a typical model of venom evolution, gene duplicates switch to venom gland expression and change function under the action of positive selection, which together with further duplication produces large gene families encoding diverse toxins. Although these processes have been demonstrated for individual toxin families, high-throughput multitissue sequencing of closely related venomous species can provide insights into evolutionary dynamics at the scale of the entire venom gland transcriptome. By assembling and analyzing multitissue transcriptomes from the Western black widow spider and two closely related species with distinct venom toxicity phenotypes, we do not find that gene duplication and duplicate retention is greater in gene families with venom gland biased expression in comparison with broadly expressed families. Positive selection has acted on some venom toxin families, but does not appear to be in excess for families with venom gland biased expression. Moreover, we find 309 distinct gene families that have single transcripts with venom gland biased expression, suggesting that the switching of genes to venom gland expression in numerous unrelated gene families has been a dominant mode of evolution. We also find ample variation in protein sequences of venom gland-specific transcripts, lineage-specific family sizes, and ortholog expression among species. This variation might contribute to the variable venom toxicity of these species. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  18. Evolution of CONSTANS Regulation and Function after Gene Duplication Produced a Photoperiodic Flowering Switch in the Brassicaceae.

    Science.gov (United States)

    Simon, Samson; Rühl, Mark; de Montaigu, Amaury; Wötzel, Stefan; Coupland, George

    2015-09-01

    Environmental control of flowering allows plant reproduction to occur under optimal conditions and facilitates adaptation to different locations. At high latitude, flowering of many plants is controlled by seasonal changes in day length. The photoperiodic flowering pathway confers this response in the Brassicaceae, which colonized temperate latitudes after divergence from the Cleomaceae, their subtropical sister family. The CONSTANS (CO) transcription factor of Arabidopsis thaliana, a member of the Brassicaceae, is central to the photoperiodic flowering response and shows characteristic patterns of transcription required for day-length sensing. CO is believed to be widely conserved among flowering plants; however, we show that it arose after gene duplication at the root of the Brassicaceae followed by divergence of transcriptional regulation and protein function. CO has two close homologs, CONSTANS-LIKE1 (COL1) and COL2, which are related to CO by tandem duplication and whole-genome duplication, respectively. The single CO homolog present in the Cleomaceae shows transcriptional and functional features similar to those of COL1 and COL2, suggesting that these were ancestral. We detect cis-regulatory and codon changes characteristic of CO and use transgenic assays to demonstrate their significance in the day-length-dependent activation of the CO target gene FLOWERING LOCUS T. Thus, the function of CO as a potent photoperiodic flowering switch evolved in the Brassicaceae after gene duplication. The origin of CO may have contributed to the range expansion of the Brassicaceae and suggests that in other families CO genes involved in photoperiodic flowering arose by convergent evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Evolution of CONSTANS Regulation and Function after Gene Duplication Produced a Photoperiodic Flowering Switch in the Brassicaceae

    Science.gov (United States)

    Simon, Samson; Rühl, Mark; de Montaigu, Amaury; Wötzel, Stefan; Coupland, George

    2015-01-01

    Environmental control of flowering allows plant reproduction to occur under optimal conditions and facilitates adaptation to different locations. At high latitude, flowering of many plants is controlled by seasonal changes in day length. The photoperiodic flowering pathway confers this response in the Brassicaceae, which colonized temperate latitudes after divergence from the Cleomaceae, their subtropical sister family. The CONSTANS (CO) transcription factor of Arabidopsis thaliana, a member of the Brassicaceae, is central to the photoperiodic flowering response and shows characteristic patterns of transcription required for day-length sensing. CO is believed to be widely conserved among flowering plants; however, we show that it arose after gene duplication at the root of the Brassicaceae followed by divergence of transcriptional regulation and protein function. CO has two close homologs, CONSTANS-LIKE1 (COL1) and COL2, which are related to CO by tandem duplication and whole-genome duplication, respectively. The single CO homolog present in the Cleomaceae shows transcriptional and functional features similar to those of COL1 and COL2, suggesting that these were ancestral. We detect cis-regulatory and codon changes characteristic of CO and use transgenic assays to demonstrate their significance in the day-length-dependent activation of the CO target gene FLOWERING LOCUS T. Thus, the function of CO as a potent photoperiodic flowering switch evolved in the Brassicaceae after gene duplication. The origin of CO may have contributed to the range expansion of the Brassicaceae and suggests that in other families CO genes involved in photoperiodic flowering arose by convergent evolution. PMID:25972346

  20. Blue Light Modulates Murine Microglial Gene Expression in the Absence of Optogenetic Protein Expression.

    Science.gov (United States)

    Cheng, Kevin P; Kiernan, Elizabeth A; Eliceiri, Kevin W; Williams, Justin C; Watters, Jyoti J

    2016-02-17

    Neural optogenetic applications over the past decade have steadily increased; however the effects of commonly used blue light paradigms on surrounding, non-optogenetic protein-expressing CNS cells are rarely considered, despite their simultaneous exposure. Here we report that blue light (450 nm) repetitively delivered in both long-duration boluses and rapid optogenetic bursts gene-specifically altered basal expression of inflammatory and neurotrophic genes in immortalized and primary murine wild type microglial cultures. In addition, blue light reduced pro-inflammatory gene expression in microglia activated with lipopolysaccharide. These results demonstrate previously unreported, off-target effects of blue light in cells not expressing optogenetic constructs. The unexpected gene modulatory effects of blue light on wild type CNS resident immune cells have novel and important implications for the neuro-optogenetic field. Further studies are needed to elucidate the molecular mechanisms and potential therapeutic utility of blue light modulation of the wild type CNS.

  1. Blue Light Modulates Murine Microglial Gene Expression in the Absence of Optogenetic Protein Expression

    Science.gov (United States)

    Cheng, Kevin P.; Kiernan, Elizabeth A.; Eliceiri, Kevin W.; Williams, Justin C.; Watters, Jyoti J.

    2016-01-01

    Neural optogenetic applications over the past decade have steadily increased; however the effects of commonly used blue light paradigms on surrounding, non-optogenetic protein-expressing CNS cells are rarely considered, despite their simultaneous exposure. Here we report that blue light (450 nm) repetitively delivered in both long-duration boluses and rapid optogenetic bursts gene-specifically altered basal expression of inflammatory and neurotrophic genes in immortalized and primary murine wild type microglial cultures. In addition, blue light reduced pro-inflammatory gene expression in microglia activated with lipopolysaccharide. These results demonstrate previously unreported, off-target effects of blue light in cells not expressing optogenetic constructs. The unexpected gene modulatory effects of blue light on wild type CNS resident immune cells have novel and important implications for the neuro-optogenetic field. Further studies are needed to elucidate the molecular mechanisms and potential therapeutic utility of blue light modulation of the wild type CNS. PMID:26883795

  2. Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

    Science.gov (United States)

    Mondragón-Palomino, Mariana; Hiese, Luisa; Härter, Andrea; Koch, Marcus A; Theißen, Günter

    2009-01-01

    Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes) are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection was less stringent in DEF

  3. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  4. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Directory of Open Access Journals (Sweden)

    Münk Carsten

    2012-05-01

    Full Text Available Abstract Background The APOBEC3 (A3 genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure.

  5. Tandem Duplication Events in the Expansion of the Small Heat Shock Protein Gene Family in Solanum lycopersicum (cv. Heinz 1706

    Directory of Open Access Journals (Sweden)

    Flavia J. Krsticevic

    2016-10-01

    Full Text Available In plants, fruit maturation and oxidative stress can induce small heat shock protein (sHSP synthesis to maintain cellular homeostasis. Although the tomato reference genome was published in 2012, the actual number and functionality of sHSP genes remain unknown. Using a transcriptomic (RNA-seq and evolutionary genomic approach, putative sHSP genes in the Solanum lycopersicum (cv. Heinz 1706 genome were investigated. A sHSP gene family of 33 members was established. Remarkably, roughly half of the members of this family can be explained by nine independent tandem duplication events that determined, evolutionarily, their functional fates. Within a mitochondrial class subfamily, only one duplicated member, Solyc08g078700, retained its ancestral chaperone function, while the others, Solyc08g078710 and Solyc08g078720, likely degenerated under neutrality and lack ancestral chaperone function. Functional conservation occurred within a cytosolic class I subfamily, whose four members, Solyc06g076570, Solyc06g076560, Solyc06g076540, and Solyc06g076520, support ∼57% of the total sHSP RNAm in the red ripe fruit. Subfunctionalization occurred within a new subfamily, whose two members, Solyc04g082720 and Solyc04g082740, show heterogeneous differential expression profiles during fruit ripening. These findings, involving the birth/death of some genes or the preferential/plastic expression of some others during fruit ripening, highlight the importance of tandem duplication events in the expansion of the sHSP gene family in the tomato genome. Despite its evolutionary diversity, the sHSP gene family in the tomato genome seems to be endowed with a core set of four homeostasis genes: Solyc05g014280, Solyc03g082420, Solyc11g020330, and Solyc06g076560, which appear to provide a baseline protection during both fruit ripening and heat shock stress in different tomato tissues.

  6. Comparative transcriptome analysis reveals whole-genome duplications and gene selection patterns in cultivated and wild Chrysanthemum species.

    Science.gov (United States)

    Won, So Youn; Kwon, Soo-Jin; Lee, Tae-Ho; Jung, Jae-A; Kim, Jung Sun; Kang, Sang-Ho; Sohn, Seong-Han

    2017-11-01

    Comparative transcriptome analysis of wild and cultivated chrysanthemums provides valuable genomic resources and helps uncover common and divergent patterns of genome and gene evolution in these species. Plants are unique in that they employ polyploidy (or whole-genome duplication, WGD) as a key process for speciation and evolution. The Chrysanthemum genus is closely associated with hybridization and polyploidization, with Chrysanthemum species exhibiting diverse ploidy levels. The commercially important species, C. morifolium is an allohexaploid plant that is thought to have originated via the hybridization of several Chrysanthemum species, but the genomic and molecular evolutionary mechanisms remain poorly understood. In the present study, we sequenced and compared the transcriptomes of C. morifolium and the wild Korean diploid species, C. boreale. De novo transcriptome assembly revealed 11,318 genes in C. morifolium and 10,961 genes in C. boreale, whose functions were annotated by homology searches. An analysis of synonymous substitution rates (Ks) of paralogous and orthologous genes suggested that the two Chrysanthemum species commonly experienced the Asteraceae paleopolyploidization and recent genome duplication or triplication before the divergence of these species. Intriguingly, C. boreale probably underwent rapid diploidization, with a reduction in chromosome number, whereas C. morifolium maintained the original chromosome number. Analysis of the ratios of non-synonymous to synonymous nucleotide substitutions (Ka/Ks) between orthologous gene pairs indicated that 107 genes experienced positive selection, which may have been crucial for the adaptation, domestication, and speciation of Chrysanthemum.

  7. A 7-bp insertion in the 3' untranslated region suggests the duplication and concerted evolution of the rabbit SRY gene

    Directory of Open Access Journals (Sweden)

    Ferrand Nuno

    2006-04-01

    Full Text Available Abstract In this work we report the genetic polymorphism of a 7-bp insertion in the 3' untranslated region of the rabbit SRY gene. The polymorphic GAATTAA motif was found exclusively in one of the two divergent rabbit Y-chromosomal lineages, suggesting that its origin is more recent than the separation of the O. c. algirus and O. c. cuniculus Y-chromosomes. In addition, the remarkable observation of haplotypes exhibiting 0, 1 and 2 7-bp inserts in essentially all algirus populations suggests that the rabbit SRY gene is duplicated and evolving under concerted evolution.

  8. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  9. Heterogeneous expression pattern of tandem duplicated sHsps genes during fruit ripening in two tomato species

    Science.gov (United States)

    Arce, DP; Krsticevic, FJ; Ezpeleta, J.; Ponce, SD; Pratta, GR; Tapia, E.

    2016-04-01

    The small heat shock proteins (sHSPs) have been found to play a critical role in physiological stress conditions in protecting proteins from irreversible aggregation. To characterize the gene expression profile of four sHsps with a tandem gene structure arrangement in the domesticated Solanum lycopersicum (Heinz 1706) genome and its wild close relative Solanum pimpinellifolium (LA1589), differential gene expression analysis using RNA-Seq was conducted in three ripening stages in both cultivars fruits. Gene promoter analysis was performed to explain the heterogeneous pattern of gene expression found for these tandem duplicated sHsps. In silico analysis results contribute to refocus wet experiment analysis in tomato sHsp family proteins.

  10. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhou

    growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.

  11. Population genetics of duplicated alternatively spliced exons of the Dscam gene in Daphnia and Drosophila

    NARCIS (Netherlands)

    Brites, Daniela; Encinas-Viso, Francisco; Ebert, Dieter; Du Pasquier, Louis; Haag, Christoph R.

    2011-01-01

    In insects and crustaceans, the Down syndrome cell adhesion molecule (Dscam) occurs in many different isoforms. These are produced by mutually exclusive alternative splicing of dozens of tandem duplicated exons coding for parts or whole immunoglobulin (Ig) domains of the Dscam protein. This

  12. LAMMPS strong scaling performance optimization on Blue Gene/Q

    Energy Technology Data Exchange (ETDEWEB)

    Coffman, Paul; Jiang, Wei; Romero, Nichols A.

    2014-11-12

    LAMMPS "Large-scale Atomic/Molecular Massively Parallel Simulator" is an open-source molecular dynamics package from Sandia National Laboratories. Significant performance improvements in strong-scaling and time-to-solution for this application on IBM's Blue Gene/Q have been achieved through computational optimizations of the OpenMP versions of the short-range Lennard-Jones term of the CHARMM force field and the long-range Coulombic interaction implemented with the PPPM (particle-particle-particle mesh) algorithm, enhanced by runtime parameter settings controlling thread utilization. Additionally, MPI communication performance improvements were made to the PPPM calculation by re-engineering the parallel 3D FFT to use MPICH collectives instead of point-to-point. Performance testing was done using an 8.4-million atom simulation scaling up to 16 racks on the Mira system at Argonne Leadership Computing Facility (ALCF). Speedups resulting from this effort were in some cases over 2x.

  13. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš

    2014-01-01

    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS -THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  14. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  15. Becker Muscular Dystrophy (BMD) caused by duplication of exons 3-6 of the dystrophin gene presenting as dilated cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, A.C.; Allingham-Hawkins, D.J.; Becker, L. [Univ. of Toronto, Ontario (Canada)] [and others

    1994-09-01

    X-linked dilated cardiomyopathy (XLCM) is a progressive myocardial disease presenting with congestive heart failure in teenage males without clinical signs of skeletal myopathy. Tight linkage of XLCM to the DMD locus has been demonstrated; it has been suggested that, at least in some families, XLCM is a {open_quotes}dystrophinopathy.{close_quotes} We report a 14-year-old boy who presented with acute heart failure due to dilated cardiomyopathy. He had no history of muscle weakness, but physical examination revealed pseudohypertrophy of the calf muscles. He subsequently received a heart transplantation. Family history was negative. Serum CK level at the time of diagnosis was 10,416. Myocardial biopsy showed no evidence of carditis. Dystrophin staining of cardiac and skeletal muscle with anti-sera to COOH and NH{sub 2}termini showed a patchy distribution of positivity suggestive of Becker muscular dystrophy. Analysis of 18 of the 79 dystrophin exons detected a duplication that included exons 3-6. The proband`s mother has an elevated serum CK and was confirmed to be a carrier of the same duplication. A mutation in the muscle promotor region of the dystrophin gene has been implicated in the etiology of SLCM. However, Towbin et al. (1991) argued that other 5{prime} mutations in the dystrophin gene could cause selective cardiomyopathy. The findings in our patient support the latter hypothesis. This suggests that there are multiple regions in the dystrophin gene which, when disrupted, can cause isolated dilated cardiomyopathy.

  16. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  17. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  18. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  19. The naked endosperm genes encode duplicate INDETERMINATE domain transcription factors required for maize endosperm cell patterning and differentiation.

    Science.gov (United States)

    Yi, Gibum; Neelakandan, Anjanasree K; Gontarek, Bryan C; Vollbrecht, Erik; Becraft, Philip W

    2015-02-01

    The aleurone is the outermost layer of cereal endosperm and functions to digest storage products accumulated in starchy endosperm cells as well as to confer important dietary health benefits. Whereas normal maize (Zea mays [Zm]) has a single aleurone layer, naked endosperm (nkd) mutants produce multiple outer cell layers of partially differentiated cells that show sporadic expression of aleurone identity markers such as a viviparous1 promoter-β-glucuronidase transgene. The 15:1 F2 segregation ratio suggested that two recessive genes were involved, and map-based cloning identified two homologous genes in duplicated regions of the genome. The nkd1 and nkd2 genes encode the INDETERMINATE1 domain (IDD) containing transcription factors ZmIDDveg9 and ZmIDD9 on chromosomes 2 and 10, respectively. Independent mutant alleles of nkd1 and nkd2, as well as nkd2-RNA interference lines in which both nkd genes were knocked down, also showed the nkd mutant phenotype, confirming the gene identities. In wild-type kernels, the nkd transcripts were most abundant around 11 to 16 d after pollination. The NKD proteins have putative nuclear localization signals, and green fluorescent protein fusion proteins showed nuclear localization. The mutant phenotype and gene identities suggest that NKD controls a gene regulatory network involved in aleurone cell fate specification and cell differentiation. © 2015 American Society of Plant Biologists. All Rights Reserved.

  20. Rapid transcriptional plasticity of duplicated gene clusters enables a clonally reproducing aphid to colonise diverse plant species.

    Science.gov (United States)

    Mathers, Thomas C; Chen, Yazhou; Kaithakottil, Gemy; Legeai, Fabrice; Mugford, Sam T; Baa-Puyoulet, Patrice; Bretaudeau, Anthony; Clavijo, Bernardo; Colella, Stefano; Collin, Olivier; Dalmay, Tamas; Derrien, Thomas; Feng, Honglin; Gabaldón, Toni; Jordan, Anna; Julca, Irene; Kettles, Graeme J; Kowitwanich, Krissana; Lavenier, Dominique; Lenzi, Paolo; Lopez-Gomollon, Sara; Loska, Damian; Mapleson, Daniel; Maumus, Florian; Moxon, Simon; Price, Daniel R G; Sugio, Akiko; van Munster, Manuella; Uzest, Marilyne; Waite, Darren; Jander, Georg; Tagu, Denis; Wilson, Alex C C; van Oosterhout, Cock; Swarbreck, David; Hogenhout, Saskia A

    2017-02-13

    The prevailing paradigm of host-parasite evolution is that arms races lead to increasing specialisation via genetic adaptation. Insect herbivores are no exception and the majority have evolved to colonise a small number of closely related host species. Remarkably, the green peach aphid, Myzus persicae, colonises plant species across 40 families and single M. persicae clonal lineages can colonise distantly related plants. This remarkable ability makes M. persicae a highly destructive pest of many important crop species. To investigate the exceptional phenotypic plasticity of M. persicae, we sequenced the M. persicae genome and assessed how one clonal lineage responds to host plant species of different families. We show that genetically identical individuals are able to colonise distantly related host species through the differential regulation of genes belonging to aphid-expanded gene families. Multigene clusters collectively upregulate in single aphids within two days upon host switch. Furthermore, we demonstrate the functional significance of this rapid transcriptional change using RNA interference (RNAi)-mediated knock-down of genes belonging to the cathepsin B gene family. Knock-down of cathepsin B genes reduced aphid fitness, but only on the host that induced upregulation of these genes. Previous research has focused on the role of genetic adaptation of parasites to their hosts. Here we show that the generalist aphid pest M. persicae is able to colonise diverse host plant species in the absence of genetic specialisation. This is achieved through rapid transcriptional plasticity of genes that have duplicated during aphid evolution.

  1. Improved detection of deletions and duplications in the DMD gene using the multiplex ligation-dependent probe amplification (MLPA) method.

    Science.gov (United States)

    Sansović, Ivona; Barišić, Ingeborg; Dumić, Katja

    2013-04-01

    The multiplex ligation-dependent probe amplification (MLPA) assay is the most powerful tool in screening for deletions and duplications in the dystrophin gene in patients with Duchenne and Becker muscular dystrophy (DMD/BMD). The efficacy of the assay was validated by testing 20 unrelated male patients with DMD/BMD who had already been screened by multiplex PCR (mPCR). We detected two duplications that had been missed by mPCR. In one DMD patient showing an ambiguous MLPA result, a novel mutation (c.3808_3809insG) was identified. MLPA improved the mutation detection rate of mPCR by 15 %. The results of our study (1) confirmed MLPA to be the method of choice for detecting DMD gene rearrangements in DMD/BMD patients, (2) showed that ambiguous MLPA amplification products should be verified by other methods, and (3) indicated that the MLPA method could be used in screening even for small mutations located in the probe-binding regions.

  2. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  3. A tandem segmental duplication (TSD) in green revolution gene Rht-D1b region underlies plant height variation.

    Science.gov (United States)

    Li, Yiyuan; Xiao, Jianhui; Wu, Jiajie; Duan, Jialei; Liu, Yue; Ye, Xingguo; Zhang, Xin; Guo, Xiuping; Gu, Yongqiang; Zhang, Lichao; Jia, Jizeng; Kong, Xiuying

    2012-10-01

    • Rht-D1c (Rht10) carried by Chinese wheat (Triticum aestivum) line Aibian 1 is an allele at the Rht-D1 locus. Among the Rht-1 alleles, little is known about Rht-D1c although it determines an extreme dwarf phenotype in wheat. • Here, we cloned and functionally characterized Rht-D1c using a combination of Southern blotting, target region sequencing, gene expression analysis and transgenic experiments. • We found that the Rht-D1c allele was generated through a tandem segmental duplication (TSD) of a > 1 Mb region, resulting in two copies of the Rht-D1b. Two copies of Rht-D1b in the TSD were three-fold more effective in reducing plant height than a single copy, and transformation with a segment containing the tandemly duplicated copy of Rht-D1b resulted in the same level of reduction of plant height as the original copy in Aibian 1. • Our results suggest that changes in gene copy number are one of the important sources of genetic diversity and some of these changes could be directly associated with important traits in crops. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  4. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  5. Determination of performance characteristics of scientific applications on IBM Blue Gene/Q

    Energy Technology Data Exchange (ETDEWEB)

    Evangelinos, C. [IBM Research Division, Cambridge, MA (United States); Walkup, R. E. [IBM, Yorktown Heights, NY (United States). Thomas J. Watson Research Center; Sachdeva, V. [IBM Research Division, Cambridge, MA (United States); Jordan, K. E. [IBM Research Division, Cambridge, MA (United States); Gahvari, H. [Univ. of Illinois, Urbana-Champaign, IL (United States). Computer Science Dept.; Chung, I. -H. [IBM, Yorktown Heights, NY (United States). Thomas J. Watson Research Center; Perrone, M. P. [IBM, Yorktown Heights, NY (United States). Thomas J. Watson Research Center; Lu, L. [IBM, Yorktown Heights, NY (United States). Thomas J. Watson Research Center; Liu, L. -K. [IBM, Yorktown Heights, NY (United States). Thomas J. Watson Research Center; Magerlein, K. [IBM, Yorktown Heights, NY (United States). Thomas J. Watson Research Center

    2013-02-13

    The IBM Blue Gene®/Q platform presents scientists and engineers with a rich set of hardware features such as 16 cores per chip sharing a Level 2 cache, a wide SIMD (single-instruction, multiple-data) unit, a five-dimensional torus network, and hardware support for collective operations. Especially important is the feature related to cores that have four “hardware threads,” which makes it possible to hide latencies and obtain a high fraction of the peak issue rate from each core. All of these hardware resources present unique performance-tuning opportunities on Blue Gene/Q. We provide an overview of several important applications and solvers and study them on Blue Gene/Q using performance counters and Message Passing Interface profiles. We also discuss how Blue Gene/Q tools help us understand the interaction of the application with the hardware and software layers and provide guidance for optimization. Furthermore, on the basis of our analysis, we discuss code improvement strategies targeting Blue Gene/Q. Information about how these algorithms map to the Blue Gene® architecture is expected to have an impact on future system design as we move to the exascale era.

  6. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  7. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Functional evolution of duplicated odorant-binding protein genes, Obp57d and Obp57e, in Drosophila.

    Directory of Open Access Journals (Sweden)

    Eriko Harada

    Full Text Available Odorant-binding proteins (OBPs are extracellular proteins found in insect chemosensilla, where they participate in the sensing of odors, tastes, and pheromones. Although a large number of OBP genes have been identified in insect genomes, their molecular functions and biological roles have been clarified in limited cases. Two OBP genes, Obp57d and Obp57e, were involved in the evolution of host-plant preference in Drosophila sechellia. Comparative analyses of the Obp57d/e genomic sequences from 27 closely related species suggested that the two genes arose by tandem gene duplication and functionally diverged from each other. In this study, the functional evolution of Obp57d and Obp57e was examined by in vitro binding assays using recombinant proteins synthesized in a bacterial system. Compared to the ancestral Dpse\\OBP57de, Dmel\\OBP57d was more specialized to tridecanoic acid while Dmel\\OBP57e was generalized regarding their binding affinity, suggesting that the two OBP genes underwent subfunctionalization and neofunctionalization. A behavioral analysis using knockout flies supported that the biological role is different between OBP57d and OBP57e in vivo. Site-directed mutagenesis of the evolutionarily conserved amino acids revealed that these residues play an important role in protein folding. These findings provide a clue to understanding how the repertoire of OBP genes is maintained in a genome under natural selection.

  9. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  10. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  11. Evolution of double MutT/Nudix domain-containing proteins: similar domain architectures from independent gene duplication-fusion events.

    Science.gov (United States)

    Lin, Jun; Hu, Yihuai; Tian, Bing; Hua, Yuejin

    2009-10-01

    The MutT/Nudix superfamily proteins repair DNA damage and play a role in human health and disease. In this study, we examined two different cases of double MutT/Nudix domain-containing proteins from eukaryotes and prokaryotes. Firstly, these double domain proteins were discovered in Drosophila, but only single Nudix domain proteins were found in other animals. The phylogenetic tree was constructed based on the protein sequence of Nudix_N and Nudix_C from Drosophila, and Nudix from other animals. The phylogenetic analysis suggested that the double Nudix domain proteins might have undergone a gene duplication-speciation-fusion process. Secondly, two genes of the MutT family, DR0004 and DR0329, were fused by two mutT gene segments and formed double MutT domain protein genes in Deinococcus radiodurans. The evolutionary tree of bacterial MutT proteins suggested that the double MutT domain proteins in D. radiodurans probably resulted from a gene duplication-fusion event after speciation. Gene duplication-fusion is a basic and important gene innovation mechanism for the evolution of double MutT/Nudix domain proteins. Independent gene duplication-fusion events resulted in similar domain architectures of different double MutT/Nudix domain proteins.

  12. Identification of Genes for Synthesis of the Blue Pigment, Biliverdin IXα, in the Blue Coral Heliopora coerulea.

    Science.gov (United States)

    Hongo, Yuki; Yasuda, Nina; NagaI, Satoshi

    2017-04-01

    Heliopora coerulea is the only species in the subclass Octocorallia that has a crystalline aragonite skeleton. The skeleton has been reported to contain the blue pigment, biliverdin IXα, which is formed by heme oxygenase (HO) during heme decomposition. There is little information regarding gene expression in H. coerulea; therefore, the biosynthesis pathway for biliverdin IXα is poorly understood. To identify the genes related to heme synthesis and degradation, metatranscripts of H. coerulea and its symbiont Symbiodinium spp. were sequenced and separated from the host- and symbiont-derived sequences. From the metatranscriptome analyses, all genes for heme synthesis and three HOs were isolated from the host and symbiont. From our phylogenetic and amino acid analysis, we noted that one of the HO isoforms in the host coral was predicted to possess HO activity. However, biliverdin reductase, which reduces biliverdin to bilirubin, was not identified in the present study. Similarly, biliverdin reductase was not identified in the transcripts of the red coral Corallium rubrum, a species that also belongs to Octocorallia. However, genes related to heme synthesis and HO were found in C. rubrum. We speculate that Heliopora coerulea can produce biliverdin and accumulate it in the skeleton, while red corals and other Octocorallia species cannot. Further information from molecular studies of H. coerulea will provide insights into the synthesis of biliverdin IXα, the blue pigment in the hard crystalline aragonite skeleton, and will be fundamental to future ecological and physiological studies.

  13. An ancestral MADS-box gene duplication occurred before the divergence of plants and animals

    OpenAIRE

    Alvarez-Buylla, Elena R.; Pelaz, Soraya; Liljegren, Sarah J.; Gold, Scott E.; Burgeff, Caroline; Ditta, Gary S.; Ribas de Pouplana, Lluis; Martínez-Castilla, León; Yanofsky, Martin F.

    2000-01-01

    Changes in genes encoding transcriptional regulators can alter development and are important components of the molecular mechanisms of morphological evolution. MADS-box genes encode transcriptional regulators of diverse and important biological functions. In plants, MADS-box genes regulate flower, fruit, leaf, and root development. Recent sequencing efforts in Arabidopsis have allowed a nearly complete sampling of the MADS-box gene family from a single plant, something that was lacking in pre...

  14. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen

    2006-01-01

    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  15. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  16. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Evolution of C2H2-zinc finger genes and subfamilies in mammals: Species-specific duplication and loss of clusters, genes and effector domains

    Directory of Open Access Journals (Sweden)

    Aubry Muriel

    2008-06-01

    Full Text Available Abstract Background C2H2 zinc finger genes (C2H2-ZNF constitute the largest class of transcription factors in humans and one of the largest gene families in mammals. Often arranged in clusters in the genome, these genes are thought to have undergone a massive expansion in vertebrates, primarily by tandem duplication. However, this view is based on limited datasets restricted to a single chromosome or a specific subset of genes belonging to the large KRAB domain-containing C2H2-ZNF subfamily. Results Here, we present the first comprehensive study of the evolution of the C2H2-ZNF family in mammals. We assembled the complete repertoire of human C2H2-ZNF genes (718 in total, about 70% of which are organized into 81 clusters across all chromosomes. Based on an analysis of their N-terminal effector domains, we identified two new C2H2-ZNF subfamilies encoding genes with a SET or a HOMEO domain. We searched for the syntenic counterparts of the human clusters in other mammals for which complete gene data are available: chimpanzee, mouse, rat and dog. Cross-species comparisons show a large variation in the numbers of C2H2-ZNF genes within homologous mammalian clusters, suggesting differential patterns of evolution. Phylogenetic analysis of selected clusters reveals that the disparity in C2H2-ZNF gene repertoires across mammals not only originates from differential gene duplication but also from gene loss. Further, we discovered variations among orthologs in the number of zinc finger motifs and association of the effector domains, the latter often undergoing sequence degeneration. Combined with phylogenetic studies, physical maps and an analysis of the exon-intron organization of genes from the SCAN and KRAB domains-containing subfamilies, this result suggests that the SCAN subfamily emerged first, followed by the SCAN-KRAB and finally by the KRAB subfamily. Conclusion Our results are in agreement with the "birth and death hypothesis" for the evolution of

  18. Independent and Parallel Evolution of New Genes by Gene Duplication in Two Origins of C4 Photosynthesis Provides New Insight into the Mechanism of Phloem Loading in C4 Species.

    Science.gov (United States)

    Emms, David M; Covshoff, Sarah; Hibberd, Julian M; Kelly, Steven

    2016-07-01

    C4 photosynthesis is considered one of the most remarkable examples of evolutionary convergence in eukaryotes. However, it is unknown whether the evolution of C4 photosynthesis required the evolution of new genes. Genome-wide gene-tree species-tree reconciliation of seven monocot species that span two origins of C4 photosynthesis revealed that there was significant parallelism in the duplication and retention of genes coincident with the evolution of C4 photosynthesis in these lineages. Specifically, 21 orthologous genes were duplicated and retained independently in parallel at both C4 origins. Analysis of this gene cohort revealed that the set of parallel duplicated and retained genes is enriched for genes that are preferentially expressed in bundle sheath cells, the cell type in which photosynthesis was activated during C4 evolution. Furthermore, functional analysis of the cohort of parallel duplicated genes identified SWEET-13 as a potential key transporter in the evolution of C4 photosynthesis in grasses, and provides new insight into the mechanism of phloem loading in these C4 species. C4 photosynthesis, gene duplication, gene families, parallel evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. A duplicated coxI gene is associated with cytoplasmic male sterility ...

    Indian Academy of Sciences (India)

    The new CMS line is comparable to euplasmic lines for almost all characters, except for flowers which bear slender, needle-like anthers with aborted pollen. Detailed Southern analysis revealed two copies of coxI gene in the CMS line. One copy, coxI-1 is similar to the coxI gene of B. juncea, whereas the second copy, coxI-2 ...

  20. Inactivation of gene expression in plants as a consequence of specific sequence duplication.

    OpenAIRE

    Flavell, R B

    1994-01-01

    Numerous examples now exist in plants where the insertion of multiple copies of a transgene leads to loss of expression of some or all copies of the transgene. Where the transgene contains sequences homologous to an endogenous gene, expression of both transgene and endogenous gene is sometimes found to be impaired. Several examples of these phenomena displaying different features are reviewed. Possible explanations for the observed phenomena are outlined, drawing on known cellular processes i...

  1. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster.

    Science.gov (United States)

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C

    2015-05-01

    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  2. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Science.gov (United States)

    Amanda L. Pendleton; Katherine E. Smith; Nicolas Feau; Francis M. Martin; Igor V. Grigoriev; Richard Hamelin; C.Dana Nelson; J.Gordon Burleigh; John M. Davis

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops . A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen...

  3. The physical map of wheat chromosome 5DS revealed gene duplications and small rearrangements

    Czech Academy of Sciences Publication Activity Database

    Akpinar, B.A.; Magni, F.; Yuce, M.; Lucas, S. J.; Šimková, Hana; Šafář, Jan; Vautrin, S.; Berges, H.; Cattonaro, F.; Doležel, Jaroslav; Budak, H.

    2015-01-01

    Roč. 16, JUN 13 (2015) ISSN 1471-2164 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Triticum aestivum * 5DS * Hexaploid wheat Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 3.867, year: 2015

  4. Divergent evolution of cis-acting peroxisome proliferator-activated receptor elements that differentially control the tandemly duplicated fatty acid-binding protein genes, fabp1b.1 and fabp1b.2, in zebrafish.

    Science.gov (United States)

    Laprairie, Robert B; Denovan-Wright, Eileen M; Wright, Jonathan M

    2016-06-01

    Gene duplication is thought to facilitate increasing complexity in the evolution of life. The fate of most duplicated genes is nonfunctionalization: functional decay resulting from the accumulation of mutations. According to the duplication-degeneration-complementation (DDC) model, duplicated genes are retained by subfunctionalization, where the functions of the ancestral gene are sub-divided between duplicate genes, or by neofunctionalization, where one of the duplicates acquires a new function. Here, we report the differential regulation of the zebrafish tandemly duplicated fatty acid-binding protein genes, fabp1b.1 and fabp1b.2, by peroxisome proliferator-activated receptors (PPAR). fabp1b.1 mRNA levels were induced in tissue explants of liver, but not intestine, by PPAR agonists. fabp1b.1 promoter activity was induced to a greater extent by rosiglitazone (PPARγ-selective agonist) compared to WY 14,643 (PPARα-selective agonist) in HEK293A cells. Mutation of a peroxisome proliferator response element (PPRE) at -1232 bp in the fabp1b.1 promoter reduced PPAR-dependent activation. fabp1b.2 promoter activity was not affected by PPAR agonists. Differential regulation of the duplicated fabp1b promoters may be the result of PPRE loss in fabp1b.2 during a meiotic crossing-over event. Retention of PPAR inducibility in fabp1b.1 and not fabp1b.2 suggests unique regulation and function of the fabp1b duplicates.

  5. Blue Genes: Sharing and Conserving the World's Aquatic Biodiversity

    International Development Research Centre (IDRC) Digital Library (Canada)

    A gene in a rose petal will respond to a message to produce red pigment, but a palm leaf gene will block the same message. The genetic code of an organism describes the essential characteristics that will be inherited by each individual – the distinctive coloration of a neon tetra, the cold tolerance of a winter flounder, the ...

  6. A Duplicated, Truncated amh Gene Is Involved in Male Sex Determination in an Old World Silverside

    Directory of Open Access Journals (Sweden)

    Dilip Kumar Bej

    2017-08-01

    Full Text Available A master sex-determining gene, the Y chromosome-linked anti-Müllerian hormone (amhy gene, has been described in two New World atheriniform species but little is known on the distribution, evolution, and function(s of this gene in other Atheriniformes. Interestingly, amhy has been found to coexist with temperature-dependent sex determination (TSD, providing a unique opportunity to explore the interplay between genotypic and environmental sex determination. In this study, the search for an amhy homolog was extended to an Old World atheriniform, the cobaltcap silverside Hypoatherina tsurugae (Atherinidae. The full sequences, including the coding and noncoding regions, of the autosomal amh (amha and a putative amhy were obtained. The deduced Amha and Amhy proteins comprised 511 and 340 amino acids (aa, respectively. PCR analysis with genomic DNA from wild adults and from laboratory-reared juveniles revealed a high, but not complete association of ∼95% between amhy and maleness. The spatiotemporal expression of amhy and amha during gonadal sex differentiation was analyzed by qRT-PCR and in situ hybridization (ISH. amhy transcription (in amhy-positive larvae started before and peaked during histological differentiation of the gonads whereas amha was negligible during the same period in both genotypes. These results demonstrate that the amhy, although with some structural differences in relation to the amhy of some New World atheriniforms, is strongly associated with maleness and probably important for testicular development in this Old World atheriniform. Thus, amhy is a candidate sex determination gene in cobaltcap silverside and it will be key to scrutinize the mechanism of sex determination in this species.

  7. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  8. A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease.

    Science.gov (United States)

    Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad

    2015-01-01

    α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

  9. Stabilized gene duplication enables long-term selection-free heterologous pathway expression.

    Science.gov (United States)

    Tyo, Keith E J; Ajikumar, Parayil Kumaran; Stephanopoulos, Gregory

    2009-08-01

    Engineering robust microbes for the biotech industry typically requires high-level, genetically stable expression of heterologous genes and pathways. Although plasmids have been used for this task, fundamental issues concerning their genetic stability have not been adequately addressed. Here we describe chemically inducible chromosomal evolution (CIChE), a plasmid-free, high gene copy expression system for engineering Escherichia coli. CIChE uses E. coli recA homologous recombination to evolve a chromosome with approximately 40 consecutive copies of a recombinant pathway. Pathway copy number is stabilized by recA knockout, and the resulting engineered strain requires no selection markers and is unaffected by plasmid instabilities. Comparison of CIChE-engineered strains with equivalent plasmids revealed that CIChE improved genetic stability approximately tenfold and growth phase-specific productivity approximately fourfold for a strain producing the high metabolic burden-biopolymer poly-3-hydroxybutyrate. We also increased the yield of the nutraceutical lycopene by 60%. CIChE should be applicable in many organisms, as it only requires having targeted genomic integration methods and a recA homolog.

  10. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    Science.gov (United States)

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Linux OS Jitter Measurements at Large Node Counts using a BlueGene/L

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Terry R [ORNL; Tauferner, Mr. Andrew [IBM T. J. Watson Research Center; Inglett, Mr. Todd [IBM T. J. Watson Research Center

    2010-01-01

    We present experimental results for a coordinated scheduling implementation of the Linux operating system. Results were collected on an IBM Blue Gene/L machine at scales up to 16K nodes. Our results indicate coordinated scheduling was able to provide a dramatic improvement in scaling performance for two applications characterized as bulk synchronous parallel programs.

  12. Genes encoding hub and bottleneck enzymes of the Arabidopsis metabolic network preferentially retain homeologs through whole genome duplication

    Directory of Open Access Journals (Sweden)

    Qi Xiaoquan

    2010-05-01

    Full Text Available Abstract Background Whole genome duplication (WGD occurs widely in angiosperm evolution. It raises the intriguing question of how interacting networks of genes cope with this dramatic evolutionary event. Results In study of the Arabidopsis metabolic network, we assigned each enzyme (node with topological centralities (in-degree, out-degree and between-ness to measure quantitatively their centralities in the network. The Arabidopsis metabolic network is highly modular and separated into 11 interconnected modules, which correspond well to the functional metabolic pathways. The enzymes with higher in-out degree and between-ness (defined as hub and bottleneck enzymes, respectively tend to be more conserved and preferentially retain homeologs after WGD. Moreover, the simultaneous retention of homeologs encoding enzymes which catalyze consecutive steps in a pathway is highly favored and easily achieved, and enzyme-enzyme interactions contribute to the retention of one-third of WGD enzymes. Conclusions Our analyses indicate that the hub and bottleneck enzymes of metabolic network obtain great benefits from WGD, and this event grants clear evolutionary advantages in adaptation to different environments.

  13. Analysis of Pigeon (Columba Ovary Transcriptomes to Identify Genes Involved in Blue Light Regulation.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Monochromatic light is widely applied to promote poultry reproductive performance, yet little is currently known regarding the mechanism by which light wavelengths affect pigeon reproduction. Recently, high-throughput sequencing technologies have been used to provide genomic information for solving this problem. In this study, we employed Illumina Hiseq 2000 to identify differentially expressed genes in ovary tissue from pigeons under blue and white light conditions and de novo transcriptome assembly to construct a comprehensive sequence database containing information on the mechanisms of follicle development. A total of 157,774 unigenes (mean length: 790 bp were obtained by the Trinity program, and 35.83% of these unigenes were matched to genes in a non-redundant protein database. Gene description, gene ontology, and the clustering of orthologous group terms were performed to annotate the transcriptome assembly. Differentially expressed genes between blue and white light conditions included those related to oocyte maturation, hormone biosynthesis, and circadian rhythm. Furthermore, 17,574 SSRs and 533,887 potential SNPs were identified in this transcriptome assembly. This work is the first transcriptome analysis of the Columba ovary using Illumina technology, and the resulting transcriptome and differentially expressed gene data can facilitate further investigations into the molecular mechanism of the effect of blue light on follicle development and reproduction in pigeons and other bird species.

  14. Characterization and evolution of microRNA genes derived from repetitive elements and duplication events in plants.

    Directory of Open Access Journals (Sweden)

    Jie Sun

    Full Text Available MicroRNAs (miRNAs are a major class of small non-coding RNAs that act as negative regulators at the post-transcriptional level in animals and plants. In this study, all known miRNAs in four plant species (Arabidopsis thaliana, Populus trichocarpa, Oryza sativa and Sorghum bicolor have been analyzed, using a combination of computational and comparative genomic approaches, to systematically identify and characterize the miRNAs that were derived from repetitive elements and duplication events. The study provides a complete mapping, at the genome scale, of all the miRNAs found on repetitive elements in the four test plant species. Significant differences between repetitive element-related miRNAs and non-repeat-derived miRNAs were observed for many characteristics, including their location in protein-coding and intergenic regions in genomes, their conservation in plant species, sequence length of their hairpin precursors, base composition of their hairpin precursors and the minimum free energy of their hairpin structures. Further analysis showed that a considerable number of miRNA families in the four test plant species arose from either tandem duplication events, segmental duplication events or a combination of the two. However, comparative analysis suggested that the contribution made by these two duplication events differed greatly between the perennial tree species tested and the other three annual species. The expansion of miRNA families in A. thaliana, O. sativa and S. bicolor are more likely to occur as a result of tandem duplication events than from segmental duplications. In contrast, genomic segmental duplications contributed significantly more to the expansion of miRNA families in P. trichocarpa than did tandem duplication events. Taken together, this study has successfully characterized miRNAs derived from repetitive elements and duplication events at the genome scale and provides comprehensive knowledge and deeper insight into the

  15. High mature grain phytase activity in the Triticeae has evolved by duplication followed by neofunctionalization of the purple acid phosphatase phytase (PAPhy) gene

    DEFF Research Database (Denmark)

    Madsen, Claus Krogh; Dionisio, Giuseppe; Holme, Inger

    2013-01-01

    consist of a set of paralogues, PAPhy_a and PAPhy_b, and have been mapped to Triticeae chromosomes 5 and 3, respectively. The promoters share a conserved core but the PAPhy_a promoter have acquired a novel cis-acting regulatory element for expression during grain filling while the PAPhy_b promoter has...... on Brachypodium chromosomes 1 and 2 does not extend beyond the PAPhy gene. The results indicate that a single-gene segmental duplication may have enabled the evolution of high MGPA by creating functional redundancy of the parent PAPhy gene. This implies that similar MGPA levels may be out of reach in breeding...

  16. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  17. Phylogeny of C4-photosynthesis enzymes based on algal transcriptomic and genomic data supports an archaeal/proteobacterial origin and multiple duplication for most C4-related genes.

    Directory of Open Access Journals (Sweden)

    Shan Chi

    Full Text Available Both Calvin-Benson-Bassham (C3 and Hatch-Slack (C4 cycles are most important autotrophic CO2 fixation pathways on today's Earth. C3 cycle is believed to be originated from cyanobacterial endosymbiosis. However, studies on evolution of different biochemical variants of C4 photosynthesis are limited to tracheophytes and origins of C4-cycle genes are not clear till now. Our comprehensive analyses on bioinformatics and phylogenetics of novel transcriptomic sequencing data of 21 rhodophytes and 19 Phaeophyceae marine species and public genomic data of more algae, tracheophytes, cyanobacteria, proteobacteria and archaea revealed the origin and evolution of C4 cycle-related genes. Almost all of C4-related genes were annotated in extensive algal lineages with proteobacterial or archaeal origins, except for phosphoenolpyruvate carboxykinase (PCK and aspartate aminotransferase (AST with both cyanobacterial and archaeal/proteobacterial origin. Notably, cyanobacteria may not possess complete C4 pathway because of the flawed annotation of pyruvate orthophosphate dikinase (PPDK genes in public data. Most C4 cycle-related genes endured duplication and gave rise to functional differentiation and adaptation in different algal lineages. C4-related genes of NAD-ME (NAD-malic enzyme and PCK subtypes exist in most algae and may be primitive ones, while NADP-ME (NADP-malic enzyme subtype genes might evolve from NAD-ME subtype by gene duplication in chlorophytes and tracheophytes.

  18. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  19. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  20. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  1. Transcriptome Signatures of Selection, Drift, Introgression, and Gene Duplication in the Evolution of an Extremophile Endemic Plant.

    Science.gov (United States)

    Hawkins, Angela K; Garza, Elyssa R; Dietz, Valerie A; Hernandez, Oscar J; Hawkins, W Daryl; Burrell, A Millie; Pepper, Alan E

    2017-12-01

    Plants on serpentine soils provide extreme examples of adaptation to environment, and thus offer excellent models for the study of evolution at the molecular and genomic level. Serpentine outcrops are derived from ultramafic rock and have extremely low levels of essential plant nutrients (e.g., N, P, K, and Ca), as well as toxic levels of heavy metals (e.g., Ni, Cr, and Co) and low moisture availability. These outcrops provide habitat to a number of endemic plant species, including the annual mustard Caulanthus amplexicaulis var. barbarae (Cab) (Brassicaceae). Its sister taxon, C. amplexicaulis var. amplexicaulis (Caa), is intolerant to serpentine soils. Here, we assembled and annotated comprehensive reference transcriptomes of both Caa and Cab for use in protein coding sequence comparisons. A set of 29,443 reciprocal best Blast hit (RBH) orthologs between Caa and Cab was compared with identify coding sequence variants, revealing a high genome-wide dN/dS ratio between the two taxa (mean = 0.346). We show that elevated dN/dS likely results from the composite effects of genetic drift, positive selection, and the relaxation of negative selection. Further, analysis of paralogs within each taxon revealed the signature of a period of elevated gene duplication (∼10 Ma) that is shared with other species of the tribe Thelypodieae, and may have played a role in the striking morphological and ecological diversity of this tribe. In addition, distribution of the synonymous substitution rate, dS, is strongly bimodal, indicating a history of reticulate evolution that may have contributed to serpentine adaptation. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Opposing phenotypes in mice with Smith-Magenis deletion and Potocki-Lupski duplication syndromes suggest gene dosage effects on fluid consumption behavior.

    Science.gov (United States)

    Heck, Detlef H; Gu, Wenli; Cao, Ying; Qi, Shuhua; Lacaria, Melanie; Lupski, James R

    2012-11-01

    A quantitative long-term fluid consumption and fluid-licking assay was performed in two mouse models with either an ∼2 Mb genomic deletion, Df(11)17, or the reciprocal duplication copy number variation (CNV), Dp(11)17, analogous to the human genomic rearrangements causing either Smith-Magenis syndrome [SMS; OMIM #182290] or Potocki-Lupski syndrome [PTLS; OMIM #610883], respectively. Both mouse strains display distinct quantitative alterations in fluid consumption compared to their wild-type littermates; several of these changes are diametrically opposing between the two chromosome engineered mouse models. Mice with duplication versus deletion showed longer versus shorter intervals between visits to the waterspout, generated more versus less licks per visit and had higher versus lower variability in the number of licks per lick-burst as compared to their respective wild-type littermates. These findings suggest that copy number variation can affect long-term fluid consumption behavior in mice. Other behavioral differences were unique for either the duplication or deletion mutants; the deletion CNV resulted in increased variability of the licking rhythm, and the duplication CNV resulted in a significant slowing of the licking rhythm. Our findings document a readily quantitated complex behavioral response that can be directly and reciprocally influenced by a gene dosage effect. Copyright © 2012 Wiley Periodicals, Inc.

  3. Engineering PFLOTRAN for Scalable Performance on Cray XT and IBM BlueGene Architectures

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Richard T [ORNL; Sripathi, Vamsi K [ORNL; Mahinthakumar, Gnanamanika [ORNL; Hammond, Glenn [Pacific Northwest National Laboratory (PNNL); Lichtner, Peter [Los Alamos National Laboratory (LANL); Smith, Barry F [Argonne National Laboratory (ANL)

    2010-01-01

    We describe PFLOTRAN - a code for simulation of coupled hydro-thermal-chemical processes in variably saturated, non-isothermal, porous media - and the approaches we have employed to obtain scalable performance on some of the largest scale supercomputers in the world. We present detailed analyses of I/O and solver performance on Jaguar, the Cray XT5 at Oak Ridge National Laboratory, and Intrepid, the IBM BlueGene/P at Argonne National Laboratory, that have guided our choice of algorithms.

  4. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  5. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie

    2013-01-01

    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  6. Assessment and Reconstruction of Novel HSP90 Genes: Duplications, Gains and Losses in Fungal and Animal Lineages

    Czech Academy of Sciences Publication Activity Database

    Pantzartzi, Chrysoula; Drosopoulou, E.; Scouras, Z.

    2013-01-01

    Roč. 8, č. 9 (2013), s. 1-11 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : Hsp90s * Fungi * duplication events Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  7. Early changes in gene expression induced by blue light irradiation of A2E-laden retinal pigment epithelial cells

    DEFF Research Database (Denmark)

    van der Burght, Barbro W; Hansen, Morten; Olsen, Jørgen

    2013-01-01

    investigated the differential gene expression in RPE cells that had accumulated the lipofuscin fluorophore A2E and were exposed to blue light (430 nm). Methods:  A2E-laden RPE cells were exposed to blue light (A2E/430 nm) at various time intervals. Cell death was quantified using Dead Red staining, and RNA...... irradiated with blue light were clearly distinguishable from the control samples. We found differential regulation of genes belonging to the following functional groups: transcription factors, stress response, apoptosis and immune response. Among the last mentioned were downregulation of four genes......). Conclusion:  This study demonstrates that blue light irradiation of A2E-laden RPE cells can alter the transcription of genes belonging to different functional pathways including stress response, apoptosis and the immune response. We suggest that these molecules may be associated to the pathogenesis of AMD...

  8. Complete mtDNA sequences of two millipedes suggest a new model for mitochondrial gene rearrangements: Duplication and non-random loss

    Energy Technology Data Exchange (ETDEWEB)

    Lavrov, Dennis V.; Boore, Jeffrey L.; Brown, Wesley M.

    2001-11-08

    We determined the complete mtDNA sequences of the millipedes Narceus annularus and Thyropygus sp. (Arthropoda: Diplopoda) and identified in both genomes all 37 genes typical for metazoan mtDNA. The arrangement of these genes is identical in the two millipedes, but differs from that inferred to be ancestral for arthropods by the location of four genes/gene clusters. This novel gene arrangement is unusual for animal mtDNA, in that genes with opposite transcriptional polarities are clustered in the genome and the two clusters are separated by two non-coding regions. The only exception to this pattern is the gene for cysteine tRNA, which is located in the part of the genome that otherwise contains all genes with the opposite transcriptional polarity. We suggest that a mechanism involving complete mtDNA duplication followed by the loss of genes, predetermined by their transcriptional polarity and location in the genome, could generate this gene arrangement from the one ancestral for arthropods. The proposed mechanism has important implications for phylogenetic inferences that are drawn on the basis of gene arrangement comparisons.

  9. Phylogeny and diversification of B-function MADS-box genes in angiosperms: evolutionary and functional implications of a 260-million-year-old duplication.

    Science.gov (United States)

    Kim, Sangtae; Yoo, Mi-Jeong; Albert, Victor A; Farris, James S; Soltis, Pamela S; Soltis, Douglas E

    2004-12-01

    B-function MADS-box genes play crucial roles in floral development in model angiosperms. We reconstructed the structural and functional implications of B-function gene phylogeny in the earliest extant flowering plants based on analyses that include 25 new AP3 and PI sequences representing critical lineages of the basalmost angiosperms: Amborella, Nuphar (Nymphaeaceae), and Illicium (Austrobaileyales). The ancestral size of exon 5 in PI-homologues is 42 bp, typical of exon 5 in other plant MADS-box genes. This 42-bp length is found in PI-homologues from Amborella and Nymphaeaceae, successive sisters to all other angiosperms. Following these basalmost branches, a deletion occurred in exon 5, yielding a length of 30 bp, a condition that unites all other angiosperms. Several shared amino acid strings, including a prominent "DEAER" motif, are present in the AP3- and PI-homologues of Amborella. These may be ancestral motifs that were present before the duplication that yielded the AP3 and PI lineages and subsequently were modified after the divergence of Amborella. Other structural features were identified, including a motif that unites the previously described TM6 clade and a deletion in AP3-homologues that unites all Magnoliales. Phylogenetic analyses of AP3- and PI-homologues yielded gene trees that generally track organismal phylogeny as inferred by multigene data sets. With both AP3 and PI amino acid sequences, Amborella and Nymphaeaceae are sister to all other angiosperms. Using nonparametric rate smoothing (NPRS), we estimated that the duplication that produced the AP3 and PI lineages occurred approximately 260 mya (231-290). This places the duplication after the split between extant gymnosperms and angiosperms, but well before the oldest angiosperm fossils. A striking similarity in the multimer-signalling C domains of the Amborella proteins suggests the potential for the formation of unique transcription-factor complexes. The earliest angiosperms may have been

  10. ThMYC4E, candidate Blue aleurone 1 gene controlling the associated trait in Triticum aestivum.

    Directory of Open Access Journals (Sweden)

    Na Li

    Full Text Available Blue aleurone is a useful and interesting trait in common wheat that was derived from related species. Here, transcriptomes of blue and white aleurone were compared for isolating Blue aleurone 1 (Ba1 transferred from Thinopyrum ponticum. In the genes involved in anthocyanin biosynthesis, only a basic helix-loop-helix (bHLH transcription factor, ThMYC4E, had a higher transcript level in blue aleurone phenotype, and was homologous to the genes on chromosome 4 of Triticum aestivum. ThMYC4E carried the characteristic domains (bHLH-MYC_N, HLH and ACT-like of a bHLH transcription factor, and clustered with genes regulating anthocyanin biosynthesis upon phylogenetic analysis. The over-expression of ThMYC4E regulated anthocyanin biosynthesis with the coexpression of the MYB transcription factor ZmC1 from maize. ThMYC4E existed in the genomes of the addition, substitution and near isogenic lines with the blue aleurone trait derived from Th. ponticum, and could not be detected in any germplasm of T. urartu, T. monococcum, T. turgidum, Aegilops tauschii or T. aestivum, with white aleurone. These results suggested that ThMYC4E was candidate Ba1 gene controlling the blue aleurone trait in T. aestivum genotypes carrying Th. ponticum introgression. The ThMYC4E isolation aids in better understanding the genetic mechanisms of the blue aleurone trait and in its more effective use during wheat breeding.

  11. Insights into the evolutionary history of tubercle bacilli as disclosed by genetic rearrangements within a PE_PGRS duplicated gene pair

    Directory of Open Access Journals (Sweden)

    Kurepina Natalia

    2006-12-01

    Full Text Available Abstract Background The highly homologous PE_PGRS (Proline-glutamic acid_polymorphic GC-rich repetitive sequence genes are members of the PE multigene family which is found only in mycobacteria. PE genes are particularly abundant within the genomes of pathogenic mycobacteria where they seem to have expanded as a result of gene duplication events. PE_PGRS genes are characterized by their high GC content and extensive repetitive sequences, making them prone to recombination events and genetic variability. Results Comparative sequence analysis of Mycobacterium tuberculosis genes PE_PGRS17 (Rv0978c and PE_PGRS18 (Rv0980c revealed a striking genetic variation associated with this typical tandem duplicate. In comparison to the M. tuberculosis reference strain H37Rv, the variation (named the 12/40 polymorphism consists of an in-frame 12-bp insertion invariably accompanied by a set of 40 single nucleotide polymorphisms (SNPs that occurs either in PE_PGRS17 or in both genes. Sequence analysis of the paralogous genes in a representative set of worldwide distributed tubercle bacilli isolates revealed data which supported previously proposed evolutionary scenarios for the M. tuberculosis complex (MTBC and confirmed the very ancient origin of "M. canettii" and other smooth tubercle bacilli. Strikingly, the identified polymorphism appears to be coincident with the emergence of the post-bottleneck successful clone from which the MTBC expanded. Furthermore, the findings provide direct and clear evidence for the natural occurrence of gene conversion in mycobacteria, which appears to be restricted to modern M. tuberculosis strains. Conclusion This study provides a new perspective to explore the molecular events that accompanied the evolution, clonal expansion, and recent diversification of tubercle bacilli.

  12. Whole genome sequencing of field isolates reveals a common duplication of the Duffy binding protein gene in Malagasy Plasmodium vivax strains.

    Directory of Open Access Journals (Sweden)

    Didier Menard

    2013-11-01

    Full Text Available Plasmodium vivax is the most prevalent human malaria parasite, causing serious public health problems in malaria-endemic countries. Until recently the Duffy-negative blood group phenotype was considered to confer resistance to vivax malaria for most African ethnicities. We and others have reported that P. vivax strains in African countries from Madagascar to Mauritania display capacity to cause clinical vivax malaria in Duffy-negative people. New insights must now explain Duffy-independent P. vivax invasion of human erythrocytes.Through recent whole genome sequencing we obtained ≥ 70× coverage of the P. vivax genome from five field-isolates, resulting in ≥ 93% of the Sal I reference sequenced at coverage greater than 20×. Combined with sequences from one additional Malagasy field isolate and from five monkey-adapted strains, we describe here identification of DNA sequence rearrangements in the P. vivax genome, including discovery of a duplication of the P. vivax Duffy binding protein (PvDBP gene. A survey of Malagasy patients infected with P. vivax showed that the PvDBP duplication was present in numerous locations in Madagascar and found in over 50% of infected patients evaluated. Extended geographic surveys showed that the PvDBP duplication was detected frequently in vivax patients living in East Africa and in some residents of non-African P. vivax-endemic countries. Additionally, the PvDBP duplication was observed in travelers seeking treatment of vivax malaria upon returning home. PvDBP duplication prevalence was highest in west-central Madagascar sites where the highest frequencies of P. vivax-infected, Duffy-negative people were reported.The highly conserved nature of the sequence involved in the PvDBP duplication suggests that it has occurred in a recent evolutionary time frame. These data suggest that PvDBP, a merozoite surface protein involved in red cell adhesion is rapidly evolving, possibly in response to constraints imposed by

  13. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  14. Blue light-mediated transcriptional activation and repression of gene expression in bacteria

    Science.gov (United States)

    Jayaraman, Premkumar; Devarajan, Kavya; Chua, Tze Kwang; Zhang, Hanzhong; Gunawan, Erry; Poh, Chueh Loo

    2016-01-01

    Light-regulated modules offer unprecedented new ways to control cellular behavior in precise spatial and temporal resolution. The availability of such tools may dramatically accelerate the progression of synthetic biology applications. Nonetheless, current optogenetic toolbox of prokaryotes has potential issues such as lack of rapid and switchable control, less portable, low dynamic expression and limited parts. To address these shortcomings, we have engineered a novel bidirectional promoter system for Escherichia coli that can be induced or repressed rapidly and reversibly using the blue light dependent DNA-binding protein EL222. We demonstrated that by modulating the dosage of light pulses or intensity we could control the level of gene expression precisely. We show that both light-inducible and repressible system can function in parallel with high spatial precision in a single cell and can be switched stably between ON- and OFF-states by repetitive pulses of blue light. In addition, the light-inducible and repressible expression kinetics were quantitatively analysed using a mathematical model. We further apply the system, for the first time, to optogenetically synchronize two receiver cells performing different logic behaviors over time using blue light as a molecular clock signal. Overall, our modular approach layers a transformative platform for next-generation light-controllable synthetic biology systems in prokaryotes. PMID:27353329

  15. Biosynthetic gene clusters for relevant secondary metabolites produced by Penicillium roqueforti in blue cheeses.

    Science.gov (United States)

    García-Estrada, Carlos; Martín, Juan-Francisco

    2016-10-01

    Ripening of blue-veined cheeses, such as the French Bleu and Roquefort, the Italian Gorgonzola, the English Stilton, the Danish Danablu or the Spanish Cabrales, Picón Bejes-Tresviso, and Valdeón, requires the growth and enzymatic activity of the mold Penicillium roqueforti, which is responsible for the characteristic texture, blue-green spots, and aroma of these types of cheeses. This filamentous fungus is able to synthesize different secondary metabolites, including andrastins, mycophenolic acid, and several mycotoxins, such as roquefortines C and D, PR-toxin and eremofortins, isofumigaclavines A and B, and festuclavine. This review provides a detailed description of the main secondary metabolites produced by P. roqueforti in blue cheese, giving a special emphasis to roquefortine, PR-toxin and mycophenolic acid, and their biosynthetic gene clusters and pathways. The knowledge of these clusters and secondary metabolism pathways, together with the ability of P. roqueforti to produce beneficial secondary metabolites, is of interest for commercial purposes.

  16. An improved TIGER2 implementation for NAMD suitable for the Blue Gene architecture

    Science.gov (United States)

    Brown, Aaron H.; Walsh, Tiffany R.

    2015-07-01

    Here we present an improved implementation of the TIGER2 Replica Exchange Molecular Dynamics (REMD) method, using the replica exchange Application Programming Interface (API) found in contemporary versions of the NAMD Molecular Dynamics Package. The implementation takes the form of a TCL script which is used in conjunction with the standard configuration file. This implementation is validated against a previous TIGER2 implementation, as well as data reported for the original TIGER2 simulations. Our implementation is compatible with a range of architectures; crucially it enables the use of this wrapper with the BlueGene/Q architecture, in addition to the x86 architecture.

  17. Evaluating Zoltan for Static Load Balancing on BlueGene Architectures

    Energy Technology Data Exchange (ETDEWEB)

    Kumfert, G

    2007-11-15

    The purpose of this TechBase was to evaluate the Zoltan load-balancing library from Sandia National Laboratories as a possible replacement for ParMetis, which had been the load balancer of choice for nearly a decade but does not scale to the full 64,000 processors of BlueGene/L. This evaluation was successful in producing a clear result, but the result was unfortunately negative. Although Zoltan presents a collection load-balancing algorithms, none were able to meet or exceed the combined scalability and quality of ParMetis on representative datasets.

  18. High frequency of additional gene mutations in acute myeloid leukemia with MLL partial tandem duplication: DNMT3A mutation is associated with poor prognosis.

    Science.gov (United States)

    Kao, Hsiao-Wen; Liang, D Cherng; Kuo, Ming-Chung; Wu, Jin-Hou; Dunn, Po; Wang, Po-Nan; Lin, Tung-Liang; Shih, Yu-Shu; Liang, Sung-Tzu; Lin, Tung-Huei; Lai, Chen-Yu; Lin, Chun-Hui; Shih, Lee-Yung

    2015-10-20

    The mutational profiles of acute myeloid leukemia (AML) with partial tandem duplication of mixed-lineage leukemia gene (MLL-PTD) have not been comprehensively studied. We studied 19 gene mutations for 98 patients with MLL-PTD AML to determine the mutation frequency and clinical correlations. MLL-PTD was screened by reverse-transcriptase PCR and confirmed by real-time quantitative PCR. The mutational analyses were performed with PCR-based assays followed by direct sequencing. Gene mutations of signaling pathways occurred in 63.3% of patients, with FLT3-ITD (44.9%) and FLT3-TKD (13.3%) being the most frequent. 66% of patients had gene mutations involving epigenetic regulation, and DNMT3A (32.7%), IDH2 (18.4%), TET2 (18.4%), and IDH1 (10.2%) mutations were most common. Genes of transcription pathways and tumor suppressors accounted for 23.5% and 10.2% of patients. RUNX1 mutation occurred in 23.5% of patients, while none had NPM1 or double CEBPA mutation. 90.8% of MLL-PTD AML patients had at least one additional gene mutation. Of 55 MLL-PTD AML patients who received standard chemotherapy, age older than 50 years and DNMT3A mutation were associated with inferior outcome. In conclusion, gene mutations involving DNA methylation and activated signaling pathway were common co-existed gene mutations. DNMT3A mutation was a poor prognostic factor in MLL-PTD AML.

  19. C4BPAL1, a member of the human regulator of complement activation (RCA) gene cluster that resulted from the duplication of the gene coding for the [alpha]-chain of C4b-binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez-Corral, P.; Pardo-Manuel de Villena, F.; Rey-Campos, J.; Rodriguez de Cordoba, S. (Unidad de Immunologia, Madrid (Spain))

    1993-07-01

    The regulator of complement activation (RCA) gene cluster evolved by multiple gene duplications to produce a family of genes coding for proteins that collectively control the activation of the complement system. The authors report here the characterization of C4BPAL1, a member of the human RCA gene cluster that arose from the duplication of the C4BPA gene after the separation of rodent and primate lineages. C4BPAL1 maps 20 kb downstream of the C4BPA gene and is in the same 5[prime] to 3[prime] orientation found for all RCA genes characterized thus far. It includes nine exon-like regions homologous to exons 2-8, 11, and 12 of the C4BPA gene. Analysis of the C4BPAL1 sequence suggests that it is currently a pseudogene in humans. However, comparisons between C4BPAL1 and the human and murine C4BPA genes show sequence conservation, which strongly suggests that, for a long period of time, C4BPAL1 has been a functional gene coding for a protein with structural requirements similar to those of the [alpha]-chain of C4b-binding protein. 50 refs., 5 figs., 1 tab.

  20. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  1. Gene expression changes induced by the tumorigenic pyrrolizidine alkaloid riddelliine in liver of Big Blue rats

    Directory of Open Access Journals (Sweden)

    Fuscoe James C

    2007-11-01

    Full Text Available Abstract Background Pyrrolizidine alkaloids (PAs are probably the most common plant constituents that poison livestock, wildlife, and humans worldwide. Riddelliine is isolated from plants grown in the western United States and is a prototype of genotoxic PAs. Riddelliine was used to investigate the genotoxic effects of PAs via analysis of gene expression in the target tissue of rats in this study. Previously we observed that the mutant frequency in the liver of rats gavaged with riddelliine was 3-fold higher than that in the control group. Molecular analysis of the mutants indicated that there was a statistically significant difference between the mutational spectra from riddelliine-treated and control rats. Results Riddelliine-induced gene expression profiles in livers of Big Blue transgenic rats were determined. The female rats were gavaged with riddelliine at a dose of 1 mg/kg body weight 5 days a week for 12 weeks. Rat whole genome microarray was used to perform genome-wide gene expression studies. When a cutoff value of a two-fold change and a P-value less than 0.01 were used as gene selection criteria, 919 genes were identified as differentially expressed in riddelliine-treated rats compared to the control animals. By analysis with the Ingenuity Pathway Analysis Network, we found that these significantly changed genes were mainly involved in cancer, cell death, tissue development, cellular movement, tissue morphology, cell-to-cell signaling and interaction, and cellular growth and proliferation. We further analyzed the genes involved in metabolism, injury of endothelial cells, liver abnormalities, and cancer development in detail. Conclusion The alterations in gene expression were directly related to the pathological outcomes reported previously. These results provided further insight into the mechanisms involved in toxicity and carcinogenesis after exposure to riddelliine, and permitted us to investigate the interaction of gene products

  2. Gene expression changes induced by the tumorigenic pyrrolizidine alkaloid riddelliine in liver of Big Blue rats

    Science.gov (United States)

    Mei, Nan; Guo, Lei; Liu, Ruqing; Fuscoe, James C; Chen, Tao

    2007-01-01

    Background Pyrrolizidine alkaloids (PAs) are probably the most common plant constituents that poison livestock, wildlife, and humans worldwide. Riddelliine is isolated from plants grown in the western United States and is a prototype of genotoxic PAs. Riddelliine was used to investigate the genotoxic effects of PAs via analysis of gene expression in the target tissue of rats in this study. Previously we observed that the mutant frequency in the liver of rats gavaged with riddelliine was 3-fold higher than that in the control group. Molecular analysis of the mutants indicated that there was a statistically significant difference between the mutational spectra from riddelliine-treated and control rats. Results Riddelliine-induced gene expression profiles in livers of Big Blue transgenic rats were determined. The female rats were gavaged with riddelliine at a dose of 1 mg/kg body weight 5 days a week for 12 weeks. Rat whole genome microarray was used to perform genome-wide gene expression studies. When a cutoff value of a two-fold change and a P-value less than 0.01 were used as gene selection criteria, 919 genes were identified as differentially expressed in riddelliine-treated rats compared to the control animals. By analysis with the Ingenuity Pathway Analysis Network, we found that these significantly changed genes were mainly involved in cancer, cell death, tissue development, cellular movement, tissue morphology, cell-to-cell signaling and interaction, and cellular growth and proliferation. We further analyzed the genes involved in metabolism, injury of endothelial cells, liver abnormalities, and cancer development in detail. Conclusion The alterations in gene expression were directly related to the pathological outcomes reported previously. These results provided further insight into the mechanisms involved in toxicity and carcinogenesis after exposure to riddelliine, and permitted us to investigate the interaction of gene products inside the signaling networks

  3. The gene for death agonist BID maps to the region of human 22q11.2 duplicated in cat eye syndrome chromosomes and to mouse chromosome 6.

    Science.gov (United States)

    Footz, T K; Birren, B; Minoshima, S; Asakawa, S; Shimizu, N; Riazi, M A; McDermid, H E

    1998-08-01

    Cat eye syndrome (CES) is associated with a duplication of a segment of human chromosome 22q11.2. Only one gene, ATP6E, has been previously mapped to this duplicated region. We now report the mapping of the human homologue of the apoptotic agonist Bid to human chromosome 22 near locus D22S57 in the CES region. Dosage analysis demonstrated that BID is located just distal to the CES region critical for the majority of malformations associated with the syndrome (CESCR), as previously defined by a single patient with an unusual supernumerary chromosome. However, BID remains a good candidate for involvement in CES-related mental impairment, and its overexpression may subtly add to the phenotype of CES patients. Our mapping of murine Bid confirms that the synteny of the CESCR and the 22q11 deletion syndrome critical region immediately telomeric on human chromosome 22 is not conserved in mice. Bid and adjacent gene Atp6e were found to map to mousechromosome 6, while the region homologous to the DGSCR is known to map to mouse chromosome 16. Copyright 1998 Academic Press.

  4. Toward an ultra-high resolution community climate system model for the BlueGene platform

    International Nuclear Information System (INIS)

    Dennis, John M; Jacob, Robert; Vertenstein, Mariana; Craig, Tony; Loy, Raymond

    2007-01-01

    Global climate models need to simulate several small, regional-scale processes which affect the global circulation in order to accurately simulate the climate. This is particularly important in the ocean where small scale features such as oceanic eddies are currently represented with adhoc parameterizations. There is also a need for higher resolution to provide climate predictions at small, regional scales. New high-performance computing platforms such as the IBM BlueGene can provide the necessary computational power to perform ultra-high resolution climate model integrations. We have begun to investigate the scaling of the individual components of the Community Climate System Model to prepare it for integrations on BlueGene and similar platforms. Our investigations show that it is possible to successfully utilize O(32K) processors. We describe the scalability of five models: the Parallel Ocean Program (POP), the Community Ice CodE (CICE), the Community Land Model (CLM), and the new CCSM sequential coupler (CPL7) which are components of the next generation Community Climate System Model (CCSM); as well as the High-Order Method Modeling Environment (HOMME) which is a dynamical core currently being evaluated within the Community Atmospheric Model. For our studies we concentrate on 1/10 0 resolution for CICE, POP, and CLM models and 1/4 0 resolution for HOMME. The ability to simulate high resolutions on the massively parallel petascale systems that will dominate high-performance computing for the foreseeable future is essential to the advancement of climate science

  5. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  6. Increased copy number for methylated maternal 15q duplications leads to changes in gene and protein expression in human cortical samples

    Directory of Open Access Journals (Sweden)

    Scoles Haley A

    2011-12-01

    Full Text Available Abstract Background Duplication of chromosome 15q11-q13 (dup15q accounts for approximately 3% of autism cases. Chromosome 15q11-q13 contains imprinted genes necessary for normal mammalian neurodevelopment controlled by a differentially methylated imprinting center (imprinting center of the Prader-Willi locus, PWS-IC. Maternal dup15q occurs as both interstitial duplications and isodicentric chromosome 15. Overexpression of the maternally expressed gene UBE3A is predicted to be the primary cause of the autistic features associated with dup15q. Previous analysis of two postmortem dup15q frontal cortical samples showed heterogeneity between the two cases, with one showing levels of the GABAA receptor genes, UBE3A and SNRPN in a manner not predicted by copy number or parental imprint. Methods Postmortem human brain tissue (Brodmann area 19, extrastriate visual cortex was obtained from 8 dup15q, 10 idiopathic autism and 21 typical control tissue samples. Quantitative PCR was used to confirm duplication status. Quantitative RT-PCR and Western blot analyses were performed to measure 15q11-q13 transcript and protein levels, respectively. Methylation-sensitive high-resolution melting-curve analysis was performed on brain genomic DNA to identify the maternal:paternal ratio of methylation at PWS-IC. Results Dup15q brain samples showed a higher level of PWS-IC methylation than control or autism samples, indicating that dup15q was maternal in origin. UBE3A transcript and protein levels were significantly higher than control and autism in dup15q, as expected, although levels were variable and lower than expected based on copy number in some samples. In contrast, this increase in copy number did not result in consistently increased GABRB3 transcript or protein levels for dup15q samples. Furthermore, SNRPN was expected to be unchanged in expression in dup15q because it is expressed from the single unmethylated paternal allele, yet SNRPN levels were significantly

  7. The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Gabriel Forn-Cuní

    Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

  8. A Homozygous TPO Gene Duplication (c.1184_1187dup4) Causes Congenital Hypothyroidism in Three Siblings Born to a Consanguineous Family.

    Science.gov (United States)

    Cangul, Hakan; Aydin, Banu K; Bas, Firdevs

    2015-12-01

    Congenital hypothyroidism (CH) is the most common neonatal endocrine disease, and germ-line mutations in the TPO gene cause the inherited form of the disease. Our aim in this study was to determine the genetic basis of congenital hypothyroidism in three affected children coming from a consanguineous Turkish family. Because CH is usually inherited in autosomal recessive manner in consanguineous/multicase families, we adopted a two-stage strategy of genetic linkage studies and targeted sequencing of the candidate genes. First, we investigated the potential genetic linkage of the family to any known CH locus, using microsatellite markers, and then screened for mutations in linked-gene by conventional sequencing. The family showed potential linkage to the TPO gene and we detected a homozygous duplication (c.1184_1187dup4) in all cases. The mutation segregated with disease status in the family. This study confirms the pathogenicity of the c.1184_1187dup4 mutation in the TPO gene and helps establish a genotype/phenotype correlation associated with this mutation. It also highlights the importance of molecular genetic studies in the definitive diagnosis and accurate classification of CH.

  9. Middle ear microbiome differences in indigenous Filipinos with chronic otitis media due to a duplication in the A2ML1 gene.

    Science.gov (United States)

    Santos-Cortez, Regie Lyn P; Hutchinson, Diane S; Ajami, Nadim J; Reyes-Quintos, Ma Rina T; Tantoco, Ma Leah C; Labra, Patrick John; Lagrana, Sheryl Mae; Pedro, Melquiadesa; Llanes, Erasmo Gonzalo D V; Gloria-Cruz, Teresa Luisa; Chan, Abner L; Cutiongco-de la Paz, Eva Maria; Belmont, John W; Chonmaitree, Tasnee; Abes, Generoso T; Petrosino, Joseph F; Leal, Suzanne M; Chiong, Charlotte M

    2016-11-01

    Previously rare A2ML1 variants were identified to confer otitis media susceptibility in an indigenous Filipino community and in otitis-prone US children. The goal of this study is to describe differences in the middle ear microbiome between carriers and non-carriers of an A2ML1 duplication variant that increases risk for chronic otitis media among indigenous Filipinos with poor health care access. Ear swabs were obtained from 16 indigenous Filipino individuals with chronic otitis media, of whom 11 carry the A2ML1 duplication variant. Ear swabs were submitted for 16S rRNA gene sequencing. Genotype-based differences in microbial richness, structure, and composition were identified, but were not statistically significant. Taxonomic analysis revealed that the relative abundance of the phyla Fusobacteria and Bacteroidetes, and genus Fusobacterium were nominally increased in carriers compared to non-carriers, but were non-significant after correction for multiple testing. We also detected rare bacteria including Oligella that was reported only once in the middle ear. These findings suggest that A2ML1-related otitis media susceptibility may be mediated by changes in the middle ear microbiome. Knowledge of middle ear microbial profiles according to genetic background can be potentially useful for therapeutic and prophylactic interventions for otitis media and can guide public health interventions towards decreasing otitis media prevalence within the indigenous Filipino community.

  10. Comparison of neuronal spike exchange methods on a Blue Gene/P supercomputer

    Directory of Open Access Journals (Sweden)

    Michael eHines

    2011-11-01

    Full Text Available The performance of several spike exchange methods using a Blue Gene/P supercomputerhas been tested with 8K to 128K cores using randomly connected networks of up to 32M cells with 1k connections per cell and 4M cells with 10k connections per cell. The spike exchange methods used are the standard Message Passing Interface collective, MPI_Allgather, and several variants of the non-blocking multisend method either implemented via non-blocking MPI_Isend, or exploiting the possibility of very low overhead direct memory access communication available on the Blue Gene/P. In all cases the worst performing method was that using MPI_Isend due to the high overhead of initiating a spike communication. The two best performing methods --- the persistent multisend method using the Record-Replay feature of the Deep Computing Messaging Framework DCMF_Multicast;and a two phase multisend in which a DCMF_Multicast is used to first send to a subset of phase 1 destination cores which then pass it on to their subset of phase 2 destination cores --- had similar performance with very low overhead for the initiation of spike communication. Departure from ideal scaling for the multisend methods is almost completely due to load imbalance caused by the largevariation in number of cells that fire on each processor in the interval between synchronization. Spike exchange time itself is negligible since transmission overlaps with computation and is handled by a direct memory access controller. We conclude that ideal performance scaling will be ultimately limited by imbalance between incoming processor spikes between synchronization intervals. Thus, counterintuitively, maximization of load balance requires that the distribution of cells on processors should not reflect neural net architecture but be randomly distributed so that sets of cells which are burst firing together should be on different processors with their targets on as large a set of processors as possible.

  11. Isolation of botulinolysin, a thiol-activated hemolysin, from serotype D Clostridium botulinum: A species-specific gene duplication in Clostridia.

    Science.gov (United States)

    Suzuki, Tomonori; Nagano, Thomas; Niwa, Koichi; Mutoh, Shingo; Uchino, Masataka; Tomizawa, Motohiro; Sagane, Yoshimasa; Watanabe, Toshihiro

    2016-12-01

    Botulinolysin (BLY) is a toxin produced by Clostridium botulinum that belongs to a group of thiol-activated hemolysins. In this study, a protein exhibiting hemolytic activity was purified from the culture supernatant of C. botulinum serotype D strain 4947. The purified protein displayed a single band by sodium dodecyl sulfate polyacrylamide gel electrophoresis with a molecular mass of 55kDa, and its N-terminal and internal amino acid sequences exhibited high similarity to a group of thiol-activated hemolysins produced by gram-positive bacteria. Thus, the purified protein was identified as the BLY. Using the nucleotide sequences of previously cloned genes for hemolysins, two types of genes encoding BLY-like proteins were cloned unexpectedly. Molecular modeling analysis indicated that the products of both genes displayed very similar structures, despite the low sequence similarity. In silico screening revealed a specific duplication of the hemolysin gene restricted to serotypes C and D of C. botulinum and their related species among thiol-activated hemolysin-producing bacteria. Our findings provide important insights into the genetic characteristics of pathogenic bacteria. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    1981-01-01

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  13. Duplication of the scapula

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez Alegre, Maria Luisa [Department of Diagnostic Imaging, Nino Jesus University Children' s Hospital, 65 Menendez Pelayo Avenue, 28009, Madrid (Spain); C/Ventura Rodrigues 6, Portal 7-4A, Boadilla del Monte, 28660, Madrid (Spain); Marin, Carlos; Mardones, Gloria G. [Department of Diagnostic Imaging, Nino Jesus University Children' s Hospital, 65 Menendez Pelayo Avenue, 28009, Madrid (Spain)

    2003-12-01

    Only three cases of scapular duplication have been described in English in the literature. We report a case of a child with duplication of the right scapula, operated on at our center with good results. (orig.)

  14. Diagnosing Smith-Magenis syndrome and duplication 17p11.2 syndrome by RAI1 gene copy number variation using quantitative real-time PCR.

    Science.gov (United States)

    Truong, Hoa T; Solaymani-Kohal, Sara; Baker, Kevin R; Girirajan, Santhosh; Williams, Stephen R; Vlangos, Christopher N; Smith, Ann C M; Bunyan, David J; Roffey, Paul E; Blanchard, Christopher L; Elsea, Sarah H

    2008-03-01

    Smith-Magenis syndrome (SMS) and duplication 17p11.2 (dup17p11.2) syndrome are multiple congenital anomalies/mental retardation disorders resulting from either a deletion or duplication of the 17p11.2 region, respectively. The retinoic acid induced 1 (RAI1) gene is the causative gene for SMS and is included in the 17p11.2 region of dup17p11.2 syndrome. Currently SMS and dup17p11.2 syndrome are diagnosed using a combination of clinically recognized phenotypes and molecular cytogenetic analyses such as fluorescent in situ hybridization (FISH). However, these methods have proven to be highly expensive, time consuming, and dependent upon the low resolving capabilities of the assay. To address the need for improved diagnostic methods for SMS and dup17p11.2 syndrome, we designed a quantitative real-time PCR (Q-PCR) assay that measures RAI1 copy number using the comparative C(t) method, DeltaDeltaC(t). We tested our assay with samples blinded to their previous SMS or dup17p11.2 syndrome status. In all cases, we were able to determine RAI1 copy number status and render a correct diagnosis accordingly. We validated these results by both FISH and multiplex ligation-dependent probe amplification (MLPA). We conclude that Q-PCR is an accurate, reproducible, low-cost, and reliable assay that can be employed for routine use in SMS and dup17p11.2 diagnosis.

  15. Genetic diversity of MHC class I loci in six non-model frogs is shaped by positive selection and gene duplication

    Science.gov (United States)

    Kiemnec-Tyburczy, K M; Richmond, J Q; Savage, A E; Lips, K R; Zamudio, K R

    2012-01-01

    Comparative studies of major histocompatibility complex (MHC) genes across vertebrate species can reveal the evolutionary processes that shape the structure and function of immune regulatory proteins. In this study, we characterized MHC class I sequences from six frog species representing three anuran families (Hylidae, Centrolenidae and Ranidae). Using cDNA from our focal species, we amplified a total of 79 unique sequences spanning exons 2–4 that encode the extracellular domains of the functional alpha chain protein. We compared intra- and interspecific nucleotide and amino-acid divergence, tested for recombination, and identified codon sites under selection by estimating the rate of non-synonymous to synonymous substitutions with multiple codon-based maximum likelihood methods. We determined that positive (diversifying) selection was acting on specific amino-acid sites located within the domains that bind pathogen-derived peptides. We also found significant signals of recombination across the physical distance of the genes. Finally, we determined that all the six species expressed two or three putative classical class I loci, in contrast to the single locus condition of Xenopus laevis. Our results suggest that MHC evolution in anurans is a dynamic process and that variation in numbers of loci and genetic diversity can exist among taxa. Thus, the accumulation of genetic data for more species will be useful in further characterizing the relative importance of processes such as selection, recombination and gene duplication in shaping MHC loci among amphibian lineages. PMID:22549517

  16. Elevated Immune Gene Expression Is Associated with Poor Reproductive Success of Urban Blue Tits

    Directory of Open Access Journals (Sweden)

    Pablo Capilla-Lasheras

    2017-06-01

    Full Text Available Urban and forest habitats differ in many aspects that can lead to modifications of the immune system of wild animals. Altered parasite communities, pollution, and artificial light at night in cities have been associated with exacerbated inflammatory responses, with possibly negative fitness consequences, but few data are available from free-living animals. Here, we investigate how urbanization affects major immune pathways and experimentally test potentially contributing factors in blue tits (Cyanistes caeruleus from an urban and forest site. We first compared breeding adults by quantifying the mRNA transcript levels of proteins associated with anti-bacterial, anti-malarial (TLR4, LY86 and anti-helminthic (Type 2 transcription factor GATA3 immune responses. Adult urban and forest blue tits differed in gene expression, with significantly increased TLR4 and GATA3, but not LY86, in the city. We then experimentally tested whether these differences were environmentally induced by cross-fostering eggs between the sites and measuring mRNA transcripts in nestlings. The populations differed in reduced reproductive success, with a lower fledging success and lower fledgling weight recorded at the urban site. This mirrors the findings of our twin study reporting that the urban site was severely resource limited when compared to the forest. Because of low urban survival, robust gene expression data were only obtained from nestlings reared in the forest. Transcript levels in these nestlings showed no (TLR4, LY86, or weak (GATA3, differences according to their origin from forest or city nests, suggesting little genetic or maternal contribution to nestling immune transcript levels. Lastly, to investigate differences in parasite pressure between urban and forest sites, we measured the prevalence of malaria in adult and nestling blood. Prevalence was invariably high across environments and not associated with the transcript levels of the studied immune genes. Our

  17. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... condition (subjects n = 12). Patients with MECP2 gain-of-function mutations showed increased oxidative stress marker levels (plasma non-protein bound iron, intraerythrocyte non-protein bound iron, F2-isoprostanes, and F4-neuroprostanes), as compared to healthy controls (P ≤ 0.05). Such increases were...

  18. A large duplication in the gene for lysyl hydroxylase accounts for the type VI variant of Ehlers-Danlos syndrome in two siblings

    Energy Technology Data Exchange (ETDEWEB)

    Hautala, T.; Heikkinen, J.; Kivirikko, K.I.; Myllylae, R. (Univ. of Oulu (Finland))

    1993-02-01

    Ehlers-Danlos syndrome is a deterogeneous disorder characterized by joint hypermobility, skin hyperextensibility, fragility, and other sign of connective tissue involvement. In addition to these, the type VI variant of the disease has some special characteristics such as kyphoscoliosis and ocular abnormalities. The biochemical abnormality in most patients with this autosomal recessively inherited type IV variant is a deficiency in the activity of lysyl hydroxylase (EC 1.14,11.4), the enzyme catalyzing the formation of hydroxylysine in collagens and other proteins with collagen-like amino acid sequences. The type VI variant of Ehlers-Danlos syndrome was first identified in two sisters with a reduced amount of lysyl hydroxylase activity in their skin fibroblasts (S.R. Pinnell, S.M. Krane, J.E. Kenzora, and M.J. Glimcher (1972) N. Engl. J. Med. 286; 1013-1020). Our recent molecular cloning of lysyl hydroxylase has now made it possible to study the mutations leading to the deficiency in lysyl dydroxylase activity in these cells. Our data indicate that the mRNA for lysyl hydroxylase produced in the affected cells is about 4 kb in size, whereas it is 3.2 kb in the control cells. The sequencing of the cDNA for lysyl hydroxylase from the affected cells revealed an apparently homozygous duplication rearrangement of nucleotides 1176 to 1955, corresponding to amino acids 326 to 585 in the normal sequence. From Southern blotting data, the duplicated area in the gene equals about 6-9 kb and corresponds to seven exons. 35 refs., 4 figs.

  19. Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

    NARCIS (Netherlands)

    A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

    1996-01-01

    textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

  20. Carboxylesterase 1 gene duplication and mRNA expression in adipose tissue are linked to obesity and metabolic function

    DEFF Research Database (Denmark)

    Friedrichsen, Martin; Poulsen, Pernille; Wojtaszewski, Jørgen

    2013-01-01

    involved in the control of mRNA expression. Here, we investigated mRNA expression level in adipose tissue and its association with measures of adiposity and metabolic function in a population of elderly twins. Furthermore, the heritability of mRNA expression level in adipose tissue and the effect of gene...

  1. Manipulating duckweed through genome duplication.

    Science.gov (United States)

    Vunsh, R; Heinig, U; Malitsky, S; Aharoni, A; Avidov, A; Lerner, A; Edelman, M

    2015-01-01

    Significant inter- and intraspecific genetic variation exists in duckweed, thus the potential for genome plasticity and manipulation is high. Polyploidy is recognised as a major mechanism of adaptation and speciation in plants. We produced several genome-duplicated lines of Landoltia punctata (Spirodela oligorrhiza) from both whole plants and regenerating explants using a colchicine-based cocktail. These lines stably maintained an enlarged frond and root morphology. DNA ploidy levels determined by florescence-activated cell sorting indicated genome duplication. Line A4 was analysed after 75 biomass doublings. Frond area, fresh and dry weights, rhizoid number and length were significantly increased versus wild type, while the growth rate was unchanged. This resulted in accumulation of biomass 17-20% faster in the A4 plants. We sought to determine if specific differences in gene products are found in the genome duplicated lines. Non-targeted ultra performance LC-quadrupole time of flight mass spectrometry was employed to compare some of the lines and the wild type to seek identification of up-regulated metabolites. We putatively identified differential metabolites in Line A65 as caffeoyl hexoses. The combination of directed genome duplication and metabolic profiling might offer a path for producing stable gene expression, leading to altered production of secondary metabolites. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  2. Genes expressed in Blue Fin Tuna (Thunnus thynnus) liver and gonads.

    Science.gov (United States)

    Chini, Valentina; Cattaneo, Anna Giulia; Rossi, Federica; Bernardini, Giovanni; Terova, Genciana; Saroglia, Marco; Gornati, Rosalba

    2008-02-29

    Blue Fin Tuna (BFT), Thunnus thynnus, has been seriously endangered by global massive overfishing and by the pollution of marine environment. Feeding and fattening of caught tuna in marine cages is a recent resource, but the development of a self-sustained aquaculture activity, being independent from the supply of wild fish, is required from both industrial and conservation perspectives. At this scope, several technical problems have to be solved and the control of reproduction is the cardinal one. Beside the technological developments of farming facilities and protocols, a molecular approach seems promising for the studies of appropriate nutritional strategies, reproduction physiology and animal welfare, as well as lifestyle and response to endocrine disruptor pollutants. In this context, we have started an EST project on this species sequencing 2743, 2907, and 3014 clones from expression libraries of ovary, testis and liver, respectively, and 1499 clones from an ovary normalized library. Thanks to this project, we have identified several sequences with known function in other organisms, but not previously described in this species. Among the new genes, 712 were found only in the expression library of the ovary, 613 in that of the testis and 318 in that of the liver, while 324 additional genes were shared by two or more expression libraries; other 127 genes not found in the expression libraries were obtained from the ovary normalized library. This represents a contribution to the knowledge of the molecular basis of BFT and a necessary step for facilitating further molecular studies on this species. Accession numbers: EC 091633 to EC 093160; EG 629962 to EG 631176; EC 917676 to EC 919417; EG 999340 to EG 999999; EH 000001 to EH 000505; EH 667253 to EH 668984; EL 610526 to EL 611807; EC 42144 to EC 422414; and EH 379568 to EH 380065.

  3. Short stature homeobox-containing gene duplications in 3.7% of girls with tall stature and normal karyotypes

    DEFF Research Database (Denmark)

    Upners, Emmie N; Jensen, Rikke B; Rajpert-De Meyts, Ewa

    2017-01-01

    AIM: The short stature homeobox containing gene (SHOX) plays an important role in short stature, but has not been explored in detail in a tall stature population before. This study explored the prevalence of SHOX aberrations in girls diagnosed with idiopathic tall stature with a normal karyotype...... in three girls with tall stature and normal karyotypes. This article is protected by copyright. All rights reserved....

  4. Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA.

    Science.gov (United States)

    Oleastro, Monica; Cordeiro, Rita; Yamaoka, Yoshio; Queiroz, Dulciene; Mégraud, Francis; Monteiro, Lurdes; Ménard, Armelle

    2009-06-22

    homB encodes a Helicobacter pylori outer membrane protein. This gene was previously associated with peptic ulcer disease (PUD) and was shown to induce activation of interleukin-8 secretion in vitro, as well as contributing to bacterial adherence. Its 90%-similar gene, homA, was previously correlated with gastritis. The present study aimed to evaluate the gastric disease association with homB and homA, as well as with the H. pylori virulence factors cagA, babA and vacA, in 415 H. pylori strains isolated from patients from East Asian and Western countries. The correlation among these genotypes was also evaluated. Both homB and homA genes were heterogeneously distributed worldwide, with a marked difference between East Asian and Western strains. In Western strains (n = 234, 124 PUD and 110 non-ulcer dyspepsia (NUD), homB, cagA and vacA s1 were all significantly associated with PUD (p = 0.025, p = 0.014, p = 0.039, respectively), and homA was closely correlated with NUD (p = 0.072). In East Asian strains (n = 138, 73 PUD and 65 NUD), homB was found more frequently than homA, and none of these genes was associated with the clinical outcome. Overall, homB was associated with the presence of cagA (p = 0.043) and vacA s1 (p homA was found more frequently in cagA-negative (p = 0.062) and vacA s2 (p homA copy number were observed, with a clear geographical specificity, suggesting an involvement of these genes in host adaptation. A correlation between the homB two-copy genotype and PUD was also observed, emphasizing the role of homB in the virulence of the strain. The global results suggest that homB and homA contribute to the determination of clinical outcome.

  5. Startling mosaicism of the Y-chromosome and tandem duplication of the SRY and DAZ genes in patients with Turner Syndrome.

    Directory of Open Access Journals (Sweden)

    Sanjay Premi

    Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.

  6. Duplicated Gephyrin Genes Showing Distinct Tissue Distribution and Alternative Splicing Patterns Mediate Molybdenum Cofactor Biosynthesis, Glycine Receptor Clustering, and Escape Behavior in Zebrafish*

    Science.gov (United States)

    Ogino, Kazutoyo; Ramsden, Sarah L.; Keib, Natalie; Schwarz, Günter; Harvey, Robert J.; Hirata, Hiromi

    2011-01-01

    Gephyrin mediates the postsynaptic clustering of glycine receptors (GlyRs) and GABAA receptors at inhibitory synapses and molybdenum-dependent enzyme (molybdoenzyme) activity in non-neuronal tissues. Gephyrin knock-out mice show a phenotype resembling both defective glycinergic transmission and molybdenum cofactor (Moco) deficiency and die within 1 day of birth due to starvation and dyspnea resulting from deficits in motor and respiratory networks, respectively. To address whether gephyrin function is conserved among vertebrates and whether gephyrin deficiency affects molybdoenzyme activity and motor development, we cloned and characterized zebrafish gephyrin genes. We report here that zebrafish have two gephyrin genes, gphna and gphnb. The former is expressed in all tissues and has both C3 and C4 cassette exons, and the latter is expressed predominantly in the brain and spinal cord and harbors only C4 cassette exons. We confirmed that all of the gphna and gphnb splicing isoforms have Moco synthetic activity. Antisense morpholino knockdown of either gphna or gphnb alone did not disturb synaptic clusters of GlyRs in the spinal cord and did not affect touch-evoked escape behaviors. However, on knockdown of both gphna and gphnb, embryos showed impairments in GlyR clustering in the spinal cord and, as a consequence, demonstrated touch-evoked startle response behavior by contracting antagonistic muscles simultaneously, instead of displaying early coiling and late swimming behaviors, which are executed by side-to-side muscle contractions. These data indicate that duplicated gephyrin genes mediate Moco biosynthesis and control postsynaptic clustering of GlyRs, thereby mediating key escape behaviors in zebrafish. PMID:20843816

  7. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li

    2017-04-01

    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  8. Gene duplication and genetic exchange drive the evolution of S-RNase-based self-incompatibility in Petunia.

    Science.gov (United States)

    Kubo, Ken-Ichi; Paape, Timothy; Hatakeyama, Masaomi; Entani, Tetsuyuki; Takara, Akie; Kajihara, Kie; Tsukahara, Mai; Shimizu-Inatsugi, Rie; Shimizu, Kentaro K; Takayama, Seiji

    2015-01-08

    Self-incompatibility (SI) systems in flowering plants distinguish self- and non-self pollen to prevent inbreeding. While other SI systems rely on the self-recognition between specific male- and female-determinants, the Solanaceae family has a non-self recognition system resulting in the detoxification of female-determinants of S-ribonucleases (S-RNases), expressed in pistils, by multiple male-determinants of S-locus F-box proteins (SLFs), expressed in pollen. It is not known how many SLF components of this non-self recognition system there are in Solanaceae species, or how they evolved. We identified 16-20 SLFs in each S-haplotype in SI Petunia, from a total of 168 SLF sequences using large-scale next-generation sequencing and genomic polymerase chain reaction (PCR) techniques. We predicted the target S-RNases of SLFs by assuming that a particular S-allele must not have a conserved SLF that recognizes its own S-RNase, and validated these predictions by transformation experiments. A simple mathematical model confirmed that 16-20 SLF sequences would be adequate to recognize the vast majority of target S-RNases. We found evidence of gene conversion events, which we suggest are essential to the constitution of a non-self recognition system and also contribute to self-compatible mutations.

  9. Dynamic Blue Light-Inducible T7 RNA Polymerases (Opto-T7RNAPs) for Precise Spatiotemporal Gene Expression Control.

    Science.gov (United States)

    Baumschlager, Armin; Aoki, Stephanie K; Khammash, Mustafa

    2017-11-17

    Light has emerged as a control input for biological systems due to its precise spatiotemporal resolution. The limited toolset for light control in bacteria motivated us to develop a light-inducible transcription system that is independent from cellular regulation through the use of an orthogonal RNA polymerase. Here, we present our engineered blue light-responsive T7 RNA polymerases (Opto-T7RNAPs) that show properties such as low leakiness of gene expression in the dark state, high expression strength when induced with blue light, and an inducible range of more than 300-fold. Following optimization of the system to reduce expression variability, we created a variant that returns to the inactive dark state within minutes once the blue light is turned off. This allows for precise dynamic control of gene expression, which is a key aspect for most applications using optogenetic regulation. The regulators, which only require blue light from ordinary light-emitting diodes for induction, were developed and tested in the bacterium Escherichia coli, which is a crucial cell factory for biotechnology due to its fast and inexpensive cultivation and well understood physiology and genetics. Opto-T7RNAP, with minor alterations, should be extendable to other bacterial species as well as eukaryotes such as mammalian cells and yeast in which the T7 RNA polymerase and the light-inducible Vivid regulator have been shown to be functional. We anticipate that our approach will expand the applicability of using light as an inducer for gene expression independent from cellular regulation and allow for a more reliable dynamic control of synthetic and natural gene networks.

  10. The ERI-6/7 Helicase Acts at the First Stage of an siRNA Amplification Pathway That Targets Recent Gene Duplications

    Science.gov (United States)

    Fischer, Sylvia E. J.; Montgomery, Taiowa A.; Zhang, Chi; Fahlgren, Noah; Breen, Peter C.; Hwang, Alexia; Sullivan, Christopher M.; Carrington, James C.; Ruvkun, Gary

    2011-01-01

    Endogenous small interfering RNAs (siRNAs) are a class of naturally occuring regulatory RNAs found in fungi, plants, and animals. Some endogenous siRNAs are required to silence transposons or function in chromosome segregation; however, the specific roles of most endogenous siRNAs are unclear. The helicase gene eri-6/7 was identified in the nematode Caenorhabditis elegans by the enhanced response to exogenous double-stranded RNAs (dsRNAs) of the null mutant. eri-6/7 encodes a helicase homologous to small RNA factors Armitage in Drosophila, SDE3 in Arabidopsis, and Mov10 in humans. Here we show that eri-6/7 mutations cause the loss of 26-nucleotide (nt) endogenous siRNAs derived from genes and pseudogenes in oocytes and embryos, as well as deficiencies in somatic 22-nucleotide secondary siRNAs corresponding to the same loci. About 80 genes are eri-6/7 targets that generate the embryonic endogenous siRNAs that silence the corresponding mRNAs. These 80 genes share extensive nucleotide sequence homology and are poorly conserved, suggesting a role for these endogenous siRNAs in silencing of and thereby directing the fate of recently acquired, duplicated genes. Unlike most endogenous siRNAs in C. elegans, eri-6/7–dependent siRNAs require Dicer. We identify that the eri-6/7–dependent siRNAs have a passenger strand that is ∼19 nt and is inset by ∼3–4 nts from both ends of the 26 nt guide siRNA, suggesting non-canonical Dicer processing. Mutations in the Argonaute ERGO-1, which associates with eri-6/7–dependent 26 nt siRNAs, cause passenger strand stabilization, indicating that ERGO-1 is required to separate the siRNA duplex, presumably through endonucleolytic cleavage of the passenger strand. Thus, like several other siRNA–associated Argonautes with a conserved RNaseH motif, ERGO-1 appears to be required for siRNA maturation. PMID:22102828

  11. The ERI-6/7 helicase acts at the first stage of an siRNA amplification pathway that targets recent gene duplications.

    Directory of Open Access Journals (Sweden)

    Sylvia E J Fischer

    2011-11-01

    Full Text Available Endogenous small interfering RNAs (siRNAs are a class of naturally occuring regulatory RNAs found in fungi, plants, and animals. Some endogenous siRNAs are required to silence transposons or function in chromosome segregation; however, the specific roles of most endogenous siRNAs are unclear. The helicase gene eri-6/7 was identified in the nematode Caenorhabditis elegans by the enhanced response to exogenous double-stranded RNAs (dsRNAs of the null mutant. eri-6/7 encodes a helicase homologous to small RNA factors Armitage in Drosophila, SDE3 in Arabidopsis, and Mov10 in humans. Here we show that eri-6/7 mutations cause the loss of 26-nucleotide (nt endogenous siRNAs derived from genes and pseudogenes in oocytes and embryos, as well as deficiencies in somatic 22-nucleotide secondary siRNAs corresponding to the same loci. About 80 genes are eri-6/7 targets that generate the embryonic endogenous siRNAs that silence the corresponding mRNAs. These 80 genes share extensive nucleotide sequence homology and are poorly conserved, suggesting a role for these endogenous siRNAs in silencing of and thereby directing the fate of recently acquired, duplicated genes. Unlike most endogenous siRNAs in C. elegans, eri-6/7-dependent siRNAs require Dicer. We identify that the eri-6/7-dependent siRNAs have a passenger strand that is ∼19 nt and is inset by ∼3-4 nts from both ends of the 26 nt guide siRNA, suggesting non-canonical Dicer processing. Mutations in the Argonaute ERGO-1, which associates with eri-6/7-dependent 26 nt siRNAs, cause passenger strand stabilization, indicating that ERGO-1 is required to separate the siRNA duplex, presumably through endonucleolytic cleavage of the passenger strand. Thus, like several other siRNA-associated Argonautes with a conserved RNaseH motif, ERGO-1 appears to be required for siRNA maturation.

  12. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  13. [Duplication of the scapula].

    Science.gov (United States)

    Martini, A K; Neusel, E

    1986-09-01

    Complete duplication of the shoulder blade has not been described so far in the literature. Two case reports with a duplication of the right shoulder blade in multiple malformations of the locomotor and postural apparatus are presented. In both children, the shoulder blades were mobilized and fused. The late examination shows good functional and cosmetic results.

  14. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  15. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  16. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template [v1; ref status: indexed, http://f1000r.es/48i

    Directory of Open Access Journals (Sweden)

    Hossein Gouran

    2014-09-01

    Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  17. Reporter system for the detection of in vivo gene conversion: changing colors from blue to green using GFP variants.

    Science.gov (United States)

    Sommer, Jeffrey R; Alderson, Jon; Laible, Goetz; Petters, Robert M

    2006-06-01

    We have devised a system for the study of in vivo gene correction based on the detection of color variants of the green fluorescent protein (GFP) from the jellyfish Aequorea victoria. The intensity and spectra of the fluorescence emitted by the blue (BFP) and red-shifted (EGFP) variants of GFP differ from each other. We modified one nucleotide from an EGFP expression vector that we predicted would yield a blue variant (TAC-CAC, Tyr(66)-His(66)). Cells that were either transiently or stably transfected with the reporter system were used to test the functionality and feasibility of the detection of in vivo gene correction. A thio-protected single-stranded oligonucleotide designed to convert the genotype of the blue variant to that of the EGFP variant by the correction of a single base pair was delivered to the reporter cells using a variety of methodologies and strategies.Conversion events were easily observed using fluorescent microscopy because of the enhanced emission intensity and different spectra of the EGFP variant.

  18. Identification of duplicated and stress-inducible Aox2b gene co-expressed with Aox1 in species of the Medicago genus reveals a regulation linked to gene rearrangement in leguminous genomes.

    Science.gov (United States)

    Cavalcanti, João Henrique Frota; Oliveira, Georgia Mesquita; Saraiva, Kátia Daniella da Cruz; Torquato, José Pedro Pires; Maia, Ivan G; de Melo, Dirce Fernandes; Costa, José Hélio

    2013-12-15

    In flowering plants, alternative oxidase (Aox) is encoded by 3-5 genes distributed in 2 subfamilies (Aox1 and Aox2). In several species only Aox1 is reported as a stress-responsive gene, but in the leguminous Vigna unguiculata Aox2b is also induced by stress. In this work we investigated the Aox genes from two leguminous species of the Medicago genus (Medicago sativa and Medicago truncatula) which present one Aox1, one Aox2a and an Aox2b duplication (named here Aox2b1 and Aox2b2). Expression analyses by semi-quantitative RT-PCR in M. sativa revealed that Aox1, Aox2b1 and Aox2b2 transcripts increased during seed germination. Similar analyses in leaves and roots under different treatments (SA, PEG, H2O2 and cysteine) revealed that these genes are also induced by stress, but with peculiar spatio-temporal differences. Aox1 and Aox2b1 showed basal levels of expression under control conditions and were induced by stress in leaves and roots. Aox2b2 presented a dual behavior, i.e., it was expressed only under stress conditions in leaves, and showed basal expression levels in roots that were induced by stress. Moreover, Aox2a was expressed at higher levels in leaves and during seed germination than in roots and appeared to be not responsive to stress. The Aox expression profiles obtained from a M. truncatula microarray dataset also revealed a stress-induced co-expression of Aox1, Aox2b1 and Aox2b2 in leaves and roots. These results reinforce the stress-inducible co-expression of Aox1/Aox2b in some leguminous plants. Comparative genomic analysis indicates that this regulation is linked to Aox1/Aox2b proximity in the genome as a result of the gene rearrangement that occurred in some leguminous plants during evolution. The differential expression of Aox2b1/2b2 suggests that a second gene has been originated by recent gene duplication with neofunctionalization. Copyright © 2013 Elsevier GmbH. All rights reserved.

  19. Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-01-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

  20. Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages.

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-11-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

  1. Characterization of indigoidine biosynthetic genes in Erwinia chrysanthemi and role of this blue pigment in pathogenicity.

    Science.gov (United States)

    Reverchon, Sylvie; Rouanet, Carine; Expert, Dominique; Nasser, William

    2002-02-01

    In the plant-pathogenic bacterium Erwinia chrysanthemi production of pectate lyases, the main virulence determinant, is modulated by a complex network involving several regulatory proteins. One of these regulators, PecS, also controls the synthesis of a blue pigment identified as indigoidine. Since production of this pigment is cryptic in the wild-type strain, E. chrysanthemi ind mutants deficient in indigoidine synthesis were isolated by screening a library of Tn5-B21 insertions in a pecS mutant. These ind mutations were localized close to the regulatory pecS-pecM locus, immediately downstream of pecM. Sequence analysis of this DNA region revealed three open reading frames, indA, indB, and indC, involved in indigoidine biosynthesis. No specific function could be assigned to IndA. In contrast, IndB displays similarity to various phosphatases involved in antibiotic synthesis and IndC reveals significant homology with many nonribosomal peptide synthetases (NRPS). The IndC product contains an adenylation domain showing the signature sequence DAWCFGLI for glutamine recognition and an oxidation domain similar to that found in various thiazole-forming NRPS. These data suggest that glutamine is the precursor of indigoidine. We assume that indigoidine results from the condensation of two glutamine molecules that have been previously cyclized by intramolecular amide bond formation and then dehydrogenated. Expression of ind genes is strongly derepressed in the pecS background, indicating that PecS is the main regulator of this secondary metabolite synthesis. DNA band shift assays support a model whereby the PecS protein represses indA and indC expression by binding to indA and indC promoter regions. The regulatory link, via pecS, between indigoidine and virulence factor production led us to explore a potential role of indigoidine in E. chrysanthemi pathogenicity. Mutants impaired in indigoidine production were unable to cause systemic invasion of potted Saintpaulia ionantha

  2. Partial Duplication of Chromosome 8p

    African Journals Online (AJOL)

    rme

    duplication.13,23-29. A number of authors suggested that a candidate gene/or a cluster of genes located in 8p23 region behaves as a dominant mutation that .... Partial trisomy of short arm of chromosome 8 (46,XY, inv dup (8) (p21- ->pter) in a Bedouin child with multiple congenital anomalies and mental retardation.

  3. Genome Duplication in Soybean (Glycine Subgenus Soja)

    Science.gov (United States)

    Shoemaker, R. C.; Polzin, K.; Labate, J.; Specht, J.; Brummer, E. C.; Olson, T.; Young, N.; Concibido, V.; Wilcox, J.; Tamulonis, J. P.; Kochert, G.; Boerma, H. R.

    1996-01-01

    Restriction fragment length polymorphism mapping data from nine populations (Glycine max X G. soja and G. max X G. max) of the Glycine subgenus soja genome led to the identification of many duplicated segments of the genome. Linkage groups contained up to 33 markers that were duplicated on other linkage groups. The size of homoeologous regions ranged from 1.5 to 106.4 cM, with an average size of 45.3 cM. We observed segments in the soybean genome that were present in as many as six copies with an average of 2.55 duplications per segment. The presence of nested duplications suggests that at least one of the original genomes may have undergone an additional round of tetraploidization. Tetraploidization, along with large internal duplications, accounts for the highly duplicated nature of the genome of the subgenus. Quantitative trait loci for seed protein and oil showed correspondence across homoeologous regions, suggesting that the genes or gene families contributing to seed composition have retained similar functions throughout the evolution of the chromosomes. PMID:8878696

  4. Brain evolution by brain pathway duplication.

    Science.gov (United States)

    Chakraborty, Mukta; Jarvis, Erich D

    2015-12-19

    Understanding the mechanisms of evolution of brain pathways for complex behaviours is still in its infancy. Making further advances requires a deeper understanding of brain homologies, novelties and analogies. It also requires an understanding of how adaptive genetic modifications lead to restructuring of the brain. Recent advances in genomic and molecular biology techniques applied to brain research have provided exciting insights into how complex behaviours are shaped by selection of novel brain pathways and functions of the nervous system. Here, we review and further develop some insights to a new hypothesis on one mechanism that may contribute to nervous system evolution, in particular by brain pathway duplication. Like gene duplication, we propose that whole brain pathways can duplicate and the duplicated pathway diverge to take on new functions. We suggest that one mechanism of brain pathway duplication could be through gene duplication, although other mechanisms are possible. We focus on brain pathways for vocal learning and spoken language in song-learning birds and humans as example systems. This view presents a new framework for future research in our understanding of brain evolution and novel behavioural traits. © 2015 The Authors.

  5. Distal Xq duplication and functional Xq disomy

    Directory of Open Access Journals (Sweden)

    Schluth-Bolard Caroline

    2009-02-01

    Full Text Available Abstract Distal Xq duplications refer to chromosomal disorders resulting from involvement of the long arm of the X chromosome (Xq. Clinical manifestations widely vary depending on the gender of the patient and on the gene content of the duplicated segment. Prevalence of Xq duplications remains unknown. About 40 cases of Xq28 functional disomy due to cytogenetically visible rearrangements, and about 50 cases of cryptic duplications encompassing the MECP2 gene have been reported. The most frequently reported distal duplications involve the Xq28 segment and yield a recognisable phenotype including distinctive facial features (premature closure of the fontanels or ridged metopic suture, broad face with full cheeks, epicanthal folds, large ears, small and open mouth, ear anomalies, pointed nose, abnormal palate and facial hypotonia, major axial hypotonia, severe developmental delay, severe feeding difficulties, abnormal genitalia and proneness to infections. Xq duplications may be caused either by an intrachromosomal duplication or an unbalanced X/Y or X/autosome translocation. In XY males, structural X disomy always results in functional disomy. In females, failure of X chromosome dosage compensation could result from a variety of mechanisms, including an unfavourable pattern of inactivation, a breakpoint separating an X segment from the X-inactivation centre in cis, or a small ring chromosome. The MECP2 gene in Xq28 is the most important dosage-sensitive gene responsible for the abnormal phenotype in duplications of distal Xq. Diagnosis is based on clinical features and is confirmed by CGH array techniques. Differential diagnoses include Prader-Willi syndrome and Alpha thalassaemia-mental retardation, X linked (ATR-X. The recurrence risk is significant if a structural rearrangement is present in one of the parent, the most frequent situation being that of an intrachromosomal duplication inherited from the mother. Prenatal diagnosis is performed by

  6. Molecular cloning and functional analysis of a blue light receptor gene MdCRY2 from apple (Malus domestica).

    Science.gov (United States)

    Li, Yuan-Yuan; Mao, Ke; Zhao, Cheng; Zhao, Xian-Yan; Zhang, Rui-Fen; Zhang, Hua-Lei; Shu, Huai-Rui; Hao, Yu-Jin

    2013-04-01

    MdCRY2 was isolated from apple fruit skin, and its function was analyzed in MdCRY2 transgenic Arabidopsis. The interaction between MdCRY2 and AtCOP1 was found by yeast two-hybrid and BiFC assays. Cryptochromes are blue/ultraviolet-A (UV-A) light receptors involved in regulating various aspects of plant growth and development. Investigations of the structure and functions of cryptochromes in plants have largely focused on Arabidopsis (Arabidopsis thaliana), tomato (Solanum lycopersicum), pea (Pisum sativum), and rice (Oryza sativa). However, no data on the function of CRY2 are available in woody plants. In this study, we isolated a cryptochrome gene, MdCRY2, from apple (Malus domestica). The deduced amino acid sequences of MdCRY2 contain the conserved N-terminal photolyase-related domain and the flavin adenine dinucleotide (FAD) binding domain, as well as the C-terminal DQXVP-acidic-STAES (DAS) domain. Relationship analysis indicates that MdCRY2 shows the highest similarity to the strawberry FvCRY protein. The expression of MdCRY2 is induced by blue/UV-A light, which represents a 48-h circadian rhythm. To investigate the function of MdCRY2, we overexpressed the MdCRY2 gene in a cry2 mutant and wild type (WT) Arabidopsis, assessed the phenotypes of the resulting transgenic plants, and found that MdCRY2 functions to regulate hypocotyl elongation, root growth, flower initiation, and anthocyanin accumulation. Furthermore, we examined the interaction between MdCRY2 and AtCOP1 using a yeast two-hybrid assay and a bimolecular fluorescence complementation assay. These data provide functional evidence for a role of blue/UV-A light-induced MdCRY2 in controlling photomorphogenesis in apple.

  7. Scaling communication-intensive applications on BlueGene/P using one-sided communication and overlap

    Energy Technology Data Exchange (ETDEWEB)

    Nishtala, Rajesh [Univ. of California, Berkeley, CA (United States); Hargrove, Paul H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Bonachea, Dan O. [Univ. of California, Berkeley, CA (United States); Yelick, Katherine A. [Univ. of California, Berkeley, CA (United States)

    2009-07-10

    In earlier work, we showed that the one-sided communication model found in PGAS languages (such as UPC) offers significant advantages in communication efficiency by decoupling data transfer from processor synchronization. We explore the use of the PGAS model on IBM Blue-Gene/P, an architecture that combines low-power, quad-core processors with extreme scalability. We demonstrate that the PGAS model, using a new port of the Berkeley UPC compiler and GASNet one-sided communication layer, outperforms two-sided (MPI) communication in both microbenchmarks and a case study of the communication-limited benchmark, NAS FT. We scale the benchmark up to 16,384 cores of the BlueGene/P and demonstrate that UPC consistently outperforms MPI by as much as 66% for some processor configurations and an average of 32%. Additionally, the results demonstrate the scalability of the PGAS model and the Berkeley implementation of UPC, the viability of using it on machines with multicore nodes, and the effectiveness of the BG/P communication layer for supporting one-sided communication and PGAS languages.

  8. BcMF26a and BcMF26b Are Duplicated Polygalacturonase Genes with Divergent Expression Patterns and Functions in Pollen Development and Pollen Tube Formation in Brassica campestris.

    Directory of Open Access Journals (Sweden)

    Meiling Lyu

    Full Text Available Polygalacturonase (PG is one of the cell wall hydrolytic enzymes involving in pectin degradation. A comparison of two highly conserved duplicated PG genes, namely, Brassica campestris Male Fertility 26a (BcMF26a and BcMF26b, revealed the different features of their expression patterns and functions. We found that these two genes were orthologous genes of At4g33440, and they originated from a chromosomal segmental duplication. Although structurally similar, their regulatory and intron sequences largely diverged. QRT-PCR analysis showed that the expression level of BcMF26b was higher than that of BcMF26a in almost all the tested organs and tissues in Brassica campestris. Promoter activity analysis showed that, at reproductive development stages, BcMF26b promoter was active in tapetum, pollen grains, and pistils, whereas BcMF26a promoter was only active in pistils. In the subcellular localization experiment, BcMF26a and BcMF26b proteins could be localized to the cell wall. When the two genes were co-inhibited, pollen intine was formed abnormally and pollen tubes could not grow or stretch. Moreover, the knockout mutants of At4g33440 delayed the growth of pollen tubes. Therefore, BcMF26a/b can participate in the construction of pollen wall by modulating intine information and BcMF26b may play a major role in co-inhibiting transformed plants.

  9. Alternative expression of vacuolar iron transporter and ferritin genes leads to blue/purple coloration of flowers in tulip cv. 'Murasakizuisho'.

    Science.gov (United States)

    Shoji, Kazuaki; Momonoi, Kazumi; Tsuji, Tosiaki

    2010-02-01

    Flowers of tulip cv. 'Murasakizuisho' have a purple perianth except for the bottom region, which is blue in color even though it has the same anthocyanin, delphinidin 3-O-rutinoside, as the entire perianth. The development of the blue coloration in the perianth bottom is due to complexation by anthocyanin, flavonol and iron (Fe), as well as a vacuolar iron transporter, TgVit1. Although transient expression of TgVit1 in the purple cells led to a color change to light blue, the coloration of the transformed cells did not coincide with the dark blue color of the cells of the perianth bottom. We thought that another factor is required for the blue coloration of the cells of perianth bottom. To examine the effect of ferritin (FER), an Fe storage protein, on blue color development, we cloned an FER gene (TgFER1) and performed expression analyses. TgFER1 transcripts were found in the cells located in the upper region of the petals along with purple color development by anthocyanin and were not found in the blue cells of the perianth bottom. This gene expression is in contrast to that of TgVit1, expressed only in the cells of the perianth bottom. Co-expression of TgVIT1 and TgFER-RNAi, constructed for suppressing endogenous TgFER1 by RNA interference (RNAi), changed the purple petal cells to a dark blue color similar to that of the natural perianth bottom. These results strongly suggest that TgVit1 expression and TgFER1 suppression are critical for the development of blue color in the perianth bottom.

  10. Pyloroduodenal duplication cyst

    Directory of Open Access Journals (Sweden)

    Venkatesh M Annigeri

    2012-01-01

    Full Text Available A 4-year-old girl presented with non-bilious vomiting and loss of appetite and weight. At laparotomy, a non-communicating pyloroduodenal duplication cyst was present. Subtotal excision of the cyst and cauterization of the mucosal lining of the common wall was performed. The post-operative recovery was uneventful.

  11. A Duplicate Construction Experiment.

    Science.gov (United States)

    Bridgeman, Brent

    This experiment was designed to assess the ability of item writers to construct truly parallel tests based on a "duplicate-construction experiment" in which Cronbach argues that if the universe description and sampling are ideally refined, the two independently constructed tests will be entirely equivalent, and that within the limits of item…

  12. Changes in plasma membrane aquaporin gene expression under osmotic stress and blue light in tomato

    Czech Academy of Sciences Publication Activity Database

    Balarynová, Jana; Danihlík, J.; Fellner, Martin

    2018-01-01

    Roč. 40, č. 2 (2018), č. článku 27. ISSN 0137-5881 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : male-sterile mutant * arabidopsis-thaliana * seed-germination * abscisic-acid * solanum-lycopersicon * nitric-oxide * 7b-1 * protein * hypocotyl * responses * Tomato * Seed * Aquaporins * Blue light * 7B-1 mutant * Mannitol * PIPs Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.364, year: 2016

  13. Three duplication events and variable molecular evolution ...

    Indian Academy of Sciences (India)

    Three duplication events and variable molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. FENG LI CHUNYANG WEI CHAN QIAO ZHENXI CHEN PENG WANG PAN WEI RAN WANG LIFENG JIN JUN YANG FUCHENG LIN ZHAOPENG LUO. RESEARCH NOTE Volume 95 Issue ...

  14. Three duplication events and variable molecular evolution ...

    Indian Academy of Sciences (India)

    Supplementary data: Three duplication events and variable molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. Feng Li, Chunyang Wei, Chan Qiao, Zhenxi Chen, Peng Wang, Pan Wei, Ran Wang, Lifeng Jin, Jun Yang,. Fucheng Lin and Zhaopeng Luo. J. Genet. 95, 453–457.

  15. Three duplication events and variable molecular evolution ...

    Indian Academy of Sciences (India)

    RESEARCH NOTE. Three duplication events and variable molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. FENG LI1, CHUNYANG WEI2, CHAN QIAO3, ZHENXI CHEN4, PENG WANG4, PAN WEI1, RAN WANG1,. LIFENG JIN1, JUN YANG1, FUCHENG LIN1 and ZHAOPENG ...

  16. Photo morphogenesis and photo response of the blue-light receptor gene Cmwc-1 in different strains of Cordyceps militaris.

    Science.gov (United States)

    Yang, Tao; Dong, Caihong

    2014-03-01

    Light is a necessary environmental factor for stroma formation and development of Cordyceps militaris, a well-known edible and medicinal fungus. In this study, photo morphogenesis and the blue-light receptor gene were studied using five representative strains of C. militaris. The results suggest that light was essential for colony pigmentation and could promote conidia production. Cmwc-1, the homologe of the blue-light photoreceptor of Neurospora crassa, was cloned from the genome of C. militaris by Hi-tail PCR. The protein CmWC-1 was characterized by the presence of the LOV and PAS domains and a GATA-type Znf domain. Genetic variation analysis of Cmwc-1 in different strains showed that 15-bp deletions occurred in three strains that resulted in 5-Gln deletions in the transcription activation domain. Phylogenetic analysis based on the Sordariomycetes WC-1-like proteins suggested that the sequence of WC-1 could be used as a candidate marker for phylogenetic analysis in fungi. Cmwc-1 mRNA was light inducible and the expression level increased significantly after irradiation in all tested strains. The sequence of CmWC-1 and the relative expressions responding to irradiation in degenerate and albino strains were similar as the cultivated one. This report will help to open the still-unexplored field of stroma development for this fungus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  17. B- and C-class gene expression during corona development of the blue passionflower (Passiflora caerulea, Passifloraceae).

    Science.gov (United States)

    Hemingway, Claire A; Christensen, Ashley R; Malcomber, Simon T

    2011-06-01

    The origin of the passionflower corona, a complex series of structures between the petals and stamens, has intrigued botanists for centuries, but has proven intractable using traditional approaches. Supplementing developmental data with expression analyses of three floral identity genes, we test whether the corona in Passiflora caerulea (blue passionflower) is homologous to petals or stamens or whether an alternative hypothesis of the corona as a novel structure is supported. Corona development was investigated using scanning electron microscopy. Expression of the P. caerulea B-class genes PISTILLATA (PcPI) and TOMATO MADS6 (PcTM6), and C-class gene AGAMOUS (PcAG) was investigated using a combination of RT-PCR and mRNA in situ hybridization analyses. Corona development starts as a ring of tissue at the base of petals. The outer radii and operculum initiate first at the periphery, followed by the inner radii and pali toward the center, and finally an annulus beneath the operculum. Late in development, a limen, the innermost component of the corona, develops from the side of the androgynophore. RT-PCR analyses indicate that the B-class genes PcPI and PcTM6 and C-class gene PcAG were all expressed in mature coronas. However, mRNA in situ hybridization analyses revealed complex temporal patterns of gene expression in the different corona elements. Our data support the hypothesis that the corona is a composite structure, with the radii, pali, and operculum homologous to stamens, and the limen, which only expresses PcTM6, considered to be a novel structure distinct from the androgynophore.

  18. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...... for reconstructing the evolutionary history of a set of species. In this paper we present methods to compute all sorting TDRLs for two given gene orders. In addition, a closed formula for the number of sorting TDRLs is derived and further properties of sorting TDRLs are investigated. It is also shown...

  19. Method of characteristics development targeting the high performance blue Gene/P computer at Argonne National Laboratory

    International Nuclear Information System (INIS)

    Smith, M.A.; Marin-Lafleche, A.; Yang, W.S.; Kaushik, Dinesh; Siegel, Andrew

    2011-01-01

    The parallel algorithm of the MOCFE solver in UNIC is tested on up to 65,536 MPI processes of Blue Gene/P. Results of strong and weak scaling studies with respect to space and angle on a representative two-dimensional VHTR problem are presented. All tests are for unpreconditioned GMRES calculations with fixed iterative improvement and upscattering iteration settings thus they only measure the effective parallelization of the sweep algorithm. The results indicate that parallel scalability is penalized when spatial domain decomposition is utilized, but it should be acceptable given the ability of the method to utilize high processor counts and maximize parallelization of the work. Additional calculations using multiple sub-domains demonstrate that load balancing is a substantial problem that requires additional research. Future work is focused on building an efficient spatial multigrid preconditioner with considerations of energy parallelization for the MOCFE solver and optimizing the spatial domain decomposition. (author)

  20. Blue light alters miR167 expression and microRNA-targeted auxin response factor genes in Arabidopsis thaliana plants.

    Science.gov (United States)

    Pashkovskiy, Pavel P; Kartashov, Alexander V; Zlobin, Ilya E; Pogosyan, Sergei I; Kuznetsov, Vladimir V

    2016-07-01

    The effect of blue LED (450 nm) on the photomorphogenesis of Arabidopsis thaliana Col-0 plants and the transcript levels of several genes, including miRNAs, photoreceptors and auxin response factors (ARF) was investigated. It was observed that blue light accelerated the generative development, reduced the rosette leaf number, significantly reduced the leaf area, dry biomass and led to the disruption of conductive tissue formation. The blue LED differentially influenced the transcript levels of several phytochromes (PHY a, b, c, d, and e), cryptochromes (CRY 1 and 2) and phototropins (PHOT 1 and 2). At the same time, the blue LED significantly increased miR167 expression compared to a fluorescent lamp or white LEDs. This increase likely resulted in the enhanced transcription of the auxin response factor genes ARF4 and ARF8, which are regulated by this miRNA. These findings support the hypothesis that the effects of blue light on A. thaliana are mediated by auxin signalling pathway involving miRNA-dependent regulation of ARF gene expression. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  1. Gastric, pancreatic, and ureteric duplication

    Directory of Open Access Journals (Sweden)

    Chattopadhyay Anindya

    2010-01-01

    Full Text Available We report a case of an 8-month-old, asymptomatic child who was incidentally detected to have two cystic structures in the abdomen. Surgical exploration revealed a gastric and pancreatic duplication cyst along with a blind-ending duplication of the right ureter. Excision of the duplications was relatively straightforward, and the child made an uneventful recovery. This constellation of duplications has not been reported before.

  2. Development of a Computational Steering Framework for High Performance Computing Environments on Blue Gene/P Systems

    KAUST Repository

    Danani, Bob K.

    2012-07-01

    Computational steering has revolutionized the traditional workflow in high performance computing (HPC) applications. The standard workflow that consists of preparation of an application’s input, running of a simulation, and visualization of simulation results in a post-processing step is now transformed into a real-time interactive workflow that significantly reduces development and testing time. Computational steering provides the capability to direct or re-direct the progress of a simulation application at run-time. It allows modification of application-defined control parameters at run-time using various user-steering applications. In this project, we propose a computational steering framework for HPC environments that provides an innovative solution and easy-to-use platform, which allows users to connect and interact with running application(s) in real-time. This framework uses RealityGrid as the underlying steering library and adds several enhancements to the library to enable steering support for Blue Gene systems. Included in the scope of this project is the development of a scalable and efficient steering relay server that supports many-to-many connectivity between multiple steered applications and multiple steering clients. Steered applications can range from intermediate simulation and physical modeling applications to complex computational fluid dynamics (CFD) applications or advanced visualization applications. The Blue Gene supercomputer presents special challenges for remote access because the compute nodes reside on private networks. This thesis presents an implemented solution and demonstrates it on representative applications. Thorough implementation details and application enablement steps are also presented in this thesis to encourage direct usage of this framework.

  3. Duplication of Vermiform Appendix.

    Science.gov (United States)

    Bhat, Gulzar Ahmad; Reshi, Tarooq Ahmad; Rashid, Asiya

    2016-02-01

    The vermiform appendix is a tubular, narrow, worm-shaped part of the alimentary canal that lies near the ileocecal junction and communicates with the caecum. Duplication of the vermiform appendix is rare, with a reported incidence of 0.004 %. Till now, fewer than 100 cases have been reported. We present a case of an 8-year-old male child with duplex appendix who presented to the emergency department of our institution with features of acute appendicitis.

  4. Colour variation in red grapevines (Vitis vinifera L.): genomic organisation, expression of flavonoid 3'-hydroxylase, flavonoid 3',5'-hydroxylase genes and related metabolite profiling of red cyanidin-/blue delphinidin-based anthocyanins in berry skin.

    Science.gov (United States)

    Castellarin, Simone D; Di Gaspero, Gabriele; Marconi, Raffaella; Nonis, Alberto; Peterlunger, Enrico; Paillard, Sophie; Adam-Blondon, Anne-Francoise; Testolin, Raffaele

    2006-01-24

    Structural genes of the phenyl-propanoid pathway which encode flavonoid 3'- and 3',5'-hydroxylases (F3'H and F3'5'H) have long been invoked to explain the biosynthesis of cyanidin- and delphinidin-based anthocyanin pigments in the so-called red cultivars of grapevine. The relative proportion of the two types of anthocyanins is largely under genetic control and determines the colour variation among red/purple/blue berry grape varieties and their corresponding wines. Gene fragments of VvF3'H and VvF3'5'H, that were isolated from Vitis vinifera 'Cabernet Sauvignon' using degenerate primers designed on plant homologous genes, translated into 313 and 239 amino acid protein fragments, respectively, with up to 76% and 82% identity to plant CYP75 cytochrome P450 monooxygenases. Putative function was assigned on the basis of sequence homology, expression profiling and its correlation with metabolite accumulation at ten different ripening stages. At the onset of colour transition, transcriptional induction of VvF3'H and VvF3'5'H was temporally coordinated with the beginning of anthocyanin biosynthesis, the expression being 2-fold and 50-fold higher, respectively, in red berries versus green berries. The peak of VvF3'5'H expression was observed two weeks later concomitantly with the increase of the ratio of delphinidin-/cyanidin-derivatives. The analysis of structural genomics revealed that two copies of VvF3'H are physically linked on linkage group no. 17 and several copies of VvF3'5'H are tightly clustered and embedded into a segmental duplication on linkage group no. 6, unveiling a high complexity when compared to other plant flavonoid hydroxylase genes known so far, mostly in ornamentals. We have shown that genes encoding flavonoid 3'- and 3',5'-hydroxylases are expressed in any tissues of the grape plant that accumulate flavonoids and, particularly, in skin of ripening red berries that synthesise mostly anthocyanins. The correlation between transcript profiles and the

  5. Colour variation in red grapevines (Vitis vinifera L.: genomic organisation, expression of flavonoid 3'-hydroxylase, flavonoid 3',5'-hydroxylase genes and related metabolite profiling of red cyanidin-/blue delphinidin-based anthocyanins in berry skin

    Directory of Open Access Journals (Sweden)

    Paillard Sophie

    2006-01-01

    Full Text Available Abstract Background Structural genes of the phenyl-propanoid pathway which encode flavonoid 3'- and 3',5'-hydroxylases (F3'H and F3'5'H have long been invoked to explain the biosynthesis of cyanidin- and delphinidin-based anthocyanin pigments in the so-called red cultivars of grapevine. The relative proportion of the two types of anthocyanins is largely under genetic control and determines the colour variation among red/purple/blue berry grape varieties and their corresponding wines. Results Gene fragments of VvF3'H and VvF3'5'H, that were isolated from Vitis vinifera 'Cabernet Sauvignon' using degenerate primers designed on plant homologous genes, translated into 313 and 239 amino acid protein fragments, respectively, with up to 76% and 82% identity to plant CYP75 cytochrome P450 monooxygenases. Putative function was assigned on the basis of sequence homology, expression profiling and its correlation with metabolite accumulation at ten different ripening stages. At the onset of colour transition, transcriptional induction of VvF3'H and VvF3'5'H was temporally coordinated with the beginning of anthocyanin biosynthesis, the expression being 2-fold and 50-fold higher, respectively, in red berries versus green berries. The peak of VvF3'5'H expression was observed two weeks later concomitantly with the increase of the ratio of delphinidin-/cyanidin-derivatives. The analysis of structural genomics revealed that two copies of VvF3'H are physically linked on linkage group no. 17 and several copies of VvF3'5'H are tightly clustered and embedded into a segmental duplication on linkage group no. 6, unveiling a high complexity when compared to other plant flavonoid hydroxylase genes known so far, mostly in ornamentals. Conclusion We have shown that genes encoding flavonoid 3'- and 3',5'-hydroxylases are expressed in any tissues of the grape plant that accumulate flavonoids and, particularly, in skin of ripening red berries that synthesise mostly

  6. Disruption of rcsB by a duplicated sequence in a curli-producing Escherichia coli O157:H7 results in differential gene expression in relation to biofilm formation, stress responses and metabolism.

    Science.gov (United States)

    Sharma, V K; Bayles, D O; Alt, D P; Looft, T; Brunelle, B W; Stasko, J A

    2017-03-08

    Escherichia coli O157:H7 (O157) strain 86-24, linked to a 1986 disease outbreak, displays curli- and biofilm-negative phenotypes that are correlated with the lack of Congo red (CR) binding and formation of white colonies (CR - ) on a CR-containing medium. However, on a CR medium this strain produces red isolates (CR + ) capable of producing curli fimbriae and biofilms. To identify genes controlling differential expression of curli fimbriae and biofilm formation, the RNA-Seq profile of a CR + isolate was compared to the CR - parental isolate. Of the 242 genes expressed differentially in the CR + isolate, 201 genes encoded proteins of known functions while the remaining 41 encoded hypothetical proteins. Among the genes with known functions, 149 were down- and 52 were up-regulated. Some of the upregulated genes were linked to biofilm formation through biosynthesis of curli fimbriae and flagella. The genes encoding transcriptional regulators, such as CsgD, QseB, YkgK, YdeH, Bdm, CspD, BssR and FlhDC, which modulate biofilm formation, were significantly altered in their expression. Several genes of the envelope stress (cpxP), heat shock (rpoH, htpX, degP), oxidative stress (ahpC, katE), nutrient limitation stress (phoB-phoR and pst) response pathways, and amino acid metabolism were downregulated in the CR + isolate. Many genes mediating acid resistance and colanic acid biosynthesis, which influence biofilm formation directly or indirectly, were also down-regulated. Comparative genomics of CR + and CR - isolates revealed the presence of a short duplicated sequence in the rcsB gene of the CR + isolate. The alignment of the amino acid sequences of RcsB of the two isolates showed truncation of RcsB in the CR + isolate at the insertion site of the duplicated sequence. Complementation of CR + isolate with rcsB of the CR - parent restored parental phenotypes to the CR + isolate. The results of this study indicate that RcsB is a global regulator affecting bacterial survival in

  7. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  8. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, J; Han, C; Gordon, L A; Terry, A; Prabhakar, S; She, X; Xie, G; Hellsten, U; Chan, Y M; Altherr, M; Couronne, O; Aerts, A; Bajorek, E; Black, S; Blumer, H; Branscomb, E; Brown, N; Bruno, W J; Buckingham, J; Callen, D F; Campbell, C S; Campbell, M L; Campbell, E W; Caoile, C; Challacombe, J F; Chasteen, L A; Chertkov, O; Chi, H C; Christensen, M; Clark, L M; Cohn, J D; Denys, M; Detter, J C; Dickson, M; Dimitrijevic-Bussod, M; Escobar, J; Fawcett, J J; Flowers, D; Fotopulos, D; Glavina, T; Gomez, M; Gonzales, E; Goodstein, D; Goodwin, L A; Grady, D L; Grigoriev, I; Groza, M; Hammon, N; Hawkins, T; Haydu, L; Hildebrand, C E; Huang, W; Israni, S; Jett, J; Jewett, P B; Kadner, K; Kimball, H; Kobayashi, A; Krawczyk, M; Leyba, T; Longmire, J L; Lopez, F; Lou, Y; Lowry, S; Ludeman, T; Manohar, C F; Mark, G A; McMurray, K L; Meincke, L J; Morgan, J; Moyzis, R K; Mundt, M O; Munk, A C; Nandkeshwar, R D; Pitluck, S; Pollard, M; Predki, P; Parson-Quintana, B; Ramirez, L; Rash, S; Retterer, J; Ricke, D O; Robinson, D; Rodriguez, A; Salamov, A; Saunders, E H; Scott, D; Shough, T; Stallings, R L; Stalvey, M; Sutherland, R D; Tapia, R; Tesmer, J G; Thayer, N; Thompson, L S; Tice, H; Torney, D C; Tran-Gyamfi, M; Tsai, M; Ulanovsky, L E; Ustaszewska, A; Vo, N; White, P S; Williams, A L; Wills, P L; Wu, J; Wu, K; Yang, J; DeJong, P; Bruce, D; Doggett, N A; Deaven, L; Schmutz, J; Grimwood, J; Richardson, P; Rokhsar, D S; Eichler, E E; Gilna, P; Lucas, S M; Myers, R M; Rubin, E M; Pennacchio, L A

    2005-04-06

    Human chromosome 16 features one of the highest levels of segmentally duplicated sequence among the human autosomes. We report here the 78,884,754 base pairs of finished chromosome 16 sequence, representing over 99.9% of its euchromatin. Manual annotation revealed 880 protein-coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes, and 3 RNA pseudogenes. These genes include metallothionein, cadherin, and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobase pairs were identified and result in gene content differences among humans. While the segmental duplications of chromosome 16 are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events likely to have had an impact on the evolution of primates and human disease susceptibility.

  9. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  10. Distinct UV-B and UV-A/blue light signal transduction pathways induce chalcone synthase gene expression in Arabidopsis cells

    International Nuclear Information System (INIS)

    Christie, J.M.; Jenkins, G.I.

    1996-01-01

    UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species

  11. Impact of blue, red, and far-red light treatments on gene expression and steviol glycoside accumulation in Stevia rebaudiana.

    Science.gov (United States)

    Yoneda, Yuki; Nakashima, Hiroshi; Miyasaka, Juro; Ohdoi, Katsuaki; Shimizu, Hiroshi

    2017-05-01

    Stevia rebaudiana (Bertoni) Bertoni is a plant that biosynthesizes a group of natural sweeteners that are up to approximately 400 times sweeter than sucrose. The sweetening components of S. rebaudiana are steviol glycosides (SGs) that partially share their biosynthesis pathway with gibberellins (GAs). However, the molecular mechanisms through which SGs levels can be improved have not been studied. Therefore, transcription levels of several SG biosynthesis-related genes were analyzed under several light treatments involved in GA biosynthesis. We detected higher transcription of UGT85C2, which is one of the UDP-glycosyltransferases (UGTs) involved in catalyzing the sugar-transfer reaction, under red/far-red (R/FR) 1.22 light-emitting diodes (LEDs) and blue LEDs treatment. In this study, it was demonstrated that transcription levels of SG-related genes and the SGs content are affected by light treatments known to affect the GA contents. It is expected that this approach could serve as a practical way to increase SG contents using specific light treatments. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Detection of tandam duplications and implications for linkage analysis

    Energy Technology Data Exchange (ETDEWEB)

    Matise, T.C.; Weeks, D.E. (Univ. of Pittsburgh, PA (United States)); Chakravarti, A. (Case Western Reserve Univ., Cleveland, OH (United States)); Patel, P.I.; Lupski, J.R. (Baylor College of Medicine, Houston, TX (United States)); Nelis, E.; Timmerman, V.; Van Broeckhoven, C. (Univ. of Antwerp (Belgium))

    1994-06-01

    The first demonstration of an autosomal dominant human disease caused by segmental trisomy came in 1991 for Charcot-Marie-Tooth disease type 1A (CMT1A). For this disorder, the segmental trisomy is due to a large tandem duplication of 1.5 Mb of DNA located on chromosome 17p11.2-p12. The search for the CMT1A disease gene was misdirected and impeded because some chromosome 17 genetic markers that are linked to CMT1A lie within this duplication. To better understand how such a duplication might affect genetic analyses in the context of disease gene mapping, the authors studied the effects of marker duplication on transmission probabilities of marker alleles, on linkage analysis of an autosomal dominant disease, and on tests of linkage homogeneity. They demonstrate that the undetected presence of a duplication distorts transmission ratios, hampers fine localization of the disease gene, and increases false evidence of linkage heterogeneity. In addition, they devised a likelihood-based method for detecting the presence of a tandemly duplicated marker when one is suspected. They tested their methods through computer simulations and on CMT1A pedigrees genotyped at several chromosome 17 markers. On the simulated data, the method detected 96% of duplicated markers (with a false-positive rate of 5%). On the CMT1A data the method successfully identified two of three loci that are duplicated (with no false positives). This method could be used to identify duplicated markers in other regions of the genome and could be used to delineate the extent of duplications similar to that involved in CMT1A. 18 refs., 5 figs., 6 tabs.

  13. Sorting duplicated loci disentangles complexities of polyploid genomes masked by genotyping by sequencing

    DEFF Research Database (Denmark)

    Limborg, Morten; Seeb, Lisa W.; Seeb, J. E.

    2016-01-01

    of duplicated loci impoverishes the interpretation of genomic data as signals from contiguous duplicated genes are ignored. We review existing strategies to genotype and map duplicated loci; we focus in detail on an overlooked strategy of using gynogenetic haploids (1N) as a part of new genotyping by sequencing...

  14. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  15. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  16. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  17. Tandem duplications lead to novel expression patterns through exon shuffling in Drosophila yakuba.

    Directory of Open Access Journals (Sweden)

    Rebekah L Rogers

    2017-05-01

    Full Text Available One common hypothesis to explain the impacts of tandem duplications is that whole gene duplications commonly produce additive changes in gene expression due to copy number changes. Here, we use genome wide RNA-seq data from a population sample of Drosophila yakuba to test this 'gene dosage' hypothesis. We observe little evidence of expression changes in response to whole transcript duplication capturing 5' and 3' UTRs. Among whole gene duplications, we observe evidence that dosage sharing across copies is likely to be common. The lack of expression changes after whole gene duplication suggests that the majority of genes are subject to tight regulatory control and therefore not sensitive to changes in gene copy number. Rather, we observe changes in expression level due to both shuffling of regulatory elements and the creation of chimeric structures via tandem duplication. Additionally, we observe 30 de novo gene structures arising from tandem duplications, 23 of which form with expression in the testes. Thus, the value of tandem duplications is likely to be more intricate than simple changes in gene dosage. The common regulatory effects from chimeric gene formation after tandem duplication may explain their contribution to genome evolution.

  18. Optimizing the performance of streaming numerical kernels on the IBM Blue Gene/P PowerPC 450 processor

    KAUST Repository

    Malas, Tareq Majed Yasin

    2012-05-21

    Several emerging petascale architectures use energy-efficient processors with vectorized computational units and in-order thread processing. On these architectures the sustained performance of streaming numerical kernels, ubiquitous in the solution of partial differential equations, represents a challenge despite the regularity of memory access. Sophisticated optimization techniques are required to fully utilize the CPU. We propose a new method for constructing streaming numerical kernels using a high-level assembly synthesis and optimization framework. We describe an implementation of this method in Python targeting the IBM® Blue Gene®/P supercomputer\\'s PowerPC® 450 core. This paper details the high-level design, construction, simulation, verification, and analysis of these kernels utilizing a subset of the CPU\\'s instruction set. We demonstrate the effectiveness of our approach by implementing several three-dimensional stencil kernels over a variety of cached memory scenarios and analyzing the mechanically scheduled variants, including a 27-point stencil achieving a 1.7× speedup over the best previously published results. © The Author(s) 2012.

  19. Optimizing The Performance of Streaming Numerical Kernels On The IBM Blue Gene/P PowerPC 450

    KAUST Repository

    Malas, Tareq

    2011-07-01

    Several emerging petascale architectures use energy-efficient processors with vectorized computational units and in-order thread processing. On these architectures the sustained performance of streaming numerical kernels, ubiquitous in the solution of partial differential equations, represents a formidable challenge despite the regularity of memory access. Sophisticated optimization techniques beyond the capabilities of modern compilers are required to fully utilize the Central Processing Unit (CPU). The aim of the work presented here is to improve the performance of streaming numerical kernels on high performance architectures by developing efficient algorithms to utilize the vectorized floating point units. The importance of the development time demands the creation of tools to enable simple yet direct development in assembly to utilize the power-efficient cores featuring in-order execution and multiple-issue units. We implement several stencil kernels for a variety of cached memory scenarios using our Python instruction simulation and generation tool. Our technique simplifies the development of efficient assembly code for the IBM Blue Gene/P supercomputer\\'s PowerPC 450. This enables us to perform high-level design, construction, verification, and simulation on a subset of the CPU\\'s instruction set. Our framework has the capability to implement streaming numerical kernels on current and future high performance architectures. Finally, we present several automatically generated implementations, including a 27-point stencil achieving a 1.7x speedup over the best previously published results.

  20. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  1. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  2. Translocations used to generate chromosome segment duplications ...

    Indian Academy of Sciences (India)

    Supplementary figure 1. (a–i) Putative novel genes created by the breakpoints. Translocation chromosomes are shown with the translocated segment indicated in red and the untranslocated segments in black or blue. Purple arrows indicate whether the chromosome is a donor (arrow pointing up) or a recipient (arrow ...

  3. Intelligent Scheduled Backup Using Duplicity

    OpenAIRE

    Matland, Håkon Nymo

    2015-01-01

    Digital information has rapidly become an important part of everyday human life. Consequently, backup solutions are important to ensure digital property is safely stored and protected. This thesis will do an in-depth study of Duplicity, a backup solution providing encrypted, bandwidth-efficient backup to both local and remote storage. The first part of the thesis investigate Duplicity in different use case scenarios, reporting on the advantages and disadvantages of the software. Research...

  4. Blue eye color in humans may be caused by a perfectly associated founder mutation in a regulatory element located within the HERC2 gene inhibiting OCA2 expression

    DEFF Research Database (Denmark)

    Eiberg, Hans; Troelsen, Jesper; Boyd, Mette

    2008-01-01

    The human eye color is a quantitative trait displaying multifactorial inheritance. Several studies have shown that the OCA2 locus is the major contributor to the human eye color variation. By linkage analysis of a large Danish family, we finemapped the blue eye color locus to a 166 Kbp region...... within the HERC2 gene. By association analyses, we identified two SNPs within this region that were perfectly associated with the blue and brown eye colors: rs12913832 and rs1129038. Of these, rs12913832 is located 21.152 bp upstream from the OCA2 promoter in a highly conserved sequence in intron 86...... of HERC2. The brown eye color allele of rs12913832 is highly conserved throughout a number of species. As shown by a Luciferase assays in cell cultures, the element significantly reduces the activity of the OCA2 promoter and electrophoretic mobility shift assays demonstrate that the two alleles bind...

  5. Blue lesions.

    Science.gov (United States)

    Longo, Caterina; Scope, Alon; Lallas, Aimilios; Zalaudek, Iris; Moscarella, Elvira; Gardini, Stefano; Argenziano, Giuseppe; Pellacani, Giovanni

    2013-10-01

    Blue color is found in a wide range of malignant and benign melanocytic and nonmelanocytic lesions and in lesions that result from penetration of exogenous materials, such as radiation or amalgam tattoo or traumatic penetration of particles. Discriminating between different diagnostic entities that display blue color relies on careful patient examination and lesion assessment. Dermoscopically, the extent, distribution, and patterns created by blue color can help diagnose lesions with specificity and differentiate between benign and malignant entities. This article provides an overview of the main diagnoses whereby blue color can be found, providing simple management rules for these lesions. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Developmental competence and expression of the MATER and ZAR1 genes in immature bovine oocytes selected by brilliant cresyl blue.

    Science.gov (United States)

    Mota, Gustavo Bruno; Batista, Ribrio Ivan Tavares Pereira; Serapião, Raquel Varella; Boité, Mariana Cortes; Viana, João Henrique Moreira; Torres, Ciro Alexandre Alves; de Almeida Camargo, Luiz Sergio

    2010-08-01

    The objective of this work was to evaluate the selection of immature bovine oocytes by brilliant cresyl blue dye (BCB) and expression of transcripts MATER and ZAR1. Cumulus-oocyte complexes (COCs) from slaughterhouse ovaries were exposed to BCB diluted in mDPBS and incubated for 60 min at 38.5 degrees C in humidified air. After exposure those COCs were distributed in two groups, according to their cytoplasm colour: BCB+ (coloured cytoplasm) or BCB- (colourless cytoplasm). The control group was submitted to in vitro maturation (IVM) immediately after morphological selection and holding control group COCs were exposed to mDPBS without BCB but in the same incubation conditions of BCB+ and BCB- group. The COCs of all groups were submitted to IVM, in vitro fertilization (IVF) and in vitro culture (IVC). Cleavage rate (72 h post-insemination) was similar between control (65.3%) and BCB+ (64.4%) groups, but greater than (p BCB- (51.3%) groups. Blastocyst rate (192 h post-insemination) was not different between BCB+ (18.5%) and control (16.3%) groups, but greater (p BCB- (8.4%) group. No difference was found for blastocyst rate between holding control group (14.2%), control and BCB+ groups. The relative expression of MATER and ZAR1 genes was evaluated by real-time PCR in immature oocytes collected from the control, holding control, BCB+ and BCB- groups. Despite the relative expression of MATER in holding control, BCB+ and BCB- were down regulated in comparison to control group there was no statistical difference (p > 0.05) in the relative expression of MATER and ZAR1 transcripts among groups. The results indicate that the BCB dye detects immature oocyte populations with different developmental competence, although no improvement in in vitro embryo production using oocytes exposed or not to BCB was observed. Development competence of immature oocytes exposed to BCB does not seem to be associated with variations in the expression of MATER and ZAR1 transcripts.

  7. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  8. Cloning of a cDNA that encodes farnesyl diphosphate synthase and the blue-light-induced expression of the corresponding gene in the leaves of rice plants.

    Science.gov (United States)

    Sanmiya, K; Iwasaki, T; Matsuoka, M; Miyao, M; Yamamoto, N

    1997-02-28

    A cDNA encoding farnesyl diphosphate synthase (FPPS), a key enzyme in isoprenoid biosynthesis, was isolated from a cDNA library constructed from mRNA that had been prepared from etiolated rice (Oriza sativa L. variety Nipponbare) seedlings after three hours of illumination by a subtraction method. The putative polypeptide deduced from the 1289 bp nucleotide sequence consisted of 353 amino acids and had a molecular mass of 40 676 Da. The predicted amino acid sequence exhibited high homology to those of FPPS from Arabidopsis (73% to type 1, 72% to type 2) and white lupin (74%). Southern blot analysis showed that the rice genome might contain only one gene for FPPS. The highest level of expression of the gene was demonstrated in leaves by RNA blot analysis. Moreover, light, in particular blue light, effectively enhanced expression of the gene.

  9. Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function.

    Science.gov (United States)

    Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee

    2013-08-01

    Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. In silico reversal of repeat-induced point mutation (RIP identifies the origins of repeat families and uncovers obscured duplicated genes

    Directory of Open Access Journals (Sweden)

    Hane James K

    2010-11-01

    Full Text Available Abstract Background Repeat-induced point mutation (RIP is a fungal genome defence mechanism guarding against transposon invasion. RIP mutates the sequence of repeated DNA and over time renders the affected regions unrecognisable by similarity search tools such as BLAST. Results DeRIP is a new software tool developed to predict the original sequence of a RIP-mutated region prior to the occurrence of RIP. In this study, we apply deRIP to the genome of the wheat pathogen Stagonospora nodorum SN15 and predict the origin of several previously uncharacterised classes of repetitive DNA. Conclusions Five new classes of transposon repeats and four classes of endogenous gene repeats were identified after deRIP. The deRIP process is a new tool for fungal genomics that facilitates the identification and understanding of the role and origin of fungal repetitive DNA. DeRIP is open-source and is available as part of the RIPCAL suite at http://www.sourceforge.net/projects/ripcal.

  11. Cloning and analysis of the Glwc-1 and Glwc-2 genes encoding putative blue light photoreceptor from Ganoderma lucidum.

    Science.gov (United States)

    Xu, Xinran; Chen, Xiangdong; Yu, Wumengxiao; Liu, Yu; Zhang, Weiwei; Lan, Jin

    2017-08-01

    Blue light plays an important role during the growth of Ganoderma lucidum, one of the best-known medicinal macrofungi in China. In the present study, we cloned Glwc-1 and Glwc-2, the homologue of the blue light photoreceptors Ncwc-1 and Ncwc-2 of Neurospora crassa, from G. lucidum. The deduced amino acid sequence of Glwc-1 contained the similar function domains as NcWC-1 including LOV, PAS B, PAS C, and PAC domains. The deduced amino acid sequence of Glwc-2 contained PAS domain and GATA-type zinc finger (Znf) domain as well as NcWC-2. Phylogenetic analysis based on fungal WC-1 and WC-2 supported GlWC-1 and GlWC-2 were blue light receptors. The expression of Glwc-1 and Glwc-2 indicated that they might play an important role during the primordium differentiation process of G. lucidum, and the external blue light stimulation increased the expression of Glwc-1 and Glwc-2. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Differential expression of the virulence-associated protein p57 and characterization of its duplicated gene rosa in virulent and attenuated strains of Renibacterium salmoninarum

    Science.gov (United States)

    O'Farrell, C. L.; Strom, M.S.

    1999-01-01

    Virulence mechanisms utilized by the salmonid fish pathogen Renibacterium salmoninarum are poorly understood. One potential virulence factor is p57 (also designated MSA for major soluble antigen), an abundant 57 kDa soluble protein that is predominately localized on the bacterial cell surface with significant levels released into the extracellular milieu. Previous studies of an attenuated strain, MT 239, indicated that it differs from virulent strains in the amount of surface-associated p57. In this report, we show overall expression of p57 in R. salmoninarum MT 239 is considerably reduced as compared to a virulent strain, ATCC 33209. The amount of cell-associated p57 is decreased while the level of p57 in the culture supernatant is nearly equivalent between the strains. To determine if lowered amount of cell-associated p57 was due to a sequence defect in p57, a genetic comparison was performed. Two copies of the gene encoding p57 (msa1 and msa2) were found in 33209 and MT 239, as well as in several other virulent isolates. Both copies from 33209 and MT 239 were cloned and sequenced and found to be identical to each other, and identical between the 2 strains. A comparison of msa1 and msa2 within each strain showed that their sequences diverge 40 base pairs 5, to the open reading frame, while sequences 3' to the open reading frame are essentially identical for at least 225 base pairs. Northern blot analysis showed no difference in steady state levels of rosa mRNA between the 2 strains. These data suggest that while cell-surface localization of p57 may be important for R. salmoninarum virulence, the differences in localization, and total p57 expression between 33209 anti MT 239 are not due to differences in rosa sequence or differences in steady state transcript levels.

  13. Analysis of gene expression changes in relation to toxicity and tumorigenesis in the livers of Big Blue transgenic rats fed comfrey (Symphytum officinale).

    Science.gov (United States)

    Mei, Nan; Guo, Lei; Zhang, Lu; Shi, Leming; Sun, Yongming Andrew; Fung, Chris; Moland, Carrie L; Dial, Stacey L; Fuscoe, James C; Chen, Tao

    2006-09-06

    Comfrey is consumed by humans as a vegetable and a tea, and has been used as an herbal medicine for more than 2000 years. Comfrey, however, is hepatotoxic in livestock and humans and carcinogenic in experimental animals. Our previous study suggested that comfrey induces liver tumors by a genotoxic mechanism and that the pyrrolizidine alkaloids in the plant are responsible for mutation induction and tumor initiation in rat liver. In this study, we identified comfrey-induced gene expression profile in the livers of rats. Groups of 6 male transgenic Big Blue rats were fed a basal diet and a diet containing 8% comfrey roots, a dose that resulted in liver tumors in a previous carcinogenicity bioassay. The animals were treated for 12 weeks and sacrificed one day after the final treatment. We used a rat microarray containing 26,857 genes to perform genome-wide gene expression studies. Dietary comfrey resulted in marked changes in liver gene expression, as well as in significant decreases in the body weight and increases in liver mutant frequency. When a two-fold cutoff value and a P-value less than 0.01 were selected, 2,726 genes were identified as differentially expressed in comfrey-fed rats compared to control animals. Among these genes, there were 1,617 genes associated by Ingenuity Pathway Analysis with particular functions, and the differentially expressed genes in comfrey-fed rat livers were involved in metabolism, injury of endothelial cells, and liver injury and abnormalities, including liver fibrosis and cancer development. The gene expression profile provides us a better understanding of underlying mechanisms for comfrey-induced hepatic toxicity. Integration of gene expression changes with known pathological changes can be used to formulate a mechanistic scheme for comfrey-induced liver toxicity and tumorigenesis.

  14. PHH1, a novel gene from Arabidopsis thaliana that encodes a protein similar to plant blue-light photoreceptors and microbial photolyases.

    Science.gov (United States)

    Hoffman, P D; Batschauer, A; Hays, J B

    1996-11-27

    A cDNA from Arabidopsis thaliana similar to microbial photolyase genes, and designated AT-PHH1, was isolated using a photolyase-like cDNA from Sinapsis alba (SA-PHR1) as a probe. Multiple isolations yielded only PHH1 cDNAs, and a few blue-light-receptor CRY1 (HY4) cDNAs (also similar to microbial photolyase genes), suggesting the absence of any other highly similar Arabidopsis genes. The AT-PHH1 and SA-PHR1 cDNA sequences predict 89% identity at the protein level, except for an AT-PHH1 C-terminal extension (111 amino acids), also not seen in microbial photolyases. AT-PHH1 and CRY1 show less similarity (54% p4erein identity), including respective C-terminal extensions that are themselves mostly dissimilar. Analysis of fifteen AT-PHH1 genomic isolates reveals a single gene, with three introns in the coding sequence and one in the 5'-untranslated leader. Full-length AT-PHH1, and both AT-PHH1 and AT-PHH1 delta C-513 (truncated to be approximately the size of microbial photolyase genes) cDNAs, were overexpressed, respectively, in yeast and Escherichia coli mutants hypersensitive to ultraviolet light. The absence of significant effects on resistance suggests either that any putative AT-PHH1 DNA repair activity requires cofactors/chromophores not present in yeast or E. coli, or that AT-PHH1 encodes a blue-light/ultraviolet-A receptor rather than a DNA repair protein.

  15. Modeling protein network evolution under genome duplication and domain shuffling

    Directory of Open Access Journals (Sweden)

    Isambert Hervé

    2007-11-01

    Full Text Available Abstract Background Successive whole genome duplications have recently been firmly established in all major eukaryote kingdoms. Such exponential evolutionary processes must have largely contributed to shape the topology of protein-protein interaction (PPI networks by outweighing, in particular, all time-linear network growths modeled so far. Results We propose and solve a mathematical model of PPI network evolution under successive genome duplications. This demonstrates, from first principles, that evolutionary conservation and scale-free topology are intrinsically linked properties of PPI networks and emerge from i prevailing exponential network dynamics under duplication and ii asymmetric divergence of gene duplicates. While required, we argue that this asymmetric divergence arises, in fact, spontaneously at the level of protein-binding sites. This supports a refined model of PPI network evolution in terms of protein domains under exponential and asymmetric duplication/divergence dynamics, with multidomain proteins underlying the combinatorial formation of protein complexes. Genome duplication then provides a powerful source of PPI network innovation by promoting local rearrangements of multidomain proteins on a genome wide scale. Yet, we show that the overall conservation and topology of PPI networks are robust to extensive domain shuffling of multidomain proteins as well as to finer details of protein interaction and evolution. Finally, large scale features of direct and indirect PPI networks of S. cerevisiae are well reproduced numerically with only two adjusted parameters of clear biological significance (i.e. network effective growth rate and average number of protein-binding domains per protein. Conclusion This study demonstrates the statistical consequences of genome duplication and domain shuffling on the conservation and topology of PPI networks over a broad evolutionary scale across eukaryote kingdoms. In particular, scale

  16. The Influence of a Cryptochrome on the Gene Expression Profile in the Diatom Phaeodactylum tricornutum under Blue Light and in Darkness.

    Science.gov (United States)

    König, Sarah; Eisenhut, Marion; Bräutigam, Andrea; Kurz, Samantha; Weber, Andreas P M; Büchel, Claudia

    2017-11-01

    Diatoms, albeit being only distantly related with higher plants, harbor a plant-like cryptochrome (CryP) that was proposed to act as a photoreceptor required for the regulation of some photosynthetic proteins. Plant cryptochromes are involved in the regulation of developmental processes relevant only to multicellular organisms. Their role in the unicellular diatoms to date is mostly enigmatic. To elucidate the function of this plant-like cryptochrome in a unicellular species, we examined the role of CryP in the regulation of transcription in the diatom Phaeodactylum tricornutum by comparative RNA-seq of wild type and CryP knock-down mutants, under prolonged darkness and one hour after onset of blue light. In total, mRNAs of 12,298 genes were identified and more than 70% of the genes could be sorted into functional bins. CryP influenced groups of transcripts in three different ways: some transcripts displayed altered expression under blue light only, others independent of the light condition, and, surprisingly, some were influenced by CryP only in darkness. Genes regulated in any condition were distributed over almost all functional categories. CryP exerted an influence on two other photoreceptors: the genes encoding phytochrome and CPF1, another cryptochrome, which were down-regulated by CryP independent of the light condition. However, the regulatory responses of the affected photoreceptors on transcriptional output were independent. The influence of CryP on the expression of other photoreceptors hints to the existence of a regulatory signaling network in diatoms that includes several cryptochromes and phytochrome, whereby CryP acts as a regulator of transcript abundance under light as well as in darkness. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Intrathoracic enteric foregut duplication cyst.

    Directory of Open Access Journals (Sweden)

    Birmole B

    1994-10-01

    Full Text Available A one month old male child presented with respiratory distress since day 10 of life. There was intercostal retraction and decreased air entry on the right side. Investigations revealed a well defined cystic mass in the posterior mediastinum with vertebral anomalies, the cyst was excised by posterolateral thoracotomy. Histopathology revealed it to be an enteric foregut duplication cyst.

  18. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  19. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic ...

  20. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  1. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  2. TBK1 duplication is found in normal tension and not in high tension ...

    Indian Academy of Sciences (India)

    Duplication in TANK-binding kinase 1 (TBK1) gene has been shown to be associated with normal tension glaucoma. (NTG), a subtype of the neurodegenerative disease glau- coma, which is the largest cause of irreversible blindness. A specific Taqman assay was used in exploring the genetic contribution of the duplication ...

  3. Comparative genomic analysis of duplicated homoeologous regions involved in the resistance of Brassica napus to stem canker

    Directory of Open Access Journals (Sweden)

    Berline eFopa Fomeju

    2015-09-01

    Full Text Available All crop species are current or ancient polyploids. Following whole genome duplication, structural and functional modifications result in differential gene content or regulation in the duplicated regions, which can play a fundamental role in the diversification of genes underlying complex traits. We have investigated this issue in Brassica napus, a species with a highly duplicated genome, with the aim of studying the structural and functional organization of duplicated regions involved in quantitative resistance to stem canker, a disease caused by the fungal pathogen Leptosphaeria maculans. Genome-wide association analysis on two oilseed rape panels confirmed that duplicated regions of ancestral blocks E, J, R, U and W were involved in resistance to stem canker. The structural analysis of the duplicated genomic regions showed a higher gene density on the A genome than on the C genome and a better collinearity between homoeologous regions than paralogous regions, as overall in the whole B. napus genome. The three ancestral sub-genomes were involved in the resistance to stem canker and the fractionation profile of the duplicated regions corresponded to what was expected from results on the B. napus progenitors. About 60% of the genes identified in these duplicated regions were single-copy genes while less than 5% were retained in all the duplicated copies of a given ancestral block. Genes retained in several copies were mainly involved in response to stress, signaling or transcription regulation. Genes with resistance-associated markers were mainly retained in more than two copies. These results suggested that some genes underlying quantitative resistance to stem canker might be duplicated genes. Genes with a hydrolase activity that were retained in one copy or R-like genes might also account for resistance in some regions. Further analyses need to be conducted to indicate to what extent duplicated genes contribute to the expression of the

  4. Construction and characterization of a forward subtracted library of blue mussels Mytilus edulis for the identification of gene transcription signatures and biomarkers of styrene exposure

    International Nuclear Information System (INIS)

    Diaz de Cerio, O.; Hands, E.; Humble, J.; Cajaraville, M.P.; Craft, J.A.; Cancio, I.

    2013-01-01

    Highlights: ► Transcription responses in blue mussels exposed to styrene have been studied by SSH. ► 1440 Clones were obtained from which 287 were sequenced. ► Immune system, cancer-related and ribosomal genes identified as upregulated genes. ► Chitin and β-1-3-glucan metabolism genes highly represented in subtracted library. -- Abstract: Transcriptional profiling can elucidate adaptive/toxicity pathways participating in achieving homeostasis or leading to pathogenesis in marine biota exposed to chemical substances. With the aim of analyzing transcriptional responses in the mussel Mytilus edulis exposed to the corrosive and putatively carcinogenic hydrocarbon styrene (3–5 ppm, 3 days), a forward subtracted (SSH) cDNA library was produced. Female mussels were selected and digestive gland mRNA was isolated. A library with 1440 clones was produced and a total of 287 clones were sequenced, 53% being identified through BlastN analysis against Mytibase and DeepSeaVent databases. Those genes included GO terms such as ‘response to drugs’, ‘immune defense’ and ‘cell proliferation’. Furthermore, sequences related to chitin and beta-1-3-glucan metabolism were also up-regulated by styrene. Many of the obtained sequences could not be annotated constituting new mussel sequences. In conclusion, this SSH study reveals novel sequences useful to generate molecular biomarkers of styrene exposure in mussels

  5. Mitochondrial content and gene expression profiles in oocyte-derived embryos of cattle selected on the basis of brilliant cresyl blue staining.

    Science.gov (United States)

    Fakruzzaman, Md; Bang, Jae-Il; Lee, Kyeong-Lim; Kim, Seong-Su; Ha, A-Na; Ghanem, Nasser; Han, Chang-Hee; Cho, Kyu-Woan; White, Kenneth L; Kong, Il-Keun

    2013-11-01

    The aim of this study was to investigate the developmental rate, lipid and mitochondrial distribution and gene expression in oocyte-derived embryos selected on the basis of brilliant cresyl blue (BCB) staining. Lipid content and mitochondrial distribution in Day 8 blastocysts were evaluated by fluorescence intensity, while gene expression was analyzed by real-time PCR. The proportion of blastocysts (30.9%) was greater (PBCB+ than in BCB- oocytes (13%) but not different (P>0.05) from the control group (28.2%). Total cell number was also greater in BCB+ (155.1 ± 36.2) than in BCB- (116.6 ± 40.5) and control (127.5 ± 35.7) blastocysts. Furthermore, the apoptotic cell number was less in BCB+ (3.7 ± 4.4) than in BCB- blastocysts (8.7 ± 8.7) but not different from the control group (5.9 ± 3.9). BCB+ embryos contained more mitochondria compared to BCB- embryos (PBCB+ than in BCB- blastocysts. By contrast, Bcl2-associated X protein (BAX) and heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) gene expression was greater in BCB- than in BCB+ and control embryos. In conclusion, oocyte-derived embryos selected on the basis of BCB staining showed differences in developmental rate, quality, mitochondrial content and target gene expression compared to control embryos. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. [Acute abdomen caused by infected duodenal duplication].

    Science.gov (United States)

    Gonzálvez Piñera, J; Fernández Córdoba, M S; Hernández Anselmi, E

    2008-07-01

    Infected cystic duplications of the duodenum are unusual lesions. We report two cases of duodenal duplications complicated by infection. The literature is reviewed, and the diagnostic modalities and management options for this unusual pathology are discussed.

  7. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  8. Blue gods, blue oil, and blue people.

    Science.gov (United States)

    Fairbanks, V F

    1994-09-01

    Studies of the composition of coal tar, which began in Prussia in 1834, profoundly affected the economies of Germany, Great Britain, India, and the rest of the world, as well as medicine and surgery. Such effects include the collapse of the profits of the British indigo monopoly, the growth in economic power of Germany based on coal tar chemistry, and an economic crisis in India that led to more humane tax laws and, ultimately, the independence of India and the end of the British Empire. Additional consequences were the development of antiseptic surgery and the synthesis of a wide variety of useful drugs that have eradicated infections and alleviated pain. Many of these drugs, particularly the commonly used analgesics, sulfonamides, sulfones, and local anesthetics, are derivatives of aniline, originally called "blue oil" or "kyanol." Some of these aniline derivatives, however, have also caused aplastic anemia, agranulocytosis, and methemoglobinemia (that is, "blue people"). Exposure to aniline drugs, particularly when two or three aniline drugs are taken concurrently, seems to be the commonest cause of methemoglobinemia today.

  9. Molecular dynamics beyonds the limits: Massive scaling on 72 racks of a BlueGene/P and supercooled glass dynamics of a 1 billion particles system

    KAUST Repository

    Allsopp, Nicholas

    2012-04-01

    We report scaling results on the world\\'s largest supercomputer of our recently developed Billions-Body Molecular Dynamics (BBMD) package, which was especially designed for massively parallel simulations of the short-range atomic dynamics in structural glasses and amorphous materials. The code was able to scale up to 72 racks of an IBM BlueGene/P, with a measured 89% efficiency for a system with 100 billion particles. The code speed, with 0.13. s per iteration in the case of 1 billion particles, paves the way to the study of billion-body structural glasses with a resolution increase of two orders of magnitude with respect to the largest simulation ever reported. We demonstrate the effectiveness of our code by studying the liquid-glass transition of an exceptionally large system made by a binary mixture of 1 billion particles. © 2012.

  10. The sequence and analysis of duplication-rich human chromosome 16.

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Chan, Yee Man; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C; Bruno, William J; Buckingham, Judith M; Callen, David F; Campbell, Connie S; Campbell, Mary L; Campbell, Evelyn W; Caoile, Chenier; Challacombe, Jean F; Chasteen, Leslie A; Chertkov, Olga; Chi, Han C; Christensen, Mari; Clark, Lynn M; Cohn, Judith D; Denys, Mirian; Detter, John C; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A; Grady, Deborah L; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip B; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Manohar, Chitra F; Mark, Graham A; McMurray, Kimberly L; Meincke, Linda J; Morgan, Jenna; Moyzis, Robert K; Mundt, Mark O; Munk, A Christine; Nandkeshwar, Richard D; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O; Robinson, Donna L; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H; Scott, Duncan; Shough, Timothy; Stallings, Raymond L; Stalvey, Malinda; Sutherland, Robert D; Tapia, Roxanne; Tesmer, Judith G; Thayer, Nina; Thompson, Linda S; Tice, Hope; Torney, David C; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E; Ustaszewska, Anna; Vo, Nu; White, P Scott; Williams, Albert L; Wills, Patricia L; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; Dejong, Pieter; Bruce, David; Doggett, Norman A; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; Rokhsar, Daniel S; Eichler, Evan E; Gilna, Paul; Lucas, Susan M; Myers, Richard M; Rubin, Edward M; Pennacchio, Len A

    2004-12-23

    Human chromosome 16 features one of the highest levels of segmentally duplicated sequence among the human autosomes. We report here the 78,884,754 base pairs of finished chromosome 16 sequence, representing over 99.9% of its euchromatin. Manual annotation revealed 880 protein-coding genes confirmed by 1,670 aligned transcripts, 19 transfer RNA genes, 341 pseudogenes and three RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukaemia. Several large-scale structural polymorphisms spanning hundreds of kilobase pairs were identified and result in gene content differences among humans. Whereas the segmental duplications of chromosome 16 are enriched in the relatively gene-poor pericentromere of the p arm, some are involved in recent gene duplication and conversion events that are likely to have had an impact on the evolution of primates and human disease susceptibility.

  11. Tandem Duplications and the Limits of Natural Selection in Drosophila yakuba and Drosophila simulans.

    Directory of Open Access Journals (Sweden)

    Rebekah L Rogers

    Full Text Available Tandem duplications are an essential source of genetic novelty, and their variation in natural populations is expected to influence adaptive walks. Here, we describe evolutionary impacts of recently-derived, segregating tandem duplications in Drosophila yakuba and Drosophila simulans. We observe an excess of duplicated genes involved in defense against pathogens, insecticide resistance, chorion development, cuticular peptides, and lipases or endopeptidases associated with the accessory glands across both species. The observed agreement is greater than expectations on chance alone, suggesting large amounts of convergence across functional categories. We document evidence of widespread selection on the D. simulans X, suggesting adaptation through duplication is common on the X. Despite the evidence for positive selection, duplicates display an excess of low frequency variants consistent with largely detrimental impacts, limiting the variation that can effectively facilitate adaptation. Standing variation for tandem duplications spans less than 25% of the genome in D. yakuba and D. simulans, indicating that evolution will be strictly limited by mutation, even in organisms with large population sizes. Effective whole gene duplication rates are low at 1.17 × 10-9 per gene per generation in D. yakuba and 6.03 × 10-10 per gene per generation in D. simulans, suggesting long wait times for new mutations on the order of thousands of years for the establishment of sweeps. Hence, in cases where adaptation depends on individual tandem duplications, evolution will be severely limited by mutation. We observe low levels of parallel recruitment of the same duplicated gene in different species, suggesting that the span of standing variation will define evolutionary outcomes in spite of convergence across gene ontologies consistent with rapidly evolving phenotypes.

  12. Narrow, duplicated internal auditory canal

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, T. [Servico de Neurorradiologia, Hospital Garcia de Orta, Avenida Torrado da Silva, 2801-951, Almada (Portugal); Shayestehfar, B. [Department of Radiology, UCLA Oliveview School of Medicine, Los Angeles, California (United States); Lufkin, R. [Department of Radiology, UCLA School of Medicine, Los Angeles, California (United States)

    2003-05-01

    A narrow internal auditory canal (IAC) constitutes a relative contraindication to cochlear implantation because it is associated with aplasia or hypoplasia of the vestibulocochlear nerve or its cochlear branch. We report an unusual case of a narrow, duplicated IAC, divided by a bony septum into a superior relatively large portion and an inferior stenotic portion, in which we could identify only the facial nerve. This case adds support to the association between a narrow IAC and aplasia or hypoplasia of the vestibulocochlear nerve. The normal facial nerve argues against the hypothesis that the narrow IAC is the result of a primary bony defect which inhibits the growth of the vestibulocochlear nerve. (orig.)

  13. Gene Expression of Monocarboxylate Transporters and Oocyte-secreted Factors in Bovine Cumulus-oocyte Complexes Selected by Brilliant Cresyl Blue.

    Science.gov (United States)

    Lopes, E F; Marques, L S; Duranti, R G; de Oliveira, A T D; Lopes, R F F; Rodrigues, J L

    2015-10-01

    Oocyte selection based on the brilliant cresyl blue (BCB) staining test has been successfully used to differentiate between competent and incompetent bovine oocytes. Here, the expression of genes involved in transport of monocarboxylates (Mct1-4) and oogenesis specific genes (Bmp15, Gdf9 and Has2) in BCB+ and BCB- selected immature and mature bovine cumulus-oocyte complexes (COC) was evaluated. In order to find specific molecular markers to characterize successful oocyte maturation, our study was also aimed at identifying the expression of Mcts and oogenesis specific genes in denuded oocytes and cumulus cells. Immature COCs morphological appropriate were (i) stained with 26 mm BCB for 90 min before IVM, (ii) exposed to same incubation conditions as stained COCs, but without BCB (holding group) or (iii) transferred into a maturation medium immediately after morphological selection (control group). mRNA expression was investigated by RT-PCR in COCs before and after IVM. No relationship was observed in the relative expression of Has2, Gdf9, Bmp15 or Mct1, 2 and 4 transcripts between BCB+ and BCB- COCs. Transcripts analysis showed that Gdf9 and Bmp15 in BCB+, BCB- and holding groups were up-regulated (p < 0.05) before IVM, while Has2 was up-regulated (p < 0.01) after IVM in the control group. Other genes remained stable during maturation (Mct1, 2 and 4). Our results showed, for the first time, Mct1, 2 and 4 expression in bovine COCs. Mct1 and Mct4 transcripts were present in denuded oocytes and cumulus cell, while Mct2 was detected only in cumulus cells. These differences between the three isoforms in localization suggest unique roles for each in monocarboxylate transport during maturation. © 2015 Blackwell Verlag GmbH.

  14. Dispersal and gene flow in the rare, parasitic Large Blue butterfly Maculinea arion

    DEFF Research Database (Denmark)

    Ugelvig, Line Vej; Andersen, Anne; Boomsma, Jacobus Jan

    2012-01-01

    decline throughout Europe and extinction in Britain followed by reintroduction of a seed population from the Swedish island of Öland. We find that populations are highly structured genetically, but that gene flow occurs over distances 15 times longer than the maximum distance recorded from mark...

  15. Photoperiodic Responses and Characterization of the Cmvvd Gene Encoding a Blue Light Photoreceptor from the Medicinal Caterpillar Fungus Cordyceps militaris (Ascomycetes).

    Science.gov (United States)

    Zhang, Xin; Dong, Xiaoming; Song, Xinhua; Wang, Fen; Dong, Caihong

    2017-01-01

    Light is a necessary environmental factor for production of conidia and pigment, formation of stroma, and development of Cordyceps militaris, a well-known edible and medicinal mushroom. In this study, an obvious rhythm loop was observed in certain strains of C. militaris under conditions of alternating 12-hour intervals of dark and light. A possibly related gene, Cmvvd, the homologue of the blue-light photoreceptor of Neurospora crassa, was cloned from the genome of C. militaris. The protein CmVVD is predicted to be 203 amino acids in length and is characterized by the presence of a light, oxygen, or voltage domain. Analysis of the CmVVD sensor domain (light, oxygen, or voltage) suggested that it is a blue-light receptor. Cysteine 108 is essential for the in vivo function of VIVID (VVD) in N. crassa photoadaptation. However, proline is in this position instead in all of the tested CmVVD proteins, suggesting that CmVVD may have a different function or may function in ways different from VVD in N. crassa. Genetic variation analysis of CmVVD in 6 representative strains indicated that 3 informative sites exist. Cmvvd messenger RNA was able to be induced by light, and the expression level increased over 10 times after irradiation and was maintained at high levels in the nascent fruiting body. The light-induced expression of Cmvvd was abolished in Cmwc-1 mutants, suggesting that the expression of Cmvvd is dependent on the photoreceptor CmWC-1 or on a functional CmWC-1/WC-2 complex. This article will help to open the still-unexplored field of circadian rhythms for this fungus.

  16. Posthuman blues

    CERN Document Server

    Tonnies, Mac

    2013-01-01

    Posthuman Blues, Vol. I is first volume of the edited version of the popular weblog maintained by author Mac Tonnies from 2003 until his tragic death in 2009. Tonnies' blog was a pastiche of his original fiction, reflections on his day-to-day life, trenchant observations of current events, and thoughts on an eclectic range of material he culled from the Internet. What resulted was a remarkably broad portrait of a thoughtful man and the complex times in which he lived, rendered with intellige...

  17. Gene expression pattern of adiponectin and adiponectin receptors in dominant and atretic follicles and oocytes screened based on brilliant cresyl blue staining.

    Science.gov (United States)

    Tabandeh, M R; Golestani, N; Kafi, M; Hosseini, A; Saeb, M; Sarkoohi, P

    2012-03-01

    Adiponectin and its receptors (AdipoR1 and AdipoR2) are novel endocrine systems that act at various levels to control male and female fertility. The aim of this study was to determine whether adiponectin and its receptors gene expression levels differ between dominant follicle (DF) and atretic follicle (AF) and also between oocytes which were stained positively and negatively with brilliant cresyl blue (BCB(+) and BCB(-)). Based on estradiol/progesterone ratio, follicles from ovaries were classified as AFs and DFs. The stages of estrous cycle (follicular or luteal phases) were defined by macroscopic observation of the ovaries and the uterus. Oocytes were stained with BCB for 90 min. The relative expression of adiponectin, AdipoR1 and AdipoR2 mRNA in theca and cumulus cells and oocytes of different follicles were determined by quantitative real time PCR. Adiponectin and its receptors genes were clearly expressed higher (PBCB(+) oocytes showed a higher (PBCB(-) counterparts. Positive correlation (r>0.725, P<0.001) was observed between adiponectin mRNA level in ovarian cells of DFs and follicular fluid E2 concentration in follicular phase. Adiponectin mRNA abundance in ovarian cells of AFs showed a significant negative correlation with follicular fluid progesterone concentration in follicular and luteal phases (r<-0.731, P<0.001). This work has revealed the novel association of adiponectin and its receptors genes with follicular dominance and oocyte competence, thereby opening several new avenues of research into the mechanisms of dominance and competence in animal and human. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Ancient genome duplications during the evolution of kiwifruit (Actinidia) and related Ericales

    Science.gov (United States)

    Shi, Tao; Huang, Hongwen; Barker, Michael S.

    2010-01-01

    Background and Aims To assess the number and phylogenetic distribution of large-scale genome duplications in the ancestry of Actinidia, publicly available expressed sequenced tags (ESTs) for members of the Actinidiaceae and related Ericales, including tea (Camellia sinensis), were analysed. Methods Synonymous divergences (Ks) were calculated for all duplications within gene families and examined for evidence of large-scale duplication events. Phylogenetic comparisons for a selection of orthologues among several related species in Ericales and two outgroups permitted placement of duplication events in relation to lineage divergences. Gene ontology (GO) categories were analysed for each whole-genome duplication (WGD) and the whole transcriptome. Key Results Evidence for three ancient WGDs in Actinidia was found. Analyses of paleologue GO categories indicated a different pattern of retained genes for each genome duplication, but a pattern consistent with the dosage-balance hypothesis among all retained paleologues. Conclusions This study provides evidence for one independent WGD in the ancestry of Actinidia (Ad-α), a WGD shared by Actinidia and Camellia (Ad-β), and the well-established At-γ WGD that occurred prior to the divergence of all taxa examined. More ESTs in other taxa are needed to elucidate which groups in Ericales share the Ad-β or Ad-α duplications and their impact on diversification. PMID:20576738

  19. Effects of continuous white light and 12h white-12h blue light-cycles on the expression of clock genes in diencephalon, liver, and skeletal muscle in chicks.

    Science.gov (United States)

    Honda, Kazuhisa; Kondo, Makoto; Hiramoto, Daichi; Saneyasu, Takaoki; Kamisoyama, Hiroshi

    2017-05-01

    The core circadian clock mechanism relies on a feedback loop comprised of clock genes, such as the brain and muscle Arnt-like 1 (Bmal1), chriptochrome 1 (Cry1), and period 3 (Per3). Exposure to the light-dark cycle synchronizes the master circadian clock in the brain, and which then synchronizes circadian clocks in peripheral tissues. Birds have long been used as a model for the investigation of circadian rhythm in human neurobiology. In the present study, we examined the effects of continuous light and the combination of white and blue light on the expression of clock genes (Bmal1, Cry1, and Per3) in the central and peripheral tissues in chicks. Seventy two day-old male chicks were weighed, allocated to three groups and maintained under three light schedules: 12h white light-12h dark-cycles group (control); 24h white light group (WW group); 12h white light-12h blue light-cycles group (WB group). The mRNA levels of clock genes in the diencephalon were significantly different between the control and WW groups. On the other hand, the alteration in the mRNA levels of clock genes was similar between the control and WB groups. Similar phenomena were observed in the liver and skeletal muscle (biceps femoris). These results suggest that 12h white-12h blue light-cycles did not disrupt the circadian rhythm of clock gene expression in chicks. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Concerted evolution of duplicated mitochondrial control regions in three related seabird species

    Directory of Open Access Journals (Sweden)

    Birt Tim P

    2010-01-01

    Full Text Available Abstract Background Many population genetic and phylogenetic analyses of mitochondrial DNA (mtDNA assume that mitochondrial genomes do not undergo recombination. Recently, concerted evolution of duplicated mitochondrial control regions has been documented in a range of taxa. Although the molecular mechanism that facilitates concerted evolution is unknown, all proposed mechanisms involve mtDNA recombination. Results Here, we document a duplication of a large region (cytochrome b, tRNAThr, tRNAPro, ND6, tRNAGlu and the control region in the mitochondrial genome of three related seabird species. To investigate the evolution of duplicate control regions, we sequenced both control region copies (CR1 and CR2 from 21 brown (Sula leucogaster, 21 red-footed (S. sula and 21 blue-footed boobies (S. nebouxii. Phylogenetic analysis suggested that the duplicated control regions are predominantly evolving in concert; however, approximately 51 base pairs at the 5' end of CR1 and CR2 exhibited a discordant phylogenetic signal and appeared to be evolving independently. Conclusions Both the structure of the duplicated region and the conflicting phylogenetic signals are remarkably similar to a pattern found in Thalassarche albatrosses, which are united with boobies in a large clade that includes all procellariiform and most pelecaniform seabirds. Therefore we suggest that concerted evolution of duplicated control regions either is taxonomically widespread within seabirds, or that it has evolved many times.

  1. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  2. MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement

    Directory of Open Access Journals (Sweden)

    Zhang Liqing

    2010-01-01

    Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments

  3. The Effect of Melatonin on Maturation, Glutathione Level and Expression of H MGB1 Gene in Brilliant Cresyl Blue (BCB) Stained Immature Oocyte.

    Science.gov (United States)

    Salimi, Maryam; Salehi, Mohammad; Masteri Farahani, Reza; Dehghani, Maryam; Abadi, Mohammad; Novin, Marefat Ghaffari; Nourozian, Mohsen; Hosseini, Ahmad

    2014-01-01

    Nutrients and antioxidants in the medium of immature oocyte have a profound effect on maturation, fertilization and development of resulting embryos. In this study the effects of melatonin as an antioxidant agent on maturation, glutathione level and expression of High mobility group box-1 (HMGB1) gene were evaluated in immature oocytes of mice stained with brilliant cresyl blue (BCB). In this experimental study, immature oocytes were harvested from ovaries of Naval Medical Research Institute (NMRI) mice. Oocytes were stained with 26 μM BCB for 90 minutes and transferred to in vitro maturation medium containing varying doses of melatonin (10-12, 10-9, 10-6, 10-3 M) and without melatonin, for 22-24 hours. Maturation was monitored using an inverted microscope. Glutathione was assessed by monochlorobimane (MCB) staining and HMGB1 expression in mature oocyte was analyzed using real-time polymerase chain reaction (PCR). Melatonin in the concentration of 10-6 M had the most effect on maturation and HMGB1 expression of BCB+ oocytes (pBCB- oocytes, compared to the control group, melatonin did not affect cytoplasm maturation (p>0.05). In vitro treatment with melatonin increases the maturation and HMGB1 expression in BCB+ immature oocytes and has no significant effect on glutathione levels.

  4. Performance Characteristics of Hybrid MPI/OpenMP Scientific Applications on a Large-Scale Multithreaded BlueGene/Q Supercomputer

    KAUST Repository

    Wu, Xingfu

    2013-07-01

    In this paper, we investigate the performance characteristics of five hybrid MPI/OpenMP scientific applications (two NAS Parallel benchmarks Multi-Zone SP-MZ and BT-MZ, an earthquake simulation PEQdyna, an aerospace application PMLB and a 3D particle-in-cell application GTC) on a large-scale multithreaded Blue Gene/Q supercomputer at Argonne National laboratory, and quantify the performance gap resulting from using different number of threads per node. We use performance tools and MPI profile and trace libraries available on the supercomputer to analyze and compare the performance of these hybrid scientific applications with increasing the number OpenMP threads per node, and find that increasing the number of threads to some extent saturates or worsens performance of these hybrid applications. For the strong-scaling hybrid scientific applications such as SP-MZ, BT-MZ, PEQdyna and PLMB, using 32 threads per node results in much better application efficiency than using 64 threads per node, and as increasing the number of threads per node, the FPU (Floating Point Unit) percentage decreases, and the MPI percentage (except PMLB) and IPC (Instructions per cycle) per core (except BT-MZ) increase. For the weak-scaling hybrid scientific application such as GTC, the performance trend (relative speedup) is very similar with increasing number of threads per node no matter how many nodes (32, 128, 512) are used. © 2013 IEEE.

  5. Two Rounds of Whole Genome Duplication in the AncestralVertebrate

    Energy Technology Data Exchange (ETDEWEB)

    Dehal, Paramvir; Boore, Jeffrey L.

    2005-04-12

    The hypothesis that the relatively large and complex vertebrate genome was created by two ancient, whole genome duplications has been hotly debated, but remains unresolved. We reconstructed the evolutionary relationships of all gene families from the complete gene sets of a tunicate, fish, mouse, and human, then determined when each gene duplicated relative to the evolutionary tree of the organisms. We confirmed the results of earlier studies that there remains little signal of these events in numbers of duplicated genes, gene tree topology, or the number of genes per multigene family. However, when we plotted the genomic map positions of only the subset of paralogous genes that were duplicated prior to the fish-tetrapod split, their global physical organization provides unmistakable evidence of two distinct genome duplication events early in vertebrate evolution indicated by clear patterns of 4-way paralogous regions covering a large part of the human genome. Our results highlight the potential for these large-scale genomic events to have driven the evolutionary success of the vertebrate lineage.

  6. Bilateral duplication of the internal auditory canal

    International Nuclear Information System (INIS)

    Weon, Young Cheol; Kim, Jae Hyoung; Choi, Sung Kyu; Koo, Ja-Won

    2007-01-01

    Duplication of the internal auditory canal is an extremely rare temporal bone anomaly that is believed to result from aplasia or hypoplasia of the vestibulocochlear nerve. We report bilateral duplication of the internal auditory canal in a 28-month-old boy with developmental delay and sensorineural hearing loss. (orig.)

  7. Current incidence of duplicate publication in otolaryngology.

    Science.gov (United States)

    Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K

    2014-03-01

    Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  8. OTX2 duplication is implicated in hemifacial microsomia.

    Directory of Open Access Journals (Sweden)

    Dina Zielinski

    Full Text Available Hemifacial microsomia (HFM is the second most common facial anomaly after cleft lip and palate. The phenotype is highly variable and most cases are sporadic. We investigated the disorder in a large pedigree with five affected individuals spanning eight meioses. Whole-exome sequencing results indicated the absence of a pathogenic coding point mutation. A genome-wide survey of segmental variations identified a 1.3 Mb duplication of chromosome 14q22.3 in all affected individuals that was absent in more than 1000 chromosomes of ethnically matched controls. The duplication was absent in seven additional sporadic HFM cases, which is consistent with the known heterogeneity of the disorder. To find the critical gene in the duplicated region, we analyzed signatures of human craniofacial disease networks, mouse expression data, and predictions of dosage sensitivity. All of these approaches implicated OTX2 as the most likely causal gene. Moreover, OTX2 is a known oncogenic driver in medulloblastoma, a condition that was diagnosed in the proband during the course of the study. Our findings suggest a role for OTX2 dosage sensitivity in human craniofacial development and raise the possibility of a shared etiology between a subtype of hemifacial microsomia and medulloblastoma.

  9. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders

    DEFF Research Database (Denmark)

    Isles, Anthony R; Ingason, Andrés; Lowther, Chelsea

    2016-01-01

    Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS) region have been associated with developmental delay (DD), autism spectrum disorder (ASD) and schizophrenia (SZ). Due to presence of imprinted genes within the region, the parental origin of these duplications may...

  10. Prader-Willi, Angelman, and 15q11-q13 duplication syndromes

    Science.gov (United States)

    2015-01-01

    Three distinct neurodevelopmental disorders arise primarily from deletions or duplications that occur at the 15q11-q13 locus: Prader-Willi syndrome (PWS), Angelman syndrome (AS), and 15q11-q13 duplication syndrome (Dup15q syndrome). Each of these disorders results from the loss of function or over-expression of at least one imprinted gene. Here we discuss the clinical background, genetic etiology, diagnostic strategy, and management for each of these three disorders. PMID:26022164

  11. Segmental duplications: evolution and impact among the current Lepidoptera genomes.

    Science.gov (United States)

    Zhao, Qian; Ma, Dongna; Vasseur, Liette; You, Minsheng

    2017-07-06

    Structural variation among genomes is now viewed to be as important as single nucleoid polymorphisms in influencing the phenotype and evolution of a species. Segmental duplication (SD) is defined as segments of DNA with homologous sequence. Here, we performed a systematic analysis of segmental duplications (SDs) among five lepidopteran reference genomes (Plutella xylostella, Danaus plexippus, Bombyx mori, Manduca sexta and Heliconius melpomene) to understand their potential impact on the evolution of these species. We find that the SDs content differed substantially among species, ranging from 1.2% of the genome in B. mori to 15.2% in H. melpomene. Most SDs formed very high identity (similarity higher than 90%) blocks but had very few large blocks. Comparative analysis showed that most of the SDs arose after the divergence of each linage and we found that P. xylostella and H. melpomene showed more duplications than other species, suggesting they might be able to tolerate extensive levels of variation in their genomes. Conserved ancestral and species specific SD events were assessed, revealing multiple examples of the gain, loss or maintenance of SDs over time. SDs content analysis showed that most of the genes embedded in SDs regions belonged to species-specific SDs ("Unique" SDs). Functional analysis of these genes suggested their potential roles in the lineage-specific evolution. SDs and flanking regions often contained transposable elements (TEs) and this association suggested some involvement in SDs formation. Further studies on comparison of gene expression level between SDs and non-SDs showed that the expression level of genes embedded in SDs was significantly lower, suggesting that structure changes in the genomes are involved in gene expression differences in species. The results showed that most of the SDs were "unique SDs", which originated after species formation. Functional analysis suggested that SDs might play different roles in different species. Our

  12. ANSYS duplicate finite-element checker routine

    Science.gov (United States)

    Ortega, R.

    1995-01-01

    An ANSYS finite-element code routine to check for duplicated elements within the volume of a three-dimensional (3D) finite-element mesh was developed. The routine developed is used for checking floating elements within a mesh, identically duplicated elements, and intersecting elements with a common face. A space shuttle main engine alternate turbopump development high pressure oxidizer turbopump finite-element model check using the developed subroutine is discussed. Finally, recommendations are provided for duplicate element checking of 3D finite-element models.

  13. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  14. Blue light-promoted rice leaf bending and unrolling are due to up-regulated brassinosteroid biosynthesis genes accompanied by accumulation of castasterone.

    Science.gov (United States)

    Asahina, Masashi; Tamaki, Yuji; Sakamoto, Tomoaki; Shibata, Kyomi; Nomura, Takahito; Yokota, Takao

    2014-08-01

    In this study the relationship between blue light- and brassinosteroid-enhanced leaf lamina bending and unrolling in rice was investigated. Twenty-four hours (h) irradiation with white or blue light increased endogenous brassinosteroid levels, especially those of typhasterol and castasterone, in aerial tissues of rice seedlings. There was an accompanying up-regulation of transcript levels of CYP85A1/OsDWARF, encoding an enzyme catalyzing C-6 oxidation, after 6h under either white or blue light. These effects were not observed in seedlings placed under far-red or red light regimes. It was concluded that blue light up-regulates the levels of several cytochrome P450 enzymes including CYP85A1, thereby promoting the synthesis of castasterone, a biologically active brassinosteroid in rice. Based on these findings, it is considered that blue light-mediated rice leaf bending and unrolling are consequences of the enhanced biosynthesis of endogenous castasterone. In contrast to aerial tissues, brassinosteroid synthesis in roots appeared to be negatively regulated by white, blue and red light but positively controlled by far-red light. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Genetics Home Reference: 17q12 duplication

    Science.gov (United States)

    ... of affected individuals have an unusually small head ( microcephaly ). Less commonly, 17q12 duplications have been associated with ... MedlinePlus (6 links) Encyclopedia: Autism Spectrum Disorder Encyclopedia: Microcephaly Encyclopedia: Schizophrenia Health Topic: Developmental Disabilities Health Topic: ...

  16. INDEPENDENT DE-DUPLICATION IN DATA CLEANING

    OpenAIRE

    Udechukwu, Ajumobi; Ezeife, Christie; Barker, Ken

    2005-01-01

    Many organizations collect large amounts of data to support their business and decision-making processes. The data originate from a variety of sources that may have inherent data-quality problems. These problems become more pronounced when heterogeneous data sources are integrated (for example, in data warehouses). A major problem that arises from integrating different databases is the existence of duplicates. The challenge of de-duplication is identifying “equivalent” records within the data...

  17. [Anaphylaxis to blue dyes].

    Science.gov (United States)

    Langner-Viviani, F; Chappuis, S; Bergmann, M M; Ribi, C

    2014-04-16

    In medicine, vital blue dyes are mainly used for the evaluation of sentinel lymph nodes in oncologic surgery. Perioperative anaphylaxis to blue dyes is a rare but significant complication. Allergic reactions to blue dyes are supposedly IgE-mediated and mainly caused by triarylmethanes (patent blue and isosulfane blue) and less frequently by methylene blue. These substances usually do not feature on the anesthesia record and should not be omitted from the list of suspects having caused the perioperative reaction, in the same manner as latex and chlorhexidine. The diagnosis of hypersensitivity to vital blue dyes can be established by skin test. We illustrate this topic with three clinical cases.

  18. Cep63 and cep152 cooperate to ensure centriole duplication.

    Directory of Open Access Journals (Sweden)

    Nicola J Brown

    Full Text Available Centrosomes consist of two centrioles embedded in pericentriolar material and function as the main microtubule organising centres in dividing animal cells. They ensure proper formation and orientation of the mitotic spindle and are therefore essential for the maintenance of genome stability. Centrosome function is crucial during embryonic development, highlighted by the discovery of mutations in genes encoding centrosome or spindle pole proteins that cause autosomal recessive primary microcephaly, including Cep63 and Cep152. In this study we show that Cep63 functions to ensure that centriole duplication occurs reliably in dividing mammalian cells. We show that the interaction between Cep63 and Cep152 can occur independently of centrosome localisation and that the two proteins are dependent on one another for centrosomal localisation. Further, both mouse and human Cep63 and Cep152 cooperate to ensure efficient centriole duplication by promoting the accumulation of essential centriole duplication factors upstream of SAS-6 recruitment and procentriole formation. These observations describe the requirement for Cep63 in maintaining centriole number in dividing mammalian cells and further establish the order of events in centriole formation.

  19. The Stress-Inducible Peroxidase TSA2 Underlies a Conditionally Beneficial Chromosomal Duplication in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Robert A. Linder

    2017-09-01

    Full Text Available Although chromosomal duplications are often deleterious, in some cases they enhance cells’ abilities to tolerate specific genetic or environmental challenges. Identifying the genes that confer these conditionally beneficial effects to particular chromosomal duplications can improve our understanding of the genetic and molecular mechanisms that enable certain aneuploidies to persist in cell populations and contribute to disease and evolution. Here, we perform a screen for spontaneous mutations that improve the tolerance of haploid Saccharomyces cerevisiae to hydrogen peroxide. Chromosome IV duplication is the most frequent mutation, as well as the only change in chromosomal copy number seen in the screen. Using a genetic mapping strategy that involves systematically deleting segments of a duplicated chromosome, we show that the chromosome IV’s duplication effect is largely due to the generation of a second copy of the stress-inducible cytoplasmic thioredoxin peroxidase TSA2. Our findings add to a growing body of literature that shows the conditionally beneficial effects of chromosomal duplication are typically mediated by a small number of genes that enhance tolerance to specific stresses when their copy numbers are increased.

  20. The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.

    Science.gov (United States)

    Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P

    2017-07-31

    The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.

  1. Characterization and evolution of conserved MicroRNA through duplication events in date palm (Phoenix dactylifera.

    Directory of Open Access Journals (Sweden)

    Yong Xiao

    Full Text Available MicroRNAs (miRNAs are important regulators of gene expression at the post-transcriptional level in a wide range of species. Highly conserved miRNAs regulate ancestral transcription factors common to all plants, and control important basic processes such as cell division and meristem function. We selected 21 conserved miRNA families to analyze the distribution and maintenance of miRNAs. Recently, the first genome sequence in Palmaceae was released: date palm (Phoenix dactylifera. We conducted a systematic miRNA analysis in date palm, computationally identifying and characterizing the distribution and duplication of conserved miRNAs in this species compared to other published plant genomes. A total of 81 miRNAs belonging to 18 miRNA families were identified in date palm. The majority of miRNAs in date palm and seven other well-studied plant species were located in intergenic regions and located 4 to 5 kb away from the nearest protein-coding genes. Sequence comparison showed that 67% of date palm miRNA members were present in duplicated segments, and that 135 pairs of miRNA-containing segments were duplicated in Arabidopsis, tomato, orange, rice, apple, poplar and soybean with a high similarity of non coding sequences between duplicated segments, indicating genomic duplication was a major force for expansion of conserved miRNAs. Duplicated miRNA pairs in date palm showed divergence in pre-miRNA sequence and in number of promoters, implying that these duplicated pairs may have undergone divergent evolution. Comparisons between date palm and the seven other plant species for the gain/loss of miR167 loci in an ancient segment shared between monocots and dicots suggested that these conserved miRNAs were highly influenced by and diverged as a result of genomic duplication events.

  2. Characterization and Evolution of Conserved MicroRNA through Duplication Events in Date Palm (Phoenix dactylifera)

    Science.gov (United States)

    Yang, Yaodong; Mason, Annaliese S.; Lei, Xintao; Ma, Zilong

    2013-01-01

    MicroRNAs (miRNAs) are important regulators of gene expression at the post-transcriptional level in a wide range of species. Highly conserved miRNAs regulate ancestral transcription factors common to all plants, and control important basic processes such as cell division and meristem function. We selected 21 conserved miRNA families to analyze the distribution and maintenance of miRNAs. Recently, the first genome sequence in Palmaceae was released: date palm (Phoenix dactylifera). We conducted a systematic miRNA analysis in date palm, computationally identifying and characterizing the distribution and duplication of conserved miRNAs in this species compared to other published plant genomes. A total of 81 miRNAs belonging to 18 miRNA families were identified in date palm. The majority of miRNAs in date palm and seven other well-studied plant species were located in intergenic regions and located 4 to 5 kb away from the nearest protein-coding genes. Sequence comparison showed that 67% of date palm miRNA members were present in duplicated segments, and that 135 pairs of miRNA-containing segments were duplicated in Arabidopsis, tomato, orange, rice, apple, poplar and soybean with a high similarity of non coding sequences between duplicated segments, indicating genomic duplication was a major force for expansion of conserved miRNAs. Duplicated miRNA pairs in date palm showed divergence in pre-miRNA sequence and in number of promoters, implying that these duplicated pairs may have undergone divergent evolution. Comparisons between date palm and the seven other plant species for the gain/loss of miR167 loci in an ancient segment shared between monocots and dicots suggested that these conserved miRNAs were highly influenced by and diverged as a result of genomic duplication events. PMID:23951162

  3. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae).

    Science.gov (United States)

    Zevering, C E; Moritz, C; Heideman, A; Sturm, R A

    1991-11-01

    Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.

  4. Do Children Think that Duplicating the Body also Duplicates the Mind?

    Science.gov (United States)

    Hood, Bruce; Gjersoe, Nathalia L.; Bloom, Paul

    2012-01-01

    Philosophers use hypothetical duplication scenarios to explore intuitions about personal identity. Here we examined 5- to 6-year-olds' intuitions about the physical properties and memories of a live hamster that is apparently duplicated by a machine. In Study 1, children thought that more of the original's physical properties than episodic…

  5. Assessing duplication and loss of APETALA1/FRUITFULL homologs in Ranunculales

    Directory of Open Access Journals (Sweden)

    Natalia ePabon-Mora

    2013-09-01

    Full Text Available Gene duplication and loss provide raw material for evolutionary change within organismal lineages as functional diversification of gene copies provide a mechanism for phenotypic variation. Here we focus on the APETALA1/FRUITFULL MADS-box gene lineage evolution. AP1/FUL genes are angiosperm-specific and have undergone several duplications. By far the most significant one is the core-eudicot duplication resulting in the euAP1 and euFUL clades. Functional characterization of several euAP1 and euFUL genes has shown that both function in proper floral meristem identity, and axillary meristem repression. Independently, euAP1 genes function in floral meristem and sepal identity, whereas euFUL genes control phase transition, cauline leaf growth, compound leaf morphogenesis and fruit development. Significant functional variation has been detected in the function of pre-duplication basal-eudicot FUL-like genes, but the underlying mechanisms for change have not been identified. FUL-like genes in the Papaveraceae encode all functions reported for euAP1 and euFUL genes, whereas FUL-like genes in Aquilegia (Ranunculaceae function in inflorescence development and leaf complexity, but not in flower or fruit development. Here we isolated FUL-like genes across the Ranunculales and used phylogenetic approaches to analyze their evolutionary history. We identified an early duplication resulting in the RanFL1 and RanFL2 clades. RanFL1 genes were present in all the families sampled and are mostly under strong negative selection in the MADS, I and K domains. RanFL2 genes were only identified from Eupteleaceae, Papaveraceae s.l., Menispermaceae and Ranunculaceae and show relaxed purifying selection at the I and K domains. We discuss how asymmetric sequence diversification, new motifs, differences in codon substitutions and likely protein-protein interactions resulting from this Ranunculiid-specific duplication can help explain the functional differences among basal

  6. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer

    International Nuclear Information System (INIS)

    Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander

    2005-01-01

    The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer

  7. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders

    Science.gov (United States)

    Isles, Anthony R.; Ingason, Andrés; Lowther, Chelsea; Gawlick, Micha; Stöber, Gerald; Potter, Harry; Georgieva, Lyudmila; Pizzo, Lucilla; Ozaki, Norio; Kushima, Itaru; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F.; Gejman, Pablo V.; Shi, Jianxin; Sanders, Alan R.; Duan, Jubao; Sisodiya, Sanjay; Costain, Gregory; Degenhardt, Franziska; Giegling, Ina; Rujescu, Dan; Hreidarsson, Stefan J.; Saemundsen, Evald; Ahn, Joo Wook; Ogilvie, Caroline; Stefansson, Hreinn; Stefansson, Kari; O’Donovan, Michael C.; Owen, Michael J.; Bassett, Anne; Kirov, George

    2016-01-01

    Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS) region have been associated with developmental delay (DD), autism spectrum disorder (ASD) and schizophrenia (SZ). Due to presence of imprinted genes within the region, the parental origin of these duplications may be key to the pathogenicity. Duplications of maternal origin are associated with disease, whereas the pathogenicity of paternal ones is unclear. To clarify the role of maternal and paternal duplications, we conducted the largest and most detailed study to date of parental origin of 15q11.2-q13.3 interstitial duplications in DD, ASD and SZ cohorts. We show, for the first time, that paternal duplications lead to an increased risk of developing DD/ASD/multiple congenital anomalies (MCA), but do not appear to increase risk for SZ. The importance of the epigenetic status of 15q11.2-q13.3 duplications was further underlined by analysis of a number of families, in which the duplication was paternally derived in the mother, who was unaffected, whereas her offspring, who inherited a maternally derived duplication, suffered from psychotic illness. Interestingly, the most consistent clinical characteristics of SZ patients with 15q11.2-q13.3 duplications were learning or developmental problems, found in 76% of carriers. Despite their lower pathogenicity, paternal duplications are less frequent in the general population with a general population prevalence of 0.0033% compared to 0.0069% for maternal duplications. This may be due to lower fecundity of male carriers and differential survival of embryos, something echoed in the findings that both types of duplications are de novo in just over 50% of cases. Isodicentric chromosome 15 (idic15) or interstitial triplications were not observed in SZ patients or in controls. Overall, this study refines the distinct roles of maternal and paternal interstitial duplications at 15q11.2-q13.3, underlining the critical importance of maternally

  8. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders.

    Directory of Open Access Journals (Sweden)

    Anthony R Isles

    2016-05-01

    Full Text Available Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS region have been associated with developmental delay (DD, autism spectrum disorder (ASD and schizophrenia (SZ. Due to presence of imprinted genes within the region, the parental origin of these duplications may be key to the pathogenicity. Duplications of maternal origin are associated with disease, whereas the pathogenicity of paternal ones is unclear. To clarify the role of maternal and paternal duplications, we conducted the largest and most detailed study to date of parental origin of 15q11.2-q13.3 interstitial duplications in DD, ASD and SZ cohorts. We show, for the first time, that paternal duplications lead to an increased risk of developing DD/ASD/multiple congenital anomalies (MCA, but do not appear to increase risk for SZ. The importance of the epigenetic status of 15q11.2-q13.3 duplications was further underlined by analysis of a number of families, in which the duplication was paternally derived in the mother, who was unaffected, whereas her offspring, who inherited a maternally derived duplication, suffered from psychotic illness. Interestingly, the most consistent clinical characteristics of SZ patients with 15q11.2-q13.3 duplications were learning or developmental problems, found in 76% of carriers. Despite their lower pathogenicity, paternal duplications are less frequent in the general population with a general population prevalence of 0.0033% compared to 0.0069% for maternal duplications. This may be due to lower fecundity of male carriers and differential survival of embryos, something echoed in the findings that both types of duplications are de novo in just over 50% of cases. Isodicentric chromosome 15 (idic15 or interstitial triplications were not observed in SZ patients or in controls. Overall, this study refines the distinct roles of maternal and paternal interstitial duplications at 15q11.2-q13.3, underlining the critical importance of

  9. Origin of the duplicated regions in the yeast genomes

    DEFF Research Database (Denmark)

    Piskur, Jure

    2001-01-01

    The genome of Saccharomyces cerevisiae contains several duplicated regions. The recent sequencing results of several yeast species suggest that the duplicated regions found in the modern Saccharomyces species are probably the result of a single gross duplication, as well as a series of sporadic...... independent short-segment duplications. The gross duplication might coincide with the origin of the ability to grow under anaerobic conditions....

  10. Dispensability of the major coat protein of oat blue dwarf virus in genome replication: Substitution of the open reading frame with the enhanced green fluorescent protein gene

    Science.gov (United States)

    Oat blue dwarf virus (OBDV) is a representative marafivirus that infects monocots and a limited number of dicot species and is vectored propagatively by the leafhopper Macrosteles fascifrons.Recently, we reported the generation of clone pOBDV-2r, the first clone of a marafivirus from which infectiou...

  11. Blue cures blue but be cautious

    Directory of Open Access Journals (Sweden)

    Pranav Sikka

    2011-01-01

    Full Text Available Methemoglobinemia is a disorder characterized by the presence of >1% methemoglobin (metHb in the blood. Spontaneous formation of methemoglobin is normally counteracted by protective enzyme systems, for example, nicotinamide adenine dinucleotide phosphate (NADPH methemoglobin reductase. Methemoglobinemia is treated with supplemental oxygen and methylene blue (1-2 mg/kg administered slow intravenously, which acts by providing an artificial electron acceptor for NADPH methemoglobin reductase. But known or suspected glucose-6-phosphate dehydrogenase (G6PD deficiency is a relative contraindication to the use of methylene blue because G6PD is the key enzyme in the formation of NADPH through pentose phosphate pathway and G6PD-deficient individuals generate insufficient NADPH to efficiently reduce methylene blue to leukomethylene blue, which is necessary for the activation of the NADPH-dependent methemoglobin reductase system. So, we should be careful using methylene blue in methemoglobinemia patient before G6PD levels.

  12. Colour variation in red grapevines (Vitis vinifera L.): genomic organisation, expression of flavonoid 3 '-hydroxylase, flavonoid 3 ',5 '-hydroxylase genes and related metabolite profiling of red cyanidin-/blue delphinidin-based anthocyanins in berry skin

    OpenAIRE

    Castellarin, Simone D; di Gaspero, Gabriele; Marconi, Raffaella; Nonis, Alberto; Peterlunger, Enrico; Paillard, Sophie; Adam-Blondon, Anne-Francoise; Testolin, Raffaele

    2006-01-01

    Abstract Background Structural genes of the phenyl-propanoid pathway which encode flavonoid 3'- and 3',5'-hydroxylases (F3'H and F3'5'H) have long been invoked to explain the biosynthesis of cyanidin- and delphinidin-based anthocyanin pigments in the so-called red cultivars of grapevine. The relative proportion of the two types of anthocyanins is largely under genetic control and determines the colour variation among red/purple/blue berry grape varieties and their corresponding wines. Results...

  13. Blue-Green Algae

    Science.gov (United States)

    ... people with hepatitis C or hepatitis B. HIV/AIDS. Research on the effects of blue-green algae in people with HIV/AIDS has been inconsistent. Some early research shows that taking 5 grams of blue-green ...

  14. Prenatal diagnosis of foetuses with congenital abnormalities and duplication of the MECP2 region.

    Science.gov (United States)

    Fu, Fang; Liu, Huan-ling; Li, Ru; Han, Jin; Yang, Xin; Min, Pan; Zhen, Li; Zhang, Yong-ling; Xie, Gui-e; Lei, Ting-ying; Li, Yan; Li, Jian; Li, Dong-zhi; Liao, Can

    2014-08-10

    MECP2 duplication results in a well-recognised syndrome in 100% of affected male children; this syndrome is characterised by severe neurodevelopmental disabilities and recurrent infections. However, no sonographic findings have been reported for affected foetuses, and prenatal molecular diagnosis has not been possible for this disease due to lack of prenatal clinical presentation. In this study, we identified a small duplication comprising the MECP2 and L1CAM genes in the Xq28 region in a patient from a family with severe X-linked mental retardation and in a prenatal foetus with brain structural abnormalities. Using high-resolution chromosome microarray analysis (CMA) to screen 108 foetuses with congenital structural abnormalities, we identified additional three foetuses with the MECP2 duplication. Our study indicates that ventriculomegaly, hydrocephalus, agenesis of the corpus callosum, choroid plexus cysts, foetal growth restriction and hydronephrosis might be common ultrasound findings in prenatal foetuses with the MECP2 duplication and provides the first set of prenatal cases with MECP2 duplication, the ultrasonographic phenotype described in these patients will help to recognise the foetuses with possible MECP2 duplication and prompt the appropriate molecular testing. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Altered serotonin, dopamine and norepinepherine levels in 15q duplication and Angelman syndrome mouse models.

    Directory of Open Access Journals (Sweden)

    M Febin Farook

    Full Text Available Childhood neurodevelopmental disorders like Angelman syndrome and autism may be the result of underlying defects in neuronal plasticity and ongoing problems with synaptic signaling. Some of these defects may be due to abnormal monoamine levels in different regions of the brain. Ube3a, a gene that causes Angelman syndrome (AS when maternally deleted and is associated with autism when maternally duplicated has recently been shown to regulate monoamine synthesis in the Drosophila brain. Therefore, we examined monoamine levels in striatum, ventral midbrain, frontal cerebral cortex, cerebellar cortex and hippocampus in Ube3a deficient and Ube3a duplication animals. We found that serotonin (5HT, a monoamine affected in autism, was elevated in the striatum and cortex of AS mice. Dopamine levels were almost uniformly elevated compared to control littermates in the striatum, midbrain and frontal cortex regardless of genotype in Ube3a deficient and Ube3a duplication animals. In the duplication 15q autism mouse model, paternal but not maternal duplication animals showed a decrease in 5HT levels when compared to their wild type littermates, in accordance with previously published data. However, maternal duplication animals show no significant changes in 5HT levels throughout the brain. These abnormal monoamine levels could be responsible for many of the behavioral abnormalities observed in both AS and autism, but further investigation is required to determine if any of these changes are purely dependent on Ube3a levels in the brain.

  16. Small homologous blocks in phytophthora genomes do not point to an ancient whole-genome duplication.

    Science.gov (United States)

    van Hooff, Jolien J E; Snel, Berend; Seidl, Michael F

    2014-05-01

    Genomes of the plant-pathogenic genus Phytophthora are characterized by small duplicated blocks consisting of two consecutive genes (2HOM blocks) and by an elevated abundance of similarly aged gene duplicates. Both properties, in particular the presence of 2HOM blocks, have been attributed to a whole-genome duplication (WGD) at the last common ancestor of Phytophthora. However, large intraspecies synteny-compelling evidence for a WGD-has not been detected. Here, we revisited the WGD hypothesis by deducing the age of 2HOM blocks. Two independent timing methods reveal that the majority of 2HOM blocks arose after divergence of the Phytophthora lineages. In addition, a large proportion of the 2HOM block copies colocalize on the same scaffold. Therefore, the presence of 2HOM blocks does not support a WGD at the last common ancestor of Phytophthora. Thus, genome evolution of Phytophthora is likely driven by alternative mechanisms, such as bursts of transposon activity.

  17. Demonstration of the Coexistence of Duplicated LH Receptors in Teleosts, and Their Origin in Ancestral Actinopterygians.

    Directory of Open Access Journals (Sweden)

    Gersende Maugars

    Full Text Available Pituitary gonadotropins, FSH and LH, control gonad activity in vertebrates, via binding to their respective receptors, FSHR and LHR, members of GPCR superfamily. Until recently, it was accepted that gnathostomes possess a single FSHR and a single LHR, encoded by fshr and lhcgr genes. We reinvestigated this question, focusing on vertebrate species of key-phylogenetical positions. Genome analyses supported the presence of a single fshr and a single lhcgr in chondrichthyans, and in sarcopterygians including mammals, birds, amphibians and coelacanth. In contrast, we identified a single fshr but two lhgcr in basal teleosts, the eels. We further showed the coexistence of duplicated lhgcr in other actinopterygians, including a non-teleost, the gar, and other teleosts, e.g. Mexican tetra, platyfish, or tilapia. Phylogeny and synteny analyses supported the existence in actinopterygians of two lhgcr paralogs (lhgcr1/ lhgcr2, which do not result from the teleost-specific whole-genome duplication (3R, but likely from a local gene duplication that occurred early in the actinopterygian lineage. Due to gene losses, there was no impact of 3R on the number of gonadotropin receptors in extant teleosts. Additional gene losses during teleost radiation, led to a single lhgcr (lhgcr1 or lhgcr2 in some species, e.g. medaka and zebrafish. Sequence comparison highlighted divergences in the extracellular and intracellular domains of the duplicated lhgcr, suggesting differential properties such as ligand binding and activation mechanisms. Comparison of tissue distribution in the European eel, revealed that fshr and both lhgcr transcripts are expressed in the ovary and testis, but are differentially expressed in non-gonadal tissues such as brain or eye. Differences in structure-activity relationships and tissue expression may have contributed as selective drives in the conservation of the duplicated lhgcr. This study revises the evolutionary scenario and nomenclature of

  18. Bladder exstrophy associated with complete urethral duplication ...

    African Journals Online (AJOL)

    J.E. Mensah

    ees.elsevier.com/afju · www.sciencedirect.com. Case report. Bladder exstrophy associated with complete urethral duplication: Bladder can be augmented with dorsal urethral mucosa. J.E. Mensaha,∗. , K.N. Ampadua, M.Y. Kyeia, B. Edusieb.

  19. Case Report Duplication Of Gastrointestinal Tract

    African Journals Online (AJOL)

    intact diaphragm, and normal anatomical location of the stomach and liver with signs of jejunal duplication. A right thoracotomy then revealed a large spherical mass in the right chest cavity with collapsed lung. There was relative fixity of the mass to the esophagus and posterior mediastinum. Careful mobilization showed.

  20. Monosomic analysis reveals duplicated chromosomal segments in ...

    Indian Academy of Sciences (India)

    Monosomic analysis reveals duplicated chromosomal segments in maize genome. MAHESH C. YADAV1,2∗, J. K. S. ... cated chromosomal segments in maize genome. Materials and methods. Development and .... each in chromosomes 2 and 7, while 10 other pairs of du- plicate loci had one copy in chromosome 3 and the ...

  1. INDEPENDENT DE-DUPLICATION IN DATA CLEANING

    Directory of Open Access Journals (Sweden)

    Ajumobi Udechukwu

    2012-07-01

    Full Text Available Many organizations collect large amounts of data to support their business anddecision-making processes. The data originate from a variety of sources that may haveinherent data-quality problems. These problems become more pronounced whenheterogeneous data sources are integrated (for example, in data warehouses. A majorproblem that arises from integrating different databases is the existence of duplicates. Thechallenge of de-duplication is identifying “equivalent” records within the database. Mostpublished research in de-duplication propose techniques that rely heavily on domainknowledge. A few others propose solutions that are partially domain-independent. Thispaper identifies two levels of domain-independence in de-duplication namely: domainindependenceat the attribute level, and domain-independence at the record level. Thepaper then proposes a positional algorithm that achieves domain-independent deduplicationat the attribute level, and a technique for field weighting by data profiling,which, when used with the positional algorithm, achieves domain-independence at therecord level. Experiments show that the proposed techniques achieve more accurate deduplicationthan the existing algorithms.

  2. Duplication of appendix: an accidental finding

    OpenAIRE

    Varshney, Manoranjan; Shahid, Mohammad; Maheshwari, Veena; Mubeen, Aysha; Gaur, Kavita

    2011-01-01

    Duplication of appendix is extremely rare anomaly. The reported incidence is 0.004–0.009%. In most of the cases the finding is accidental. Here the authors are presenting a case of type A duplex appendix in a 25-year male patient.

  3. 20 CFR 410.705 - Duplicate claims.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Duplicate claims. 410.705 Section 410.705 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Rules for the Review of Denied and Pending Claims Under the Black Lung...

  4. Translocations used to generate chromosome segment duplications ...

    Indian Academy of Sciences (India)

    †Dedicated to the memory of our colleague T Bhavani Prasanna. Abbreviations used: Dp, duplication; Df, deficiency; ITs, insertional translocations; LG, lineage group; OR, Oak Ridge; ORFs, open reading frames; PCR, polymerase chain reaction; QTs, quasiterminal translocations; RIP, repeat-induced point mutation.

  5. Duplicated Publication Fundamentals for Student Periodicals.

    Science.gov (United States)

    Columbia Scholastic Press Association, New York, NY.

    This handbook provides the 1973 basic principles of the Columbia Scholastic Press Association for determining the quality of high school and college student periodicals which are intended for duplication. The handbook begins with an explanation of rating procedures used in this evaluation and then provides sample scorebooks for student newspapers,…

  6. Incomplete urethral duplication in an adult male.

    LENUS (Irish Health Repository)

    Davis, N F

    2012-09-01

    Urethral duplication is a rare congenital anomaly with less than 200 cases reported. It predominantly occurs in males and is nearly always diagnosed in childhood or adolescence. It is defined as a complete second passage from the bladder to the dorsum of the penis or as an accessory pathway that ends blindly on the dorsal or ventral surface.

  7. Genome structure analysis of molluscs revealed whole genome duplication and lineage specific repeat variation.

    Science.gov (United States)

    Yoshida, Masa-aki; Ishikura, Yukiko; Moritaki, Takeya; Shoguchi, Eiichi; Shimizu, Kentaro K; Sese, Jun; Ogura, Atsushi

    2011-09-01

    Comparative genome structure analysis allows us to identify novel genes, repetitive sequences and gene duplications. To explore lineage-specific genomic changes of the molluscs that is good model for development of nervous system in invertebrate, we conducted comparative genome structure analyses of three molluscs, pygmy squid, nautilus and scallops using partial genome shotgun sequencing. Most effective elements on the genome structural changes are repetitive elements (REs) causing expansion of genome size and whole genome duplication producing large amount of novel functional genes. Therefore, we investigated variation and proportion of REs and whole genome duplication. We, first, identified variations of REs in the three molluscan genomes by homology-based and de novo RE detection. Proportion of REs were 9.2%, 4.0%, and 3.8% in the pygmy squid, nautilus and scallop, respectively. We, then, estimated genome size of the species as 2.1, 4.2 and 1.8 Gb, respectively, with 2× coverage frequency and DNA sequencing theory. We also performed a gene duplication assay based on coding genes, and found that large-scale duplication events occurred after divergence from the limpet Lottia, an out-group of the three molluscan species. Comparison of all the results suggested that RE expansion did not relate to the increase in genome size of nautilus. Despite close relationships to nautilus, the squid has the largest portion of REs and smaller genome size than nautilus. We also identified lineage-specific RE and gene-family expansions, possibly relate to acquisition of the most complicated eye and brain systems in the three species. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Multiple independent origins of mitochondrial control region duplications in the order Psittaciformes

    DEFF Research Database (Denmark)

    Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.

    2012-01-01

    Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified ...

  9. Our experience with unusual gastrointestinal tract duplications in infants

    Directory of Open Access Journals (Sweden)

    Bilal Mirza

    2014-01-01

    Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.

  10. Fine mapping of a de novo interstitial 10q22-q23 duplication in a patient with congenital heart disease and microcephaly

    DEFF Research Database (Denmark)

    Erdogan, F; Belloso, J M; Gabau, E

    2008-01-01

    In this study we report a female patient with an interstitial duplication of a region (10q22-q23) which is rarely reported in the literature. We fine mapped the aberration with array CGH, which revealed an 18.6-Mb duplication, covering 89 annotated genes, at 10q22.2-q23.33. There were no other...

  11. Presentation and Surgical Management of Duodenal Duplication in Adults

    Directory of Open Access Journals (Sweden)

    Caroline C. Jadlowiec

    2015-01-01

    Full Text Available Duodenal duplications in adults are exceedingly rare and their diagnosis remains difficult as symptoms are largely nonspecific. Clinical presentations include pancreatitis, biliary obstruction, gastrointestinal bleeding from ectopic gastric mucosa, and malignancy. A case of duodenal duplication in a 59-year-old female is presented, and her treatment course is reviewed with description of combined surgical and endoscopic approach to repair, along with a review of historic and current recommendations for management. Traditionally, gastrointestinal duplications have been treated with surgical resection; however, for duodenal duplications, the anatomic proximity to the biliopancreatic ampulla makes surgical management challenging. Recently, advances in endoscopy have improved the clinical success of cystic intraluminal duodenal duplications. Despite these advances, surgical resection is still recommended for extraluminal tubular duplications although combined techniques may be necessary for long tubular duplications. For duodenal duplications, a combined approach of partial excision combined with mucosal stripping may offer advantage.

  12. Genomic Analysis of the Basal Lineage Fungus Rhizopus oryzae Reveals a Whole-Genome Duplication

    Science.gov (United States)

    Ma, Li-Jun; Ibrahim, Ashraf S.; Skory, Christopher; Grabherr, Manfred G.; Burger, Gertraud; Butler, Margi; Elias, Marek; Idnurm, Alexander; Lang, B. Franz; Sone, Teruo; Abe, Ayumi; Calvo, Sarah E.; Corrochano, Luis M.; Engels, Reinhard; Fu, Jianmin; Hansberg, Wilhelm; Kim, Jung-Mi; Kodira, Chinnappa D.; Koehrsen, Michael J.; Liu, Bo; Miranda-Saavedra, Diego; O'Leary, Sinead; Ortiz-Castellanos, Lucila; Poulter, Russell; Rodriguez-Romero, Julio; Ruiz-Herrera, José; Shen, Yao-Qing; Zeng, Qiandong; Galagan, James; Birren, Bruce W.

    2009-01-01

    Rhizopus oryzae is the primary cause of mucormycosis, an emerging, life-threatening infection characterized by rapid angioinvasive growth with an overall mortality rate that exceeds 50%. As a representative of the paraphyletic basal group of the fungal kingdom called “zygomycetes,” R. oryzae is also used as a model to study fungal evolution. Here we report the genome sequence of R. oryzae strain 99–880, isolated from a fatal case of mucormycosis. The highly repetitive 45.3 Mb genome assembly contains abundant transposable elements (TEs), comprising approximately 20% of the genome. We predicted 13,895 protein-coding genes not overlapping TEs, many of which are paralogous gene pairs. The order and genomic arrangement of the duplicated gene pairs and their common phylogenetic origin provide evidence for an ancestral whole-genome duplication (WGD) event. The WGD resulted in the duplication of nearly all subunits of the protein complexes associated with respiratory electron transport chains, the V-ATPase, and the ubiquitin–proteasome systems. The WGD, together with recent gene duplications, resulted in the expansion of multiple gene families related to cell growth and signal transduction, as well as secreted aspartic protease and subtilase protein families, which are known fungal virulence factors. The duplication of the ergosterol biosynthetic pathway, especially the major azole target, lanosterol 14α-demethylase (ERG11), could contribute to the variable responses of R. oryzae to different azole drugs, including voriconazole and posaconazole. Expanded families of cell-wall synthesis enzymes, essential for fungal cell integrity but absent in mammalian hosts, reveal potential targets for novel and R. oryzae-specific diagnostic and therapeutic treatments. PMID:19578406

  13. Duplicatio of CYP2D6 predicts high clearance of desipramine but high clearance does not predict duplication of CYP2D6

    DEFF Research Database (Denmark)

    Bergmann, T K; Bathum, L; Brøsen, Kim

    2001-01-01

    a duplicated allele. The question is whether gene duplication is a relatively rare cause (perhaps predictor) of very rapid metabolism or whether a low metabolic ratio is a poor predictor of this. METHODS: After measuring metabolic ratios anew, we selected six volunteers with duplication of CYP2D6 and metabolic...... ratios ranging from 0.07 to 0.17 and six volunteers without duplication with metabolic ratios ranging from 0.08 to 0.21. Each subject took 100 mg of desipramine. Blood and urine were collected for 48 h. RESULTS: The median total oral clearance of desipramine was 372 l/h and 196 l/h [median difference 108...... of duplication of CYP2D6 is poor; there must be other causes (or predictors) of very rapid metabolism and with much higher frequency than duplication of CYP2D6....

  14. The role of duplications in the evolution of genomes highlights the need for evolutionary-based approaches in comparative genomics

    Directory of Open Access Journals (Sweden)

    Levasseur Anthony

    2011-02-01

    Full Text Available Abstract Understanding the evolutionary plasticity of the genome requires a global, comparative approach in which genetic events are considered both in a phylogenetic framework and with regard to population genetics and environmental variables. In the mechanisms that generate adaptive and non-adaptive changes in genomes, segmental duplications (duplication of individual genes or genomic regions and polyploidization (whole genome duplications are well-known driving forces. The probability of fixation and maintenance of duplicates depends on many variables, including population sizes and selection regimes experienced by the corresponding genes: a combination of stochastic and adaptive mechanisms has shaped all genomes. A survey of experimental work shows that the distinction made between fixation and maintenance of duplicates still needs to be conceptualized and mathematically modeled. Here we review the mechanisms that increase or decrease the probability of fixation or maintenance of duplicated genes, and examine the outcome of these events on the adaptation of the organisms. Reviewers This article was reviewed by Dr. Etienne Joly, Dr. Lutz Walter and Dr. W. Ford Doolittle.

  15. Identifying Tracks Duplicates via Neural Network

    CERN Document Server

    Sunjerga, Antonio; CERN. Geneva. EP Department

    2017-01-01

    The goal of the project is to study feasibility of state of the art machine learning techniques in track reconstruction. Machine learning techniques provide promising ways to speed up the pattern recognition of tracks by adding more intelligence in the algorithms. Implementation of neural network to process of track duplicates identifying will be discussed. Different approaches are shown and results are compared to method that is currently in use.

  16. A molecularly defined duplication set for the X chromosome of Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.

    2010-07-22

    We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

  17. A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.

    Science.gov (United States)

    Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C

    2010-12-01

    We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

  18. Unilateral Pulmonary Agenesis and Gastric Duplication Cyst: A Rare Association

    OpenAIRE

    Halilbasic, Amir; Skokic, Fahrija; Hotic, Nesad; Husaric, Edin; Radoja, Gordana; Muratovic, Selma; Dedic, Nermina; Halilbasic, Meliha

    2013-01-01

    Lung agenesis and gastric duplication cysts are both rare congenital anomalies. Gastric duplication cysts can present with nausea, vomiting, hematemesis, or vague abdominal pain. Unilateral pulmonary agenesis can present with respiratory distress which usually occurs due to retention of bronchial secretions and inflammations. We report the unique case of right pulmonary agenesis associated with gastric duplication cyst.

  19. Genetics Home Reference: 22q11.2 duplication

    Science.gov (United States)

    ... Facebook Twitter Home Health Conditions 22q11.2 duplication 22q11.2 duplication Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description 22q11.2 duplication is a condition caused by an extra ...

  20. Noncommunicating isolated enteric duplication cyst in the abdomen ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplication cyst in the abdomen in children: report of one case and review of the literature. Hyun-Young Kim, Soo-Hong Kim, Kwi-Won Park and Sung-Eun Jung. Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their ...

  1. The E2F-DP1 Transcription Factor Complex Regulates Centriole Duplication in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Jacqueline G. Miller

    2016-03-01

    Full Text Available Centrioles play critical roles in the organization of microtubule-based structures, from the mitotic spindle to cilia and flagella. In order to properly execute their various functions, centrioles are subjected to stringent copy number control. Central to this control mechanism is a precise duplication event that takes place during S phase of the cell cycle and involves the assembly of a single daughter centriole in association with each mother centriole . Recent studies have revealed that posttranslational control of the master regulator Plk4/ZYG-1 kinase and its downstream effector SAS-6 is key to ensuring production of a single daughter centriole. In contrast, relatively little is known about how centriole duplication is regulated at a transcriptional level. Here we show that the transcription factor complex EFL-1-DPL-1 both positively and negatively controls centriole duplication in the Caenorhabditis elegans embryo. Specifically, we find that down regulation of EFL-1-DPL-1 can restore centriole duplication in a zyg-1 hypomorphic mutant and that suppression of the zyg-1 mutant phenotype is accompanied by an increase in SAS-6 protein levels. Further, we find evidence that EFL-1-DPL-1 promotes the transcription of zyg-1 and other centriole duplication genes. Our results provide evidence that in a single tissue type, EFL-1-DPL-1 sets the balance between positive and negative regulators of centriole assembly and thus may be part of a homeostatic mechanism that governs centriole assembly.

  2. Catalytic activity, duplication and evolution of the CYP98 cytochrome P450 family in wheat.

    Science.gov (United States)

    Morant, Marc; Schoch, Guillaume A; Ullmann, Pascaline; Ertunç, Tanya; Little, Dawn; Olsen, Carl Erik; Petersen, Maike; Negrel, Jonathan; Werck-Reichhart, Danièle

    2007-01-01

    A burst of evolutionary duplication upon land colonization seems to have led to the large superfamily of cytochromes P450 in higher plants. Within this superfamily some clans and families are heavily duplicated. Others, such as genes involved in the phenylpropanoid pathway have led to fewer duplication events. Eight coding sequences belonging to the CYP98 family reported to catalyze the 3-hydroxylation step in this pathway were isolated from Triticum aestivum (wheat) and expressed in yeast. Comparison of the catalytic properties of the recombinant enzymes with those of CYP98s from other plant taxa was coupled to phylogenetic analyses. Our results indicate that the unusually high frequency of gene duplication in the wheat CYP98 family is a direct or indirect result from ploidization. While ancient duplication led to evolution of enzymes with different substrate preferences, most of recent duplicates underwent silencing via degenerative mutations. Three of the eight tested CYP98s from wheat have phenol meta-hydroxylase activity, with p-coumaroylshikimate being the primary substrate for all of these, as it is the case for CYP98s from sweet basil and Arabidopsis thaliana. However, CYP98s from divergent taxa have acquired different additional subsidiary activities. Some of them might be significant in the metabolism of various free or conjugated phenolics in different plant species. One of the most significant is meta-hydroxylation of p-coumaroyltyramine, predominantly by the wheat enzymes, for the synthesis of suberin phenolic monomers. Homology modeling, confirmed by directed mutagenesis, provides information on the protein regions and structural features important for some observed changes in substrate selectivity. They indicate that the metabolism of quinate ester and tyramine amide of p-coumaric acid rely on the same recognition site in the protein.

  3. Quantitative measurement of duplicated DNA as a diagnostic test for Charcot-Marie-Tooth disease type 1a

    NARCIS (Netherlands)

    Hensels, G. W.; Janssen, E. A.; Hoogendijk, J. E.; Valentijn, L. J.; Baas, F.; Bolhuis, P. A.

    1993-01-01

    Charcot-Marie-Tooth disease type 1 (CMT1) is a hereditary motor and sensory neuropathy. The autosomal dominant subtype is often linked with a large duplication on chromosome 17p11.2. The gene encoding the peripheral myelin protein PMP 22 (the critical gene in this subtype of CMT1) is located within

  4. Blue light inhibits proliferation of melanoma cells

    Science.gov (United States)

    Becker, Anja; Distler, Elisabeth; Klapczynski, Anna; Arpino, Fabiola; Kuch, Natalia; Simon-Keller, Katja; Sticht, Carsten; van Abeelen, Frank A.; Gretz, Norbert; Oversluizen, Gerrit

    2016-03-01

    Photobiomodulation with blue light is used for several treatment paradigms such as neonatal jaundice, psoriasis and back pain. However, little is known about possible side effects concerning melanoma cells in the skin. The aim of this study was to assess the safety of blue LED irradiation with respect to proliferation of melanoma cells. For that purpose we used the human malignant melanoma cell line SK-MEL28. Cell proliferation was decreased in blue light irradiated cells where the effect size depended on light irradiation dosage. Furthermore, with a repeated irradiation of the melanoma cells on two consecutive days the effect could be intensified. Fluorescence-activated cell sorting with Annexin V and Propidium iodide labeling did not show a higher number of dead cells after blue light irradiation compared to non-irradiated cells. Gene expression analysis revealed down-regulated genes in pathways connected to anti-inflammatory response, like B cell signaling and phagosome. Most prominent pathways with up-regulation of genes were cytochrome P450, steroid hormone biosynthesis. Furthermore, even though cells showed a decrease in proliferation, genes connected to the cell cycle were up-regulated after 24h. This result is concordant with XTT test 48h after irradiation, where irradiated cells showed the same proliferation as the no light negative control. In summary, proliferation of melanoma cells can be decreased using blue light irradiation. Nevertheless, the gene expression analysis has to be further evaluated and more studies, such as in-vivo experiments, are warranted to further assess the safety of blue light treatment.

  5. Blue Ocean Thinking

    Science.gov (United States)

    Orem, Donna

    2016-01-01

    This article describes a concept called the "blue ocean thinking strategy," developed by W. Chan Kim and Renée Mauborgne, professors at INSEAD, an international graduate school of business in France. The "blue ocean" thinking strategy considers opportunities to create new markets for services, rather than focusing solely on…

  6. How Genes Evolve

    Indian Academy of Sciences (India)

    which they are found e.g. the evolution of the gene coding for the protein cytochrome-C which is part ofthe respiratory apparatus. On the contrary, paralogous genes are descendants of a duplicated gene. Paralogous genes therefore evolve within the same species as well as in different species e.g. genes coding for alpha ...

  7. Genetic Variation at Exon 2 of the MHC Class II DQB Locus in Blue Whale (Balaenoptera musculus) from the Gulf of California.

    Science.gov (United States)

    Moreno-Santillán, Diana D; Lacey, Eileen A; Gendron, Diane; Ortega, Jorge

    2016-01-01

    The genes of the Major Histocompatibility Complex (MHC) play an important role in the vertebrate immune response and are among the most polymorphic genes known in vertebrates. In some marine mammals, MHC genes have been shown to be characterized by low levels of polymorphism compared to terrestrial taxa; this reduction in variation is often explained as a result of lower pathogen pressures in marine habitats. To determine if this same reduction in variation applies to the migratory population of blue whales (Balaenoptera musculus) that occurs in the Gulf of California, we genotyped a 172 bp fragment of exon 2 of the MHC Class II DQB locus for 80 members of this population. Twenty-two putatively functional DQB allotypes were identified, all of which were homologous with DQB sequences from other cetacean species. Up to 5 putative alleles per individual were identified, suggesting that gene duplication has occurred at this locus. Rates of non-synonymous to synonymous substitutions (ω) and maximum likelihood analyses of models of nucleotide variation provided potential evidence of ongoing positive selection at this exon. Phylogenetic analyses of DQB alleles from B. musculus and 16 other species of cetaceans revealed trans-specific conservation of MHC variants, suggesting that selection has acted on this locus over prolonged periods of time. Collectively our findings reveal that immunogenic variation in blue whales is comparable to that in terrestrial mammals, thereby providing no evidence that marine taxa are subject to reduced pathogen-induced selective pressures.

  8. Clinical implications of duplicated mtDNA in Pearson syndrome.

    Science.gov (United States)

    Muraki, K; Sakura, N; Ueda, H; Kihara, H; Goto, Y

    2001-01-22

    We report on a seven-year-old Japanese boy with Pearson syndrome, which is characterized by refractory sideroblastic anemia with vacuolization of marrow precursors and dysfunction of the exocrine pancreas, and caused by mitochondrial (mt) DNA deletions and duplications. Although analysis with Southern hybridization on his bone marrow cells at age one year or on the muscle at age five years did not detect any duplications of mtDNA, an analysis after death at age seven years detected them in the kidney, heart, and even in the bone marrow. Using long PCR to specifically amplify duplicated mtDNA, we found duplications in all biopsy and postmortem samples, indicating that duplications had been present in the patient since his early life, and that the number of duplications increased with age. The results indicate some dynamism in the mtDNA duplication and that the dynamism may imply clinical importance.

  9. A wild 'albino' bilberry (Vaccinium myrtillus L. from Slovenia shows three bottlenecks in the anthocyanin pathway and significant differences in the expression of several regulatory genes compared to the common blue berry type.

    Directory of Open Access Journals (Sweden)

    Zala Zorenc

    Full Text Available Relative expressions of structural genes and a number of transcription factors of the anthocyanin pathway relevant in Vaccinium species, and related key enzyme activities were compared with the composition and content of metabolites in skins of ripe fruits of wild albino and blue bilberry (Vaccinium myrtillus found in Slovenia. Compared to the common blue type, the albino variant had a 151-fold lower total anthocyanin and a 7-fold lower total phenolic content in their berry skin, which correlated with lower gene expression of flavonoid 3-O-glycosyltransferase (FGT; 33-fold, flavanone 3-hydroxylase (FHT; 18-fold, anthocyanidin synthase (ANS; 11-fold, chalcone synthase (CHS, 7.6-fold and MYBPA1 transcription factor (22-fold. The expression of chalcone isomerase (CHI, dihydroflavonol 4-reductase (DFR, leucoanthocyanidin reductase (LAR, anthocyanidin reductase (ANR and MYBC2 transcription factor was reduced only by a factor of 1.5-2 in the albino berry skins, while MYBR3 and flavonoid 3',5'-hydroxylase (F3'5'H were increased to a similar extent. Expression of the SQUAMOSA class transcription factor TDR4, in contrast, was independent of the color type and does therefore not seem to be correlated with anthocyanin formation in this variant. At the level of enzymes, significantly lower FHT and DFR activities, but not of phenylalanine ammonia-lyase (PAL and CHS/CHI, were observed in the fruit skins of albino bilberries. A strong increase in relative hydroxycinnamic acid derivative concentrations indicates the presence of an additional bottleneck in the general phenylpropanoid pathway at a so far unknown step between PAL and CHS.

  10. Atypical autism in a boy with double duplication of 22q11.2: implications of increasing dosage.

    Science.gov (United States)

    Dale, Breanne; Modi, Bonnie MacKinnon; Jilderda, Sanne; McConnell, Beth; Hoang, Ny; Swaroop, Pooja; Falcon, Jhoan; Thiruvahindrapuram, Bhooma; Walker, Susan; Scherer, Stephen W; Stavropoulos, D James; Drmic, Irene E; Carter, Melissa T

    2017-01-01

    Duplication of chromosome 22q11.2 (LCR A-D) has been reported at higher frequencies in clinical samples than the general population, but phenotypes vary widely. Triplication (4 copies) is rare, but studying the associated phenotype may provide insight into dosage-sensitivity of the genes in this chromosomal interval. We describe a proband with a triplication, specifically a "double duplication" (two copies per chromosome) of the 22q11.2 region, while his parents and two siblings each have a single duplication (3 copies). The proband had a heart malformation, dysmorphic features, and learning and socialization deficits, whereas the other family members did not. This family illustrates that while duplication of the 22q11.2 may not be sufficient to cause clinically significant neurodevelopmental or health-related phenotypes, triplication of the same region may result in a phenotype characterized by a mild neurodevelopmental disorder, facial dysmorphism, and possibly cardiac anomalies.

  11. SANCTIONING DUPLICATION IN ADMINISTRATIVE AND PENAL AREAS

    Directory of Open Access Journals (Sweden)

    José Manuel Cabrera Delgado

    2014-12-01

    Full Text Available This article provides a first approach from the point of view of jurisprudence, to the recurring problem of concurrency sanctions in cases where further intervention of the courts has become necessary for administrative action. In this regard, the main judgments of both the Constitutional Court and the Supreme Court is, that have shaped the decisions that must be applied from the administrative level, in particular by educational inspectors, when it is foreseeable that it can produce a duplication of disciplinary procedures in the two areas, penal and administrative.

  12. Blue ocean strategy.

    Science.gov (United States)

    Kim, W Chan; Mauborgne, Renée

    2004-10-01

    Despite a long-term decline in the circus industry, Cirque du Soleil profitably increased revenue 22-fold over the last ten years by reinventing the circus. Rather than competing within the confines of the existing industry or trying to steal customers from rivals, Cirque developed uncontested market space that made the competition irrelevant. Cirque created what the authors call a blue ocean, a previously unknown market space. In blue oceans, demand is created rather than fought over. There is ample opportunity for growth that is both profitable and rapid. In red oceans--that is, in all the industries already existing--companies compete by grabbing for a greater share of limited demand. As the market space gets more crowded, prospects for profits and growth decline. Products turn into commodities, and increasing competition turns the water bloody. There are two ways to create blue oceans. One is to launch completely new industries, as eBay did with online auctions. But it's much more common for a blue ocean to be created from within a red ocean when a company expands the boundaries of an existing industry. In studying more than 150 blue ocean creations in over 30 industries, the authors observed that the traditional units of strategic analysis--company and industry--are of limited use in explaining how and why blue oceans are created. The most appropriate unit of analysis is the strategic move, the set of managerial actions and decisions involved in making a major market-creating business offering. Creating blue oceans builds brands. So powerful is blue ocean strategy, in fact, that a blue ocean strategic move can create brand equity that lasts for decades.

  13. Isolation and Characterization of Blue Green Algae from Egyptian ...

    African Journals Online (AJOL)

    meldemellawy

    2014-02-20

    Feb 20, 2014 ... aminotransferase (AMT) domains of the mycE and ndaF genes (Jungblut et al., 2006) allowing detection of microcystin and nodularin-producing cyanobacteria. MATERIALS AND METHODS. Isolation and cultivation of blue green algae. Blue green algae had been isolated from soil of Rice field in river.

  14. Dealing with duplicate regulations and conflicting jurisdictions

    International Nuclear Information System (INIS)

    Aamodt, P.L.

    1991-01-01

    There are a number of situations where mixed wastes are regulated by dual regulations and regulators. This presentation attempts to show where such duplication exists and how it evolved historically through legislative actions. The presentation includes a discussion of strategies that have been used to deal with the problems that result from duplicate regulations and jurisdictional conflicts. The RCRA and AEA regulations are really more similar than dissimilar. There are significant issues that must be worked through with the regulators. It is most important to work with your regulators early in process. The following are suggestions for dealing with the regulators. (1) Know the regulations in advance of discussions. (2) Begin dialogue with the regulator(s) as early as possible and get to know the people you will be dealing with -- and let them know you. (3) Explain the technical/regulatory issues/problems that you face at your facility in sufficient detail that they are clearly understood, and work with the regulator(s) to reasonably address them in the language/requirements of the permit. (4) Always attempt to comply with the regulations first before going in with a variance request -- document your efforts, and be honest with your assessment of issues. (5) Don't be adversarial -- remember that the regulator has the same objectives as you do. 1 tab

  15. Thermodynamically stable blue phases.

    Science.gov (United States)

    Castles, F; Morris, S M; Terentjev, E M; Coles, H J

    2010-04-16

    We show theoretically that flexoelectricity stabilizes blue phases in chiral liquid crystals. Induced internal polarization reduces the elastic energy cost of splay and bend deformations surrounding singular lines in the director field. The energy of regions of double twist is unchanged. This in turn reduces the free energy of the blue phase with respect to that of the chiral nematic phase, leading to stability over a wider temperature range. The theory explains the discovery of large temperature range blue phases in highly flexoelectric "bimesogenic" and "bent-core" materials, and predicts how this range may be increased further.

  16. Chalcone synthase family genes have redundant roles in anthocyanin biosynthesis and in response to blue/UV-A light in turnip (Brassica rapa; Brassicaceae).

    Science.gov (United States)

    Zhou, Bo; Wang, Yu; Zhan, Yaguang; Li, Yuhua; Kawabata, Saneyuki

    2013-12-01

    The epidermis of Brassica rapa (turnip) cv. Tsuda contains light-induced anthocyanins, visible signs of activity of chalcone synthase (CHS), a key anthocyanin biosynthetic enzyme, which is encoded by the CHS gene family. To elucidate the regulation of this light-induced pigmentation, we isolated Brassica rapa CHS1-CHS6 (BrCHS1-CHS6) and characterized their cis-elements and expression patterns. Epidermises of light-exposed swollen hypocotyls (ESHS) were harvested to analyze transcription levels of BrCHS genes by real-time PCR. Different promoters for the genes were inserted into tobacco to examine pCHS-GUS activity by histochemistry. Yeast-one-hybridization was used to detect binding activity of BrCHS motifs to transcription factors. Transcript levels of BrCHS1, -4, and -5 and anthocyanin-biosynthesis-related genes F3H, DFR, and ANS were high, while those of BrCHS2, -3, and -6 were almost undetectable in pigmented ESHS. However, in leaves, CHS5, F3H, and ANS expression was higher than in nonpigmented ESHS, but transcription of DFR was not detected. In the analysis of BrCHS1 and BrCHS3 promoter activity, GUS activity was strong in pigmented flowers of BrPCHS1-GUS-transformed tobacco plants, but nearly absent in BrPCHS3-GUS-transformed plants. Transcript levels of regulators, BrMYB75 and BrTT8, were strongly associated with the anthocyanin content and were light-induced. Coregulated cis-elements were found in promoters of BrCHS1,-4, and -5, and BrMYB75 and BrTT8 had high binding activities to the BrCHS Unit 1 motif. The chalcone synthase gene family encodes a redundant set of light-responsive, tissue-specific genes that are expressed at different levels and are involved in flavonoid biosynthesis in Tsuda turnip.

  17. A PATIENT WITH PARTIAL CHROMOSOME 12q DUPLICATION AND 10q DELETION.

    Science.gov (United States)

    Saat, H; Soysal, Y; Kurtgoz, S; Ergun, M A; Percin, E F

    2015-01-01

    Chromosomal deletions and/or duplications are relatively common cytogenetic abnormalities. Clinical findings depend on pure or complex forms of the anomaly, the location and size. In those cases, using current analytical technologies increases the possibility of discovering candidate genes that were not detected by conventional karyotyping responsible for these features. Here, we report an 18-month-old girl with prenatal and postnatal growth retardation, secundum ASD and PDA, facial dysmorphic features including frontal bossing, arched eyebrows, hypertelorism, wide nasal bridge and chronic diarrhea. Chromosome analysis on the peripheral leukocytes showed a 46,XX del(10)(q26.3),dup(12)(q24.11-q24.33) dn karyotype. An array-CGH analysis was performed to understand which genes were located on the deletion and duplication regions and what was their relationship with the phenotype. Based on our analyses, the deletion of the CALY gene on Chromosome 10q and the duplication of PTPN11 and TBX5 genes on chromosome 12q were possibly relevant for the clinical findings with our patient.

  18. Case report of individual with cutaneous immunodeficiency and novel 1p36 duplication

    Directory of Open Access Journals (Sweden)

    Hatter AD

    2016-01-01

    Full Text Available Alyn D Hatter,1 David C Soler,2,3 Christine Curtis,4 Kevin D Cooper,1,2,3,5 Thomas S McCormick,2,31University Hospitals Case Medical Center, 2Department of Dermatology, 3The Murdough Family Center for Psoriasis, Case Western Reserve University, 4Cleveland Department of Pathology and Center for Human Genetics Laboratory, 5VA Medical Center, Cleveland, OH, USAIntroduction: Crusted or Norwegian scabies is an infectious skin dermatopathology usually associated with an underlying immunodeficiency condition. It is caused when the mite Sarcoptes scabiei infects the skin, and the immune system is unable to control its spread, leading to a massive hyperinfestation with a simultaneous inflammatory and hyperkeratotic reaction. This is the first report of a novel 1p36 duplication associated with a recurrent infection of crusted scabies.Case report: We describe a 34-year-old patient with a cutaneous immunodeficiency characterized by recurrent crusted scabies infestation, diffuse tinea, and recurrent staphylococcal cellulitis, who we suspected had an undiagnosed syndrome. The patient also suffered from mental retardation, renal failure, and premature senescence. A cytogenetic fluorescence in situ hybridization analysis revealed a 9.34 Mb duplication within the short (p arm of chromosome 1, precisely from 1p36.11 to 1p36.21, with an adjacent 193 kb copy gain entirely within 1p36.11. In addition, chromosome 4 had a 906 kb gain in 4p16.1 and chromosome 9 had a 81 kb copy gain in 9p24.3. Over 100 genes localized within these duplicated regions. Gene expression array revealed 82 genes whose expression changed >1.5-fold compared to a healthy age-matched skin control, but among them only the lipolytic enzyme arylacetamide deacetylase-like 3 was found within the duplicated 1p36 region of chromosome 1.Discussion: Although genetic duplications in the 1p36 region have been previously described, our report describes a novel duplicative variant within the 1p36 region. The

  19. Blue Ribbon Panel Report

    Science.gov (United States)

    An NCI Cancer Currents blog by the NCI acting director thanking the cancer community for contributing to the Cancer Moonshot Blue Ribbon Panel report, which was presented to the National Cancer Advisory Board on September 7.

  20. New York Blue

    Data.gov (United States)

    Federal Laboratory Consortium — New York Blue is used cooperatively by the Laboratory and Stony Brook University as part of the New York Center for Computation Sciences. Ranked as the 28th fastest...

  1. Implications of duplicated cis-regulatory elements in the evolution of metazoans: the DDI model or how simplicity begets novelty.

    Science.gov (United States)

    Jiménez-Delgado, Senda; Pascual-Anaya, Juan; Garcia-Fernàndez, Jordi

    2009-07-01

    The discovery that most regulatory genes were conserved among animals from distant phyla challenged the ideas that gene duplication and divergence of homologous coding sequences were the basis for major morphological changes in metazoan evolution. In recent years, however, the interest for the roles, conservation and changes of non-coding sequences grew-up in parallel with genome sequencing projects. Presently, many independent studies are highlighting the importance that subtle changes in cis-regulatory regions had in the evolution of morphology trough the Animal Kingdom. Here we will show and discuss some of these studies, and underscore the future of cis-Evo-Devo research. Nevertheless, we would also explore how gene duplication, which includes duplication of regulatory regions, may have been critical for spatial or temporal co-option of new regulatory networks, causing the deployment of new transcriptome scenarios, and how these induced morphological changes were critical for the evolution of new forms. Forty years after Susumu Ohno famous sentence 'natural selection merely modifies, while redundancy creates', we suggest the alternative: 'natural selection modifies, while redundancy of cis-regulatory elements innovates', and propose the Duplication-Degeneration-Innovation model to explain the increased evolvability of duplicated cis-regulatory regions. Paradoxically, making regulation simpler by subfunctionalization paved the path for future complexity or, in other words, 'to make it simple to make it complex'.

  2. A novel noncontiguous duplication in the DMD gene escapes the ...

    Indian Academy of Sciences (India)

    2014-04-16

    Apr 16, 2014 ... Centro Médico Nacional 20 de Noviembre, México, C. P. 03100, D.F., México. 2Instituto Nacional de Rehabilitación, Secretaría de Salud, México, C. P. 14389, D.F., México. 3Instituto Politécnico Nacional, Escuela Superior de Medicina, México, C. P. 11340, D.F., México. 4Programa de Medicina Genómica, ...

  3. A novel noncontiguous duplication in the DMD gene escapes the ...

    Indian Academy of Sciences (India)

    2014-04-16

    Apr 16, 2014 ... parents are healthy and the marriage is nonconsanguineous. Family history was negative for neuromuscular disorders. The propositus was born at 35 .... collisions between transcription and replication machineries, whenever the duration of the former is large and of the lat- ter short. This may potentially ...

  4. A novel noncontiguous duplication in the DMD gene escapes the ...

    Indian Academy of Sciences (India)

    Instituto de Seguridad y Servicios Sociales de los Trabajadores del Estado, Subdirección de Enseñanza e Investigación, Centro Médico Nacional 20 de Noviembre, México, C. P. 03100, D.F., México; Instituto Nacional de Rehabilitación, Secretaría de Salud, México, C. P. 14389, D.F., México; Instituto Politécnico Nacional, ...

  5. Concerning the incidence of duplicity among cepheid variables

    International Nuclear Information System (INIS)

    Madore, B.F.; Fernie, J.D.

    1980-01-01

    A 'phase-shift' technique for detecting photometric companions to cepheids is applied to 202 variables. The inferred incidence of duplicity is 35 plus or minus 5%. An earlier 'color-color loop' method suggested 20%-27% duplicity. However, when positive results are required of both methods for a given star, the incidence falls to 15%. This lack of detailed agreement, as well as an apparent correlation of duplicity with period, suggests neither method is infallible

  6. Cholecystitis of a duplicated gallbladder complicated by a cholecystoenteric fistula

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Brady K. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Chess, Mitchell A. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Advanced Imaging, Batavia, NY (United States)

    2009-04-15

    Gallbladder duplications are uncommon anatomic variants that are sometimes mistaken for other entities on imaging. We present a surgically confirmed case of cholecystitis in a ductular-type duplicated gallbladder complicated by the formation of an inflammatory fistula to the adjacent duodenum. Both US and magnetic resonance cholangiopancreatography were performed preoperatively, in addition to intraoperative cholangiography, which confirmed the presence of a duplicated gallbladder. (orig.)

  7. Buffalo embryos produced by handmade cloning from oocytes selected using brilliant cresyl blue staining have better developmental competence and quality and are closer to embryos produced by in vitro fertilization in terms of their epigenetic status and gene expression pattern.

    Science.gov (United States)

    Mohapatra, Sushil K; Sandhu, Anjit; Neerukattu, Venkata S; Singh, Karn P; Selokar, Naresh L; Singla, Suresh K; Chauhan, Manmohan S; Manik, Radhey S; Palta, Prabhat

    2015-04-01

    We compared handmade cloned (HMC) buffalo blastocysts produced from oocytes stained with Brilliant Cresyl Blue (BCB) and classified into those with blue (BCB+) or colorless cytoplasm (BCB-). The blastocyst rate was higher (p<0.001) for BCB+ than for BCB- oocytes (43.41 ± 2.54 vs. 22.74 ± 1.76%). BCB+ blastocysts had inner cell mass (ICM) cell number, ICM-to-trophectoderm ratio, global level of H3K18ac, apoptotic index, and expression level of BCL-XL, but not that of CASPASE-3, similar to that of blastocysts produced through in vitro fertilization (IVF), which was higher (p<0.05) than that of BCB- blastocysts. The global level of H3K9me2, which was similar in BCB+ and BCB- blastocysts, was higher (p<0.01) than that in IVF blastocysts. The expression level of OCT4 and SOX2 was higher (p<0.05) and that of GATA2 was lower (p<0.05) in BCB+ than that in BCB- blastocysts, whereas that of DNMT1, DNMT3a, NANOG, and CDX2 was not significantly different between the two groups. The expression level of DNMT1, OCT4, NANOG, and SOX2 was lower (p<0.05) and that of CDX2 was higher (p<0.05) in BCB+ than in IVF blastocysts. In conclusion, because BCB+ blastocysts have better developmental competence and are closer to IVF blastocysts in terms of quality, epigenetic status, and gene expression than BCB- blastocysts, BCB staining can be used effectively for selection of developmentally competent oocytes for HMC.

  8. Chromosomal duplication strains of Aspergillus nidulans and their instability

    International Nuclear Information System (INIS)

    Azevedo, J.L. de; Almeida Okino, L.M. de

    1981-01-01

    Strains of Aspergillus nidulans with chromosomal duplication were obtained after gamma irradiation followed by crossing of the translocated strains with normal strains. From 20 analysed colonies, 12 have shown translocations induced by irradiation. Segregants from four of these translocation strains crossed to normal strains have shown to be unstable although presenting normal morphology. Two segregants were genetically analysed. The first one has shown a duplication of part of linkage groups VIII and the second one presented a duplication of a segment of linkage group V. These new duplication strains in A. nidulans open new perspectives of a more detailed study of the instability phenomenon in this fungus. (Author) [pt

  9. Duplicación apendicular Appendicular duplication

    Directory of Open Access Journals (Sweden)

    Fidel Taquechel Barreto

    2011-09-01

    Full Text Available El apéndice cecal es un órgano pródigamente estudiado, debido a la gran frecuencia con que se producen inflamaciones agudas en él, no obstante, son menos conocidas las anomalías congénitas que resultan en una duplicación apendicular, por ser esta una entidad rara. Se presenta un caso de una paciente que se interviene quirúrgicamente por una apendicitis aguda, en la cual se encontró otro apéndice cecal. Se realiza discusión y revisión del tema.Cecal appendix is much studied organ due to the high frequency of its acute inflammations, however, the congenital anomalies are less associated resulting in a appendicular duplication because of it is a rare entity. This is the case of a female patient operated on due to acute appendicitis founding another cecal appendix.

  10. Differential gene expression of IGF-I, IGF-II, and toll-like receptors 3 and 5 during embryogenesis in hybrid (channel x blue) and channel catfish.

    Science.gov (United States)

    Peterson, Brian C; Bosworth, Brian G; Bilodeau, A Lelania

    2005-05-01

    Insulin-like growth factors-I and-II (IGF-I and IGF-II) play important roles in growth and development of mammals. Toll-like receptors (TLRs) are pattern recognition molecules that orchestrate the induction of early innate immune response by recognition of specific sequences. Evidence is growing that suggests a relationship between growth and immune function. The objective of the study was to examine changes in gene expression of IGF-I, IGF-II, TLR3, and TLR5 during embryogenesis and early larval development in hybrid (channel catfishxblue catfish) and channel catfish. Egg samples were taken pre- and post-fertilization; embryos were collected at two stages of embryogenesis, at hatch, and at swim-up. All genes were detected in unfertilized catfish eggs. Expression levels of TLR5 and IGF-I mRNA in channel catfish and expression levels of TLR3, IGF-I, and IGF-II mRNA in hybrids increased over time (Pcatfish and for TLR5 mRNA in hybrid catfish. Results of this study suggest growth (IGF-I and IGF-II) and immune (TLR3 and TLR5) associated genes could be functional and play important roles during embryogenesis and early development of hybrid and channel catfish.

  11. Fast computation of a string duplication history under no-breakpoint-reuse

    Science.gov (United States)

    Brejová, Broňa; Kravec, Martin; Landau, Gad M.; Vinař, Tomáš

    2014-01-01

    In this paper, we provide an O(n log2 n log log n log* n) algorithm to compute a duplication history of a string under no-breakpoint-reuse condition. The motivation of this problem stems from computational biology, in particular, from analysis of complex gene clusters. The problem is also related to computing edit distance with block operations, but, in our scenario, the start of the history is not fixed, but chosen to minimize the distance measure. PMID:24751867

  12. Impact of gene family evolutionary histories on phylogenetic species tree inference by gene tree parsimony.

    Science.gov (United States)

    Shi, Tao

    2016-03-01

    Complicated history of gene duplication and loss brings challenge to molecular phylogenetic inference, especially in deep phylogenies. However, phylogenomic approaches, such as gene tree parsimony (GTP), show advantage over some other approaches in its ability to use gene families with duplications. GTP searches the 'optimal' species tree by minimizing the total cost of biological events such as duplications, but accuracy of GTP and phylogenetic signal in the context of different gene families with distinct histories of duplication and loss are unclear. To evaluate how different evolutionary properties of different gene families can impact on species tree inference, 3900 gene families from seven angiosperms encompassing a wide range of gene content, lineage-specific expansions and contractions were analyzed. It was found that the gene content and total duplication number in a gene family strongly influence species tree inference accuracy, with the highest accuracy achieved at either very low or very high gene content (or duplication number) and lowest accuracy centered in intermediate gene content (or duplication number), as the relationship can fit a binomial regression. Besides, for gene families of similar level of average gene content, those with relatively higher lineage-specific expansion or duplication rates tend to show lower accuracy. Additional correlation tests support that high accuracy for those gene families with large gene content may rely on abundant ancestral copies to provide many subtrees to resolve conflicts, whereas high accuracy for single or low copy gene families are just subject to sequence substitution per se. Very low accuracy reached by gene families of intermediate gene content or duplication number can be due to insufficient subtrees to resolve the conflicts from loss of alternative copies. As these evolutionary properties can significantly influence species tree accuracy, I discussed the potential weighting of the duplication cost by

  13. Submicroscopic duplication of the Wolf-Hirschhorn critical region with a 4p terminal deletion.

    Science.gov (United States)

    Roselló, M; Monfort, S; Orellana, C; Ferrer-Bolufer, I; Quiroga, R; Oltra, S; Martínez, F

    2009-01-01

    Chromosomal rearrangements in the short arm of chromosome 4 can result in 2 different clinical entities: Wolf-Hirschhorn syndrome (WHS), characterized by severe growth delay, mental retardation, microcephaly, 'Greek helmet' facies, and closure defects, or partial 4p trisomy, associated with multiple congenital anomalies, mental retardation, and facial dysmorphisms. We present clinical and laboratory findings in a patient who showed a small duplication in 4p16.3 associated with a subtle terminal deletion in the same chromosomal region. GTG-banding analyses, multiplex ligation-dependent probe amplification analyses, and studies by array-based comparative genomic hybridization were performed. The results of the analyses revealed a de novo 1.3 Mb deletion of the terminal 4p and a 1.1 Mb duplication in our patient, encompassing the WHS critical region. Interestingly, this unusual duplication/deletion rearrangement results in an intermediate phenotype that shares characteristics of the WHS and the 4p trisomy syndrome. The use of novel technologies in the genetic diagnosis leads to the description of new clinical syndromes; there is a growing list of microduplication syndromes. Therefore, we propose that overexpression of candidate genes in WHS (WHSC1, WHSC2 and LETM1) due to a duplication causes a clinical entity different to both the WHS and 4p trisomy syndrome. (c) 2009 S. Karger AG, Basel.

  14. Novel partial duplication of EYA1 causes branchiootic syndrome in a large Brazilian family.

    Science.gov (United States)

    Dantas, Vitor G L; Freitas, Erika L; Della-Rosa, Valter A; Lezirovitz, Karina; de Moraes, Ana Maria S M; Ramos, Silvia B; Oiticica, Jeanne; Alves, Leandro U; Pearson, Peter L; Rosenberg, Carla; Mingroni-Netto, Regina C

    2015-01-01

    To identify novel genetic causes of syndromic hearing loss in Brazil. To map a candidate chromosomal region through linkage studies in an extensive Brazilian family and identify novel pathogenic variants using sequencing and array-CGH. Brazilian pedigree with individuals affected by BO syndrome characterized by deafness and malformations of outer, middle and inner ear, auricular and cervical fistulae, but no renal abnormalities. Whole genome microarray-SNP scanning on samples of 11 affected individuals detected a multipoint Lod score of 2.6 in the EYA1 gene region (chromosome 8). Sequencing of EYA1 in affected patients did not reveal pathogenic mutations. However, oligonucleotide-array-CGH detected a duplication of 71.8Kb involving exons 4 to 10 of EYA1 (heterozygous state). Real-time-PCR confirmed the duplication in fourteen of fifteen affected individuals and absence in 13 unaffected individuals. The exception involved a consanguineous parentage and was assumed to involve a different genetic mechanism. Our findings implicate this EYA1 partial duplication segregating with BO phenotype in a Brazilian pedigree and is the first description of a large duplication leading to the BOR/BO syndrome.

  15. A Meiotic Uv-Sensitive Mutant That Causes Deletion of Duplications in Neurospora

    Science.gov (United States)

    Newmeyer, Dorothy; Galeazzi, Donna R.

    1978-01-01

    The meiotic-3 (mei-3) mutant of Neurospora crassa has several effects: (1) When homozygous, it almost completely blocks meiosis and ascospore formation, (2) it is sensitive to UV, (3) its growth is inhibited by histidine and, (4) it increases the instability of nontandem duplications. This was shown for duplications produced by five different rearrangements and was demonstrated by two different criteria. The effects on meiosis and duplication instability are expressed strongly at 25°; the effects on sensitivity to UV and to histidine are expressed strongly at 38.5° but only slightly at 25°. Nevertheless, all four effects were shown to be due to a single gene. mei-3 is not allelic with previously reported UV-sensitive mutants.—Two other results were obtained that are not necessarily due to mei-3: (1) A cross involving mei-3 produced a new unlinked meiotic mutant, mei-4, which is not sensitive to UV or histidine, and (2) a burst of several new mutants occurred in a different mei-3 stock, including a partial revertant of mei-3.—mei-3 has previously been shown to cause frequent complete loss of a terminal duplicate segment, beginning exactly at the original rearrangement breakpoint. Possible mechanisms are discussed by which a UV-sensitive mutant could cause such precise deletions. PMID:17248837

  16. Recombination and evolution of duplicate control regions in the mitochondrial genome of the Asian big-headed turtle, Platysternon megacephalum.

    Directory of Open Access Journals (Sweden)

    Chenfei Zheng

    Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P

  17. Diagnosis of CMT1A duplications and HNPP deletions by interphase FISH: Implications for testing in the cytogenetics laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Shaffer, L.G.; Kennedy, G.M.; Spikes, A.S. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1997-03-31

    Charcot-Marie-Tooth (CMT) disease type 1A is an inherited peripheral neuropathy characterized by slowly progressive distal muscle wasting and weakness, decreased nerve conduction velocities, and genetic linkage to 17p12. Most (>98%) CMT1A cases are caused by a DNA duplication of a 1.5-Mb region in 17p12 containing the PMP22 gene. The reciprocal product of the CMT1A duplication is a 1.5-Mb deletion which causes hereditary neuropathy with liability to pressure palsies (HNPP). The most informative current diagnostic testing requires pulsed-field gel electrophoresis to detect DNA rearrangement-specific junction fragments. We investigated the use of interphase FISH for the detection of duplications and deletions for these disorders in the clinical molecular cytogenetics laboratory. Established cell lines or blood specimens from 23 individuals with known molecular diagnoses and 10 controls were obtained and scored using a two-color FISH assay. At least 70%, of CMT1A cells displayed three signals consistent with duplications. Using this minimum expected percentile to make a CMT1A duplication diagnosis, all patients with CMT1A showed a range of 71-92% of cells displaying at least three signals. Of the HNPP cases, 88% of cells displayed only one hybridization signal, consistent with deletions. The PMP22 locus from normal control individuals displayed a duplication pattern in {approximately}9% of cells, interpreted as replication of this locus. The percentage of cells showing replication was significantly lower than in those cells displaying true duplications. We conclude that FISH can be reliably used to diagnose CMT1A and HNPP in the clinical cytogenetics laboratory and to readily distinguish the DNA rearrangements associated with these disorders from individuals without duplication or deletion of the PMP22 locus. 43 refs., 4 figs., 2 tabs.

  18. When do you send blue roses

    Energy Technology Data Exchange (ETDEWEB)

    1991-06-21

    Late in August, DNA Plant Technology Corp (DNAP), in Cinnaminson, New Jersey, plans to field-test genetically transformed chrysanthemums that sport pure white blossoms. If all goes well, florists may be selling the transgenic mums within two years. The DNAP researchers got white mums by adding a nonfunctional duplicate of the pigment gene, which suppressed the original gene's expression. Although nonengineered white mums are already on the market, none have the high productivity and disease resistance of the gene-spliced kind. Moreover, gene-splicing promises flower colors never seen in nature. There's every incentive to try, according to DNAP's Neil Courtney-Gutterson. The demand for horticultural oddities is huge - the worldwide market for cut flowers and ornamentals exceeds $4 billion annually.

  19. Evolutionary patterns of RNA-based duplication in non-mammalian chordates.

    Directory of Open Access Journals (Sweden)

    Ming Chen

    Full Text Available The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes.

  20. Insights into three whole-genome duplications gleaned from the Paramecium caudatum genome sequence.

    Science.gov (United States)

    McGrath, Casey L; Gout, Jean-Francois; Doak, Thomas G; Yanagi, Akira; Lynch, Michael

    2014-08-01

    Paramecium has long been a model eukaryote. The sequence of the Paramecium tetraurelia genome reveals a history of three successive whole-genome duplications (WGDs), and the sequences of P. biaurelia and P. sexaurelia suggest that these WGDs are shared by all members of the aurelia species complex. Here, we present the genome sequence of P. caudatum, a species closely related to the P. aurelia species group. P. caudatum shares only the most ancient of the three WGDs with the aurelia complex. We found that P. caudatum maintains twice as many paralogs from this early event as the P. aurelia species, suggesting that post-WGD gene retention is influenced by subsequent WGDs and supporting the importance of selection for dosage in gene retention. The availability of P. caudatum as an outgroup allows an expanded analysis of the aurelia intermediate and recent WGD events. Both the Guanine+Cytosine (GC) content and the expression level of preduplication genes are significant predictors of duplicate retention. We find widespread asymmetrical evolution among aurelia paralogs, which is likely caused by gradual pseudogenization rather than by neofunctionalization. Finally, cases of divergent resolution of intermediate WGD duplicates between aurelia species implicate this process acts as an ongoing reinforcement mechanism of reproductive isolation long after a WGD event. Copyright © 2014 by the Genetics Society of America.

  1. Borax methylene blue: a spectroscopic and staining study.

    Science.gov (United States)

    Donaldson, P T; Russo, A; Reynolds, C; Lillie, R D

    1978-07-01

    Borax methylene blue is quite stable at room temperatures of 22-25 C. At 30 C polychroming is slow; during 50 days in a water bath at this temperature the absorption peak moves from 665 to 656 nm. At 35 C, the absorption peak reaches 660 nm in 7 days, 654 nm in 14. At 60 C polychroming is rapid, the absorption peak reaching 640-620 nm in 3 days. When the pH of the borax methylene blue solutions, normally about 9.0, is adjusted to pH 6.5, the absorption peak remains at 665 nm even when incubated at 60 C for extended periods. When used as a blood stain 0.4 ml borax methylene blue (1% methylene blue in 1% borax), 4 ml acetone, 2 ml borax-acid phosphate buffer to bring the solution to pH 6.5, and distilled water to make 40 ml, with 0.2 ml 1% eosin added just before using, an excellent Nocht-Giemsa type stain is achieved after 30 minutes staining. The material plasmodia P. falciparum, P. vivax, and P. berghei stain moderate blue with dark red chromatin and green to black pigment granules. The study confirms Malachowski's 1891 results and explains Gautier's 1896-98 failure to duplicate it.

  2. Female Urethral Duplication: Rare Anomaly with Unusual Presentation

    African Journals Online (AJOL)

    UD is classified according to plane (frontal or sagittal) of duplication into different types: (1) Double urethra and double bladder, (2) double urethra with single bladder,. (3) accessory urethra posterior to the normal channel,. (4) double proximal urethra and single distal urethra, and. (5) single proximal urethra and duplicated ...

  3. A rare case of congenital Y-type urethral duplication

    Directory of Open Access Journals (Sweden)

    Charu Tiwari

    2015-11-01

    Full Text Available Duplication of urethra is a rare congenital anomaly. We report a case of Y-type of urethral duplication with the accessory urethra arising from posterior urethra and opening in the perineum. The orthotopic urethra was normal. The accessory urethral tract was cored, transfixed and divided. At 1 year of follow-up, the patient has no urinary complaints

  4. Gallbladder duplication masquerading as a dilated common bile ...

    African Journals Online (AJOL)

    A duplicate gall bladder was diagnosed at laparoscopy, having been erroneously diagnosed on ultrasonography as a dilated common bile duct with choledocholithiasis. Gallbladder duplication is a congenital abnormality with a rare incidence, occuring in approximately 1 in 4 000 births and 0.020% in al large autopsy ...

  5. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typical...

  6. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin

    2016-01-01

    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  7. Penile shaft sinus: A sequalae of circumcision in urethral duplication

    Directory of Open Access Journals (Sweden)

    Lukman O Abdur-Rahman

    2009-01-01

    Full Text Available Urethral duplication (UD is rare congenital anomalies with varied presentation. Careful clinical evaluation of children by specialist would enhance diagnosis, adequate management and reduce occurrence of complication. We present a 12-year-old boy with chronic post circumcision ventral penile sinus that was successfully managed for urethral duplication.

  8. 40 CFR 25.13 - Coordination and non-duplication.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Coordination and non-duplication. 25.13 Section 25.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN... ACT § 25.13 Coordination and non-duplication. The public participation activities and materials that...

  9. Clinical Fact of Rectal Duplication with gastric heterotopy | Atmani ...

    African Journals Online (AJOL)

    DOWNLOAD FULL TEXT Open Access DOWNLOAD FULL TEXT Subscription or Fee Access. Clinical Fact of Rectal Duplication with gastric heterotopy. S Atmani, S Boujraf, L Chater, K Khattala, M Rami, M Maaroufi, A Afifi, M Hida, Y Bouabdallah. Abstract. Enteric duplication could occur through the entire alimentary tract.

  10. Natural Blue Food Colour

    DEFF Research Database (Denmark)

    Roda-Serrat, Maria Cinta

    In recent years, there has been a growing tendency to avoid the use of artificial colorants and additives in food products, especially after some studies linked their consumption with behavioural changes in children. However, the incorporation of colorants from natural origin remains a challenge...... for food technologists, as these are typically less vivid and less stable than their synthetic alternatives. Regarding blue colorants, phycocyanins from cyanobacteria are currently in the spotlight as promising new natural blue colorants. Phycocyanins are proteins which blue colour results from...... the presence of the chromophore phycocyanobilin (PCB), a covalently attached linear tetrapyrrole. The applications of phycocyanins as food colorants are however limited, as they show poor stability in certain conditions of pH, light and temperature. Cleavage of PCB from the protein followed by careful product...

  11. Transducin Duplicates in the Zebrafish Retina and Pineal Complex: Differential Specialisation after the Teleost Tetraploidisation

    Science.gov (United States)

    Lagman, David; Callado-Pérez, Amalia; Franzén, Ilkin E.

    2015-01-01

    Gene duplications provide raw materials that can be selected for functional adaptations by evolutionary mechanisms. We describe here the results of 350 million years of evolution of three functionally related gene families: the alpha, beta and gamma subunits of transducins, the G protein involved in vision. Early vertebrate tetraploidisations resulted in separate transducin heterotrimers: gnat1/gnb1/gngt1 for rods, and gnat2/gnb3/gngt2 for cones. The teleost-specific tetraploidisation generated additional duplicates for gnb1, gnb3 and gngt2. We report here that the duplicates have undergone several types of subfunctionalisation or neofunctionalisation in the zebrafish. We have found that gnb1a and gnb1b are co-expressed at different levels in rods; gnb3a and gnb3b have undergone compartmentalisation restricting gnb3b to the dorsal and medial retina, however, gnb3a expression was detected only at very low levels in both larvae and adult retina; gngt2b expression is restricted to the dorsal and medial retina, whereas gngt2a is expressed ventrally. This dorsoventral distinction could be an adaptation to protect the lower part of the retina from intense light damage. The ontogenetic analysis shows earlier onset of expression in the pineal complex than in the retina, in accordance with its earlier maturation. Additionally, gnb1a but not gnb1b is expressed in the pineal complex, and gnb3b and gngt2b are transiently expressed in the pineal during ontogeny, thus showing partial temporal subfunctionalisation. These retina-pineal distinctions presumably reflect their distinct functional roles in vision and circadian rhythmicity. In summary, this study describes several functional differences between transducin gene duplicates resulting from the teleost-specific tetraploidisation. PMID:25806532

  12. The evolution of the tape measure protein: units, duplications and losses

    Directory of Open Access Journals (Sweden)

    Poisson Guylaine

    2011-10-01

    Full Text Available Abstract Background A large family of viruses that infect bacteria, called phages, is characterized by long tails used to inject DNA into their victims' cells. The tape measure protein got its name because the length of the corresponding gene is proportional to the length of the phage's tail: a fact shown by actually copying or splicing out parts of DNA in exemplar species. A natural question is whether there exist units for these tape measures, and if different tape measures have different units and lengths. Such units would allow us to retrace the evolution of tape measure proteins using their duplication/loss history. The vast number of sequenced phages genomes allows us to attack this problem with a comparative genomics approach. Results Here we describe a subset of phages whose tape measure proteins contain variable numbers of an 11 amino acids sequence repeat, aligned with sequence similarity, structural properties, and simple arithmetics. This subset provides a unique opportunity for the combinatorial study of phage evolution, without the added uncertainties of multiple alignments, which are trivial in this case, or of protein functions, that are well established. We give a heuristic that reconstructs the duplication history of these sequences, using divergent strains to discriminate between mutations that occurred before and after speciation, or lineage divergence. The heuristic is based on an efficient algorithm that gives an exhaustive enumeration of all possible parsimonious reconstructions of the duplication/speciation history of a single nucleotide. Finally, we present a method that allows, when possible, to discriminate between duplication and loss events. Conclusions Establishing the evolutionary history of viruses is difficult, in part due to extensive recombinations and gene transfers, and high mutation rates that often erase detectable similarity between homologous genes. In this paper, we introduce new tools to address this

  13. Prenatal diagnosis of 17q12 duplication and deletion syndrome in two fetuses with congenital anomalies.

    Science.gov (United States)

    Li, Ru; Fu, Fang; Zhang, Yong-Ling; Li, Dong-Zhi; Liao, Can

    2014-12-01

    The objective of this study was to characterize the genetic abnormalities in two fetuses with congenital anomalies in prenatal screening. The mother of Fetus 1 was 26 years old and had a second trimester serum screening that indicated the fetus was at low risk. The prenatal ultrasound and magnetic resonance imaging (MRI) at 28 weeks of gestation showed mild ventriculomegaly, microcephaly, and agenesis of the corpus callosum. The mother of Fetus 2 was 25 years old and also had a second trimester serum screening that indicated the fetus was at low risk. The prenatal ultrasound at 32 weeks of gestation showed the presence of hyperechogenic and enlarged kidneys with multicystic renal dysplasia bilaterally and a persistent left superior vena cava (PLSVC). Both pregnant women underwent cord blood samplings because of the abnormal imaging results. Karyotype analysis revealed normal results in the two fetuses. Chromosome microarray analysis (CMA) was then performed to provide genetic analysis of the cord blood and parental blood samples. Ultimately, the pregnancies were both terminated. CMA detected a 1.56-Mb duplication at 17q12 in Fetus 1 and a 1.93-Mb deletion of 17q12 in Fetus 2. Both the duplicated and deleted regions included the HNF1B and LHX1 genes. Neither the duplication nor deletion was inherited from the parents. This study is the first to report the prenatal diagnosis of a 17q12 duplication syndrome. Our results further confirmed that genes in this region, including HNF1B and LHX1, are essential for normal brain and kidney development, and also indicated some genes that may be associated with the cardiovascular abnormality. Combined with imaging examination, the use of CMA will improve the diagnosis of submicroscopic chromosomal aberrations in fetuses with congenital anomalies. Copyright © 2014. Published by Elsevier B.V.

  14. The effects of fipronil and the photodegradation product fipronil desulfinyl on growth and gene expression in juvenile blue crabs, Callinectes sapidus, at different salinities

    Science.gov (United States)

    Goff, Andrew D.; Saranjampour, Parichehr; Ryan, Lauren M.; Hladik, Michelle; Covi, Joseph A.; Armbrust, Kevin L.; Brander, Susanne M.

    2017-01-01

    Endocrine disrupting compounds (EDCs) are now widely established to be present in the environment at concentrations capable of affecting wild organisms. Although many studies have been conducted in fish, less is known about effects in invertebrates such as decapod crustaceans. Decapods are exposed to low concentrations of EDCs that may cause infertility, decreased growth, and developmental abnormalities. The objective herein was to evaluate effects of fipronil and its photodegradation product fipronil desulfinyl. Fipronil desulfinyl was detected in the eggs of the decapod Callinectes sapidus sampled off the coast of South Carolina. As such, to examine specific effects on C. sapidus exposed in early life, we exposed laboratory-reared juveniles to fipronil and fipronil desulfinyl for 96 hours at three nominal concentrations (0.01, 0.1, 0.5 μg/L) and two different salinities (10, 30 ppt). The size of individual crabs (weight, carapace width) and the expression of several genes critical to growth and reproduction were evaluated. Exposure to fipronil and fipronil desulfinyl resulted in significant size increases in all treatments compared to controls. Levels of expression for vitellogenin (Vtg), an egg yolk precursor, and the ecdysone receptor (EcR), which binds to ecdysteroids that control molting, were inversely correlated with increasing fipronil and fipronil desulfinyl concentrations. Effects on overall growth and on the expression of EcR and Vtg differ depending on the exposure salinity. The solubility of fipronil is demonstrated to decrease considerably at higher salinities. This suggests that fipronil and its photodegradation products may be more bioavailable to benthic organisms as salinity increases, as more chemical would partition to tissues. Our findings suggest that endocrine disruption is occurring through alterations to gene expression in C. sapidus populations exposed to environmental levels of fipronil, and that effects may be dependent upon the

  15. A Blue Lagoon Function

    DEFF Research Database (Denmark)

    Markvorsen, Steen

    2007-01-01

    We consider a specific function of two variables whose graph surface resembles a blue lagoon. The function has a saddle point $p$, but when the function is restricted to any given straight line through $p$ it has a {\\em{strict local minimum}} along that line at $p$.......We consider a specific function of two variables whose graph surface resembles a blue lagoon. The function has a saddle point $p$, but when the function is restricted to any given straight line through $p$ it has a {\\em{strict local minimum}} along that line at $p$....

  16. Novel Duplicate Address Detection with Hash Function.

    Directory of Open Access Journals (Sweden)

    GuangJia Song

    Full Text Available Duplicate address detection (DAD is an important component of the address resolution protocol (ARP and the neighbor discovery protocol (NDP. DAD determines whether an IP address is in conflict with other nodes. In traditional DAD, the target address to be detected is broadcast through the network, which provides convenience for malicious nodes to attack. A malicious node can send a spoofing reply to prevent the address configuration of a normal node, and thus, a denial-of-service attack is launched. This study proposes a hash method to hide the target address in DAD, which prevents an attack node from launching destination attacks. If the address of a normal node is identical to the detection address, then its hash value should be the same as the "Hash_64" field in the neighboring solicitation message. Consequently, DAD can be successfully completed. This process is called DAD-h. Simulation results indicate that address configuration using DAD-h has a considerably higher success rate when under attack compared with traditional DAD. Comparative analysis shows that DAD-h does not require third-party devices and considerable computing resources; it also provides a lightweight security resolution.

  17. A Case of Duplicated Right Vertebral Artery.

    Science.gov (United States)

    Motomura, Mayuko; Watanabe, Koichi; Tabira, Yoko; Iwanaga, Joe; Matsuuchi, Wakako; Yoshida, Daichi; Saga, Tsuyoshi; Yamaki, Koh-Ichi

    2018-04-27

    We encountered a case of duplicated right vertebral artery during an anatomical dissection course for medical students in 2015. Two vertebral arteries were found in the right neck of a 91-year-old female cadaver. The proximal leg of the arteries arose from the area between the right subclavian artery and the right common carotid artery that diverged from the brachiocephalic artery. The distal leg arose from the right subclavian artery as expected. The proximal leg entered the transverse foramen of the fourth cervical vertebra and the distal leg entered the transverse foramen of the sixth cervical vertebra. The two right vertebral arteries joined to form one artery just after the origin of the right vertebral artery of the brachiocephalic artery entered the transverse foramen of the fourth cervical vertebra. This artery then traveled up in the transverse foramina and became the basilar artery, joining with the left vertebral artery. We discuss the embryological origin of this case and review previously reported cases.

  18. Tourette Syndrome and Klippel-Feil Anomaly in a Child with Chromosome 22q11 Duplication

    Directory of Open Access Journals (Sweden)

    Raymond A. Clarke

    2009-01-01

    Full Text Available This is the first case description of the association of Klippel-Feil Syndrome (KFS, Tourette Syndrome (TS, Motor Stereotypies, and Obsessive Compulsive Behavior, with chromosome 22q11.2 Duplication Syndrome (22q11DupS. Neuropsychiatric symptoms in persons with 22q11.2 deletion, including obsessive compulsiveness, anxiety, hyperactivity, and one prior case report of TS, have been attributed to low copy number effects on Catechol-O-Methyltransferase (COMT. However, the present unique case of 22q11DupS and TS suggests a more complex relationship involving another gene(s at or near this locus.

  19. Two cases of the caudal duplication anomaly including a discordant monozygotic twin

    NARCIS (Netherlands)

    Kroes, HY; Takahashi, M; Zijlstra, RJ; Baert, JALL; Kooi, KA; Hofstra, RMW; van Essen, AJ

    2002-01-01

    We present two unrelated patients with various duplications in the caudal region. One patient presented with a duplication of the distal spine from L4, left double ureter, duplication of the vagina and cervix, and duplication of the distal colon. The second patient was diagnosed with a duplication

  20. Construction and characterization of a forward subtracted library of blue mussels Mytilus edulis for the identification of gene transcription signatures and biomarkers of styrene exposure.

    Science.gov (United States)

    Diaz de Cerio, O; Hands, E; Humble, J; Cajaraville, M P; Craft, J A; Cancio, I

    2013-06-15

    Transcriptional profiling can elucidate adaptive/toxicity pathways participating in achieving homeostasis or leading to pathogenesis in marine biota exposed to chemical substances. With the aim of analyzing transcriptional responses in the mussel Mytilus edulis exposed to the corrosive and putatively carcinogenic hydrocarbon styrene (3-5 ppm, 3days), a forward subtracted (SSH) cDNA library was produced. Female mussels were selected and digestive gland mRNA was isolated. A library with 1440 clones was produced and a total of 287 clones were sequenced, 53% being identified through BlastN analysis against Mytibase and DeepSeaVent databases. Those genes included GO terms such as 'response to drugs', 'immune defense' and 'cell proliferation'. Furthermore, sequences related to chitin and beta-1-3-glucan metabolism were also up-regulated by styrene. Many of the obtained sequences could not be annotated constituting new mussel sequences. In conclusion, this SSH study reveals novel sequences useful to generate molecular biomarkers of styrene exposure in mussels. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Three duplication events and variable molecular evolution ...

    Indian Academy of Sciences (India)

    molecular evolution characteristics involved in multiple GGPS genes of six Solanaceae species. J. Genet. 95, 453–457]. Introduction ... Solanaceae plants, and hidden Markov model (HMM) search were also carried out ... Solanaceae; GGPS gene; molecular evolution; three-dimensional structure. Journal of Genetics, Vol.

  2. Clinical features of SMARCA2 duplication overlap with Coffin-Siris syndrome.

    Science.gov (United States)

    Miyake, Noriko; Abdel-Salam, Ghada; Yamagata, Takanori; Eid, Maha M; Osaka, Hitoshi; Okamoto, Nobuhiko; Mohamed, Amal M; Ikeda, Takahiro; Afifi, Hanan H; Piard, Juliette; van Maldergem, Lionel; Mizuguchi, Takeshi; Miyatake, Satoko; Tsurusaki, Yoshinori; Matsumoto, Naomichi

    2016-10-01

    Coffin-Siris syndrome is a rare congenital malformation and intellectual disability syndrome. Mutations in at least seven genes have been identified. Here, we performed copy number analysis in 37 patients with features of CSS in whom no causative mutations were identified by exome sequencing. We identified a patient with a 9p24.3-p22.2 duplication and another patient with the chromosome der(6)t(6;9)(p25;p21)mat. Both patients share a duplicated 15.8-Mb region containing 46 protein coding genes, including SMARCA2. Dominant negative effects of SMARCA2 mutations may contribute to Nicolaides-Baraitser syndrome. We conclude that their features better resemble Coffin-Siris syndrome, rather than Nicolaides-Baraitser syndrome and that these features likely arise from SMARCA2 over-dosage. Pure 9p duplications (not caused by unbalanced translocations) are rare. Copy number analysis in patients with features that overlap with Coffin-Siris syndrome is recommended to further determine their genetic aspects. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Williams syndrome deletions and duplications: Genetic windows to understanding anxiety, sociality, autism, and schizophrenia.

    Science.gov (United States)

    Crespi, Bernard J; Procyshyn, Tanya L

    2017-08-01

    We describe and evaluate an integrative hypothesis for helping to explain the major neurocognitive features of individuals with Williams syndrome region deletions and duplications. First, we demonstrate how the cognitive differences between Williams syndrome individuals, individuals with duplications of this region, and healthy individuals parallel the differences between individuals subject to effects of increased or decreased oxytocin. Second, we synthesize evidence showing that variation in expression of the gene GTF2I (General Transcription Factor II-I) underlies the primary social phenotypes of Williams syndrome and that common genetic variation in GTF2I mediates oxytocin reactivity, and its correlates, in healthy populations. Third, we describe findings relevant to the hypothesis that the GTF2I gene is subject to parent of origin effects whose behavioral expression fits with predictions from the kinship theory of genomic imprinting. Fourth, we describe how Williams syndrome can be considered, in part, as an autistic syndrome of Lorna Wing's 'active-but-odd' autism subtype, in contrast to associations of duplications with both schizophrenia and autism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. The "Blue Banana" Revisited

    NARCIS (Netherlands)

    Faludi, A.K.F.

    2015-01-01

    This essay is about the “Blue Banana”. Banana is the name given subsequently by others to a Dorsale européenne (European backbone) identified empirically by Roger Brunet. In a background study to the Communication of the European Commission ‘Europe 2000’, Klaus Kunzmann and Michael Wegener put

  5. The Blue Baby Syndrome

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 8; Issue 10. The Blue Baby Syndrome - Nitrate Poisoning in Humans. Deepanjan Majumdar. General Article Volume 8 Issue 10 October 2003 pp 20-30. Fulltext. Click here to view fulltext PDF. Permanent link:

  6. MURCS Association with Partial Duplication of the Distal Long Chromosome 5 and Unilateral Ovarian Agenesis

    Directory of Open Access Journals (Sweden)

    Anna Dabkowska-Huc

    2013-01-01

    Full Text Available A combination of the congenital abnormalities, Müllerian duct aplasia, renal aplasia, and cervicothoracic somite dysplasia, is defined as the MURCS association. Various genetic defects have been described in the MURCS association so far, yet the unambiguous molecular basis of these disorders has not been established. We report the case of an 18-year-old woman who presented with primary amenorrhea, right kidney, Arnold-Chiari malformation, and Klippel-Feil syndrome. In addition, the patient showed the following unusual features: right ovarian and Skenes gland agenesis, cubitus valgus with hyperextension and decreased range of motion at elbows, and facial changes. Moreover, the performed DNA analysis showed interstitial duplication in chromosome 5 (5q35.1. In the duplicated region, there are genes whose function is not well known. It is thought that they have an influence on the early stages of development and their joining in the later period can lead to neoplastic disorders, especially leukemias.

  7. Genetics Home Reference: MECP2 duplication syndrome

    Science.gov (United States)

    ... two copies of the gene typically does not cause the disorder, but can be associated with behavioral and psychiatric symptoms such as depression, anxiety, and features of autism spectrum disorders that affect communication and social interaction. Females ...

  8. Colonic duplications: Clinical presentation and radiologic features of five cases

    International Nuclear Information System (INIS)

    Blickman, J.G.; Rieu, P.H.M.; Buonomo, C.; Hoogeveen, Y.L.; Boetes, C.

    2006-01-01

    Diagnosis of colonic duplication can pose a potential problem even for those familiar with gastro-intestinal tract duplications in general but unaware of the condition due to its rarity and its apparently bimodal clinical presentation. In this report of five cases of surgically proven pediatric colonic duplication, we illustrate how the condition manifests clinically and describe the imaging features in an attempt to illustrate this bimodal presentation of the condition. The possible etiology, associated congenital anomalies and modes of clinical presentation are reviewed based on literature review as well as on our own experience

  9. Duplication of the vermiform appendix in an adult patient.

    Science.gov (United States)

    Lim, K H

    2014-07-01

    Duplication of the appendix is extremely rare. A 69-year-old woman was admitted with a 2-day history of right lower quadrant abdominal pain. Physical examination was consistent with acute appendicitis. Ultrasonography and colonoscopy gave a clinical impression of an inflammatory appendiceal mucocoele. Operative findings were an enlarged and inflamed appendix with distal cystic changes. Laparoscopic wedge resection of the caecum was performed. A tubular structure with a true lumen was found in the appendix. Haematoxylin and eosin staining and trichrome staining showed both structures had a true mucosa and a muscular layer. The duplication in this case does not belong to any of the previously described types of duplication.

  10. [Blue light and eye health].

    Science.gov (United States)

    Zou, Leilei; Dai, Jinhui

    2015-01-01

    Blue light, with the wavelength between 400 nm and 500 nm, has caused public concern because of the injury to the retinal cells. Meanwhile, it is important in circadian rhythm regulation, scotopic vision and ocular growth. Is the blue light safe? Should it be eliminated from the daily life? Here we review the effect and safety of the blue light.

  11.  Hypertelorism in Charcot-Marie-Tooth disease 1A from the common PMP22 duplication: A Case Report

    Directory of Open Access Journals (Sweden)

    Josef Finsterer

    2012-03-01

    Full Text Available  The 1.4Mb tandem-duplication in the PMP22 gene at 17p11.2 usually manifests as hereditary sensorimotor polyneuropathy with foot deformity, sensorineural hearing-loss, moderate developmental delay, and gait disturbance. Hypertelorism and marked phenotypic variability within a single family has not been reported. In a single family, the PMP22 tandem-duplication manifested as short stature, sensorimotor polyneuropathy, tremor, ataxia, sensorineural hearing-loss, and hypothyroidism in the 27 years-old index case, as mild facial dysmorphism, muscle cramps, tinnitus, intention tremor, bradydiadochokinesia, and sensorimotor polyneuropathy in the 31 year-old half-brother of the index-patient, and as sensorimotor polyneuropathy and foot deformityin the father of the two. The half-brother additionally presented with hypertelorism, not previously reported in PMP22tandem-duplication carriers. The presented cases show that the tandem-duplication 17p11.2 may present with marked intra-familialphenotype variability and that mild facial dysmorphism with stuck-out ears and hypertelorism may be a rare phenotypic feature of this mutation. The causal relation between facial dysmorphism and the PMP22 tandem-duplication, however, remains speculative.

  12. Isolation and characterization of two herpes simplex virus type 1 variants containing duplication of sequences within the unique long component of their genomes

    International Nuclear Information System (INIS)

    Fareed, M.U.; Maclean, A.R.; Maclean, C.A.; Fu, A.; Brown, S.M.

    1995-01-01

    This paper reports the first spontaneous isolation of two DNA duplication variants in the unique long (U L ) component of herpes simplex virus type 1 (HSV-1) strain 17 + genome, one (1719) with a duplication of 7.5 kb DNA sequences centered around Ori L and the other (1740In) with a 356 bp DNA duplication between the UL19 (MCP and UL20 open reading frames (ORFs). The variant 1719 is stable with the rare isolation of a wild type (strain 17 + ) genome presumably generated by the excision of the duplicated sequences during homologous recombination. Because of the 7.5 kb duplication, UL29 (DBP is diploid and UL30 (DNA polymerase) is present as one partial copy. Although duplication in the variant 1740In involved sequences from the UL20 ORF, the virus produces an intact UL20 gene product. Both variants show normal growth characteristics when compared with the parental viruses. DNA duplications in these variants suggest a link between replication and recombination in HSV-1. (author)

  13. Recurrent duplications of 17q12 associated with variable phenotypes

    DEFF Research Database (Denmark)

    Mitchell, Elyse; Douglas, Andrew; Kjaegaard, Susanne

    2015-01-01

    , tracheomalacia, cutaneous mosaicism, pectus excavatum,