WorldWideScience

Sample records for block rna silencing

  1. RNA silencing movement in plants

    Institute of Scientific and Technical Information of China (English)

    Glykeria Mermigka; Frederic Verret; Kriton Kalantidis

    2016-01-01

    Multicellular organisms, like higher plants, need to coordinate their growth and development and to cope with environmental cues. To achieve this, various signal molecules are transported between neighboring cells and distant organs to control the fate of the recipient cells and organs. RNA silencing produces cell non-autonomous signal molecules that can move over short or long distances leading to the sequence specific silencing of a target gene in a well defined area of cells or throughout the entire plant, respectively. The nature of these signal molecules, the route of silencing spread, and the genes involved in their production, movement and reception are discussed in this review. Additionally, a short section on features of silencing spread in animal models is presented at the end of this review.

  2. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

    OpenAIRE

    R. Lu; Folimonov, A; Shintaku, M; Li, W. X.; Falk, B W; Dawson, W O; Ding, S W

    2004-01-01

    Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the approximate to20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although ...

  3. Inducible Systemic RNA Silencing in Caenorhabditis elegans

    OpenAIRE

    Timmons, Lisa; Tabara, Hiroaki; Mello, Craig C.; Fire, Andrew Z.

    2003-01-01

    Introduction of double-stranded RNA (dsRNA) can elicit a gene-specific RNA interference response in a variety of organisms and cell types. In many cases, this response has a systemic character in that silencing of gene expression is observed in cells distal from the site of dsRNA delivery. The molecular mechanisms underlying the mobile nature of RNA silencing are unknown. For example, although cellular entry of dsRNA is possible, cellular exit of dsRNA from normal anim...

  4. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double strand

  5. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

    Science.gov (United States)

    Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

    2004-11-01

    Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

  6. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    OpenAIRE

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double stranded (ds)RNA ‘trigger’ molecules into small interfering RNAs (siRNAs) by enzymes of the Dicer family. The siRNA molecules are essential components of the RNA induced silencing complex (RISC), which u...

  7. Nucleolar dominance and ribosomal RNA gene silencing

    OpenAIRE

    Tucker, Sarah; Vitins, Alexa; Pikaard, Craig S.

    2010-01-01

    Nucleolar dominance is an epigenetic phenomenon that occurs in genetic hybrids and describes the expression of 45S rRNA genes inherited from one progenitor due to the silencing of the other progenitor’s rRNA genes. Nucleolar dominance is a manifestation of rRNA gene dosage control, which also occurs in non-hybrids, regulating the number of active rRNA genes according to the cellular demand for ribosomes and protein synthesis. Ribosomal RNA gene silencing involves changes in DNA methylation an...

  8. RNA Silencing in Aspergillus nidulans Is Independent of RNA-Dependent RNA Polymerases

    OpenAIRE

    Hammond, T. M.; Keller, N P

    2005-01-01

    The versatility of RNA-dependent RNA polymerases (RDRPs) in eukaryotic gene silencing is perhaps best illustrated in the kingdom Fungi. Biochemical and genetic studies of Schizosaccharomyces pombe and Neurospora crassa show that these types of enzymes are involved in a number of fundamental gene-silencing processes, including heterochromatin regulation and RNA silencing in S. pombe and meiotic silencing and RNA silencing in N. crassa. Here we show that Aspergillus nidulans, another model fung...

  9. Spatial and temporal dynamics of the RNA silencing response

    OpenAIRE

    Groenenboom, M.A.C.

    2008-01-01

    In this thesis we studied various aspects of siRNA mediated silencing. siRNA mediated silencing is initiated by the introduction of dsRNA, transgenes and viral infection. Our first goal was to study the ability of the core pathway of RNA silencing to explain transgene and dsRNA induced silencing. To that extend we developed and studied concise models of the RNA silencing pathway. Secondly, we investigated the efficacy of RNA silencing to reduce viral infections, and added a replicating RNA vi...

  10. The RNA-induced Silencing Complex: A Versatile Gene-silencing Machine*

    OpenAIRE

    Pratt, Ashley J.; MacRae, Ian J.

    2009-01-01

    RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review t...

  11. Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors

    OpenAIRE

    Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J.; Carrington, James C.; LIU, Yu-Ping; Dolja, Valerian V.; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József

    2006-01-01

    RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate st...

  12. Viral counterdefense on RNA silencing : analysis of RNA silencing suppressors from arthropod-borne negative strand RNA plant viruses

    OpenAIRE

    Schnettler, E.

    2010-01-01

    This thesis describes that RNA silencing suppressor (RSS) proteins encoded by negative-stranded RNA plant viruses are able to interfere with different RNA silencing pathways in a variety of organisms by interacting with double stranded (ds)RNA molecules. These RSS proteins are able to counteract the antiviral RNA silencing response in their plant host and insect vector, and even in mammalian cells, that are non-hosts for these viruses. Whereas Rice hoja blanca virus NS3 has been shown to bind...

  13. A silencing safeguard: links between RNA silencing and mRNA processing in Arabidopsis

    OpenAIRE

    Chen, Xuemei

    2008-01-01

    RNA silencing is a genome defense mechanism that many eukaryotic organisms use to fight the invasion of viruses and to control transposable elements. Work by Gregory et al. on Arabidopsis thaliana reported in this issue (Gregory et al., 2008) revealed that this mechanism can backfire to silence endogenous protein-coding transcripts unless the plant is vigilant about mRNA quality control. They also uncovered an unexpected role of the cap-binding protein ABH1 (Hugouvieux et al., 2001) in miRNA ...

  14. Two classes of short interfering RNA in RNA silencing

    OpenAIRE

    Hamilton, Andrew; Voinnet, Olivier; Chappell, Louise; Baulcombe, David

    2015-01-01

    RNA silencing is a eukaryotic genome defence system that involves processing of double-stranded RNA (dsRNA) into 21–26 nt, short interfering RNA (siRNA). The siRNA mediates suppression of genes corresponding to the dsRNA through targeted RNA degradation. In some plant systems there are additional silencing processes, involving systemic spread of silencing and RNA-directed methylation/transcriptional suppression of homologous genomic DNA. We show here that siRNAs produced in plants from a gree...

  15. SiRNA Mediated Gene Silencing: A Mini Review

    OpenAIRE

    M.V Jeevitha; S.U Ajisha; Baby Joseph

    2012-01-01

    RNA interference (RNAi) technology has become a novel tool for silencing gene expression in cells or organisms. RNA interference is the process that double-stranded RNA induces the homology-dependent degradation of cognate mRNA mediated by 21-23 nucleotide short interfering RNA (siRNA). RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNAi is mediated by a family of ribonucleoprotein (RNP) complexes called R...

  16. Defective RNA processing enhances RNA silencing and influences flowering of Arabidopsis

    OpenAIRE

    Herr, Alan J.; Molnàr, Attila; Jones, Alex; Baulcombe, David C.

    2006-01-01

    Many eukaryotic cells use RNA-directed silencing mechanisms to protect against viruses and transposons and to suppress endogenous gene expression at the posttranscriptional level. RNA silencing also is implicated in epigenetic mechanisms affecting chromosome structure and transcriptional gene silencing. Here, we describe enhanced silencing phenotype (esp) mutants in Arabidopsis thaliana that reveal how proteins associated with RNA processing and 3′ end formation can influence RNA silencing. T...

  17. Export of RNA silencing from C. elegans tissues does not require the RNA channel SID-1

    OpenAIRE

    Jose, Antony M.; Smith, Jessica J.; Hunter, Craig P.

    2009-01-01

    Double-stranded RNA (dsRNA) triggers RNA interference (RNAi) to silence genes of matching sequence. In some animals this experimentally induced silencing is transported between cells, and studies in the nematode Caenorhabditis elegans have shown that the dsRNA channel SID-1 is required for the import of such transported silencing signals. Gene silencing can also be triggered by endogenously expressed RNAi triggers, but it is unknown whether such silencing is transported between cells. Here, w...

  18. Double-Stranded RNA Binding May Be a General Plant RNA Viral Strategy To Suppress RNA Silencing

    OpenAIRE

    Mérai, Zsuzsanna; Kerényi, Zoltán; Kertész, Sándor; Magna, Melinda; Lakatos, Lóránt; Silhavy, Dániel

    2006-01-01

    In plants, RNA silencing (RNA interference) is an efficient antiviral system, and therefore successful virus infection requires suppression of silencing. Although many viral silencing suppressors have been identified, the molecular basis of silencing suppression is poorly understood. It is proposed that various suppressors inhibit RNA silencing by targeting different steps. However, as double-stranded RNAs (dsRNAs) play key roles in silencing, it was speculated that dsRNA binding might be a g...

  19. Characterization and subcellular localization of an RNA silencing suppressor encoded by Rice stripe tenuivirus

    International Nuclear Information System (INIS)

    Rice stripe virus (RSV) is a single-stranded (ss) RNA virus belonging to the genus Tenuivirus. RSV is present in many East Asian countries and causes severe diseases in rice fields, especially in China. In this study, we analyzed six proteins encoded by the virus for their abilities to suppress RNA silencing in plant using a green fluorescent protein (GFP)-based transient expression assay. Our results indicate that NS3 encoded by RSV RNA3, but not other five RSV encoded proteins, can strongly suppress local GFP silencing in agroinfiltrated Nicotiana benthamiana leaves. NS3 can reverse the GFP silencing, it can also prevent long distance spread of silencing signals which have been reported to be necessary for inducing systemic silencing in host plants. The NS3 protein can significantly reduce the levels of small interfering RNAs (siRNAs) in silencing cells, and was found to bind 21-nucleotide ss-siRNA, siRNA duplex and long ssRNA but not long double-stranded (ds)-RNA. Both N and C terminal of the NS3 protein are critical for silencing suppression, and mutation of the putative nuclear localization signal decreases its local silencing suppression efficiency and blocks its systemic silencing suppression. The NS3-GFP fusion protein and NS3 were shown to accumulate predominantly in nuclei of onion, tobacco and rice cells through transient expression assay or immunocytochemistry and electron microscopy. In addition, transgenic rice and tobacco plants expressing the NS3 did not show any apparent alteration in plant growth and morphology, although NS3 was proven to be a pathogenicity determinant in the PVX heterogenous system. Taken together, our results demonstrate that RSV NS3 is a suppressor of RNA silencing in planta, possibly through sequestering siRNA molecules generated in cells that are undergoing gene silencing.

  20. Novel RNA-based Strategies for Therapeutic Gene Silencing

    OpenAIRE

    Sibley, Christopher R.; Seow, Yiqi; Wood, Matthew JA

    2010-01-01

    The past decade has seen intense scientific interest in non-coding RNAs. In particular, the discovery and subsequent exploitation of gene silencing via RNA interference (RNAi) has revolutionized the way in which gene expression is now studied and understood. It is now well established that post-transcriptional gene silencing (PTGS) by the microRNA (miRNA) and other RNAi-associated pathways represents an essential layer of complexity to gene regulation. Gene silencing using RNAi additionally d...

  1. Dissecting RNA silencing in protoplasts uncovers novel effects of viral suppressors on the silencing pathway at the cellular level

    OpenAIRE

    Qi, Yijun; Zhong, Xuehua; Itaya, Asuka; Ding, Biao

    2004-01-01

    Short interfering RNA (siRNA)-mediated RNA silencing plays an important role in cellular defence against viral infection and abnormal gene expression in multiple organisms. Many viruses have evolved silencing suppressors for counter-defence. We have developed an RNA silencing system in the protoplasts of Nicotiana benthamiana to investigate the functions of viral suppressors at the cellular level. We showed that RNA silencing against a green fluorescent protein (GFP) reporter gene in the prot...

  2. Is the Efficiency of RNA Silencing Evolutionarily Regulated?

    Science.gov (United States)

    Ui-Tei, Kumiko

    2016-01-01

    Small interfering RNAs (siRNAs) and microRNAs (miRNAs) regulate gene expression in a sequence-specific manner. Genes with partial complementarity to siRNA/miRNA sequences in their 3'-untranslated regions (UTRs) are suppressed by a mechanism referred to as the siRNA off-target effect or miRNA-mediated RNA silencing. However, the determinants of such RNA silencing efficiency are poorly understood. Previously, I and co-workers reported that the efficiency of RNA silencing is strongly correlated with the thermodynamic stability of base pairing in the duplex formed within an siRNA/miRNA and between the seed region and its target mRNA. In this review, I first summarize our previous studies that identified the thermodynamic parameter to estimate the silencing efficiency using the calculated base pairing stability: siRNAs downregulate the expression of off-target genes depending on the stability of binding between the siRNA seed region (nucleotides 2-8) and off-target mRNAs, and miRNAs downregulate target mRNA expression depending on the stability of the duplex formed between the 5' terminus of the miRNA and its target mRNA. I further discuss the possibility that such thermodynamic features of silencing efficiency may have arisen during evolution with increasing body temperature in various organisms. PMID:27187367

  3. SiRNA Mediated Gene Silencing: A Mini Review

    Directory of Open Access Journals (Sweden)

    M.V. Jeevitha

    2012-12-01

    Full Text Available RNA interference (RNAi technology has become a novel tool for silencing gene expression in cells or organisms. RNA interference is the process that double-stranded RNA induces the homology-dependent degradation of cognate mRNA mediated by 21-23 nucleotide short interfering RNA (siRNA. RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNAi is mediated by a family of ribonucleoprotein (RNP complexes called RNA-Induced Silencing Complexes (RISCs, which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs been co-opted by evolution many times to generate a broad spectrum of gene silencing pathways. The study about the Silencing of gene expression by siRNA is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. In this study, the applications of siRNA expressing recombinant adenovirus system in plants, animals and in cancer gene therapy are given importance with its modifications

  4. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  5. Retrovirus silencer blocking by the cHS4 insulator is CTCF independent

    OpenAIRE

    Yao, Shuyuan; Osborne, Cameron S; Bharadwaj, Rikki R.; Pasceri, Peter; Sukonnik, Tanya; Pannell, Dylan; Recillas-Targa, Félix; West, Adam G.; Ellis, James

    2003-01-01

    Silencing of retrovirus vectors poses a significant obstacle to genetic manipulation of stem cells and their use in gene therapy. We describe a mammalian silencer blocking assay using insulator elements positioned between retrovirus silencer elements and an LCRβ-globin reporter transgene. In transgenic mice, we show that retrovirus silencers are blocked by the cHS4 insulator. Silencer blocking is independent of the CTCF binding site and is most effective when flanking the internal reporter tr...

  6. Importance of coat protein and RNA silencing in satellite RNA/virus interactions

    Science.gov (United States)

    RNA silencing is a major defense mechanism that plants use to fight an invading virus. The silencing suppressor of Turnip crinkle virus (TCV) is the viral coat protein (CP), which obstructs the DCL2/DCL4 silencing pathway. TCV is associated with a virulent satellite RNA (satC) that represses the a...

  7. Suppressors of RNA silencing encoded by tomato leaf curl betasatellites

    Indian Academy of Sciences (India)

    Richa Shukla; Sunita Dalal; V G Malathi

    2013-03-01

    Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to counter RNA-silencing defense of plants. Whitefly-transmitted begomoviruses infecting tomato crop code for five different proteins, ORF AC4, ORF AC2 and ORF AV2 in DNA-A component, ORF BV1 in DNA-B and ORF C1 in satellite DNA which are predicted to function as silencing suppressors. In the present study suppressor function of ORF C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl Multan betasatellite CLCuMB–[IN:Sri:02] and Luffa leaf distortion betasatellite LuLDB-[IN:Lu:04] were examined. Agroinfiltration of GFP-silenced Nicotiana tabaccum cv. Xanthi with the cells expressing C1 protein resulted in reversal of silenced GFP expression. GFP-siRNA level was more than 50-fold lower compared to silenced plants in plants infiltrated with C1 gene from ToLCBB. However, in the case of 35S-C1 CLCuMB and 35S-C1 LuLDB construct, although GFP was expressed, siRNA level was not reduced, indicating that the step at which C1 interfere in RNA-silencing pathway is different.

  8. Multiple suppressors of RNA silencing encoded by both genomic RNAs of the crinivirus, Tomato chlorosis virus

    OpenAIRE

    Cañizares, Mª Carmen; J. Navas-Castillo; Moriones, E

    2008-01-01

    Viruses express proteins with silencing suppression activity to counteract the RNA silencing-mediated defense response of the host. In the family Closteroviridae, examples of multiple-component RNA silencing suppression systems have been reported

  9. Nuclear RNA silencing and related phenomena in animals

    Czech Academy of Sciences Publication Activity Database

    Malík, Radek; Svoboda, Petr

    Chichester: Wiley, 2012 - (Sahu, S.), s. 297-315 ISBN 9781119976097 Institutional research plan: CEZ:AV0Z50520514 Institutional support: RVO:68378050 Keywords : nuclear RNA silencing * small RNAs * Dicer Subject RIV: EB - Genetics ; Molecular Biology

  10. Synthetic RNA silencing in bacteria - antimicrobial discovery and resistance breaking

    Directory of Open Access Journals (Sweden)

    James E.M. Stach

    2011-09-01

    Full Text Available The increasing incidence and prevalence of antibiotic resistance in bacteria threatens the antibiotic miracle. Conventional antimicrobial drug development has failed to replace the armamentarium needed to combat this problem, and novel solutions are urgently required. Here we review both natural and synthetic RNA silencing and its potential to provide new antibacterials through improved target selection, evaluation and screening. Furthermore, we focus on synthetic RNA silencers as a novel class of antibacterials and review their unique properties.

  11. RNA-Dependent RNA Polymerase 6 Is Required for Efficient hpRNA-Induced Gene Silencing in Plants

    OpenAIRE

    Harmoko, Rikno; Fanata, Wahyu Indra Duwi; Yoo, Jae Yong; Ko, Ki Seong; Rim, Yeong Gil; Uddin, Mohammad Nazim; Siswoyo, Tri Agus; Lee, Seung Sik; Kim, Dool Yi; Lee, Sang Yeol; Lee, Kyun Oh

    2013-01-01

    In plants, transgenes with inverted repeats are used to induce efficient RNA silencing, which is also frequently induced by highly transcribed sense transgenes. RNA silencing induced by sense transgenes is dependent on RNA-dependent RNA polymerase 6 (RDR6), which converts single-stranded (ss) RNA into double-stranded (ds) RNA. By contrast, it has been proposed that RNA silencing induced by self-complementary hairpin RNA (hpRNA) does not require RDR6, because the hpRNA can directly fold back o...

  12. RNA silencing in plants by the expression of siRNA duplexes

    OpenAIRE

    Lu, Shanfa; Shi, Rui; Tsao, Cheng-Chung; Yi, Xiaoping; Li, Laigeng; Chiang, Vincent L.

    2004-01-01

    In animal cells, stable RNA silencing can be achieved by vector-based small interfering RNA (siRNA) expression system, in which Pol III RNA gene promoters are used to drive the expression of short hairpin RNA, however, this has not been demonstrated in plants. Whether Pol III RNA gene promoter is capable of driving siRNA expression in plants is unknown. Here, we report that RNA silencing was achieved in plants through stable expression of short hairpin RNA, which was driven by Pol III RNA gen...

  13. Gene silencing: Double-stranded RNA mediated mRNA degradation and gene inactivation

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The recent development of gene transfer approaches in plants and animals has revealed that transgene can undergo silencing after integration in the genome. Host genes can also be silenced as a consequence of the presence of a homologous transgene. More and more investigations have demonstrated that doublestranded RNA can silence genes by triggering degradation of homologous RNA in the cytoplasm and by directing methylation of homologous nuclear DNA sequences. Analyses of Arabidopsis mutants and plant viral suppressors of silencing are unraveling RNA-silencing mechanisms and are assessing the role of methylation in transcriptional and posttranscriptional gene silencing. This review will focus on double-stranded RNA mediated mRNA degradation and gene inactivation in plants.

  14. The dynamics and efficacy of antiviral RNA silencing: A model study

    OpenAIRE

    Hogeweg Paulien; Groenenboom Marian AC

    2008-01-01

    Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cl...

  15. A 22-nt artificial microRNA mediates widespread RNA silencing in Arabidopsis

    OpenAIRE

    McHale, Marcus; Eamens, Andrew L.; Finnegan, E Jean; Waterhouse, Peter M

    2013-01-01

    It is known that 22-nucleotide (nt) microRNAs (miRNAs) derived from asymmetric duplexes trigger phased small-interfering RNA (phasiRNA) production from complementary targets. Here we investigate the efficacy of 22-nt artificial miRNA (amiRNA)-mediated RNA silencing relative to conventional hairpin RNA (hpRNA) and 21-nt amiRNA-mediated RNA silencing. CHALCONE SYNTHASE (CHS) was selected as a target in Arabidopsis thaliana due to the obvious and non-lethal loss of anthocyanin accumulation upon ...

  16. RNA silencing can explain chlorotic infection patterns on plant leaves

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-11-01

    Full Text Available Abstract Background RNA silencing has been implicated in virus symptom development in plants. One common infection symptom in plants is the formation of chlorotic tissue in leaves. Chlorotic and healthy tissue co-occur on a single leaf and form patterns. It has been shown that virus levels in chlorotic tissue are high, while they are low in healthy tissue. Additionally, the presence of siRNAs is confined to the chlorotic spots and the boundaries between healthy and infected tissue. These results strongly indicate that the interaction between virus growth and RNA silencing plays a role in the formation of infection patterns on leaves. However, how RNA silencing leads to the intricate patterns is not known. Results Here we elucidate the mechanisms leading to infection patterns and the conditions which lead to the various patterns observed. We present a modeling approach in which we combine intra- and inter-cellular dynamics of RNA silencing and viral growth. We observe that, due to the spread of viruses and the RNA silencing response, parts of the tissue become infected while other parts remain healthy. As is observed in experiments high virus levels coincide with high levels of siRNAs, and siRNAs are also present in the boundaries between infected and healthy tissue. We study how single- and double-stranded cleavage by Dicer and amplification by RNA-dependent RNA polymerase can affect the patterns formed. Conclusion This work shows that RNA silencing and virus growth within a cell, and the local spread of virions and siRNAs between cells can explain the heterogeneous spread of virus in leaf tissue, and therewith the observed infection patterns in plants.

  17. Anti-viral RNA silencing: do we look like plants ?

    OpenAIRE

    Lecellier Charles-Henri; Saumet Anne

    2006-01-01

    Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to ...

  18. Molecular mechanism of RNA silencing suppression mediated by p19 protein of tombusviruses

    OpenAIRE

    Lakatos, Lóránt; Szittya, György; Silhavy, Dániel; Burgyán, József

    2004-01-01

    RNA silencing is an evolutionarily conserved surveillance system that occurs in a broad range of eukaryotic organisms. In plants, RNA silencing acts as an antiviral system; thus, successful virus infection requires suppression of gene silencing. A number of viral suppressors have been identified so far; however, the molecular bases of silencing suppression are still poorly understood. Here we show that p19 of Cymbidium ringspot virus (CymRSV) inhibits RNA silencing via its small RNA-binding a...

  19. Disease-Causing Allele-Specific Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Hirohiko Hohjoh

    2013-04-01

    Full Text Available Small double-stranded RNAs (dsRNAs of approximately 21-nucleotides in size, referred to as small interfering RNA (siRNA duplexes, can induce sequence-specific posttranscriptional gene silencing, or RNA interference (RNAi. Since chemically synthesized siRNA duplexes were found to induce RNAi in mammalian cells, RNAi has become a powerful reverse genetic tool for suppressing the expression of a gene of interest in mammals, including human, and its application has been expanding to various fields. Recent studies further suggest that synthetic siRNA duplexes have the potential for specifically inhibiting the expression of an allele of interest without suppressing the expression of other alleles, i.e., siRNA duplexes likely confer allele-specific silencing. Such gene silencing by RNAi is an advanced technique with very promising applications. In this review, I would like to discuss the potential utility of allele-specific silencing by RNAi as a therapeutic method for dominantly inherited diseases, and describe possible improvements in siRNA duplexes for enhancing their efficacy.

  20. A Multifunctional Protein Encoded by Turkey Herpesvirus Suppresses RNA Silencing in Nicotiana benthamiana▿

    OpenAIRE

    Jing, Xiu-li; Fan, Mei-na; Jia, Gang; Liu, Lan-wei; Lin MA; Zheng, Cheng-Chao; Zhu, Xiao-Ping; Liu, Hong-Mei; Wang, Xiao-Yun

    2011-01-01

    Many plant and animal viruses counteract RNA silencing-mediated defense by encoding diverse RNA silencing suppressors. We characterized HVT063, a multifunctional protein encoded by turkey herpesvirus (HVT), as a silencing suppressor in coinfiltration assays with green fluorescent protein transgenic Nicotiana benthamiana line 16c. Our results indicated that HVT063 could strongly suppress both local and systemic RNA silencing induced by either sense RNA or double-stranded RNA (dsRNA). HVT063 co...

  1. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  2. Lentivirus-based RNA Silencing of Nemo-like Kinase (NLK) Inhibits the CAL 27 Human Adenosquamos Carcinoma Cells Proliferation and Blocks G0/G1 Phase to S Phase

    OpenAIRE

    Zhang, Bin; Li, Ke Yi; Chen, Hai Ying; Pan, Shao Dong; Chen, Shuang Feng; Zhang, Wei Feng; Xia, Chun Peng; Jiang, Li Cheng; Liu, Xian Bin; Zhao, Feng Jun; Yuan, Dao Ying; Wang, Le Xin; Wu, Ya Ping; Liu, Shu Wei

    2013-01-01

    Background: The Nemo-like kinase (NLK) is a serine/threonine-protein kinase that involved in a number of signaling pathways regulating cell fate. Variation of NLK has been shown to be associated with the risk of cancer. However, the function of NLK in oral adenosquamous carcinoma cells line CAL-27 is unknown. Methods: In this study, we evaluated the function of NLK in CAL-27 cells by using lentivirus-mediated RNA silence. The targeted gene expression, cell proliferation and cell cycle are inv...

  3. Identification of an RNA Silencing Suppressor from a Plant Double-Stranded RNA Virus

    OpenAIRE

    Cao, Xuesong; Zhou, Peng; Zhang, Xiaoming; Zhu, Shifeng; Zhong, Xuehua; Xiao, Qi; Ding, Biao; Li, Yi

    2005-01-01

    RNA silencing is a mechanism which higher plants and animals have evolved to defend against viral infection in addition to regulation of gene expression for growth and development. As a counterdefense, many plant and some animal viruses studied to date encode RNA silencing suppressors (RSS) that interfere with various steps of the silencing pathway. In this study, we report the first identification of an RSS from a plant double-stranded RNA (dsRNA) virus. Pns10, encoded by S10 of Rice dwarf p...

  4. Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum

    OpenAIRE

    Schumann, Ulrike; Smith, Neil A; Kazan, Kemal; Ayliffe, Michael; Wang, Ming-Bo

    2013-01-01

    Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is...

  5. CAPN5 gene silencing by short hairpin RNA interference

    OpenAIRE

    Nelson, Nnamdi G; Jessica M Skeie; Muradov, Hakim; Rowell, Hannah A; Seo, Seongjin; Mahajan, Vinit B

    2014-01-01

    Background The purpose of this project was to identify short hairpin RNA (shRNA) sequences that can suppress expression of human CAPN5 in which gain-of-function mutants cause autosomal dominant neovascular inflammatory vitreoretinopathy (ADNIV). We created HEK293T cells that stably express an ADNIV disease allele, CAPN5-p.R243L. Transfection protocols were optimized for neuroblastoma SHSY5Y cells. The gene silencing effect of four different shRNA plasmids that target CAPN5 was tested. RNA and...

  6. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been...... phosphorothioate-DNA segment flanked by LNA gaps, rivals siRNA as the technology of choice for target validation and therapeutic applications....

  7. Involvement of RDR6 in short-range intercellular RNA silencing in Nicotiana benthamiana

    OpenAIRE

    Cheng Qin; Nongnong Shi; Mei Gu; Hang Zhang; Bin Li; Jiajia Shen; Atef Mohammed; Eugene Ryabov; Chunyang Li; Huizhong Wang; Yule Liu; Toba Osman; Manu Vatish; Yiguo Hong

    2012-01-01

    In plants, non-cell autonomous RNA silencing spreads between cells and over long distances. Recent work has revealed insight on the genetic and molecular components essential for cell-to-cell movement of RNA silencing in Arabidopsis. Using a local RNA silencing assay, we report on a distinct mechanism that may govern the short-range (6–10 cell) trafficking of virus-induced RNA silencing from epidermal to neighbouring palisade and spongy parenchyma cells in Nicotiana benthamiana. This process ...

  8. Tat RNA silencing suppressor activity contributes to perturbation of lymphocyte miRNA by HIV-1

    Directory of Open Access Journals (Sweden)

    Yu Lianbo

    2011-05-01

    Full Text Available Abstract Background MicroRNA (miRNA-mediated RNA silencing is integral to virtually every cellular process including cell cycle progression and response to virus infection. The interplay between RNA silencing and HIV-1 is multifaceted, and accumulating evidence posits a strike-counterstrike interface that alters the cellular environment to favor virus replication. For instance, miRNA-mediated RNA silencing of HIV-1 translation is antagonized by HIV-1 Tat RNA silencing suppressor activity. The activity of HIV-1 accessory proteins Vpr/Vif delays cell cycle progression, which is a process prominently modulated by miRNA. The expression profile of cellular miRNA is altered by HIV-1 infection in both cultured cells and clinical samples. The open question stands of what, if any, is the contribution of Tat RNA silencing suppressor activity or Vpr/Vif activity to the perturbation of cellular miRNA by HIV-1. Results Herein, we compared the perturbation of miRNA expression profiles of lymphocytes infected with HIV-1NL4-3 or derivative strains that are deficient in Tat RNA silencing suppressor activity (Tat K51A substitution or ablated of the vpr/vif open reading frames. Microarrays recapitulated the perturbation of the cellular miRNA profile by HIV-1 infection. The miRNA expression trends overlapped ~50% with published microarray results on clinical samples from HIV-1 infected patients. Moreover, the number of miRNA perturbed by HIV-1 was largely similar despite ablation of Tat RSS activity and Vpr/Vif; however, the Tat RSS mutation lessened HIV-1 downregulation of twenty-two miRNAs. Conclusions Our study identified miRNA expression changes attributable to Tat RSS activity in HIV-1NL4-3. The results accomplish a necessary step in the process to understand the interface of HIV-1 with host RNA silencing activity. The overlap in miRNA expression trends observed between HIV-1 infected CEMx174 lymphocytes and primary cells supports the utility of cultured

  9. SERRATE is required for intron suppression of RNA silencing in Arabidopsis

    OpenAIRE

    Christie, Michael; Carroll, Bernard J.

    2011-01-01

    Transposons and viruses are generally devoid of introns and are prime targets for small interfering RNAs (siRNAs) and RNA silencing. Conversely, endogenous genes often contain introns and are not usually subjected to post-transcriptional gene silencing by siRNAs. In a recent study, we reported that efficient intron splicing directly suppresses siRNA biogenesis and RNA silencing of a Green Fluorescence Protein (GFP) transgene. Splicing-mediated suppression of GFP silencing was dependent on ABH...

  10. Noise and correlations in genes silenced by small RNA.

    Science.gov (United States)

    Hwa, Terence; Levine, Erel

    2006-03-01

    Many small regulatory RNAs have been identified in prokaryotes and eukaryotes in recent years. In many cases, RNA regulation is found in critical pathways. These include stress response and quorum sensing pathways in bacteria, and cell differentiation and programmed cell death in eukaryotes. In many cases, regulation by small RNA is used in switching off a response program as long as it is not required, allowing for a fast switching on when necessary. Clearly, accidental execution of such a program may bare grave consequences on the cell, and should be avoided. Here we analyze a stochastic model for gene regulation by the most abundant class of small RNA in bacteria. This class of small RNAs acts by base pairing with target mRNAs, silencing its translation and actively promoting its degradation. Importantly, the small RNA molecule is not recycled. Our model suggests that genes silenced by sRNA exhibits smooth noise, as opposed to the bursty noise characteristic to genes repressed at the level of transcription, with coupling between intrinsic noise and global, extrinsic fluctuations. In addition, we investigate how noise propagates through the indirect coupling between different targets of the same sRNA. These features are discussed in the context of circuits exhibiting multi-stability, where protein bursts have strong implications on spontaneous switching.

  11. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation.

    Science.gov (United States)

    Fusaro, Adriana F; Correa, Regis L; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F S; Waterhouse, Peter M

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0(PE), in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0(PE) has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0(PE) destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery. PMID:22361475

  12. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    International Nuclear Information System (INIS)

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0PE, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  13. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    Directory of Open Access Journals (Sweden)

    Tan Bertrand

    2012-06-01

    Full Text Available Abstract Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters.

  14. Rescue of Mtp siRNA-induced hepatic steatosis by DGAT2 siRNA silencing[S

    OpenAIRE

    Tep, Samnang; Mihaila, Radu; Freeman, Alexander; Pickering, Victoria; Huynh, Felicia; Tadin-Strapps, Marija; Stracks, Allison; Hubbard, Brian; Caldwell, Jeremy; Flanagan, W. Michael; Kuklin, Nelly A.; Ason, Brandon

    2012-01-01

    Microsomal triglyceride transfer protein (Mtp) inhibitors represent a novel therapeutic approach to lower circulating LDL cholesterol, although therapeutic development has been hindered by the observed increase in hepatic triglycerides and liver steatosis following treatment. Here, we used small interfering RNAs (siRNA) targeting Mtp to achieve target-specific silencing to study this phenomenon and to determine to what extent liver steatosis is induced by changes in Mtp expression. We observe...

  15. Analysis of Pineapple Mealybug Wilt Associated Virus -1 and -2 for Potential RNA Silencing Suppressors and Pathogenicity Factors

    Directory of Open Access Journals (Sweden)

    Kishore K. Dey

    2015-03-01

    Full Text Available Higher plants use RNA silencing to defend against viral infections. As a counter defense, plant viruses have evolved proteins that suppress RNA silencing. Mealybug wilt of pineapple (MWP, an important disease of pineapple, has been associated with at least three distinct viruses, Pineapple mealybug wilt associated virus -1, -2, and -3 (PMWaV-1, -2, and -3. Selected open reading frames (ORFs of PMWaV-1 and PMWaV-2 were screened for their local and systemic suppressor activities in Agrobacterium-mediated transient assays using green fluorescent protein (GFP in Nicotiana benthamiana. Results indicate that PMWaV-2 utilizes a multiple-component RNA silencing suppression mechanism. Two proteins, p20 and CP, target both local and systemic silencing in N. benthamiana, while the p22 and CPd proteins target only systemic silencing. In the related virus PMWaV-1, we found that only one of the encoded proteins, p61, had only systemic suppressor activity. Of all the proteins tested from both viruses, only the PMWaV-2 p20 protein suppressed local silencing induced by double-stranded RNA (dsRNA, but only when low levels of inducing dsRNA were used. None of the proteins analyzed could interfere with the short distance spread of silencing. We examined the mechanism of systemic suppression activity by investigating the effect of PMWaV-2-encoded p20 and CP proteins on secondary siRNAs. Our results suggest that the PMWaV-2 p20 and CP proteins block the systemic silencing signal by repressing production of secondary siRNAs. We also demonstrate that the PMWaV-2 p20 and p22 proteins enhanced the pathogenicity of Potato virus X in N. benthamiana.

  16. JMJ14, a JmjC domain protein, is required for RNA silencing and cell-to-cell movement of an RNA silencing signal in Arabidopsis

    OpenAIRE

    Searle, I.R.; Melnyk, C. W.; Baulcombe, D. C.; Smith, L. M.; Pontes, O.

    2010-01-01

    JMJ14 is a histone H3 Lys4 (H3K4) trimethyl demethylase that affects mobile RNA silencing in an Arabidopsis transgene system. It also influences CHH DNA methylation, abundance of endogenous transposon transcripts, and flowering time. JMJ14 acts at a point in RNA silencing pathways that is downstream from RNA-dependent RNA polymerase 2 (RDR2) and Argonaute 4 (AGO4). Our results illustrate a link between RNA silencing and demethylation of histone H3 trimethylysine. We propose that JMJ14 acts do...

  17. Essential and overlapping functions for mammalian Argonautes in microRNA silencing

    OpenAIRE

    Su, Hong; Trombly, Melanie I.; Chen, Jian; Wang, Xiaozhong

    2009-01-01

    MicroRNA (miRNA) silencing fine-tunes protein output and regulates diverse biological processes. Argonaute (Ago) proteins are the core effectors of the miRNA pathway. In lower organisms, multiple Agos have evolved specialized functions for distinct RNA silencing pathways. However, the roles of mammalian Agos have not been well characterized. Here we show that mouse embryonic stem (ES) cells deficient for Ago1–4 are completely defective in miRNA silencing and undergo apoptosis. In miRNA silenc...

  18. Silencing Near tRNA Genes Requires Nucleolar Localization*S

    OpenAIRE

    Wang, Li; Haeusler, Rebecca A.; Good, Paul D.; Thompson, Martin; Nagar, Sapna; Engelke, David R.

    2005-01-01

    Transcription by RNA polymerase II is antagonized by the presence of a nearby tRNA gene in Saccharomyces cerevisiae. To test hypotheses concerning the mechanism of this tRNA gene-mediated (tgm) silencing, the effects of specific gene deletions were determined. The results show that the mechanism of silencing near tRNA genes is fundamentally different from other forms of transcriptional silencing in yeast. Rather, tgm silencing is dependent on the ability to cluster the dispersed tRNA genes in...

  19. piRNA-guided slicing of transposon transcripts enforces their transcriptional silencing via specifying the nuclear piRNA repertoire

    OpenAIRE

    Senti, Kirsten-André; Jurczak, Daniel; Sachidanandam, Ravi; Brennecke, Julius

    2015-01-01

    In this study, Senti et al investigate how cytoplasmic post-transcriptional silencing influences transcriptional silencing in the nucleus. They show that Piwi-bound piRNA populations depend almost exclusively on prior piRNA-guided transcript slicing, thus providing further insight into the regulation of piRNA biogenesis in the developing Drosophila ovary.

  20. Mod5 protein binds to tRNA gene complexes and affects local transcriptional silencing

    OpenAIRE

    Pratt-Hyatt, Matthew; Pai, Dave A.; Haeusler, Rebecca A.; Wozniak, Glenn G.; Good, Paul D.; Miller, Erin L.; McLeod, Ian X.; Yates, John R.; Hopper, Anita K.; Engelke, David R.

    2013-01-01

    This study provides new insight into the requirements for observed silencing of RNA polymerase II transcription near tRNA genes. Mod5 is a conserved tRNA modification enzyme found in both the nucleus and cytoplasm, although it only modifies tRNAs in the cytoplasm. Mod5 is required for silencing near tRNA genes, and it is bound to both nuclear tRNA gene complexes and nuclear pre-tRNA transcripts. Possible mechanisms for this form of RNA-mediated transcriptional silencing are discussed.

  1. Tobacco rattle virus 16K silencing suppressor binds ARGONAUTE 4 and inhibits formation of RNA silencing complexes.

    Science.gov (United States)

    Fernández-Calvino, Lourdes; Martínez-Priego, Llúcia; Szabo, Edit Z; Guzmán-Benito, Irene; González, Inmaculada; Canto, Tomás; Lakatos, Lóránt; Llave, César

    2016-01-01

    The cysteine-rich 16K protein of tobacco rattle virus (TRV), the type member of the genus Tobravirus, is known to suppress RNA silencing. However, the mechanism of action of the 16K suppressor is not well understood. In this study, we used a GFP-based sensor strategy and an Agrobacterium-mediated transient assay in Nicotiana benthamiana to show that 16K was unable to inhibit the activity of existing small interfering RNA (siRNA)- and microRNA (miRNA)-programmed RNA-induced silencing effector complexes (RISCs). In contrast, 16K efficiently interfered with de novo formation of miRNA- and siRNA-guided RISCs, thus preventing cleavage of target RNA. Interestingly, we found that transiently expressed endogenous miR399 and miR172 directed sequence-specific silencing of complementary sequences of viral origin. 16K failed to bind small RNAs, although it interacted with ARGONAUTE 4, as revealed by bimolecular fluorescence complementation and immunoprecipitation assays. Site-directed mutagenesis demonstrated that highly conserved cysteine residues within the N-terminal and central regions of the 16K protein are required for protein stability and/or RNA silencing suppression. PMID:26498945

  2. Post-transcriptional regulation of meiotic genes by a nuclear RNA silencing complex

    OpenAIRE

    Egan, Emily D.; Braun, Craig R.; Gygi, Steven P.; Moazed, Danesh

    2014-01-01

    The authors define a multiprotein nuclear RNA silencing (NURS) complex that mediates silencing of meiotic genes during vegetative growth in the fission yeast S. pombe. Meiotic gene silencing occurs post-transcriptionally through recruitment of the exosome complex to promote RNA degradation. Extensive interaction analysis and functional characterizations link the NURS complex to specific RNA-binding and processing proteins and also chromatin modification machinery.

  3. The dynamics and efficacy of antiviral RNA silencing: A model study

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-03-01

    Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

  4. Aureusvirus P14 Is an Efficient RNA Silencing Suppressor That Binds Double-Stranded RNAs without Size Specificity‡

    OpenAIRE

    Mérai, Zsuzsanna; Kerényi, Zoltán; Molnár, Attila; Barta, Endre; Válóczi, Anna; Bisztray, György; Havelda, Zoltán; Burgyán, József; Silhavy, Dániel

    2005-01-01

    RNA silencing is a conserved eukaryotic gene regulatory system in which sequence specificity is determined by small RNAs. Plant RNA silencing also acts as an antiviral mechanism; therefore, viral infection requires expression of a silencing suppressor. The mechanism and the evolution of silencing suppression are still poorly understood. Tombusvirus open reading frame (ORF) 5-encoded P19 is a size-selective double-stranded RNA (dsRNA) binding protein that suppresses silencing by sequestering d...

  5. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    International Nuclear Information System (INIS)

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  6. Evaluation of shRNA-mediated gene silencing by electroporation in LPB fibrosarcoma cells:

    OpenAIRE

    Čemažar, Maja; Kamenšek, Urška; Vidic, Suzana

    2008-01-01

    Background. Silencing oncogenes or other genes that contribute to tumor malignancy and progression offers a promising approach to treating cancer. Specific and efficient silencing of gene expression can be achieved by RNA interference (RNAi) technology using small interfering RNA (siRNA) or short hairpin RNA (shRNA). However, a major challenge in RNAi technology is effective delivery of interfering molecules into target cells. The aim of our study was to evaluate electroporation as a perspect...

  7. Modification of Small RNAs Associated with Suppression of RNA Silencing by Tobamovirus Replicase Protein▿

    OpenAIRE

    Vogler, Hannes; Akbergenov, Rashid; Shivaprasad, Padubidri V; Dang, Vy; Fasler, Monika; Kwon, Myoung-Ok; Zhanybekova, Saule; Hohn, Thomas; Heinlein, Manfred

    2007-01-01

    Plant viruses act as triggers and targets of RNA silencing and have evolved proteins to suppress this plant defense response during infection. Although Tobacco mosaic tobamovirus (TMV) triggers the production of virus-specific small interfering RNAs (siRNAs), this does not lead to efficient silencing of TMV nor is a TMV-green fluorescent protein (GFP) hybrid able to induce silencing of a GFP-transgene in Nicotiana benthamiana, indicating that a TMV silencing suppressor is active and acts down...

  8. The p122 Subunit of Tobacco Mosaic Virus Replicase Is a Potent Silencing Suppressor and Compromises both Small Interfering RNA- and MicroRNA-Mediated Pathways▿

    OpenAIRE

    Csorba, Tibor; Bovi, Aurelie; Dalmay, Tamás; Burgyán, József

    2007-01-01

    One of the functions of RNA silencing in plants is to defend against molecular parasites, such as viruses, retrotransposons, and transgenes. Plant viruses are inducers, as well as targets, of RNA silencing-based antiviral defense. Replication intermediates or folded viral RNAs activate RNA silencing, generating small interfering RNAs (siRNAs), which are the key players in the antiviral response. Viruses are able to counteract RNA silencing by expressing silencing-suppressor proteins. It has b...

  9. Viral Class 1 RNase III Involved in Suppression of RNA Silencing

    OpenAIRE

    Kreuze, Jan F.; Savenkov, Eugene I.; Cuellar, Wilmer; Li, Xiangdong; Valkonen, Jari P. T.

    2005-01-01

    Double-stranded RNA (dsRNA)-specific endonucleases belonging to RNase III classes 3 and 2 process dsRNA precursors to small interfering RNA (siRNA) or microRNA, respectively, thereby initiating and amplifying RNA silencing-based antiviral defense and gene regulation in eukaryotic cells. However, we now provide evidence that a class 1 RNase III is involved in suppression of RNA silencing. The single-stranded RNA genome of sweet potato chlorotic stunt virus (SPCSV) encodes an RNase III (RNase3)...

  10. Receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient delivery system for MRTF silencing in conjunctival fibrosis

    Science.gov (United States)

    Yu-Wai-Man, Cynthia; Tagalakis, Aristides D.; Manunta, Maria D.; Hart, Stephen L.; Khaw, Peng T.

    2016-02-01

    There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.

  11. Influence of viral genes on the cell-to-cell spread of RNA silencing

    OpenAIRE

    Zhou, Yu; Ryabov, Eugene; Zhang, Xuemei; Hong, Yiguo

    2008-01-01

    The turnip crinkle virus-based vector TCV–GFPΔCP had been devised previously to study cell-to-cell and long-distance spread of virus-induced RNA silencing. TCV–GFPΔCP, which had been constructed by replacing the coat protein (CP) gene with a green fluorescent protein (GFP) coding sequence, was able to induce RNA silencing in single epidermal cells, from which RNA silencing spread from cell-to-cell. Using this unique local silencing assay together with mutagenesis analysis, two TCV genes, p8 a...

  12. Viral suppressors of RNA silencing in Wheat mosaic virus (WMoV)

    Science.gov (United States)

    RNA silencing is the most effective antiviral adaptive defense mechanism mounted in higher plants to combat viral infection and proliferation. However, viruses have developed a variety of efficient counter-defense mechanisms by suppression of RNA silencing (VSR) in order to successfully impede the h...

  13. High potency silencing by single-stranded boranophosphate siRNA

    OpenAIRE

    Hall, Allison H. S.; Wan, Jing; Spesock, April; Sergueeva, Zinaida; Shaw, Barbara Ramsay; Alexander, Kenneth A.

    2006-01-01

    In RNA interference (RNAi), double-stranded short interfering RNA (ds-siRNA) inhibits expression from complementary mRNAs. Recently, it was demonstrated that short, single-stranded antisense RNA (ss-siRNA) can also induce RNAi. While ss-siRNA may offer several advantages in both clinical and research applications, its overall poor activity compared with ds-siRNA has prevented its widespread use. In contrast to the poor gene silencing activity of native ss-siRNA, we found that the silencing ac...

  14. Simple gene silencing using the trans-acting siRNA pathway.

    Science.gov (United States)

    Jacobs, Thomas B; Lawler, Noah J; LaFayette, Peter R; Vodkin, Lila O; Parrott, Wayne A

    2016-01-01

    In plants, particular micro-RNAs (miRNAs) induce the production of a class of small interfering RNAs (siRNA) called trans-acting siRNA (ta-siRNA) that lead to gene silencing. A single miRNA target is sufficient for the production of ta-siRNAs, which target can be incorporated into a vector to induce the production of siRNAs, and ultimately gene silencing. The term miRNA-induced gene silencing (MIGS) has been used to describe such vector systems in Arabidopsis. Several ta-siRNA loci have been identified in soybean, but, prior to this work, few of the inducing miRNAs have been experimentally validated, much less used to silence genes. Nine ta-siRNA loci and their respective miRNA targets were identified, and the abundance of the inducing miRNAs varies dramatically in different tissues. The miRNA targets were experimentally verified by silencing a transgenic GFP gene and two endogenous genes in hairy roots and transgenic plants. Small RNAs were produced in patterns consistent with the utilization of the ta-siRNA pathway. A side-by-side experiment demonstrated that MIGS is as effective at inducing gene silencing as traditional hairpin vectors in soybean hairy roots. Soybean plants transformed with MIGS vectors produced siRNAs and silencing was observed in the T1 generation. These results complement previous reports in Arabidopsis by demonstrating that MIGS is an efficient way to produce siRNAs and induce gene silencing in other species, as shown with soybean. The miRNA targets identified here are simple to incorporate into silencing vectors and offer an effective and efficient alternative to other gene silencing strategies. PMID:25816689

  15. AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system

    OpenAIRE

    Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

    2013-01-01

    AGO/RISC-mediated antiviral RNA silencing, an important component of the plant’s immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs ...

  16. Promoter-bound trinucleotide repeat mRNA drives epigenetic silencing in fragile X syndrome.

    Science.gov (United States)

    Colak, Dilek; Zaninovic, Nikica; Cohen, Michael S; Rosenwaks, Zev; Yang, Wang-Yong; Gerhardt, Jeannine; Disney, Matthew D; Jaffrey, Samie R

    2014-02-28

    Epigenetic gene silencing is seen in several repeat-expansion diseases. In fragile X syndrome, the most common genetic form of mental retardation, a CGG trinucleotide-repeat expansion adjacent to the fragile X mental retardation 1 (FMR1) gene promoter results in its epigenetic silencing. Here, we show that FMR1 silencing is mediated by the FMR1 mRNA. The FMR1 mRNA contains the transcribed CGG-repeat tract as part of the 5' untranslated region, which hybridizes to the complementary CGG-repeat portion of the FMR1 gene to form an RNA·DNA duplex. Disrupting the interaction of the mRNA with the CGG-repeat portion of the FMR1 gene prevents promoter silencing. Thus, our data link trinucleotide-repeat expansion to a form of RNA-directed gene silencing mediated by direct interactions of the trinucleotide-repeat RNA and DNA. PMID:24578575

  17. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  18. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  19. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Science.gov (United States)

    Mahajan, Monika; Ahuja, Paramvir Singh; Yadav, Sudesh Kumar

    2011-01-01

    Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS) encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS) is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi) through post-transcriptional gene silencing (PTGS) of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin) content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin) was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA) at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  20. RNA complementary to the 5' UTR of mRNA triggers effective silencing in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Conditional silencing of target genes in Saccharomyces cerevisiae by antisense RNAs expressed in vivo has been challenged. The MFα1::lacZ fusion present in S. cerevisiae SF51-3 was chosen as a model target, and fragments of this gene were cloned in reverse orientation into the expression vector pYES2, bearing the GAL1 promoter. Among the different antisense constructs tested, only the one complementary to the 5' UTR of target mRNA featured effective silencing. Nevertheless, the expression in vivo of this antisense RNA could not be properly tuned by the absence or presence of galactose in the culture medium. Accordingly, conditional silencing could not be attained by this antisense hosted into pYES2. On the contrary, cloning the same antisense construct into the expression vector pSAL4 yielded a fully conditional silencing linked to the control of antisense expression by the absence or presence of Cu2+ into the culture medium

  1. A single transgene locus triggers both transcriptional and post-transcriptional silencing through double-stranded RNA production

    OpenAIRE

    Mourrain, Philippe; Blokland, van, R.; Kooter, Jan; Vaucheret, Hervé

    2007-01-01

    Silencing of a target locus by an unlinked silencing locus can result from transcription inhibition (transcriptional gene silencing; TGS) or mRNA degradation (post-transcriptional gene silencing; PTGS), owing to the production of double-stranded RNA (dsRNA) corresponding to promoter or transcribed sequences, respectively. The involvement of distinct cellular components in each process suggests that dsRNA-induced TGS and PTGS likely result from the diversification of an ancient common mechanis...

  2. Widespread siRNA “off-target” transcript silencing mediated by seed region sequence complementarity

    OpenAIRE

    Jackson, Aimee L.; Burchard, Julja; Schelter, Janell; Chau, B. Nelson; Cleary, Michele; Lim, Lee; Linsley, Peter S

    2006-01-01

    Transfected siRNAs and miRNAs regulate numerous transcripts that have only limited complementarity to the active strand of the RNA duplex. This process reflects natural target regulation by miRNAs, but is an unintended (“off-target”) consequence of siRNA-mediated silencing. Here we demonstrate that this unintended off-target silencing is widespread, and occurs in a manner reminiscent of target silencing by miRNAs. A high proportion of unintended transcripts silenced by siRNAs showed 3' UTR se...

  3. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  4. MicroRNA 665 Regulates Dentinogenesis through MicroRNA-Mediated Silencing and Epigenetic Mechanisms.

    Science.gov (United States)

    Heair, Hannah M; Kemper, Austin G; Roy, Bhaskar; Lopes, Helena B; Rashid, Harunur; Clarke, John C; Afreen, Lubana K; Ferraz, Emanuela P; Kim, Eddy; Javed, Amjad; Beloti, Marcio M; MacDougall, Mary; Hassan, Mohammad Q

    2015-09-01

    Studies of proteins involved in microRNA (miRNA) processing, maturation, and silencing have indicated the importance of miRNAs in skeletogenesis, but the specific miRNAs involved in this process are incompletely defined. Here, we identified miRNA 665 (miR-665) as a potential repressor of odontoblast maturation. Studies with cultured cell lines and primary embryonic cells showed that miR-665 represses the expression of early and late odontoblast marker genes and stage-specific proteases involved in dentin maturation. Notably, miR-665 directly targeted Dlx3 mRNA and decreased Dlx3 expression. Furthermore, RNA-induced silencing complex (RISC) immunoprecipitation and biotin-labeled miR-665 pulldown studies identified Kat6a as another potential target of miR-665. KAT6A interacted physically and functionally with RUNX2, activating tissue-specific promoter activity and prompting odontoblast differentiation. Overexpression of miR-665 reduced the recruitment of KAT6A to Dspp and Dmp1 promoters and prevented KAT6A-induced chromatin remodeling, repressing gene transcription. Taken together, our results provide novel molecular evidence that miR-665 functions in an miRNA-epigenetic regulatory network to control dentinogenesis. PMID:26124283

  5. MicroRNA mimicry blocks pulmonary fibrosis

    Science.gov (United States)

    Montgomery, Rusty L; Yu, Guoying; Latimer, Paul A; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva

    2014-01-01

    Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular disease. While many studies have shown therapeutic efficacy using miRNA inhibitors, efforts to restore or increase the function of a miRNA have been lagging behind. The miR-29 family has gained a lot of attention for its clear function in tissue fibrosis. This fibroblast-enriched miRNA family is downregulated in fibrotic diseases which induces a coordinate increase of many extracellular matrix genes. Here, we show that intravenous injection of synthetic RNA duplexes can increase miR-29 levels in vivo for several days. Moreover, therapeutic delivery of these miR-29 mimics during bleomycin-induced pulmonary fibrosis restores endogenous miR-29 function whereby decreasing collagen expression and blocking and reversing pulmonary fibrosis. Our data support the feasibility of using miRNA mimics to therapeutically increase miRNAs and indicate miR-29 to be a potent therapeutic miRNA for treating pulmonary fibrosis. PMID:25239947

  6. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    Induction of post-transcriptional gene silencing (PTGS) by transgenes can be exploited in the genetic engineering of plants for virus resistance, altered lipid or polysaccharide composition, delayed flowering, reduced toxin or allergen content, and many other desired traits. Transformation with...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... of simple and inverted repeat constructs with respect to resistance stability upon challenge with another virus. We found that silencing induced by an inverted repeat construct persisted after virus infection where silencing induced by a simple sense construct failed. Furthermore, even with a simple...

  7. Modified siRNA Structure With a Single Nucleotide Bulge Overcomes Conventional siRNA-mediated Off-target Silencing

    OpenAIRE

    Dua, Pooja; Yoo, Jae Wook; Kim, Soyoun; Lee, Dong-ki

    2011-01-01

    Off-target gene silencing is a major concern when using RNA interference. Imperfect pairing of the antisense strand with unintended mRNA targets is one of the main causes of small interfering RNA (siRNA) off-target silencing. To overcome this, we have developed “bulge-siRNA,” a modified siRNA backbone structure with a single nucleotide (nt) bulge placed in the antisense strand. We found that siRNAs with a bulge at position 2 of the antisense strand were able to discriminate better between per...

  8. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    OpenAIRE

    Jin, Hailing; Zhu, Jian-Kang

    2010-01-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904–915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular pro...

  9. Plant responses against invasive nucleic acids: RNA silencing and its suppression by plant viral pathogens

    OpenAIRE

    Alvarado, Veria; Herman B Scholthof

    2009-01-01

    RNA silencing is a common strategy shared by eukaryotic organisms to regulate gene expression, and also operates as a defense mechanism against invasive nucleic acids such as viral transcripts. The silencing pathway is quite sophisticated in higher eukaryotes but the distinct steps and nature of effector complexes vary between and even within species. To counteract this defense mechanism viruses have evolved the ability to encode proteins that suppress silencing to protect their genomes from ...

  10. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing

    2010-05-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  11. RNA-mediated gene silencing in the phytopathogenic fungus Bipolaris oryzae.

    Science.gov (United States)

    Moriwaki, Akihiro; Ueno, Makoto; Arase, Sakae; Kihara, Junichi

    2007-04-01

    The Ascomycetous fungus Bipolaris oryzae is the causal agent of brown leaf spot disease in rice and is a model for studying photomorphogenetic responses by near-UV radiation. Targeted gene disruption (knockout) for functional analysis of photomorphogenesis-related genes in B. oryzae can be achieved by homologous recombination with low efficiency. Here, the applicability of RNA silencing (knockdown) as a tool for targeting endogenous genes in B. oryzae is reported. A polyketide synthase gene (PKS1), involved in fungal DHN melanin biosynthesis pathways, was targeted by gene silencing as a marker. The silencing vector encoding hairpin RNA of the PKS1 fragment was constructed in a two-step PCR-based cloning, and introduced into the B. oryzae genomic DNA. Silencing of the PKS1 gene resulted in albino phenotypes and reduction of PKS1 mRNA expression. These results demonstrate the applicability of targeted gene silencing as a useful reverse-genetics approach in B. oryzae. PMID:17227462

  12. ShRNA-mediated gene silencing of β-catenin inhibits growth of human colon cancer cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    AIM: To observe the gene silencing mediated by the specific shRNA targeted against β-catenin and its effect on cell proliferation and cycle distribution in the human colon cancer cell line Colo205.METHODS: Two shRNA plasmid vectors against β-catenin were constructed and transfected into Colo205 cells with LipofectamineTM2000. The down-regulations of β-catenin, c-myc and cyclinD1 expressions were detected by RT-PCR and western blot analysis. The cell proliferation inhibitions were determined by MTT assay and soft agar colony formation assay. The effect of these two β-catenin shRNAs on cell cycle distribution and apoptosis was examined by flow cytometry.RESULTS: These two shRNA vectors targeted against β-catenin efficiently suppressed the expression of β-catenin and its down stream genes, c-myc and cyclinD1. The expression inhibition rates were around 40%-50% either at the mRNA or at the protein level.The shRNA-mediated gene silencing of β-catenin resulted in significant inhibition of cell growth both on the culture plates and in the soft agar. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis at 72 h post transfection due to gene silencing.CONCLUSION: These specific shRNAs targeted against β-catenin could have a gene silencing effect and block the WNT signaling pathway. They could inhibit cell growth, increase apoptosis, and induce cell cycle arrest in Colo205 cells. ShRNA interference against β-catenin is of potential value in gene therapy of colon cancer.

  13. Native microRNA loop sequences can improve short hairpin RNA processing for virus gene silencing in animal cells

    OpenAIRE

    Hinton, Tracey M.; Wise, Terry G; Cottee, Pauline A; Doran, Timothy J

    2008-01-01

    Introduction of small interfering RNAs (siRNAs) into cells results in transitory silencing of target genes with complementary sequence. Incorporating siRNAs into short-hairpin RNAs (shRNAs) or microRNA-adapted shRNAs (shRNAmir) is a popular tool for targeted gene silencing. shRNAmirs mimicking endogenous pre-microRNAs (unprocessed hairpin microRNAs) are more difficult to design and result in longer RNA molecules. The use of microRNA (miRNA) loop sequences in shRNAs as an alternative to an ent...

  14. Promoter-Bound Trinucleotide Repeat mRNA Drives Epigenetic Silencing in Fragile X Syndrome

    OpenAIRE

    Colak, Dilek; Zaninovic, Nikica; Cohen, Michael S; Rosenwaks, Zev; Yang, Wang-Yong; Gerhardt, Jeannine; Disney, Matthew D.; Jaffrey, Samie R.

    2014-01-01

    Epigenetic gene silencing is seen in several repeat-expansion diseases. In fragile X syndrome, the most common genetic form of mental retardation, a CGG trinucleotide–repeat expansion adjacent to the fragile X mental retardation 1 (FMR1) gene promoter results in its epigenetic silencing. Here, we show that FMR1 silencing is mediated by the FMR1 mRNA. The FMR1 mRNA contains the transcribed CGG-repeat tract as part of the 5′ untranslated region, which hybridizes to the complementary CGG-repeat ...

  15. Silencing Huntington's chorea: Is RNA Interference a Potential Cure?

    Directory of Open Access Journals (Sweden)

    Gerlinde A. Metz

    2006-01-01

    Full Text Available In 1872, George Huntington described Huntington's disease as characterized by motor, cognitive and psychiatric impairments. Huntington's disease is a dominant and autosomal mutation on chromosome 4 featuring the insertion of numerous CAG repeats. CAG codes for the amino acid, glutmanine that forms part of the Huntingtin protein (htt. Excess glutamine attachments make htt prone to accumulate in neurons. Three genes can be considered when developing therapies for Huntington's disease. They include targeting the symptoms of the disease, the progression of the disease and the cause of the disease. By using RNA interference (RNAi, the cause of the disease can be targeted. RNAi is a method that could potentially silence the formation of abnormal htt. This paper will discuss how RNAi could potentially cure Huntington's disease, by describing the genetic and proteinomic basis of Huntington's disease, the function of RNAi in Huntington's disease and the problems of benefits of RNAi. Preliminary work using RNAi in transgenic mice has shown a decrease in the behavioural expression of the mutant Huntington gene. There are several limitations associated with using RNAi as a gene therapy. For example, the effects of RNAi are short lived. A transposition system such as Sleeping Beauty can be used to increase the integration of the gene, however, for patients who currently have Huntington's disease, RNAi may potentially be used in combination with drugs or other treatments to target both symptoms and the underlying cause of Huntington's disease. This combination could eventually alleviate many painful symptoms associated with Huntington's disease and could even stop the progressive neurodegeneration of Huntington's disease. This review concludes that a substantial amount of new research is still necessary before RNAi is directly applicable to human patients with Huntington's disease.

  16. HIV-1 Tat RNA silencing suppressor activity is conserved across kingdoms and counteracts translational repression of HIV-1

    OpenAIRE

    Qian, Shuiming; Zhong, Xuehua; Yu, Lianbo; Ding, Biao; Haan, Peter; Boris-Lawrie, Kathleen

    2009-01-01

    The RNA silencing pathway is an intracellular innate response to virus infections and retro-transposons. Many plant viruses counter this host restriction by RNA silencing suppressor (RSS) activity of a double-stranded RNA-binding protein, e.g., tomato bushy stunt virus P19. Here, we demonstrate P19 and HIV-1 Tat function across the plant and animal kingdoms and suppress a common step in RNA silencing that is downstream of small RNA maturation. Our experiments reveal that RNA silencing in HIV-...

  17. A highly specific microRNA-mediated mechanism silences LTR retrotransposons of strawberry.

    Science.gov (United States)

    Šurbanovski, Nada; Brilli, Matteo; Moser, Mirko; Si-Ammour, Azeddine

    2016-01-01

    Small RNAs are involved in a plethora of functions in plant genomes. In general, transcriptional gene silencing is mediated by 24-nucleotide siRNAs and is required for maintaining transposable elements in a silenced state. However, microRNAs are not commonly associated with transposon silencing. In this study, we performed small RNA transcriptome and degradome analyses of the Rosaceae model plant Fragaria vesca (the woodland strawberry) at the genome-wide level, and identified miRNA families and their targets. We report a highly specific mechanism of LTR retrotransposon silencing mediated by an abundant, ubiquitously expressed miRNA (fve-miR1511) generated from a single locus. This miRNA specifically targets LTR retroelements, silencing them post-transcriptionally by perfectly pairing to the highly conserved primer binding site for methionyl initiator tRNA that is essential for reverse transcription. We investigated the possible origins of this miRNA, and present evidence that the pre-miR1511 hairpin structure probably derived from a locus coding for tRNA(iM) (et) through a single microinversion event. Our study shows that this miRNA targets retrotransposons specifically and constitutively, and contributes to features such as genome stability, size and architecture in a far more direct way than previously thought. PMID:26611654

  18. The influenza A virus NS1 protein binds small interfering RNAs and suppresses RNA silencing in plants

    NARCIS (Netherlands)

    Bucher, E.C.; Hemmes, J.C.; Haan, de P.; Goldbach, R.W.; Prins, M.W.

    2004-01-01

    RNA silencing comprises a set of sequence-specific RNA degradation pathways that occur in a wide range of eukaryotes, including animals, fungi and plants. A hallmark of RNA silencing is the presence of small interfering RNA molecules (siRNAs). The siRNAs are generated by cleavage of larger double-st

  19. Mammalian hyperplastic discs homolog EDD regulates microRNA-mediated gene silencing

    OpenAIRE

    Su, Hong; Meng, Shuxia; Lu, Yanyan; Trombly, Melanie I.; Chen, Jian; Lin, Chengyi; Turk, Anita; Wang, Xiaozhong

    2011-01-01

    MicroRNAs (miRNAs) regulate gene expression through translation repression and mRNA destabilization. However, the molecular mechanisms of miRNA silencing are still not well defined. Using a genetic screen in mouse embryonic stem (ES) cells, we identify mammalian hyperplastic discs protein EDD, a known E3 ubiquitin ligase, as a key component of the miRNA silencing pathway. ES cells deficient for EDD are defective in miRNA function and exhibit growth defects. We demonstrate that E3 ubiquitin li...

  20. RNA-induced silencing attenuates G protein-mediated calcium signals.

    Science.gov (United States)

    Philip, Finly; Sahu, Shriya; Golebiewska, Urszula; Scarlata, Suzanne

    2016-05-01

    Phospholipase Cβ (PLCβ) is activated by G protein subunits in response to environmental stimuli to increase intracellular calcium. In cells, a significant portion of PLCβ is cytosolic, where it binds a protein complex required for efficient RNA-induced silencing called C3PO (component 3 promoter of RISC). Binding between C3PO and PLCβ raises the possibility that RNA silencing activity can affect the ability of PLCβ to mediate calcium signals. By use of human and rat neuronal cell lines (SK-N-SH and PC12), we show that overexpression of one of the main components of C3PO diminishes Ca(2+) release in response to Gαq/PLCβ stimulation by 30 to 40%. In untransfected SK-N-SH or PC12 cells, the introduction of siRNA(GAPDH) [small interfering RNA(glyceraldehyde 3-phosphate dehydrogenase)] reduces PLCβ-mediated calcium signals by ∼30%, but addition of siRNA(Hsp90) (heat shock protein 90) had little effect. Fluorescence imaging studies suggest an increase in PLCβ-C3PO association in cells treated with siRNA(GAPDH) but not siRNA(Hsp90). Taken together, our studies raise the possibility that Ca(2+) responses to extracellular stimuli can be modulated by components of the RNA silencing machinery.-Philip, F., Sahu, S., Golebiewska, U., Scarlata, S. RNA-induced silencing attenuates G protein-mediated calcium signals. PMID:26862135

  1. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. PMID:26747561

  2. The role of GW182 proteins in miRNA-mediated gene silencing.

    Science.gov (United States)

    Braun, Joerg E; Huntzinger, Eric; Izaurralde, Elisa

    2013-01-01

    GW182 family proteins are essential for microRNA-mediated gene silencing in animal cells. They are recruited to miRNA targets through direct interactions with Argonaute proteins and promote target silencing. They do so by repressing translation and enhancing mRNA turnover. Although the precise mechanism of action of GW182 proteins is not fully understood, these proteins have been shown to interact with the cytoplasmic poly(A)-binding protein (PABP) and with the PAN2-PAN3 and CCR4-NOT deadenylase complexes. These findings suggest that GW182 proteins function as scaffold proteins for the assembly of the multiprotein complex that silences miRNA targets. PMID:23224969

  3. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Inhibits RNA-Mediated Gene Silencing by Targeting Ago-2

    OpenAIRE

    Jing Chen; Xibao Shi; Xiaozhuan Zhang; Li Wang; Jun Luo; Guangxu Xing; Ruiguang Deng; Hong Yang; Jinting Li; Aiping Wang; Gaiping Zhang

    2015-01-01

    Porcine reproductive and respiratory syndrome virus (PRRSV) infection strongly modulates the host’s immune response. The RNA silencing pathway is an intracellular innate response to viral infections. However, it is unknown whether PRRSV interacts with cellular RNA silencing to facilitate the viral infection. Here, we report for the first time the interaction between PRRSV and RNA silencing in both the porcine macrophages and African green monkey kidney cell line (MARC-145) cell line, which we...

  4. The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.

    Science.gov (United States)

    Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin

    2013-06-01

    Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P myostatin protein expression was reduced by 95 % (P myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts. PMID:23604693

  5. Defining roles for RNA silencing in mammalian cells

    Czech Academy of Sciences Publication Activity Database

    Svoboda, Petr

    Oxford : Library Publishing Media, 2007. s. 23-23. [ RNA i2007: The Expanding Roles of Small RNA s. 29.03.2007-30.3.2007, Oxford] R&D Projects: GA AV ČR IAA501110701 Institutional research plan: CEZ:AV0Z50520514 Keywords : dsRNA * RNA i * Dicer Subject RIV: EB - Genetics ; Molecular Biology

  6. Defining roles of RNA silencing in mammalian cells

    Czech Academy of Sciences Publication Activity Database

    Svoboda, Petr

    2007-01-01

    Roč. 3, č. 1 (2007), s. 254-263. [ RNA i2007: The Expanding Roles of Small RNA s. 29.03.2007-30.3.2007, Oxford] R&D Projects: GA AV ČR IAA501110701 Institutional research plan: CEZ:AV0Z50520514 Keywords : dsRNA * RNA i * Dicer Subject RIV: EB - Genetics ; Molecular Biology

  7. Analysis and application of viroid-specific small RNAs generated by viroid-inducing RNA silencing.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Zhang, Zhixiang; Li, Shifang; Sano, Teruo

    2015-01-01

    Viroids are noncoding RNA pathogens inducing severe to mild disease symptoms on agriculturally important crop plants. Viroid replication is entirely dependent on host transcription machinery, and their replication/accumulation in the infected cells can activate RNA silencing-a host defense mechanism that targets the viroid itself. RNA silencing produces in the cell large amounts of viroid-specific small RNAs of 21-24-nucleotides by cleaving (or "dicing") entire molecules of viroid RNA. However, viroid replication is resistant to the effects of RNA silencing and disrupts the normal regulation of host gene expression, finally resulting in the development of disease symptoms on infected plant. The molecular mechanisms of biological processes involving RNA silencing and underlying various aspects of viroid-host interaction, such as symptom expression, are of special interests to both basic and applied areas of viroid research. Here we present a method to create infectious viroid cDNA clones and RNA transcripts, the starting material for such analyses, using Hop stunt viroid as an example. Next we describe methods for the preparation and analysis of viroid-specific small RNAs by deep sequencing using tomato plants infected with Potato spindle tuber viroid as an example. Finally we introduce bioinformatics tools and methods necessary to process, analyze, and characterize these viroid-specific small RNAs. These bioinformatic methods provide a powerful new tool for the detection and discovery of both known and new viroid species. PMID:25287502

  8. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing

    Science.gov (United States)

    Virus-induced gene silencing (VIGS) is a useful technique for functional characterization of plant genes. However, the silencing efficiency of the VIGS system is variable largely depending on compatibility between the host and the virus. Antiviral RNA silencing is involved in plant antiviral defense...

  9. BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS

    Directory of Open Access Journals (Sweden)

    Omarov R.T.

    2012-08-01

    Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of

  10. The influenza A virus NS1 protein binds small interfering RNAs and suppresses RNA silencing in plants

    OpenAIRE

    Bucher, E.C.; Hemmes, J.C.; Haan, de, L.; Goldbach, R.W.; Prins, M.W.

    2004-01-01

    RNA silencing comprises a set of sequence-specific RNA degradation pathways that occur in a wide range of eukaryotes, including animals, fungi and plants. A hallmark of RNA silencing is the presence of small interfering RNA molecules (siRNAs). The siRNAs are generated by cleavage of larger double-stranded RNAs (dsRNAs) and provide the sequence specificity for degradation of cognate RNA molecules. In plants, RNA silencing plays a key role in developmental processes and in control of virus repl...

  11. Generation of tobacco lines with widely different reduction in nicotine levels via RNA silencing approaches

    Indian Academy of Sciences (India)

    Peng Wang; Zhifeng Liang; Jia Zeng Wenchao; Wenchao Li; Xiaofen Sun; Zhiqi Miao; Kexuan Tang

    2008-06-01

    Issues related to the nicotine content of tobacco have been public concerns. Several reports have described decreasing nicotine levels by silencing the putrescine N-methyltransferase (PMT) genes, but the reported variations of nicotine levels among transgenic lines are relatively low in general. Here we describe the generation in tobacco (Nicotiana tabacum) lines with widely different, reduced nicotine levels using three kinds of RNA-silencing approaches. The relative efficacies of suppression were compared among the three approaches regarding the aspect of nicotine level in tobacco leaves. By suppressing expression of the PMT genes, over 200 transgenic lines were obtained with nicotine levels reduced by 9.1–96.7%. RNA interference (RNAi) was the most efficient method of reducing the levels of nicotine, whereas cosuppression and antisense methods were less effective. This report gives clues to the efficient generation of plants with a variety of metabolite levels, and the results demonstrate the relative efficiencies of various RNA-silencing methods.

  12. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  13. Simulation of RNA Silencing Pathway for Time-Dependent Transgene Transcription Rate

    Science.gov (United States)

    Yang, Xiao-Dong; Mahapatra, Debiprosad Roy; Melnik, Roderick V. N.

    2007-11-01

    The synthesis of dsRNA is analyzed using a pathway model with amplifications caused by the aberrant RNAs. The transgene influx rate is assumed time-decaying considering the fact that the number of transgenes can not be infinite. The dynamics of the transgene induced RNA silencing is investigated using a system of coupled nonautonomous ordinary nonlinear differential equations which describe the model phenomenologically. The silencing phenomena are detected after a period of transcription. Important contributions of certain parameters are discussed with several numerical examples.

  14. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.

    2013-06-13

    Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  15. Analysis of the siRNA-mediated gene silencing process targeting three homologous genes controlling soybean seed oil quality

    Science.gov (United States)

    Since the discovery of RNA silencing in the nineties, the implication and potential application of this new technology have been recognized. In the past decades, RNA silencing has gained significant attention because its success in genomic scale research and also in the genetic improvement of crop p...

  16. Viral suppressors of RNA interference impair RNA silencing induced by a Semliki Forest virus replicon in tick cells

    NARCIS (Netherlands)

    Garcia, S.; Billecocq, A.; Crance, J.M.; Prins, M.W.; Garin, D.; Bouloy, M.

    2006-01-01

    It was recently shown that infection of ISE6 tick cells by a recombinant Semliki Forest virus (SFV) expressing a heterologous gene induced small interfering RNAs (siRNAs) and silencing of the gene. To gain information on RNA interference (RNAi) in ticks, three known viral inhibitors that act in diff

  17. Gene silencing by RNA interference in the house dust mite, Dermatophagoides pteronyssinus.

    Science.gov (United States)

    Marr, Edward J; Sargison, Neil D; Nisbet, Alasdair J; Burgess, Stewart T G

    2015-12-01

    This is the first report of gene silencing by RNA interference (RNAi) in the European house dust mite, Dermatophagoides pteronyssinus, Trouessart, 1897. Using a non-invasive immersion method first developed for the honey bee mite, Varroa destructor, a significant reduction in the expression of D. pteronyssinus glutathione-S-transferase mu-class 1 enzyme (DpGST-mu1) was achieved following overnight immersion in double stranded RNA encoding DpGST-mu1. Although no detrimental phenotypic changes were observed following silencing, this technique can now be used to address fundamental physiological questions and assess the potential therapeutic benefit in silencing D. pteronyssinus target genes in selected domestic situations of high human-mite interface. PMID:26212476

  18. Chapter 11: RNA silencing in mammalian oocytes and early embryos

    Czech Academy of Sciences Publication Activity Database

    Svoboda, Petr

    Heidelberg : Springer Verlag, 2008, s. 225-256. ISBN 978-3-540-75156-4 Grant ostatní: EMBO(XE) EMBO Installation Grant 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : RNA i, * miRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology

  19. Effects of siRNA-silenced CHD6 on radiosensitivity in A549

    International Nuclear Information System (INIS)

    Objective To observe the effects of siRNA-silenced chromatin reconstitution protein CHD6 on the proliferation and radiosensitivity in A549 cells. Methods: CHD6-silenced cellular model was constructed by plasmid mediated siRNA technique. RT-PCR was used to detect the expression of mRNA. Growth curve, flow cytometry and fluorescent staining method were used to measure changes of cell proliferation, cell cycle and apoptosis, respectively. The radiosensitivity of A549 cells was determined with cell cloning efficiency test. Results siRNA-asilence CHD6 increased the growth of A549 cells and enhanced the radiation resistance of A549 cells when gamma irradiation dose was lesser than two grays, whereas it had no significant effect on apoptosis in cells being irradiated with larger doses. Conclusion: Inhibition of CHD6 could enhance cell proliferation and cell radiosensitivity. (authors)

  20. Silencing HIF-1α through RNA interference sensitizes SPCA-1 cells

    International Nuclear Information System (INIS)

    Objective: To investigate the radiosensitization of silencing HIF-lα by RNA interference in human lung adenocarcinoma cells (SPCA-l). Methods: HIF-lα RNA interference (RNAi)vector (pSUPER-HIF-1α) was constructed by using pSUPER plasmid. The RNAi effect was detected by RT-PCR and Western blot in SPCA-1 cell line, both under normoxia and hypoxia condition. The radiosensitization effect of silencing HIF-α was measured by colony forming assay. Results: after silencing the HIF-lα by RNAi, the expression of HIF-lα mRNA was decreased to 64% and 76% under normoxia and hypoxia condition, respectively; the expression of HIF-1α protein was inhibited under hypoxia condition. The Do of cells transfected with pSUPER-HIF-lα, pSUPER and controlled cell was 2.5, 5.0 and 5.1 Gy, respectively, with a radiosensitization ratio of 2.1. Conclusion: RNA-in-terference targeting silenced HIF-lα may increase the radiosensitivity of SPCA-1 cell line. (authors)

  1. The Ebola virus VP35 protein is a suppressor of RNA silencing

    NARCIS (Netherlands)

    Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

    2007-01-01

    RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is trigger

  2. An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

    Directory of Open Access Journals (Sweden)

    Lim Chee Liew

    Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

  3. On the origin and functions of RNA-mediated silencing: from protists to man

    OpenAIRE

    Cerutti, Heriberto; Casas-Mollano, J. Armando

    2006-01-01

    Double-stranded RNA has been shown to induce gene silencing in diverse eukaryotes and by a variety of pathways. We have examined the taxonomic distribution and the phylogenetic relationship of key components of the RNA interference (RNAi) machinery in members of five eukaryotic supergroups. On the basis of the parsimony principle, our analyses suggest that a relatively complex RNAi machinery was already present in the last common ancestor of eukaryotes and consisted, at a minimum, of one Argo...

  4. Virus-Induced Gene Silencing as a Tool for Delivery of dsRNA into Plants

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Meenu Padmanabhan and Savithramma P. Dinesh-Kumar1 Corresponding author ([](mailto:)) ### INTRODUCTION The inherent RNA silencing mechanism in plants has been effectively manipulated as a tool for the targeted down-regulation of genes. Numerous methods have been employed to initiate this homology-based RNA degradation process, but all rely on the activity of double-stranded RNAs (dsRNAs) corresponding to th...

  5. In vitro assembly of plant RNA-induced silencing complexes facilitated by molecular chaperone HSP90.

    Science.gov (United States)

    Iki, Taichiro; Yoshikawa, Manabu; Nishikiori, Masaki; Jaudal, Mauren C; Matsumoto-Yokoyama, Eiko; Mitsuhara, Ichiro; Meshi, Tetsuo; Ishikawa, Masayuki

    2010-07-30

    RNA-induced silencing complexes (RISCs) play central roles in posttranscriptional gene silencing. In plants, the mechanism of RISC assembly has remained elusive due to the lack of cell-free systems that recapitulate the process. In this report, we demonstrate that plant AGO1 protein synthesized by in vitro translation using an extract of evacuolated tobacco protoplasts incorporates synthetic small interfering RNA (siRNA) and microRNA (miRNA) duplexes to form RISCs that sequester the single-stranded siRNA guide strand and miRNA strand, respectively. The formed RISCs were able to recognize and cleave the complementary target RNAs. In this system, the siRNA duplex was incorporated into HSP90-bound AGO1, and subsequent removal of the passenger strand was triggered by ATP hydrolysis by HSP90. Removal of the siRNA passenger strand required the ribonuclease activity of AGO1, while that of the miRNA star strand did not. Based on these results, the mechanism of plant RISC formation is discussed. PMID:20605502

  6. Intravaginal gene silencing using biodegradable polymer nanoparticles densely loaded with small-interfering RNA

    Science.gov (United States)

    Woodrow, Kim A.; Cu, Yen; Booth, Carmen J.; Saucier-Sawyer, Jennifer K.; Wood, Monica J.; Mark Saltzman, W.

    2009-06-01

    Vaginal instillation of small-interfering RNA (siRNA) using liposomes has led to silencing of endogenous genes in the genital tract and protection against challenge from infectious disease. Although siRNA lipoplexes are easily formulated, several of the most effective transfection agents available commercially may be toxic to the mucosal epithelia and none are able to provide controlled or sustained release. Here, we demonstrate an alternative approach using nanoparticles composed entirely of FDA-approved materials. To render these materials effective for gene silencing, we developed novel approaches to load them with high amounts of siRNA. A single dose of siRNA-loaded nanoparticles to the mouse female reproductive tract caused efficient and sustained gene silencing. Knockdown of gene expression was observed proximal (in the vaginal lumen) and distal (in the uterine horns) to the site of topical delivery. In addition, nanoparticles penetrated deep into the epithelial tissue. This is the first report demonstrating that biodegradable polymer nanoparticles are effective delivery vehicles for siRNA to the vaginal mucosa.

  7. Autocidal control of ticks by silencing of a single gene by RNA interference

    International Nuclear Information System (INIS)

    Ticks impact human and animal health worldwide and new control methods are needed to circumvent draw-backs of tick control by acaricide application including selection of drug resistant ticks and environmental pollution. Using RNA interference we silenced the expression of a single gene, subolesin, and produced ticks with diminished reproductive performance and prevented successful mating and production of viable offspring. We propose a sterile acarine technique (SAT) for reduction of tick populations by release of subolesin-silenced ticks. Conservation of subolesin among tick species suggests that SAT may be useful for control of many medically and economically important tick species. (author)

  8. An siRNA-based method for efficient silencing of gene expression in mature brown adipocytes.

    Science.gov (United States)

    Isidor, Marie S; Winther, Sally; Basse, Astrid L; Petersen, M Christine H; Cannon, Barbara; Nedergaard, Jan; Hansen, Jacob B

    2016-01-01

    Brown adipose tissue is a promising therapeutic target for opposing obesity, glucose intolerance and insulin resistance. The ability to modulate gene expression in mature brown adipocytes is important to understand brown adipocyte function and delineate novel regulatory mechanisms of non-shivering thermogenesis. The aim of this study was to optimize a lipofection-based small interfering RNA (siRNA) transfection protocol for efficient silencing of gene expression in mature brown adipocytes. We determined that a critical parameter was to deliver the siRNA to mature adipocytes by reverse transfection, i.e. transfection of non-adherent cells. Using this protocol, we effectively knocked down both high- and low-abundance transcripts in a model of mature brown adipocytes (WT-1) as well as in primary mature mouse brown adipocytes. A functional consequence of the knockdown was confirmed by an attenuated increase in uncoupled respiration (thermogenesis) in response to β-adrenergic stimulation of mature WT-1 brown adipocytes transfected with uncoupling protein 1 siRNA. Efficient gene silencing was also obtained in various mouse and human white adipocyte models (3T3-L1, primary mouse white adipocytes, hMADS) with the ability to undergo "browning." In summary, we report an easy and versatile reverse siRNA transfection protocol to achieve specific silencing of gene expression in various models of mature brown and browning-competent white adipocytes, including primary cells. PMID:27386153

  9. MicroRNA mimicry blocks pulmonary fibrosis

    OpenAIRE

    Montgomery, Rusty L.; Yu, Guoying; Latimer, Paul A.; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva

    2014-01-01

    Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular disease. While many studies have shown therapeutic efficacy using miRNA inhibitors, efforts to restore or increase the function of a miRNA have been lagging behind. The miR-29 family has gained a lot of ...

  10. RNA interference targeting silence Rad51 gene sensitizes cancer cells to irradiation

    International Nuclear Information System (INIS)

    Objective: To investigate whether RNA interference (RNAi) can targeting silence the Rad51gene thereby increase the radiosensitivity of cancer cells. Methods: Psilencer U6-1.0 vector expressing the short interference RNA (siRNA) silences the endogenous Rad51 gene of HT1080 cell line. RNAi effect was analyzed by Western blot; The radiobiology effect of targeting silencing Rad51 in HT1080 cell line was analyzed by colony forming assay and radiation-induced apoptosis method. Results: All three tested target sequences showed the RNA interference effect. Forty-eight hours after transient transfection, the endogenous Rad51 expression was reduced about 79.8%, 94.3% and 97.4% by sequence 1, 2 and 3, respectively. The radiation-induced Rad51 expression was also suppressed in silenced cells. Colony assay showed the survival fraction to be 80.5% , 78.6% 69.0% and 57.7% compared with control group after ir- radiation at 2, 4, 6 and 8 Gy (P=0.020). The radiation induced apoptosis in silencing group increased 1.03-, 1.43-, 1.19-, 1.29-, 1.33-fo1d 0, 6, 18, 24, and 48 hours after irradiation when compared with the control group (P=0.017). Conclusion: The endogenous expression of Rad51 as well as its radiation- induced up-regulation can be inhibited effectively by RNAi. Our study suggests that RNAi technique be a useful tool in cancer research and radiosensitization studies. (authors)

  11. Global Effects on Gene Expression in Fission Yeast by Silencing and RNA Interference Machineries

    DEFF Research Database (Denmark)

    Hansen, Klavs R.; Burns, G.; Mata, J.; Volpe, T. A.; Martienssen, R. A.; Bähler, J.; Thon, Genevieve

    2005-01-01

    Histone modifications influence gene expression in complex ways. The RNA interference (RNAi) machinery can repress transcription by recruiting histone-modifying enzymes to chromatin, although it is not clear whether this is a general mechanism for gene silencing or whether it requires repeated...... genes were repressed by both the silencing and RNAi machineries, with transcripts from centromeric repeats and Tf2 retrotransposons being notable exceptions. We found no correlation between repression by RNAi and proximity to LTRs, and the wtf family of repeated sequences seems to be repressed by...... histone deacetylation independent of RNAi. Our data indicate that the RNAi and Clr proteins show only a limited functional overlap and that the Clr proteins play more global roles in gene silencing....

  12. MicroRNA silencing in primates: towards development of novel therapeutics

    DEFF Research Database (Denmark)

    Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

    2009-01-01

    MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....

  13. The functional scope of plant microRNA-mediated silencing.

    Science.gov (United States)

    Li, Junyan; Reichel, Marlene; Li, Yanjiao; Millar, Anthony A

    2014-12-01

    Deep sequencing has identified a complex set of plant miRNAs that potentially regulates many target genes of high complementarity. Furthermore, the discovery that many plant miRNAs work through a translational repression mechanism, along with the identification of noncanonical targets, has encouraged bioinformatic searches with less stringent parameters, identifying an even wider range of potential targets. Together, these findings suggest that any given plant miRNA family may regulate a highly diverse set of mRNAs. Here we present evolutionary, genetic, and mechanistic evidence that opposes this idea but instead suggests that families of sequence-related miRNAs regulate very few functionally related targets. We propose that complexities beyond complementarity impact plant miRNA target recognition, possibly explaining the current disparity between bioinformatic prediction and functional evidence. PMID:25242049

  14. Development of RNA Interference Trigger-Mediated Gene Silencing in Entamoeba invadens.

    Science.gov (United States)

    Suresh, Susmitha; Ehrenkaufer, Gretchen; Zhang, Hanbang; Singh, Upinder

    2016-04-01

    Entamoeba histolytica, a protozoan parasite, is an important human pathogen and a leading parasitic cause of death. The organism has two life cycle stages, trophozoites, which are responsible for tissue invasion, and cysts, which are involved in pathogen transmission. Entamoeba invadens is the model system to study Entamoeba developmental biology, as high-grade regulated encystation and excystation are readily achievable. However, the lack of gene-silencing tools in E. invadens has limited the molecular studies that can be performed. Using the endogenous RNA interference (RNAi) pathway in Entamoeba, we developed an RNAi-based trigger gene-silencing approach inE. invadens We demonstrate that a gene's coding region that has abundant antisense small RNAs (sRNAs) can trigger silencing of a gene that is fused to it. The trigger fusion leads to the generation of abundant antisense sRNAs that map to the target gene, with silencing occurring independently of trigger location at the 5' or 3' end of a gene. Gene silencing is stably maintained during development, including encystation and excystation. We have used this approach to successfully silence two E. invadens genes: a putative rhomboid protease gene and a SHAQKY family Myb gene. The Myb gene is upregulated during oxidative stress and development, and its downregulation led, as predicted, to decreased viability under oxidative stress and decreased cyst formation. Thus, the RNAi trigger silencing method can be used to successfully investigate the molecular functions of genes inE. invadens Dissection of the molecular basis of Entamoeba stage conversion is now possible, representing an important technical advance for the system. PMID:26787723

  15. Dissection of Silencing Signal Movement in Arabidopsis

    OpenAIRE

    Smith, Lisa M.; Baulcombe, David C.

    2007-01-01

    In our recent paper in Plant Cell, we examined the phenomenon of non-cell autonomous RNA silencing through a genetic screen of the requirements for cell-to-cell signal movement.1 We found a requirement for components of the nuclear and trans-acting RNA silencing pathways in blocking or enhancing the spread of silencing and identified a new SNF2 domain-containing protein, CLSY1, in the nuclear RNA silencing pathway. Here we discuss our data from a broader perspective of other recently publishe...

  16. Precise and efficient siRNA design: a key point in competent gene silencing.

    Science.gov (United States)

    Fakhr, E; Zare, F; Teimoori-Toolabi, L

    2016-04-01

    RNA interference-related strategies have become appealing methods in various fields of research. Exact sequence design of these small molecules is an essential step in the silencing procedure. Numerous researchers have tried to define some algorithms in order to increase the chance of short interfering RNA's (siRNA's) success. In recent decades, online designing software has aimed at promoting the quality of siRNA designing based on the most cited algorithms. According to our previous experiments, a combination of different criteria would be helpful. That is, siRNAs suggested by a combination of tools seem to be more efficient. Furthermore, different factors such as distance of target region to transcription start site, nucleotide composition, absence of off-target effects and secondary structures in the target site and siRNA and the presence of asymmetry and energy valley within the siRNA will increase the efficiency of siRNAs. Despite application of different online tools and fulfilling the criteria, there is no guarantee for designing an effective siRNA. However, meticulous designing of siRNAs according to the suggested algorithms and scoring systems and using different siRNAs for targeting the same gene would lead to improved silencing outcome. In this review, we focus on common algorithms and online software, and introduce a new scoring system used in our experiments. PMID:26987292

  17. Triticum mosaic poacevirus enlists P1 rather than HC-Pro to suppress RNA silencing-mediated host defense

    Science.gov (United States)

    RNA silencing, or posttranscriptional gene silencing (PTGS) is one of the most important defense mechanisms employed by higher plants and animals to defend against viral infections. Plant viruses evolved by adopting divergent proteins, even within single virus families, to counter this host defense ...

  18. Systemic gene silencing in plants triggered by fluorescent nanoparticle-delivered double-stranded RNA

    Science.gov (United States)

    Jiang, Li; Ding, Lian; He, Bicheng; Shen, Jie; Xu, Zejun; Yin, Meizhen; Zhang, Xiaolan

    2014-08-01

    A cationic fluorescence nanoparticle efficiently enters plants with high transfection efficacy. Applying a mixture of G2/dsRNA to the model plant, Arabidopsis root, leads to significant reduction in the expression of important developmental genes and results in apparent phenotypes. This study reports a non-viral gene nanocarrier which triggers gene silencing in plants and leads to systemic phenotypes.A cationic fluorescence nanoparticle efficiently enters plants with high transfection efficacy. Applying a mixture of G2/dsRNA to the model plant, Arabidopsis root, leads to significant reduction in the expression of important developmental genes and results in apparent phenotypes. This study reports a non-viral gene nanocarrier which triggers gene silencing in plants and leads to systemic phenotypes. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr03481c

  19. CCN2/CTGF silencing blocks cell aggregation in embryonal carcinoma P19 cell

    Directory of Open Access Journals (Sweden)

    D.P. Aguiar

    2011-03-01

    Full Text Available Connective tissue growth factor (CCN2/CTGF is a matricellular-secreted protein involved in extracellular matrix remodeling. The P19 cell line is an embryonic carcinoma line widely used as a cellular model for differentiation and migration studies. In the present study, we employed an exogenous source of CCN2 and small interference RNA to address the role of CCN2 in the P19 cell aggregation phenomenon. Our data showed that increasing CCN2 protein concentrations from 0.1 to 20 nM decreased the number of cell clusters and dramatically increased cluster size without changing proliferation or cell survival, suggesting that CCN2 induced aggregation. In addition, CCN2 specific silencing inhibited typical P19 cell aggregation, which could be partially rescued by 20 nM CCN2. The present study demonstrates that CCN2 is a key molecule for cell aggregation of embryonic P19 cells.

  20. Stability of miRNA 5′terminal and seed regions is correlated with experimentally observed miRNA-mediated silencing efficacy

    OpenAIRE

    Naoki Hibio; Kimihiro Hino; Eigo Shimizu; Yoshiro Nagata; Kumiko Ui-Tei

    2012-01-01

    MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the R...

  1. Interaction between viral RNA silencing suppressors and host factors in plant immunity.

    Science.gov (United States)

    Nakahara, Kenji S; Masuta, Chikara

    2014-08-01

    To elucidate events in the molecular arms race between the host and pathogen in evaluating plant immunity, a zigzag model is useful for uncovering aspects common to different host-pathogen interactions. By analogy of the steps in virus-host interactions with the steps in the standard zigzag model outlined in recent papers, we may regard RNA silencing as pattern-triggered immunity (PTI) against viruses, RNA silencing suppressors (RSSs) as effectors to overcome host RNA silencing and resistance gene (R-gene)-mediated defense as effector-triggered immunity (ETI) recognizing RSSs as avirulence proteins. However, because the standard zigzag model does not fully apply to some unique aspects in the interactions between a plant host and virus, we here defined a model especially designed for viruses. Although we simplified the phenomena involved in the virus-host interactions in the model, certain specific interactive steps can be explained by integrating additional host factors into the model. These host factors are thought to play an important role in maintaining the efficacy of the various steps in the main pathway of defense against viruses in this model for virus-plant interactions. For example, we propose candidates that may interact with viral RSSs to induce the resistance response. PMID:24875766

  2. Silencing microRNA-155 ameliorates experimental autoimmune encephalomyelitis.

    Science.gov (United States)

    Murugaiyan, Gopal; Beynon, Vanessa; Mittal, Akanksha; Joller, Nicole; Weiner, Howard L

    2011-09-01

    IFN-γ-producing Th1 and IL-17-producing Th17 cells are the key participants in various autoimmune diseases, including multiple sclerosis and its animal model, experimental autoimmune encephalomyelitis (EAE). Although both of these T cell subsets are known to be regulated by specific transcription factors and cytokines, the role of microRNAs that control these two inflammatory T cell subsets and whether targeting microRNAs can have therapeutic effects are not known. In this study, we show that microRNA-155 (Mir-155) expression is elevated in CD4(+) T cells during EAE, and Mir-155(-/-) mice had a delayed course and reduced severity of disease and less inflammation in the CNS. The attenuation of EAE in Mir-155(-/-) mice was associated with a decrease in Th1 and Th17 responses in the CNS and peripheral lymphoid organs. The T cell-intrinsic function of Mir-155(-/-) was demonstrated by the resistance of Mir-155(-/-) CD4(+) T cell-repleted Rag-1(-/-) mice to EAE. Finally, we found that anti-Mir-155 treatment reduced clinical severity of EAE when given before and after the appearance of clinical symptoms. These findings demonstrate that Mir-155 confers susceptibility to EAE by affecting inflammatory T cell responses and identify Mir-155 as a new target for therapeutic intervention in multiple sclerosis. PMID:21788439

  3. RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

    International Nuclear Information System (INIS)

    The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

  4. Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

    International Nuclear Information System (INIS)

    Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

  5. Exonuclease-mediated degradation of nascent RNA silences genes linked to severe malaria.

    Science.gov (United States)

    Zhang, Qingfeng; Siegel, T Nicolai; Martins, Rafael M; Wang, Fei; Cao, Jun; Gao, Qi; Cheng, Xiu; Jiang, Lubin; Hon, Chung-Chau; Scheidig-Benatar, Christine; Sakamoto, Hiroshi; Turner, Louise; Jensen, Anja T R; Claes, Aurelie; Guizetti, Julien; Malmquist, Nicholas A; Scherf, Artur

    2014-09-18

    Antigenic variation of the Plasmodium falciparum multicopy var gene family enables parasite evasion of immune destruction by host antibodies. Expression of a particular var subgroup, termed upsA, is linked to the obstruction of blood vessels in the brain and to the pathogenesis of human cerebral malaria. The mechanism determining upsA activation remains unknown. Here we show that an entirely new type of gene silencing mechanism involving an exonuclease-mediated degradation of nascent RNA controls the silencing of genes linked to severe malaria. We identify a novel chromatin-associated exoribonuclease, termed PfRNase II, that controls the silencing of upsA var genes by marking their transcription start site and intron-promoter regions leading to short-lived cryptic RNA. Parasites carrying a deficient PfRNase II gene produce full-length upsA var transcripts and intron-derived antisense long non-coding RNA. The presence of stable upsA var transcripts overcomes monoallelic expression, resulting in the simultaneous expression of both upsA and upsC type PfEMP1 proteins on the surface of individual infected red blood cells. In addition, we observe an inverse relationship between transcript levels of PfRNase II and upsA-type var genes in parasites from severe malaria patients, implying a crucial role of PfRNase II in severe malaria. Our results uncover a previously unknown type of post-transcriptional gene silencing mechanism in malaria parasites with repercussions for other organisms. Additionally, the identification of RNase II as a parasite protein controlling the expression of virulence genes involved in pathogenesis in patients with severe malaria may provide new strategies for reducing malaria mortality. PMID:25043062

  6. Exploring sRNA-mediated gene silencing mechanisms using artificial small RNAs derived from a natural RNA scaffold in Escherichia coli

    OpenAIRE

    Park, Hongmarn; Bak, Geunu; Kim, Sun Chang; Lee, Younghoon

    2013-01-01

    An artificial small RNA (afsRNA) scaffold was designed from an Escherichia coli sRNA, SibC. Using the lacZ reporter system, the gene silencing effects of afsRNAs were examined to explore the sRNA-mediated gene-silencing mechanisms in E. coli. Substitution of the original target recognition sequence with a new sequence recognizing lacZ mRNA led to effective reduction of lacZ gene expression. Single-strandedness of the target recognition sequences in the scaffold was essential for effective gen...

  7. Ethylendiamine core PAMAM dendrimers/siRNA complexes as in vitro silencing agents.

    Science.gov (United States)

    Perez, A P; Romero, E L; Morilla, M J

    2009-10-01

    We have screened the formation of complexes between ethylendiamine (EDA) core polyamidoamine (PAMAM) dendrimers (D) and a short interfering RNA (siRNA) as a function of three variables: the ionic strength of the medium (lacking or containing 150 mM NaCl), the D generation (G4, G5, G6 and G7) and the N/P ratio (nitrogen amines in D/phosphate in siRNA). It was observed that all D formed complexes with siRNA, being the size of the complexes strictly dependent on the ionic strength of the media. The strong electrostatic interactions occurring in NaCl lacking medium made siRNA-D complexes (siRNA-D) smaller than those obtained in NaCl containing medium (30-130 nm, +25 mV zeta potential vs. several microm-800 nm, 0 zeta potential, respectively). Not surprisingly, both the uptake and inhibition of EGFP expression in cell culture, resulted dependent on siRNA-D size. siRNA-D prepared in NaCl containing medium were poorly captured and presented a basal activity on phagocytic (J-774-EGFP) cells, being inactive on non-phagocytic cells (T98G-EGFP). However, the smaller siRNA-D prepared in NaCl lacking medium were massively captured, exhibiting the highest inhibition of EGFP expression at 50 nM siRNA (non-cytotoxic concentration). Remarkably, siRNA-G7 produced the highest inhibition of EGFP expression both in T98G-EGFP (35%) and J-774-EGFP (45%) cells, in spite of inducing a lower protection of siRNA against RNase A degradation. Taken together, our results showed that modifying the chemical structure of D is not the only way of achieving siRNA-D suitable for silencing activity. The simple use of a low ionic strength preparation media has been critical to get small siRNA-D that could be captured by cells and in particular, siRNA-G7 but not those formed by lower generation D, possessed structural constraints other than size that could favor its silencing activity. PMID:19577619

  8. Synthetic Polymer Hybridization with DNA and RNA Directs Nanoparticle Loading, Silencing Delivery, and Aptamer Function.

    Science.gov (United States)

    Zhou, Zhun; Xia, Xin; Bong, Dennis

    2015-07-22

    We report herein discrete triplex hybridization of DNA and RNA with polyacrylates. Length-monodisperse triazine-derivatized polymers were prepared on gram-scale by reversible addition-fragmentation chain-transfer polymerization. Despite stereoregio backbone heterogeneity, the triazine polymers bind T/U-rich DNA or RNA with nanomolar affinity upon mixing in a 1:1 ratio, as judged by thermal melts, circular dichroism, gel-shift assays, and fluorescence quenching. We call these polyacrylates "bifacial polymer nucleic acids" (bPoNAs). Nucleic acid hybridization with bPoNA enables DNA loading onto polymer nanoparticles, siRNA silencing delivery, and can further serve as an allosteric trigger of RNA aptamer function. Thus, bPoNAs can serve as tools for both non-covalent bioconjugation and structure-function nucleation. It is anticipated that bPoNAs will have utility in both bio- and nanotechnology. PMID:26138550

  9. S100A4 silencing blocks invasive ability of esophageal squamous cell carcinoma cells

    Institute of Scientific and Technical Information of China (English)

    Dong Chen; Xue-Feng Zheng; Ze-You Yang; Dong-Xiao Liu; Guo-You Zhang; Xue-Long Jiao; Hui Zhao

    2012-01-01

    AIM:To investigate a potential role of S100A4 in esophagus squamous cell carcinoma metastasis (ESCCs).METHODS:Expression of S100A4 and E-cadherin were analyzed in frozen sections from ESCCs (metastasis,n =28; non-metastasis,n =20) by reverse transcription-polymerase chain reaction,quantitative polymerase chain reaction and immunohistochemistry.To explore the influence of S100A4 on esophageal cancer invasion and metastasis,S100A4 was overexpressed or silenced by S100A4 siRNA in TE-13 or Eca-109 cells in vitro and in vivo.RESULTS:We found the mRNA and protein levels of S100A4 expression in ESCCs was significantly upregulated,and more importantly,that expression of S100A4 and E cadherin are strongly negatively correlated in patients who had metastasis.It was indicated that overexpression of S100A4 in TE-13 and Eca-109 cells downregulates the expression of E-cadherin,leading to increased cell migration in vitro,whereas knockdown of S100A4 inhibited cell migration and upregulation of E-cadherin expression.Moreover,the loss of cell metastatic potential was rescued by overexpression of E-cadherin completely.In addition,nude mice inoculated with S100A4 siRNA-transfected cells exhibited a significantly decreased invasion ability in vivo.CONCLUSION:S100A4 may be involved in ESCC progression by regulate E-cadherin expression,vectorbased RNA interference targeting S100A4 is a potential therapeutic method for human ESCC.

  10. Host Control of Insect Endogenous Retroviruses: Small RNA Silencing and Immune Response

    Directory of Open Access Journals (Sweden)

    Marie Fablet

    2014-11-01

    Full Text Available Endogenous retroviruses are relics of ancient infections from retroviruses that managed to integrate into the genome of germline cells and remained vertically transmitted from parent to progeny. Subsequent to the endogenization process, these sequences can move and multiply in the host genome, which can have deleterious consequences and disturb genomic stability. Natural selection favored the establishment of silencing pathways that protect host genomes from the activity of endogenous retroviruses. RNA silencing mechanisms are involved, which utilize piRNAs. The response to exogenous viral infections uses siRNAs, a class of small RNAs that are generated via a distinct biogenesis pathway from piRNAs. However, interplay between both pathways has been identified, and interactions with anti-bacterial and anti-fungal immune responses are also suspected. This review focuses on Diptera (Arthropods and intends to compile pieces of evidence showing that the RNA silencing pathway of endogenous retrovirus regulation is not independent from immunity and the response to infections. This review will consider the mechanisms that allow the lasting coexistence of viral sequences and host genomes from an evolutionary perspective.

  11. Differential effects of viral silencing suppressors on siRNA and miRNA loading support the existence of two distinct cellular pools of ARGONAUTE1

    OpenAIRE

    Schott, Gregory; Mari-Ordonez, Arturo; Himber, Christophe; Alioua, Abdelmalek; Voinnet, Olivier; Dunoyer, Patrice

    2012-01-01

    Plant viruses encode suppressors (VSRs) that target the host antiviral RNA silencing pathway. Here, VSRs are shown to differentially impair siRNA and miRNA binding to Argonaute1, AGO1, revealing distinct AGO1 pools that are preferentially loaded with either siRNAs or miRNAs.

  12. Bifunctional oligodeoxynucleotide/antagomiR constructs: evaluation of a new tool for microRNA silencing.

    Science.gov (United States)

    Ziegler, Saskia; Eberle, Mariel Esther; Wölfle, Sabine J; Heeg, Klaus; Bekeredjian-Ding, Isabelle

    2013-12-01

    MicroRNAs (miRNAs) are fine-tuners in cellular processes, including those of the immune response. To study their functions and effects in immune cells, it is necessary to achieve specific silencing of individual miRNAs. To date, introduction of antisense microRNAs (antagomiRs) into primary cells is based on electroporation, lipofection, and viral vectors. However, these techniques often compromise viability, proliferative capacity, and differentiation. Furthermore, efficiency varies depending on the cell type and some are not suitable for in vivo approaches. To overcome these limitations we exploited the property of phosphorothioate (PTO)-modified DNA oligodeoxynucleotides (ODN) to enter cells with high efficacy: we developed and evaluated ODN/antagomiR constructs that consist of a PTO-ODN carrier covalently linked to a fully methylated antagomiR RNA sequence. Using these constructs, we achieved transfection efficiency of approximately 99% in leukocytes-in particular, in B lymphocytes that are hard to transfect with other methods. Our data demonstrate that miRNA silencing by the antagomiR portion of the constructs was specific and efficient, which could be further confirmed by an increase in target protein under silencing conditions. The constructs were successfully tested in human B cells, plasmacytoid dendritic cells, monocytes, and monocyte-derived dendritic cells, thus demonstrating their versatility. Moreover, introduction of stimulatory CpG sequences into the ODN portion conveys immune stimulatory quality when intended. Thus, bifunctional ODN/antagomiR constructs represent a highly efficient, versatile, and easy-to-handle tool to manipulate cellular miRNA expression levels and to allow the subsequent investigation of specific miRNA functions. PMID:24236889

  13. A Structured Viroid RNA Serves as a Substrate for Dicer-Like Cleavage To Produce Biologically Active Small RNAs but Is Resistant to RNA-Induced Silencing Complex-Mediated Degradation▿

    OpenAIRE

    Itaya, Asuka; Zhong, Xuehua; Bundschuh, Ralf; Qi, Yijun; Wang, Ying; Takeda, Ryuta; Harris, Ann R.; Molina, Carlos; Nelson, Richard S; Ding, Biao

    2007-01-01

    RNA silencing is a potent means of antiviral defense in plants and animals. A hallmark of this defense response is the production of 21- to 24-nucleotide viral small RNAs via mechanisms that remain to be fully understood. Many viruses encode suppressors of RNA silencing, and some viral RNAs function directly as silencing suppressors as counterdefense. The occurrence of viroid-specific small RNAs in infected plants suggests that viroids can trigger RNA silencing in a host, raising the question...

  14. Elucidation of the Mechanism of Gene Silencing using Small Interferin RNA: DNA Hybrid Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L

    2006-02-08

    The recent discovery that short hybrid RNA:DNA molecules (siHybrids) induce long-term silencing of gene expression in mammalian cells conflicts with the currently hypothesized mechanisms explaining the action of small, interfering RNA (siRNA). As a first step to elucidating the mechanism for this effect, we set out to quantify the delivery of siHybrids and determine their cellular localization in mammalian cells. We then tracked the segregation of the siHybrids into daughter cells after cell division. Markers for siHybrid delivery were shown to enter cells with and without the use of a transfection agent. Furthermore, delivery without transfection agent only occurred after a delay of 2-4 hours, suggesting a degradation process occurring in the cell culture media. Therefore, we studied the effects of nucleases and backbone modifications on the stability of siHybrids under cell culture conditions.

  15. Selective silencing of gene target expression by siRNA expression plasmids in human cervical cancer cells.

    Science.gov (United States)

    Peralta-Zaragoza, Oscar; De-la-O-Gómez, Faustino; Deas, Jessica; Fernández-Tilapa, Gloria; Fierros-Zárate, Geny Del Socorro; Gómez-Cerón, Claudia; Burguete-García, Ana; Torres-Poveda, Kirvis; Bermúdez-Morales, Victor Hugo; Rodríguez-Dorantes, Mauricio; Pérez-Plasencia, Carlos; Madrid-Marina, Vicente

    2015-01-01

    RNA interference is a natural mechanism to silence post-transcriptional gene expression in eukaryotic cells in which microRNAs act to cleave or halt the translation of target mRNAs at specific target sequences. Mature microRNAs, 19-25 nucleotides in length, mediate their effect at the mRNA level by inhibiting translation, or inducing cleavage of the mRNA target. This process is directed by the degree of complementary nucleotides between the microRNAs and the target mRNA; perfect complementary base pairing induces cleavage of mRNA, whereas several mismatches lead to translational arrest. Biological effects of microRNAs can be manipulated through the use of small interference RNAs (siRNAs) generated by chemical synthesis, or by cloning in molecular vectors. The cloning of a DNA insert in a molecular vector that will be transcribed into the corresponding siRNAs is an approach that has been developed using siRNA expression plasmids. These vectors contain DNA inserts designed with software to generate highly efficient siRNAs which will assemble into RNA-induced silencing complexes (RISC), and silence the target mRNA. In addition, the DNA inserts may be contained in cloning cassettes, and introduced in other molecular vectors. In this chapter we describe an attractive technology platform to silence cellular gene expression using specific siRNA expression plasmids, and evaluate its biological effect on target gene expression in human cervical cancer cells. PMID:25348304

  16. siRNA epidermal growth factor receptor silencing in U251 glioma cells

    Institute of Scientific and Technical Information of China (English)

    Chunsheng Kang; Zhiyong Zhang; Zhifan Jia; Qiang Huang; Guangxiu Wang; Mingzhe Qiu; Peiyu Pu

    2008-01-01

    BACKGROUND: Dicer, a large multidomain ribonuclease, is responsible for processing double-stranded RNAs (dsRNAs) to 20-bp-long small interfering RNAs (siRNAs), which act as effectors during RNA interference (RNAi). OBJECTIVE: To observe the efficacy of siRNA cocktails generated by recombinant human Dicer on the down-regulation of epidermal growth factor receptor (EGFR) expression in human glioma cells. DESIGN, TIME AND SETTING: The following in vitro experiment was performed at the Department of Neurosurgery, Tianjin Medical University General Hospital and Laboratory of Neuro-Oncology, Tianjin Neurological Institute. MATERIALS: Mini-RNA isolation kit, human placenta complimentary DNA (cDNA) was produced by Tiangen Biotech (Beijing, China), human glioblastoma U251-MG cells were produced by the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. METHODS: A PCR product from the human EGFR, which corresponded to the tyrosine kinase domain of the 3'-end fragment, was used as the T7-promotor for in vitro transcription, siRNA cocktails were generated by in vitro dicing of double stranded RNA. A total of 500, 250 and 125 μg siRNA cocktails were transiently transfected into U251 glioma cells through the use of the GeneSilencer. MAIN OUTCOME MEASURE: Expression of EGFR was detected by real-time PCR. RESULTS: The total PCR product of the human EGFR, corresponding to the tyrosine kinase domain, is approximately 680 bp in length. The PCR transcriptants included GCC leader sequences and a T7 promoter sequence, with a fragment of EGFR cDNA at the center. The T7 promoter was prepared for in vitro transcription of dsRNA. After dicing for 24 hours, the 21-nt siRNA cocktails were verified by 4% agarose gel. The difference between threshold cycle of a sample assay and threshold cycle of the corresponding endogenous reference (△ Ct) among parental U251 cells and cells transfected with different doses of siRNA cocktails were determined to be 3.06, 7.35, and 10

  17. Efficient transformation and artificial miRNA gene silencing in Lemna minor.

    Science.gov (United States)

    Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

    2015-01-01

    Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. PMID:24989135

  18. Roles of RNA silencing in mammalian cells: Sources and effects on long dsRNA

    Czech Academy of Sciences Publication Activity Database

    Svoboda, Petr

    Vídeň : IMBA, 2007. ---. [Microsymposium on Small RNA s /2./. 21.05.2007-23.05.2007, Vídeň] R&D Projects: GA AV ČR IAA501110701 Institutional research plan: CEZ:AV0Z50520514 Keywords : dsRNA * RNA i * L1 Subject RIV: EB - Genetics ; Molecular Biology

  19. Post-Transcriptional Silencing of Flavonol Synthase mRNA in Tobacco Leads to Fruits with Arrested Seed Set

    OpenAIRE

    Monika Mahajan; Paramvir Singh Ahuja; Sudesh Kumar Yadav

    2011-01-01

    Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS) encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols...

  20. MicroRNA-208a Silencing Attenuates Doxorubicin Induced Myocyte Apoptosis and Cardiac Dysfunction

    Directory of Open Access Journals (Sweden)

    Hasahya Tony

    2015-01-01

    Full Text Available Aims. GATA4 depletion is a distinct mechanism by which doxorubicin leads to cardiomyocyte apoptosis, and preservation of GATA4 mitigates doxorubicin induced myocyte apoptosis and cardiac dysfunction. We investigated a novel approach of attenuating doxorubicin induced cardiac toxicity by silencing miR-208a, a heart specific microRNA known to target GATA4. Methods and Results. Eight-week-old female Balb/C mice were randomly assigned to sham, antagomir, and control groups. Antagomir group were pretreated with miR-208a antagomir 4 days before doxorubicin administration. At day 0, control and antagomir groups received 20 mg/kg of doxorubicin, while sham mice received phosphate buffered solution. Echocardiography was done at day 7, after which animals were sacrificed and hearts harvested and assessed for apoptosis and expression of miR-208a, GATA4, and BCL-2. Doxorubicin significantly upregulated miR-208a, downregulated GATA4, and increased myocyte apoptosis, with resulting decrease in cardiac function. In contrast, therapeutic silencing of miR-208a salvaged GATA4 and BCL-2 and decreased apoptosis, with improvement in cardiac function. Conclusion. Doxorubicin upregulates miR-208a and promotes cardiomyocyte apoptosis, while therapeutic silencing of miR-208a attenuates doxorubicin induced myocyte apoptosis with subsequent improvement in cardiac function. These novel results highlight the therapeutic potential of targeting miR-208a to prevent doxorubicin cardiotoxicity.

  1. Hypovirus Papain-Like Protease p29 Suppresses RNA Silencing in the Natural Fungal Host and in a Heterologous Plant System

    OpenAIRE

    Segers, Gerrit C.; van Wezel, Rene; Zhang, Xuemei; Hong, Yiguo; Nuss, Donald L.

    2006-01-01

    Virulence-attenuating hypoviruses of the species Cryphonectria hypovirus 1 (CHV1) encode a papain-like protease, p29, that shares similarities with the potyvirus-encoded suppressor of RNA silencing HC-Pro. We now report that hypovirus CHV1-EP713-encoded p29 can suppress RNA silencing in the natural host, the chestnut blight fungus Cryphonectria parasitica. Hairpin RNA-triggered silencing was suppressed in C. parasitica strains expressing p29, and transformation of a transgenic green fluoresce...

  2. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens

    International Nuclear Information System (INIS)

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms

  3. A conserved small RNA promotes silencing of the outer membrane protein YbfM

    DEFF Research Database (Denmark)

    Rasmussen, Anders Aamann; Johansen, Jesper; Nielsen, Jesper S; Overgaard, Martin; Kallipolitis, Birgitte; Valentin-Hansen, Poul; Graakjær, Jesper

    2009-01-01

    important physiological role of regulatory RNA molecules in Gram-negative bacteria is to modulate the cell surface and/or to prevent accumulation of OMPs in the envelope. Here, we extend the OMP-sRNA network by showing that the expression of the outer membrane protein YbfM is silenced by a conserved sRNA......In the past few years an increasing number of small non-coding RNAs (sRNAs) in enterobacteria have been found to negatively regulate the expression of outer membrane proteins (OMPs) at the post-transcriptional level. These RNAs act under various growth and stress conditions, suggesting that one......, designated MicM (also known as RybC/SroB). The regulation is strictly dependent on the RNA chaperone Hfq, and mutational analysis indicates that MicM sequesters the ribosome binding site of ybfM mRNA by an antisense mechanism. Furthermore, we provide evidence that Hfq strongly enhances the on-rate of duplex...

  4. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  5. Chitosanase-based method for RNA isolation from cells transfected with chitosan/siRNA nanocomplexes for real-time RT-PCR in gene silencing

    Directory of Open Access Journals (Sweden)

    Mohamad Alameh

    2010-07-01

    Full Text Available Mohamad Alameh, Myriam Jean, Diogo DeJesus, Michael D Buschmann, Abderrazzak Merzouki1Institute of Biomedical Engineering, Department of Chemical Engineering, École Polytechnique, Station Centre-ville, Montréal, QC, CanadaAbstract: Chitosan, a well known natural cationic polysaccharide, has been successfully ­implemented in vitro and in vivo as a nonviral delivery system for both plasmid DNA and siRNA. While using chitosan/siRNA polyplexes to knock down specific targets, we have underestimated the effect of nucleic acids binding to chitosan when extracting RNA for subsequent quantitative PCR evaluation of silencing. In vitro transfection using chitosan/siRNA-based polyplexes reveals a very poor recovery of total RNA especially when using low cell numbers in 96 well plates. Here, we describe a method that dramatically enhances RNA extraction from chitosan/siRNA-treated cells by using an enzymatic treatment with a type III chitosanase. We show that chitosanase treatment prior to RNA extraction greatly enhances the yield and the integrity of extracted RNA. This method will therefore eliminate the bias associated with lower RNA yield and integrity when quantifying gene silencing of chitosan-based systems using quantitative real time PCR.Keywords: chitosan, chitosanase, siRNA, DPP-IV gene silencing, RIN, qPCR

  6. Silencing the ribosomal locus of Saccharomyces cerevisiae: role of RNA polymerase I transcription and chromatin acetylation”

    OpenAIRE

    Cesarini, Elisa

    2011-01-01

    During my PhD I investigated the transcriptional silencing occurring at the ribosomal DNA of Saccharomyces cerevisiae. In yeast the ribosomal locus (rDNA) is transcribed with high efficiency by RNA polymerase I (Pol I) and III to synthetize ribosomal RNAs. It has been discovered that RNA polymerase Pol II (Pol II) can also transcribe the ribosomal locus, at low level, starting from cryptic promoters and generating non coding RNAs (ncRNAs). ncRNA transcription leads to genome...

  7. The Nucleocapsid Protein of Coronaviruses Acts as a Viral Suppressor of RNA Silencing in Mammalian Cells

    Science.gov (United States)

    Cui, Lei; Wang, Haiying; Ji, Yanxi; Yang, Jie; Xu, Shan; Huang, Xingyu; Wang, Zidao; Qin, Lei; Tien, Po; Zhou, Xi

    2015-01-01

    ABSTRACT RNA interference (RNAi) is a process of eukaryotic posttranscriptional gene silencing that functions in antiviral immunity in plants, nematodes, and insects. However, recent studies provided strong supports that RNAi also plays a role in antiviral mechanism in mammalian cells. To combat RNAi-mediated antiviral responses, many viruses encode viral suppressors of RNA silencing (VSR) to facilitate their replication. VSRs have been widely studied for plant and insect viruses, but only a few have been defined for mammalian viruses currently. We identified a novel VSR from coronaviruses, a group of medically important mammalian viruses including Severe acute respiratory syndrome coronavirus (SARS-CoV), and showed that the nucleocapsid protein (N protein) of coronaviruses suppresses RNAi triggered by either short hairpin RNAs or small interfering RNAs in mammalian cells. Mouse hepatitis virus (MHV) is closely related to SARS-CoV in the family Coronaviridae and was used as a coronavirus replication model. The replication of MHV increased when the N proteins were expressed in trans, while knockdown of Dicer1 or Ago2 transcripts facilitated the MHV replication in mammalian cells. These results support the hypothesis that RNAi is a part of the antiviral immunity responses in mammalian cells. IMPORTANCE RNAi has been well known to play important antiviral roles from plants to invertebrates. However, recent studies provided strong supports that RNAi is also involved in antiviral response in mammalian cells. An important indication for RNAi-mediated antiviral activity in mammals is the fact that a number of mammalian viruses encode potent suppressors of RNA silencing. Our results demonstrate that coronavirus N protein could function as a VSR through its double-stranded RNA binding activity. Mutational analysis of N protein allowed us to find out the critical residues for the VSR activity. Using the MHV-A59 as the coronavirus replication model, we showed that ectopic

  8. Effects of Trypanosoma brucei tryptophanyl-tRNA synthetases silencing by RNA interference

    Directory of Open Access Journals (Sweden)

    Liliana Torcoroma García

    2007-09-01

    Full Text Available The kinetoplast genetic code deviates from the universal code in that 90% of mitochondrial tryptophans are specified by UGA instead of UGG codons. A single nucleus-encoded tRNA Trp(CCA is used by both nuclear and mitochondria genes, since all kinetoplast tRNAs are imported into the mitochondria from the cytoplasm. To allow decoding of the mitochondrial UGA codons as tryptophan, the tRNA Trp(CCA anticodon is changed to UCA by an editing event. Two tryptophanyl tRNA synthetases (TrpRSs have been identified in Trypanosoma brucei: TbTrpRS1 and TbTrpRS2 which localize to the cytoplasm and mitochondria respectively. We used inducible RNA interference (RNAi to assess the role of TbTrpRSs. Our data validates previous observations of TrpRS as potential drug design targets and investigates the RNAi effect on the mitochondria of the parasite.

  9. Effects of stathmin 1 silencing by siRNA on sensitivity of esophageal cancer cells Eca-109 to paclitaxel.

    Science.gov (United States)

    Zhu, H W; Jiang, D; Xie, Z Y; Zhou, M H; Sun, D Y; Zhao, Y G

    2015-01-01

    We investigated the effects of stathmin 1 (STMN1) silencing by small interfering (siRNA) on the sensitivity of esophageal cancer cells Eca-109 to paclitaxel. STMN1 siRNA was transiently transfected into Eca-109 cells. The effects of transfection were detected by quantitative polymerase chain reaction and western blotting. The effects of STMN1 silencing by siRNA on the sensitivity of esophageal cancer cells Eca-109 to paclitaxel was tested by MTT and colony formation assays. Hoechst 33258 nuclear staining was used to investigate the differences in Eca-109 cell apoptosis induced by paclitaxel. STMN1 siRNA was successfully transfected and the expression of STMN1 was inhibited. The sensitivity of STMN1 siRNA-transfected Eca-109 cells to paclitaxel was significantly increased (P Eca-109 cells significantly increased following treatment with paclitaxel (P Eca-109 to paclitaxel and induce apoptosis. PMID:26782519

  10. Effect of silencing of ATM expression by siRNA on radiosensitivity of human lung adenocarcinoma A549 cells

    International Nuclear Information System (INIS)

    Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A549 cells in G1 and G2/M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)

  11. Experimental identification of microRNA-140 targets by silencing and overexpressing miR-140

    DEFF Research Database (Denmark)

    Nicolas, Francisco Esteban; Pais, Helio; Schwach, Frank; Lindow, Morten; Kauppinen, Sakari; Moulton, Vincent; Dalmay, Tamas

    2008-01-01

    cartilage-specific miR-140 was overexpressed and silenced in cells it is normally expressed in separate experiments. Expression of mRNAs was profiled in both experiments and the intersection of mRNAs repressed by miR-140 overexpression and derepressed by silencing of miR-140 was identified. The intersection......MicroRNAs (miRNAs) are short noncoding RNA molecules regulating the expression of mRNAs. Target identification of miRNAs is computationally difficult due to the relatively low homology between miRNAs and their targets. We present here an experimental approach to target identification where the...... contained only 49 genes, although both treatments affected the accumulation of hundreds of mRNAs. These 49 genes showed a very strong enrichment for the miR-140 seed sequence implying that the approach is efficient and specific. Twenty-one of these 49 genes were predicted to be direct targets based on the...

  12. Growth Inhibition of Head and Neck Squamous Cell Carcinoma Cells by sgRNA Targeting the Cyclin D1 mRNA Based on TRUE Gene Silencing

    OpenAIRE

    Iizuka, Satoshi; Oridate, Nobuhiko; Nashimoto, Masayuki; Fukuda, Satoshi; Tamura, Masato

    2014-01-01

    Head and neck squamous cell carcinoma (HNSCC) exhibits increased expression of cyclin D1 (CCND1). Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing) is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any...

  13. Mastering Dendrimer Self-Assembly for Efficient siRNA Delivery: From Conceptual Design to In Vivo Efficient Gene Silencing.

    Science.gov (United States)

    Chen, Chao; Posocco, Paola; Liu, Xiaoxuan; Cheng, Qiang; Laurini, Erik; Zhou, Jiehua; Liu, Cheng; Wang, Yang; Tang, Jingjie; Col, Valentina Dal; Yu, Tianzhu; Giorgio, Suzanne; Fermeglia, Maurizio; Qu, Fanqi; Liang, Zicai; Rossi, John J; Liu, Minghua; Rocchi, Palma; Pricl, Sabrina; Peng, Ling

    2016-07-01

    Self-assembly is a fundamental concept and a powerful approach in molecular science. However, creating functional materials with the desired properties through self-assembly remains challenging. In this work, through a combination of experimental and computational approaches, the self-assembly of small amphiphilic dendrons into nanosized supramolecular dendrimer micelles with a degree of structural definition similar to traditional covalent high-generation dendrimers is reported. It is demonstrated that, with the optimal balance of hydrophobicity and hydrophilicity, one of the self-assembled nanomicellar systems, totally devoid of toxic side effects, is able to deliver small interfering RNA and achieve effective gene silencing both in cells - including the highly refractory human hematopoietic CD34(+) stem cells - and in vivo, thus paving the way for future biomedical implementation. This work presents a case study of the concept of generating functional supramolecular dendrimers via self-assembly. The ability of carefully designed and gauged building blocks to assemble into supramolecular structures opens new perspectives on the design of self-assembling nanosystems for complex and functional applications. PMID:27244195

  14. The Promise and Challenge of Therapeutic MicroRNA Silencing in Diabetes and Metabolic Diseases.

    Science.gov (United States)

    Sethupathy, Praveen

    2016-06-01

    MicroRNAs (miRNAs) are small, non-coding, RNA molecules that regulate gene expression. They have a long evolutionary history and are found in plants, viruses, and animals. Although initially discovered in 1993 in Caenorhabditis elegans, they were not appreciated as widespread and abundant gene regulators until the early 2000s. Studies in the last decade have found that miRNAs confer phenotypic robustness in the face of environmental perturbation, may serve as diagnostic and prognostic indicators of disease, underlie the pathobiology of a wide array of complex disorders, and represent compelling therapeutic targets. Pre-clinical studies in animal models have demonstrated that pharmacologic manipulation of miRNAs, mostly in the liver, can modulate metabolic phenotypes and even reverse the course of insulin resistance and diabetes. There is cautious optimism in the field about miRNA-based therapies for diabetes, several of which are already in various stages of clinical trials. This review will highlight both the promise and the most pressing challenges of therapeutic miRNA silencing in diabetes and related conditions. PMID:27112956

  15. Stable siRNA-mediated silencing of antizyme inhibitor: regulation of ornithine decarboxylase activity

    International Nuclear Information System (INIS)

    Ornithine decarboxylase (ODC) is the rate-limiting enzyme involved in the biosynthesis of polyamines essential for cell growth and differentiation. Aberrant upregulation of ODC, however, is widely believed to be a contributing factor in tumorigenesis. Antizyme is a major regulator of ODC, inhibiting ODC activity through the formation of complexes and facilitating degradation of ODC by the 26S proteasome. Moreover, the antizyme inhibitor (AZI) serves as another factor in regulating ODC, by binding to antizyme and releasing ODC from ODC-antizyme complexes. In our previous report, we observed elevated AZI expression in tumor specimens. Therefore, to evaluate the role of AZI in regulating ODC activity in tumors, we successfully down-regulated AZI expression using RNA interference technology in A549 lung cancer cells expressing high levels of AZI. Two AZI siRNAs, which were capable to generate a hairpin dsRNA loop targeting AZI, could successively decrease the expression of AZI. Using biological assays, antizyme activity increased in AZI-siRNA-transfected cells, and ODC levels and activity were reduced as well. Moreover, silencing AZI expression decreased intracellular polyamine levels, reduced cell proliferation, and prolonged population doubling time. Our results directly demonstrate that downregulation of AZI regulates ODC activity, intracellular polyamine levels, and cell growth through regulating antizyme activity. This study also suggests that highly expressed AZI may be partly responsible for increased ODC activity and cellular transformation

  16. Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

    Directory of Open Access Journals (Sweden)

    Satoshi Iizuka

    Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

  17. Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

    Science.gov (United States)

    Iizuka, Satoshi; Oridate, Nobuhiko; Nashimoto, Masayuki; Fukuda, Satoshi; Tamura, Masato

    2014-01-01

    Head and neck squamous cell carcinoma (HNSCC) exhibits increased expression of cyclin D1 (CCND1). Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing) is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA). In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs. PMID:25437003

  18. Differential meiotic stability of transcriptionally silenced epialleles of tobacco transgenes generated in trans by RNA-signals

    Czech Academy of Sciences Publication Activity Database

    Crhák Khaitová, Lucie; Fojtová, Miloslava; Depicker, A.; Křížová, Kateřina; Kovařík, Aleš

    Evry, 2009. s. 1. [Plant Genomics and Beyond. 05.07.2009-08.07.2009, Evry] R&D Projects: GA ČR(CZ) GD204/05/H505 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA methylation * transcriptional gene silencing * RNA-signals Subject RIV: BO - Biophysics

  19. A Pooled shRNA Screen Identifies Rbm15, Spen, and Wtap as Factors Required for Xist RNA-Mediated Silencing

    Directory of Open Access Journals (Sweden)

    Benoit Moindrot

    2015-07-01

    Full Text Available X-chromosome inactivation is the process that evolved in mammals to equalize levels of X-linked gene expression in XX females relative to XY males. Silencing of a single X chromosome in female cells is mediated by the non-coding RNA Xist. Although progress has been made toward identifying factors that function in the maintenance of X inactivation, the primary silencing factors are largely undefined. We developed an shRNA screening strategy to produce a ranked list of candidate primary silencing factors. Validation experiments performed on several of the top hits identified the SPOC domain RNA binding proteins Rbm15 and Spen and Wtap, a component of the m6A RNA methyltransferase complex, as playing an important role in the establishment of Xist-mediated silencing. Localization analysis using super-resolution 3D-SIM microscopy demonstrates that these factors co-localize with Xist RNA within the nuclear matrix subcompartment, consistent with a direct interaction.

  20. A Pooled shRNA Screen Identifies Rbm15, Spen, and Wtap as Factors Required for Xist RNA-Mediated Silencing.

    Science.gov (United States)

    Moindrot, Benoit; Cerase, Andrea; Coker, Heather; Masui, Osamu; Grijzenhout, Anne; Pintacuda, Greta; Schermelleh, Lothar; Nesterova, Tatyana B; Brockdorff, Neil

    2015-07-28

    X-chromosome inactivation is the process that evolved in mammals to equalize levels of X-linked gene expression in XX females relative to XY males. Silencing of a single X chromosome in female cells is mediated by the non-coding RNA Xist. Although progress has been made toward identifying factors that function in the maintenance of X inactivation, the primary silencing factors are largely undefined. We developed an shRNA screening strategy to produce a ranked list of candidate primary silencing factors. Validation experiments performed on several of the top hits identified the SPOC domain RNA binding proteins Rbm15 and Spen and Wtap, a component of the m6A RNA methyltransferase complex, as playing an important role in the establishment of Xist-mediated silencing. Localization analysis using super-resolution 3D-SIM microscopy demonstrates that these factors co-localize with Xist RNA within the nuclear matrix subcompartment, consistent with a direct interaction. PMID:26190105

  1. Prolonged efficiency of siRNA-mediated gene silencing in primary cultures of human preadipocytes and adipocytes

    OpenAIRE

    Lee, Mi-Jeong; Pickering, R. Taylor; Puri, Vishwajeet

    2013-01-01

    Objective Primary human preadipocytes and differentiated adipocytes in culture are valuable cell culture systems to study adipogenesis and adipose function in relation to human adipose biology. To use these systems for mechanistic studies, we studied siRNA-mediated knockdown of genes for its effectiveness. Design and Methods Methods were developed to effectively deliver siRNA to for gene silencing in primary preadipocytes isolated from human subcutaneous adipose tissue and newly-differentiate...

  2. DsRNA-mediated silencing of Nudix hydrolase in Trichinella spiralis inhibits the larval invasion and survival in mice.

    Science.gov (United States)

    Zhang, Shuai Bing; Jiang, Peng; Wang, Zhong Quan; Long, Shao Rong; Liu, Ruo Dan; Zhang, Xi; Yang, Wei; Ren, Hui Jun; Cui, Jing

    2016-03-01

    The aim of this study was to investigate the functions of Trichinella spiralis Nudix hydrolase (TsNd) during the larval invasion of intestinal epithelial cells (IECs), development and survival in host by RNAi. The TsNd-specific double-stranded RNA (dsRNA) was designed to silence the expression of TsNd in T. spiralis larvae. DsRNA were delivered to the larvae by soaking incubation or electroporation. Silencing effect of TsNd transcription and expression was determined by real-time PCR and Western blotting, respectively. The infectivity of larvae treated with dsRNA was investigated by the in vitro larval invasion of IECs and experimental infection in mice. After being soaked with 40 ng/μl of dsRNA-TsNd, the transcription and expression level of TsNd gene was inhibited 65.8% and 56.4%, respectively. After being electroporated with 40 ng/μl of dsRNA-TsNd, the transcription and expression level of TsNd gene was inhibited 74.2% and 58.2%, respectively. Silencing TsNd expression by both soaking and electroporation inhibited significantly the larval invasion of IECs in a dose-dependent manner (r1 = -0.96798, r2 = -0.98707). Compared with the mice inoculated with untreated larvae, mice inoculated with larvae soaked with TsNd dsRNA displayed a 49.9% reduction in adult worms and 39.9% reduction in muscle larvae, while mice inoculated with larvae electroporated with TsNd dsRNA displayed a 83.4% reduction in adult worms and 69.5% reduction in muscle larvae, indicating that electroporation has a higher efficiency than soaking in inhibiting the larval development and survival in mice. Our results showed that silencing TsNd expression in T. spiralis inhibited significantly the larval invasion and survival in host. PMID:26778819

  3. Inducible viral inoculation system with cultured plant cells facilitates a biochemical approach for virus-induced RNA silencing.

    Science.gov (United States)

    Tamai, Atsushi; Dohi, Koji; Mori, Masasi; Meshi, Tetsuo; Ishikawa, Masayuki

    2010-03-01

    An inducible virus infection system was demonstrated to be an efficient protein expression system for inducing synchronous virus vector multiplication in suspension-cultured plant cells. A GFP-tagged tomato mosaic virus (ToMV-GFP) derivative that has a defect in its 130 K protein, a silencing suppressor of ToMV, was synchronously infected to tobacco BY2 cultured cells using this system. In the infection-induced cells, viral RNA was degraded rapidly, and a cytosol extract prepared from the infected cells showed RNA degradation activity specific for ToMV- or GFP-related sequences. In lysate prepared from cells infected by ToMV-GFP carrying the wild-type 130 K protein, sequence-specific RNA degradation activity was suppressed, although siRNA derived from the virus was generated. Furthermore, the 130 K protein interfered with 3'-end methylation of siRNA. The inducible virus infection system may provide a method for biochemical analysis of antiviral RNA silencing and silencing suppression by ToMV. PMID:20035436

  4. Factors affecting susceptibility to RNA interference in Haemonchus contortus and in vivo silencing of an H11 aminopeptidase gene.

    Science.gov (United States)

    Samarasinghe, Buddhini; Knox, David P; Britton, Collette

    2011-01-01

    Gene silencing by RNA interference (RNAi) has been applied very successfully to Caenorhabditis elegans to study gene function but has proven less effective in parasitic nematodes. In the sheep gastrointestinal nematode Haemonchus contortus, previous studies demonstrated reproducible silencing of β-tubulin but not of other genes targeted. Here we aimed to examine whether the level of target transcript or site of gene expression influence susceptibility to RNAi by soaking. Target genes represented by a high number of expressed sequence tags (ESTs) in the H. contortus L3 stage were not reproducibly silenced. In contrast, four out of six genes putatively expressed in the intestine, excretory cell or amphids were consistently silenced by RNAi. This suggests that genes expressed in sites accessible to the environment are more likely to be susceptible to RNAi by soaking. Silenced genes included those encoding the highly protective gut aminopeptidase H11, secretory protein Hc-ASP-1, β-tubulin and homologues of aquaporin and RNA helicase. To determine whether RNAi silencing of H11 could mimic H11 vaccination in reducing worm and egg counts, we examined the in vivo effects of H11 RNAi. This is the first, to our knowledge, in vivo study of RNAi in an animal parasitic nematode. RNAi of the H11 gene in infective larvae prior to infection resulted in a 57% reduction in faecal egg count (FEC), 40% reduction in worm burden and 64% decrease in aminopeptidase activity compared with pre-soaking in control dsRNA. Thus, in this study we have established that RNAi is a valid and feasible approach to identify essential gene function. However, using current methods, this may be limited to genes expressed in accessible sites. PMID:20699100

  5. DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Sizolwenkosi Mlotshwa

    Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

  6. Epigenetic silencing of monoallelically methylated miRNA loci in precancerous colorectal lesions.

    Science.gov (United States)

    Menigatti, M; Staiano, T; Manser, C N; Bauerfeind, P; Komljenovic, A; Robinson, M; Jiricny, J; Buffoli, F; Marra, G

    2013-01-01

    Epigenetic silencing of protein-encoding genes is common in early-stage colorectal tumorigenesis. Less is known about the methylation-mediated silencing of genes encoding microRNAs (miRNAs), which are also important epigenetic modulators of gene expression. Using quantitative PCR, we identified 56 miRNAs that were expressed in normal colorectal mucosa and in HT29 colorectal cancer cells treated with demethylating agents but not in untreated HT29 cells, suggesting that they probably undergo methylation-induced silencing during colorectal tumorigenesis. One of these, miR-195, had recently been reported to be underexpressed in colorectal cancers and to exert tumor-suppressor effects in colorectal cancer cells. We identified the transcription start site (TSS) for primary miRNA (pri-miR)-497/195, the primary precursor that yields miR-195 and another candidate on our list, miR-497, and a single CpG island upstream to the TSS, which controls expression of both miRNAs. Combined bisulfite restriction analysis and bisulfite genomic sequencing studies revealed monoallelic methylation of this island in normal colorectal mucosa (50/50 samples) and full methylation in most colorectal adenomas (38/50; 76%). The hypermethylated precancerous lesions displayed significantly downregulated expression of both miRNAs. Similar methylation patterns were observed at two known imprinted genes, MEG3 and GNAS-AS1, which encode several of the 56 miRNAs on our list. Imprinting at these loci was lost in over half the adenomas (62% at MEG3 and 52% at GNAS-AS1). Copy-number alterations at MEG3, GNAS-AS1 and pri-miR-497/195, which are frequent in colorectal cancers, were less common in adenomas and confined to tumors displaying differential methylation at the involved locus. Our data show that somatically acquired, epigenetic changes at monoallelically methylated regions encoding miRNAs are relatively frequent in sporadic colorectal adenomas and might contribute to the onset and progression of

  7. RNA interference-mediated silencing of mitotic kinesin KIF14 disrupts cell cycle progression and induces cytokinesis failure.

    Science.gov (United States)

    Carleton, Michael; Mao, Mao; Biery, Matthew; Warrener, Paul; Kim, Sammy; Buser, Carolyn; Marshall, C Gary; Fernandes, Christine; Annis, James; Linsley, Peter S

    2006-05-01

    KIF14 is a microtubule motor protein whose elevated expression is associated with poor-prognosis breast cancer. Here we demonstrate KIF14 accumulation in mitotic cells, where it associated with developing spindle poles and spindle microtubules. Cells at later stages of mitosis were characterized by the concentration of KIF14 at the midbody. Time-lapse microscopy revealed that strong RNA interference (RNAi)-mediated silencing of KIF14 induced cytokinesis failure, causing several rounds of endoreduplication and resulting in multinucleated cells. Additionally, less efficacious KIF14-specific short interfering RNAs (siRNAs) induced multiple phenotypes, all of which resulted in acute apoptosis. Our data demonstrate the ability of siRNA-mediated silencing to generate epiallelic hypomorphs associated with KIF14 depletion. Furthermore, the link we observed between siRNA efficacy and phenotypic outcome indicates that distinct stages during cell cycle progression are disrupted by the differential modulation of KIF14 expression. PMID:16648480

  8. The RNA silencing enzyme RNA polymerase v is required for plant immunity.

    Directory of Open Access Journals (Sweden)

    Ana López

    2011-12-01

    Full Text Available RNA-directed DNA methylation (RdDM is an epigenetic control mechanism driven by small interfering RNAs (siRNAs that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1. NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V, which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence

  9. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

    Science.gov (United States)

    Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

    2016-01-01

    This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05). The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular

  10. Early origin and adaptive evolution of the GW182 protein family, the key component of RNA silencing in animals.

    Science.gov (United States)

    Zielezinski, Andrzej; Karlowski, Wojciech M

    2015-01-01

    The GW182 proteins are a key component of the miRNA-dependent post-transcriptional silencing pathway in animals. They function as scaffold proteins to mediate the interaction of Argonaute (AGO)-containing complexes with cytoplasmic poly(A)-binding proteins (PABP) and PAN2-PAN3 and CCR4-NOT deadenylases. The AGO-GW182 complexes mediate silencing of the target mRNA through induction of translational repression and/or mRNA degradation. Although the GW182 proteins are a subject of extensive experimental research in the recent years, very little is known about their origin and evolution. Here, based on complex functional annotation and phylogenetic analyses, we reveal 448 members of the GW182 protein family from the earliest animals to humans. Our results indicate that a single-copy GW182/TNRC6C progenitor gene arose with the emergence of multicellularity and it multiplied in the last common ancestor of vertebrates in 2 rounds of whole genome duplication (WGD) resulting in 3 genes. Before the divergence of vertebrates, both the AGO- and CCR4-NOT-binding regions of GW182s showed significant acceleration in the accumulation of amino acid changes, suggesting functional adaptation toward higher specificity to the molecules of the silencing complex. We conclude that the silencing ability of the GW182 proteins improves with higher position in the taxonomic classification and increasing complexity of the organism. The first reconstruction of the molecular journey of GW182 proteins from the ancestral metazoan protein to the current mammalian configuration provides new insight into development of the miRNA-dependent post-transcriptional silencing pathway in animals. PMID:26106978

  11. The siRNA-mediated silencing of Trichinella spiralis nudix hydrolase results in reduction of larval infectivity.

    Science.gov (United States)

    Wang, Zhong Quan; Zhang, Shuai Bing; Jiang, Peng; Liu, Ruo Dan; Long, Shao Rong; Zhang, Xi; Ren, Hui Jun; Cui, Jing

    2015-09-01

    Previous studies showed that Trichinella spiralis Nudix hydrolase (TsNd) bound to intestinal epithelial cells (IECs), and vaccination of mice with rTsNd or TsNd DNA produced a partial protective immunity against T. spiralis infection. In this study, three TsNd specific small interfering RNA (siRNA) were designed to silence the expression of TsNd in T. spiralis larvae. SiRNAs were delivered to the larvae by electroporation. Silencing effect of TsNd transcription and expression was determined by real-time PCR and Western blotting, respectively. The infectivity of the larvae treated with siRNA was investigated by the in vitro larval invasion of IECs and experimental infection in mice. The results showed that siRNAs were efficiently delivered into T. spiralis larvae through electroporation. Real-time PCR and Western blotting showed that transcription and expression level of TsNd gene was inhibited 73.3 and 76.7 %, respectively, after being electroporated with 2 μM of siRNA-275 for 1 day. Silencing TsNd expression inhibited significantly the larval invasion of IECs (P < 0.01) and was in a dose-dependent manner (r = -0.97941). The mice with infected larvae treated with TsNd siRNA displayed a 63.6 % reduction in intestinal adult worms and 68.8 % reduction in muscle larval burden compared with mice infected with control siRNA-treated larvae. Our results showed that silencing TsNd expression in T. spiralis significantly reduced the larval infectivity and survival in host. PMID:26231837

  12. Gene Overexpression and RNA Silencing Tools for the Genetic Manipulation of the S-(+-Abscisic Acid Producing Ascomycete Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Zhong-Tao Ding

    2015-05-01

    Full Text Available The phytopathogenic ascomycete Botrytis cinerea produces several secondary metabolites that have biotechnical significance and has been particularly used for S-(+-abscisic acid production at the industrial scale. To manipulate the expression levels of specific secondary metabolite biosynthetic genes of B. cinerea with Agrobacterium tumefaciens-mediated transformation system, two expression vectors (pCBh1 and pCBg1 with different selection markers and one RNA silencing vector, pCBSilent1, were developed with the In-Fusion assembly method. Both expression vectors were highly effective in constitutively expressing eGFP, and pCBSilent1 effectively silenced the eGFP gene in B. cinerea. Bcaba4, a gene suggested to participate in ABA biosynthesis in B. cinerea, was then targeted for gene overexpression and RNA silencing with these reverse genetic tools. The overexpression of bcaba4 dramatically induced ABA formation in the B. cinerea wild type strain Bc-6, and the gene silencing of bcaba4 significantly reduced ABA-production in an ABA-producing B. cinerea strain.

  13. Antiviral RNA silencing is restricted to the marginal region of the dark green tissue in the mosaic leaves of tomato mosaic virus-infected tobacco plants.

    Science.gov (United States)

    Hirai, Katsuyuki; Kubota, Kenji; Mochizuki, Tomofumi; Tsuda, Shinya; Meshi, Tetsuo

    2008-04-01

    Mosaic is a common disease symptom caused by virus infection in plants. Mosaic leaves of Tomato mosaic virus (ToMV)-infected tobacco plants consist of yellow-green and dark green tissues that contain large and small numbers of virions, respectively. Although the involvement of RNA silencing in mosaic development has been suggested, its role in the process that results in an uneven distribution of the virus is unknown. Here, we investigated whether and where ToMV-directed RNA silencing was established in tobacco mosaic leaves. When transgenic tobaccos defective in RNA silencing were infected with ToMV, little or no dark green tissue appeared, implying the involvement of RNA silencing in mosaic development. ToMV-related small interfering RNAs were rarely detected in the dark green areas of the first mosaic leaves, and their interior portions were susceptible to infection. Thus, ToMV-directed RNA silencing was not effective there. By visualizing the cells where ToMV-directed RNA silencing was active, it was found that the effective silencing occurs only in the marginal regions of the dark green tissue ( approximately 0.5 mm in width) and along the major veins. Further, the cells in the margins were resistant against recombinant potato virus X carrying a ToMV-derived sequence. These findings demonstrate that RNA silencing against ToMV is established in the cells located at the margins of the dark green areas, restricting the expansion of yellow-green areas, and consequently defines the mosaic pattern. The mechanism of mosaic symptom development is discussed in relation to the systemic spread of the virus and RNA silencing. PMID:18216118

  14. Antiviral RNA Silencing Is Restricted to the Marginal Region of the Dark Green Tissue in the Mosaic Leaves of Tomato Mosaic Virus-Infected Tobacco Plants▿

    Science.gov (United States)

    Hirai, Katsuyuki; Kubota, Kenji; Mochizuki, Tomofumi; Tsuda, Shinya; Meshi, Tetsuo

    2008-01-01

    Mosaic is a common disease symptom caused by virus infection in plants. Mosaic leaves of Tomato mosaic virus (ToMV)-infected tobacco plants consist of yellow-green and dark green tissues that contain large and small numbers of virions, respectively. Although the involvement of RNA silencing in mosaic development has been suggested, its role in the process that results in an uneven distribution of the virus is unknown. Here, we investigated whether and where ToMV-directed RNA silencing was established in tobacco mosaic leaves. When transgenic tobaccos defective in RNA silencing were infected with ToMV, little or no dark green tissue appeared, implying the involvement of RNA silencing in mosaic development. ToMV-related small interfering RNAs were rarely detected in the dark green areas of the first mosaic leaves, and their interior portions were susceptible to infection. Thus, ToMV-directed RNA silencing was not effective there. By visualizing the cells where ToMV-directed RNA silencing was active, it was found that the effective silencing occurs only in the marginal regions of the dark green tissue (∼0.5 mm in width) and along the major veins. Further, the cells in the margins were resistant against recombinant potato virus X carrying a ToMV-derived sequence. These findings demonstrate that RNA silencing against ToMV is established in the cells located at the margins of the dark green areas, restricting the expansion of yellow-green areas, and consequently defines the mosaic pattern. The mechanism of mosaic symptom development is discussed in relation to the systemic spread of the virus and RNA silencing. PMID:18216118

  15. Gene Overexpression and RNA Silencing Tools for the Genetic Manipulation of the S-(+)-Abscisic Acid Producing Ascomycete Botrytis cinerea

    OpenAIRE

    Zhong-Tao Ding; Zhi Zhang; Di Luo; Jin-Yan Zhou; Juan Zhong; Jie Yang; Liang Xiao; Dan Shu; Hong Tan

    2015-01-01

    The phytopathogenic ascomycete Botrytis cinerea produces several secondary metabolites that have biotechnical significance and has been particularly used for S-(+)-abscisic acid production at the industrial scale. To manipulate the expression levels of specific secondary metabolite biosynthetic genes of B. cinerea with Agrobacterium tumefaciens-mediated transformation system, two expression vectors (pCBh1 and pCBg1 with different selection markers) and one RNA silencing vector, pCBSilent1, w...

  16. Multitasking of the piRNA Silencing Machinery: Targeting Transposable Elements and Foreign Genes in the Bdelloid Rotifer Adineta vaga.

    Science.gov (United States)

    Rodriguez, Fernando; Arkhipova, Irina R

    2016-05-01

    RNA-mediated silencing processes play a key role in silencing of transposable elements, especially in the germ line, where piwi-interacting RNAs (piRNAs) are responsible for suppressing transposon mobility and maintaining genome integrity. We previously reported that the genome of Adineta vaga, the first sequenced representative of the phylum Rotifera (class Bdelloidea), is characterized by massive levels of horizontal gene transfer, by unusually low transposon content, and by highly diversified RNA-mediated silencing machinery. Here, we investigate genome-wide distribution of pi-like small RNAs, which in A. vaga are 25-31 nucleotides in length and have a strong 5'-uridine bias, while lacking ping-pong amplification signatures. In agreement with expectations, 71% of mapped reads corresponded to annotated transposons, with 93% of these reads being in the antisense orientation. Unexpectedly, a significant fraction of piRNAs originate from predicted coding regions corresponding to genes of putatively foreign origin. The distribution of piRNAs across foreign genes is not biased toward 3'-UTRs, instead resembling transposons in uniform distribution pattern throughout the gene body, and in predominantly antisense orientation. We also find that genes with small RNA coverage, including a number of genes of metazoan origin, are characterized by higher occurrence of telomeric repeats in the surrounding genomic regions, and by higher density of transposons in the vicinity, which have the potential to promote antisense transcription. Our findings highlight the complex interplay between RNA-based silencing processes and acquisition of genes at the genome periphery, which can result either in their loss or eventual domestication and integration into the host genome. PMID:27017627

  17. Control of HIV-1 env RNA splicing and transport: investigating the role of hnRNP A1 in exon splicing silencer (ESS3a) function

    International Nuclear Information System (INIS)

    The control of HIV-1 viral RNA splicing and transport plays an important role in the successful replication of the virus. Previous studies have identified both an exon splicing enhancer (ESE) and a bipartite exon splicing silencer (ESS3a and ESS3b) within the terminal exon of HIV-1 that are involved in modulating both splicing and Rev-mediated export of viral RNA. To define the mechanism of ESS3a function, experiments were carried out to better define the cis and trans components required for ESS3a activity. Mutations throughout the 30-nt element resulted in partial loss of ESS function. Combining mutations was found to have an additive effect, suggesting the presence of multiple binding sites. Analysis of interacting factors identified hnRNP A1 as one component of the complex that modulates ESS3a activity. However, subsequent binding analyses determined that hnRNP A1 interacts with only one portion of ESS3a, suggesting the involvement of another host factor. Parallel analysis of the effect of the mutations on Rev-mediated export determined that there is not a direct correlation between the effect of the mutations on splicing and RNA transport. Consistent with this hypothesis, replacement of ESS3a with consensus hnRNP A1 binding sites was found to be insufficient to block Rev-mediated RNA export

  18. Oral cancer cells may rewire alternative metabolic pathways to survive from siRNA silencing of metabolic enzymes

    International Nuclear Information System (INIS)

    Cancer cells may undergo metabolic adaptations that support their growth as well as drug resistance properties. The purpose of this study is to test if oral cancer cells can overcome the metabolic defects introduced by using small interfering RNA (siRNA) to knock down their expression of important metabolic enzymes. UM1 and UM2 oral cancer cells were transfected with siRNA to transketolase (TKT) or siRNA to adenylate kinase (AK2), and Western blotting was used to confirm the knockdown. Cellular uptake of glucose and glutamine and production of lactate were compared between the cancer cells with either TKT or AK2 knockdown and those transfected with control siRNA. Statistical analysis was performed with student T-test. Despite the defect in the pentose phosphate pathway caused by siRNA knockdown of TKT, the survived UM1 or UM2 cells utilized more glucose and glutamine and secreted a significantly higher amount of lactate than the cells transferred with control siRNA. We also demonstrated that siRNA knockdown of AK2 constrained the proliferation of UM1 and UM2 cells but similarly led to an increased uptake of glucose/glutamine and production of lactate by the UM1 or UM2 cells survived from siRNA silencing of AK2. Our results indicate that the metabolic defects introduced by siRNA silencing of metabolic enzymes TKT or AK2 may be compensated by alternative feedback metabolic mechanisms, suggesting that cancer cells may overcome single defective pathways through secondary metabolic network adaptations. The highly robust nature of oral cancer cell metabolism implies that a systematic medical approach targeting multiple metabolic pathways may be needed to accomplish the continued improvement of cancer treatment

  19. Small RNA profiles of wild-type and silencing suppressor-deficient tomato spotted wilt virus infected Nicotiana benthamiana.

    Science.gov (United States)

    Margaria, Paolo; Miozzi, Laura; Rosa, Cristina; Axtell, Michael J; Pappu, Hanu R; Turina, Massimo

    2015-10-01

    Tospoviruses are plant-infecting viruses belonging to the family Bunyaviridae. We used a collection of wild-type, phylogenetically distinct tomato spotted wilt virus isolates and related silencing-suppressor defective mutants to study the effects on the small RNA (sRNA) accumulation during infection of Nicotiana benthamiana. Our data showed that absence of a functional silencing suppressor determined a marked increase of the total amount of viral sRNAs (vsRNAs), and specifically of the 21 nt class. We observed a common under-representation of vsRNAs mapping to the intergenic region of S and M genomic segments, and preferential mapping of the reads against the viral sense open reading frames, with the exception of the NSs gene. The NSs-mutant strains showed enrichment of NSm-derived vsRNA compared to the expected amount based on gene size. Analysis of 5' terminal nucleotide preference evidenced a significant enrichment in U for the 21 nt- and in A for 24 nt-long endogenous sRNAs in all the samples. Hotspot analysis revealed a common abundant accumulation of reads at the 5' end of the L segment, mostly in the antiviral sense, for the NSs-defective isolates, suggesting that absence of the silencing suppressor can influence preferential targeting of the viral genome. PMID:26047586

  20. The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

    KAUST Repository

    Chen, Hao

    2010-09-28

    The Arabidopsis FIERY1 (FRY1) locus was originally identified as a negative regulator of stress-responsive gene expression and later shown to be required for suppression of RNA silencing. In this study we discovered that the FRY1 locus also regulates lateral root formation. Compared with the wild type, fry1 mutant seedlings generated significantly fewer lateral roots under normal growth conditions and also exhibited a dramatically reduced sensitivity to auxin in inducing lateral root initiation. Using transgenic plants that overexpress a yeast homolog of FRY1 that possesses only the 3\\', 5\\'-bisphosphate nucleotidase activity but not the inositol 1-phosphatase activity, we demonstrated that the lateral root phenotypes in fry1 result from loss of the nucleotidase activity. Furthermore, a T-DNA insertion mutant of another RNA silencing suppressor, XRN4 (but not XRN2 or XRN3), which is an exoribonuclease that is inhibited by the substrate of the FRY1 3\\', 5\\'-bisphosphate nucleotidase, exhibits similar lateral root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results indicate that RNA silencing modulated by FRY1 and XRN4 plays an important role in shaping root architecture. © 2010 Blackwell Publishing Ltd.

  1. Overexpression of a host factor TOM1 inhibits tomato mosaic virus propagation and suppression of RNA silencing.

    Science.gov (United States)

    Hagiwara-Komoda, Yuka; Hirai, Katsuyuki; Mochizuki, Atsuko; Nishiguchi, Masamichi; Meshi, Tetsuo; Ishikawa, Masayuki

    2008-06-20

    A plant integral membrane protein TOM1 is involved in the multiplication of Tomato mosaic virus (ToMV). TOM1 interacts with ToMV replication proteins and has been suggested to tether the replication proteins to the membranes where the viral RNA synthesis takes place. We have previously demonstrated that inactivation of TOM1 results in reduced ToMV multiplication. In the present study, we show that overexpression of TOM1 in tobacco also inhibits ToMV propagation. TOM1 overexpression led to a decreased accumulation of the soluble form of the replication proteins and interfered with the ability of the replication protein to suppress RNA silencing. The reduced accumulation of the soluble replication proteins was also observed in a silencing suppressor-defective ToMV mutant. Based on these results, we propose that RNA silencing suppression is executed by the soluble form of the replication proteins and that efficient ToMV multiplication requires balanced accumulation of the soluble and membrane-bound replication proteins. PMID:18440043

  2. Silencing and transcriptional properties of the imprinted Airn ncRNA are independent of the endogenous promoter

    OpenAIRE

    Stricker, Stefan H; Steenpass, Laura; Pauler, Florian M; Santoro, Federica; Latos, Paulina A.; Huang, Ru; Koerner, Martha V.; Sloane, Mathew A.; Warczok, Katarzyna E; Barlow, Denise P.

    2008-01-01

    The Airn macro ncRNA is the master regulator of imprinted expression in the Igf2r imprinted gene cluster where it silences three flanking genes in cis. Airn transcription shows unusual features normally viewed as promoter specific, such as impaired post-transcriptional processing and a macro size. The Airn transcript is 108 kb long, predominantly unspliced and nuclear localized, with only a minority being variably spliced and exported. Here, we show by deletion of the Airn ncRNA promoter and ...

  3. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  4. Expression of geminiviral AC2 RNA silencing suppressor changes sugar and jasmonate responsive gene expression in transgenic tobacco plants

    Directory of Open Access Journals (Sweden)

    Soitamo Arto J

    2012-11-01

    Full Text Available Abstract Background RNA-silencing is a conserved gene regulation and surveillance machinery, which in plants, is also used as major defence mechanism against viruses. Various virus-specific dsRNA structures are recognized by the silencing machinery leading to degradation of the viral RNAs or, as in case of begomoviruses, to methylation of their DNA genomes. Viruses produce specific RNA silencing suppressor (RSS proteins to prevent these host defence mechanisms, and as these interfere with the silencing machinery they also disturb the endogenous silencing reactions. In this paper, we describe how expression of AC2 RSS, derived from African cassava mosaic geminivirus changes transcription profile in tobacco (Nicotiana tabacum leaves and in flowers. Results Expression of AC2 RSS in transgenic tobacco plants induced clear phenotypic changes both in leaves and in flowers. Transcriptomes of these plants were strongly altered, with total of 1118 and 251 differentially expressed genes in leaves and flowers, respectively. The three most up-regulated transcript groups were related to stress, cell wall modifications and signalling, whereas the three most down-regulated groups were related to translation, photosynthesis and transcription. It appears that many of the gene expression alterations appeared to be related to enhanced biosynthesis of jasmonate and ethylene, and consequent enhancement of the genes and pathways that are regulated by these hormones, or to the retrograde signalling caused by the reduced photosynthetic activity and sugar metabolism. Comparison of these results to a previous transcriptional profiling of HC-Pro RSS-expressing plants revealed that some of same genes were induced by both RSSs, but their expression levels were typically higher in AC2 than in HC-Pro RSS expressing plants. All in all, a large number of transcript alterations were found to be specific to each of the RSS expressing transgenic plants. Conclusions AC2 RSS in

  5. Suppression of local RNA silencing is not sufficient to promote cell-to-cell movement of Turnip crinkle virus in Nicotiana benthamiana

    OpenAIRE

    Shi, Yan; Ryabov, Eugene V.; van Wezel, Rene; Li, Chunyang; Jin, Mingfei; Wang, Wenjing; Fan, Zaifeng; Hong, Yiguo

    2009-01-01

    The biological relationship between suppression of RNA silencing and virus movement poses an intriguing question in virus-plant interactions. Here, we have used a local RNA silencing assay, based on a movement-deficient Turnip crinkle virus TCV/GFPΔCP, to investigate the influence of silencing suppression by three different viral suppressors: the TCV 38K coat protein (CP), the 126K protein of Tobacco mosaic virus (TMV), and P19 of Tomato bushy stunt virus (TBSV) on cell-to-cell movement and l...

  6. Small RNA interference-mediated gene silencing of heparanase abolishes the invasion, metastasis and angiogenesis of gastric cancer cells

    International Nuclear Information System (INIS)

    Heparanase facilitates the invasion and metastasis of cancer cells, and is over-expressed in many kinds of malignancies. Our studies indicated that heparanase was frequently expressed in advanced gastric cancers. The aim of this study is to determine whether silencing of heparanase expression can abolish the malignant characteristics of gastric cancer cells. Three heparanase-specific small interfering RNA (siRNAs) were designed, synthesized, and transfected into cultured gastric cancer cell line SGC-7901. Heparanase expression was measured by RT-PCR, real-time quantitative PCR and Western blot. Cell proliferation was detected by MTT colorimetry and colony formation assay. The in vitro invasion and metastasis of cancer cells were measured by cell adhesion assay, scratch assay and matrigel invasion assay. The angiogenesis capabilities of cancer cells were measured by tube formation of endothelial cells. Transfection of siRNA against 1496-1514 bp of encoding regions resulted in reduced expression of heparanase, which started at 24 hrs and lasted for 120 hrs post-transfection. The siRNA-mediated silencing of heparanase suppressed the cellular proliferation of SGC-7901 cells. In addition, the in vitro invasion and metastasis of cancer cells were attenuated after knock-down of heparanase. Moreover, transfection of heparanase-specific siRNA attenuated the in vitro angiogenesis of cancer cells in a dose-dependent manner. These results demonstrated that gene silencing of heparanase can efficiently abolish the proliferation, invasion, metastasis and angiogenesis of human gastric cancer cells in vitro, suggesting that heparanase-specific siRNA is of potential values as a novel therapeutic agent for human gastric cancer

  7. Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes.

    Science.gov (United States)

    Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S

    2016-05-01

    RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. PMID:26794313

  8. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    International Nuclear Information System (INIS)

    Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

  9. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

    Directory of Open Access Journals (Sweden)

    Liu X

    2016-04-01

    Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

  10. Evaluation of substance metabolism in mfn2 gene silencing mice mediated by RNA interference with 3H tracing

    International Nuclear Information System (INIS)

    In order to investigate the function of Mfn2, isotopic tracer technique was used to measure the changes of fatty acid synthesis and hepatic glucose production in Mfn2 gene silencing mice mediated by RNA interference. Mfn2 shRNA and negative control plasmid were constructed by using shRNA target finder program. Twenty-four mice were randomly divided into transfection and control group. In transfection group,mice were injected with Mfn2 shRNA plasmid by vena caudalis; and in control group,mice were injected with negative control plasmid by vena caudalis. 5 days after injection, all mice were administered 3H-labeled glucose or 3H2O by vena caudalis or intraperitoneal injection. Then blood and tissue samples were taken at specific times. Radioactivity was measured in all samples with liquid scintillation counter. The rates of hepatic glucose production and fatty acid synthesis in vivo were calculated. The rate of hepatic glucose production was significantly elevated in Mfn2 gene silencing mice (49.43 ± 16.31), compared with negative control mice(24.91 ± 4.07), P 3H tracer study confirms that Mfn2 gene plays an important role in maintaining glucose and lipid homeostasis in vivo. (authors)

  11. Silencing of ataxia-telangiectasia mutated by siRNA enhances the in vitro and in vivo radiosensitivity of glioma.

    Science.gov (United States)

    Li, Yan; Li, Luchun; Li, Bo; Wu, Zhijuan; Wu, Yongzhong; Wang, Ying; Jin, Fu; Li, Dairong; Ma, Huiwen; Wang, Donglin

    2016-06-01

    It is reported that high expression of the ataxia-telangiectasia mutated (ATM) gene is linked with radioresistance in glioma. We hypothesized that the radiosensitivity of this brain tumor is enhanced by silencing of the ATM gene. We transfected the glioma cell line U251 with the siRNA-ATMpuro (group A) lentivirus or the siRNA-HKpuro (group N, negative control) lentivirus before irradiation. RT-qPCR and western blotting were performed to verify the efficiency of siRNA‑mediated ATM silencing. Expression levels of the ATM gene and protein were obviously downregulated after transfection. Moreover, the expression of the p53, PCNA and survivin genes, which are related to radiosensitivity, was also decreased. CCK-8 and colony formation assays showed lower cell proliferation and survival in group A than in groups N and C (control group that was not transfected with any siRNA). The level of double-stranded DNA breaks was also greater in group A, as determined by the comet tail assay. Flow cytometry showed a higher rate of cell apoptosis and a higher number of cells in the G2 phase in group A. Furthermore, caspase-3, caspase-8 and caspase-9 activity was also higher in group A. In vivo analysis in mouse models created by implantation of the transfected cell lines showed that the amount of necrosis and hemorrhage was higher in group A than that in the control groups. In conclusion, silencing of ATM via the siRNA technique could improve the in vitro and in vivo radiosensitivity of glioma cells. PMID:27108486

  12. Gene silencing of the tick protective antigens, Bm86, Bm91 and subolesin, in the one-host tick Boophilus microplus by RNA interference.

    Science.gov (United States)

    Nijhof, Ard M; Taoufik, Amar; de la Fuente, José; Kocan, Katherine M; de Vries, Erik; Jongejan, Frans

    2007-05-01

    The use of RNA interference (RNAi) to assess gene function has been demonstrated in several three-host tick species but adaptation of RNAi to the one-host tick, Boophilus microplus, has not been reported. We evaluated the application of RNAi in B. microplus and the effect of gene silencing on three tick-protective antigens: Bm86, Bm91 and subolesin. Gene-specific double-stranded (dsRNA) was injected into two tick stages, freshly molted unfed and engorged females, and specific gene silencing was confirmed by real time PCR. Gene silencing occurred in injected unfed females after they were allowed to feed. Injection of dsRNA into engorged females caused gene silencing in the subsequently oviposited eggs and larvae that hatched from these eggs, but not in adults that developed from these larvae. dsRNA injected into engorged females could be detected by quantitative real-time RT-PCR in eggs 14 days from the beginning of oviposition, demonstrating that unprocessed dsRNA was incorporated in the eggs. Eggs produced by engorged females injected with subolesin dsRNA were abnormal, suggesting that subolesin may play a role in embryonic development. The injection of dsRNA into engorged females to obtain gene-specific silencing in eggs and larvae is a novel method which can be used to study gene function in tick embryogenesis. PMID:17196597

  13. siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Keshava Mysore

    2015-11-01

    Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

  14. Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

    International Nuclear Information System (INIS)

    Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

  15. Mungbean yellow mosaic Indian virus encoded AC2 protein suppresses RNA silencing by inhibiting Arabidopsis RDR6 and AGO1 activities.

    Science.gov (United States)

    Kumar, Vikash; Mishra, Sumona Karjee; Rahman, Jamilur; Taneja, Jyoti; Sundaresan, Geethaa; Mishra, Neeti Sanan; Mukherjee, Sunil K

    2015-12-01

    RNA silencing refers to a conserved RNA-directed gene regulatory mechanism in a wide range of eukaryotes. It plays an important role in many processes including growth, development, genome stability, and antiviral defense in the plants. Geminivirus encoded AC2 is identified as an RNA silencing suppressor protein, however, the mechanism of action has not been characterized. In this paper, we elucidate another mechanism of AC2-mediated suppression activity of Mungbean Yellow Mosaic India Virus (MYMIV). The AC2 protein, unlike many other suppressors, does not bind to siRNA or dsRNA species and its suppression activity is mediated through interaction with key components of the RNA silencing pathway, viz., RDR6 and AGO1. AC2 interaction inhibits the RDR6 activity, an essential component of siRNA and tasi-RNA biogenesis and AGO1, the major slicing factor of RISC. Thus the study identifies dual sites of MYMIV-AC2 interference and probably accounts for its strong RNA silencing suppression activity. PMID:26433748

  16. Silencing MicroRNA-155 Attenuates Cardiac Injury and Dysfunction in Viral Myocarditis via Promotion of M2 Phenotype Polarization of Macrophages

    OpenAIRE

    Yingying Zhang; Mengying Zhang; Xueqin Li; Zongsheng Tang; Xiangmin Wang; Min Zhong; Qifeng Suo; Yao Zhang; Kun Lv

    2016-01-01

    Macrophage infiltration is a hallmark feature of viral myocarditis. As studies have shown that microRNA-155 regulates the differentiation of macrophages, we aimed to investigate the role of microRNA-155 in VM. We report that silencing microRNA-155 protects mice from coxsackievirus B3 induced myocarditis. We found that microRNA-155 expression was upregulated and localized primarily in heart-infiltrating macrophages and CD4+ T lymphocytes during acute myocarditis. In contrast with wildtype (WT)...

  17. DNA methylation mediated silencing of microRNA-145 is a potential prognostic marker in patients with lung adenocarcinoma

    OpenAIRE

    Wenjie Xia; Qiang Chen; Jie Wang; Qixing Mao; Gaochao Dong; Run Shi; YanYan Zheng; Lin Xu; Feng Jiang

    2015-01-01

    The molecular mechanism of down-regulated microRNA-145 (miR-145) expression in lung adenocarcinoma (LAC) remains largely unknown. We hypothesized that aberrant hyper-methylation of the CpG sites silenced the expression of miR-145 in LAC. In consideration of its pivotal role in LAC development and progression, we also evaluated the clinical utility of miR-145 as a prognostic marker. We assessed the DNA methylation status of the miR-145 promoter region in 20 pairs of LAC and the matched non-tum...

  18. Expanding the Lotus japonicus reverse genetics toolbox – Development of LORE1 retrotransposon mutagenesis and artificial miRNA-mediated silencing

    DEFF Research Database (Denmark)

    Urbanski, Dorian Fabian

    2011-01-01

    -transcriptional gene silencing by expression of artificial miRNAs. Although attempts to conduct genome-wide gene tagging have previously been made in Lotus, all of them lacked efficient methods for high-throughput mutagenesis. The present study takes advantage of the germinal transposition of Lotus endogenous...... introduced into Lotus to exploit the endogenous miRNA processing machinery for target gene silencing. Two amiRNA precursors were shown to be active in a Lotus hairy roots transgenic system based on the data gathered from a heterologous β-glucuronidase silencing experiment. The challenges in silencing...... protocols developed in the current project are now the cornerstone of a new LORE1 reverse genetics resource characterized by efficient mutant line generation and accurate mutation annotation. In parallel, artificial microRNAs (amiRNAs) were designed based on both Arabidopsis and Lotus backbones and...

  19. MicroRNA-mediated NBS1 Gene Silence and Its Effects on Telomerase Activation in Hela Cells

    Institute of Scientific and Technical Information of China (English)

    CAO Sun-qiong; REN Chang-shan

    2008-01-01

    Objective:To research the silence of NBS1 after transfection microRNA expressing eukaryotic recombinants and the changes of telomerase activation in teiomerase-positive cell line Hela.Methods:According to the sequence of NBS1 mRNA,the NBS1 pre-microRNA was designed and synthesized,then cloned into the GFP reporter pcDNA6.2-GW/EmGFP-miR vector and transfected into Hela cells.The integrity of the insert fragment was verified through colony PCR and sequencing analysis.The NBS1 gene expression of NBS1 microRNA recombinants was detected by Real-Time PCR and western blot.Telomerase activity in Hela cells was assayed by TRAP-PCR-EB.Results:Sequences of insert fragment in microRNA expressing recombinants were correct.The NBS1 gene expression was decreased,and the telomerase activation of Hela cell reduced.Conclusion:NBS1 microRNA inhibits NBS1 gene expression,and depresses telomerase activation of Hela cells.This confirms that there is relevance between NBS1 gene and telomerase activity.

  20. GW182 proteins cause PABP dissociation from silenced miRNA targets in the absence of deadenylation.

    Science.gov (United States)

    Zekri, Latifa; Kuzuoğlu-Öztürk, Duygu; Izaurralde, Elisa

    2013-04-01

    GW182 family proteins interact with Argonaute proteins and are required for the translational repression, deadenylation and decay of miRNA targets. To elicit these effects, GW182 proteins interact with poly(A)-binding protein (PABP) and the CCR4-NOT deadenylase complex. Although the mechanism of miRNA target deadenylation is relatively well understood, how GW182 proteins repress translation is not known. Here, we demonstrate that GW182 proteins decrease the association of eIF4E, eIF4G and PABP with miRNA targets. eIF4E association is restored in cells in which miRNA targets are deadenylated, but decapping is inhibited. In these cells, eIF4G binding is not restored, indicating that eIF4G dissociates as a consequence of deadenylation. In contrast, PABP dissociates from silenced targets in the absence of deadenylation. PABP dissociation requires the interaction of GW182 proteins with the CCR4-NOT complex. Accordingly, NOT1 and POP2 cause dissociation of PABP from bound mRNAs in the absence of deadenylation. Our findings indicate that the recruitment of the CCR4-NOT complex by GW182 proteins releases PABP from the mRNA poly(A) tail, thereby disrupting mRNA circularization and facilitating translational repression and deadenylation. PMID:23463101

  1. MicroRNA-dependent development revealed by RNA interference-mediated gene silencing of LmDicer1 in the migratory locust

    Institute of Scientific and Technical Information of China (English)

    Yan-Li Wang; Mei-Ling Yang; Feng Jiang; Jian-Zhen Zhang; Le Kang

    2013-01-01

    MicroRNAs(miRNAs)are small noncoding RNAs,which participate in many biological processes.The small RNA transcriptome in the migratory locust has been characterized and 50 conserved miRNA families and 185 potential locust-specific miRNA family candidates have been identified using high-throughput sequencing.However,it is unclear whether miRNAs influence a wide variety of locusts' biological processes,such as growth or development.In insects,Dicer 1 ribonuclease transforms miRNA precursors into mature miRNAs.Thus,using systemic RNA interference(RNAi)to silence the expression of Dicerl in the migratory locust,Locusta migratoria,we reduced miRNA contents in the locust and disrupted two types of molt(nymph-nymph,and nymph-adult).The RNAi of LmDicerl also resulted in a high mortality in L.migratora.Our study revealed that LmDicerl was essential for miRNA regulation and development of L.migratoria.These results further support our notion that LmDicerl could serve as an excellent target for developing novel strategies for controlling this important insect pest.

  2. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    International Nuclear Information System (INIS)

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response

  3. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  4. Tritimovirus P1 functions as a suppressor of RNA silencing and an enhancer of disease symptoms

    Science.gov (United States)

    Wheat streak mosaic virus (WSMV) is an eriophyid mite-transmitted virus of the genus Tritimovirus, family Potyviridae. Complete deletion of HC-Pro has no effect on WSMV virulence or disease synergism, suggesting that a different viral protein suppresses post-transcriptional gene silencing (PTGS). PT...

  5. Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans

    Science.gov (United States)

    Imae, Rieko; Dejima, Katsufumi; Kage-Nakadai, Eriko; Arai, Hiroyuki; Mitani, Shohei

    2016-01-01

    RNA silencing signals in C. elegans spread among cells, leading to RNAi throughout the body. During systemic spread of RNAi, membrane trafficking is thought to play important roles. Here, we show that RNAi Spreading Defective-3 (rsd-3), which encodes a homolog of epsinR, a conserved ENTH (epsin N-terminal homology) domain protein, generally participates in cellular uptake of silencing RNA. RSD-3 is previously thought to be involved in systemic RNAi only in germ cells, but we isolated several deletion alleles of rsd-3, and found that these mutants are defective in the spread of silencing RNA not only into germ cells but also into somatic cells. RSD-3 is ubiquitously expressed, and intracellularly localized to the trans-Golgi network (TGN) and endosomes. Tissue-specific rescue experiments indicate that RSD-3 is required for importing silencing RNA into cells rather than exporting from cells. Structure/function analysis showed that the ENTH domain alone is sufficient, and membrane association of the ENTH domain is required, for RSD-3 function in systemic RNAi. Our results suggest that endomembrane trafficking through the TGN and endosomes generally plays an important role in cellular uptake of silencing RNA.

  6. The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Ling Yang

    2013-01-01

    Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

  7. A Signaling Cascade from miR444 to RDR1 in Rice Antiviral RNA Silencing Pathway.

    Science.gov (United States)

    Wang, Huacai; Jiao, Xiaoming; Kong, Xiaoyu; Hamera, Sadia; Wu, Yao; Chen, Xiaoying; Fang, Rongxiang; Yan, Yongsheng

    2016-04-01

    Plant RNA-DEPENDENT RNA POLYMERASE1 (RDR1) is a key component of the antiviral RNA-silencing pathway, contributing to the biogenesis of virus-derived small interfering RNAs. This enzyme also is responsible for producing virus-activated endogenous small interfering RNAs to stimulate the broad-spectrum antiviral activity through silencing host genes. The expression of RDR1 orthologs in various plants is usually induced by virus infection. However, the molecular mechanisms of activation of RDR1 expression in response to virus infection remain unknown. Here, we show that a monocot-specific microRNA, miR444, is a key factor in relaying the antiviral signaling from virus infection to OsRDR1 expression. The expression of miR444 is enhanced by infection with Rice stripe virus (RSV), and overexpression of miR444 improves rice (Oryza sativa) resistance against RSV infection accompanied by the up-regulation of OsRDR1 expression. We further show that three miR444 targets, the MIKC(C)-type MADS box proteins OsMADS23, OsMADS27a, and OsMADS57, form homodimers and heterodimers between them to repress the expression of OsRDR1 by directly binding to the CArG motifs of its promoter. Consequently, an increased level of miR444 diminishes the repressive roles of OsMADS23, OsMADS27a, and OsMADS57 on OsRDR1 transcription, thus activating the OsRDR1-dependent antiviral RNA-silencing pathway. We also show that overexpression of miR444-resistant OsMADS57 reduced OsRDR1 expression and rice resistance against RSV infection, and knockout of OsRDR1 reduced rice resistance against RSV infection. In conclusion, our results reveal a molecular cascade in the rice antiviral pathway in which miR444 and its MADS box targets directly control OsRDR1 transcription. PMID:26858364

  8. A novel sweet potato potyvirus open reading frame (ORF) is expressed via polymerase slippage and suppresses RNA silencing

    Science.gov (United States)

    Untiveros, Milton; Olspert, Allan; Artola, Katrin

    2016-01-01

    Summary The single‐stranded, positive‐sense RNA genome of viruses in the genus Potyvirus encodes a large polyprotein that is cleaved to yield 10 mature proteins. The first three cleavage products are P1, HCpro and P3. An additional short open reading frame (ORF), called pipo, overlaps the P3 region of the polyprotein ORF. Four related potyviruses infecting sweet potato (Ipomoea batatas) are predicted to contain a third ORF, called pispo, which overlaps the 3′ third of the P1 region. Recently, pipo has been shown to be expressed via polymerase slippage at a conserved GA6 sequence. Here, we show that pispo is also expressed via polymerase slippage at a GA6 sequence, with higher slippage efficiency (∼5%) than at the pipo site (∼1%). Transient expression of recombinant P1 or the ‘transframe’ product, P1N‐PISPO, in Nicotiana benthamiana suppressed local RNA silencing (RNAi), but only P1N‐PISPO inhibited short‐distance movement of the silencing signal. These results reveal that polymerase slippage in potyviruses is not limited to pipo expression, but can be co‐opted for the evolution and expression of further novel gene products. PMID:26757490

  9. Evidence for a piwi-dependent RNA silencing of the gypsy endogenous retrovirus by the Drosophila melanogaster flamenco gene.

    Science.gov (United States)

    Sarot, Emeline; Payen-Groschêne, Geneviève; Bucheton, Alain; Pélisson, Alain

    2004-03-01

    In Drosophila melanogaster, the endogenous retrovirus gypsy is repressed by the functional alleles (restrictive) of an as-yet-uncloned heterochromatic gene called flamenco. Using gypsy-lacZ transcriptional fusions, we show here that this repression takes place not only in the follicle cells of restrictive ovaries, as was previously observed, but also in restrictive larval female gonads. Analyses of the role of gypsy cis-regulatory sequences in the control of gypsy expression are also presented. They rule out the hypothesis that gypsy would contain a single binding region for a putative Flamenco repressor. Indeed, the ovarian expression of a chimeric yp3-lacZ construct was shown to become sensitive to the Flamenco regulation when any of three different 5'-UTR gypsy sequences (ranging from 59 to 647 nucleotides) was incorporated into the heterologous yp3-lacZ transcript. The piwi mutation, which is known to affect RNA-mediated homology-dependent transgene silencing, was also shown to impede the repression of gypsy in restrictive female gonads. Finally, a RNA-silencing model is also supported by the finding in ovaries of short RNAs (25-27 nucleotides long) homologous to sequences from within the gypsy 5'-UTR. PMID:15082550

  10. Silencing of MGMT with small interference RNA reversed resistance in human BCUN-resistant glioma cell lines

    Institute of Scientific and Technical Information of China (English)

    XIE Si-ming; FANG Mao; GUO Hui; ZHONG Xue-yun

    2011-01-01

    Background Our previous study had cloned two glioma cell lines SWOZ1 and SWOZ2 isolated from parental glioma cell line SWO38.The 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) resistance of SWOZ1 was higher than that of SWOZ2.Since O6-methylguanine-DNA methyltransferase (MGMT) was thought to be closely related to BCNU resistance in glioma,this study aimed to explore the function of MGMT in glioma resistant to BCNU.Methods A BCNU resistant glioma cell line SWOZ2-BCNU was established.The expression of MGMT was detected in SWOZ1,SWOZ2 and SWOZ2-BCNU.Small interferencing RNA targeting MGMT was used to silence the expression of MGMT in resistant cell lines SWOZ1 and SWOZ2-BCNU.The cytotoxicity of BCNU to these cells was measured using the cell counting kit-8 assay.Statistical analysis was carried out by one-way analysis of variance in statistical package SPSS 13.0.Results The resistance of SWOZ1 and SWOZ2-BCNU against BCNU was 4.9-fold and 5.3-fold higher than that of SWOZ2.The results of quantitative RT-PCR and Western blotting confirmed that MGMT was both significantly increased in SWOZ1 and SWOZ2-BCNU compared to SOWZ2.After transfection with small interferencing RNA targeting MGMT,a decreased level of MGMT mRNA expression in SWOZ1 and SWOZ2-BCNU for more than 75% compared to negative control was found and confirmed by Western blotting.As a result,the resistance against BCNU was reversed for about 50% both in the BCNU-resistant cell lines SWOZ1 and SWOZ2-BCNU.Conclusions Silencing MGMT with specific small interferencing RNA can reverse the BCNU resistant phenotype in these glioma cell lines.MGMT may play an important role both in intrinsic and acquired BCNU-resistance in glioma.

  11. Pentatricopeptide repeats: Modular blocks for building RNA-binding proteins

    OpenAIRE

    Filipovska, Aleksandra; Rackham, Oliver

    2013-01-01

    Pentatricopeptide repeat (PPR) proteins control diverse aspects of RNA metabolism across the eukaryotic domain. Recent computational and structural studies have provided new insights into how they recognize RNA, and show that the recognition is sequence-specific and modular. The modular code for RNA-binding by PPR proteins holds great promise for the engineering of new tools to target RNA and identifying RNAs bound by natural PPR proteins.

  12. Development of Nano- and Microparticle Technologies for Targeted Gene Silencing through RNA Interference Manipulation of the Immune Response in Inflammatory Lung Disease

    OpenAIRE

    Kelly, Ciara

    2011-01-01

    RNA Interference (RNAi) allows specific and potent knockdown of target genes and interest now lies beyond its use as a molecular biology tool and in its potential as a therapeutic to mediate gene silencing in diseased cells. Targeted local delivery of small interfering RNA (siRNA) to the lungs via inhalation offers a unique opportunity to treat a range of previously unbeatable or poorly controlled respiratory conditions. Alveolar macrophages are the first line of defence against inhaled toxin...

  13. RNA interference blocking the apoptosis in HEK293 cells induced by overexpression of alpha-synuclein

    Institute of Scientific and Technical Information of China (English)

    Tao Chen; Beisha Tang; Xiaoping Liao; Guoqiang Wen; Xinxiang Yan; Jifeng Guo; Yuhu Zhang; Feng Ouyang; Zhigang Long; Li Cao; Jing Li

    2009-01-01

    BACKGROUND: Overexpression of o-synuclein can induce cell apoptosis. RNA interference (RNAi)may block specific gene function and cause gene silencing.OBJECTIVE: To construct a specific and effective RNAi plasmid for the a-synuclein gene and investigate if RNAi can block apoptosis in HEK293 cells, induced by overexpression of wild-type α-synuclein.DESIGN, TIME AND SETTING: A contrast experiment based on genetically engineered cytobiology was performed at the State Key Lab of Medical Genetics of China, Xiangya Medical College of Central South University, between October 2004 and October 2008.MATERIALS: HEK293 cells and pBSHH1 plasmid were provided by the State Key Lab of Medical Genetics of China; OligDNA sequence by Sagon Bioengineering Company, Shanghai;Lipofectamine 2000 by Invitrogen, USA;α-synuclein monoclonal antibody, Hoechst 33258, and MTT by Sigma, USA; Horseradish peroxidase-coupled goat anti-rat luG by KPL, USA; FACSan flow cytometry by BD, USA.METHODS: Four target sites were used to construct hairpin RNA pBSHH1 vectors-pSYNi-1,pSYNi-2, pSYNi-3 and pSYNi-4-which were cloned in the pBSHH1 plasmid. HEK293 cells were transfected using Lipofectamine 2000. In addition, a non-transfect group and a negative plasmid transfect group were established. The cultured HEK293 cells were processed as follows:transfection of blank plasmid (blank control group), transfection of α-synuclein-pEGFP and RNAi negative vector (negative control group), and transfection of a-synuclein-pEGFP and pSYNi-1 (transfection group). Cells in all groups were transfected with Lipofectamine 2000 for 48 hours.MAIN OUTCOME MEASURES: Expression of α-synuclein mRNA and protein were detected by RT-PCR and Western blot. Cell morphology was observed under an inverted fluorescence microscope; cell viability was measured using MTT method; and cell apoptosis was determined with Annexin V-PE flow cytometry.RESULTS: a-synuclein mRNA and protein expressions were significantly decreased in the pSYNi-1

  14. Gene silencing of HIV chemokine receptors using ribozymes and single-stranded antisense RNA.

    Science.gov (United States)

    Qureshi, Amer; Zheng, Richard; Parlett, Terry; Shi, Xiaoju; Balaraman, Priyadhashini; Cheloufi, Sihem; Murphy, Brendan; Guntermann, Christine; Eagles, Peter

    2006-03-01

    The chemokine receptors CXCR4 and CCR5 are required for HIV-1 to enter cells, and the progression of HIV-1 infection to AIDS involves a switch in the co-receptor usage of the virus from CCR5 to CXCR4. These receptors therefore make attractive candidates for therapeutic intervention, and we have investigated the silencing of their genes by using ribozymes and single-stranded antisense RNAs. In the present study, we demonstrate using ribozymes that a depletion of CXCR4 and CCR5 mRNAs can be achieved simultaneously in human PBMCs (peripheral blood mononuclear cells), cells commonly used by the virus for infection and replication. Ribozyme activity leads to an inhibition of the cell-surface expression of both CCR5 and CXCR4, resulting in a significant inhibition of HIV-1 replication when PBMCs are challenged with the virus. In addition, we show that small single-stranded antisense RNAs can also be used to silence CCR5 and CXCR4 genes when delivered to PBMCs. This silencing is caused by selective degradation of receptor mRNAs. PMID:16293105

  15. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  16. Gene silencing of the tick protective antigens, Bm86, Bm91 and subolesin, in the one-host tick Boophilus microplus by RNA interference

    OpenAIRE

    Nijhof, A. M.; Taoufik, A.; de la Fuente, M.R.; Kocan, K M; de Vries, E; Jongejan, F

    2007-01-01

    The use of RNA interference (RNAi) to assess gene function has been demonstrated in several three-host tick species but adaptation of RNAi to the one-host tick, Boophilus microplus, has not been reported. We evaluated the application of RNAi in B. microplus and the effect of gene silencing on three tick-protective antigens: Bm86, Bm91 and subolesin. Gene-specific double-stranded (dsRNA) was injected into two tick stages, freshly molted unfed and engorged females, and specific gene silencing w...

  17. Antiviral RNA Silencing Is Restricted to the Marginal Region of the Dark Green Tissue in the Mosaic Leaves of Tomato Mosaic Virus-Infected Tobacco Plants▿

    OpenAIRE

    Hirai, Katsuyuki; Kubota, Kenji; Mochizuki, Tomofumi; Tsuda, Shinya; Meshi, Tetsuo

    2008-01-01

    Mosaic is a common disease symptom caused by virus infection in plants. Mosaic leaves of Tomato mosaic virus (ToMV)-infected tobacco plants consist of yellow-green and dark green tissues that contain large and small numbers of virions, respectively. Although the involvement of RNA silencing in mosaic development has been suggested, its role in the process that results in an uneven distribution of the virus is unknown. Here, we investigated whether and where ToMV-directed RNA silencing was est...

  18. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Directory of Open Access Journals (Sweden)

    Justine M Pompey

    Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  19. Investigation of siRNA Nanoparticle Formation Using Mono-Cationic Detergents and Its Use in Gene Silencing in Human HeLa Cells

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Yuma; Suzuki, Ryosuke; Harashima, Hideyoshi, E-mail: harashima@pharm.hokudai.ac.jp [Laboratory for Molecular Design of Pharmaceutics, Faculty of Pharmaceutical Sciences, Hokkaido University, Kita-12, Nishi-6, Kita-ku, Sapporo 060-0812 (Japan)

    2013-11-01

    The focus of recent research has been on the development of siRNA vectors to achieve an innovative gene therapy. Most of the conventional vectors are siRNA nanoparticles complexed with cationic polymers and liposomes, making it difficult to release siRNA. In this study, we report on the use of MCD, a quaternary ammonium salt detergent containing a long aliphatic chain (L-chain) as an siRNA complexation agent using human HeLa cells (a model cancer cell). We prepared siRNA nanoparticles using various MCDs, and measured the diameters and zeta-potentials of the particles. The use of an MCD with a long L-chain resulted in the formation of a positively charged nanoparticle. In contrast, a negatively charged nanoparticle was formed when a MCD with a short L-chain was used. We next evaluated the gene silencing efficiency of the nanoparticles using HeLa cells expressing the luciferase protein. The results showed that the siRNA/MCD nanoparticles showed a higher gene silencing efficiency than Lipofectamine 2000. We also found that the efficiency of gene silencing is a function of the length of the alkyl chain in MCD and zeta-potential of the siRNA/MCD nanoparticles. Such information provides another viewpoint for designing siRNA vectors.

  20. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Science.gov (United States)

    Pompey, Justine M; Foda, Bardees; Singh, Upinder

    2015-01-01

    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway. PMID:26230096

  1. Investigation of siRNA Nanoparticle Formation Using Mono-Cationic Detergents and Its Use in Gene Silencing in Human HeLa Cells

    International Nuclear Information System (INIS)

    The focus of recent research has been on the development of siRNA vectors to achieve an innovative gene therapy. Most of the conventional vectors are siRNA nanoparticles complexed with cationic polymers and liposomes, making it difficult to release siRNA. In this study, we report on the use of MCD, a quaternary ammonium salt detergent containing a long aliphatic chain (L-chain) as an siRNA complexation agent using human HeLa cells (a model cancer cell). We prepared siRNA nanoparticles using various MCDs, and measured the diameters and zeta-potentials of the particles. The use of an MCD with a long L-chain resulted in the formation of a positively charged nanoparticle. In contrast, a negatively charged nanoparticle was formed when a MCD with a short L-chain was used. We next evaluated the gene silencing efficiency of the nanoparticles using HeLa cells expressing the luciferase protein. The results showed that the siRNA/MCD nanoparticles showed a higher gene silencing efficiency than Lipofectamine 2000. We also found that the efficiency of gene silencing is a function of the length of the alkyl chain in MCD and zeta-potential of the siRNA/MCD nanoparticles. Such information provides another viewpoint for designing siRNA vectors

  2. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    Directory of Open Access Journals (Sweden)

    Anesti Anna-Maria

    2010-09-01

    Full Text Available Abstract Background Delivery of small interfering RNA (siRNA to tumours remains a major obstacle for the development of RNA interference (RNAi-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA or artificial microRNA (miRNA against the reporter genes green fluorescent protein (eGFP and β-galactosidase (lacZ. These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen

  3. Specific degradation of 3' regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5'-3' spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina;

    2002-01-01

    Target regions for posttranscriptional silencing of transgenes often reside in the 3' region of the coding sequence, although there are exceptions. To resolve if the target region is determined by the gene undergoing silencing rather than by the structure of the transgene loci or the plant genetic...... coding region but upstream of the last 200 nt. The quantities of small (21-25 nt) RNAs homologous to 5' or 3' regions of the GUS coding sequence were found to correlate approximately with the target strength of the corresponding regions. These results suggest that transgene locus structure and plant...... can act as efficient inducers as well as targets of posttranscriptional silencing, although the 3' region is the predominant target region in the spontaneously silencing transgenic plant lines examined. Finally, we investigated spreading of the target region in the N. benthamiana plants undergoing...

  4. Assembling Mn:ZnSe quantum dots-siRNA nanoplexes for gene silencing in tumor cells.

    Science.gov (United States)

    Wang, Yucheng; Yang, Chengbin; Hu, Rui; Toh, Hui Ting; Liu, Xin; Lin, Guimiao; Yin, Feng; Yoon, Ho Sup; Yong, Ken-Tye

    2015-01-01

    In this work, we demonstrate the use of manganese doped zinc selenide QDs (Mn:ZnSe d-dots) for gene delivery in vitro. Specifically, the d-dots were prepared as nanoplexes for facilitating the intracellular delivery of small interfering RNA (siRNA) molecules to pancreatic cancer cells (Panc-1), thereby inducing sequence-specific silencing of oncogenic K-Ras mutations in pancreatic carcinoma. For nanoplex preparation, a layer-by-layer (LBL) assembling method was adopted to modify the d-dot surface with cationic polymer poly(allylamine hydrochloride) (PAH) or polyethylenimine (PEI) for generating positive surface potential for complexing with K-Ras siRNA molecules. Owing to the unique and stable PL properties of the d-dots, siRNA transfection and the subsequent intracellular release profile from the d-dot/polymer-siRNA nanoplexes were monitored by fluorescence imaging. Quantitative results from flow cytometry study suggested that a high gene transfection efficiency was achieved. The expression of the mutant K-Ras mRNA in Panc-1 cells was observed to be significantly suppressed upon transfecting them with the nanoplex formulation. More importantly, cell viability studies showed that the d-dot/PAH nanoplexes were biocompatible and non-toxic even at concentrations as high as 160 μg mL(-1). Furthermore, the amine-terminated surface could be further modified to obtain multiple bio-functions. Based on these results, we envision that the designed d-dot nanoplexes can be developed as a flexible nanoplatform for both fundamental and practical clinical research applications. PMID:26214202

  5. Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

    Czech Academy of Sciences Publication Activity Database

    Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

    2011-01-01

    Roč. 6, č. 5 (2011), s. 650-660. ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant ostatní: GA ČR(CZ) GPP501/11/P667 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

  6. Graft-transmitted siRNA signal from the root induces visual manifestation of endogenous post-transcriptional gene silencing in the scion.

    Directory of Open Access Journals (Sweden)

    Atsushi Kasai

    Full Text Available In plants, post-transcriptional gene silencing (PTGS spreads systemically, being transmitted from the silenced stock to the scion expressing the corresponding transgene. It has been reported that a graft-transmitted siRNA signal can also induce PTGS of an endogenous gene, but this was done by top-grafting using silenced stock. In the present study involving grafting of Nicotiana benthamiana, we found that PTGS of an endogenous gene, glutamate-1-semialdehyde aminotransferase (GSA, which acts as a visible marker of RNAi via inhibition of chlorophyll synthesis, was manifested along the veins of newly developed leaves in the wild-type scion by the siRNA signal synthesized only in companion cells of the rootstock.

  7. Two virus-encoded RNA silencing suppressors, P14 of Beet necrotic yellow vein virus and S6 of Rice black streak dwarf virus

    Institute of Scientific and Technical Information of China (English)

    ZHANG Lingdi; WANG Zhaohui; WANG Xianbing; LI Dawei; HAN Chenggui; ZHAI Yafeng; YU Jialin

    2005-01-01

    Functional analysis for gene silencing suppressor of P14 gene of Beet necrotic yellow vein virus and S6 gene of Rice black streak dwarf virus was carried out by agro- infiltration with recombinant vectors of Potato virus X. The phenotype observation of green fluorescent protein (GFP) expression and Northern blot showed that the gene silencing of gfp transgenic Nicotiana benthamiana induced by homologous sequence was strongly suppressed by the immixture infiltration of either the P14 or the S6. In the suppressed plants, the gfp mRNA accumulation was higher than that in the non-suppressed controls and the symptoms caused by PVX infection became more severe, especially the gfp DNA methylation of plant genome was significantly inhabited when co-infiltrated with RBSDV S6 gene. These results suggested that these two virus genes were potentially to encode for proteins as RNA silencing suppressors.

  8. Virus-induced gene silencing of the RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana.

    Science.gov (United States)

    Nemchinov, Lev G; Boutanaev, Alexander M; Postnikova, Olga A

    2016-01-01

    In eukaryotic cells, RNA polymerase III is highly conserved and transcribes housekeeping genes such as ribosomal 5S rRNA, tRNA and other small RNAs. The RPC5-like subunit is one of the 17 subunits forming RNAPIII and its exact functional roles in the transcription are poorly understood. In this work, we report that virus-induced gene silencing of transcripts encoding a putative RPC5-like subunit of the RNA Polymerase III in a model species Nicotiana benthamiana had pleiotropic effects, including but not limited to severe dwarfing appearance, chlorosis, nearly complete reduction of internodes and abnormal leaf shape. Using transcriptomic analysis, we identified genes and pathways affected by RPC5 silencing and thus presumably related to the cellular roles of the subunit as well as to the downstream cascade of reactions in response to partial loss of RNA Polymerase III function. Our results suggest that silencing of the RPC5L in N. benthamiana disrupted not only functions commonly associated with the core RNA Polymerase III transcripts, but also more diverse cellular processes, including responses to stress. We believe this is the first demonstration that activity of the RPC5 subunit is critical for proper functionality of RNA Polymerase III and normal plant development. PMID:27282827

  9. The ability of PVX p25 to form RL structures in plant cells is necessary for its function in movement, but not for its suppression of RNA silencing.

    Directory of Open Access Journals (Sweden)

    Fei Yan

    Full Text Available The p25 triple gene block protein of Potato virus X (PVX is multifunctional, participating in viral movement and acting as a suppressor of RNA silencing. The cell-to-cell movement of PVX is known to depend on the suppression function of p25. GFP-fused p25 accumulates in rod-like (RL structures with intense fluorescence in cells. By monitoring the location of fluorescence at different times, we have now shown that the RL structure is composed of filaments. P25 mutants without the conditional ability to recover movement function could not form RL structures while the mutants that had the ability did form the structure, suggesting that the ability of p25 to form RL structures is necessary for its function in cell-to-cell movement, but not for its suppressor function. Moreover, chemical inhibition of microfilaments in cells destroyed the formation of the complete RL structure. Additionally, TGBp2 and TGBp3 were recruited into the RL structure, suggesting a relationship between the TGBps in virus movement.

  10. MicroRNA silencing and the development of novel therapies for liver disease

    OpenAIRE

    Szabo, Gyongyi; Sarnow, Peter; Bala, Shashi

    2012-01-01

    In recent years microRNAs have emerged as crucial small non-coding RNA molecules with diverse roles in various diseases including diseases of the liver. In this review, we highlight the latest advances in the field of microRNA biology and their potential as emerging therapeutic targets in liver disease.

  11. Small interfering RNA in silencing Bcl-2 expression and enhancing radiosensitivity of esophageal cancer cells

    International Nuclear Information System (INIS)

    Objective: To explore the effects of small interfering RNA (siRNA) specific to Bcl-2 gene on radiosensitivity of esophageal cancer cells. Methods: Bcl-2 gene siRNA ( Bcl-2 siRNA ) was induced into esophageal cancer EC9706 cells by lipofectamine. Bcl-2 protein expression and apoptosis of EC9706 cells were detected by flowcytometer. Clone forming assay was used to determine the inhibitory effects of X-ray radiation combined with Bcl-2 siRNA interference. Results: When Bcl-2 siRNA had been induced into EC9706 cells, Bcl-2 protein expression in EC9706 cells was inhibited, and cell apoptosis was increased. Bcl-2 protein expression rates of EC9706 cells induced with Bcl-2 siRNA1, A2, A3 (25.13% ±2.04%, 8.87% ± 3.34%, 30.55% ± 2.73%) were lower than the control group (84.28% ± 1.47%)(t =4.01, 3.043.64, P 0, Dq, and SF2 of combined treatment group were much lower than those of irradiation alone group . The sensitization enhancing ratio was 1.32 (ratio of D0 values). Conclusions: Bcl-2 gene siRNA could enhance the radiosensitivity of esophageal cancer EC9706 cells and may has a good future in clinical practice. (authors)

  12. Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection

    DEFF Research Database (Denmark)

    Lanford, Robert E; Hildebrandt-Eriksen, Elisabeth S; Petri, Andreas; Persson, Robert; Lindow, Morten; Munk, Martin E; Kauppinen, Sakari; Ørum, Henrik

    2010-01-01

    The liver-expressed microRNA-122 (miR-122) is essential for hepatitis C virus (HCV) RNA accumulation in cultured liver cells, but its potential as a target for antiviral intervention has not been assessed. We found that treatment of chronically infected chimpanzees with a locked nucleic acid (LNA...

  13. CTLA4 Silencing with siRNA Promotes Deviation of Th1/Th2 in Chronic Hepatitis B Patients

    Institute of Scientific and Technical Information of China (English)

    Yongsheng Yu; Hao Wu; Zhenghao Tang; Guoqing Zang

    2009-01-01

    To determine whether RNA interference (RNAi) could block cytotoxic T-lymphocyte antigen 4 (CTLA4) in human lymphocytes in vitro and promote IFN-γ and IL-2 secretions, three small interfering RNAs (siRNAs) were selected based on target specificity sequences of human CTLA4 and transfected into human lymphocytes of chronic HBV patients. As a result, the expression of human CTLA4 mRNA was efficiently suppressed by all the three siRNAs. Compared with negative control (siRNA-co), siRNA-1 inhibited the expression of CTLA4 most efficiently and was used in the further study. The expressions of IFN-γ and IL-2 were upregulated and the level of IL-4 was almost unchanged in lymphocytes transfected with siRNA-1 compared with the blank control. These results indicated that siRNA-1 led to IFN-γ and IL-2 secretions, which is a main response of Th1/Th2. In a conclusion, RNAi significantly suppressed the expression of human CTLA4 mRNA in human lymphocytes in vitro, and could induce Th1/Th2 response. It could be a new therapeutic strategy for chronic HBV infection. Cellular & Molecular Immunology.

  14. Carbon nanotube-mediated siRNA delivery for gene silencing in cancer cells

    Science.gov (United States)

    Hong, Tu; Guo, Honglian; Xu, Yaqiong

    2011-10-01

    Small interfering RNA (siRNA) is potentially a promising tool in influencing gene expression with a high degree of target specificity. However, its poor intracellular uptake, instability in vivo, and non-specific immune stimulations impeded its effect in clinical applications. In this study, carbon nanotubes (CNTs) functionalized with two types of phospholipid-polyethylene glycol (PEG) have shown capabilities to stabilize siRNA in cell culture medium during the transfection and efficiently deliver siRNA into neuroblastoma and breast cancer cells. Moreover, the intrinsic optical properties of CNTs have been investigated through absorption and fluorescence measurements. We have found that the directly-functionalized groups play an important role on the fluorescence imaging of functionalized CNTs. The unique fluorescence imaging and high delivery efficiency make CNTs a promising material to deliver drugs and evaluate the treatment effect simultaneously.

  15. Design of potential siRNA molecules for hepatitis delta virus gene silencing

    OpenAIRE

    Singh, Sarita; Gupta, Sunil Kumar; Nischal, Anuradha; Khattri, Sanjay; Nath, Rajendra; Pant, Kamlesh Kumar; Seth, Prahlad Kishore

    2012-01-01

    Hepatitis D is a liable reason of mortality and morbidity worldwide. It is caused by an RNA virus known as Hepatitis Delta Virus (HDV). Genetic studies of HDV have shown that delta antigen protein is responsible for replication of genome and play a foremost role in viral infection. Therefore, delta antigen protein may be used as suitable target for disease diagnosis. Viral activity can be restrained through RNA interference (RNAi) technology, an influential method for post transcriptional gen...

  16. Synthetic Polymer Hybridization with DNA and RNA Directs Nanoparticle Loading, Silencing Delivery, and Aptamer Function

    OpenAIRE

    Zhou, Zhun; Xia, Xin; Bong, Dennis

    2015-01-01

    We report herein discrete triplex hybridization of DNA and RNA with polyacrylates. Length-monodisperse triazine-derivatized polymers were prepared on gram-scale by reversible addition–fragmentation chain-transfer polymerization. Despite stereoregio backbone heterogeneity, the triazine polymers bind T/U-rich DNA or RNA with nanomolar affinity upon mixing in a 1:1 ratio, as judged by thermal melts, circular dichroism, gel-shift assays, and fluorescence quenching. We call these polyacrylates “bi...

  17. Silencing of Long Non-Coding RNA MALAT1 Promotes Apoptosis of Glioma Cells.

    Science.gov (United States)

    Xiang, Jianping; Guo, Shifeng; Jiang, Shuling; Xu, Yuelong; Li, Jiwei; Li, Li; Xiang, Jinyu

    2016-05-01

    The metastasis-associated lung adenocarcinoma transcription 1 (MALAT1) is a highly conserved long non-coding RNA (lncRNA) gene. However, little is known about the pathological role of lncRNA MALAT1 in glioma. In the present study, we explored the expression level of lncRNA MALAT1 in primary glioma tissues as well as in U87 and U251 glioma cell lines. Using qRT-PCR, we found that the expression of lncRNA MALAT1 was significantly increased in glioma tissues compared with that of paracancerous tissues. Meanwhile, the expression of MALAT1 was highly expressed in U98 and U251 cells. In order to explore the function of MALAT1, the expression of MALAT1 was greatly reduced in U87 and U251 cells transfected with siRNA specifically targeting MALAT1. Consequently, cell viability of U87 and U251 cells were drastically decreased after the knockdown of MALAT1. Concomitantly, the apoptosis rate of the two cell lines was dramatically increased. Furthermore, the expression levels of some tumor markers were reduced after the knockdown of MALAT1, such as CCND1 and MYC. In summary, the current study indicated a promoting role of MALAT1 in the development of glioma cell. PMID:27134488

  18. Resistance to Sri Lankan Cassava Mosaic Virus (SLCMV) in Genetically Engineered Cassava cv. KU50 through RNA Silencing

    KAUST Repository

    Ntui, Valentine Otang

    2015-04-22

    Cassava ranks fifth among the starch producing crops of the world, its annual bioethanol yield is higher than for any other crop. Cassava cultivar KU50, the most widely grown cultivar for non-food purposes is susceptible to Sri Lankan cassava mosaic virus (SLCMV). The objective of this work was to engineer resistance to SLCMV by RNA interference (RNAi) in order to increase biomass yield, an important aspect for bioethanol production. Here, we produced transgenic KU50 lines expressing dsRNA homologous to the region between the AV2 and AV1 of DNA A of SLCMV. High level expression of dsRNA of SLCMV did not induce any growth abnormality in the transgenic plants. Transgenic lines displayed high levels of resistance to SLCMV compared to the wild-type plants and no virus load could be detected in uninoculated new leaves of the infected resistant lines after PCR amplification and RT-PCR analysis. The agronomic performance of the transgenic lines was unimpaired after inoculation with the virus as the plants presented similar growth when compared to the mock inoculated control plants and revealed no apparent reduction in the amount and weight of tubers produced. We show that the resistance is correlated with post-transcriptional gene silencing because of the production of transgene specific siRNA. The results demonstrate that transgenic lines exhibited high levels of resistance to SLCMV. This resistance coupled with the desirable yield components in the transgenic lines makes them better candidates for exploitation in the production of biomass as well as bioethanol.

  19. Resistance to Sri Lankan cassava mosaic virus (SLCMV in genetically engineered cassava cv. KU50 through RNA silencing.

    Directory of Open Access Journals (Sweden)

    Valentine Otang Ntui

    Full Text Available Cassava ranks fifth among the starch producing crops of the world, its annual bioethanol yield is higher than for any other crop. Cassava cultivar KU50, the most widely grown cultivar for non-food purposes is susceptible to Sri Lankan cassava mosaic virus (SLCMV. The objective of this work was to engineer resistance to SLCMV by RNA interference (RNAi in order to increase biomass yield, an important aspect for bioethanol production. Here, we produced transgenic KU50 lines expressing dsRNA homologous to the region between the AV2 and AV1 of DNA A of SLCMV. High level expression of dsRNA of SLCMV did not induce any growth abnormality in the transgenic plants. Transgenic lines displayed high levels of resistance to SLCMV compared to the wild-type plants and no virus load could be detected in uninoculated new leaves of the infected resistant lines after PCR amplification and RT-PCR analysis. The agronomic performance of the transgenic lines was unimpaired after inoculation with the virus as the plants presented similar growth when compared to the mock inoculated control plants and revealed no apparent reduction in the amount and weight of tubers produced. We show that the resistance is correlated with post-transcriptional gene silencing because of the production of transgene specific siRNA. The results demonstrate that transgenic lines exhibited high levels of resistance to SLCMV. This resistance coupled with the desirable yield components in the transgenic lines makes them better candidates for exploitation in the production of biomass as well as bioethanol.

  20. Hydrophobic interactions between polymeric carrier and palmitic acid-conjugated siRNA improve PEGylated polyplex stability and enhance in vivo pharmacokinetics and tumor gene silencing.

    Science.gov (United States)

    Sarett, Samantha M; Werfel, Thomas A; Chandra, Irene; Jackson, Meredith A; Kavanaugh, Taylor E; Hattaway, Madison E; Giorgio, Todd D; Duvall, Craig L

    2016-08-01

    Formation of stable, long-circulating siRNA polyplexes is a significant challenge in translation of intravenously-delivered, polymeric RNAi cancer therapies. Here, we report that siRNA hydrophobization through conjugation to palmitic acid (siPA) improves stability, in vivo pharmacokinetics, and tumor gene silencing of PEGylated nanopolyplexes (siPA-NPs) with balanced cationic and hydrophobic content in the core relative to the analogous polyplexes formed with unmodified siRNA, si-NPs. Hydrophobized siPA loaded into the NPs at a lower charge ratio (N(+):P(-)) relative to unmodified siRNA, and siPA-NPs had superior resistance to siRNA cargo unpackaging in comparison to si-NPs upon exposure to the competing polyanion heparin and serum. In vitro, siPA-NPs increased uptake in MDA-MB-231 breast cancer cells (100% positive cells vs. 60% positive cells) but exhibited equivalent silencing of the model gene luciferase relative to si-NPs. In vivo in a murine model, the circulation half-life of intravenously-injected siPA-NPs was double that of si-NPs, resulting in a >2-fold increase in siRNA biodistribution to orthotopic MDA-MB-231 mammary tumors. The increased circulation half-life of siPA-NPs was dependent upon the hydrophobic interactions of the siRNA and the NP core component and not just siRNA hydrophobization, as siPA did not contribute to improved circulation time relative to unmodified siRNA when delivered using polyplexes with a fully cationic core. Intravenous delivery of siPA-NPs also achieved significant silencing of the model gene luciferase in vivo (∼40% at 24 h after one treatment and ∼60% at 48 h after two treatments) in the murine MDA-MB-231 tumor model, while si-NPs only produced a significant silencing effect after two treatments. These data suggest that stabilization of PEGylated siRNA polyplexes through a combination of hydrophobic and electrostatic interactions between siRNA cargo and the polymeric carrier improves in vivo pharmacokinetics and

  1. Silencing MicroRNA-155 Attenuates Cardiac Injury and Dysfunction in Viral Myocarditis via Promotion of M2 Phenotype Polarization of Macrophages.

    Science.gov (United States)

    Zhang, Yingying; Zhang, Mengying; Li, Xueqin; Tang, Zongsheng; Wang, Xiangmin; Zhong, Min; Suo, Qifeng; Zhang, Yao; Lv, Kun

    2016-01-01

    Macrophage infiltration is a hallmark feature of viral myocarditis. As studies have shown that microRNA-155 regulates the differentiation of macrophages, we aimed to investigate the role of microRNA-155 in VM. We report that silencing microRNA-155 protects mice from coxsackievirus B3 induced myocarditis. We found that microRNA-155 expression was upregulated and localized primarily in heart-infiltrating macrophages and CD4(+) T lymphocytes during acute myocarditis. In contrast with wildtype (WT) mice, microRNA-155(-/-) mice developed attenuated viral myocarditis, which was characterized by decreased cardiac inflammation and decreased intracardiac CD45(+) leukocytes. Hearts of microRNA-155(-/-) mice expressed decreased levels of the IFN-γ and increased levels of the cytokines IL-4 and IL-13. Although total CD4(+) and regulatory T cells were unchanged in miR-155(-/-) spleen proportionally, the activation of T cells and CD4(+) T cell proliferation in miR-155(-/-) mice were significantly decreased. Beyond the acute phase, microRNA-15(5-/-) mice had reduced mortality and improved cardiac function during 5 weeks of follow-up. Moreover, silencing microRNA-155 led to increased levels of alternatively-activated macrophages (M2) and decreased levels of classically-activated macrophages (M1) in the heart. Combined, our studies suggest that microRNA-155 confers susceptibility to viral myocarditis by affecting macrophage polarization, and thus may be a potential therapeutic target for viral myocarditis. PMID:26931072

  2. Differential RNA silencing suppression activity of NS1 proteins from different influenza A virus strains

    NARCIS (Netherlands)

    W. de Vries; J. Haasnoot; R. Fouchier; P. de Haan; B. Berkhout

    2009-01-01

    The NS1 gene of influenza A virus encodes a multi-functional protein that plays an important role in counteracting cellular antiviral mechanisms such as the interferon (IFN), protein kinase R and retinoic acid-inducible gene product I pathways. In addition, NS1 has recently been shown to have RNA in

  3. Viral RNA Silencing Suppressors (RSS): Novel Strategy of Viruses to Ablate the Host RNA Interference (RNAi) Defense System

    OpenAIRE

    Bivalkar-Mehla, Shalmali; Vakharia, Janaki; Mehla, Rajeev; Abreha, Measho; Kanwar, Jagat Rakesh; Tikoo, Akshay; Chauhan, Ashok

    2010-01-01

    Pathogenic viruses have developed a molecular defense arsenal for their survival by counteracting the host anti-viral system known as RNA interference (RNAi). Cellular RNAi, in addition to regulating gene expression through microRNAs, also serves as a barrier against invasive foreign nucleic acids. RNAi is conserved across the biological species, including plants, animals and invertebrates. Viruses in turn, have evolved mechanisms that can counteract this anti-viral defense of the host. Recen...

  4. Enhanced salt sensitivity following shRNA silencing of neuronal TRPV1 in rat spinal cord

    Institute of Scientific and Technical Information of China (English)

    Shuang-quan YU; Donna H WANG

    2011-01-01

    Aim: To investigate the effects of selective knockdown of TRPV1 channels in the lower thoracic and upper lumbar segments of spinal cord, dorsal root ganglia (DRG) and me senteric arteries on rat blood pressure responses to high salt intake.Methods: TRPV1 short-hairpin RNA (shRNA) was delivered using intrathecal injection (6 μg.kg1-d-1, for 3 d). Levels of TRPV1 and tyrosine hydroxylase expression were determined by Western blot analysis. Systolic blood pressure and mean arterial pressure (MAP) were examined using tail-cuff and direct arterial measurement, respectively.Results: In rats injected with control shRNA, high-salt diet (HS) caused higher systolic blood pressure compared with normal-salt diet(NS) (HS:149±4 mmHg; NS:126±2 mmHg, P<0.05). Intrathecal injection of TRPV1 shRNA significantly increased the systolic blood pressure in both HS rats and NS rats (HS:169±3 mmHg; NS:139±2 mmHg). The increases was greater in HS rats than in NS rats (HS:13.9%±1.8%; NS: 9.8±0.7, P<0.05). After TRPV1 shRNA treatment, TRPV1 expression in the dorsal horn and DRG of T8-L3 segments and in mesenteric arteries was knocked down to a greater extent in HS rats compared with NS rats. Blockade of α1-adrenoceptors abolished the TRPV1 shRNA-induced pressor effects. In rats injected with TRPV1 shRNA, level of tyrosine hydroxylase in mesenteric arteries was increased to a greater extent in HS rats compared with NS rats.Conclusion: Selective knockdown of TRPV1 expression in the lower thoracic and upper lumbar segments of spinal cord, DRG, and mesenteric arteries enhanced the prohypertensive effects of high salt intake, suggesting that TRPV1 channels in these sites protect against increased salt sensitivity, possibly via suppression of sympatho-excitatory responses.

  5. Knockdown of TFIIS by RNA silencing inhibits cancer cell proliferation and induces apoptosis

    International Nuclear Information System (INIS)

    A common element among cancer cells is the presence of improperly controlled transcription. In these cells, the degree of specific activation of some genes is abnormal, and altering the aberrant transcription may therefore directly target cancer. TFIIS is a transcription elongation factor, which directly binds the transcription motor, RNA Polymerase II and allows it to read through various transcription arrest sites. We report on RNA interference of TFIIS, a transcription elongation factor, and its affect on proliferation of cancer cells in culture. RNA interference was performed by transfecting siRNA to specifically knock down TFIIS expression in MCF7, MCF10A, PL45 and A549 cells. Levels of TFIIS expression were determined by the Quantigene method, and relative protein levels of TFIIS, c-myc and p53 were determined by C-ELISA. Induction of apoptosis was determined by an enzymatic Caspase 3/7 assay, as well as a non-enzymatic assay detecting cytoplasmic mono- and oligonucleosomes. A gene array analysis was conducted for effects of TFIIS siRNA on MCF7 and MCF10A cell lines. Knockdown of TFIIS reduced cancer cell proliferation in breast, lung and pancreatic cancer cell lines. More specifically, TFIIS knockdown in the MCF7 breast cancer cell line induced cancer cell death and increased c-myc and p53 expression whereas TFIIS knockdown in the non-cancerous breast cell line MCF10A was less affected. Differential effects of TFIIS knockdown in MCF7 and MCF10A cells included the estrogenic, c-myc and p53 pathways, as observed by C-ELISA and gene array, and were likely involved in MCF7 cell-death. Although transcription is a fundamental process, targeting select core transcription factors may provide for a new and potent avenue for cancer therapeutics. In the present study, knockdown of TFIIS inhibited cancer cell proliferation, suggesting that TFIIS could be studied as a potential cancer target within the transcription machinery

  6. APC/C-mediated degradation of dsRNA-binding protein 4 (DRB4 involved in RNA silencing.

    Directory of Open Access Journals (Sweden)

    Katia Marrocco

    Full Text Available BACKGROUND: Selective protein degradation via the ubiquitin-26S proteasome is a major mechanism underlying DNA replication and cell division in all Eukaryotes. In particular, the APC/C (Anaphase Promoting Complex or Cyclosome is a master ubiquitin protein ligase (E3 that targets regulatory proteins for degradation allowing sister chromatid separation and exit from mitosis. Interestingly, recent work also indicates that the APC/C remains active in differentiated animal and plant cells. However, its role in post-mitotic cells remains elusive and only a few substrates have been characterized. METHODOLOGY/PRINCIPAL FINDINGS: In order to identify novel APC/C substrates, we performed a yeast two-hybrid screen using as the bait Arabidopsis APC10/DOC1, one core subunit of the APC/C, which is required for substrate recruitment. This screen identified DRB4, a double-stranded RNA binding protein involved in the biogenesis of different classes of small RNA (sRNA. This protein interaction was further confirmed in vitro and in plant cells. Moreover, APC10 interacts with DRB4 through the second dsRNA binding motif (dsRBD2 of DRB4, which is also required for its homodimerization and binding to its Dicer partner DCL4. We further showed that DRB4 protein accumulates when the proteasome is inactivated and, most importantly, we found that DRB4 stability depends on APC/C activity. Hence, depletion of Arabidopsis APC/C activity by RNAi leads to a strong accumulation of endogenous DRB4, far beyond its normal level of accumulation. However, we could not detect any defects in sRNA production in lines where DRB4 was overexpressed. CONCLUSIONS/SIGNIFICANCE: Our work identified a first plant substrate of the APC/C, which is not a regulator of the cell cycle. Though we cannot exclude that APC/C-dependent degradation of DRB4 has some regulatory roles under specific growth conditions, our work rather points to a housekeeping function of APC/C in maintaining precise cellular

  7. siRNA-induced silencing of hypoxia-inducible factor 3α (HIF3α) increases endurance capacity in rats.

    Science.gov (United States)

    Drozdovska, S; Gavenauskas, B; Drevytska, T; Nosar, V; Nagibin, V; Mankovska, I; Dosenko, V

    2016-06-01

    Molecular mechanisms of adaptation to exercise despite a large number of studies remain unclear. One of the crucial factors in this process is hypoxia inducible factor (HIF) that regulates transcription of many target genes encoding proteins that are implicated in molecular adaptation to hypoxia. Experiments were conducted on 24 adult male Fisher rats. Real-time PCR analysis was performed for quantitative evaluation of Hif3α, Igf1, Glut-4 and Pdk-1 in m. gastrocnemius, m. soleus, in lung and heart tissues. Mitochondrial respiratory function and electron microscopy were performed. Knockdown of Hif3α using siRNA increases time of swimming to exhaustion by 1.5 times. Level of mitochondrial NAD- and FAD-dependent oxidative pathways is decreased, however efficiency of phosphorylation is increased after Hif3α siRNA treatment. Expression of HIF target genes in muscles was not changed significantly, except for increasing of Pdk-1 expression in m. soleus by 2.1 times. More prominent changes were estimated in lung and heart: Igf1 gene expression was increased by 32.5 and 37.5 times correspondingly. Glut4 gene expression in lungs was increased from undetected level till 0.3 rel. units and by 84.2 times in heart. Level of Pdk1 gene expression was increased by 249.2 in lungs and by 35.1 times in hearts, correspondingly. Some destructive changes in muscle tissue were detected in animals with siRNA-inducing silencing of Hif3α. PMID:27274101

  8. Well-Defined Degradable Cationic Polylactide as Nanocarrier for the Delivery of siRNA to Silence Angiogenesis in Prostate Cancer

    OpenAIRE

    Chen, Chih-Kuang; Law, Wing-Cheung; Aalinkeel, Ravikumar; Nair, Bindukumar; Kopwitthaya, Atcha; Mahajan, Supriya D.; Reynolds, Jessica L.; Zou, Jiong; Schwartz, Stanley A; Paras N. Prasad; Cheng, Chong

    2012-01-01

    Well-defined tertiary amine-functionalized cationic polylactides (CPLAs) are synthesized by thiol-ene click functionalization of an allyl-functionalized polylactide, and utilized here for the delivery of interleukin-8 (IL-8) siRNA via CPLA-IL-8 siRNA nanoplexes. The CPLAs possess remarkable hydrolytic degradability, and their cytotoxicity is relatively low. The CPLA-IL-8 siRNA nanoplexes can be readily taken up by prostate cancer cells, resulting in significant IL-8 gene silencing. It is foun...

  9. Small interfering RNA targeted to secretory clusterin blocks tumor growth, motility, and invasion in breast cancer

    Institute of Scientific and Technical Information of China (English)

    Zhaohe Niu; Xinhui Li; Bin Hu; Rong Li; Ligang Wang; Lilin Wu; Xingang Wang

    2012-01-01

    Clusterin/apolipoprotein J (Clu) is a ubiquitously expressed secreted heterodimeric glycoprotein that is implicated in several physiological processes.It has been reported that the elevated level of secreted clusterin (sClu) protein is associated with poor survival in breast cancer patients and can induce metastasis in rodent models.In this study,we investigated the effects of sClu inhibition with small interfering RNAs (siRNAs) on cell motility,invasion,and growth in vitro and in vivo.MDA-MB-231 cells were transfected with pSuper-siRNA/sClu.Cell survival and proliferation were examined by 3-(4,5-dimethyl-thiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium and clonogenic survival assay.The results showed that sClu silencing significantly inhibited the proliferation of MDA-MB-231 cells.The invasion and migration ability were also dramatically decreased,which was detected by matrigel assays.TUNEL staining and caspase-3 activity assay demonstrated that sClu silencing also could increase the apoptosis rate of cells,resulting in the inhibition of cell growth.We also determined the effects of sClu silencing on tumor growth and metastatic progression in an orthotopic breast cancer model.The results showed that orthotopic primary tumors derived from MDA-MB-231/pSuper sClu siRNA cells grew significantly slower than tumors derived from parental MDA-MB-231 or MDA-MB-231/pSuper scramble siRNA cells,and metastasize less to the lungs.These data suggest that secretory clusterin plays a significant role in tumor growth and metastatic progression.Knocking-down sClu gene expression may provide a valuable method for breast cancer therapy.

  10. The Ins and Outs of miRNA-Mediated Gene Silencing during Neuronal Synaptic Plasticity

    Directory of Open Access Journals (Sweden)

    Dipen Rajgor

    2016-01-01

    Full Text Available Neuronal connections through specialized junctions, known as synapses, create circuits that underlie brain function. Synaptic plasticity, i.e., structural and functional changes to synapses, occurs in response to neuronal activity and is a critical regulator of various nervous system functions, including long-term memory formation. The discovery of mRNAs, miRNAs, ncRNAs, ribosomes, translational repressors, and other RNA binding proteins in dendritic spines allows individual synapses to alter their synaptic strength rapidly through regulation of local protein synthesis in response to different physiological stimuli. In this review, we discuss our understanding of a number of miRNAs, ncRNAs, and RNA binding proteins that are emerging as important regulators of synaptic plasticity, which play a critical role in memory, learning, and diseases that arise when neuronal circuits are impaired.

  11. Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

    OpenAIRE

    Malgorzata Sierant; Alina Paduszynska; Julia Kazmierczak-Baranska; Benedetta Nacmias; Sandro Sorbi; Silvia Bagnoli; Elzbieta Sochacka; Barbara Nawrot

    2011-01-01

    RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry ...

  12. Transitive RNA silencing signals induce cytosine methylation of a transgenic but not an endogenous target

    Czech Academy of Sciences Publication Activity Database

    Vermeersch, L.; De Winne, N.; Nolf, J.; Bleys, A.; Kovařík, Aleš; Depicker, A.

    2013-01-01

    Roč. 74, č. 5 (2013), s. 867-879. ISSN 0960-7412 R&D Projects: GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : DIRECTED DNA METHYLATION * POTATO-VIRUS-X * DOUBLE-STRANDED-RNA Subject RIV: BO - Biophysics Impact factor: 6.815, year: 2013

  13. Anti-tumor effect of RNA interference silencing survivin gene combined with X-ray irradiation on human hepatoma xenograft in nude mice

    International Nuclear Information System (INIS)

    Objective: To investigate the anti-tumor effect of RNA interference silencing Survivin gene combined with X-ray irradiation on human hepatoma xenograft in nude mice. Methods: siRNA expression plasmids targeting Survivin genes packed by liposome were injected into human hepatoma xenograft which were irradiated with 5 Gy X-ray later. Tumor volumes at different time points and mean survival period of mice were observed. Expression level of Survivin, PCNA and intratumoral microvessel density were detected by Immunohistochemical staining. Apoptotic cells in tumor tissue were detected by TUNEL method. Results: Tumor volumes of pGenesil-survivin+5 Gy group were significantly lower than those of the control, pGenesil-survivin and 5 Gy groups 3 ∼ 21 days after the beginning of therapy. Mean survival period of mice in pGenesil-survivin+5 Gy group was the longest. Expression level of PCNA and intratumoral microvessel density in pGenesil-survivin+5 Gy group were significantly lower than those of pGenesil-survivin group and radiotherapy group 1 day after therapy. Percentage of apoptotic cells in tumor tissue in pGenesil-survivin+5 Gy group was significantly higher than other groups. Conclusion: RNA interference silencing Survivin gene combined with radiotherapy could effectively inhibit cell proliferation and tumor angiogenesis, enhance apoptosis in tumor xenograft and its anti-tumor effect was more powerful than that of radiotherapy or RNA interference silencing Survivin gene. (authors)

  14. Silencing of the metastasis-linked gene, AEG-1, using siRNA-loaded cholamine surface-modified gelatin nanoparticles in the breast carcinoma cell line MCF-7.

    Science.gov (United States)

    Abozeid, Salma M; Hathout, Rania M; Abou-Aisha, Khaled

    2016-09-01

    Cholamine surface-modified gelatin nanoparticles prepared by the double desolvation method using acetone as a dehydrating agent were selected and potentially evaluated as non viral vectors of siRNA targeting a metastatic gene AEG-1 in MCF-7 breast carcinoma cells. The ability of modified gelatin nanoparticle to complex and deliver siRNA for gene silencing was investigated. Hence, Particle size, surface charge (zeta potential) and morphology of siRNA/Gelatin nanoparticles (siGNPs) were characterized via dynamic light scattering (DLS), scanning electron microscopy (SEM) and transmission electron microscope (TEM). Moreover, the nanoparticles cytotoxicity, loading efficiency and interaction with MCF-7 human breast carcinoma cells were evaluated. Cationized GNPs of mean size range of 174nm and PDI of 0.101 were produced. The loading efficiency of siGNPs at a Nitrogen/Phosphate (N/P) ratio (w/w) of 200:1 was approximately 96%. Cellular uptake was evaluated after FITC conjugation where the particles produced high transfection efficiency. Finally, ELISA analysis of AEG-1/MTDH expression demonstrated the gene silencing effect of siGNPs, as more than 75% MTDH protein were inhibited. Our data indicate that cholamine modified GNPs pose a promising non-viral siRNA carrier for altering gene expression in MCF-7 breast cancer cells with many advantages such as relatively high gene transfection efficiency and efficient silencing ability. PMID:27285732

  15. Lentiviral vector-mediated gene transfer and RNA silencing technology in neuronal dysfunctions.

    Science.gov (United States)

    Dreyer, Jean-Luc

    2011-02-01

    Lentiviral-mediated gene transfer in vivo or in cultured mammalian neurons can be used to address a wide variety of biological questions, to design animals models for specific neurodegenerative pathologies, or to test potential therapeutic approaches in a variety of brain disorders. Lentiviruses can infect non-dividing cells, thereby allowing stable gene transfer in post-mitotic cells such as mature neurons. An important contribution has been the use of inducible vectors: the same animal can thus be used repeatedly in the doxycycline-on or -off state, providing a powerful mean for assessing the function of a gene candidate in a disorder within a specific neuronal circuit. Furthermore, lentivirus vectors provide a unique tool to integrate siRNA expression constructs with the aim to locally knockdown expression of a specific gene, enabling to assess the function of a gene in a very specific neuronal pathway. Lentiviral vector-mediated delivery of short hairpin RNA results in persistent knockdown of gene expression in the brain. Therefore, the use of lentiviruses for stable expression of siRNA in brain is a powerful aid to probe gene functions in vivo and for gene therapy of diseases of the central nervous system. In this chapter I review the applications of lentivirus-mediated gene transfer in the investigation of specific gene candidates involved in major brain disorders and neurodegenerative processes. Major applications have been in polyglutamine disorders, such as synucleinopathies and Parkinson's disease, or in investigating gene function in Huntington's disease, dystonia, or muscular dystrophy. Recently, lentivirus gene transfer has been an invaluable tool for evaluation of gene function in behavioral disorders such as drug addiction and attention-deficit hyperactivity disorder or in learning and cognition. PMID:20862616

  16. The use of pH-sensitive functional selenium nanoparticles shows enhanced in vivo VEGF-siRNA silencing and fluorescence imaging

    Science.gov (United States)

    Yu, Qianqian; Liu, Yanan; Cao, Chengwen; Le, Fangling; Qin, Xiuying; Sun, Dongdong; Liu, Jie

    2014-07-01

    The utility of small interfering RNAs (siRNAs) has shown great promise in treating a variety of diseases including many types of cancer. While their ability to silence a wide range of target genes underlies their effectiveness, the application of therapies remains hindered by a lack of an effective delivery system. In this study, we sought to develop an siRNA-delivery system for VEGF, a known signaling molecule involved in cancer, that consists of two selenium nanoparticles SeNPs and G2/PAH-Cit/SeNPs. A G2/PAH-Cit/SeNP is a pH-sensitive delivery system that is capable of enhancing siRNA loading, thus increasing siRNA release efficiency and subsequent target gene silencing both in vitro and in vivo. In vivo experiments using G2/PAH-Cit/SeNPs@siRNA led to significantly higher accumulation of siRNA within the tumor itself, VEGF gene silencing, and reduced angiogenesis in the tumor. Furthermore, the G2/PAH-Cit/SeNP delivery system not only enhanced anti-tumor effects on tumor-bearing nude mice as compared to SeNPs@siRNA, but also resulted in weak occurrence of lesions in major target organs. In sum, this study provides a new class of siRNA delivery system, thereby providing an alternative therapeutic route for cancer treatment.The utility of small interfering RNAs (siRNAs) has shown great promise in treating a variety of diseases including many types of cancer. While their ability to silence a wide range of target genes underlies their effectiveness, the application of therapies remains hindered by a lack of an effective delivery system. In this study, we sought to develop an siRNA-delivery system for VEGF, a known signaling molecule involved in cancer, that consists of two selenium nanoparticles SeNPs and G2/PAH-Cit/SeNPs. A G2/PAH-Cit/SeNP is a pH-sensitive delivery system that is capable of enhancing siRNA loading, thus increasing siRNA release efficiency and subsequent target gene silencing both in vitro and in vivo. In vivo experiments using G2/PAH-Cit/SeNPs@siRNA

  17. Structure of the Cmr2 Subunit of the CRISPR-Cas RNA Silencing Complex

    Energy Technology Data Exchange (ETDEWEB)

    Cocozaki, Alexis I.; Ramia, Nancy F.; Shao, Yaming; Hale, Caryn R.; Terns, Rebecca M.; Terns, Michael P.; Li, Hong (FSU); (Georgia)

    2012-08-10

    Cmr2 is the largest and an essential subunit of a CRISPR RNA-Cas protein complex (the Cmr complex) that cleaves foreign RNA to protect prokaryotes from invading genetic elements. Cmr2 is thought to be the catalytic subunit of the effector complex because of its N-terminal HD nuclease domain. Here, however, we report that the HD domain of Cmr2 is not required for cleavage by the complex in vitro. The 2.3 {angstrom} crystal structure of Pyrococcus furiosus Cmr2 (lacking the HD domain) reveals two adenylyl cyclase-like and two {alpha}-helical domains. The adenylyl cyclase-like domains are arranged as in homodimeric adenylyl cyclases and bind ADP and divalent metals. However, mutagenesis studies show that the metal- and ADP-coordinating residues of Cmr2 are also not critical for cleavage by the complex. Our findings suggest that another component provides the catalytic function and that the essential role by Cmr2 does not require the identified ADP- or metal-binding or HD domains in vitro.

  18. RNA silencing in the model mycorrhizal fungus Laccaria bicolor: gene knock-down of nitrate reductase results in inhibition of symbiosis with Populus.

    Science.gov (United States)

    Kemppainen, Minna; Duplessis, Sébastien; Martin, Francis; Pardo, Alejandro G

    2009-07-01

    Mycorrhizal symbioses are a rule in nature and may have been crucial in plant and fungal evolution. Ectomycorrhizas are mutualistic interactions between tree roots and soil fungi typical of temperate and boreal forests. The functional analysis of genes involved in developmental and metabolic processes, such as N nutrition, is important to understand the ontogeny of this mutualistic symbiosis. RNA silencing was accomplished in the model mycorrhizal fungus Laccaria bicolor by Agrobacterium-mediated gene transfer. Promoter-directed expression of double-stranded RNA with a partial coding sequence of the Laccaria nitrate reductase gene resulted in fungal transgenic strains strongly affected in growth with nitrate as N source in a medium with high concentration of an utilizable C source. The phenotype correlated with a clear reduction of the target gene mRNA level and this effect was not caused by homologous recombination of the T-DNA in the nitrate reductase locus. Transformation with the hairpin sequence resulted in specific CpG methylation of both the silenced transgene and the nitrate reductase encoding gene. The methylation in the target gene was restricted to the silencing trigger sequence and did not represent the entire genomic DNA in the dikaryon suggesting that the epigenetic changes accompanying RNA silencing affected only the transformed nucleus. Mycorrhization experiments of Populus with strongly silenced fungal strains revealed a systematic inhibition of symbiosis under mycorrhization conditions (C starvation) and nitrate as N source compared with the wild type. This inhibition of mycorrhization was reversed by an organic N source only utilizable by the fungus. These observations would indicate that the plant may be capable of monitoring and detecting the nutritional status of a potential symbiont avoiding the establishment of an unsatisfactory interaction. A probable control mechanism conducted by the plant would inhibit symbiosis when the metabolic

  19. Long noncoding RNA PVT1 promotes cervical cancer progression through epigenetically silencing miR-200b.

    Science.gov (United States)

    Zhang, Shaorong; Zhang, Guanli; Liu, Jingying

    2016-08-01

    Long noncoding RNA PVT1 has been reported to be dysregulated and play vital roles in a variety of cancers. However, the functions and molecular mechanisms of PVT1 in cervical cancer remain unclear. The objective of this study was to investigate the expression, clinical significance, biological roles, and underlying functional mechanisms of PVT1 in cervical cancer. Our results revealed that PVT1 is upregulated in cervical cancer tissues. Enhanced expression of PVT1 is associated with larger tumor size, advanced International Federation of Gynecology and Obstetrics stage, and poor prognosis of cervical cancer patients. Using gain-of-function and loss-of-function approaches, we demonstrated that overexpression of PVT1 promotes cervical cancer cells proliferation, cell cycle progression and migration, and depletion of PVT1 inhibits cervical cancer cell proliferation, cell cycle progression, and migration. Mechanistically, we verified that PVT1 binds to EZH2, recruits EZH2 to the miR-200b promoter, increases histone H3K27 trimethylation level on the miR-200b promoter, and inhibits miR-200b expression. Furthermore, the effects of PVT1 on cervical cell proliferation and migration depend upon silencing of miR-200b. Taken together, our findings confirmed that PVT1 functions as an oncogene in cervical cancer and indicated that PVT1 is not only an important prognostic marker, but also a potential therapy target for cervical cancer. PMID:27272214

  20. RNA interference-mediated silencing of NANOG reduces cell proliferation and induces G0/G1 cell cycle arrest in breast cancer cells.

    Science.gov (United States)

    Han, Jinghua; Zhang, Fei; Yu, Man; Zhao, Peiqi; Ji, Wei; Zhang, Haichang; Wu, Bing; Wang, Yuqing; Niu, Ruifang

    2012-08-01

    Since the processes of normal embryogenesis and neoplasia share many of similar pathways, tumor development has been interpreted as an abnormal form of organogenesis. NANOG is a homeodomain-containing transcription factor that functions to maintain self-renewal and proliferation of embryonic stem cells (ESCs). Aberrant expression of NANOG has been observed in many types of human malignancies. However, its potential implication in tumorigenesis has not been fully clarified. In this study, we have employed small interference RNA (RNAi) technology to silence endogenous NANOG expression in breast cancer cells and successfully selected three independent clones with stably inhibited NANOG expression of MCF-7 cells. Functional analysis revealed that down-regulation of NANOG reduced cell proliferation, colony formation and migration ability of MCF-7 cells. Consistently, proliferation of breast cancer MDA-MB-231 cells was also significantly inhibited after the knockdown of NANOG expression. Interestingly, we found that the expression levels of cyclinD1 and c-myc were markedly down-regulated and the cell cycle were blocked at the G0/G1 phases after the knockdown of NANOG, while the expression of cyclinE and signal transducers and activators of transcription3 (STAT3) remained unaffected. In addition, the expression of NANOG and cyclinD1 can be rescued after the transfection of pcDNA3.1 (-)-NANOG expression vector into the three clones. Finally, our chromatin immunoprecipitation (ChIP) experiment showed that NANOG protein can bind to the promoter region of cyclinD1 and regulate cells cycle. Taken together, our findings may not only establish a molecular basis for the role of NANOG in modulating cell cycle progression of breast cancer cells but also suggest a potential target for the treatment of at least some subtypes of breast cancer. PMID:22381696

  1. Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

    Directory of Open Access Journals (Sweden)

    Kevin J Paik

    Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

  2. Nanoparticle mediated P-glycoprotein silencing for improved drug delivery across the blood-brain barrier: a siRNA-chitosan approach.

    Directory of Open Access Journals (Sweden)

    Jostein Malmo

    Full Text Available The blood-brain barrier (BBB, composed of tightly organized endothelial cells, limits the availability of drugs to therapeutic targets in the central nervous system. The barrier is maintained by membrane bound efflux pumps efficiently transporting specific xenobiotics back into the blood. The efflux pump P-glycoprotein (P-gp, expressed at high levels in brain endothelial cells, has several drug substrates. Consequently, siRNA mediated silencing of the P-gp gene is one possible strategy how to improve the delivery of drugs to the brain. Herein, we investigated the potential of siRNA-chitosan nanoparticles in silencing P-gp in a BBB model. We show that the transfection of rat brain endothelial cells mediated effective knockdown of P-gp with subsequent decrease in P-gp substrate efflux. This resulted in increased cellular delivery and efficacy of the model drug doxorubicin.

  3. Transforming petals into sepaloid organs in Arabidopsis and oilseed rape: implementation of the hairpin RNA-mediated gene silencing technology in an organ-specific manner.

    Science.gov (United States)

    Byzova, Marina; Verduyn, Christoph; De Brouwer, Dirk; De Block, Marc

    2004-01-01

    Oilseed rape ( Brassica napus L.) genotypes with no or small petals are thought to have advantages in photosynthetic activity. The flowers of field-grown oilseed rape form a bright-yellow canopy that reflects and absorbs nearly 60% of the photosynthetically active radiation (PAR), causing a severe yield penalty. Reducing the size of the petals and/or removing the reflecting colour will improve the transmission of PAR to the leaves and is expected to increase the crop productivity. In this study the 'hairpin' RNA-mediated (hpRNA) gene silencing technology was implemented in Arabidopsis thaliana (L.) Heynh. and B. napus to silence B-type MADS-box floral organ identity genes in a second-whorl-specific manner. In Arabidopsis, silencing of B-type MADS-box genes was obtained by expressing B. napus APETALA3( BAP3) or PISTILLATA ( BPI) homologous self-complementary hpRNA constructs under control of the Arabidopsis A-type MADS-box gene APETALA1 ( AP1) promoter. In B. napus, silencing of the BPI gene family was achieved by expressing a similar hpRNA construct as used in Arabidopsis under the control of a chimeric promoter consisting of a modified petal-specific Arabidopsis AP3 promoter fragment fused to the AP1 promoter. In this way, transgenic plants were generated producing male fertile flowers in which the petals were converted into sepals ( Arabidopsis) or into sepaloid petals ( B. napus). These novel flower phenotypes were stable and heritable in both species. PMID:14534787

  4. Complex coding of endogenous siRNA, transcriptional silencing and H3K9 methylation on native targets of germline nuclear RNAi in C. elegans

    OpenAIRE

    Ni, Julie Zhouli; Chen, Esteban; Gu, Sam Guoping

    2014-01-01

    Background Small RNA-guided transcriptional silencing (nuclear RNAi) is fundamental to genome integrity and epigenetic inheritance. Despite recent progress in identifying the capability and genetic requirements for nuclear RNAi in Caenorhabditis elegans, the natural targets and cellular functions of nuclear RNAi remain elusive. Methods To resolve this gap, we coordinately examined the genome-wide profiles of transcription, histone H3 lysine 9 methylation (H3K9me) and endogenous siRNAs of a ge...

  5. Heterologous expression of viral suppressors of RNA silencing complements virulence of the HC-Pro mutant of clover yellow vein virus in pea.

    Science.gov (United States)

    Atsumi, Go; Nakahara, Kenji S; Wada, Tomoko Sugikawa; Choi, Sun Hee; Masuta, Chikara; Uyeda, Ichiro

    2012-06-01

    Many plant viruses encode suppressors of RNA silencing, including the helper component-proteinase (HC-Pro) of potyviruses. Our previous studies showed that a D-to-Y mutation at amino acid position 193 in HC-Pro (HC-Pro-D193Y) drastically attenuated the virulence of clover yellow vein virus (ClYVV) in legume plants. Furthermore, RNA-silencing suppression (RSS) activity of HC-Pro-D193Y was significantly reduced in Nicotiana benthamiana. Here, we examine the effect of expression of heterologous suppressors of RNA silencing, i.e., tomato bushy stunt virus p19, cucumber mosaic virus 2b, and their mutants, on the virulence of the ClYVV point mutant with D193Y (Cl-D193Y) in pea. P19 and 2b fully and partially complemented Cl-D193Y multiplication and virulence, including lethal systemic HR in pea, respectively, but the P19 and 2b mutants with defects in their RSS activity did not. Our findings strongly suggest that the D193Y mutation exclusively affects RSS activity of HC-Pro and that RSS activity is necessary for ClYVV multiplication and virulence in pea. PMID:22398917

  6. In vitro transcription activities of Pol IV, Pol V and RDR2 reveal coupling of Pol IV and RDR2 for dsRNA synthesis in plant RNA silencing

    Energy Technology Data Exchange (ETDEWEB)

    Haag, Jeremy R.; Ream, Thomas S.; Marasco, Michelle; Nicora, Carrie D.; Norbeck, Angela D.; Pasa-Tolic, Ljiljana; Pikaard, Craig S.

    2012-12-14

    In Arabidopsis, RNA-dependent DNA methylation and transcriptional silencing involves three nuclear RNA polymerases that are biochemically undefined: the presumptive DNA-dependent RNA polymerases, Pol IV and Pol V and the putative RNA-dependent RNA polymerase, RDR2. Here, we demonstrate their RNA polymerase activities in vitro. Unlike Pol II, Pols IV and V require an RNA primer, are insensitive to alpha-amanitin and differ in their ability to displace non-template DNA during transcription. Biogenesis of 24 nt small interfering RNAs (siRNAs) requires both Pol IV and RDR2, which physically associate in vivo. Pol IV does not require RDR2 for activity, but RDR2 is nonfunctional in the absence of associated Pol IV, suggesting that their coupling explains the channeling of Pol IV transcripts into double-stranded RNAs that are then diced into 24 nt siRNAs.

  7. RNA Interference-mediated Silencing of Phytochelatin Synthase Gene Reduce Cadmium Accumulation in Rice Seeds

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Phytochelatins (PCs) play an important role in heavy metal resistance and accumulation. To reduce the accumulation of cadmium (Cd) in rice seeds, the expression of phytochelatin synthase (PCS) gene OsPCS1 was suppressed by RNA interference (RNAi). A hairpin construct of a PCS fragment was designed in the pRNAi-OsPCS1 under the control of ZMM1, a seed-specific promoter from maize. The construct was introduced into rice (japonica) through Agrobacterium tumefaciens. The RNAi rice plantlets were selected and cultivated in pots exposured to 10 mg/kg Cd. The transcriptional level of OsPCS1 declined in seeds of some RNAi rice compared to the wild type. As a result Cd accumulation was reduced by about half in the seeds of RNAi rice. As expected, no apparent difference of growth appeared between RNAi and wild-type plants. The results suggest that this new approach can be used to control heavy metal accumulation in crops.

  8. Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

    Science.gov (United States)

    Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

    2015-11-01

    Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine

  9. Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Timo Faltus

    2004-11-01

    Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

  10. siRNA-mediated silencing of Cockayne Cyndrome group B gene potentiates radiation-induced apoptosis and antiproliferative effect in HeLa cells

    Institute of Scientific and Technical Information of China (English)

    LIU Feng; YU Zi-jian; SUI Jian-li; BAI Bei; ZHOU Ping-kun

    2006-01-01

    Background Cockayne syndrome (CS) is a rare human genetic disorder characterized by increased UV sensitivity, developmental abnormalities and premature aging. Cells isolated from individuals with CS have a defect in transcription-coupled DNA repair. Despite the repair defect, there is no any increased risk of spontaneous or UV-induced cancer for CS individuals. The strategy of RNA interfering was used here to explore the potential radiosensitizing and anticancer activity of targeting CS group B (CSB) gene.Methods The vectors encoding CSB-specific siRNAs were constructed by inserting duplex siRNA encoding oligonucleotides into the plasmid psilencer TM 3.1. The cell lines expressing the CSB-siRNA were generated from HeLa cells transfected with the above vectors. Colony-forming ability was used to assay cell survival. Cell cycle was analyzed by FACScan flow cytometry. The apoptosis was measured by detecting the accumulation of sub-G1 population as well as by fluorescence staining assay. Reverse transcriptase polymerase chain reaction (RT-PCR)was used to semi-quantify mRNA expression. Protein level was detected by Western blotting analysis.Results Two constructs encoding CSB-specific siRNA were generated, both of them resulted in remarkable suppression on CSB expression in HeLa cells, and led to an increased sensitivity to γ-ray and UV light.siRNA-mediated silencing of CSB decreased cell proliferation rate, increased spontaneous apoptosis as well as the occurrence of UV- or cisplatin-induced apoptosis by 2 to 3.5 fold. A significant S phase blockage and a remarkable reduction of G1 population were induced in control HeLa cells at 18 hours after being exposed to 10J/m2 of UV light. The S phase blockage was also observed in UV-irradiated CSB-siRNA transfected HeLa cells,but the extent of increased S phase population was lower than that in the UV-irradiated control cells. No or a relative weak reduction on G1 phase population was observed in UV-irradiated CSB-siRNA

  11. Gliotoxin: inhibitor of poliovirus RNA synthesis that blocks the viral RNA polymerase 3Dpol.

    OpenAIRE

    Rodriguez, P L; Carrasco, L.

    1992-01-01

    The mode of action of gliotoxin against poliovirus has been analyzed in detail. This fungal metabolite inhibits the appearance of poliovirus proteins when present from the beginning of infection but has no effect on viral translation when added at late times. In agreement with previous findings, this toxin potently inhibited the incorporation of [3H]uridine into poliovirus RNA soon after its addition to the culture medium. Analysis of the synthesis of poliovirus plus- or minus-stranded RNA in...

  12. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-08-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  13. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants[OPEN

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-01-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  14. Synergistic effect of silencing the expression of tick protective antigens 4D8 and Rs86 in Rhipicephalus sanguineus by RNA interference.

    Science.gov (United States)

    de la Fuente, José; Almazán, Consuelo; Naranjo, Victoria; Blouin, Edmour F; Kocan, Katherine M

    2006-07-01

    Tick proteins have been shown to be useful for the development of vaccines which reduce tick infestations. Potential tick protective antigens have been identified and characterized, in part, by use of RNA interference (RNAi). RNAi allows for analysis of gene function by characterizing the impact of loss of gene expression on tick physiology. Herein, we used RNAi in Rhipicephalus sanguineus to evaluate gene functions of two tick protective antigens, 4D8 and Rs86, the homologue of Bm86, on tick infestation, feeding and oviposition. Silencing of 4D8 alone resulted in decreased tick attachment, survival, feeding and oviposition. Although the effect of Rs86 RNAi was less pronounced, silencing of this gene also reduced tick weight and oviposition. Most notably, simultaneous silencing of 4D8 and Rs86 by RNAi resulted in a synergistic effect in which tick survival, attachment, feeding, weight and oviposition were profoundly reduced. Microscopic evaluation of tick tissues revealed that guts from dual injected ticks were distended with epithelial cells sparsely distributed along the basement membrane. These results demonstrated the synergistic effect of the silencing expression of two tick protective genes. Inclusion of multiple tick protective antigens may, therefore, enhance the efficacy of tick vaccines. PMID:16518610

  15. Preparation of Polyion Complex Micelles Using Block Copolymers for SiRNA Delivery.

    Science.gov (United States)

    Kim, Hyun Jin; Zheng, Meng; Miyata, Kanjiro; Kataoka, Kazunori

    2016-01-01

    Polyion complex (PIC) micelles can be prepared through the spontaneous assembly of cationic block copolymers with oppositely charged short interfering RNAs (SiRNAs). Their core-shell architectures offer a delivery platform for vulnerable SiRNA, improving their biological activities for medicinal applications such as tumor-targeted therapy. Here, we report a protocol for the preparation of SiRNA-loaded PIC micelles using a poly(ethylene glycol)-block-poly(aspartamide) derivative, providing the physicochemical criteria for well-defined micellar formulation. In addition, we describe protocols for a stability assay for SiRNA-loaded PIC micelles in the presence of serum using fluorescence correlation spectroscopy and a luciferase assay for cultured cancer cells stably expressing luciferase, thus providing the biological criteria for further medicinal applications. PMID:26472445

  16. Low-weight polyethylenimine cross-linked 2-hydroxypopyl-ß-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA

    Directory of Open Access Journals (Sweden)

    Li JM

    2013-06-01

    Full Text Available Jin-Ming Li, Yuan-Yuan Wang, Wei Zhang, Hua Su, Liang-Nian Ji, Zong-Wan Mao MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, People's Republic of China Background: Targeted delivery of small interfering RNA (siRNA has been regarded as one of the most important technologies for the development of siRNA therapeutics. However, the need for safe and efficient delivery systems is a barrier to further development of RNA interference therapeutics. In this work, a nontoxic and efficient siRNA carrier delivery system of low molecular weight polyethyleneimine (PEI-600 Da cross-linked with 2-hydroxypopyl-β-cyclodextrin (HP-β-CD and folic acid (FA was synthesized for biomedical application. Methods: The siRNA carrier was prepared using a simple method and characterized by nuclear magnetic resonance and Fourier transform infrared spectroscopy. The siRNA carrier nanoparticles were characterized in terms of morphology, size and zeta potential, stability, efficiency of delivery, and gene silencing efficiency in vitro and in vivo. Results: The siRNA carrier was synthesized successfully. It showed good siRNA binding capacity and ability to protect siRNA. Further, the toxicity of the carrier measured in vitro and in vivo appeared to be negligible, probably because of degradation of the low molecular weight PEI and HP-β-CD in the cytosol. Flow cytometry and confocal microscopy confirmed that the FA receptor-mediated endocytosis of the FA-HP-β-CD-PEI/siRNA complexes was greater than that of the HP-β-CD-PEI/siRNA complexes in FA receptor-enriched HeLa cells. The FA-HP-β-CD-PEI/siRNA complexes also demonstrated excellent gene silencing efficiency in vitro (in the range of 90%, and reduced vascular endothelial growth factor (VEGF protein expression in the presence of 20% serum. FA-HP-β-CD-PEI/siRNA complexes administered via tail vein injection resulted in marked

  17. Silencing of RhoA and RhoC expression by RNA interference suppresses human colorectal carcinoma growth in vivo

    Directory of Open Access Journals (Sweden)

    Wang Haibo

    2010-09-01

    Full Text Available Abstract Background RhoA and RhoC have been proved to be over-expressed in many solid cancers, including colorectal cancer. The reduction of RhoA and RhoC expression by RNA interference (RNAi resulted growth inhibition of cancer cells. The present study was to evaluate the effect of silencing of RhoA and RhoC expression by RNAi on growth of human colorectal carcinoma (CRC in tumor-bearing nude mice in vivo. Methods To establish HCT116 cell transplantable model, the nude mice were subcutaneously inoculated with 1.0 × 107 HCT116 cells and kept growing till the tumor xenografts reached 5-7 mm in diameter. Then the mice were randomly assigned to three groups(seven mice in each group: (1 normal saline(NS group, (2replication-defective recombinant adenovirus carrying the negative control shRNA (Ad-HK group and (3replication-defective recombinant adenovirus carrying the 4-tandem linked RhoA and RhoC shRNAs (Ad-RhoA-RhoC group. Ad-HK (4 × 108 pfu, 30 ul/mouse, Ad-RhoA-RhoC (4 × 108 pfu, 30 ul/mouse or PBS (30 ul/mouse was injected intratumorally four times once every other day. The weight and volumes of tumor xenografts were recorded. The levels of RhoA and RhoC mRNA transcripts and proteins in tumor xenografts were detected by reverse quantitative transcription polymerase chain reaction (QRT-PCR and immunohistochemical staining respectively. The terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL assay was used to detect the death of cells. Results The xenografts in mice could be seen at 5th day from the implantation of HCT116 cells and all had reached 5-7 mm in size at 9th day. After injection intratumorally, the growth speed of tumor xenografts in Ad-RhoA-RhoC group was significantly delayed compared with those in NS and Ad-HK group(P RhoA and RhoC reduced more in Ad-RhoA-RhoC group than those in NS and Ad-HK group. The relative RhoA and RhoC mRNA transcripts were decreased to 48% and 43% respectively (P RhoA and Rho

  18. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  19. RNA Interference Silencing of Glycogen Synthase Kinase 3β Inhibites Tau Phosphorylation in Mice with Alzheimer Disease.

    Science.gov (United States)

    Bian, Hong; Bian, Wei; Lin, Xiaoying; Ma, Zhaoyin; Chen, Wen; Pu, Ying

    2016-09-01

    To explore the effect of glycogen synthase kinase 3β (GSK-3β) silencing on Tau-5 phosphorylation in mice suffering Alzheimer disease (AD). GSK-3β was firstly silenced in human neuroblastoma SH-SY5Y cells using special lentivirus (LV) and the content of Tau (A-12), p-Tau (Ser396) and p-Tau (PHF-6) proteins. GSK-3β was also silenced in APP/PS1 mouse model of AD mice, which were divided into three groups (n = 10): AD, vehicle, and LV group. Ten C57 mice were used as control. The memory ability of mice was tested by square water maze, and the morphological changes of hippocampus and neuron death were analyzed by haematoxylin-eosin staining. Moreover, the levels of Tau and phosphorylated Tau (p-Tau) were detected by western blotting and immunohistochemistry, respectively. The lentivirus-mediated GSK-3β silencing system was successfully developed and silencing GSK-3β at the cellular level reduced Tau phosphorylation obviously. Moreover, GSK-3β silence significantly improved the memory ability of AD mice in LV group compared with AD group (P < 0.05) according to the latency periods and error numbers. As for the hippocampus morphology and neuron death, no significant change was observed between LV group and normal control. Immunohistochemical detection and western blotting revealed that the levels of Tau and p-Tau were significantly down-regulated after GSK-3β silence. Silencing GSK-3β may have a positive effect on inhibiting the pathologic progression of AD through down-regulating the level of p-Tau. PMID:27255602

  20. Chitosan/siRNA functionalized titanium surface via a layer-by-layer approach for in vitro sustained gene silencing and osteogenic promotion

    Directory of Open Access Journals (Sweden)

    Song W

    2015-03-01

    Full Text Available Wen Song,1,* Xin Song,2,* Chuanxu Yang,2 Shan Gao,2 Lasse Hyldgaard Klausen,2 Yumei Zhang,1 Mingdong Dong,2 Jørgen Kjems21State Key Laboratory of Military Stomatology, Department of Prosthetic Dentistry, School of Stomatology, The Fourth Military Medical University, Xi’an, People’s Republic of China; 2Interdisciplinary Nanoscience Center (iNANO, Aarhus University, Aarhus, Denmark*These authors contributed equally to this workAbstract: Titanium surface modification is crucial to improving its bioactivity, mainly its bone binding ability in bone implant materials. In order to functionalize titanium with small interfering RNA (siRNA for sustained gene silencing in nearby cells, the layer-by-layer (LbL approach was applied using sodium hyaluronate and chitosan/siRNA (CS/siRNA nanoparticles as polyanion and polycation, respectively, to build up the multilayered film on smooth titanium surfaces. The CS/siRNA nanoparticle characterization was analyzed first. Dynamic contact angle, atomic force microscopy, and scanning electron microscopy were used to monitor the layer accumulation. siRNA loaded in the film was quantitated and the release profile of film in phosphate-buffered saline was studied. In vitro knockdown effect and cytotoxicity evaluation of the film were investigated using H1299 human lung carcinoma cells expressing green fluorescent protein (GFP. The transfection of human osteoblast-like cell MG63 and H1299 were performed and the osteogenic differentiation of MG63 on LbL film was analyzed. The CS/siRNA nanoparticles exhibited nice size distribution. During formation of the film, the surface wettability, topography, and roughness were alternately changed, indicating successful adsorption of the individual layers. The scanning electron microscope images clearly demonstrated the hybrid structure between CS/siRNA nanoparticles and sodium hyaluronate polymer. The cumulated load of siRNA increased linearly with the bilayer number and, more

  1. The RNA interference revolution

    Directory of Open Access Journals (Sweden)

    G. Lenz

    2005-12-01

    Full Text Available The discovery of double-stranded RNA-mediated gene silencing has rapidly led to its use as a method of choice for blocking a gene, and has turned it into one of the most discussed topics in cell biology. Although still in its infancy, the field of RNA interference has already produced a vast array of results, mainly in Caenorhabditis elegans, but recently also in mammalian systems. Micro-RNAs are short hairpins of RNA capable of blocking translation, which are transcribed from genomic DNA and are implicated in several aspects from development to cell signaling. The present review discusses the main methods used for gene silencing in cell culture and animal models, including the selection of target sequences, delivery methods and strategies for a successful silencing. Expected developments are briefly discussed, ranging from reverse genetics to therapeutics. Thus, the development of the new paradigm of RNA-mediated gene silencing has produced two important advances: knowledge of a basic cellular mechanism present in the majority of eukaryotic cells and access to a potent and specific new method for gene silencing.

  2. Interference RNA (RNAi)-based silencing of endogenous thrombopoietin receptor (Mpl) in Dami cells resulted in decreased hNUDC-mediated megakaryocyte proliferation and differentiation

    International Nuclear Information System (INIS)

    Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.

  3. Cystathionine-γ-lyase gene silencing with siRNA in monocytes/ macrophages attenuates inflammation in cecal ligation and puncture-induced sepsis in the mouse

    Indian Academy of Sciences (India)

    A Badiei; ST Chambers; RR Gaddam; M Bhatia

    2016-03-01

    Hydrogen sulphide is an endogenous inflammatory mediator produced by cystathionine-γ-lyase (CSE) in macrophages. To determine the role of H2S and macrophages in sepsis, we used small interference RNA (siRNA) to target the CSE gene and investigated its effect in a mouse model of sepsis. Cecal ligation puncture (CLP)-induced sepsis is characterized by increased levels of myeloperoxidase (MPO) activity, morphological changes in liver and pro-inflammatory cytokines and chemokines in the liver and lung. SiRNA treatment attenuated inflammation in the liver and lungs of mice following CLP-induced sepsis. Liver MPO activity increased in CLP-induced sepsis and treatment with siRNA significantly reduced this. Similarly, lung MPO activity increased following induction of sepsis with CLP while siRNA treatment significantly reduced MPO activity. Liver and lung cytokine and chemokine levels in CLP-induced sepsis reduced following treatment with siRNA. These findings show a crucial pro-inflammatory role for H2S synthesized by CSE in macrophages in sepsis and suggest CSE gene silencing with siRNA as a potential therapeutic approach for this condition.

  4. Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient resistance against Fusarium wilt in banana.

    Science.gov (United States)

    Ghag, Siddhesh B; Shekhawat, Upendra K S; Ganapathi, Thumballi R

    2014-06-01

    Fusarium wilt, caused by Fusarium oxysporum f. sp. cubense (Foc), is among the most destructive diseases of banana (Musa spp.). Because no credible control measures are available, development of resistant cultivars through genetic engineering is the only option. We investigated whether intron hairpin RNA (ihpRNA)-mediated expression of small interfering RNAs (siRNAs) targeted against vital fungal genes (velvet and Fusarium transcription factor 1) in transgenic banana could achieve effective resistance against Foc. Partial sequences of these two genes were assembled as ihpRNAs in suitable binary vectors (ihpRNA-VEL and ihpRNA-FTF1) and transformed into embryogenic cell suspensions of banana cv. Rasthali by Agrobacterium-mediated genetic transformation. Eleven transformed lines derived from ihpRNA-VEL and twelve lines derived from ihpRNA-FTF1 were found to be free of external and internal symptoms of Foc after 6-week-long greenhouse bioassays. The five selected transgenic lines for each construct continued to resist Foc at 8 months postinoculation. Presence of specific siRNAs derived from the two ihpRNAs in transgenic banana plants was confirmed by Northern blotting and Illumina sequencing of small RNAs derived from the transgenic banana plants. The present study represents an important effort in proving that host-induced post-transcriptional ihpRNA-mediated gene silencing of vital fungal genes can confer efficient resistance against debilitating pathogens in crop plants. PMID:24476152

  5. RNA-Dependent RNA Polymerase Is Required for Enhancer-Mediated Transcriptional Silencing Associated With Paramutation at the Maize p1 Gene

    OpenAIRE

    Sidorenko, Lyudmila; Chandler, Vicki

    2008-01-01

    Paramutation is the ability of an endogenous gene or a transgene to heritably silence another closely related allele or gene. At the maize p1 (pericarp color1) gene, paramutation is associated with decreases in transcript levels and reduced pigmentation of the endogenous allele that normally specifies red seed coat (pericarp) and cob pigmentation. Herein we demonstrate that this silencing occurs at the transcriptional level and that a specific enhancer fragment from p1 is sufficient to induce...

  6. Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans

    OpenAIRE

    Luteijn, Maartje J.; van Bergeijk, Petra; Kaaij, Lucas J. T.; Almeida, Miguel Vasconcelos; Roovers, Elke F.; Berezikov, Eugene; Ketting, René F.

    2012-01-01

    RNA-induced epigenetic silencing (RNAe) is a new pathway in C. elegans initiated by the Piwi protein PRG-1. RNAe stably silences transgenes over many generations through a nuclear RNAi pathway that induces transcriptional silencing.

  7. Silencing Bag-1 gene via magnetic gold nanoparticle-delivered siRNA plasmid for colorectal cancer therapy in vivo and in vitro.

    Science.gov (United States)

    Huang, Wenbai; Liu, Zhan'ao; Zhou, Guanzhou; Ling, Jianmin; Tian, Ailing; Sun, Nianfeng

    2016-08-01

    Apoptosis disorder is generally regarded as an important mechanism of carcinogenesis. Inducement of tumor cell apoptosis can be an effectual way to treat cancer. Bcl-2-associated athanogene 1 (Bag-1) is a positive regulator of Bcl-2 which is an anti-apoptotic gene. Bag-1 is highly expressed in colorectal cancer, which plays a critical role in promoting metastasis, poor prognosis, especially in anti-apoptotic function, and is perhaps a valuable gene target for colorectal cancer therapy. Recently, we applied a novel non-viral gene carrier, magnetic gold nanoparticle, and mediated plasmid pGPH1/GFP/Neo-Bag-1-homo-825 silencing Bag-1 gene for treating colorectal cancer in vivo and in vitro. By mediating with magnetic gold nanoparticle, siRNA plasmid was successfully transfected into cell. In 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) assay, magnetic gold nanoparticle had no significant cytotoxicity and by which delivered RNA plasmid inhibited cell viability significantly (P plasmid complex-transfected Balb c/nude tumor xenograft. In conclusion, Bag-1 is confirmed an anti-apoptosis gene that functioned in colorectal cancer, and the mechanism of Bag-1 gene causing colorectal cancer may be related to Wnt/β-catenin signaling pathway abnormality and suggested that magnetic gold nanoparticle-delivered siRNA plasmid silencing Bag-1 is an effective gene therapy method for colorectal cancer. PMID:26846101

  8. Silencing of microRNA-155 in mice during acute inflammatory response leads to derepression of c/ebp Beta and down-regulation of G-CSF

    OpenAIRE

    Worm, Jesper; Stenvang, Jan; Petri, Andreas; Frederiksen, Klaus Stensgaard; Obad, Susanna; Elmén, Joacim; Hedtjärn, Maj; Straarup, Ellen Marie; Hansen, Jens Bo; Kauppinen, Sakari

    2009-01-01

    microRNA-155 (miR-155) has been implicated as a central regulator of the immune system, but its function during acute inflammatory responses is still poorly understood. Here we show that exposure of cultured macrophages and mice to lipopolysaccharide (LPS) leads to up-regulation of miR-155 and that the transcription factor c/ebp Beta is a direct target of miR-155. Interestingly, expression profiling of LPS-stimulated macrophages combined with overexpression and silencing of miR-155 in murine ...

  9. Silencing of microRNA-155 in mice during acute inflammatory response leads to derepression of c/ebp Beta and down-regulation of G-CSF.

    Science.gov (United States)

    Worm, Jesper; Stenvang, Jan; Petri, Andreas; Frederiksen, Klaus Stensgaard; Obad, Susanna; Elmén, Joacim; Hedtjärn, Maj; Straarup, Ellen Marie; Hansen, Jens Bo; Kauppinen, Sakari

    2009-09-01

    microRNA-155 (miR-155) has been implicated as a central regulator of the immune system, but its function during acute inflammatory responses is still poorly understood. Here we show that exposure of cultured macrophages and mice to lipopolysaccharide (LPS) leads to up-regulation of miR-155 and that the transcription factor c/ebp Beta is a direct target of miR-155. Interestingly, expression profiling of LPS-stimulated macrophages combined with overexpression and silencing of miR-155 in murine macrophages and human monocytic cells uncovered marked changes in the expression of granulocyte colony-stimulating factor (G-CSF), a central regulator of granulopoiesis during inflammatory responses. Consistent with these data, we show that silencing of miR-155 in LPS-treated mice by systemically administered LNA-antimiR results in derepression of the c/ebp Beta isoforms and down-regulation of G-CSF expression in mouse splenocytes. Finally, we report for the first time on miR-155 silencing in vivo in a mouse inflammation model, which underscores the potential of miR-155 antagonists in the development of novel therapeutics for treatment of chronic inflammatory diseases. PMID:19596814

  10. Saturation of recognition elements blocks evolution of new tRNA identities

    Science.gov (United States)

    Saint-Léger, Adélaïde; Bello, Carla; Dans, Pablo D.; Torres, Adrian Gabriel; Novoa, Eva Maria; Camacho, Noelia; Orozco, Modesto; Kondrashov, Fyodor A.; Ribas de Pouplana, Lluís

    2016-01-01

    Understanding the principles that led to the current complexity of the genetic code is a central question in evolution. Expansion of the genetic code required the selection of new transfer RNAs (tRNAs) with specific recognition signals that allowed them to be matured, modified, aminoacylated, and processed by the ribosome without compromising the fidelity or efficiency of protein synthesis. We show that saturation of recognition signals blocks the emergence of new tRNA identities and that the rate of nucleotide substitutions in tRNAs is higher in species with fewer tRNA genes. We propose that the growth of the genetic code stalled because a limit was reached in the number of identity elements that can be effectively used in the tRNA structure. PMID:27386510

  11. In Nicotiana species, an artificial microRNA corresponding to the virulence modulating region of Potato spindle tuber viroid directs RNA silencing of a soluble inorganic pyrophosphatase gene and the development of abnormal phenotypes.

    Science.gov (United States)

    Eamens, Andrew L; Smith, Neil A; Dennis, Elizabeth S; Wassenegger, Michael; Wang, Ming-Bo

    2014-02-01

    Potato spindle tuber viroid (PSTVd) is a small non-protein-coding RNA pathogen that can induce disease symptoms in a variety of plant species. How PSTVd induces disease symptoms is a long standing question. It has been suggested that PSTVd-derived small RNAs (sRNAs) could direct RNA silencing of a targeted host gene(s) resulting in symptom development. To test this, we expressed PSTVd sequences as artificial microRNAs (amiRNAs) in Nicotiana tabacum and Nicotiana benthamiana. One amiRNA, amiR46 that corresponds to sequences within the PSTVd virulence modulating region (VMR), induced abnormal phenotypes in both Nicotiana species that closely resemble those displayed by PSTVd infected plants. In N. tabacum amiR46 plants, phenotype severity correlated with amiR46 accumulation and expression down-regulation of the bioinformatically-identified target gene, a Nicotiana soluble inorganic pyrophosphatase (siPPase). Taken together, our phenotypic and molecular analyses suggest that disease symptom development in Nicotiana species following PSTVd infection results from sRNA-directed RNA silencing of the host gene, siPPase. PMID:24503090

  12. The effect of silencing 20E biosynthesis relative genes by feeding bacterially expressed dsRNA on the larval development of Chilo suppressalis.

    Science.gov (United States)

    Zhu, Jian; Dong, Yong-Cheng; Li, Ping; Niu, Chang-Ying

    2016-01-01

    RNA interference (RNAi) is a robust tool to study gene functions as well as potential for insect pest control. Finding suitable target genes is the key step in the development of an efficient RNAi-mediated pest control technique. Based on the transcriptome of Chilo suppressalis, 24 unigenes which putatively associated with insect hormone biosynthesis were identified. Amongst these, four genes involved in ecdysteroidogenesis i.e., ptth, torso, spook and nm-g were evaluated as candidate targets for function study. The partial cDNA of these four genes were cloned and their bacterially expressed dsRNA were fed to the insects. Results revealed a significant reduction in mRNA abundance of target genes after 3 days. Furthermore, knocked down of these four genes resulted in abnormal phenotypes and high larval mortality. After 15 days, the survival rates of insects in dsspook, dsptth, dstorso, and dsnm-g groups were significantly reduced by 32%, 38%, 56%, and 67% respectively, compared with control. Moreover, about 80% of surviving larvae showed retarded development in dsRNA-treated groups. These results suggest that oral ingestion of bacterially expressed dsRNA in C. suppressalis could silence ptth, torso, spook and nm-g. Oral delivery of bacterially expressed dsRNA provides a simple and potential management scheme against C. suppressalis. PMID:27352880

  13. The effect of silencing 20E biosynthesis relative genes by feeding bacterially expressed dsRNA on the larval development of Chilo suppressalis

    Science.gov (United States)

    Zhu, Jian; Dong, Yong-Cheng; Li, Ping; Niu, Chang-Ying

    2016-01-01

    RNA interference (RNAi) is a robust tool to study gene functions as well as potential for insect pest control. Finding suitable target genes is the key step in the development of an efficient RNAi-mediated pest control technique. Based on the transcriptome of Chilo suppressalis, 24 unigenes which putatively associated with insect hormone biosynthesis were identified. Amongst these, four genes involved in ecdysteroidogenesis i.e., ptth, torso, spook and nm-g were evaluated as candidate targets for function study. The partial cDNA of these four genes were cloned and their bacterially expressed dsRNA were fed to the insects. Results revealed a significant reduction in mRNA abundance of target genes after 3 days. Furthermore, knocked down of these four genes resulted in abnormal phenotypes and high larval mortality. After 15 days, the survival rates of insects in dsspook, dsptth, dstorso, and dsnm-g groups were significantly reduced by 32%, 38%, 56%, and 67% respectively, compared with control. Moreover, about 80% of surviving larvae showed retarded development in dsRNA-treated groups. These results suggest that oral ingestion of bacterially expressed dsRNA in C. suppressalis could silence ptth, torso, spook and nm-g. Oral delivery of bacterially expressed dsRNA provides a simple and potential management scheme against C. suppressalis. PMID:27352880

  14. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor-Ne...

  15. The "tobacco mosaic virus" 126-kDa protein associated with virus replication and movement suppresses RNA silencing

    Science.gov (United States)

    Systemic symptoms induced on "Nicotiana tabacum" cv. Xanthi by "Tobacco mosaic virus" (TMV) are modulated by one or both amino-coterminal viral 126- and 183-kDa proteins, proteins involved in virus replication and cell-to-cell movement. Here we compare the systemic accumulation and gene silencing c...

  16. The P1 protein, not HC-Pro, of Wheat streak mosaic virus is a suppressor of RNA silencing

    Science.gov (United States)

    HC-Pro, a well-characterized multi-functional protein encoded by members of the genus Potyvirus, has been shown to be involved in aphid transmission, replication maintenance, systemic movement, and posttranscriptional gene silencing (PTGS) suppression, and to be a determinant of disease synergism in...

  17. Extendable blocking probe in reverse transcription for analysis of RNA variants with superior selectivity

    Science.gov (United States)

    Ho, Tho H.; Dang, Kien X.; Lintula, Susanna; Hotakainen, Kristina; Feng, Lin; Olkkonen, Vesa M.; Verschuren, Emmy W.; Tenkanen, Tuomas; Haglund, Caj; Kolho, Kaija-Leena; Stenman, Ulf-Hakan; Stenman, Jakob

    2015-01-01

    Here we provide the first strategy to use a competitive Extendable Blocking Probe (ExBP) for allele-specific priming with superior selectivity at the stage of reverse transcription. In order to analyze highly similar RNA variants, a reverse-transcriptase primer whose sequence matches a specific variant selectively primes only that variant, whereas mismatch priming to the alternative variant is suppressed by virtue of hybridization and subsequent extension of the perfectly matched ExBP on that alternative variant template to form a cDNA–RNA hybrid. This hybrid will render the alternative RNA template unavailable for mismatch priming initiated by the specific primer in a hot-start protocol of reverse transcription when the temperature decreases to a level where such mismatch priming could occur. The ExBP-based reverse transcription assay detected BRAF and KRAS mutations in at least 1000-fold excess of wild-type RNA and detection was linear over a 4-log dynamic range. This novel strategy not only reveals the presence or absence of rare mutations with an exceptionally high selectivity, but also provides a convenient tool for accurate determination of RNA variants in different settings, such as quantification of allele-specific expression. PMID:25378315

  18. Silencing of hpv16 e6 and e7 oncogenic activities by small interference rna induces autophagy and apoptosis in human cervical cancer cells

    Directory of Open Access Journals (Sweden)

    Jonathan Salazar-León

    2011-08-01

    Full Text Available Cervical cancer is the second most common form of death by cancer in women worldwide and has special attention for the development of new treatment strategies. Human Papilloma Virus (HPV persistent infection is the main etiological agent of this neoplasia, and the main cellular transformation mechanism is by disruption of p53 and pRb function by interaction with HPV E6 and E7 oncoproteins. This generates alterations in cellular differentiation and cellular death inhibition. Thus, HPV E6 and E7 oncogenes represent suitable targets for the development of gene therapy strategies against cervical cancer. An attractive technology platform is developing for post-transcriptional selective silencing of gene expression, using small interference RNA. Therefore, in the present study, we used SiHa cells (HPV16+ transiently transfected with specific siRNA expression plasmids for HPV16 E6 and E7 oncogenes. In this model we detected repression of E6 and E7 oncogene and oncoprotein expression, an increase in p53 and hypophosphorylated pRb isoform protein expression, and autophagy and apoptosis morphology features. These findings suggest that selective silencing of HPV16 E6 and E7 oncogenes by siRNAs, has significant biological effects on the survival of human cancer cells and is a potential gene therapy strategy against cervical cancer.

  19. miRNA-Mediated KHSRP Silencing Rewires Distinct Post-transcriptional Programs during TGF-β-Induced Epithelial-to-Mesenchymal Transition.

    Science.gov (United States)

    Puppo, Margherita; Bucci, Gabriele; Rossi, Martina; Giovarelli, Matteo; Bordo, Domenico; Moshiri, Arfa; Gorlero, Franco; Gherzi, Roberto; Briata, Paola

    2016-07-26

    Epithelial-to-mesenchymal transition (EMT) confers several traits to cancer cells that are required for malignant progression. Here, we report that miR-27b-3p-mediated silencing of the single-strand RNA binding protein KHSRP is required for transforming growth factor β (TGF-β)-induced EMT in mammary gland cells. Sustained KHSRP expression limits TGF-β-dependent induction of EMT factors and cell migration, whereas its knockdown in untreated cells mimics TGF-β-induced EMT. Genome-wide sequencing analyses revealed that KHSRP controls (1) levels of mature miR-192-5p, a microRNA that targets a group of EMT factors, and (2) alternative splicing of a cohort of pre-mRNAs related to cell adhesion and motility including Cd44 and Fgfr2. KHSRP belongs to a ribonucleoprotein complex that includes hnRNPA1, and the two proteins cooperate in promoting epithelial-type exon usage of select pre-mRNAs. Thus, TGF-β-induced KHSRP silencing is central in a pathway leading to gene-expression changes that contribute to the cellular changes linked to EMT. PMID:27396342

  20. Silencing tissue inhibitors of metalloproteinases (TIMPs) with short interfering RNA reveals a role for TIMP-1 in hepatic stellate cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Fowell, Andrew J., E-mail: ajf2@soton.ac.uk [Liver and Pancreas Group, University of Southampton, Division of Infection, Inflammation and Immunity, Southampton General Hospital, Southampton (United Kingdom); Collins, Jane E.; Duncombe, Dale R.; Pickering, Judith A. [Liver and Pancreas Group, University of Southampton, Division of Infection, Inflammation and Immunity, Southampton General Hospital, Southampton (United Kingdom); Rosenberg, William M.C. [Centre for Hepatology, Division of Medicine, University College London, London (United Kingdom); Benyon, R. Christopher [Liver and Pancreas Group, University of Southampton, Division of Infection, Inflammation and Immunity, Southampton General Hospital, Southampton (United Kingdom)

    2011-04-08

    Research highlights: {yields} Myofibroblastic, activated hepatic stellate cells (HSC) play a pivotal role in the development of liver fibrosis. {yields} We used short interfering RNA (siRNA) to investigate the effects of autocrine TIMP-1 and -2 on HSC proliferation. {yields} Specific silencing of TIMP-1, but not TIMP-2, significantly reduces HSC proliferation and is associated with reduced Akt phosphorylation. {yields} TIMP-1 is localised in part to the HSC nucleus. {yields} TIMP-1 might promote liver fibrosis by means other than its previously described anti-apoptotic effect on HSC. -- Abstract: Myofibroblastic, activated hepatic stellate cells (HSC) play a pivotal role in the development of liver fibrosis through the secretion of fibrillar collagens and the tissue inhibitors of metalloproteinase (TIMP)-1 and -2. TIMPs are believed to promote hepatic fibrosis by inhibiting both matrix degradation and apoptosis of HSC. In other cell types, there is evidence that TIMP-1 has effects on proliferation, however the role of TIMPs in the regulation of HSC proliferation remains unexplored. Therefore, we have used short interfering RNA (siRNA) to investigate the effects of autocrine TIMP-1 and -2 on HSC proliferation. TIMP-1 and -2 siRNA were highly effective, producing peak target protein knockdown compared to negative control siRNA of 92% and 63%, respectively. Specific silencing of TIMP-1, using siRNA, significantly reduced HSC proliferation. TIMP-1 was localised in part to the HSC nucleus and TIMP-1 siRNA resulted in loss of both cytoplasmic and nuclear TIMP-1. Attenuated proliferation was associated with reduced Akt phosphorylation and was partially rescued by addition of recombinant TIMP-1. We have revealed a novel autocrine mitogenic effect of TIMP-1 on HSC, which may involve Akt-dependent and specific nuclear mechanisms of action. We suggest that TIMP-1 might promote liver fibrosis by means other than its previously described anti-apoptotic effect on HSC. Moreover

  1. Silencing tissue inhibitors of metalloproteinases (TIMPs) with short interfering RNA reveals a role for TIMP-1 in hepatic stellate cell proliferation

    International Nuclear Information System (INIS)

    Research highlights: → Myofibroblastic, activated hepatic stellate cells (HSC) play a pivotal role in the development of liver fibrosis. → We used short interfering RNA (siRNA) to investigate the effects of autocrine TIMP-1 and -2 on HSC proliferation. → Specific silencing of TIMP-1, but not TIMP-2, significantly reduces HSC proliferation and is associated with reduced Akt phosphorylation. → TIMP-1 is localised in part to the HSC nucleus. → TIMP-1 might promote liver fibrosis by means other than its previously described anti-apoptotic effect on HSC. -- Abstract: Myofibroblastic, activated hepatic stellate cells (HSC) play a pivotal role in the development of liver fibrosis through the secretion of fibrillar collagens and the tissue inhibitors of metalloproteinase (TIMP)-1 and -2. TIMPs are believed to promote hepatic fibrosis by inhibiting both matrix degradation and apoptosis of HSC. In other cell types, there is evidence that TIMP-1 has effects on proliferation, however the role of TIMPs in the regulation of HSC proliferation remains unexplored. Therefore, we have used short interfering RNA (siRNA) to investigate the effects of autocrine TIMP-1 and -2 on HSC proliferation. TIMP-1 and -2 siRNA were highly effective, producing peak target protein knockdown compared to negative control siRNA of 92% and 63%, respectively. Specific silencing of TIMP-1, using siRNA, significantly reduced HSC proliferation. TIMP-1 was localised in part to the HSC nucleus and TIMP-1 siRNA resulted in loss of both cytoplasmic and nuclear TIMP-1. Attenuated proliferation was associated with reduced Akt phosphorylation and was partially rescued by addition of recombinant TIMP-1. We have revealed a novel autocrine mitogenic effect of TIMP-1 on HSC, which may involve Akt-dependent and specific nuclear mechanisms of action. We suggest that TIMP-1 might promote liver fibrosis by means other than its previously described anti-apoptotic effect on HSC. Moreover, these findings, together

  2. Correction of Mutant p63 in EEC Syndrome Using siRNA Mediated Allele-Specific Silencing Restores Defective Stem Cell Function.

    Science.gov (United States)

    Barbaro, Vanessa; Nasti, Annamaria A; Del Vecchio, Claudia; Ferrari, Stefano; Migliorati, Angelo; Raffa, Paolo; Lariccia, Vincenzo; Nespeca, Patrizia; Biasolo, Mariangela; Willoughby, Colin E; Ponzin, Diego; Palù, Giorgio; Parolin, Cristina; Di Iorio, Enzo

    2016-06-01

    Ectrodactyly-Ectodermal dysplasia-Clefting (EEC) syndrome is a rare autosomal dominant disease caused by heterozygous mutations in the p63 gene and characterized by limb defects, orofacial clefting, ectodermal dysplasia, and ocular defects. Patients develop progressive total bilateral limbal stem cell deficiency, which eventually results in corneal blindness. Medical and surgical treatments are ineffective and of limited benefit. Oral mucosa epithelial stem cells (OMESCs) represent an alternative source of stem cells capable of regenerating the corneal epithelium and, combined with gene therapy, could provide an attractive therapeutic avenue. OMESCs from EEC patients carrying the most severe p63 mutations (p.R279H and p.R304Q) were characterized and the genetic defect of p.R279H silenced using allele-specific (AS) small interfering RNAs (siRNAs). Systematic screening of locked nucleic acid (LNA)-siRNAs against R279H-p63 allele in (i) stable WT-ΔNp63α-RFP and R279H-ΔNp63α-EGFP cell lines, (ii) transient doubly transfected cell lines, and (iii) p.R279H OMESCs, identified a number of potent siRNA inhibitors for the mutant allele, which had no effect on wild-type p63. In addition, siRNA treatment led to longer acquired life span of mutated stem cells compared to controls, less accelerated stem cell differentiation in vitro, reduced proliferation properties, and effective ability in correcting the epithelial hypoplasia, thus giving rise to full thickness stratified and differentiated epithelia. This study demonstrates the phenotypic correction of mutant stem cells (OMESCs) in EEC syndrome by means of siRNA mediated AS silencing with restoration of function. The application of siRNA, alone or in combination with cell-based therapies, offers a therapeutic strategy for corneal blindness in EEC syndrome. Stem Cells 2016;34:1588-1600. PMID:26891374

  3. A lincRNA connected to cell mortality and epigenetically-silenced in most common human cancers.

    Science.gov (United States)

    Vrba, Lukas; Garbe, James C; Stampfer, Martha R; Futscher, Bernard W

    2015-01-01

    Immortality is an essential characteristic of human carcinoma cells. We recently developed an efficient, reproducible method that immortalizes human mammary epithelial cells (HMEC) in the absence of gross genomic changes by targeting 2 critical senescence barriers. Consistent transcriptomic changes associated with immortality were identified using microarray analysis of isogenic normal finite pre-stasis, abnormal finite post-stasis, and immortal HMECs from 4 individuals. A total of 277 genes consistently changed in cells that transitioned from post-stasis to immortal. Gene ontology analysis of affected genes revealed biological processes significantly altered in the immortalization process. These immortalization-associated changes showed striking similarity to the gene expression changes seen in The Cancer Genome Atlas (TCGA) clinical breast cancer data. The most dramatic change in gene expression seen during the immortalization step was the downregulation of an unnamed, incompletely annotated transcript that we called MORT, for mortality, since its expression was closely associated with the mortal, finite lifespan phenotype. We show here that MORT (ZNF667-AS1) is expressed in all normal finite lifespan human cells examined to date and is lost in immortalized HMEC. MORT gene silencing at the mortal/immortal boundary was due to DNA hypermethylation of its CpG island promoter. This epigenetic silencing is also seen in human breast cancer cell lines and in a majority of human breast tumor tissues. The functional importance of DNA hypermethylation in MORT gene silencing is supported by the ability of 5-aza-2'-deoxycytidine to reactivate MORT expression. Analysis of TCGA data revealed deregulation of MORT expression due to DNA hypermethylation in 15 out of the 17 most common human cancers. The epigenetic silencing of MORT in a large majority of the common human cancers suggests a potential fundamental role in cellular immortalization during human carcinogenesis. PMID

  4. Cytopathological evaluations combined RNA and protein analyses on defined cell regions using single frozen tissue block

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The co-existence of multiple cell components in tissue samples is the main obstacle for precise molecular evaluation on defined cell types. Based on morphological examination, we developed an efficient approach for paralleled RNA and protein isolations from an identical histological region in frozen tissue section.The RNA and protein samples prepared were sufficient for RT-PCR and Western blot analyses, and the results obtained were well coincident each other as well as with the corresponding parameters revealed from immunohistochemical examinations. By this way, the sampling problem caused by cell-cross contamination can be largely avoided, committing the experimental data more specific to a defined cell type. These novel methods thus allow us to use single tissue block for a comprehensive study by integration of conventional cytological evaluations with nucleic acid and protein analyses.

  5. Chitosan/siRNA functionalized titanium surface via a layer-by-layer approach for in vitro sustained gene silencing and osteogenic promotion.

    Science.gov (United States)

    Song, Wen; Song, Xin; Yang, Chuanxu; Gao, Shan; Klausen, Lasse Hyldgaard; Zhang, Yumei; Dong, Mingdong; Kjems, Jørgen

    2015-01-01

    Titanium surface modification is crucial to improving its bioactivity, mainly its bone binding ability in bone implant materials. In order to functionalize titanium with small interfering RNA (siRNA) for sustained gene silencing in nearby cells, the layer-by-layer (LbL) approach was applied using sodium hyaluronate and chitosan/siRNA (CS/siRNA) nanoparticles as polyanion and polycation, respectively, to build up the multilayered film on smooth titanium surfaces. The CS/siRNA nanoparticle characterization was analyzed first. Dynamic contact angle, atomic force microscopy, and scanning electron microscopy were used to monitor the layer accumulation. siRNA loaded in the film was quantitated and the release profile of film in phosphate-buffered saline was studied. In vitro knockdown effect and cytotoxicity evaluation of the film were investigated using H1299 human lung carcinoma cells expressing green fluorescent protein (GFP). The transfection of human osteoblast-like cell MG63 and H1299 were performed and the osteogenic differentiation of MG63 on LbL film was analyzed. The CS/siRNA nanoparticles exhibited nice size distribution. During formation of the film, the surface wettability, topography, and roughness were alternately changed, indicating successful adsorption of the individual layers. The scanning electron microscope images clearly demonstrated the hybrid structure between CS/siRNA nanoparticles and sodium hyaluronate polymer. The cumulated load of siRNA increased linearly with the bilayer number and, more importantly, a gradual release of the film allowed the siRNA to be maintained on the titanium surface over approximately 1 week. In vitro transfection revealed that the LbL film-associated siRNA could consistently suppress GFP expression in H1299 without showing significant cytotoxicity. The LbL film loading with osteogenic siRNA could dramatically increase the osteogenic differentiation in MG63. In conclusion, LbL technology can potentially modify titanium

  6. Proof-of-concept Studies for siRNA-mediated Gene Silencing for Coagulation Factors in Rat and Rabbit

    OpenAIRE

    Chen, Zhu; Luo, Bin; Cai, Tian-Quan; Thankappan, Anil; Xu, Yiming; Wu, Weizhen; DiMuzio, Jillian; Lifsted, Traci; DiPietro, Marty; Disa, Jyoti; Ng, Bruce; Leander, Karen; Clark, Seth; Hoos, Lizbeth; Zhou, Yuchen

    2015-01-01

    The present study aimed at establishing feasibility of delivering short interfering RNA (siRNA) to target the coagulation cascade in rat and rabbit, two commonly used species for studying thrombosis and hemostasis. siRNAs that produced over 90% mRNA knockdown of rat plasma prekallikrein and rabbit Factor X (FX) were identified from in vitro screens. An ionizable amino lipid based lipid nanoparticle (LNP) formulation for siRNA in vivo delivery was characterized as tolerable and exerting no app...

  7. Silencing of Bcl-XL Expression in Human MGC-803 Gastric Cancer Cells by siRNA

    Institute of Scientific and Technical Information of China (English)

    Xiao-Yong LEI; Miao ZHONG; Lan-Fang FENG; Chun-Yan YAN; Bing-Yang ZHU; Sheng-Song TANG; Duan-Fang LIAO

    2005-01-01

    To investigate the inhibitory effect of the Bcl-XL small interfering RNA (siRNA) on Bcl-XL gene expression in the human gastric cancer cell line MGC-803, green fluorescent protein (GFP) siRNA was constructed and transfected into MGC-803 ceils, together with GFP expression vector pTrace SV40.GFP expression levels were observed using fluorescence microscopy. Bcl-XL siRNA and negative siRNA were then constructed and stably transfected into MGC-803 cells. RT-PCR and immunofluorescence were used to detect the expression of Bcl-XL. Spontaneous apoptosis was detected by acridine orange (AO) and flow cytometry. Results were as follows: (1) 48 h after GFP expression vector and GFP siRNA co-transfection, the expression level of GFP in the GFP siRNA group was much lower than the negative siRNA group,according to fluorescence microscopy results. The mRNA and protein levels of Bcl-XL in Bcl-XL siRNA stable transfectants were reduced to almost background level compared with negative siRNA transfectants or untreated cells. (2) Changes in nucleus morphology was observed by AO staining nucleic and flow cytometry analysis, which showed that stable Bcl-XL siRNA transfectants have an increased spontaneous apoptosis (21.17%± 1.26% vs. 1.19%±0.18% and 1.56%±0.15 % respectively, P<0.05 vs. negative siRNA or untreated control). siRNA targeting GFP or Bcl-XL genes can specifically suppress GFP or Bcl-XL expression in MGC-803 cells, and Bcl-XL siRNA can increase spontaneous apoptosis. Bcl-XL siRNA may be a beneficial agent against human gastric adenocarcinoma.

  8. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma

    OpenAIRE

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A. M.; Remke, M; A. Boro; Grunder, E; Siler, U; Ohgaki, H.; M. D. Taylor; M. Baumgartner; Shalaby, T.; Grotzer, M. A.

    2013-01-01

    Background: microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Methods: Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinic...

  9. Epigenetic silencing of p21 by long non-coding RNA HOTAIR is involved in the cell cycle disorder induced by cigarette smoke extract.

    Science.gov (United States)

    Liu, Yi; Wang, Bairu; Liu, Xinlu; Lu, Lu; Luo, Fei; Lu, Xiaolin; Shi, Le; Xu, Wenchao; Liu, Qizhan

    2016-01-01

    Long noncoding RNAs (lncRNAs), which are epigenetic regulators, are involved in human malignancies. Little is known, however, about the molecular mechanisms for lncRNA regulation of genes induced by cigarette smoke. We recently found that, in human bronchial epithelial (HBE) cells, the lncRNA, Hox transcript antisense intergenic RNA (HOTAIR), is associated with changes in the cell cycle caused by cigarette smoke extract (CSE). In the present study, we report that increased expression of HOTAIR and enhancer of zeste homolog 2 (EZH2), and tri-methylation of Lys 27 of histone H3 (H3K27me3), affect cell cycle progression during CSE-induced transformation of HBE cells. Inhibition of HOTAIR and EZH2 by siRNAs attenuated CSE-induced decreases of p21 levels. Further, ChIP assays verified that HOTAIR and EZH2 were needed to maintain the interaction of H3K27me3 with the promoter regions of p21; combined use of a HOTAIR plasmid and EZH2 siRNA supported this observation. Thus, HOTAIR epigenetic silencing of p21 via EZH2-mediated H3K27 trimethylation contributes to changes in the cell cycle induced by CSE. These observations provide further understanding of the regulation of CSE-induced lung carcinogenesis and identify new therapeutic targets. PMID:26506537

  10. The Drosophila HP1 homolog Rhino is required for transposon silencing and piRNA production by dual-strand clusters.

    Science.gov (United States)

    Klattenhoff, Carla; Xi, Hualin; Li, Chengjian; Lee, Soohyun; Xu, Jia; Khurana, Jaspreet S; Zhang, Fan; Schultz, Nadine; Koppetsch, Birgit S; Nowosielska, Anetta; Seitz, Herve; Zamore, Phillip D; Weng, Zhiping; Theurkauf, William E

    2009-09-18

    Piwi-interacting RNAs (piRNAs) silence transposons and maintain genome integrity during germline development. In Drosophila, transposon-rich heterochromatic clusters encode piRNAs either on both genomic strands (dual-strand clusters) or predominantly one genomic strand (uni-strand clusters). Primary piRNAs derived from these clusters are proposed to drive a ping-pong amplification cycle catalyzed by proteins that localize to the perinuclear nuage. We show that the HP1 homolog Rhino is required for nuage organization, transposon silencing, and ping-pong amplification of piRNAs. rhi mutations virtually eliminate piRNAs from the dual-strand clusters and block production of putative precursor RNAs from both strands of the major 42AB dual-strand cluster, but not of transcripts or piRNAs from the uni-strand clusters. Furthermore, Rhino protein associates with the 42AB dual-strand cluster,but does not bind to uni-strand cluster 2 or flamenco. Rhino thus appears to promote transcription of dual-strand clusters, leading to production of piRNAs that drive the ping-pong amplification cycle. PMID:19732946

  11. DICER/AGO-dependent epigenetic silencing of D4Z4 repeats enhanced by exogenous siRNA suggests mechanisms and therapies for FSHD.

    Science.gov (United States)

    Lim, Jong-Won; Snider, Lauren; Yao, Zizhen; Tawil, Rabi; Van Der Maarel, Silvère M; Rigo, Frank; Bennett, C Frank; Filippova, Galina N; Tapscott, Stephen J

    2015-09-01

    Facioscapulohumeral muscular dystrophy (FSHD) is caused by the aberrant expression of the DUX4 transcription factor in skeletal muscle. The DUX4 retrogene is encoded in the D4Z4 macrosatellite repeat array, and smaller array size or a mutation in the SMCHD1 gene results in inefficient epigenetic repression of DUX4 in skeletal muscle, causing FSHD1 and FSHD2, respectively. Previously we showed that the entire D4Z4 repeat is bi-directionally transcribed with the generation of small si- or miRNA-like fragments and suggested that these might suppress DUX4 expression through the endogenous RNAi pathway. Here we show that exogenous siRNA targeting the region upstream of the DUX4 transcription start site suppressed DUX4 mRNA expression and increased both H3K9 methylation and AGO2 recruitment. In contrast, similarly targeted MOE-gapmer antisense oligonucleotides that degrade RNA but do not engage the RNAi pathway did not repress DUX4 expression. In addition, knockdown of DICER or AGO2 using either siRNA or MOE-gapmer chemistries resulted in the induction of DUX4 expression in control muscle cells that normally do not express DUX4, indicating that the endogenous RNAi pathway is necessary to maintain repression of DUX4 in control muscle cells. Together these data demonstrate a role of the endogenous RNAi pathway in repeat-mediated epigenetic repression of the D4Z4 macrosatellite repeat, and show that enhancing the activity of this pathway by supplying exogenous siRNA oligonucleotides represents a potential therapeutic approach to silencing DUX4 in FSHD. PMID:26041815

  12. Effect of siRNA-induced silencing of cellular prion protein on tyrosine hydroxylase expression in the substantia nigra of a rat model of Parkinson's disease.

    Science.gov (United States)

    Wang, X; Yang, H A; Wang, X N; Du, Y F

    2016-01-01

    The most significant pathological feature of Parkinson's disease (PD) is the progressive degeneration of dopaminergic (DA) neurons in the substantia nigra. Currently, available treatments for PD cannot prevent the loss of DA neurons. Tyrosine hydroxylase (TH) expressed in substantia nigra neurons catalyzes the conversion of tyrosine to L-3,4-dihydroxyphenylalanine (L-DOPA), which is the rate-limiting step of DA biosynthesis. Major reasons for PD occurrence include decreased TH activity in the substantia nigra and secondary DA suppression. Decreased TH activity and the resulting suppression of DA synthesis (or neurotransmission) in the substantia nigra are key factors underlying the development of PD. Cellular prion protein (PRP) is a membrane glycoprotein expressed in the central nervous system. Although the sequence of PRP is highly conserved, its physiological function is unclear. The purpose of this study was to investigate the effect of PRP-targeted small interfering RNA (siRNA) on TH expression in a rat model of PD. Thirty male Wistar rats were injected with 6-hydroxydopamine (6-OHDA) to generate a model of PD. The rats then received injections of PRP-siRNA or nonsense siRNA in the lateral ventricles. Substantia nigra samples were collected for quantification of PRP and TH expression using real-time polymerase chain reaction and western blotting. PRP-siRNA decreased PRP expression in the substantia nigra. TH expression was decreased in PD model rats but was increased after PRP silencing. We conclude that PRP-siRNA may increase TH expression in vivo and may therefore exert protective effects on neurons in a model of PD. PMID:27173342

  13. Post-transcriptional silencing of the SGE1 gene induced by a dsRNA hairpin in Fusarium oxysporum f. sp cubense, the causal agent of Panama disease.

    Science.gov (United States)

    Fernandes, J S; Angelo, P C S; Cruz, J C; Santos, J M M; Sousa, N R; Silva, G F

    2016-01-01

    Fusarium oxysporum f. sp cubense (Foc), the causal agent of Panama disease, is responsible for economic losses in banana crops worldwide. The identification of genes that effectively act on pathogenicity and/or virulence may contribute to the development of different strategies for disease control and the production of resistant plants. The objective of the current study was to analyze the importance of SGE1 gene expression in Foc virulence through post-transcriptional silencing using a double-stranded RNA hairpin. Thirteen transformants were selected based on different morphological characteristics, and sporulation in these transformants was significantly reduced by approximately 95% (P < 0.05) compared to that of the wild-type strain. The relative SGE1 expression levels in the transformant strains were reduced by 27 to 47% compared to those in the wild-type strain. A pathogenicity analysis revealed that the transformants were able to reach the rhizomes and pseudostems of the inoculated banana plants. However, the transformants induced initial disease symptoms in the banana plants approximately 10 days later than that by the wild-type Foc, and initial disease symptoms persisted even at 45 days after inoculation. These results indicate that the SGE1 gene is directly involved in the virulence of Foc. Therefore, SGE1 may be a potential candidate for host-induced gene silencing in banana plants. PMID:27173186

  14. Enhanced Gene Delivery and siRNA Silencing by Gold Nanoparticles Coated with Charge-Reversal Polyelectrolyte

    OpenAIRE

    Guo, Shutao; Huang, Yuanyu; Jiang, Qiao; Sun, Yun; Deng, Liandong; Liang, Zicai; Du, Quan; Xing, Jinfeng; Zhao, Yuliang; Wang, Paul C.; Dong, Anjie; Liang, Xing-Jie

    2010-01-01

    Charge-reversal functional gold nanoparticles first prepared by layer-by-layer technique were employed to deliver small interfering RNA (siRNA) and plasmid DNA into cancer cells. Polyacrylamide gel electrophoresis measurements of siRNA confirmed the occurrence of the charge-reversal property of functional gold nanoparticles. The expression efficiency of enhanced green fluorescent protein (EGFP) was improved by adjuvant transfection with charge-reversal functional gold nanoparticles, which als...

  15. Proof-of-concept Studies for siRNA-mediated Gene Silencing for Coagulation Factors in Rat and Rabbit

    Science.gov (United States)

    Chen, Zhu; Luo, Bin; Cai, Tian-Quan; Thankappan, Anil; Xu, Yiming; Wu, Weizhen; DiMuzio, Jillian; Lifsted, Traci; DiPietro, Marty; Disa, Jyoti; Ng, Bruce; Leander, Karen; Clark, Seth; Hoos, Lizbeth; Zhou, Yuchen; Jochnowitz, Nina; Jachec, Christine; Szczerba, Peter; Gindy, Marian E.; Strapps, Walter; Sepp-Lorenzino, Laura; Seiffert, Dietmar A.; Lubbers, Laura; Tadin-Strapps, Marija

    2015-01-01

    The present study aimed at establishing feasibility of delivering short interfering RNA (siRNA) to target the coagulation cascade in rat and rabbit, two commonly used species for studying thrombosis and hemostasis. siRNAs that produced over 90% mRNA knockdown of rat plasma prekallikrein and rabbit Factor X (FX) were identified from in vitro screens. An ionizable amino lipid based lipid nanoparticle (LNP) formulation for siRNA in vivo delivery was characterized as tolerable and exerting no appreciable effect on coagulability at day 7 postdosing in both species. Both prekallikrein siRNA-LNP and FX siRNA-LNP resulted in dose-dependent and selective knockdown of target gene mRNA in the liver with maximum reduction of over 90% on day 7 following a single dose of siRNA-LNP. Knockdown of plasma prekallikrein was associated with modest clot weight reduction in the rat arteriovenous shunt thrombosis model and no increase in the cuticle bleeding time. Knockdown of FX in the rabbit was accompanied with prolongation in ex vivo clotting times. Results fit the expectations with both targets and demonstrate for the first time, the feasibility of targeting coagulation factors in rat, and, more broadly, targeting a gene of interest in rabbit, via systemic delivery of ionizable LNP formulated siRNA. PMID:25625614

  16. The importance of RT-qPCR primer design for the detection of siRNA-mediated mRNA silencing

    Directory of Open Access Journals (Sweden)

    Lasham Annette

    2011-05-01

    Full Text Available Abstract Background The use of RNAi to analyse gene function in vitro is now widely applied in biological research. However, several difficulties are associated with its use in vivo, mainly relating to inefficient delivery and non-specific effects of short RNA duplexes in animal models. The latter can lead to false positive results when real-time RT-qPCR alone is used to measure target mRNA knockdown. Findings We observed that detection of an apparent siRNA-mediated knockdown in vivo was dependent on the primers used for real-time RT-qPCR measurement of the target mRNA. Two siRNAs specific for RRM1 with equivalent activity in vitro were administered to A549 xenografts via intratumoural injection. In each case, apparent knockdown of RRM1 mRNA was observed only when the primer pair used in RT-qPCR flanked the siRNA cleavage site. This false-positive result was found to result from co-purified siRNA interfering with both reverse transcription and qPCR. Conclusions Our data suggest that using primers flanking the siRNA-mediated cleavage site in RT-qPCR-based measurements of mRNA knockdown in vivo can lead to false positive results. This is particularly relevant where high concentrations of siRNA are introduced, particularly via intratumoural injection, as the siRNA may be co-purified with the RNA and interfere with downstream enzymatic steps. Based on these results, using primers flanking the siRNA target site should be avoided when measuring knockdown of target mRNA by real-time RT-qPCR.

  17. Silencing by blasting: combination of laser pulse induced stress waves and magnetophoresis for siRNA delivery

    Science.gov (United States)

    Babincová, M.; Babincová, N.; Durdík, S.; Bergemann, C.; Sourivong, P.

    2016-06-01

    A new method is developed for efficient delivery of short interference RNA into cells using combination of magnetophoresis for pre-concentration of siRNA-magnetic nanoparticle complex on the surface of cells with subsequent nanosecond laser pulse generating stress waves in transfection chamber, which is able to permeabilize cell membrane for the facilitated delivery of siRNA into the cell interior. As has been shown using siRNA inducing cell apoptosis, combination of these two physical factors increased the efficiency of three different human carcinoma cells transfection to 93%, 89%, and 84%, for HeLa (cervical carcinoma), MCF-7 (breast carcinoma), and UCI-107 (ovarian carcinoma) cells, respectively. This new physical method of siRNA delivery may have therefore far reaching applications in biotechnology and functional genomics.

  18. Dynamic Contrast Enhanced MRI Assessing the Antiangiogenic Effect of Silencing HIF-1α with Targeted Multifunctional ECO/siRNA Nanoparticles.

    Science.gov (United States)

    Malamas, Anthony S; Jin, Erlei; Gujrati, Maneesh; Lu, Zheng-Rong

    2016-07-01

    Stabilization of hypoxia inducible factor 1α (HIF-1α), a biomarker of hypoxia, in hypoxic tumors mediates a variety of downstream genes promoting tumor angiogenesis and cancer cell survival as well as invasion, and compromising therapeutic outcome. In this study, dynamic contrast enhanced MRI (DCE-MRI) with a biodegradable macromolecular MRI contrast agent was used to noninvasively assess the antiangiogenic effect of RGD-targeted multifunctional lipid ECO/siHIF-1α nanoparticles in a mouse HT29 colon cancer model. The RGD-targeted ECO/siHIF-1α nanoparticles resulted in over 50% reduction in tumor size after intravenous injection at a dose of 2.0 mg of siRNA/kg every 3 days for 3 weeks compared to a saline control. DCE-MRI revealed significant decline in vascularity and over a 70% reduction in the tumor blood flow, permeability-surface area product, and plasma volume fraction vascular parameters in the tumor treated with the targeted ECO/siHIF-1α nanoparticles. The treatment with targeted ECO/siRNA nanoparticles resulted in significant silencing of HIF-1α expression at the protein level, which also significantly suppressed the expression of VEGF, Glut-1, HKII, PDK-1, LDHA, and CAIX, which are all important players in tumor angiogenesis, glycolytic metabolism, and pH regulation. By possessing the ability to elicit a multifaceted effect on tumor biology, silencing HIF-1α with RGD-targeted ECO/siHIF-1α nanoparticles has great promise as a single therapy or in combination with traditional chemotherapy or radiation strategies to improve cancer treatment. PMID:27264671

  19. Cyclophilin inhibitors block arterivirus replication by interfering with viral RNA synthesis.

    Science.gov (United States)

    de Wilde, Adriaan H; Li, Yanhua; van der Meer, Yvonne; Vuagniaux, Grégoire; Lysek, Robert; Fang, Ying; Snijder, Eric J; van Hemert, Martijn J

    2013-02-01

    Virus replication strongly depends on cellular factors, in particular, on host proteins. Here we report that the replication of the arteriviruses equine arteritis virus (EAV) and porcine reproductive and respiratory syndrome virus (PRRSV) is strongly affected by low-micromolar concentrations of cyclosporine A (CsA), an inhibitor of members of the cyclophilin (Cyp) family. In infected cells, the expression of a green fluorescent protein (GFP) reporter gene inserted into the PRRSV genome was inhibited with a half-maximal inhibitory concentration (IC(50)) of 5.2 μM, whereas the GFP expression of an EAV-GFP reporter virus was inhibited with an IC(50) of 0.95 μM. Debio-064, a CsA analog that lacks its undesirable immunosuppressive properties, inhibited EAV replication with an IC(50) that was 3-fold lower than that of CsA, whereas PRRSV-GFP replication was inhibited with an IC(50) similar to that of CsA. The addition of 4 μM CsA after infection prevented viral RNA and protein synthesis in EAV-infected cells, and CsA treatment resulted in a 2.5- to 4-log-unit reduction of PRRSV or EAV infectious progeny. A complete block of EAV RNA synthesis was also observed in an in vitro assay using isolated viral replication structures. The small interfering RNA-mediated knockdown of Cyp family members revealed that EAV replication strongly depends on the expression of CypA but not CypB. Furthermore, upon fractionation of intracellular membranes in density gradients, CypA was found to cosediment with membranous EAV replication structures, which could be prevented by CsA treatment. This suggests that CypA is an essential component of the viral RNA-synthesizing machinery. PMID:23152531

  20. Silencing of cystatin M in metastatic oral cancer cell line MDA-686Ln by siRNA increases cysteine proteinases and legumain activities, cell proliferation and in vitro invasion.

    NARCIS (Netherlands)

    Vigneswaran, N.; Wu, J.; Nagaraj, N.; James, R.; Zeeuwen, P.L.J.M.; Zacharias, W.

    2006-01-01

    Cystatins are inhibitors of lysosomal cysteine proteinases. Cystatin M demonstrates more diverse tissue distribution, target specificity and biological function than other cystatins from the same family. We utilized small interference RNAs (siRNA) to silence cystatin M gene expression in a metastati

  1. Enhancement of Gene Silencing Effect and Membrane Permeability by Peptide-Conjugated 27-Nucleotide Small Interfering RNA

    Directory of Open Access Journals (Sweden)

    Toshio Seyama

    2012-09-01

    Full Text Available Two different sizes of siRNAs, of which one type was 21-nucleotide (nt siRNA containing 2-nt dangling ends and the other type was 27-nt siRNA with blunt ends, were conjugated with a nuclear export signal peptide of HIV-1 Rev at the 5′-sense end. Processing by Dicer enzyme, cell membrane permeability, and RNAi efficiency of the peptide-conjugated siRNAs were examined. Dicer cleaved the peptide-conjugated 27-nt siRNA leading to the release of 21-nt siRNA, whereas the peptide-conjugated 21-nt siRNA was not cleaved. High membrane permeability and cytoplasmic localization was found in the conjugates. Moreover, the peptide-conjugated 27-nt siRNA showed increased potency of RNAi in comparison with the nonmodified 21-nt and 27-nt siRNAs, whereas the peptide-conjugated 21-nt siRNA showed decreased RNAi efficacy. This potent RNAi efficacy is probably owing to acceleration of RISC through recognition by Dicer, as well as to the improvement of cell membrane permeability and intracellular accumulation.

  2. Transgenic tobacco plants expressing siRNA targeted against the Mungbean yellow mosaic virus transcriptional activator protein gene efficiently block the viral DNA accumulation.

    Science.gov (United States)

    Shanmugapriya, Gnanasekaran; Das, Sudhanshu Sekhar; Veluthambi, Karuppannan

    2015-06-01

    Mungbean yellow mosaic virus (MYMV) is a bipartite begomovirus that infects many pulse crops such as blackgram, mungbean, mothbean, Frenchbean, and soybean. We tested the efficacy of the transgenically expressed intron-spliced hairpin RNA gene of the transcriptional activator protein (hpTrAP) in reducing MYMV DNA accumulation. Tobacco plants transformed with the MYMV hpTrAP gene accumulated 21-22 nt siRNA. Leaf discs of the transgenic plants, agroinoculated with the partial dimers of MYMV, displayed pronounced reduction in MYMV DNA accumulation. Thus, silencing of the TrAP gene, a suppressor of gene silencing, emerged as an effective strategy to control MYMV. PMID:26436122

  3. Specific degradation of 3[prime prime or minute] regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5[prime prime or minute]-3[prime prime or minute] spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, T.H.; Moury, B.; Johannessen, M.M.;

    2002-01-01

    genetic background are not major determinants of silencing target regions. We also show that virus-induced gene silencing (VIGS) of GUS in Nicotiana benthamiana is induced equally effectively with Potato virus X carrying either the 5' or 3' third of the GUS coding region. This indicates that both regions...

  4. Nanotechnology approach for drug addiction therapy: Gene silencing using delivery of gold nanorod-siRNA nanoplex in dopaminergic neurons

    OpenAIRE

    Bonoiu, Adela C.; Mahajan, Supriya D.; Ding, Hong; Roy, Indrajit; Yong, Ken-Tye; Kumar, Rajiv; Hu, Rui; Bergey, Earl J.; Schwartz, Stanley A.; Prasad, Paras N.

    2009-01-01

    Drug abuse is a worldwide health concern in which addiction involves activation of the dopaminergic signaling pathway in the brain. Here, we introduce a nanotechnology approach that utilizes gold nanorod-DARPP-32 siRNA complexes (nanoplexes) that target this dopaminergic signaling pathway in the brain. The shift in the localized longitudinal plasmon resonance peak of gold nanorods (GNRs) was used to show their interaction with siRNA. Plasmonic enhanced dark field imaging was used to visualize...

  5. MicroRNA-mediated Silencing of RhoC Inhibits Tumor Invasion and Increases Chemosensitivity to Paclitaxel in SKOV3 Cells in vitro

    Institute of Scientific and Technical Information of China (English)

    PAN Ying; DU Zhen-wu; LENG Wei-chun; ZHOU Jia-wen; WANG Ying-jian; SHENG Min-jia; WANG Jun-rong; ZHANG Gui-zhen

    2011-01-01

    RhoC is a member of the Ras-homologous family of genes which are implicated in tumorigenesis and tumor progression. Up-regulation of RhoC is associated with tumor progression in ovarian carcinoma and RhoC is significantly correlated with the invasive capability of ovarian cancer cell lines in vitro. We developed a system that blocks RhoC in the human ovarian cancer SKOV3 cells using specific MicroRNA(miRNA) interference. By transfecting SKOV3 cells with the plasmid vector to express specific MiRNA that targets human RhoC, we were able to establish a stable clone in which RhoC expression was significantly downregnlated. This resulted in the decreased invasive potential of SKOV3 cells as well as increased chemosensitivity to paclitaxel. RhoC involves in invasion and chemosensitivity of SKOV3, indicating that RhoC may be a promising therapeutic target for ovarian cancer.

  6. Silencing of RTKN2 by siRNA suppresses proliferation, and induces G1 arrest and apoptosis in human bladder cancer cells.

    Science.gov (United States)

    Liao, Yi-Xiang; Zeng, Jin-Min; Zhou, Jia-Jie; Yang, Guang-Hua; Ding, Kun; Zhang, Xian-Jue

    2016-06-01

    Human bladder cancer is the most common urological malignancy in China. One of the causes of carcinogenesis in the cancer may be gene mutation. Therefore, the present study investigated the expression levels of Rhotekin 2 (RTKN2), a Rho effector protein, in human bladder cancer tissues and cell lines, and examined the effect of RTKN2 on the proliferation, cell cycle, apoptosis and invasion of human bladder cancer cell lines. The mRNA expression levels of RTKN2 in 30 human bladder cancer tissue samples were significantly higher, compared with those in 30 normal human bladder tissue samples. The protein expression levels of RTKN2 was markedly higher in T24 and 5637 cells, compared with those in four other human bladder cancer cell lines. The silencing of RTKN2 by small interfering (si)RNA inhibited cell proliferation and arrested cell cycle at the G1 phase, via reducing the expression levels of the MCM10, CDK2, CDC24A and CDC6 cell cycle‑associated proteins in the T24 and 5637 cells. Furthermore, RTKN2 knockdown in the cells led to cell apoptosis and the suppression of invasion. These results suggested that RTKN2 is involved in the carcinogenesis and progression of human bladder cancer, indicating that RTKN2 may be a molecular target in cancer therapy. PMID:27082503

  7. Gene Silencing

    Czech Academy of Sciences Publication Activity Database

    Kertbundit, Sunee; Juříček, Miloslav; Hall, T.C.

    Dordrecht : Springer, 2010 - (Jain, S.; Brar, D.), s. 631-652 ISBN 978-90-481-2966-9 Institutional research plan: CEZ:AV0Z50380511 Keywords : Gene Silencing * RISC complex Subject RIV: EB - Genetics ; Molecular Biology

  8. A novel artificial microRNA expressing AAV vector for phospholamban silencing in cardiomyocytes improves Ca2+ uptake into the sarcoplasmic reticulum.

    Directory of Open Access Journals (Sweden)

    Tobias Gröβl

    Full Text Available In failing rat hearts, post-transcriptonal inhibition of phospholamban (PLB expression by AAV9 vector-mediated cardiac delivery of short hairpin RNAs directed against PLB (shPLBr improves both impaired SERCA2a controlled Ca2+ cycling and contractile dysfunction. Cardiac delivery of shPLB, however, was reported to cause cardiac toxicity in canines. Thus we developed a new AAV vector, scAAV6-amiR155-PLBr, expressing a novel engineered artificial microRNA (amiR155-PLBr directed against PLB under control of a heart-specific hybrid promoter. Its PLB silencing efficiency and safety were compared with those of an AAV vector expressing shPLBr (scAAV6-shPLBr from an ubiquitously active U6 promoter. Investigations were carried out in cultured neonatal rat cardiomyocytes (CM over a period of 14 days. Compared to shPLBr, amiR155-PLBr was expressed at a significantly lower level, resulting in delayed and less pronounced PLB silencing. Despite decreased knockdown efficiency of scAAV6-amiR155-PLBr, a similar increase of the SERCA2a-catalyzed Ca2+ uptake into sarcoplasmic reticulum (SR vesicles was observed for both the shPLBr and amiR155-PLBr vectors. Proteomic analysis confirmed PLB silencing of both therapeutic vectors and revealed that shPLBr, but not the amiR155-PLBr vector, increased the proinflammatory proteins STAT3, STAT1 and activated STAT1 phosphorylation at the key amino acid residue Tyr701. Quantitative RT-PCR analysis detected alterations in the expression of several cardiac microRNAs after treatment of CM with scAAV6-shPLBr and scAAV6-amiR155-PLBr, as well as after treatment with its related amiR155- and shRNAs-expressing control AAV vectors. The results demonstrate that scAAV6-amiR155-PLBr is capable of enhancing the Ca2+ transport function of the cardiac SR PLB/SERCA2a system as efficiently as scAAV6-shPLBr while offering a superior safety profile.

  9. Comparison of helper component-protease RNA silencing suppression activity, subcellular localization, and aggregation of three Korean isolates of Turnip mosaic virus.

    Science.gov (United States)

    Han, Jae-Yeong; Chung, Jinsoo; Kim, Jungkyu; Seo, Eun-Young; Kilcrease, James P; Bauchan, Gary R; Lim, Seungmo; Hammond, John; Lim, Hyoun-Sub

    2016-08-01

    In 2014, we performed a nationwide survey in Korean radish fields to investigate the distribution and variability of Turnip mosaic virus (TuMV). Brassica rapa ssp. pekinensis sap-inoculated with three isolates of TuMV from infected radish tissue showed different symptom severities, whereas symptoms in Raphanus sativus were similar for each isolate. The helper component-protease (HC-Pro) genes of each isolate were sequenced, and phylogenetic analysis showed that the three Korean isolates were clustered into the basal-BR group. The HC-Pro proteins of these isolates were tested for their RNA silencing suppressor (VSR) activity and subcellular localization in Nicotiana benthamiana. A VSR assay by co-agroinfiltration of HC-Pro with soluble-modified GFP (smGFP) showed that HC-Pro of isolate R007 and R041 showed stronger VSR activity than R065. The HC-Pros showed 98.25 % amino acid identity, and weak VSR isolate (R065) has a single variant residue in the C-terminal domain associated with protease activity and self-interaction compared to isolates with strong VSR activity. Formation of large subcellular aggregates of GFP:HC-Pro fusion proteins in N. benthamiana was only observed for HC-Pro from isolates with strong VSR activity, suggesting that R065 'weak' HC-Pro may have diminished self-association; substitution of the variant C-terminal residue largely reversed the HC-Pro aggregation and silencing suppressor characteristics. The lack of correlation between VSR efficiency and induction of systemic necrosis (SN) suggests that differences in viral accumulation due to HC-Pro are not responsible for SN. PMID:27059238

  10. Arabidopsis RRP6L1 and RRP6L2 function in FLOWERING LOCUS C silencing via regulation of antisense RNA synthesis.

    Directory of Open Access Journals (Sweden)

    Jun-Hye Shin

    2014-09-01

    Full Text Available The exosome complex functions in RNA metabolism and transcriptional gene silencing. Here, we report that mutations of two Arabidopsis genes encoding nuclear exosome components AtRRP6L1 and AtRRP6L2, cause de-repression of the main flowering repressor FLOWERING LOCUS C (FLC and thus delay flowering in early-flowering Arabidopsis ecotypes. AtRRP6L mutations affect the expression of known FLC regulatory antisense (AS RNAs AS I and II, and cause an increase in Histone3 K4 trimethylation (H3K4me3 at FLC. AtRRP6L1 and AtRRP6L2 function redundantly in regulation of FLC and also act independently of the exosome core complex. Moreover, we discovered a novel, long non-coding, non-polyadenylated antisense transcript (ASL, for Antisense Long originating from the FLC locus in wild type plants. The AtRRP6L proteins function as the main regulators of ASL synthesis, as these mutants show little or no ASL transcript. Unlike ASI/II, ASL associates with H3K27me3 regions of FLC, suggesting that it could function in the maintenance of H3K27 trimethylation during vegetative growth. AtRRP6L mutations also affect H3K27me3 levels and nucleosome density at the FLC locus. Furthermore, AtRRP6L1 physically associates with the ASL transcript and directly interacts with the FLC locus. We propose that AtRRP6L proteins participate in the maintenance of H3K27me3 at FLC via regulating ASL. Furthermore, AtRRP6Ls might participate in multiple FLC silencing pathways by regulating diverse antisense RNAs derived from the FLC locus.

  11. The P0 gene of Sugarcane yellow leaf virus encodes an RNA silencing suppressor with unique activities

    International Nuclear Information System (INIS)

    The Sugarcane yellow leaf virus (SCYLV) P0, a member of the highly heterologous proteins of poleroviruses, is a suppressor of posttranscriptional gene silencing (PTGS) and has additional activities not seen in other P0 proteins. The P0 protein in previously tested poleroviruses (Beet western yellows virus and Cucurbit aphid-borne yellows virus), suppresses local, but not systemic, PTGS induced by both sense GFP and inverted repeat GF using its F-box-like domain to mediate destabilization of the Argonaute1 protein. We now report that the SCYLV P0 protein not only suppressed local PTGS induced by sense GFP and inverted repeat GF in Nicotiana benthamiana, but also triggered a dosage dependent cell death phenotype in infiltrated leaves and suppressed systemic sense GFP-PTGS. Deletion of the first 15 N-terminal amino acid residues of SCYLV P0 abolished suppression of both local and systemic PTGS and the induction of cell death. In contrast, only systemic PTGS and cell death were lost when the 15 C-terminal amino acid residues were deleted. We conclude that the 15 C-terminal amino acid residue region of SCYLV P0 is necessary for suppressing systemic PTGS and inducing cell death, but is not required for suppression of local PTGS

  12. Blocking the Wnt/β-Catenin Pathway by Lentivirus-Mediated Short Hairpin RNA Targeting β-Catenin Gene Suppresses Silica-Induced Lung Fibrosis in Mice

    Directory of Open Access Journals (Sweden)

    Xin Wang

    2015-09-01

    Full Text Available Silicosis is a form of occupational lung disease caused by inhalation of crystalline silica dust. While the pathogenesis of silicosis is not clearly understood, the Wnt/β-catenin signaling pathway is thought to play a major role in lung fibrosis. To explore the role of Wnt/β-catenin pathway in silicosis, we blocked Wnt/β-catenin pathway both in silica-treated MLE-12 cells (a mouse pulmonary epithelial cell line and in a mouse silicosis model by using a lentiviral vector expressing a short hairpin RNA silencing β-catenin (Lv-shβ-catenin. In vitro, Lv-shβ-catenin significantly decreased the expression of β-catenin, MMP2 and MMP9, and secretion of TGF-β1. In vivo, intratracheal treatment with Lv-shβ-catenin significantly reduced expression of β-catenin in the lung and levels of TGF-β1 in bronchoalveolar lavage fluid, and notably attenuated pulmonary fibrosis as evidenced by hydroxyproline content and collagen I\\III synthesis in silica-administered mice. These results indicate that blockade of the Wnt/β-catenin pathway can prevent the development of silica-induced lung fibrosis. Thus Wnt/β-catenin pathway may be a target in prevention and treatment of silicosis.

  13. Blocking the Wnt/β-Catenin Pathway by Lentivirus-Mediated Short Hairpin RNA Targeting β-Catenin Gene Suppresses Silica-Induced Lung Fibrosis in Mice.

    Science.gov (United States)

    Wang, Xin; Dai, Wujing; Wang, Yanrang; Gu, Qing; Yang, Deyi; Zhang, Ming

    2015-09-01

    Silicosis is a form of occupational lung disease caused by inhalation of crystalline silica dust. While the pathogenesis of silicosis is not clearly understood, the Wnt/β-catenin signaling pathway is thought to play a major role in lung fibrosis. To explore the role of Wnt/β-catenin pathway in silicosis, we blocked Wnt/β-catenin pathway both in silica-treated MLE-12 cells (a mouse pulmonary epithelial cell line) and in a mouse silicosis model by using a lentiviral vector expressing a short hairpin RNA silencing β-catenin (Lv-shβ-catenin). In vitro, Lv-shβ-catenin significantly decreased the expression of β-catenin, MMP2 and MMP9, and secretion of TGF-β1. In vivo, intratracheal treatment with Lv-shβ-catenin significantly reduced expression of β-catenin in the lung and levels of TGF-β1 in bronchoalveolar lavage fluid, and notably attenuated pulmonary fibrosis as evidenced by hydroxyproline content and collagen I\\III synthesis in silica-administered mice. These results indicate that blockade of the Wnt/β-catenin pathway can prevent the development of silica-induced lung fibrosis. Thus Wnt/β-catenin pathway may be a target in prevention and treatment of silicosis. PMID:26340635

  14. Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis

    International Nuclear Information System (INIS)

    Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7shGrb2), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation

  15. A possible role for miRNA silencing in disease phenotype variation in Swedish transthyretin V30M carriers

    Directory of Open Access Journals (Sweden)

    Olsson Malin

    2010-09-01

    Full Text Available Abstract Background Familial amyloidosis with polyneuropathy (FAP is an autosomal dominant disease caused by transthyretin (TTR mutations, of which V30M (TTR c.148G > A, p.Val50Met, "Val30Met" is the most common. Swedish V30M carriers display later age at onset and lower penetrance compared to other populations. Methods In the study, 130 Swedish V30M carriers (32 early, 30 late onset and 68 asymptomatic carriers and 50 controls, 23 French symptomatic V30M carriers and 29 controls and 18 Japanese symptomatic V30M carriers and 29 controls were included. We aimed to identify additional genetic factors in the TTR gene and its surrounding region that could have an impact on phenotype. Results We identified three SNPs (rs71383038, rs3794885 and rs62093482 with a significant difference in allele frequency between Swedish V30M carriers and controls. The two Swedish V30M homozygous patients present in the study also displayed homozygosity for the CA10 (rs71383038, A (rs3794885 and T (rs62093482 alleles in these SNPs. Hence, these alleles are present on the Swedish V30M haplotype. Of these, rs62093482 is located in the 3'UTR of TTR gene and thus more interesting since SNPs in the 3'UTR can affect gene expression levels by modifying microRNA (miRNA targeting activity. miRNA target predictions revealed four potential miRNAs with predicted targets unique for the polymorphic allele. Conclusions Our results are the first to show the presence of a 3'UTR polymorphism on the V30M haplotype in Swedish carriers, which can serve as a miRNA binding site potentially leading to down-regulated expression from the mutated TTR allele. This finding may be related to the low penetrance and high age at onset of the disease observed in the Swedish patient population.

  16. Nanolayered siRNA delivery platforms for local silencing of CTGF reduce cutaneous scar contraction in third-degree burns.

    Science.gov (United States)

    Castleberry, Steven A; Golberg, Alexander; Sharkh, Malak Abu; Khan, Saiqa; Almquist, Benjamin D; Austen, William G; Yarmush, Martin L; Hammond, Paula T

    2016-07-01

    Wound healing is an incredibly complex biological process that often results in thickened collagen-enriched healed tissue called scar. Cutaneous scars lack many functional structures of the skin such as hair follicles, sweat glands, and papillae. The absence of these structures contributes to a number of the long-term morbidities of wound healing, including loss of function for tissues, increased risk of re-injury, and aesthetic complications. Scar formation is a pervasive factor in our daily lives; however, in the case of serious traumatic injury, scars can create long-lasting complications due to contraction and poor tissue remodeling. Within this report we target the expression of connective tissue growth factor (CTGF), a key mediator of TGFβ pro-fibrotic response in cutaneous wound healing, with controlled local delivery of RNA interference. Through this work we describe both a thorough in vitro analysis of nanolayer coated sutures for the controlled delivery of siRNA and its application to improve scar outcomes in a third-degree burn induced scar model in rats. We demonstrate that the knockdown of CTGF significantly altered the local expression of αSMA, TIMP1, and Col1a1, which are known to play roles in scar formation. The knockdown of CTGF within the healing burn wounds resulted in improved tissue remodeling, reduced scar contraction, and the regeneration of papillary structures within the healing tissue. This work adds support to a number of previous reports that indicate CTGF as a potential therapeutic target for fibrosis. Additionally, we believe that the controlled local delivery of siRNA from ultrathin polymer coatings described within this work is a promising approach in RNA interference that could be applied in developing improved cancer therapies, regenerative medicine, and fundamental scientific research. PMID:27108403

  17. Silencing CTL1 mRNA decreases choline transport and cell growth in NG108-15 cells

    Czech Academy of Sciences Publication Activity Database

    Machová, Eva; Michal, Pavel; Lisá, Věra; Doležal, Vladimír

    Praha, 2005. s. 138-138. [Conference of the Czech Neuroscience Society /5./, The Annual Meeting of the Network of European Neuroscience Institutes. 19.11.2005-21.11.2005, Prague] R&D Projects: GA AV ČR(CZ) IAA5011206; GA MŠk(CZ) LC554 Grant ostatní: GA-(XE) QLK1-CT-2002-00172 Institutional research plan: CEZ:AV0Z50110509 Keywords : CTL1 protein knockdown * RNA interference * NG108-15 cells * cell growth * choline transport Subject RIV: ED - Physiology

  18. Thumb Site 2 Inhibitors of Hepatitis C Viral RNA-dependent RNA Polymerase Allosterically Block the Transition from Initiation to Elongation.

    Science.gov (United States)

    Li, Jiawen; Johnson, Kenneth A

    2016-05-01

    Replication of the hepatitis C viral genome is catalyzed by the NS5B (nonstructural protein 5B) RNA-dependent RNA polymerase, which is a major target of antiviral drugs currently in the clinic. Prior studies established that initiation of RNA replication could be facilitated by starting with a dinucleotide (pGG). Here we establish conditions for efficient initiation from GTP to form the dinucleotide and subsequent intermediates leading to highly processive elongation, and we examined the effects of four classes of nonnucleoside inhibitors on each step of the reaction. We show that palm site inhibitors block initiation starting from GTP but not when starting from pGG. In addition we show that nonnucleoside inhibitors binding to thumb site-2 (NNI2) lead to the accumulation of abortive intermediates three-five nucleotides in length. Our kinetic analysis shows that NNI2 do not significantly block initiation or elongation of RNA synthesis; rather, they block the transition from initiation to elongation, which is thought to proceed with significant structural rearrangement of the enzyme-RNA complex including displacement of the β-loop from the active site. Direct measurement in single turnover kinetic studies show that pyrophosphate release is faster than the chemistry step, which appears to be rate-limiting during processive synthesis. These results reveal important new details to define the steps involved in initiation and elongation during viral RNA replication, establish the allosteric mechanisms by which NNI2 inhibitors act, and point the way to the design of more effective allosteric inhibitors that exploit this new information. PMID:26851276

  19. A Cis-Acting tRNA Gene Imposes the Cell Cycle Progression Requirement for Establishing Silencing at the HMR Locus in Yeast

    OpenAIRE

    Lazarus, Asmitha G.; Holmes, Scott G

    2011-01-01

    Numerous studies have determined that the establishment of Sir protein-dependent transcriptional silencing in yeast requires progression through the cell cycle. In our study we examined the cell cycle requirement for the establishment of silencing at the HML and HMR loci using strains bearing conditional or inducible SIR3 alleles. Consistent with prior reports, we observed that establishing silencing at HMR required progression through the cell cycle. Unexpectedly, we found that the HML locus...

  20. Silencing of ABCG2 by MicroRNA-3163 Inhibits Multidrug Resistance in Retinoblastoma Cancer Stem Cells.

    Science.gov (United States)

    Jia, Ming; Wei, Zhenhua; Liu, Peng; Zhao, Xiaoli

    2016-06-01

    To investigate the function and regulation mechanism of ATP-binding cassette, subfamily G, member 2 (ABCG2) in retinoblastoma cancer stem cells (RCSCs), a long-term culture of RCSCs from WERI-Rb1 cell line was successfully established based on the high expression level of ABCG2 on the surface of RCSCs. To further explore the molecular mechanism of ABCG2 on RCSCs, a microRNA that specifically targets ABCG2 was predicted. Subsequently, miR-3163 was selected and confirmed as the ABCG2-regulating microRNA. Overexpression of miR-3163 led to a significant decrease in ABCG2 expression. Additionally, ABCG2 loss-of-function induced anti-proliferation and apoptosis-promoting functions in RCSCs, and multidrug resistance to cisplatin, carboplatin, vincristine, doxorubicin, and etoposide was greatly improved in these cells. Our data suggest that miR-3163 has a significant impact on ABCG2 expression and can influence proliferation, apoptosis, and drug resistance in RCSCs. This work may provide new therapeutic targets for retinoblastoma. PMID:27247490

  1. Silencing stromal interaction molecule 1 by RNA interference inhibits the proliferation and migration of endothelial progenitor cells

    International Nuclear Information System (INIS)

    Research highlights: → STIM1 and TRPC1 are expressed in EPCs. → Knockdown of STIM1 inhibits the proliferation, migration and SOCE of EPCs. → TRPC1-SOC cooperates with STIM1 to mediate the SOCE of EPCs. -- Abstract: Knockdown of stromal interaction molecule 1 (STIM1) significantly suppresses neointima hyperplasia after vascular injury. Endothelial progenitor cells (EPCs) are the major source of cells that respond to endothelium repair and contribute to re-endothelialization by reducing neointima formation after vascular injury. We hypothesized that the effect of STIM1 on neointima hyperplasia inhibition is mediated through its effect on the biological properties of EPCs. In this study, we investigated the effects of STIM1 on the proliferation and migration of EPCs and examined the effect of STIM1 knockdown using cultured rat bone marrow-derived EPCs. STIM1 was expressed in EPCs, and knockdown of STIM1 by adenoviral delivery of small interfering RNA (siRNA) significantly suppressed the proliferation and migration of EPCs. Furthermore, STIM1 knockdown decreased store-operated channel entry 48 h after transfection. Replenishment with recombinant human STIM1 reversed the effects of STIM1 knockdown. Our data suggest that the store-operated transient receptor potential canonical 1 channel is involved in regulating the biological properties of EPCs through STIM1. STIM1 is a potent regulator of cell proliferation and migration in rat EPCs and may play an important role in the biological properties of EPCs.

  2. Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways.

    Directory of Open Access Journals (Sweden)

    Stephanie M Rainey

    2016-04-01

    Full Text Available The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection, and is being introduced into mosquito populations in the wild to block the transmission of arboviruses that infect humans and are a major public health concern. To investigate the mechanisms underlying this antiviral protection, we have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture with the model mosquito-borne Semliki Forest virus (SFV; Togaviridae, Alphavirus. Wolbachia provides strong antiviral protection rapidly after infection, suggesting that an early stage post-infection is being blocked. Wolbachia does appear to have major effects on events distinct from entry, assembly or exit as it inhibits the replication of an SFV replicon transfected into the cells. Furthermore, it causes a far greater reduction in the expression of proteins from the 3´ open reading frame than the 5´ non-structural protein open reading frame, indicating that it is blocking the replication of viral RNA. Further to this separation of the replicase proteins and viral RNA in transreplication assays shows that uncoupling of viral RNA and replicase proteins does not overcome Wolbachia's antiviral activity. This further suggests that replicative processes are disrupted, such as translation or replication, by Wolbachia infection. This may occur by Wolbachia mounting an active antiviral response, but the virus did not cause any transcriptional response by the bacterium, suggesting that this is not the case. Host microRNAs (miRNAs have been implicated in protection, but again we found that host cell miRNA expression was unaffected by the bacterium and neither do our findings suggest any involvement of the antiviral siRNA pathway. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed

  3. Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways.

    Science.gov (United States)

    Rainey, Stephanie M; Martinez, Julien; McFarlane, Melanie; Juneja, Punita; Sarkies, Peter; Lulla, Aleksei; Schnettler, Esther; Varjak, Margus; Merits, Andres; Miska, Eric A; Jiggins, Francis M; Kohl, Alain

    2016-04-01

    The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection, and is being introduced into mosquito populations in the wild to block the transmission of arboviruses that infect humans and are a major public health concern. To investigate the mechanisms underlying this antiviral protection, we have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture with the model mosquito-borne Semliki Forest virus (SFV; Togaviridae, Alphavirus). Wolbachia provides strong antiviral protection rapidly after infection, suggesting that an early stage post-infection is being blocked. Wolbachia does appear to have major effects on events distinct from entry, assembly or exit as it inhibits the replication of an SFV replicon transfected into the cells. Furthermore, it causes a far greater reduction in the expression of proteins from the 3´ open reading frame than the 5´ non-structural protein open reading frame, indicating that it is blocking the replication of viral RNA. Further to this separation of the replicase proteins and viral RNA in transreplication assays shows that uncoupling of viral RNA and replicase proteins does not overcome Wolbachia's antiviral activity. This further suggests that replicative processes are disrupted, such as translation or replication, by Wolbachia infection. This may occur by Wolbachia mounting an active antiviral response, but the virus did not cause any transcriptional response by the bacterium, suggesting that this is not the case. Host microRNAs (miRNAs) have been implicated in protection, but again we found that host cell miRNA expression was unaffected by the bacterium and neither do our findings suggest any involvement of the antiviral siRNA pathway. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed to an induced

  4. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Directory of Open Access Journals (Sweden)

    Yao Han

    Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

  5. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage

    Directory of Open Access Journals (Sweden)

    María José Benítez-Galeano

    2015-07-01

    Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.

  6. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage.

    Science.gov (United States)

    Benítez-Galeano, María José; Rubio, Leticia; Bertalmío, Ana; Maeso, Diego; Rivas, Fernando; Colina, Rodney

    2015-07-01

    Citrus Tristeza Virus (CTV) is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23). Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36) in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD) and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1) the genetic diversity of Uruguayan CTV isolates circulating in the country and (2) the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program. PMID:26205407

  7. Deep sequencing of viroid-derived small RNAs from grapevine provides new insights on the role of RNA silencing in plant-viroid interaction.

    Directory of Open Access Journals (Sweden)

    Beatriz Navarro

    Full Text Available BACKGROUND: Viroids are circular, highly structured, non-protein-coding RNAs that, usurping cellular enzymes and escaping host defense mechanisms, are able to replicate and move through infected plants. Similarly to viruses, viroid infections are associated with the accumulation of viroid-derived 21-24 nt small RNAs (vd-sRNAs with the typical features of the small interfering RNAs characteristic of RNA silencing, a sequence-specific mechanism involved in defense against invading nucleic acids and in regulation of gene expression in most eukaryotic organisms. METHODOLOGY/PRINCIPAL FINDINGS: To gain further insights on the genesis and possible role of vd-sRNAs in plant-viroid interaction, sRNAs isolated from Vitis vinifera infected by Hop stunt viroid (HSVd and Grapevine yellow speckle viroid 1 (GYSVd1 were sequenced by the high-throughput platform Solexa-Illumina, and the vd-sRNAs were analyzed. The large majority of HSVd- and GYSVd1-sRNAs derived from a few specific regions (hotspots of the genomic (+ and (- viroid RNAs, with a prevalence of those from the (- strands of both viroids. When grouped according to their sizes, vd-sRNAs always assumed a distribution with prominent 21-, 22- and 24-nt peaks, which, interestingly, mapped at the same hotspots. CONCLUSIONS/SIGNIFICANCE: These findings show that different Dicer-like enzymes (DCLs target viroid RNAs, preferentially accessing to the same viroid domains. Interestingly, our results also suggest that viroid RNAs may interact with host enzymes involved in the RNA-directed DNA methylation pathway, indicating more complex scenarios than previously thought for both vd-sRNAs genesis and possible interference with host gene expression.

  8. The effects of short hairpin RNA-mediated silencing Net1 on ionizing radiation-induced damage responses

    International Nuclear Information System (INIS)

    Objective: To study the biological roles of the neuroepithelioma transforming gene 1 (Netl) in the cellular responses to ionizing radiation (IR)-induced damage. Methods: Specific shRNA was used to deplete Netl in cells. The effects of Netl depletion on the cellular responses to ionizing radiation were investigated through the clonogenic survival assay and immunoblotting analysis of DNA damage response proteins' phosphorylation. Results: Netl-depleted cells were more sensitive to IR, with a significantly increased induction of apoptosis. In response to IR, the phosphorylation levels of ataxia-telangiectasia mutated and checkpoint kinase 2 were much higher in the Net1-depleted cells than that in the control cells. Conclusion: Net1 protects IR-treated cells from apoptosis and possibly plays an important role in IR-induced damage response and repair. (authors)

  9. DNA interference: DNA-induced gene silencing in the appendicularian Oikopleura dioica.

    Science.gov (United States)

    Omotezako, Tatsuya; Onuma, Takeshi A; Nishida, Hiroki

    2015-05-22

    RNA interference is widely employed as a gene-silencing system in eukaryotes for host defence against invading nucleic acids. In response to invading double-stranded RNA (dsRNA), mRNA is degraded in sequence-specific manner. So far, however, DNA interference (DNAi) has been reported only in plants, ciliates and archaea, and has not been explored in Metazoa. Here, we demonstrate that linear double-stranded DNA promotes both sequence-specific transcription blocking and mRNA degradation in developing embryos of the appendicularian Oikopleura dioica. Introduced polymerase chain reaction (PCR) products or linearized plasmids encoding Brachyury induced tail malformation and mRNA degradation. This malformation was also promoted by DNA fragments of the putative 5'-flanking region and intron without the coding region. PCR products encoding Zic-like1 and acetylcholine esterase also induced loss of sensory organ and muscle acetylcholinesterase activity, respectively. Co-injection of mRNA encoding EGFP and mCherry, and PCR products encoding these fluorescent proteins, induced sequence-specific decrease in the green or red fluorescence, respectively. These results suggest that O. dioica possesses a defence system against exogenous DNA and RNA, and that DNA fragment-induced gene silencing would be mediated through transcription blocking as well as mRNA degradation. This is the first report of DNAi in Metazoa. PMID:25904672

  10. MicroRNA-155 silencing enhances inflammatory response and lipid uptake in oxidized low-density lipoprotein-stimulated human THP-1 macrophages.

    Science.gov (United States)

    Huang, Ri-sheng; Hu, Guan-qiong; Lin, Bin; Lin, Zhi-yi; Sun, Cheng-chao

    2010-12-01

    It has been proposed that the inflammatory response of monocytes/macrophages induced by oxidized low-density lipoprotein (oxLDL) is a key event in the pathogenesis of atherosclerosis. MicroRNA-155 (miR-155) is an important regulator of the immune system and has been shown to be involved in acute inflammatory response. However, the function of miR-155 in oxLDL-stimulated inflammation and atherosclerosis remains unclear. Here, we show that the exposure of human THP-1 macrophages to oxLDL led to a marked up-regulation of miR-155 in a dose-dependent manner. Silencing of endogenous miR-155 in THP-1 cells using locked nucleic acid-modified antisense oligonucleotides significantly enhanced oxLDL-induced lipid uptake, up-regulated the expression of scavenger receptors (lectinlike oxidized LDL receptor-1, cluster of differentiation 36 [CD36], and CD68), and promoted the release of several cytokines including interleukin (IL)-6, -8, and tumor necrosis factor α (TNF-α). Luciferase reporter assay showed that targeting miR-155 promoted nuclear factor-kappa B (NF-κB) nuclear translocation and potentiated the NF-κB-driven transcription activity. Moreover, miR-155 knockdown resulted in a marked increase in the protein amount of myeloid differentiation primary response gene 88 (MyD88), an important adapter protein used by Toll-like receptors to activate the NF-κB pathway. Our data demonstrate that miR-155 serves as a negative feedback regulator in oxLDL-stimulated THP-1 inflammatory responses and lipid uptake and thus might have potential therapeutic implications in atherosclerosis. PMID:21030878

  11. Silencing of hypoxia inducible factor-1α by RNA interference inhibits growth of SK-NEP-1 Wilms tumour cells in vitro, and suppresses tumourigenesis and angiogenesis in vivo.

    Science.gov (United States)

    Shi, Bo; Li, Ying; Wang, Xiuli; Yang, Yi; Li, Dan; Liu, Xin; Yang, Xianghong

    2016-06-01

    Wilms tumour is the most common tumour of the pediatric kidney. Elevation of hypoxia-inducible factor 1α (HIF-1α) has been detected in 93% to 100% of human Wilms tumour specimens, suggesting a potential value of HIF-1α as a therapeutic target for Wilms tumour. In the present study, a stable HIF-1α-silenced Wilms tumour cell strain was established by introducing HIF-1α short-hairpin RNA (shRNA) into SK-NEP-1 cells. Silencing of HIF-1α significantly reduced single-cell growth capacity, suppressed proliferation and arrested cell cycle of SK-NEP-1 cells. In addition, reduction of HIF-1α expression induced apoptosis in SK-NEP-1 cells, which was accompanied by increased levels of cleaved caspase-3, cleaved poly (ADP-ribose) polymerase (PARP) and Bax as well as downregulation of Bcl-2 in the cells. Furthermore, when inoculated subcutaneously in nude mice, HIF-1α-silenced SK-NEP-1 cells displayed retarded tumour growth and impaired tumour angiogenesis. In summary, the findings of this study suggest that HIF-1α plays a critical role in the development of Wilms tumour, and it may serve as a candidate target of gene therapy for Wilms tumour. PMID:27015631

  12. Identification of Pns6, a putative movement protein of RRSV, as a silencing suppressor

    Directory of Open Access Journals (Sweden)

    Lin Qiying

    2010-11-01

    Full Text Available Abstract RNA silencing is a potent antiviral response in plants. As a counterdefense, most plant and some animal viruses encode RNA silencing suppressors. In this study, we showed that Pns6, a putative movement protein of Rice ragged stunt virus (RRSV, exhibited silencing suppressor activity in coinfiltration assays with the reporter green fluorescent protein (GFP in transgenic Nicotiana benthamiana line 16c. Pns6 of RRSV suppressed local silencing induced by sense RNA but had no effect on that induced by dsRNA. Deletion of a region involved in RNA binding abolished the silencing suppressor activity of Pns6. Further, expression of Pns6 enhanced Potato virus × pathogenicity in N. benthamiana. Collectively, these results suggested that RRSV Pns6 functions as a virus suppressor of RNA silencing that targets an upstream step of the dsRNA formation in the RNA silencing pathway. This is the first silencing suppressor to be identified from the genus Oryzavirus.

  13. Inorganic phosphate blocks binding of pre-miRNA to Dicer-2 via its PAZ domain

    OpenAIRE

    Fukunaga, Ryuya; Colpan, Cansu; Han, Bo W.; Zamore, Phillip D.

    2014-01-01

    In Drosophila, Dicer-1 produces microRNAs (miRNAs) from pre-miRNAs, whereas Dicer-2 generates small interfering RNAs from long double-stranded RNA (dsRNA), a process that requires ATP hydrolysis. We previously showed that inorganic phosphate inhibits Dicer-2 cleavage of pre-miRNAs, but not long dsRNAs. Here, we report that phosphate-dependent substrate discrimination by Dicer-2 reflects dsRNA substrate length. Efficient processing by Dicer-2 of short dsRNA requires a 5′ terminal phosphate and...

  14. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied to...... mammalian cells, the technology of RNAi expanded from being a valuable experimental tool to being an applicable method for gene-specific therapeutic regulation, and much effort has been put into further refinement of the technique. This review will focus on how RNAi has developed over the years and how the...

  15. The inhibition of cell proliferation using silencing of N-cadherin gene by siRNA process in human melanoma cell lines.

    Science.gov (United States)

    Ciołczyk-Wierzbicka, D; Gil, D; Laidler, P

    2012-01-01

    Malignant melanoma is a disease with high mortality rate caused by rapid metastasis. Cell motility is physically and biochemically restricted by cadherin-mediated cell interactions and signalling pathways, and alterations in cadherin expression strongly correlate with E to N-cadherin switch as well as the metastasis and progression of tumours. Contrary to E-cadherin, N-cadherin plays an important role in stimulating processes of cell division, migration, differentiation and death. In this study we investigated the role of N-cadherin in proliferation and AKT, ERK, beta-catenin signalling pathway in human melanoma cells: WM793(VGP), WM115(VGP) from the primary tumor site, as well as Lu1205(lung) and WM266-4(skin) from metastatic sites. N-cadherin, pAKT(S473), β-catenin, pERK1/2(T202/Y204), cyclin D1, cyclin D3, cyclin-dependent kinases CDK4, CDK6, and p15, p16, p21, p27 inhibitors expression was determined by western blot analysis. The study on proliferation of cells was performed with the use of BrdU incorporation and crystal violet staining assays. Knock-out of N-cadherin gene expression by siRNA process reduced the expression of: pAKT(S473), pERK1/2(T202/Y204), betacatenin, cyclin D1, cyclin D3, cyclin-dependent kinases CDK4, CDK6 while increasing expression of cell cycle inhibitors p21 and p27, and significantly decreased cell proliferation (50-70%). The collected data indicate that N-cadherin mediates the effect of cell cycle in G1 phase by AKT, β-catenin, and ERK signalling pathway. These results suggest that increased expression of N-cadherin significantly contributes to the increased invasive potential of melanoma cells. Silencing of N-cadherin arrests cell growth at G1 phase and inhibits the entry into S-phase which is of great importance as to its possible future use in cancer treatment. PMID:22300088

  16. Ligand-responsive RNA switches: viral translation regulators, therapeutic targets, and tunable building blocks for nanotechnology

    OpenAIRE

    Boerneke, Mark A.

    2016-01-01

    Ligand-responsive RNA mechanical switches represent a new class of simple and small switching modules which regulate viral translation initiation by adopting well-defined ligand-free and bound conformational states without undergoing large secondary structure rearrangements, distinguishing them from metabolite-sensing riboswitches. Initially discovered in the internal ribosome entry site (IRES) of hepatitis C virus (HCV), RNA switch motifs have now been discovered in the genomes of diverse o...

  17. Silencing of microRNA-21 confers radio-sensitivity through inhibition of the PI3K/AKT pathway and enhancing autophagy in malignant glioma cell lines.

    Directory of Open Access Journals (Sweden)

    Ho-Shin Gwak

    Full Text Available Radiation is a core part of therapy for malignant glioma and is often provided following debulking surgery. However, resistance to radiation occurs in most patients, and the underlying molecular mechanisms of radio-resistance are not fully understood. Here, we demonstrated that microRNA 21 (miR-21, a well-known onco-microRNA in malignant glioma, is one of the major players in radio-resistance. Radio-resistance in different malignant glioma cell lines measured by cytotoxic cell survival assay was closely associated with miR-21 expression level. Blocking miR-21 with anti-miR-21 resulted in radio-sensitization of U373 and U87 cells, whereas overexpression of miR-21 lead to a decrease in radio-sensitivity of LN18 and LN428 cells. Anti-miR-21 sustained γ-H2AX DNA foci formation, which is an indicator of double-strand DNA damage, up to 24 hours and suppressed phospho-Akt (ser473 expression after exposure to γ-irradiation. In a cell cycle analysis, a significant increase in the G₂/M phase transition by anti-miR-21 was observed at 48 hours after irradiation. Interestingly, our results showed that anti-miR-21 increased factors associated with autophagosome formation and autophagy activity, which was measured by acid vesicular organelles, LC3 protein expression, and the percentage of GFP-LC3 positive cells. Furthermore, augmented autophagy by anti-miR-21 resulted in an increase in the apoptotic population after irradiation. Our results show that miR-21 is a pivotal molecule for circumventing radiation-induced cell death in malignant glioma cells through the regulation of autophagy and provide a novel phenomenon for the acquisition of radio-resistance.

  18. A novel dendritic nanocarrier of polyamidoamine-polyethylene glycol-cyclic RGD for “smart” small interfering RNA delivery and in vitro antitumor effects by human ether-à-go-go-related gene silencing in anaplastic thyroid carcinoma cells

    Directory of Open Access Journals (Sweden)

    Li G

    2013-03-01

    Full Text Available Guanhua Li,1,2 Zuojun Hu,1 Henghui Yin,1 Yunjian Zhang,1 Xueling Huang,1 Shenming Wang,1 Wen Li2 1Department of Vascular and Thyroid Surgery, 2Key Laboratory of Surgery, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou, People's Republic of China Abstract: The application of RNA interference techniques is promising in gene therapeutic approaches, especially for cancers. To improve safety and efficiency of small interfering RNA (siRNA delivery, a triblock dendritic nanocarrier, polyamidoamine-polyethylene glycol-cyclic RGD (PAMAM-PEG-cRGD, was developed and studied as an siRNA vector targeting the human ether-à-go-go-related gene (hERG in human anaplastic thyroid carcinoma cells. Structure characterization, particle size, zeta potential, and gel retardation assay confirmed that complete triblock components were successfully synthesized with effective binding capacity of siRNA in this triblock nanocarrier. Cytotoxicity data indicated that conjugation of PEG significantly alleviated cytotoxicity when compared with unmodified PAMAM. PAMAM-PEG-cRGD exerted potent siRNA cellular internalization in which transfection efficiency measured by flow cytometry was up to 68% when the charge ratio (N/P ratio was 3.5. Ligand-receptor affinity together with electrostatic interaction should be involved in the nano-siRNA endocytosis mechanism and we then proved that attachment of cRGD enhanced cellular uptake via RGD-integrin recognition. Gene silencing was evaluated by reverse transcription polymerase chain reaction and PAMAM-PEG-cRGD-siRNA complex downregulated the expression of hERG to 26.3% of the control value. Furthermore, gene knockdown of hERG elicited growth suppression as well as activated apoptosis by means of abolishing vascular endothelial growth factor secretion and triggering caspase-3 cascade in anaplastic thyroid carcinoma cells. Our study demonstrates that this novel triblock polymer, PAMAM-PEG-cRGD, exhibits negligible

  19. Two classes of silencing RNAs move between C. elegans tissues

    OpenAIRE

    Jose, Antony Merlin; Garcia, Giancarlo; Hunter, Craig P.

    2011-01-01

    Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the ...

  20. Silencing of microRNA-155 in mice during acute inflammatory response leads to derepression of c/ebp Beta and down-regulation of G-CSF

    DEFF Research Database (Denmark)

    Worm, Jesper; Stenvang, Jan; Petri, Andreas;

    2009-01-01

    -stimulating factor (G-CSF), a central regulator of granulopoiesis during inflammatory responses. Consistent with these data, we show that silencing of miR-155 in LPS-treated mice by systemically administered LNA-antimiR results in derepression of the c/ebp Beta isoforms and down-regulation of G-CSF expression...

  1. Identification of Pns6, a putative movement protein of RRSV, as a silencing suppressor

    OpenAIRE

    Lin Qiying; Wu Zujian; Hu Meiqun; Cai Lijun; Wang Chunzheng; Du Zhenguo; Wu Jianguo; Li Yi; Xie Lianhui

    2010-01-01

    Abstract RNA silencing is a potent antiviral response in plants. As a counterdefense, most plant and some animal viruses encode RNA silencing suppressors. In this study, we showed that Pns6, a putative movement protein of Rice ragged stunt virus (RRSV), exhibited silencing suppressor activity in coinfiltration assays with the reporter green fluorescent protein (GFP) in transgenic Nicotiana benthamiana line 16c. Pns6 of RRSV suppressed local silencing induced by sense RNA but had no effect on ...

  2. Molecular Bases of Viral RNA Targeting by Viral Small Interfering RNA-Programmed RISC▿

    OpenAIRE

    Pantaleo, Vitantonio; Szittya, György; Burgyán, József

    2007-01-01

    RNA silencing is conserved in a broad range of eukaryotes and operates in the development and maintenance of genome integrity in many organisms. Plants have adapted this system for antiviral defense, and plant viruses have in turn developed mechanisms to suppress RNA silencing. RNA silencing-related RNA inactivation is likely based on target RNA cleavage or translational arrest. Although it is widely assumed that virus-induced gene silencing (VIGS) promotes the endonucleolytic cleavage of the...

  3. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  4. Mammalian meiotic silencing exhibits sexually dimorphic features.

    Science.gov (United States)

    Cloutier, J M; Mahadevaiah, S K; ElInati, E; Tóth, A; Turner, James

    2016-06-01

    During mammalian meiotic prophase I, surveillance mechanisms exist to ensure that germ cells with defective synapsis or recombination are eliminated, thereby preventing the generation of aneuploid gametes and embryos. Meiosis in females is more error-prone than in males, and this is in part because the prophase I surveillance mechanisms are less efficient in females. A mechanistic understanding of this sexual dimorphism is currently lacking. In both sexes, asynapsed chromosomes are transcriptionally inactivated by ATR-dependent phosphorylation of histone H2AFX. This process, termed meiotic silencing, has been proposed to perform an important prophase I surveillance role. While the transcriptional effects of meiotic silencing at individual genes are well described in the male germ line, analogous studies in the female germ line have not been performed. Here we apply single- and multigene RNA fluorescence in situ hybridization (RNA FISH) to oocytes from chromosomally abnormal mouse models to uncover potential sex differences in the silencing response. Notably, we find that meiotic silencing in females is less efficient than in males. Within individual oocytes, genes located on the same asynapsed chromosome are silenced to differing extents, thereby generating mosaicism in gene expression profiles across oocyte populations. Analysis of sex-reversed XY female mice reveals that the sexual dimorphism in silencing is determined by gonadal sex rather than sex chromosome constitution. We propose that sex differences in meiotic silencing impact on the sexually dimorphic prophase I response to asynapsis. PMID:26712235

  5. Silencing the city?

    OpenAIRE

    Jean-Paul Thibaud; Pascal Amphoux

    2013-01-01

    The notion of silence must be handled very carefully. In addition, its use reveals the way we deal with the urban environment as well as social life. What does the notion of silence convey about the current state of the urban sonic environment? How can we clarify the various meanings and the stakes involved in silence? Three themes are developed in order to answer these questions: silence as a research topic presents three complementary perspectives (acoustic, sociocultural, technological); s...

  6. Silencing expression of the catalytic subunit of DNA-dependent protein kinase by small interfering RNA sensitizes human cells for radiation-induced chromosome damage, cell killing, and mutation

    Science.gov (United States)

    Peng, Yuanlin; Zhang, Qinming; Nagasawa, Hatsumi; Okayasu, Ryuichi; Liber, Howard L.; Bedford, Joel S.

    2002-01-01

    Targeted gene silencing in mammalian cells by RNA interference (RNAi) using small interfering RNAs (siRNAs) was recently described by Elbashir et al. (S. M. Elbashir et al., Nature (Lond.), 411: 494-498, 2001). We have used this methodology in several human cell strains to reduce expression of the Prkdc (DNA-PKcs) gene coding for the catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs) that is involved in the nonhomologous end joining of DNA double-strand breaks. We have also demonstrated a radiosensitization for several phenotypic endpoints of radiation damage. In low-passage normal human fibroblasts, siRNA knock-down of DNA-PKcs resulted in a reduced capacity for restitution of radiation-induced interphase chromosome breaks as measured by premature chromosome condensation, an increased yield of acentric chromosome fragments at the first postirradiation mitosis, and an increased radiosensitivity for cell killing. For three strains of related human lymphoblasts, DNA-PKcs-targeted siRNA transfection resulted in little or no increase in radiosensitivity with respect to cell killing, a 1.5-fold decrease in induced mutant yield in TK6- and p53-null NH32 cells, but about a 2-fold increase in induced mutant yield in p53-mutant WTK1 cells at both the hypoxanthine quanine phosphoribosyl transferase (hprt) and the thymidine kinase loci.

  7. The distribution of a germline methylation marker suggests a regional mechanism of LINE-1 silencing by the piRNA-PIWI system

    Directory of Open Access Journals (Sweden)

    Sigurdsson Martin I

    2012-04-01

    Full Text Available Abstract Background A defense system against transposon activity in the human germline based on PIWI proteins and piRNA has recently been discovered. It represses the activity of LINE-1 elements via DNA methylation by a largely unknown mechanism. Based on the dispersed distribution of clusters of piRNA genes in a strand-specific manner on all human chromosomes, we hypothesized that this system might work preferentially on local and proximal sequences. We tested this hypothesis with a methylation-associated SNP (mSNP marker which is based on the density of C-T transitions in CpG dinucleotides as a surrogate marker for germline methylation. Results We found significantly higher density of mSNPs flanking piRNA clusters in the human genome for flank sizes of 1-16 Mb. A dose-response relationship between number of piRNA genes and mSNP density was found for up to 16 Mb of flanking sequences. The chromosomal density of hypermethylated LINE-1 elements had a significant positive correlation with the chromosomal density of piRNA genes (r = 0.41, P = 0.05. Genome windows of 1-16 Mb containing piRNA clusters had significantly more hypermethylated LINE-1 elements than windows not containing piRNA clusters. Finally, the minimum distance to the next piRNA cluster was significantly shorter for hypermethylated LINE-1 compared to normally methylated elements (14.4 Mb vs 16.1 Mb. Conclusions Our observations support our hypothesis that the piRNA-PIWI system preferentially methylates sequences in close proximity to the piRNA clusters and perhaps physically adjacent sequences on other chromosomes. Furthermore they suggest that this proximity effect extends up to 16 Mb. This could be due to an unknown localization signal, transcription of piRNA genes near the nuclear membrane or the presence of an unknown RNA molecule that spreads across the chromosome and targets the methylation directed by the piRNA-PIWI complex. Our data suggest a region specific molecular

  8. Prevention of hyperglycemia-induced myocardial apoptosis by gene silencing of Toll-like receptor-4

    Directory of Open Access Journals (Sweden)

    Singh Manpreet

    2010-12-01

    Full Text Available Abstract Background Apoptosis is an early event involved in cardiomyopathy associated with diabetes mellitus. Toll-like receptor (TLR signaling triggers cell apoptosis through multiple mechanisms. Up-regulation of TLR4 expression has been shown in diabetic mice. This study aimed to delineate the role of TLR4 in myocardial apoptosis, and to block this process through gene silencing of TLR4 in the myocardia of diabetic mice. Methods Diabetes was induced in C57/BL6 mice by the injection of streptozotocin. Diabetic mice were treated with 50 μg of TLR4 siRNA or scrambled siRNA as control. Myocardial apoptosis was determined by TUNEL assay. Results After 7 days of hyperglycemia, the level of TLR4 mRNA in myocardial tissue was significantly elevated. Treatment of TLR4 siRNA knocked down gene expression as well as diminished its elevation in diabetic mice. Apoptosis was evident in cardiac tissues of diabetic mice as detected by a TUNEL assay. In contrast, treatment with TLR4 siRNA minimized apoptosis in myocardial tissues. Mechanistically, caspase-3 activation was significantly inhibited in mice that were treated with TLR4 siRNA, but not in mice treated with control siRNA. Additionally, gene silencing of TLR4 resulted in suppression of apoptotic cascades, such as Fas and caspase-3 gene expression. TLR4 deficiency resulted in inhibition of reactive oxygen species (ROS production and NADPH oxidase activity, suggesting suppression of hyperglycemia-induced apoptosis by TLR4 is associated with attenuation of oxidative stress to the cardiomyocytes. Conclusions In summary, we present novel evidence that TLR4 plays a critical role in cardiac apoptosis. This is the first demonstration of the prevention of cardiac apoptosis in diabetic mice through silencing of the TLR4 gene.

  9. siRNA in silencing the expression of DNA-dependent protein kinase and its effect on radiosensitivity of lung adenocarcinoma cells

    International Nuclear Information System (INIS)

    Objective: To discuss the role of DNA-dependent protein kinase catalytic subunit (DNA-DPKCS) in human lung adenocarcinoma cell line (A549) by using small interfering RNA (siRNA) to specifically knockdown DNA-DPKCS expression and its effects on cell proliferation, cell cycle and radio-sensitivity. Methods: The DNA-DPKCS-siRNA expression vector was constructed and transfected into A549 cell line. The transformed clones were randomly selected and isolated. The cell cycle distribution and apoptosis were analyzed by flow cytometry analysis. Cell survival was detected by using clonogenic formation as-say. Results: With specific inhibition of DNA-DPKCS expression, stable transfected cell line 549pRNA-DNA-DPKCS was constructed by RNA interference technique. The 549pRNA-C and 549pSUPER cell lines were the control cell lines transfected with control and blank plasmids, respectively. Compared with A549 cells, the expression levels of DNA-DPKCS mRNA (0.110: 1. 000), protein (0. 870: 2.967) and activity of DNA-DPKCS (0.004: 0.266) in 549pRNA-DNA-DPKCS cells were significantly lower (F = 80.55 ,P 2(0.25:0.76), D0 (1.42:1.62) and Dq (0.06: 1. 00) showed significant difference between 549pRNA-DNA-DPKCS and A549 cells (F = 996.86, P 2 (10.7%: 11.0%) phases was significantly decreased (F = 4.83, P<0.05 and F=32.04, P <0.01, respectively). Conclusions: In A549 cells, inhibit of DNA-DPKCS gene expression can enhance the radiosensitivity and affect cell cycle distribution. (authors)

  10. Silver nanoparticles-quercetin conjugation to siRNA against drug-resistant Bacillus subtilis for effective gene silencing: in vitro and in vivo.

    Science.gov (United States)

    Sun, Dongdong; Zhang, Weiwei; Li, Nuan; Zhao, Zhiwei; Mou, Zhipeng; Yang, Endong; Wang, Weiyun

    2016-06-01

    Quercetin (Qe) exhibited extremely low water solubility, and thus, it was modified using silver nanoparticles (AgNPs). We fabricated AgNPs combined with Qe (AgNPs-Qe). The modification suggested that the synergistic properties of Qe enhanced the antibacterial activity of AgNPs. However, AgNPs-Qe exerted no effect on many kinds of drug-resistant bacteria, including Pseudomonas aeruginosa and Bacillus subtilis. RNA interference has considerable therapeutic potential because of its high specificity and potential capability to evade drug resistance. Therefore, we stabilized AgNPs-Qe with a layer of molecules (siRNA). The newly fabricated nanoparticles exerted improved effect on many kinds of bacteria, including the most prominent drug-resistant species B. subtilis. Agarose gel electrophoresis showed that the highest critical nitrogen-to-phosphorus (N/P) ratio occurred at a vector/siRNA with a w/w ratio of 7:1. Characterization experiment indicated that the diameter of siRNA/AgNPs-Qe was approximately 40 nm (40 ± 10 nm). Moreover, AgNPs-Qe were stabilized with a layer of siRNA that was approximately 10nm thick. Results of the in vitro study suggested that siRNA/AgNPs-Qe could destroy the cell wall and inhibit bacterial propagation. Meanwhile, the in vivo experiment on the animal bacteremia model, as well as the optical imaging of nude mice and their isolated organs, demonstrated that bacteria accumulated in the blood, heart, liver, spleen, lungs, and kidneys after the intravenous injection of B. subtilis. The bacteria in the blood and organs, as well as the inflamed cells in the tissues, gradually decreased after the mice received intravenous tail injection of siRNA/AgNPs-Qe for treatment. Both the in vitro and the in vivo studies exhibit that siRNA/AgNPs-Qe can be a potential nanoscale drug delivery system for B. subtilis targeting bacterimia. PMID:27040247

  11. Influence of Bxpel1 Gene Silencing by dsRNA Interference on the Development and Pathogenicity of the Pine Wood Nematode, Bursaphelenchus xylophilus.

    Science.gov (United States)

    Qiu, Xiu-Wen; Wu, Xiao-Qin; Huang, Lin; Ye, Jian-Ren

    2016-01-01

    As the causal agent of pine wilt disease (PWD), the pine wood nematode (PWN), Bursaphelenchus xylophilus, causes huge economic losses by devastating pine forests worldwide. The pectate lyase gene is essential for successful invasion of their host plants by plant-parasitic nematodes. To demonstrate the role of pectate lyase gene in the PWD process, RNA interference (RNAi) is used to analyze the function of the pectate lyase 1 gene in B. xylophilus (Bxpel1). The efficiency of RNAi was detected by real-time PCR. The result demonstrated that the quantity of B. xylophilus propagated with control solution treatment was 62 times greater than that soaking in double-stranded RNA (dsRNA) after B. xylophilus inoculation in Botrytis cinerea for the first generation (F1). The number of B. xylophilus soaking in control solution was doubled compared to that soaking in Bxpel1 dsRNA four days after inoculation in Pinus thunbergii. The quantity of B. xylophilus was reduced significantly (p control solution treatment. Bxpel1 dsRNAi reduced the migration speed and reproduction of B. xylophilus in pine trees. The pathogenicity to P. thunbergii seedling of B. xylophilus was weaker after soaking in dsRNA solution compared with that after soaking in the control solution. Our results suggest that Bxpel1 gene is a significant pathogenic factor in the PWD process and this basic information may facilitate a better understanding of the molecular mechanism of PWD. PMID:26797602

  12. DICER-LIKE2 Plays a Primary Role in Transitive Silencing of Transgenes in Arabidopsis

    OpenAIRE

    Mlotshwa, Sizolwenkosi; Pruss, Gail J; Peragine, Angela; Endres, Matthew W.; Li, Junjie; Chen, Xuemei; Poethig, R Scott; Bowman, Lewis H.; Vance, Vicki

    2008-01-01

    Dicer-like (DCL) enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA) that triggers silencing into the primary short interfering RNAs (siRNAs) that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR)-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2–but not DCL4-is required for transitivity in ...

  13. Tomato mosaic virus replication protein suppresses virus-targeted posttranscriptional gene silencing.

    Science.gov (United States)

    Kubota, Kenji; Tsuda, Shinya; Tamai, Atsushi; Meshi, Tetsuo

    2003-10-01

    Posttranscriptional gene silencing (PTGS), a homology-dependent RNA degradation system, has a role in defending against virus infection in plants, but plant viruses encode a suppressor to combat PTGS. Using transgenic tobacco in which the expression of green fluorescent protein (GFP) is posttranscriptionally silenced, we investigated a tomato mosaic virus (ToMV)-encoded PTGS suppressor. Infection with wild-type ToMV (L strain) interrupted GFP silencing in tobacco, coincident with visible symptoms, whereas some attenuated strains of ToMV (L(11) and L(11)A strains) failed to suppress GFP silencing. Analyses of recombinant viruses containing the L and L(11)A strains revealed that a single base change in the replicase gene, which causes an amino acid substitution, is responsible for the symptomless and suppressor-defective phenotypes of the attenuated strains. An agroinfiltration assay indicated that the 130K replication protein acts as a PTGS suppressor. Small interfering RNAs (siRNAs) of 21 to 25 nucleotides accumulated during ToMV infection, suggesting that the major target of the ToMV-encoded suppressor is downstream from the production of siRNAs in the PTGS pathway. Analysis with GFP-tagged recombinant viruses revealed that the suppressor inhibits the establishment of the ToMV-targeted PTGS system in the inoculated leaves but does not detectably suppress the activity of the preexisting, sequence-specific PTGS machinery there. Taken together, these results indicate that it is likely that the ToMV-encoded suppressor, the 130K replication protein, blocks the utilization of silencing-associated small RNAs, so that a homology-dependent RNA degradation machinery is not newly formed. PMID:14512550

  14. Pathogenicity of Pepper mild mottle virus Is Controlled by the RNA Silencing Suppression Activity of Its Replication Protein but Not the Viral Accumulation.

    Science.gov (United States)

    Tsuda, Shinya; Kubota, Kenji; Kanda, Ayami; Ohki, Takehiro; Meshi, Tetsuo

    2007-04-01

    ABSTRACT Pepper mild mottle virus (PMMoV) infects pepper plants, causing mosaic symptoms on the upper developing leaves. We investigated the relationship between a virus pathogenicity determinant domain and the appearance of mosaic symptoms. Genetically modified PMMoV mutants were constructed, which had a base substitution in the 130K replication protein gene causing an amino acid change or a truncation of the 3' terminal pseudoknot structure. Only one substitution mutant (at amino acid residue 349) failed to cause symptoms, although its accumulation was relatively high. Conversely, the pseudoknot mutants showed the lower accumulation, but they still caused mosaic symptoms as severe as the wild-type virus. Therefore, the level of virus accumulation in a plant does not necessarily correlate with the development of mosaic symptoms. The activity to suppress posttranscriptional gene silencing (PTGS) was impaired in the asymptomatic mutant. Consequently, pathogenicity causing mosaic symptoms should be controlled by combat between host PTGS and its suppression by the 130K replication protein rather than virus accumulation. PMID:18943281

  15. Silencing the city?

    Directory of Open Access Journals (Sweden)

    Jean-Paul Thibaud

    2013-12-01

    Full Text Available The notion of silence must be handled very carefully. In addition, its use reveals the way we deal with the urban environment as well as social life. What does the notion of silence convey about the current state of the urban sonic environment? How can we clarify the various meanings and the stakes involved in silence? Three themes are developed in order to answer these questions: silence as a research topic presents three complementary perspectives (acoustic, sociocultural, technological; silence as a polysemous notion emphasises the ideas of keeping quiet, tranquillity and pause; silence as a design issue relies on basic properties and principles in order to orient the design of the urban sonic environment.

  16. Identifizierung und Charakterisierung von Silencing Suppressoren in Arabidopsis

    OpenAIRE

    Thran, Moritz

    2013-01-01

    Post-transkriptionelles gene silencing (PTGS) kann ein limitierender Faktor für die Expression von Transgenen sein. Transgene mRNAs können von der RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) erkannt werden, was die Synthese doppelsträngiger RNA (dsRNA) initiiert und die Akkumulation von small interfering RNAs (siRNAs) zur Folge hat. Diese vermitteln die sequenzspezifische endonukleolytische Spaltung einer Ziel-mRNA und verhindern somit deren Akkumulation. Für die Initiierung des Transgen Silencing ...

  17. Influence of Bxpel1 Gene Silencing by dsRNA Interference on the Development and Pathogenicity of the Pine Wood Nematode, Bursaphelenchus xylophilus

    Directory of Open Access Journals (Sweden)

    Xiu-Wen Qiu

    2016-01-01

    Full Text Available As the causal agent of pine wilt disease (PWD, the pine wood nematode (PWN, Bursaphelenchus xylophilus, causes huge economic losses by devastating pine forests worldwide. The pectate lyase gene is essential for successful invasion of their host plants by plant-parasitic nematodes. To demonstrate the role of pectate lyase gene in the PWD process, RNA interference (RNAi is used to analyze the function of the pectate lyase 1 gene in B. xylophilus (Bxpel1. The efficiency of RNAi was detected by real-time PCR. The result demonstrated that the quantity of B. xylophilus propagated with control solution treatment was 62 times greater than that soaking in double-stranded RNA (dsRNA after B. xylophilus inoculation in Botrytis cinerea for the first generation (F1. The number of B. xylophilus soaking in control solution was doubled compared to that soaking in Bxpel1 dsRNA four days after inoculation in Pinus thunbergii. The quantity of B. xylophilus was reduced significantly (p < 0.001 after treatment with dsRNAi compared with that using a control solution treatment. Bxpel1 dsRNAi reduced the migration speed and reproduction of B. xylophilus in pine trees. The pathogenicity to P. thunbergii seedling of B. xylophilus was weaker after soaking in dsRNA solution compared with that after soaking in the control solution. Our results suggest that Bxpel1 gene is a significant pathogenic factor in the PWD process and this basic information may facilitate a better understanding of the molecular mechanism of PWD.

  18. Inhibition of proliferation of human non-Hodgkin's lymphoma Raji cells by small interference RNA silencing Pokemon gene%siRNA 沉默 Pokemon 基因抑制人非霍奇金淋巴瘤 Raji细胞的增殖

    Institute of Scientific and Technical Information of China (English)

    董珂; 蒲业迪; 刘琼; 代广霞; 李丽珍; 李颢; 王玲玲; 王鲁群

    2014-01-01

    Objective Small interference RNA ( siRNA) was used to silence Pokemon gene in human non-Hodgkin's lymphoma Raji cells, then to observe the change of proliferation of Raji cells and explore its possible molecular mecha-nisms.Methods Pokemon-targeted siRNA was constructed with lentivirus vector and transfected to Raji cells. RT-PCR and Western blotting were adopted to confirm the silence effect of Pokemon gene in Raji cells, which were then used to determine the mRNA and protein expressions of bcl-6 and mutant p53.Flow cytometry was used to detect the cell apoptosis of each group.Results Pokemon-siRNA constructed with lentivirus vector could efficiently silence the expression of Pokemon gene in Raji cell (P<0.05).After that, the mRNA and protein expressions of bcl-6 and mutant p53 were significantly decreased (P<0.05) and the cell apoptosis rate was markedly elevated compared with the controls.Conclusion The siRNA Pokemon gene silencing promotes human non-Hodgkin's lymphoma Raji cells apoptosis by lowering the expressions of bcl-6 and mutant p53 gene and protein and inhibiting the proliferation.Poke-mon gene is expected to become a new target for non-Hodgkin's lymphoma treatment.%目的:采用siRNA干扰技术沉默人非霍奇金淋巴瘤Raji细胞中Pokemon基因,观察Raji细胞增殖活性的变化,并探讨其可能的分子机制。方法构建靶向Pokemon基因的siRNA重组慢病毒载体并转染Raji细胞。采用实时定量PCR法和Western blotting法检测Raji细胞Pokemon基因的沉默效果,在Raji细胞中沉默Pokemon基因的表达后采用实时定量PCR法和Western blotting法检测bcl-6和突变型p53表达水平的变化;采用流式细胞术检测Pokemon基因沉默后Raji细胞凋亡的情况。结果利用Pokemon靶向siRNA重组慢病毒载体感染Raji细胞有效沉默Raji细胞Pokemon基因表达(P<0.05)。沉默Pokemon基因后,bcl-6和突变型p53基因和蛋白表达均显著降低(P<0.05)

  19. Mitotic silencing of human rRNA synthesis: inactivation of the promoter selectivity factor SL1 by cdc2/cyclin B-mediated phosphorylation.

    OpenAIRE

    Heix, J; Vente, A.; Voit, R; Budde, A; Michaelidis, T M; Grummt, I

    1998-01-01

    We have used a reconstituted cell-free transcription system to investigate the molecular basis of mitotic repression of RNA polymerase I (pol I) transcription. We demonstrate that SL1, the TBP-containing promoter-binding factor, is inactivated by cdc2/cyclin B-directed phosphorylation, and reactivated by dephosphorylation. Transcriptional inactivation in vitro is accompanied by phosphorylation of two subunits, e.g. TBP and hTAFI110. To distinguish whether transcriptional repression is due to ...

  20. Systemic delivery of siRNA by actively targeted polyion complex micelles for silencing the E6 and E7 human papillomavirus oncogenes.

    Science.gov (United States)

    Nishida, Haruka; Matsumoto, Yoko; Kawana, Kei; Christie, R James; Naito, Mitsuru; Kim, Beob Soo; Toh, Kazuko; Min, Hyun Su; Yi, Yu; Matsumoto, Yu; Kim, Hyun Jin; Miyata, Kanjiro; Taguchi, Ayumi; Tomio, Kensuke; Yamashita, Aki; Inoue, Tomoko; Nakamura, Hiroe; Fujimoto, Asaha; Sato, Masakazu; Yoshida, Mitsuyo; Adachi, Katsuyuki; Arimoto, Takahide; Wada-Hiraike, Osamu; Oda, Katsutoshi; Nagamatsu, Takeshi; Nishiyama, Nobuhiro; Kataoka, Kazunori; Osuga, Yutaka; Fujii, Tomoyuki

    2016-06-10

    Human papillomavirus (HPV) E6 and E7 oncogenes are essential for the immortalization and maintenance of HPV-associated cancer and are ubiquitously expressed in cervical cancer lesions. Small interfering RNA (siRNA) coding for E6 and E7 oncogenes is a promising approach for precise treatment of cervical cancer, yet a delivery system is required for systemic delivery to solid tumors. Here, an actively targeted polyion complex (PIC) micelle was applied to deliver siRNAs coding for HPV E6/E7 to HPV cervical cancer cell tumors in immune-incompetent tumor-bearing mice. A cell viability assay revealed that both HPV type 16 and 18 E6/E7 siRNAs (si16E6/E7 and si18E6/E7, respectively) interfered with proliferation of cervical cancer cell lines in an HPV type-specific manner. A fluorescence imaging biodistribution analysis further revealed that fluorescence dye-labeled siRNA-loaded PIC micelles efficiently accumulated within the tumor mass after systemic administration. Ultimately, intravenous injection of si16E6/E7 and si18E6/E7-loaded PIC micelles was found to significantly suppress the growth of subcutaneous SiHa and HeLa tumors, respectively. The specific activity of siRNA treatment was confirmed by the observation that p53 protein expression was restored in the tumors excised from the mice treated with si16E6/E7- and si18E6/E7-loaded PIC micelles for SiHa and HeLa tumors, respectively. Therefore, the actively targeted PIC micelle incorporating HPV E6/E7-coding siRNAs demonstrated its therapeutic potential against HPV-associated cancer. PMID:26979870

  1. Increased expression of long noncoding RNA TUG1 predicts a poor prognosis of gastric cancer and regulates cell proliferation by epigenetically silencing of p57

    OpenAIRE

    Zhang, E; He, X; Yin, D; Han, L.; Qiu, M; XU, T; Xia, R; Xu, L.; Yin, R; De, W

    2016-01-01

    Recent evidence highlights long noncoding RNAs (lncRNAs) as crucial regulators of cancer biology that contribute to tumorigenesis. LncRNA TUG1 was initially detected in a genomic screen for genes upregulated in response to taurine treatment in developing mouse retinal cells. Our previous study showed that TUG1 could affect cell proliferation through epigenetically regulating HOXB7 in human non-small cell lung cancer. However, the clinical significance and potential role of TUG1 in GC remains ...

  2. siRNA抑制人乳腺癌KLK6基因表达的实验研究%Research of silencing kallikrein 6 gene with siRNA in human breast cancer

    Institute of Scientific and Technical Information of China (English)

    季丙元; 关晶

    2011-01-01

    目的 探讨siRNA沉默KLK6基因表达对乳腺癌细胞生长的抑制作用及其机制,为乳腺癌的基因诊断和治疗提供理论依据.方法 针对KLK6 mRNA 序列设计合成siRNA,构建2个重组质粒PGCsilencerTMH1/GFP/Neo/KLK6和PGCsilencerTMH1/GFP/Neo/Non;将重组质粒导入乳腺癌MCF-7细胞株,G418筛选获得稳定转染的细胞株;实验分为脂质体对照、阴性质粒转染对照及KLK6 siRNA 重组质粒转染组,实时荧光定量PCR 法检测KLK6 mRNA 的表达的变化,用四甲基偶氮唑盐(MTT)法测量细胞生长情况.结果 测序证实表达载体构建成功,在稳定转染重组质粒PGCsilencerTMH1/GFP/Neo/KLK6的乳腺癌MCF-7细胞株中,KLK6 mRNA抑制率(76%)明显高于阴性质粒对照组(2.7%),MCF-7细胞增殖活性显著低于阴性对照组和脂质体对照组.结论 重组质粒PGCsilencerTMH1/GFP/Neo/KLK6可抑制乳腺癌细胞中KLK6基因的表达,并抑制乳腺癌细胞的生长.%Objective To investigate the inhibitory effect of silencing KLK6 gene with siRNA on the growth of breast cancer cells and its mechanism,and to provide evidence in diagnosis and treatment for breast cancer.Methods Specific siRNA for KLK6 mRNA was designed and synthesized.Two recombinant plasmids PGCsilencer TM H1/GFP/Neo/KLK6 and PGCsilencer tm H1/GFP/Neo/Non were constructed.The two plasmids were transfected into MCF-7 cells and the positive cell clones were obtained by G418 selection.The breast cancer cell line MCF-7 were divided into three groups :liposome-treated control group,negative plasmid-transfected control group and KLK6-siRNA transfected group.The expression of KLK6 was determined by real time quantitative PCR,and the proliferation was also observed by MTT assay.Results The recombinant plasmid was successfully constructed.The results of real time quantitative PCR indicated that the inhibitory rates of mRNA in PGCsilencer TM H1/GFP/Neo/KLK6 transfected group (76%) was higher than that in negative plasmid

  3. Silencing of the hTERT gene by shRNA inhibits colon cancer SW480 cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Ai-Qun Liu

    Full Text Available Human telomerase reverse transcriptase (hTERT is the key enzyme responsible for synthesizing and maintaining the telomeres on the ends of chromosomes, and it is essential for cell proliferation. This has made hTERT a focus of oncology research and an attractive target for anticancer drug development. In this study, we designed a small interfering RNA (siRNA targeting the catalytic subunit of hTERT and tested its effects on the growth of telomerase-positive human colon carcinoma SW480 cells in vitro, as well as on the tumorigenicity of these cells in nude mice. Transient and stable transfection of hTERT siRNA into colon cancer SW480 cells suppressed hTERT expression, reduced telomerase activity and inhibited cell growth and proliferation. Knocking down hTERT expression in SW480 tumors xenografted into nude mice significantly slowed tumor growth and promoted tumor cell apoptosis. Our results suggest that hTERT is involved in carcinogenesis of human colon carcinoma, and they highlight the therapeutic potential of a hTERT knock-down approach.

  4. siRNA沉默c-FLIP对K562/ADR耐药性的影响%Effect of siRNA-mediated silencing of c-FLIP on adriamycin-resistance of K562/ADR cells

    Institute of Scientific and Technical Information of China (English)

    宋敏; 王建宁; 孟庆齐; 包红雨; 杨杰

    2015-01-01

    目的:探讨c-FLIP siRNA干扰c-FLIP mRNA水平对阿霉素耐药细胞K562/ADR的耐药性的影响及作用机制。方法应用siRNA干扰的方法抑制K562及K562/ADR细胞c-FLIP的表达,通过荧光定量PCR的方法检测c-FLIP mRNA表达及对多药耐药基因MDR1 mRNA水平的影响。MTT法检测c-FLIP干扰与否对K562及K562/ADR细胞增殖的影响,Annexin V/7-ADD双染研究c-FLIP干扰与否对K562及K562/ADR细胞凋亡的影响。结果与阴性siRNA转染组相比较,c-FLIP siRNA转染下调K562细胞中c-FLIP的mRNA后,K562细胞增殖受到一定程度的抑制(P<0.05),但是并未显著诱导细胞凋亡,c-FLIP干扰与否K562细胞48 h增殖率分别为(69.14±1.82)%和(60.69±2.23)%,凋亡率分别为(1.7±0.3)%和(1.8±0.2)%。与阴性siRNA转染组相比较, c-FLIP siRNA转染抑制K562/ADR细胞中c-FLIP的mRNA后,K562/ADR细胞增殖显著被抑制(P<0.05),并显著诱导了细胞凋亡增加(P<0.05),c-FLIP干扰与否K562/ADR细胞48 h增殖率分别为(-6.07±0.71)%和(-37.45±3.53)%,凋亡率分别为(5.2±0.4)%和(9.2±0.4)%。并且c-FLIP siRNA下调c-FLIP mRNA水平后,K562/ADR细胞中的多药耐药基因MDR1的mRNA表达水平也被显著下调(P<0.05)。结论 c-FLIP siRNA下调K562/ADR细胞中c-FLIP的mRNA水平抑制了多药耐药基因MDR1的表达,从而抑制了K562/ADR细胞对阿霉素的耐药性。%Objective To investigate the effect of silenced c-FLIP mRNA level by small interfering RNA (siRNA) on adriamycin-resistance of K562/ADR cells. Methods c-FLIP siRNA and negative siRNA were transfect-ed into K562 and K562/ADR cell lines respectively, and mRNA expression of c-FLIP and multi-drug resistance gene 1 (MDR1) were detected by quantitative PCR. Cell proliferation rate was detected by MTT assay, and cell apoptosis rate was assayed by Annexin V/7-ADD double-staining method. Results Compared with negative siRNA transfection group, siRNA transfection significantly decreased c-FLIP mRNA

  5. MicroRNA-26a is Strongly Down-regulated in Melanoma and Induces Cell Death through Repression of Silencer of Death Domains (SODD)

    OpenAIRE

    Reuland, Steven N.; Smith, Shilo; Bemis, Lynne; Goldstein, Nathaniel B.; Almeida, Adam; Katie A. Partyka; Marquez, Victor E.; Zhang, Qinghong; David A Norris; Yiqun G Shellman

    2012-01-01

    Melanoma is an aggressive cancer that metastasizes rapidly, and is refractory to conventional chemotherapies. Identifying miRNAs that are responsible for this pathogenesis is therefore a promising means of developing new therapies. We identified miR-26a through microarray and qRT-PCR experiments as an miRNA that is strongly down-regulated in melanoma cell lines as compared to primary melanocytes. Treatment of cell lines with miR-26a mimic caused significant and rapid cell death compared to a ...

  6. Long non-coding RNA TUG1 is up-regulated in hepatocellular carcinoma and promotes cell growth and apoptosis by epigenetically silencing of KLF2

    OpenAIRE

    Huang, Ming-De; Chen, Wen-ming; Qi, Fu-zhen; Sun, Ming; Xu, Tong-peng; Ma, Pei; Shu, Yong-qian

    2015-01-01

    Background Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death worldwide, and the biology of this cancer remains poorly understood. Recent evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in a variety of cancers, including HCC. Taurine Up-regulated Gene 1 (TUG1), a 7.1-kb lncRNA, recruiting and binding to polycomb repressive complex 2 (PRC2), is found to be disregulated in non-small cell lung carcinoma (NSCLC) and esophageal s...

  7. A crucial role for GW182 and the DCP1:DCP2 decapping complex in miRNA-mediated gene silencing

    OpenAIRE

    Rehwinkel, Jan; BEHM-ANSMANT, ISABELLE; Gatfield, David; Izaurralde, Elisa

    2005-01-01

    In eukaryotic cells degradation of bulk mRNA in the 5′ to 3′ direction requires the consecutive action of the decapping complex (consisting of DCP1 and DCP2) and the 5′ to 3′ exonuclease XRN1. These enzymes are found in discrete cytoplasmic foci known as P-bodies or GW-bodies (because of the accumulation of the GW182 antigen). Proteins acting in other post-transcriptional processes have also been localized to P-bodies. These include SMG5, SMG7, and UPF1, which function in nonsense-mediated mR...

  8. Aspergillus Mycoviruses Are Targets and Suppressors of RNA Silencing▿ †

    OpenAIRE

    Hammond, T. M.; Andrewski, M. D.; Roossinck, M J; Keller, N P

    2007-01-01

    RNA silencing can function as a virus defense mechanism in a diverse range of eukaryotes, and many viruses are capable of suppressing the silencing machinery targeting them. However, the extent to which this occurs between fungal RNA silencing and mycoviruses is unclear. Here, three Aspergillus dsRNA mycoviruses were partially characterized, and their relationship to RNA silencing was investigated. Aspergillus virus 1816 is related to Agaricus bisporus white button mushroom virus 1 and suppre...

  9. Expression analysis and localization of wt1, ad4bp/sf-1 and gata4 in the testis of catfish, Clarias batrachus: Impact of wt1-esiRNA silencing.

    Science.gov (United States)

    Murugananthkumar, Raju; Senthilkumaran, Balasubramanian

    2016-08-15

    In teleosts, a comprehensive role or interaction of wt1, ad4bp/sf-1 and gata4 genes in relation to gonadal development and/or recrudescence was never attempted. Present study aimed to identify the involvement of these genes during testicular development of catfish, Clarias batrachus. Dominant expression of wt1 and gata4 was observed in developing and adult testis, while ad4bp/sf-1 showed steady expression. Localization of these genes in adult testis revealed their presence in spermatogonia, spermatocytes and interstitial/Leydig cells. Significant high expression during pre-spawning and spawning phases, and upregulated levels of these genes after hCG induction authenticated gonadotropic regulation. Transient silencing of wt1-esiRNA displayed decrease in wt1 expression, which further downregulated the expression of ad4bp/sf-1 and gata4, and certain steroidogenic enzyme genes related to androgen production. These results suggest that wt1 might target ad4bp/sf-1 and gata4 expression, and also have regulatory influence either indirectly or directly on the steroidogenic enzyme genes of catfish. PMID:27173028

  10. The Escherichia coli OxyS regulatory RNA represses fhlA translation by blocking ribosome binding.

    OpenAIRE

    Altuvia, S; Zhang, A.; Argaman, L; Tiwari, A; Storz, G.

    1998-01-01

    OxyS is a small untranslated RNA which is induced in response to oxidative stress in Escherichia coli. This novel RNA acts as a global regulator to activate or repress the expression of as many as 40 genes, including the fhlA-encoded transcriptional activator and the rpoS-encoded sigma(s) subunit of RNA polymerase. Deletion analysis of OxyS showed that different domains of the small RNA are required for the regulation of fhlA and rpoS. We examined the mechanism of OxyS repression of fhlA and ...

  11. The preferred route for the degradation of silencing target RNAs in transgenic plants depends on pre-established silencing conditions

    OpenAIRE

    Sanders, Matthew; Lannoo, Nausicaä; Maddelein, Wendy; Depicker, Anna; Van Montagu, Marc; Cornelissen, Marc; Jacobs, John

    2004-01-01

    RNA silencing can be initiated upon dsRNA accumulation and results in homology-dependent degradation of target RNAs mediated by 21–23 nt small interfering RNAs (siRNAs). These small regulatory RNAs can direct RNA degradation via different routes such as the RdRP/Dicer- and the RNA-induced silencing complex (RISC)-catalysed pathways. The relative contribution of both pathways to degradation of target RNAs is not understood. To gain further insight in the process of target selection and degrada...

  12. 慢病毒载体介导RNA干扰体外抑制人胰腺癌细胞VIM基因的表达%Construction of a lentiviral vector for RNA interference of human VIM gene and its silencing effect in pancreatic cancer cells

    Institute of Scientific and Technical Information of China (English)

    Jianxin Jiang; Ming Shen; Renyi Qin; Rui Tian; Jing Li; Min Wang

    2009-01-01

    Objective: To construct a lentiviral expression vector for RNA interference (RNAi) of human VIM gene; and assess its gene silencing effect in pancreatic cancer cell line Panc-1. Methods: Three pairs of human VIM gene short hairpin RNA (shRNA) sequences were designed using a software available on-line and one pair came from document. After synthesis and annealing, four double-stranded oligonucleotides (dsOligo) were cloned into the pGCL-GFP/U6 plasmid, which were subsequently confirmed by polymerase chain reaction (PCR) and DNA sequencing analysis. Real-time PCR and Western blotting were used to screen the effective pGCL-GFP-shRNA plasmid in 293T cells, then the most effective one was packed into the recombinant lentivirus Lv-VIM-shRNA with lentiviral packing materials pHelper 1.0 and pHelper 2.0 in 293T cells.The titer of lentivirus was determined by hole-by-dilution titer assay. The silencing effect of Lv-VIM-shRNA in Panc-1 cells were validated by real-time PCR and Western-blotting. Results: An effective Lv-VIM-shRNA was successfully constructed.The titer of lentivirus was determined on 2×109TU/mL. The expressions of VIM mRNA and vimentin were down-regluated in the Panc-1 cells infected with Lv-VIM-shRNA. Conclusion: An effective Lv-VIM-shRNA could inhibit the expression of VIM gene in Panc-1 cells in vitro, which provides a tool for investigating the role of VIM gene in the signaling pathway involved in tumorigenesis and progression of pancreatic cancer and searching new therapeutic targets.

  13. Rapid evolution and gene expression: a rapidly evolving Mendelian trait that silences field crickets has widespread effects on mRNA and protein expression.

    Science.gov (United States)

    Pascoal, S; Liu, X; Ly, T; Fang, Y; Rockliffe, N; Paterson, S; Shirran, S L; Botting, C H; Bailey, N W

    2016-06-01

    A major advance in modern evolutionary biology is the ability to start linking phenotypic evolution in the wild with genomic changes that underlie that evolution. We capitalized on a rapidly evolving Hawaiian population of crickets (Teleogryllus oceanicus) to test hypotheses about the genomic consequences of a recent Mendelian mutation of large effect which disrupts the development of sound-producing structures on male forewings. The resulting silent phenotype, flatwing, persists because of natural selection imposed by an acoustically orienting parasitoid, but it interferes with mate attraction. We examined gene expression differences in developing wing buds of wild-type and flatwing male crickets using RNA-seq and quantitative proteomics. Most differentially expressed (DE) transcripts were down-regulated in flatwing males (625 up vs. 1716 down), whereas up- and down-regulated proteins were equally represented (30 up and 34 down). Differences between morphs were clearly not restricted to a single pathway, and we recovered annotations associated with a broad array of functions that would not be predicted a priori. Using a candidate gene detection test based on homology, we identified 30% of putative Drosophila wing development genes in the cricket transcriptome, but only 10% were DE. In addition to wing-related annotations, endocrine pathways and several biological processes such as reproduction, immunity and locomotion were DE in the mutant crickets at both biological levels. Our results illuminate the breadth of genetic pathways that are potentially affected in the early stages of adaptation. PMID:26999731

  14. Crystallization and preliminary X-ray diffraction analysis of the Cmr2–Cmr3 subcomplex in the CRISPR–Cas RNA-silencing effector complex

    International Nuclear Information System (INIS)

    The Cmr2–Cmr3 subcomplex from P. furiosus was co-crystallized with 3′-AMP. X-ray diffraction data for the crystals were collected to 2.6 Å resolution using a synchrotron-radiation source. Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci, found in prokaryotes, are transcribed to produce CRISPR RNAs (crRNAs). The Cmr proteins (Cmr1–6) and crRNA form a ribonucleoprotein complex that degrades target RNAs derived from invading genetic elements. Cmr2dHD, a Cmr2 variant lacking the N-terminal putative HD nuclease domain, and Cmr3 were co-expressed in Escherichia coli cells and co-purified as a complex. The Cmr2dHD–Cmr3 complex was co-crystallized with 3′-AMP by the vapour-diffusion method. The crystals diffracted to 2.6 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the orthorhombic space group I222, with unit-cell parameters a = 103.9, b = 136.7, c = 192.0 Å. The asymmetric unit of the crystals is expected to contain one Cmr2dHD–Cmr3 complex with a Matthews coefficient of 3.0 Å3 Da−1 and a solvent content of 59%

  15. Ombuds’ corner: Employee silence

    CERN Multimedia

    Vincent Vuillemin

    2013-01-01

    Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

  16. MAPKAP Kinase 2 Blocks Tristetraprolin-directed mRNA Decay by Inhibiting CAF1 Deadenylase Recruitment

    OpenAIRE

    Marchese, Francesco P.; Aubareda, Anna; Tudor, Corina; Saklatvala, Jeremy; Clark, Andrew R; Dean, Jonathan L. E.

    2010-01-01

    Tristetraprolin (TTP) directs its target AU-rich element (ARE)-containing mRNAs for degradation by promoting removal of the poly(A) tail. The p38 MAPK pathway regulates mRNA stability via the downstream kinase MAPK-activated protein kinase 2 (MAPKAP kinase 2 or MK2), which phosphorylates and prevents the mRNA-destabilizing function of TTP. We show that deadenylation of endogenous ARE-containing tumor necrosis factor mRNA is inhibited by p38 MAPK. To investigate whether phosphorylation of TTP ...

  17. The trp RNA-binding attenuation protein of Bacillus subtilis regulates translation of the tryptophan transport gene trpP (yhaG) by blocking ribosome binding.

    Science.gov (United States)

    Yakhnin, Helen; Zhang, Hong; Yakhnin, Alexander V; Babitzke, Paul

    2004-01-01

    Expression of the Bacillus subtilis tryptophan biosynthetic genes (trpEDCFBA and pabA [trpG]) is regulated in response to tryptophan by TRAP, the trp RNA-binding attenuation protein. TRAP-mediated regulation of the tryptophan biosynthetic genes includes a transcription attenuation and two distinct translation control mechanisms. TRAP also regulates translation of trpP (yhaG), a single-gene operon that encodes a putative tryptophan transporter. Its translation initiation region contains triplet repeats typical of TRAP-regulated mRNAs. We found that regulation of trpP and pabA is unaltered in a rho mutant strain. Results from filter binding and gel mobility shift assays demonstrated that TRAP binds specifically to a segment of the trpP transcript that includes the untranslated leader and translation initiation region. While the affinities of TRAP for the trpP and pabA transcripts are similar, TRAP-mediated translation control of trpP is much more extensive than for pabA. RNA footprinting revealed that the trpP TRAP binding site consists of nine triplet repeats (five GAG, three UAG, and one AAG) that surround and overlap the trpP Shine-Dalgarno (S-D) sequence and translation start codon. Results from toeprint and RNA-directed cell-free translation experiments indicated that tryptophan-activated TRAP inhibits TrpP synthesis by preventing binding of a 30S ribosomal subunit. Taken together, our results establish that TRAP regulates translation of trpP by blocking ribosome binding. Thus, TRAP coordinately regulates tryptophan synthesis and transport by three distinct mechanisms: attenuation transcription of the trpEDCFBA operon, promoting formation of the trpE S-D blocking hairpin, and blocking ribosome binding to the pabA and trpP transcripts. PMID:14702295

  18. Zn(2+ inhibits coronavirus and arterivirus RNA polymerase activity in vitro and zinc ionophores block the replication of these viruses in cell culture.

    Directory of Open Access Journals (Sweden)

    Aartjan J W te Velthuis

    Full Text Available Increasing the intracellular Zn(2+ concentration with zinc-ionophores like pyrithione (PT can efficiently impair the replication of a variety of RNA viruses, including poliovirus and influenza virus. For some viruses this effect has been attributed to interference with viral polyprotein processing. In this study we demonstrate that the combination of Zn(2+ and PT at low concentrations (2 µM Zn(2+ and 2 µM PT inhibits the replication of SARS-coronavirus (SARS-CoV and equine arteritis virus (EAV in cell culture. The RNA synthesis of these two distantly related nidoviruses is catalyzed by an RNA-dependent RNA polymerase (RdRp, which is the core enzyme of their multiprotein replication and transcription complex (RTC. Using an activity assay for RTCs isolated from cells infected with SARS-CoV or EAV--thus eliminating the need for PT to transport Zn(2+ across the plasma membrane--we show that Zn(2+ efficiently inhibits the RNA-synthesizing activity of the RTCs of both viruses. Enzymatic studies using recombinant RdRps (SARS-CoV nsp12 and EAV nsp9 purified from E. coli subsequently revealed that Zn(2+ directly inhibited the in vitro activity of both nidovirus polymerases. More specifically, Zn(2+ was found to block the initiation step of EAV RNA synthesis, whereas in the case of the SARS-CoV RdRp elongation was inhibited and template binding reduced. By chelating Zn(2+ with MgEDTA, the inhibitory effect of the divalent cation could be reversed, which provides a novel experimental tool for in vitro studies of the molecular details of nidovirus replication and transcription.

  19. Organ-specific alterations in tobacco transcriptome caused by the PVX-derived P25 silencing suppressor transgene

    OpenAIRE

    Jada Balaji; Soitamo Arto J; Lehto Kirsi

    2013-01-01

    Abstract Background RNA silencing affects a broad range of regulatory processes in all eukaryotes ranging from chromatin structure maintenance to transcriptional and translational regulation and longevity of the mRNAs. Particularly in plants, it functions as the major defense mechanism against viruses. To counter-act this defense, plant viruses produce suppressors of RNA silencing (Viral suppressors of RNA silencing, VSRSs), which are essential for viruses to invade their specific host plants...

  20. Multiple Functions of Rice Dwarf Phytoreovirus Pns10 in Suppressing Systemic RNA Silencing▿

    OpenAIRE

    Ren, Bo; Guo, Yuanyuan; Gao, Feng; Zhou, Peng; Wu, Feng; Meng, Zheng; Wei, Chunhong; Li, Yi

    2010-01-01

    RNA silencing is a potent mechanism of antiviral defense response in plants and other organisms. For counterdefense, viruses have evolved a variety of suppressors of RNA silencing (VSRs) that can inhibit distinct steps of a silencing pathway. We previously identified Pns10 encoded by Rice dwarf phytoreovirus (RDV) as a VSR, the first of its kind from double-stranded RNA (dsRNA) viruses. In this study we investigated the mechanisms of Pns10 function in suppressing systemic RNA silencing in the...

  1. The C. elegans CSR-1 Argonaute pathway counteracts epigenetic silencing to promote germline gene expression

    OpenAIRE

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

    2013-01-01

    Organisms can develop adaptive sequence-specific immunity by re-expressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piRNA pathway recruits RNA-dependent RNA polymerase RdRP to foreign sequences to amplify a trans-generational small RNA-induced epigenetic silencing signal (termed RNAe). Here we provide evidence that in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expres...

  2. Efficient and Tumor Targeted siRNA Delivery by Polyethylenimine-graft-polycaprolactone-block-poly(ethylene glycol)-folate (PEI-PCL-PEG-Fol).

    Science.gov (United States)

    Liu, Li; Zheng, Mengyao; Librizzi, Damiano; Renette, Thomas; Merkel, Olivia M; Kissel, Thomas

    2016-01-01

    Efficient delivery of functional nucleic acids into specific cells or tissues is still a challenge for gene therapy and largely depends on targeted delivery strategies. The folate receptor (FR) is known to be overexpressed extracellularly on a variety of human cancers and is therefore an outstanding gate for tumor-targeted Trojan horse-like delivery of therapeutics. In this study, an amphiphilic and biodegradable ternary copolymer conjugated with folate as ligand, polyethylenimine-graft-polycaprolactone-block-poly(ethylene glycol)-folate (PEI-PCL-PEG-Fol) was synthesized and evaluated for targeted siRNA delivery via folate-FR recognition. The amphiphilic character of similar polymers was shown previously to support endosomal release of endocytosed nanocarriers and to promote formation of long circulating micelles. The obtained PEI-PCL-PEG-Fol exhibited less cytotoxicity in comparison with the corresponding ternary copolymer without folate (PEI-PCL-PEG) and with unmodified PEI25kDa. Stable micelle-like polyplexes with hydrodynamic diameters about 100 nm were found to have a zeta potential of +8.6 mV, which was lower than that of micelleplexes without folate-conjugation (+13-16 mV). Nonetheless, increased cellular uptake and in vitro gene knockdown of PEI-PCL-PEG-Fol/siRNA micelleplexes were observed in SKOV-3 cells, an FR overexpressing cell line, in comparison with the nonfolate-conjugated ones. Moreover, PEI-PCL-PEG-Fol/siRNA micelleplexes exhibited excellent stability in vivo during the analysis of 120 min and a longer circulation half life than hyPEI25kDa/siRNA polyplexes. Most interestingly, the targeted delivery system yielded 17% deposition of the i.v. injected siRNA per gram in the tumor after 24 h due to the effective folate targeting and the prolonged circulation. PMID:26641134

  3. Redundancy of the Two Dicer Genes in Transgene-Induced Posttranscriptional Gene Silencing in Neurospora crassa†

    OpenAIRE

    Catalanotto, Caterina; Pallotta, Massimiliano; Refalo, Paul; Sachs, Matthew S.; Vayssie, Laurence; Macino, Giuseppe; Cogoni, Carlo

    2004-01-01

    RNA interference (RNAi) in animals, cosuppression in plants, and quelling in fungi are homology-dependent gene silencing mechanisms in which the introduction of either double-stranded RNA (dsRNA) or transgenes induces sequence-specific mRNA degradation. These phenomena share a common genetic and mechanistic basis. The accumulation of short interfering RNA (siRNA) molecules that guide sequence-specific mRNA degradation is a common feature in both silencing mechanisms, as is the component of th...

  4. Memories Persist in Silence

    Directory of Open Access Journals (Sweden)

    Sandra Patricia Arenas Grisales

    2012-08-01

    Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

  5. Breaking the Silence

    Institute of Scientific and Technical Information of China (English)

    1998-01-01

    Many women who suffer from vaginitis have kept silent about their illness because they think it is shameful to have such a disease. The International Women’s Health Coalition (IWHC) has publicized the problem, referring to it as a "culture of silence"inherited from traditional thinking. The coalition has made attempts to improve women’s health conditions by changing people’s misconceptions about the disease. In 1997, under a grant from the American Ford Foundation, the Sichuan Provincial Women’s Federation carried out a study on women’s repro-ductive health, aimed at "breaking the silence."

  6. Illuminating employees’ organizational silence

    Directory of Open Access Journals (Sweden)

    Jaber Moghaddampour

    2013-08-01

    Full Text Available Undoubtedly, human capital is the main source of knowledge generation, which leads to a competitive advantage and sustainability of organizations. When managers pay more attention to such capital, they will be able to lead their organization, more effectively. In such route, the managers should look for their employees’ opinions on policies/plans of the organization and learn how to run the organization and organizational challenges. They should use their employees’ knowledge to improve the quality of decisions, they should encourage them to share their ideas and protect them from organizational silence. Thus, human capitals will be obviously considered as strategic capitals of an organization. Concerning the importance of organizational sound, the status of organizational silence is studied in 13 selected organizations in Qom Province – as one the biggest Iranian provinces. The findings indicate that organizational silence in Qom selected organizations is not in an ideal status and the current level should be mitigated. Likewise, findings show that there is no significant difference between organizational silence in Qom selected organizations in terms of demographic variables.

  7. Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Praveen Guleria

    Full Text Available BACKGROUND: Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. METHODOLOGY/PRINCIPAL FINDINGS: RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. CONCLUSIONS: SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

  8. Efficient Silencing of Endogenous MicroRNAs Using Artificial MicroRNAs in Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    Andrew L. Eamens; Claire Agius; Neil A. Smith; Peter M. Waterhouse; Ming-Bo Wang

    2011-01-01

    We report here that the expression of endogenous microRNAs (miRNAs) can be efficiently silenced in Arabidopsis thaliana (Arabidopsis) using artificial miRNA (amiRNA) technology. We demonstrate that an amiRNA designed to target a mature miRNA directs silencing against all miRNA family members, whereas an amiRNA designed to target the stem-loop region of a miRNA precursor transcript directs silencing against only the individual family member targeted.Furthermore, our results indicate that amiRNAs targeting both the mature miRNA and stem-loop sequence direct RNA silencing through cleavage of the miRNA precursor transcript, which presumably occurs in the nucleus of a plant cell during the initial stages of miRNA biogenesis. This suggests that small RNA (sRNA)-guided RNA cleavage in plants occurs not only in the cytoplasm, but also in the nucleus. Many plant miRNA gene families have been identified via sequencing and bioinformatic analysis, but, to date, only a small tranche of these have been functionally characterized due to a lack of effective forward or reverse genetic tools. Our findings therefore provide a new and powerful reverse-genetic tool for the analysis of miRNA function in plants.

  9. A Modular Plasmid Assembly Kit for Multigene Expression, Gene Silencing and Silencing Rescue in Plants

    Science.gov (United States)

    Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin

    2014-01-01

    The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083

  10. A modular plasmid assembly kit for multigene expression, gene silencing and silencing rescue in plants.

    Directory of Open Access Journals (Sweden)

    Andreas Binder

    Full Text Available The Golden Gate (GG modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct.

  11. Stable expression of silencing-suppressor protein enhances the performance and longevity of an engineered metabolic pathway.

    Science.gov (United States)

    Naim, Fatima; Shrestha, Pushkar; Singh, Surinder P; Waterhouse, Peter M; Wood, Craig C

    2016-06-01

    Transgenic engineering of plants is important in both basic and applied research. However, the expression of a transgene can dwindle over time as the plant's small (s)RNA-guided silencing pathways shut it down. The silencing pathways have evolved as antiviral defence mechanisms, and viruses have co-evolved viral silencing-suppressor proteins (VSPs) to block them. Therefore, VSPs have been routinely used alongside desired transgene constructs to enhance their expression in transient assays. However, constitutive, stable expression of a VSP in a plant usually causes pronounced developmental abnormalities, as their actions interfere with endogenous microRNA-regulated processes, and has largely precluded the use of VSPs as an aid to stable transgene expression. In an attempt to avoid the deleterious effects but obtain the enhancing effect, a number of different VSPs were expressed exclusively in the seeds of Arabidopsis thaliana alongside a three-step transgenic pathway for the synthesis of arachidonic acid (AA), an ω-6 long chain polyunsaturated fatty acid. Results from independent transgenic events, maintained for four generations, showed that the VSP-AA-transformed plants were developmentally normal, apart from minor phenotypes at the cotyledon stage, and could produce 40% more AA than plants transformed with the AA transgene cassette alone. Intriguingly, a geminivirus VSP, V2, was constitutively expressed without causing developmental defects, as it acts on the siRNA amplification step that is not part of the miRNA pathway, and gave strong transgene enhancement. These results demonstrate that VSP expression can be used to protect and enhance stable transgene performance and has significant biotechnological application. PMID:26628000

  12. Plant RNA binding proteins for control of RNA virus infection

    OpenAIRE

    Huh, Sung Un; Paek, Kyung-Hee

    2013-01-01

    Plant RNA viruses have effective strategies to infect host plants through either direct or indirect interactions with various host proteins, thus suppressing the host immune system. When plant RNA viruses enter host cells exposed RNAs of viruses are recognized by the host immune system through processes such as siRNA-dependent silencing. Interestingly, some host RNA binding proteins have been involved in the inhibition of RNA virus replication, movement, and translation through RNA-specific b...

  13. Silence in Intercultural communication

    Institute of Scientific and Technical Information of China (English)

    Guo Jun

    2012-01-01

    In communication, most of people's attention focuses on verbal communication, nonverbal language as a means of exchange is often ignored. However, nonverbal language continues sending signals, and most of these signals are sent to conversational partners unconsciously. So correct understanding of these signals will help people improve effectiveness of communication. This article will focus on silence, a major part of nonverbal communication, exploring its communicative functions and cultural differences.

  14. The Conspiracy Of Silence

    OpenAIRE

    Cohen, Saul

    1980-01-01

    The issue of the impaired physician is compounded by not only mass denial of the problem, but also a 'conspiracy of silence' among many groups associated with the physician. The conspirators—including the physician himself, his family, community, professional colleagues and nurses as well as hospital boards and administration—are unable to reconcile deteriorating performance due to alcohol or drugs with an otherwise gifted professional who should know the dangers of substance abuse. They may ...

  15. The Silence of Michelangelo

    DEFF Research Database (Denmark)

    Foote, Jonathan

    2016-01-01

    In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... understood as loud and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

  16. Low energy (0-12 eV) electron interaction with gas phase building blocks of DNA/RNA

    International Nuclear Information System (INIS)

    We review recent results on dissociative electron attachment (DEA) to gas phase D-ribose, tetraacetyl-D-ribose (TAR) and dibutylphosphate (DBP), which serve as model compounds for the DNA or RNA backbone. New results are presented on negative ion formation in D-ribose probed by matrix-assisted laser desorption/ionisation time-of-flight (MALDI-TOF) mass spectrometry. The two methods reveal that the transient D-ribose anion R- decomposes in the same way like the deprotonated D-ribose molecule [R-H]-, i.e. by abstraction of different numbers of water and formaldehyde units. In DEA the TNI R- is generated at very low energies close to 0 eV most likely through a vibrational feshbach resonance. The fragmentation pattern and the characteristic resonances of D-ribose are preserved in TAR, where a furanose is bound to four acetyl groups. The presence of an acetyl group leads additionally to fragmentation through a shape resonance. Shape resonances were also observed in DBP, followed by C-O and P-O bond breaking.

  17. PERK silence inhibits glioma cell growth under low glucose stress by blockage of p-AKT and subsequent HK2's mitochondria translocation

    KAUST Repository

    Hou, Xu

    2015-03-12

    Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)\\'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.

  18. siRNA Design Software for a Target Gene-Specific RNA Interference

    OpenAIRE

    Naito, Yuki; Ui-Tei, Kumiko

    2012-01-01

    RNA interference (RNAi) is a mechanism through which small interfering RNA (siRNA) induces sequence-specific posttranscriptional gene silencing. RNAi is commonly recognized as a powerful tool not only for functional genomics but also for therapeutic applications. Twenty-one-nucleotide-long siRNA suppresses the expression of the intended gene whose transcript possesses perfect complementarity to the siRNA guide strand. Hence, its silencing effect has been assumed to be extremely specific. Howe...

  19. Efficiency of Xist-mediated silencing on autosomes is linked to chromosomal domain organisation

    Directory of Open Access Journals (Sweden)

    Tang Y Amy

    2010-05-01

    Full Text Available Abstract Background X chromosome inactivation, the mechanism used by mammals to equalise dosage of X-linked genes in XX females relative to XY males, is triggered by chromosome-wide localisation of a cis-acting non-coding RNA, Xist. The mechanism of Xist RNA spreading and Xist-dependent silencing is poorly understood. A large body of evidence indicates that silencing is more efficient on the X chromosome than on autosomes, leading to the idea that the X chromosome has acquired sequences that facilitate propagation of silencing. LINE-1 (L1 repeats are relatively enriched on the X chromosome and have been proposed as candidates for these sequences. To determine the requirements for efficient silencing we have analysed the relationship of chromosome features, including L1 repeats, and the extent of silencing in cell lines carrying inducible Xist transgenes located on one of three different autosomes. Results Our results show that the organisation of the chromosome into large gene-rich and L1-rich domains is a key determinant of silencing efficiency. Specifically genes located in large gene-rich domains with low L1 density are relatively resistant to Xist-mediated silencing whereas genes located in gene-poor domains with high L1 density are silenced more efficiently. These effects are observed shortly after induction of Xist RNA expression, suggesting that chromosomal domain organisation influences establishment rather than long-term maintenance of silencing. The X chromosome and some autosomes have only small gene-rich L1-depleted domains and we suggest that this could confer the capacity for relatively efficient chromosome-wide silencing. Conclusions This study provides insight into the requirements for efficient Xist mediated silencing and specifically identifies organisation of the chromosome into gene-rich L1-depleted and gene-poor L1-dense domains as a major influence on the ability of Xist-mediated silencing to be propagated in a continuous

  20. The Functions of RNA-Dependent RNA Polymerases in Arabidopsis

    OpenAIRE

    Willmann, Matthew R.; Endres, Matthew W.; Cook, Rebecca T.; Gregory, Brian D.

    2011-01-01

    One recently identified mechanism that regulates mRNA abundance is RNA silencing, and pioneering work in Arabidopsis thaliana and other genetic model organisms helped define this process. RNA silencing pathways are triggered by either self-complementary fold-back structures or the production of double-stranded RNA (dsRNA) that gives rise to small RNAs (smRNAs) known as microRNAs (miRNAs) or small-interfering RNAs (siRNAs). These smRNAs direct sequence-specific regulation of various gene trans...

  1. Structure and Gene-Silencing Mechanisms of Small Noncoding RNAs

    Science.gov (United States)

    Chu, Chia-Ying; Rana, Tariq M.

    Small (19-31-nucleotides) noncoding RNAs were identified in the past 10 years for their distinct function in gene silencing. The best known gene-silencing phenomenon, RNA interference (RNAi), is triggered in a sequence-specific manner by endogenously produced or exogenously introduced small doubled-stranded RNAs. As knowledge of the structure and function of the RNAi machinery has expanded, this phenomenon has become a powerful tool for biochemical research; it has enormous potential for therapeutics. This chapter summarizes significant aspects of three major classes of small noncoding, regulatory RNAs: small interfering RNAs (siRNAs), microRNAs (miRNAs), and Piwi-interacting RNAs (piRNAs). Here, we focus on the biogenesis of these small RNAs, their structural features and coupled effectors as well as the mechanisms of each small regulatory RNA pathway which reveal fascinating ways by which gene silencing is controlled and fine-tuned at an epigenetic level.

  2. Studies of the silencing of Baculovirus DNA binding protein

    NARCIS (Netherlands)

    Quadt, I.; Lent, van J.W.M.; Knebel-Morsdorf, D.

    2007-01-01

    Baculovirus DNA binding protein (DBP) binds preferentially single-stranded DNA in vitro and colocalizes with viral DNA replication sites. Here, its putative role as viral replication factor has been addressed by RNA interference. Silencing of DBP in Autographa californica multiple nucleopolyhedrovir

  3. Transcriptional silencing of multiple genes in trophozoites of Entamoeba histolytica.

    Directory of Open Access Journals (Sweden)

    Rivka Bracha

    2006-05-01

    Full Text Available In a previous work we described the transcriptional silencing of the amoebapore A (AP-A gene (Ehap-a of Entamoeba histolytica strain HM-1:IMSS. The silencing occurred following transfection with a plasmid containing a 5' upstream region (473 bp of Ehap-a that included a truncated segment (140 bp of a short interspersed nuclear element (SINE1. Silencing remained in effect even after removal of the plasmid (clone G3. Neither short interfering RNA nor methylated DNA were detected, but the chromatin domain of Ehap-a in the gene-silenced trophozoites was modified. Two other similar genes (Ehap-b and one encoding a Saposin-like protein, SAPLIP 1 also became silenced. In the present work we demonstrate the silencing of a second gene of choice, one that encodes the light subunit of the Gal/GalNAc inhibitable lectin (Ehlgl1 and the other, the cysteine proteinase 5 (EhCP-5. This silencing occurred in G3 trophozoites transfected with a plasmid in which the 473 bp 5' upstream Ehap-a fragment was directly ligated to the second gene. Transcriptional silencing occurred in both the transgene and the chromosomal gene. SINE1 sequences were essential, as was a direct connection between the Ehap-a upstream region and the beginning of the open reading frame of the second gene. Gene silencing did not occur in strain HM-1:IMSS with any of these plasmid constructs. The trophozoites with two silenced genes were virulence-attenuated as were those of clone G3. In addition, trophozoites not expressing Lgl1 and AP-A proteins had a significantly reduced ability to cap the Gal/GalNAc-lectin to the uroid region when incubated with antibodies against the heavy (170 kDa subunit of the lectin. Lysates of trophozoites lacking cysteine proteinase 5 and AP-A proteins had 30% less cysteine proteinase activity than those of HM-1:IMSS strain or the G3 clone. Silencing of other genes in G3 amoebae could provide a model to study their various functions. In addition, double gene-silenced

  4. Gene silencing and homology-dependent gene silencing in Arabidopsis: genetic modifiers and DNA methylation.

    OpenAIRE

    Furner, I J; Sheikh, M. A.; Collett, C E

    1998-01-01

    Transgenes inserted into the plant genome can become inactive (gene silencing) or result in silencing of homologous cellular genes [homology-dependent gene silencing (HDG silencing)]. In an earlier study we reported HDG silencing of chalcone synthase (CHS) in Arabidopsis. This study concerns genetic revertants of one of the CHS HDG-silencing transgenic homozygotes. Two monogenic recessive trans-acting mutations (hog1 and ddm1) that impair gene silencing and HDG silencing were identified. Thes...

  5. siRNA沉默LKB1基因激活Hedgehog信号通路及对人乳腺癌裸鼠移植瘤模型生长的实验研究%Silencing LKB1 by siRNA activated Hedgehog signaling pathway and the growth of xenografted breast carcinoma in nude mice

    Institute of Scientific and Technical Information of China (English)

    庄志刚; 成小林; 蒋蓓琦; 傅韵; 李正东; 罗建民; 金伟

    2011-01-01

    目的 探讨应用小分子干扰RNA(small interfering RNA,siRNA)沉默抑癌基因LKB1对人乳腺癌细胞MDA-MB-231中Hedgehog信号通路相关因子的表达及人乳腺癌裸鼠移植瘤模型的肿瘤生长的影响.方法 构建LKB1基因siRNA质粒LKB1-siRNA;建立LKB1表达抑制的MDA-MB-435细胞模型;裸鼠乳晕皮下接种,建立人乳腺癌裸鼠移植瘤动物模型;成瘤后,观察肿瘤体积变化、裸鼠生存时间;并用Western印迹法检测瘤组织中LKB1和Hedgehog信号通路中信号肽Shh、Sufu、膜受体Ptch、Smo、转录因子Gli1、Hip 蛋白表达的变化.结果 LKB1-siRNA质粒组裸鼠的肿瘤体积明显增长(P<0.05);肿瘤内LKB1基因表达水平明显下降,而Hedgehog信号通路相关因子Shh、Gli1、Ptch、Smo的表达升高,Hedgehog信号通路抑制因子Sufu、Hip表达下降.结论 LKB1基因siRNA能够明显抑制人乳腺癌裸鼠移植模型的LKB1基因的表达,上调Hedgehog信号通路相关因子的表达,促进肿瘤生长.LKB1基因和Hedgehog信号通路在乳腺癌细胞中呈现负相关表达.%Objective To investigate the effect of silencing LKB1 by small interfering RNA(siR-NA) on the expression of the correlation factor of Hedgehog signaling pathways in human breast cancer MDA-MB-231 cells and the growth of xenografted breast carcinoma in nude mice. Methods Plasmids of siRNA for LKB1 gene were constructed. RNA interference technique was used to silence LKB1 gene in breast carcinoma cells,xenografted tumor model was established in nude mice by subcutaneous inoculation of MDA-MB-231 cells. The tumor volume and survival time of nude mice were recorded. The expression of LKB1, Shh, Sufu.Gli 1 ,Ptch,Smo and Hip was measured by Western blotting. Results The tumor size was significantly increased in LKBl-siRNA treated group(P <0. 01). Western blotting analysis showed that the expression of LKB1 in xenografted tumor was markedly decreased and the correlation factor of Hedgehog signaling pathways was

  6. An miRNA-mediated therapy for SCA6 blocks IRES-driven translation of the CACNA1A second cistron.

    Science.gov (United States)

    Miyazaki, Yu; Du, Xiaofei; Muramatsu, Shin-Ichi; Gomez, Christopher M

    2016-07-13

    Spinocerebellar ataxia type 6 (SCA6) is a dominantly inherited neurodegenerative disease characterized by slowly progressive ataxia and Purkinje cell degeneration. SCA6 is caused by a polyglutamine repeat expansion within a second CACNA1A gene product, α1ACT. α1ACT expression is under the control of an internal ribosomal entry site (IRES) present within the CACNA1A coding region. Whereas SCA6 allele knock-in mice show indistinguishable phenotypes from wild-type littermates, expression of SCA6-associated α1ACT (α1ACTSCA6) driven by a Purkinje cell-specific promoter in mice produces slowly progressive ataxia and cerebellar atrophy. We developed an early-onset SCA6 mouse model using an adeno-associated virus (AAV)-based gene delivery system to ectopically express CACNA1A IRES-driven α1ACTSCA6 to test the potential of CACNA1A IRES-targeting therapies. Mice expressing AAV9-mediated CACNA1A IRES-driven α1ACTSCA6 exhibited early-onset ataxia, motor deficits, and Purkinje cell degeneration. We identified miR-3191-5p as a microRNA (miRNA) that targeted CACNA1A IRES and preferentially inhibited the CACNA1A IRES-driven translation of α1ACT in an Argonaute 4 (Ago4)-dependent manner. We found that eukaryotic initiation factors (eIFs), eIF4AII and eIF4GII, interacted with the CACNA1A IRES to enhance α1ACT translation. Ago4-bound miR-3191-5p blocked the interaction of eIF4AII and eIF4GII with the CACNA1A IRES, attenuating IRES-driven α1ACT translation. Furthermore, AAV9-mediated delivery of miR-3191-5p protected mice from the ataxia, motor deficits, and Purkinje cell degeneration caused by CACNA1A IRES-driven α1ACTSCA6 We have established proof of principle that viral delivery of an miRNA can rescue a disease phenotype through modulation of cellular IRES activity in a mouse model. PMID:27412786

  7. Bodies, Spaces, Voices, Silences

    Directory of Open Access Journals (Sweden)

    Donatella Mazzoleni

    2013-07-01

    Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

  8. Stability of Barley stripe mosaic virus-induced gene silencing in barley

    DEFF Research Database (Denmark)

    Bruun-Rasmussen, Marianne; Madsen, Christian Toft; Jessing, Stine;

    2007-01-01

    for barley and wheat; however, silencing using this vector is generally transient, with efficient silencing often being confined to the first two or three systemically infected leaves. To investigate this further, part of the barley Phytoene desaturase (PDS) gene was inserted into BSMV and the...... length influenced stability but not efficiency of VIGS. Silencing was transient in most cases; however, the decrease in PDS mRNA levels measured by qRT-PCR began earlier and lasted longer than the photobleaching. Occasionally, silencing persisted and could be transmitted through seed as well as via......Virus-induced gene silencing (VIGS) can be used as a powerful tool for functional genomics studies in plants. With this approach, it is possible to target most genes and downregulate the messenger (m)RNA in a sequence-specific manner. Barley stripe mosaic virus (BSMV) is an established VIGS vector...

  9. RNA interference mediated inhibition of dengue virus multiplication and entry in HepG2 cells.

    Directory of Open Access Journals (Sweden)

    Mohammed Abdelfatah Alhoot

    Full Text Available BACKGROUND: Dengue virus-host cell interaction initiates when the virus binds to the attachment receptors followed by endocytic internalization of the virus particle. Successful entry into the cell is necessary for infection initiation. Currently, there is no protective vaccine or antiviral treatment for dengue infection. Targeting the viral entry pathway has become an attractive therapeutic strategy to block infection. This study aimed to investigate the effect of silencing the GRP78 and clathrin-mediated endocytosis on dengue virus entry and multiplication into HepG2 cells. METHODOLOGY/PRINCIPAL FINDINGS: HepG2 cells were transfected using specific siRNAs to silence the cellular surface receptor (GRP78 and clathrin-mediated endocytosis pathway. Gene expression analysis showed a marked down-regulation of the targeted genes (87.2%, 90.3%, and 87.8% for GRP78, CLTC, and DNM2 respectively in transfected HepG2 cells when measured by RT-qPCR. Intracellular and extracellular viral RNA loads were quantified by RT-qPCR to investigate the effect of silencing the attachment receptor and clathrin-mediated endocytosis on dengue virus entry. Silenced cells showed a significant reduction of intracellular (92.4% and extracellular viral RNA load (71.4% compared to non-silenced cells. Flow cytometry analysis showed a marked reduction of infected cells (89.7% in silenced HepG2 cells compared to non-silenced cells. Furthermore, the ability to generate infectious virions using the plaque assay was reduced 1.07 log in silenced HepG2 cells. CONCLUSIONS/SIGNIFICANCE: Silencing the attachment receptor and clathrin-mediated endocytosis using siRNA could inhibit dengue virus entry and multiplication into HepG2 cells. This leads to reduction of infected cells as well as the viral load, which might function as a unique and promising therapeutic agent for attenuating dengue infection and prevent the development of dengue fever to the severe life-threatening DHF or DSS

  10. Plum pox virus coat protein gene intron-hairpin-RNA (ihpRNA) constructs provide resistance to Plum pox virus in Nicotiana benthamiana and Prunus domestica

    Science.gov (United States)

    The efficiency and strength of RNA silencing appears to depend on the formation of dsRNA. Constructs with self-complementary sequences separated by an intron produce "hairpin" RNA (ihpRNA) structures that efficiently elicit post-transcriptional gene silencing (PTGS). In the present study, we used t...

  11. Silence Amenity Engineering

    Science.gov (United States)

    Fujita, Hajime

    Engineering civilization brought convenient and comfortable life to us. However, some environmental problems such as various pollutions have also been developed with it. Acoustical noise is one of the major problems in modern life. Noise is generated from a noise source and propagates through transmitting medium such as the air and eventually reaches a receiver, usually a human being. The noise problem can be avoided, therefore, if one of those three elements in the noise problem is removed completely. In actual case, engineers are looking for most efficient way combining the controls for these three elements. In this article, basic characteristics of noise is reviewed briefly at first, then sound field analysis to predict sound transmission is discussed Aerodynamic noise is one of the major problems in silence amenity engineering today. Basic concept of the aerodynamic noise generation mechanism is discussed in detail with applications to turbo-machinery and high speed train noise control technology.

  12. SAT in silence.

    Science.gov (United States)

    Brockdorff, Neil

    2009-04-01

    X chromosome inactivation triggered by Xist RNA can only occur in specific developmental contexts. In this issue of Developmental Cell, Agrelo et al. show that the nuclear matrix protein SATB1 is a critical determinant of Xist responsiveness. PMID:19386254

  13. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  14. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  15. Post-transcriptional gene silencing signal could move rapidly and bidirectionally in grafted Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    LI Ming; JIANG Shiling; WANG Youqun; LIU Guoqin

    2006-01-01

    RNA interference (RNAi), one of the newly found ways for post-transcriptional gene silencing, has been widely used to investigate gene functions through transgenic methods for introducing an RNA silencing signal into plants. In the present study, we constructed a dexamethazone (DEX)-inducible RNAi binary vector harboring a specific sequence fragment (168-bp) homologous to KatB and KatC, two kinesin isoform genes of Arabidopsis, which were proved to result in the post-transcriptional gene silencing of KatB and KatC in DEX-induced transgenic plants. RT-PCR and Northern blot analysis on transgenic homozygous Arabidopsis (termed as RNAi-type plants) showed that DEX inducement causes KatB and KatC mRNA degradation. With a simplified method, Arabidopsis grafting was effectively performed between RNAi-type and wild-type lines. The target gene mRNA levels were tested based on semi-quantitative RT-PCR. Our results demonstrateed that DEX-induced gene silencing signals could result in a reduction in KatB and KatC mRNA in the wild-type rootstocks or scions, indicating that silencing signals of RNAi could be transmitted bidirectionally across the graft junction whether RNAi-plants were scions or stocks. In contrast to the previously reported results on grafted tobacco, the transmission of post- transcriptional gene silencing signals caused by RNAi in grafted Arabidopsis is more effective than that in tobacco.

  16. Hepatitis C Virus (HCV) NS5B Nonnucleoside Inhibitors Specifically Block Single-Stranded Viral RNA Synthesis Catalyzed by HCV Replication Complexes In Vitro▿

    OpenAIRE

    Yang, Wengang; Sun, Yongnian; Phadke, Avinash; Deshpande, Milind; Huang, Mingjun

    2006-01-01

    Replication complexes of hepatitis C virus synthesized two major species of viral RNA in vitro, double stranded and single stranded. NS5B nonnucleoside inhibitors inhibited dose dependently the synthesis of single-stranded RNA but not double-stranded RNA. Moreover, replication complexes carrying a mutation resistant to a nonnucleoside inhibitor lost their susceptibilities to the inhibitor.

  17. Hairpin dsRNA does not trigger RNA interference in Candida albicans cells

    OpenAIRE

    Staab, Janet F.; White, Theodore C.; Marr, Kieren A.

    2010-01-01

    RNA interference/silencing mechanisms triggered by double-stranded RNA (dsRNA) have been described in many eukaryotes, including fungi. These mechanisms have in common small RNA molecules (siRNAs or microRNAs) originating from dsRNAs that, together with the effector protein Argonaute, mediate silencing. The genome of the fungal pathogen Candida albicans harbours a well-conserved Argonaute and a non-canonical Dicer, essential members of silencing pathways. Prototypical siRNAs are detected as m...

  18. Silencing of MicroRNA-21 confers the sensitivity to tamoxifen and fulvestrant by enhancing autophagic cell death through inhibition of the PI3K-AKT-mTOR pathway in breast cancer cells.

    Science.gov (United States)

    Yu, Xinfeng; Li, Ruilian; Shi, Wenna; Jiang, Tao; Wang, Yufei; Li, Cong; Qu, Xianjun

    2016-02-01

    Tamoxifen (TAM) and fulvestrant (FUL) represent the major adjuvant therapy to estrogen receptor-alpha positive (ER(+)) breast cancer patients. However, endocrine resistance to TAM and FUL is a great impediment for successful treatment. We hypothesized that miR-21 might alter the sensitivity of breast cancer cells to TAM or FUL by regulating cell autophagy. Using the ER(+) breast cancer cells, we knockdown miR-21.by transfection with miR-21 inhibitor, then the cells were exposed to TAM or FUL and the percentages of apoptosis and autophagy were determined. Knockdown of miR-21 significantly increased the TAM or FUL-induced apoptosis in ER(+) breast cancer cells. Further, silencing of miR-21 in MCF-7 cells enhanced cell autophagy at both basal and TAM or FUL-induced level. The increase of autophagy in miR-21-knockdown MCF-7 cells was also indicated by increase of beclin-1, LC3-II and increased GFP-LC3 dots. Importantly, knockdown of miR-21 contributed to autophagic cell death, which is responsible for part of TAM induced cell death in miR-21 inhibitor-transfected cells. Further analysis suggested that miR-21 inhibitor enhance autophagic cell death through inhibition of PI3K-AKT-mTOR pathway. MiR-21 coordinated the function of autophagy and apoptosis by targeting Phosphatase and tensin homolog (PTEN) through inhibition of PI3K-AKT-mTOR pathway. In conclusion, silencing of miR-21 increased the sensitivity of ER(+) breast cancer cells to TAM or FUL by increasing autophagic cell death. Targeting autophagy-related miRNAs is a potential strategy for overcoming endocrine resistance to TAM and FUL. PMID:26796263

  19. Host-induced gene silencing: a tool for understanding fungal host interaction and for developing novel disease control strategies.

    Science.gov (United States)

    Nunes, Cristiano C; Dean, Ralph A

    2012-06-01

    Recent discoveries regarding small RNAs and the mechanisms of gene silencing are providing new opportunities to explore fungal pathogen-host interactions and potential strategies for novel disease control. Plant pathogenic fungi are a constant and major threat to global food security; they represent the largest group of disease-causing agents on crop plants on the planet. An initial understanding of RNA silencing mechanisms and small RNAs was derived from model fungi. Now, new knowledge with practical implications for RNA silencing is beginning to emerge from the study of plant-fungus interactions. Recent studies have shown that the expression of silencing constructs in plants designed on fungal genes can specifically silence their targets in invading pathogenic fungi, such as Fusarium verticillioides, Blumeria graminis and Puccinia striiformis f.sp. tritici. Here, we highlight the important general aspects of RNA silencing mechanisms and emphasize recent findings from plant pathogenic fungi. Strategies to employ RNA silencing to investigate the basis of fungal pathogenesis are discussed. Finally, we address important aspects for the development of fungal-derived resistance through the expression of silencing constructs in host plants as a powerful strategy to control fungal disease. PMID:22111693

  20. Targeting choline phospholipid metabolism: GDPD5 and GDPD6 silencing decrease breast cancer cell proliferation, migration, and invasion.

    Science.gov (United States)

    Cao, Maria Dung; Cheng, Menglin; Rizwan, Asif; Jiang, Lu; Krishnamachary, Balaji; Bhujwalla, Zaver M; Bathen, Tone F; Glunde, Kristine

    2016-08-01

    Abnormal choline phospholipid metabolism is associated with oncogenesis and tumor progression. We have investigated the effects of targeting choline phospholipid metabolism by silencing two glycerophosphodiesterase genes, GDPD5 and GDPD6, using small interfering RNA (siRNA) in two breast cancer cell lines, MCF-7 and MDA-MB-231. Treatment with GDPD5 and GDPD6 siRNA resulted in significant increases in glycerophosphocholine (GPC) levels, and no change in the levels of phosphocholine or free choline, which further supports their role as GPC-specific regulators in breast cancer. The GPC levels were increased more than twofold during GDPD6 silencing, and marginally increased during GDPD5 silencing. DNA laddering was negative in both cell lines treated with GDPD5 and GDPD6 siRNA, indicating absence of apoptosis. Treatment with GDPD5 siRNA caused a decrease in cell viability in MCF-7 cells, while GDPD6 siRNA treatment had no effect on cell viability in either cell line. Decreased cell migration and invasion were observed in MDA-MB-231 cells treated with GDPD5 or GDPD6 siRNA, where a more pronounced reduction in cell migration and invasion was observed under GDPD5 siRNA treatment as compared with GDPD6 siRNA treatment. In conclusion, GDPD6 silencing increased the GPC levels in breast cancer cells more profoundly than GDPD5 silencing, while the effects of GDPD5 silencing on cell viability/proliferation, migration, and invasion were more severe than those of GDPD6 silencing. Our results suggest that silencing GDPD5 and GDPD6 alone or in combination may have potential as a new molecular targeting strategy for breast cancer treatment. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27356959

  1. Hydrolytic charge-reversal of PEGylated polyplexes enhances intracellular un-packaging and activity of siRNA.

    Science.gov (United States)

    Werfel, Thomas A; Swain, Corban; Nelson, Christopher E; Kilchrist, Kameron V; Evans, Brian C; Miteva, Martina; Duvall, Craig L

    2016-04-01

    Hydrolytically degrading nano-polyplexes (HDG-NPs) that reverse charge through conversion of tertiary amines to carboxylic acids were investigated to improve intracellular un-packaging of siRNA and target gene silencing compared to a non-degradable analog (non-HDG-NPs). Both NP types comprised reversible addition-fragmentation chain-transfer (RAFT) synthesized diblock copolymers of a poly(ethylene glycol) (PEG) corona-forming block and a cationic block for nucleic acid packaging that incorporated butyl methacrylate (BMA) and either dimethylaminoethyl methacrylate (DMAEMA, non-HDG-NPs) or dimethylaminoethyl acrylate (DMAEA, HDG-NPs). HDG-NPs decreased significantly in size and released significantly more siRNA (∼40%) than non-HDG-NPs after 24 h in aqueous solution. While both HDG-NPs and non-HDG-NPs had comparable uptake and cytotoxicity up to 150 nM siRNA doses, HDG-NPs achieved significantly higher target gene silencing of the model gene luciferase in vitro. High resolution FRET confocal microscopy was used to monitor the intracellular un-packaging of siRNA. Non-HDG-NPs had significantly higher FRET efficiency than HDG-NPs, indicating that siRNA delivered from HDG-NPs was more fully un-packaged and therefore had improved intracellular bioavailability. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 917-927, 2016. PMID:26691570

  2. siRNA delivery: Loaded-up microsponges

    Science.gov (United States)

    Grabow, Wade W.; Jaeger, Luc

    2012-04-01

    Self-assembled microsponges of hairpin RNA polymers achieve, with one thousand times lower concentration, the same degree of gene silencing in tumour-carrying mice as conventional nanoparticle-based siRNA delivery vehicles.

  3. Characterizing siRNA production from a dual reporter system

    Science.gov (United States)

    Various reporter genes have proven effective at demonstrating the effects of RNA silencing in plants. Previous data has indicated a differential effect of RNA silencing on two luciferase genes (unrelated at the DNA sequence level), irrespective of the promoters use to drive the reporter genes. To in...

  4. Multimeric small interfering ribonucleic acid for highly efficient sequence-specific gene silencing

    Science.gov (United States)

    Mok, Hyejung; Lee, Soo Hyeon; Park, Ji Won; Park, Tae Gwan

    2010-03-01

    Small interfering RNA (siRNA) with 19-21 base pairs has been recently recognized as a new therapeutic agent for effectively silencing a specific gene on a post-transcription level. For siRNA therapeutics, safe and efficient delivery issues are significant hurdles to clinical applications. Here we present a new class of biologically active siRNA structure based on chemically self-crosslinked and multimerized siRNA through cleavable disulphide linkages. The multimerized siRNA can produce more stable and compact polyelectrolyte complexes with less cytotoxic cationic carriers than naked siRNA because of substantially increased charge densities and the presence of flexible chemical linkers in the backbone. The cleavable and multimerized siRNA shows greatly enhanced gene-silencing efficiencies in vitro and in vivo through a target-messenger-RNA-specific RNA interference processing without significantly eliciting immune induction. This study demonstrates that the multimerized siRNA structure complexed with selected cationic condensing agents can serve as potential gene-silencing therapeutics for treating various diseases.

  5. Antisense Gene Silencing: Therapy for Neurodegenerative Disorders?

    Directory of Open Access Journals (Sweden)

    Troels T. Nielsen

    2013-09-01

    Full Text Available Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied to mammalian cells, the technology of RNAi expanded from being a valuable experimental tool to being an applicable method for gene-specific therapeutic regulation, and much effort has been put into further refinement of the technique. This review will focus on how RNAi has developed over the years and how the technique is exploited in a pre-clinical and clinical perspective in relation to neurodegenerative disorders.

  6. The effects of age-in-block on RNA-seq analysis of archival formalin-fixed paraffin-embedded (FFPE) samples

    Science.gov (United States)

    Archival samples represent a vast resource for identification of chemical and pharmaceutical targets. Previous use of formalin-fixed paraffin-embedded (FFPE) samples has been limited due to changes in RNA introduced by fixation and embedding procedures. Recent advances in RNA-seq...

  7. Silencing leptin with short interfering RNA reveals the role of leptin in rat firrosis%小干扰RNA沉默瘦素揭示了瘦素在大鼠肝纤维化中的作用

    Institute of Scientific and Technical Information of China (English)

    薛秀兰; 邢玉刚; 吴晓鹭; 刘家俊

    2014-01-01

    目的:观察靶向瘦素(leptin)小干扰 RNA(interference ,siRNA)真核细胞表达质粒对大鼠肝纤维化的影响。方法采用已构建的重组 Leptin-siRNA 真核细胞表达质粒,用脂质体包埋法通过腹腔注射将其导入大鼠肝纤维化模型体内。通过 HE染色观察肝脏病理形态学变化;Western Blot 检测 leptin、I 型胶原和 STAT3蛋白表达变化;半定量 RT-PCR 检测leptin mRNA表达。结果与正常对照组相比,肝纤维化组(CCl4)和质粒空载体组(CCl4(+)K)肝纤维化程度较重,纤维化评分多为Ⅳ级(P<0.01),同时肝脏 leptin、I型胶原和 STAT3含量明显上升(P<0.05);而与肝纤维化组(CCl4)和质粒空载体组(CCl4(+)K)比,leptin-siRNA质粒转染组(The CCl4(+)L)肝纤维化程度减轻,纤维化程度多为Ⅰ-Ⅱ级,肝脏 leptin、I型胶原和 STAT3表达均显著抑制(P<0.05)。正常对照组和 leptin-siRNA 质粒组(The CCl4(+)L)在组织学及 leptin、I 型胶原和 STAT3基因转录和表达水平无统计学差异(P>0.05)。结论 leptin-siRNA 表达质粒降低 I 型胶原和 STAT3含量、抑制 leptin表达,阻抑肝纤维化;Leptin有望成为肝纤维化基因治疗的新靶位点。%Obj ective To observe the effects of leptin-siRNA expression plasmids on rat liver fibro-sis.Methods The constructed leptin-siRNA expression plasmids were injected into the abdominal cavity of rat liver fibrosis models by encapsulation with Lipofectmine 2000.The pathological grade was observed by HE staining.Leptin,collagen I and STAT3 were detected by Western blot.The mRNA expression of lep-tin was assessed by semi-RT-PCR .Results The fibrosis model CCl4 and CCl4(+)K groups showed severe fibrosis,including septal fibrosis,extensive bridging,and fatty degeneration.The expressions of leptin, collagen type I and STAT3 in mRNA and protein were also elevated in the livers from these groups(P0.05).Conclusion The leptin-siRNA plasmid can decrease collagen I and STAT3,inhibit

  8. Specific Tandem Repeats Are Sufficient for Paramutation-Induced Trans-Generational Silencing

    OpenAIRE

    Belele, Christiane L.; Lyudmila Sidorenko; Maike Stam; Rechien Bader; Arteaga-Vazquez, Mario A.; Chandler, Vicki L.

    2013-01-01

    Paramutation is a well-studied epigenetic phenomenon in which trans communication between two different alleles leads to meiotically heritable transcriptional silencing of one of the alleles. Paramutation at the b1 locus involves RNA-mediated transcriptional silencing and requires specific tandem repeats that generate siRNAs. This study addressed three important questions: 1) are the tandem repeats sufficient for paramutation, 2) do they need to be in an allelic position to mediate paramutati...

  9. Transcription-dependent silencing of inducible convergent transgenes in transgenic mice

    Directory of Open Access Journals (Sweden)

    Calero-Nieto Fernando J

    2010-01-01

    Full Text Available Abstract Background Silencing of transgenes in mice is a common phenomenon typically associated with short multi-copy transgenes. We have investigated the regulation of the highly inducible human granulocyte-macrophage colony-stimulating-factor gene (Csf2 in transgenic mice. Results In the absence of any previous history of transcriptional activation, this transgene was expressed in T lineage cells at the correct inducible level in all lines of mice tested. In contrast, the transgene was silenced in a specific subset of lines in T cells that had encountered a previous episode of activation. Transgene silencing appeared to be both transcription-dependent and mediated by epigenetic mechanisms. Silencing was accompanied by loss of DNase I hypersensitive sites and inability to recruit RNA polymerase II upon stimulation. This pattern of silencing was reflected by increased methylation and decreased acetylation of histone H3 K9 in the transgene. We found that silenced lines were specifically associated with a single pair of tail-to-tail inverted repeated copies of the transgene embedded within a multi-copy array. Conclusions Our study suggests that epigenetic transgene silencing can result from convergent transcription of inverted repeats which can lead to silencing of an entire multi-copy transgene array. This mechanism may account for a significant proportion of the reported cases of transgene inactivation in mice.

  10. Branched RNA: A New Architecture for RNA Interference

    Directory of Open Access Journals (Sweden)

    Anna Aviñó

    2011-01-01

    Full Text Available Branched RNAs with two and four strands were synthesized. These structures were used to obtain branched siRNA. The branched siRNA duplexes had similar inhibitory capacity as those of unmodified siRNA duplexes, as deduced from gene silencing experiments of the TNF-α protein. Branched RNAs are considered novel structures for siRNA technology, and they provide an innovative tool for specific gene inhibition. As the method described here is compatible with most RNA modifications described to date, these compounds may be further functionalized to obtain more potent siRNA derivatives and can be attached to suitable delivery systems.

  11. Trans-specific gene silencing between host and parasitic plants.

    Science.gov (United States)

    Tomilov, Alexey A; Tomilova, Natalia B; Wroblewski, Tadeusz; Michelmore, Richard; Yoder, John I

    2008-11-01

    Species of Orobanchaceae parasitize the roots of nearby host plants to rob them of water and other nutrients. Parasitism can be debilitating to the host plant, and some of the world's most pernicious agricultural pests are parasitic weeds. We demonstrate here that interfering hairpin constructs transformed into host plants can silence expression of the targeted genes in the parasite. Transgenic roots of the hemi-parasitic plant Triphysaria versicolor expressing the GUS reporter gene were allowed to parasitize transgenic lettuce roots expressing a hairpin RNA containing a fragment of the GUS gene (hpGUS). When stained for GUS activity, Triphysaria roots attached to non-transgenic lettuce showed full GUS activity, but those parasitizing transgenic hpGUS lettuce lacked activity in root tissues distal to the haustorium. Transcript quantification indicated a reduction in the steady-state level of GUS mRNA in Triphysaria when they were attached to hpGUS lettuce. These results demonstrate that the GUS silencing signal generated by the host roots was translocated across the haustorium interface and was functional in the parasite. Movement across the haustorium was bi-directional, as demonstrated in double-junction experiments in which non-transgenic Triphysaria concomitantly parasitized two hosts, one transgenic for hpGUS and the other transgenic for a functional GUS gene. Observation of GUS silencing in the second host demonstrated that the silencing trigger could be moved from one host to another using the parasite as a physiological bridge. Silencing of parasite genes by generating siRNAs in the host provides a novel strategy for controlling parasitic weeds. PMID:18643992

  12. Switching off small RNA regulation with trap-mRNA

    DEFF Research Database (Denmark)

    Overgaard, Martin; Johansen, Jesper; Møller-Jensen, Jakob; Valentin-Hansen, Poul

    2009-01-01

    Small non-coding regulatory RNAs in bacteria have been shown predominantly to be tightly regulated at the level of transcription initiation, and sRNAs that function by an antisense mechanism on trans-encoded target mRNAs have been shown or predicted to act stoichiometrically. Here we show that Mic......M, which silences the expression of an outer membrane protein, YbfM under most growth conditions, does not become destabilized by target mRNA overexpression, indicating that the small RNA regulator acts catalytically. Furthermore, our regulatory studies suggested that control of micM expression is unlikely...... to operate at the level of transcription initiation. By employing a highly sensitive genetic screen we uncovered a novel RNA-based regulatory principle in which induction of a trap-mRNA leads to selective degradation of a small regulatory RNA molecule, thereby abolishing the sRNA-based silencing of...

  13. Silencing by imprinted noncoding RNAs: is transcription the answer?

    OpenAIRE

    Pauler, Florian M; Koerner, Martha V.; Barlow, Denise P.

    2007-01-01

    Non-coding RNAs (ncRNAs) with gene regulatory functions are starting to be seen as a common feature of mammalian gene regulation with the discovery that most of the transcriptome is ncRNA. The prototype has long been the Xist ncRNA, which induces X-chromosome inactivation in female cells. However, a new paradigm is emerging – the silencing of imprinted gene clusters by long ncRNAs. Here, we review models by which imprinted ncRNAs could function. We argue that an Xist-like model is only one of...

  14. G9a is essential for epigenetic silencing of K(+) channel genes in acute-to-chronic pain transition.

    Science.gov (United States)

    Laumet, Geoffroy; Garriga, Judit; Chen, Shao-Rui; Zhang, Yuhao; Li, De-Pei; Smith, Trevor M; Dong, Yingchun; Jelinek, Jaroslav; Cesaroni, Matteo; Issa, Jean-Pierre; Pan, Hui-Lin

    2015-12-01

    Neuropathic pain is a debilitating clinical problem and difficult to treat. Nerve injury causes a long-lasting reduction in K(+) channel expression in the dorsal root ganglion (DRG), but little is known about the epigenetic mechanisms involved. We found that nerve injury increased dimethylation of Lys9 on histone H3 (H3K9me2) at Kcna4, Kcnd2, Kcnq2 and Kcnma1 promoters but did not affect levels of DNA methylation on these genes in DRGs. Nerve injury increased activity of euchromatic histone-lysine N-methyltransferase-2 (G9a), histone deacetylases and enhancer of zeste homolog-2 (EZH2), but only G9a inhibition consistently restored K(+) channel expression. Selective knockout of the gene encoding G9a in DRG neurons completely blocked K(+) channel silencing and chronic pain development after nerve injury. Remarkably, RNA sequencing analysis revealed that G9a inhibition not only reactivated 40 of 42 silenced genes associated with K(+) channels but also normalized 638 genes down- or upregulated by nerve injury. Thus G9a has a dominant function in transcriptional repression of K(+) channels and in acute-to-chronic pain transition after nerve injury. PMID:26551542

  15. Molecular deregulation induced by silencing of the high mobility group protein A2 gene in retinoblastoma cells

    OpenAIRE

    Venkatesan, Nalini; Krishnakumar, Subramanian; Deepa, Perinkulam Ravi; Deepa, Murali; Khetan, Vikas; Reddy, M. Ashwin

    2012-01-01

    Aim To explore the molecular mechanisms deregulated by high mobility group protein A2 (HMGA2) gene silencing in retinoblastoma (RB) cells. Methods Synthetic anti-HMGA2 short interfering RNA (siRNA) was used to silence the HMGA2 gene in cultured Y79 RB cells that were subjected to whole genome microarray analysis. The expression of differentially regulated key genes was confirmed with quantitative reverse-transcriptase polymerase chain reaction (qRT–PCR) in post-silenced RB cell lines (Y79 and...

  16. Pumilio turns on microRNA function.

    Science.gov (United States)

    Triboulet, Robinson; Gregory, Richard I

    2010-10-01

    Pumilio proteins PUM1 and PUM2 are shown to regulate microRNA-dependent gene silencing by induction of a conformational switch in the 3' untranslated region of p27 mRNA. This conformational change is required for efficient microRNA-mediated repression of this cell-cycle regulator in rapidly proliferating cells. PMID:20885420

  17. Construction of lentiviral vector of shRNA specific for rat PAX2 and the silencing effect%大鼠PAX2基因RNA干扰慢病毒载体的构建及沉默效果

    Institute of Scientific and Technical Information of China (English)

    李里; 吴玉斌

    2014-01-01

    Objective To observe the influence of lentiviral vector-mediated RNA interference on expression of rat PAX 2 gene in rat normal renal tubular epithelial cells (NRK52E).Methods The effective RNA interference sequence targeting PAX 2 gene was screened and determined according to previous study.The complementary DNA containing both sense and antisense Oligo DNA of the targeting sequence was designed,synthesized and cloned into pGCSIL-GFP vector to construct a lentiviral vector which expressed PAX 2 shRNA,subsequently confirmed by PCR and DNA sequencing analysis.293 T cells were co-transfected with the plasmids using liposome transfection methods ,and packaged to produce lentiviral particles.The recombinant lentiviruses were transfected into NRK52 E cells, and the PAX2 mRNA and protein expression were examined by RT-PCR and Western blot .The results were compared with those of the non-transfected and blank vector trans-fected NRK52E cells.Results PCR analysis and DNA sequencing confirmed that the PAX 2 shRNA sequences were successfully inserted in-to the lentiviral vectors.After transfection with PAX2 shRNA,the PAX2 expression in NRK52E cells was significantly inhibited at both mR-NA and protein levels compared with that in non-transfected and empty vector transfected NRK 52E cells.Conclusions The lentiviral RNAi vectors targeting PAX2 gene have been successfully constructed ,and can effectively inhibit the expression of PAX 2 gene in NRK52E cells.It paves a way for PAX2-targeted gene therapy of obstructive nephropathy.%目的:构建PAX2特异性shRNA 干扰慢病毒载体并观察其对大鼠肾小管上皮细胞( NRK52E)中PAX2基因的沉默效果。方法采用PAX2基因 RNAi靶点序列合成靶序列的 Oligo DNA,退火形成双链 DNA,与pGCSIL-GFP载体连接产生 shRNA慢病毒载体,经 PCR筛选阳性克隆进行 DNA 测序鉴定。用脂质体转染法将质粒共转染293T 细胞,将包装产生的慢病毒颗粒感染NRK52E

  18. Communicative Silences: Forms and Functions

    Science.gov (United States)

    Bruneau, Thomas J.

    1973-01-01

    The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

  19. Teaching Note: Gaining Voice through Silence

    Science.gov (United States)

    Kaufman, Peter

    2008-01-01

    For educators striving to create an egalitarian classroom based on open, reflexive, and honest dialogue, silence can be the ultimate obstacle. Not only does silence stifle individual expression; more importantly, silence also prevents the collective production of knowledge, understanding, compassion, and empathy. When learners and teachers feel…

  20. The donor substrate site within the peptidyl transferase loop of 23 S rRNA and its putative interactions with the CCA-end of N-blocked aminoacyl-tRNA(Phe)

    DEFF Research Database (Denmark)

    Porse, B T; Thi-Ngoc, H P; Garrett, R A

    1996-01-01

    An RNA region associated with the donor substrate site, located at the base of the peptidyl transferase loop of 23 S rRNA, was subjected to a comprehensive single-site mutational study. Growth phenotypes of Escherichia coli cells were characterized on induction of synthesis of the mutated rRNAs and...... the mutated ribosomes were tested, selectively, for their capacity to generate peptide bonds under the conditions of the "fragment" assay. Most of the mutants exhibited dominant or recessive lethal growth phenotypes and, in general, defective growth correlated with low activities in peptide bond...... approach was employed to test for Watson-Crick base-pairing interactions between the -CCA end of the P-site bound tRNA(Phe) and this region of the peptidyl-transferase loop. Single nucleotide substitutions were introduced into the -CCA end of tRNA(Phe) and the ability of the 3'-terminal pentanucleotide...

  1. ShRNA-mediated Ku80 gene silencing inhibits cell proliferation and sensitizes to γ-radiation and mitomycin C-induced apoptosis in esophageal squamous cell carcinoma lines

    International Nuclear Information System (INIS)

    To investigate the effects of Ku80 depletion on cell growth and sensitization to γ-radiation and Mitomycin C (MMC)-induced apoptosis in esophageal squamous cell carcinoma lines. Six human carcinoma cell lines (LNcaP, K562, MDA-MB-231, MCF-7, EC9706, and K150) and normal HEK293 cell line were examined for basal levels of Ku80 protein by western blotting analysis. The suppression of Ku80 expression was performed using vector-based shRNA in EC9706 cells. Cell proliferation was determined with MTT assay and colony formation assay and tumorigenicity in a xenograft model in vitro and in vivo. Sensitivity of EC9706 cells treated with shRNA vector to γ-radiation and MMC was determined with colony formation assay and MTT assay. The cell cycle distribution was determined by Flow cytometry. Apoptosis induced by γ-radiation and MMC was analyzed using GENMED-TUNEL FACS kit. Ku80 showed higher basal levels in six carcinoma cell lines than in HEK293. The suppression of Ku80 expression decreased cellular proliferation, colony formation and inhibited tumorigenicity in a xenograft model. Furthermore, it sensitized apoptosis of the cancer cells induced by γ-radiation and MMC. Ku80 plays an important role not only in tumorigenesis but also in radiation resistance and chemotherapy resistance in esophageal cancer cells. Hence Ku80 may serve as a promising therapeutic target, particularly for recurrent esophageal tumors. (author)

  2. Templated assembly of albumin-based nanoparticles for simultaneous gene silencing and magnetic resonance imaging

    Science.gov (United States)

    Mertz, Damien; Affolter-Zbaraszczuk, Christine; Barthès, Julien; Cui, Jiwei; Caruso, Frank; Baumert, Thomas F.; Voegel, Jean-Claude; Ogier, Joelle; Meyer, Florent

    2014-09-01

    In this article, we address the design of innovative human serum albumin (HSA)-based nanoparticles loaded with silencing RNA and grafted with gadolinium complexes having average sizes ranging from ca. 50 to 150 nm according to the siRNA/HSA composition. The non-covalent siRNA/HSA assembly is formed on isobutyramide-modified mesoporous silica and the self-supported HSA-based nanoparticles are obtained following the silica template dissolution. These original protein particles provide simultaneous magnetic resonance imaging contrast enhancement and cellular in vitro gene silencing.In this article, we address the design of innovative human serum albumin (HSA)-based nanoparticles loaded with silencing RNA and grafted with gadolinium complexes having average sizes ranging from ca. 50 to 150 nm according to the siRNA/HSA composition. The non-covalent siRNA/HSA assembly is formed on isobutyramide-modified mesoporous silica and the self-supported HSA-based nanoparticles are obtained following the silica template dissolution. These original protein particles provide simultaneous magnetic resonance imaging contrast enhancement and cellular in vitro gene silencing. Electronic supplementary information (ESI) available: Experimental details and supporting Fig. S1-S4. See DOI: 10.1039/c4nr02623c

  3. Blocking miRNA Biogenesis in Adult Forebrain Neurons Enhances Seizure Susceptibility, Fear Memory, and Food Intake by Increasing Neuronal Responsiveness.

    Science.gov (United States)

    Fiorenza, Anna; Lopez-Atalaya, Jose P; Rovira, Victor; Scandaglia, Marilyn; Geijo-Barrientos, Emilio; Barco, Angel

    2016-04-01

    The RNase Dicer is essential for the maturation of most microRNAs, a molecular system that plays an essential role in fine-tuning gene expression. To gain molecular insight into the role of Dicer and the microRNA system in brain function, we conducted 2 complementary RNA-seq screens in the hippocampus of inducible forebrain-restricted Dicer1 mutants aimed at identifying the microRNAs primarily affected by Dicer loss and their targets, respectively. Functional genomics analyses predicted the main biological processes and phenotypes associated with impaired microRNA maturation, including categories related to microRNA biology, signal transduction, seizures, and synaptic transmission and plasticity. Consistent with these predictions, we found that, soon after recombination, Dicer-deficient mice exhibited an exaggerated seizure response, enhanced induction of immediate early genes in response to different stimuli, stronger and more stable fear memory, hyperphagia, and increased excitability of CA1 pyramidal neurons. In the long term, we also observed slow and progressive excitotoxic neurodegeneration. Overall, our results indicate that interfering with microRNA biogenesis causes an increase in neuronal responsiveness and disrupts homeostatic mechanisms that protect the neuron against overactivation, which may explain both the initial and late phenotypes associated with the loss of Dicer in excitatory neurons. PMID:25595182

  4. Application of RNA interference in treating human diseases

    Indian Academy of Sciences (India)

    S. Abdolhamid Angaji; Sara Sadate Hedayati; Reihane Hosein Poor; Safoura Madani; Sanaz Samad Poor; Samin Panahi

    2010-12-01

    Gene silencing can occur either through repression of transcription, termed transcriptional gene silencing (TGS), or through translation repression and mRNA degradation, termed posttranscriptional gene silencing (PTGS). PTGS results from sequence-specific mRNA degradation in the cytoplasm without dramatic changes in transcription of corresponding gene in nucleus. Both TGS and PTGS are used to regulate endogenous genes. Interestingly, mechanisms for gene silencing also protect the genome from transposons and viruses. In this paper, we first review RNAi mechanism and then focus on some of its applications in biomedical research such as treatment for HIV, viral hepatitis, cardiovascular and cerebrovascular diseases, metabolic disease, neurodegenerative disorders and cancer.

  5. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    Science.gov (United States)

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  6. Induction of Silencing in Plants by High-Pressure Spraying of In vitro-Synthesized Small RNAs.

    Science.gov (United States)

    Dalakouras, Athanasios; Wassenegger, Michèle; McMillan, John N; Cardoza, Vinitha; Maegele, Ira; Dadami, Elena; Runne, Miriam; Krczal, Gabi; Wassenegger, Michael

    2016-01-01

    In this report, we describe a method for the delivery of small interfering RNAs (siRNAs) into plant cells. In vitro synthesized siRNAs that were designed to target the coding region of a GREEN FLUORESCENT PROTEIN (GFP) transgene were applied by various methods onto GFP-expressing transgenic Nicotiana benthamiana plants to trigger RNA silencing. In contrast to mere siRNA applications, including spraying, syringe injection, and infiltration of siRNAs that all failed to induce RNA silencing, high pressure spraying of siRNAs resulted in efficient local and systemic silencing of the GFP transgene, with comparable efficiency as was achieved with biolistic siRNA introduction. High-pressure spraying of siRNAs with sizes of 21, 22, and 24 nucleotides (nt) led to local GFP silencing. Small RNA deep sequencing revealed that no shearing of siRNAs was detectable by high-pressure spraying. Systemic silencing was basically detected upon spraying of 22 nt siRNAs. Local and systemic silencing developed faster and more extensively upon targeting the apical meristem than spraying of mature leaves. PMID:27625678

  7. Plasma hydrogenated cationic detonation nanodiamonds efficiently deliver to human cells in culture functional siRNA targeting the Ewing sarcoma junction oncogene.

    Science.gov (United States)

    Bertrand, Jean-Rémi; Pioche-Durieu, Catherine; Ayala, Juan; Petit, Tristan; Girard, Hugues A; Malvy, Claude P; Le Cam, Eric; Treussart, François; Arnault, Jean-Charles

    2015-03-01

    The expression of a defective gene can lead to major cell dysfunctions among which cell proliferation and tumor formation. One promising therapeutic strategy consists in silencing the defective gene using small interfering RNA (siRNA). In previous publications we showed that diamond nanocrystals (ND) of primary size 35 nm, rendered cationic by polyethyleneimine-coating, can efficiently deliver siRNA into cell, which further block the expression of EWS/FLI-1 oncogene in a Ewing sarcoma disease model. However, a therapeutic application of such nanodiamonds requires their elimination by the organism, particularly in urine, which is impossible for 35 nm particles. Here, we report that hydrogenated cationic nanodiamonds of primary size 7 nm (ND-H) have also a high affinity for siRNA and are capable of delivering them in cells. With siRNA/ND-H complexes, we measured a high inhibition efficacy of EWS/FLI-1 gene expression in Ewing sarcoma cell line. Electron microscopy investigations showed ND-H in endocytosis compartments, and especially in macropinosomes from which they can escape before siRNA degradation occurred. In addition, the association of EWS/FLI-1 silencing by the siRNA/ND-H complex with a vincristine treatment yielded a potentiation of the toxic effect of this chemotherapeutic drug. Therefore ND-H appears as a promising delivery agent in anti-tumoral gene therapy. PMID:25662499

  8. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    Although retroviral vector systems have been found to efficiently transduce a variety of cell types in vitro, the use of vectors based on murine leukemia virus in preclinical models of somatic gene therapy has led to the identification of transcriptional silencing in vivo as an important problem....... Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t...

  9. Heart Block

    Science.gov (United States)

    ... the signal causes the heart to contract and pump blood. Heart block occurs if the electrical signal is ... degree heart block limits the heart's ability to pump blood to the rest of the body. This type ...

  10. Silencing and Innate Immunity in Plant Defense Against Viral and Non-Viral Pathogens

    Directory of Open Access Journals (Sweden)

    Anna S. Zvereva

    2012-10-01

    Full Text Available The frontline of plant defense against non-viral pathogens such as bacteria, fungi and oomycetes is provided by transmembrane pattern recognition receptors that detect conserved pathogen-associated molecular patterns (PAMPs, leading to pattern-triggered immunity (PTI. To counteract this innate defense, pathogens deploy effector proteins with a primary function to suppress PTI. In specific cases, plants have evolved intracellular resistance (R proteins detecting isolate-specific pathogen effectors, leading to effector-triggered immunity (ETI, an amplified version of PTI, often associated with hypersensitive response (HR and programmed cell death (PCD. In the case of plant viruses, no conserved PAMP was identified so far and the primary plant defense is thought to be based mainly on RNA silencing, an evolutionary conserved, sequence-specific mechanism that regulates gene expression and chromatin states and represses invasive nucleic acids such as transposons. Endogenous silencing pathways generate 21-24 nt small (sRNAs, miRNAs and short interfering (siRNAs, that repress genes post-transcriptionally and/or transcriptionally. Four distinct Dicer-like (DCL proteins, which normally produce endogenous miRNAs and siRNAs, all contribute to the biogenesis of viral siRNAs in infected plants. Growing evidence indicates that RNA silencing also contributes to plant defense against non-viral pathogens. Conversely, PTI-based innate responses may contribute to antiviral defense. Intracellular R proteins of the same NB-LRR family are able to recognize both non-viral effectors and avirulence (Avr proteins of RNA viruses, and, as a result, trigger HR and PCD in virus-resistant hosts. In some cases, viral Avr proteins also function as silencing suppressors. We hypothesize that RNA silencing and innate immunity (PTI and ETI function in concert to fight plant viruses. Viruses counteract this dual defense by effectors that suppress both PTI-/ETI-based innate responses

  11. Long noncoding RNA ANRIL indicates a poor prognosis of gastric cancer and promotes tumor growth by epigenetically silencing of miR-99a/miR-449a.

    Science.gov (United States)

    Zhang, Er-bao; Kong, Rong; Yin, Dan-dan; You, Liang-hui; Sun, Ming; Han, Liang; Xu, Tong-peng; Xia, Rui; Yang, Jin-song; De, Wei; Chen, Jin fei

    2014-04-30

    Long noncoding RNAs are involved in diseases including cancer. Here, we reported that ANRIL (CDKN2B-AS1), a 3.8-kb long noncoding RNA, recruiting and binding to PRC2, was generally upregulated in human gastric cancer (GC) tissues. In a cohort of 120 GC patients, the higher expression of ANRIL was significantly correlated with a higher TNM stage (P=0.041) and tumor size (P=0.001). Multivariate analyses revealed that ANRIL expression served as an independent predictor for overall survival (P=0.036). Further experiments revealed that ANRIL knockdown significantly repressed the proliferation both in vitro and in vivo. We also showed that E2F1 could induce ANRIL and ANRIL-mediated growth promotion is in part due to epigenetic repression of miR-99a/miR-449a in Trans (controlling the targets--mTOR and CDK6/E2F1 pathway) by binding to PRC2, thus forming a positive feedback loop, continuing to promote GC cell proliferation. To our knowledge, this is the first report showed that the role of ANRIL in the progression of GC and ANRIL could crosstalk with microRNAs in epigenetic level. Our results suggest that ANRIL, as a growth regulator, may serve as a candidate prognostic biomarker and target for new therapies in human gastric cancer. PMID:24810364

  12. Population Blocks.

    Science.gov (United States)

    Smith, Martin H.

    1992-01-01

    Describes an educational game called "Population Blocks" that is designed to illustrate the concept of exponential growth of the human population and some potential effects of overpopulation. The game material consists of wooden blocks; 18 blocks are painted green (representing land), 7 are painted blue (representing water); and the remaining…

  13. Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

    Directory of Open Access Journals (Sweden)

    Jiexiong Feng

    Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

  14. ADME studies of [5‐3H]‐2′‐O‐methyluridine nucleoside in mice: a building block in siRNA therapeutics

    OpenAIRE

    Lozac'h, Frederic; Christensen, Jesper; Faller, Thomas; van de Kerkhof, Esther; Krauser, Joel; Garnier, Maxime; Litherland, Karine; Catoire, Alexandre; Natt, Francois; Hunziker, Jurg; Swart, Piet

    2016-01-01

    Abstract The chemical modification 2′‐O‐methyl of nucleosides is often used to increase siRNA stability towards nuclease activities. However, the metabolic fate of modified nucleosides remains unclear. Therefore, the aim of this study was to determine the mass balance, pharmacokinetic, and absorption, distribution, metabolism, and excretion (ADME)‐properties of tritium‐labeled 2′‐O‐methyluridine, following a single intravenous dose to male CD‐1 mice. The single intravenous administration of [...

  15. Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.

    Science.gov (United States)

    Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

    2015-01-01

    RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667

  16. Specific tandem repeats are sufficient for paramutation-induced trans-generational silencing.

    Directory of Open Access Journals (Sweden)

    Christiane L Belele

    Full Text Available Paramutation is a well-studied epigenetic phenomenon in which trans communication between two different alleles leads to meiotically heritable transcriptional silencing of one of the alleles. Paramutation at the b1 locus involves RNA-mediated transcriptional silencing and requires specific tandem repeats that generate siRNAs. This study addressed three important questions: 1 are the tandem repeats sufficient for paramutation, 2 do they need to be in an allelic position to mediate paramutation, and 3 is there an association between the ability to mediate paramutation and repeat DNA methylation levels? Paramutation was achieved using multiple transgenes containing the b1 tandem repeats, including events with tandem repeats of only one half of the repeat unit (413 bp, demonstrating that these sequences are sufficient for paramutation and an allelic position is not required for the repeats to communicate. Furthermore, the transgenic tandem repeats increased the expression of a reporter gene in maize, demonstrating the repeats contain transcriptional regulatory sequences. Transgene-mediated paramutation required the mediator of paramutation1 gene, which is necessary for endogenous paramutation, suggesting endogenous and transgene-mediated paramutation both require an RNA-mediated transcriptional silencing pathway. While all tested repeat transgenes produced small interfering RNAs (siRNAs, not all transgenes induced paramutation suggesting that, as with endogenous alleles, siRNA production is not sufficient for paramutation. The repeat transgene-induced silencing was less efficiently transmitted than silencing induced by the repeats of endogenous b1 alleles, which is always 100% efficient. The variability in the strength of the repeat transgene-induced silencing enabled testing whether the extent of DNA methylation within the repeats correlated with differences in efficiency of paramutation. Transgene-induced paramutation does not require extensive

  17. Blocking the Wnt/β-Catenin Pathway by Lentivirus-Mediated Short Hairpin RNA Targeting β-Catenin Gene Suppresses Silica-Induced Lung Fibrosis in Mice

    OpenAIRE

    Xin Wang; Wujing Dai; Yanrang Wang; Qing Gu; Deyi Yang; Ming Zhang

    2015-01-01

    Silicosis is a form of occupational lung disease caused by inhalation of crystalline silica dust. While the pathogenesis of silicosis is not clearly understood, the Wnt/β-catenin signaling pathway is thought to play a major role in lung fibrosis. To explore the role of Wnt/β-catenin pathway in silicosis, we blocked Wnt/β-catenin pathway both in silica-treated MLE-12 cells (a mouse pulmonary epithelial cell line) and in a mouse silicosis model by using a lentiviral vector expressing a short ha...

  18. Construction of TLR4 gene-specific RNA interference recombinant vectors and comparison on their silence effects%TLR4基因RNA干扰载体的构建及其抑制效率比较

    Institute of Scientific and Technical Information of China (English)

    姜泓; 王平忠; 张野; 徐哲; 王九平; 彭梅娟; 黄长形; 白雪帆

    2009-01-01

    目的 构建含有Toll样受体4(TLR4)基因特异性RNA干扰序列的pSliencer4.1-CMV neo载体,比较其对TLR4的抑制效率.方法 通过Ambion公司的在线软件设计TLR4基因(GenBank:NM138554)的RNA干扰(RNAi)序列,按siRNA设计的优化原则筛选靶序列,再选取其中部分序列进行合成,经退火、连接,构建含有TLR4基因特异性RNA干扰序列的pSliencer4.1-CMVneo载体.用脂质体SPort XP-1分别将载体及阳性和阴性对照质粒转染血管内皮细胞系EVC-304细胞,提取细胞总RNA,进行RT-PCR反应,筛选抑制效率较高的载体.结果 共设计出可供选择的序列228条,经BLAST比对后,有30条序列有较好的序列特异性,并根据其在基因中的相对位置选择9条作为siRNA靶序列.RT-PCR结果表明其中有5个载体具有较高的抑制效率,以TS4,TS6,TS8抑制效率最高,分别为89%,90%,88%,其余siRNA的抑制效率均未超过50%.抑制效果较好的5条序列在TLR4基因中的位置分别为444、1 203、1 389、2 774、3 409nt处.结论 成功构建了抑制效率较高的TLR4基因特异性RNA干扰序列的pSliencer4.1-CMV neo载体,筛选出特异性抑制TLR4表达的序列,为TLR4信号转导的研究奠定了基础.

  19. Evidence for large complex networks of plant short silencing RNAs.

    Directory of Open Access Journals (Sweden)

    Daniel MacLean

    Full Text Available BACKGROUND: In plants and animals there are many classes of short RNAs that carry out a wide range of functions within the cell; short silencing RNAs (ssRNAs of 21-25 nucleotides in length are produced from double-stranded RNA precursors by the protein Dicer and guide nucleases and other proteins to their RNA targets through base pairing interactions. The consequence of this process is degradation of the targeted RNA, suppression of its translation or initiation of secondary ssRNA production. The secondary ssRNAs in turn could then initiate further layers of ssRNA production to form extensive cascades and networks of interacting RNA [1]. Previous empirical analysis in plants established the existence of small secondary ssRNA cascade [2], in which a single instance of this event occurred but it was not known whether there are other more extensive networks of secondary sRNA production. METHODOLOGY/PRINCIPAL FINDINGS: We generated a network by predicting targets of ssRNA populations obtained from high-throughput sequencing experiments. The topology of the network shows it to have power law connectivity distribution, to be dissortative, highly clustered and composed of multiple components. We also identify protein families, PPR and ULP1, that act as hubs within the network. Comparison of the repetition of genomic sub-sequences of ssRNA length between Arabidopsis and E.coli suggest that the network structure is made possible by the underlying repetitiveness in the genome sequence. CONCLUSIONS/SIGNIFICANCE: Together our results provide good evidence for the existence of a large, robust ssRNA interaction network with distinct regulatory function. Such a network could have a massive effect on the regulation of gene expression via mediation of transcript levels.

  20. Silencing of VAMP3 inhibits cell migration and integrin-mediated adhesion

    International Nuclear Information System (INIS)

    Integrins are transmembrane receptors for cell adhesion to the extracellular matrix. In cell migration, integrins are endocytosed from the plasma membrane or the cell surface, transported in vesicles and exocytosed actively at the cell front. In the present study, we examined the roles of VAMP3, a SNARE protein that mediates exocytosis, in cell migration and integrin trafficking. Small interfering RNA (siRNA)-induced silencing of VAMP3 inhibited chemotactic cell migration by more than 60% without affecting cell proliferation. VAMP3 silencing reduced the levels of β1 integrin at the cell surface but had no effect on total cellular β1 integrin, indicating that VAMP3 is required for trafficking of β1 integrin to the plasma membrane. Furthermore, VAMP3 silencing diminished cell adhesion to laminin but not to fibronectin or collagen. Taken together, these data suggest that VAMP3-dependent integrin trafficking is crucial in cell migration and cell adhesion to laminin.