WorldWideScience

Sample records for block rna silencing

  1. Tospovirus : induction and suppression of RNA silencing

    NARCIS (Netherlands)

    Hedil, Marcio

    2016-01-01

    While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

  2. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

  3. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  4. Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

    Science.gov (United States)

    Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

    2016-06-17

    In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

  5. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  6. Conifers have a unique small RNA silencing signature

    OpenAIRE

    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

    2008-01-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  7. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  8. Antiviral RNA silencing viral counter defense in plants

    NARCIS (Netherlands)

    Bucher, E.C.

    2006-01-01

    The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

  9. RNA interference: ready to silence cancer?

    Science.gov (United States)

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  10. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

    Science.gov (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

    2017-09-11

    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  12. Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

    Directory of Open Access Journals (Sweden)

    Thibaut Josse

    2007-09-01

    Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

  13. Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

    Science.gov (United States)

    Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

    2012-03-01

    Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

  14. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  15. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  16. A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

    Science.gov (United States)

    Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

    2017-07-27

    In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Science.gov (United States)

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  18. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

    Directory of Open Access Journals (Sweden)

    Marcio Hedil

    2016-07-01

    Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  19. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

    Science.gov (United States)

    Hedil, Marcio; Kormelink, Richard

    2016-07-23

    The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  20. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  1. Conifers have a unique small RNA silencing signature.

    Science.gov (United States)

    Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

    2008-08-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

  2. MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

    Science.gov (United States)

    Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

    2014-01-01

    Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

  3. MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

    Directory of Open Access Journals (Sweden)

    Bushuai Zhong

    Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

  4. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  5. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

    Science.gov (United States)

    Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

    2010-11-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

  6. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    International Nuclear Information System (INIS)

    Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

    2012-01-01

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  7. Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

    Science.gov (United States)

    Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

    2016-09-15

    Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  8. Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

    Science.gov (United States)

    Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

    2009-01-01

    RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

  9. The dynamics and efficacy of antiviral RNA silencing: A model study

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-03-01

    Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

  10. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Directory of Open Access Journals (Sweden)

    Adrian Valli

    Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  11. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Science.gov (United States)

    Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

    2012-01-01

    RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  12. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    Energy Technology Data Exchange (ETDEWEB)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)

    2009-10-07

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  13. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    International Nuclear Information System (INIS)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B

    2009-01-01

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  14. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  15. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules

    NARCIS (Netherlands)

    Schnettler, E.; Hemmes, J.C.; Huisman, R.; Goldbach, R.W.; Prins, M.W.; Kormelink, R.J.M.

    2010-01-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs

  16. Receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient delivery system for MRTF silencing in conjunctival fibrosis.

    Science.gov (United States)

    Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T

    2016-02-24

    There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.

  17. RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

    NARCIS (Netherlands)

    Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

    2009-01-01

    RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

  18. AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

    Science.gov (United States)

    Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

    2013-05-01

    AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

  19. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  20. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  1. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  2. MicroRNA mimicry blocks pulmonary fibrosis

    Science.gov (United States)

    Montgomery, Rusty L; Yu, Guoying; Latimer, Paul A; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva

    2014-01-01

    Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular disease. While many studies have shown therapeutic efficacy using miRNA inhibitors, efforts to restore or increase the function of a miRNA have been lagging behind. The miR-29 family has gained a lot of attention for its clear function in tissue fibrosis. This fibroblast-enriched miRNA family is downregulated in fibrotic diseases which induces a coordinate increase of many extracellular matrix genes. Here, we show that intravenous injection of synthetic RNA duplexes can increase miR-29 levels in vivo for several days. Moreover, therapeutic delivery of these miR-29 mimics during bleomycin-induced pulmonary fibrosis restores endogenous miR-29 function whereby decreasing collagen expression and blocking and reversing pulmonary fibrosis. Our data support the feasibility of using miRNA mimics to therapeutically increase miRNAs and indicate miR-29 to be a potent therapeutic miRNA for treating pulmonary fibrosis. PMID:25239947

  3. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing; Zhu, Jian-Kang

    2010-01-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  4. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing

    2010-05-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  5. Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.

    Science.gov (United States)

    Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H

    2012-12-11

    Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.

  6. Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

    NARCIS (Netherlands)

    Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

    2017-01-01

    Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

  7. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  8. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

    NARCIS (Netherlands)

    Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

    2004-01-01

    RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

  9. Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

    Science.gov (United States)

    Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

    2017-10-01

    MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

  10. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  11. Pathways of cellular internalisation of liposomes delivered siRNA and effects on siRNA engagement with target mRNA and silencing in cancer cells.

    Science.gov (United States)

    Alshehri, Abdullah; Grabowska, Anna; Stolnik, Snow

    2018-02-28

    Design of an efficient delivery system is a generally recognised bottleneck in translation of siRNA technology into clinic. Despite research efforts, cellular processes that determine efficiency of siRNA silencing achieved by different delivery formulations remain unclear. Here, we investigated the mechanism(s) of cellular internalisation of a model siRNA-loaded liposome system in a correlation to the engagement of delivered siRNA with its target and consequent silencing by adopting siRNA molecular beacon technology. Probing of cellular internalisation pathways by a panel of pharmacological inhibitors indicated that clathrin-mediated (dynamin-dependent) endocytosis, macropinocytosis (dynamine independent), and cell membrane cholesterol dependent process(es) (clathrin and caveolea-independent) all play a role in the siRNA-liposomes internalization. The inhibition of either of these entry routes was, in general, mirrored by a reduction in the level of siRNA engagement with its target mRNA, as well as in a reduction of the target gene silencing. A dramatic increase in siRNA engagement with its target RNA was observed on disruption of endosomal membrane (by chloroquine), accompanied with an increased silencing. The work thus illustrates that employing molecular beacon siRNA technology one can start to assess the target RNA engagement - a stage between initial cellular internalization and final gene silencing of siRNA delivery systems.

  12. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

    Science.gov (United States)

    Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

    2017-10-10

    The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

  13. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

    OpenAIRE

    Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

    2016-01-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

  14. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  15. Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

    DEFF Research Database (Denmark)

    Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

    2011-01-01

    expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...

  16. Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

    Directory of Open Access Journals (Sweden)

    Elisabeth H. Vollmann

    2017-06-01

    Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

  17. BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS

    Directory of Open Access Journals (Sweden)

    Omarov R.T.

    2012-08-01

    Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of

  18. Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

    Directory of Open Access Journals (Sweden)

    Chantelle Ahlenstiel

    2015-01-01

    Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

  19. Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

    Science.gov (United States)

    Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

    2016-11-29

    Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

  20. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  1. Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer.

    Science.gov (United States)

    Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong

    2014-02-01

    The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

  2. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.

    2013-06-13

    Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  3. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

    Directory of Open Access Journals (Sweden)

    Adriana F. Fusaro

    2017-10-01

    Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

  4. An intronic microRNA silences genes that are functionally antagonistic to its host gene.

    Science.gov (United States)

    Barik, Sailen

    2008-09-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

  5. Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain

    Directory of Open Access Journals (Sweden)

    Julia F Alterman

    2015-01-01

    Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.

  6. An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

    Directory of Open Access Journals (Sweden)

    Lim Chee Liew

    Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

  7. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  8. Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots

    Directory of Open Access Journals (Sweden)

    Ida Bagus Andika

    2016-09-01

    Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.

  9. The Ebola virus VP35 protein is a suppressor of RNA silencing

    NARCIS (Netherlands)

    Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

    2007-01-01

    RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is

  10. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

    Science.gov (United States)

    Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

    2007-09-18

    Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

  11. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Directory of Open Access Journals (Sweden)

    Jiangyu Wu

    2013-01-01

    Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

  12. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Science.gov (United States)

    Huang, Weizhe; He, Ziying

    2013-01-01

    RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

  13. MicroRNA mimicry blocks pulmonary fibrosis

    NARCIS (Netherlands)

    Montgomery, Rusty L; Yu, Guoying; Latimer, Paul A; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva

    2014-01-01

    Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular

  14. MicroRNA silencing in primates: towards development of novel therapeutics

    DEFF Research Database (Denmark)

    Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

    2009-01-01

    MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....

  15. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  16. Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.

    Science.gov (United States)

    Gredell, Joseph A; Berger, Angela K; Walton, S Patrick

    2008-07-01

    The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si

  17. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  18. PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.

    Science.gov (United States)

    Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N

    2016-05-01

    To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat.

    Science.gov (United States)

    Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio

    2016-09-01

    We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

    Directory of Open Access Journals (Sweden)

    Livia Donaire

    Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

  1. Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

    Science.gov (United States)

    Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

    2011-05-01

    There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

  2. Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.

    Science.gov (United States)

    Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui

    2013-10-01

    Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.

  3. RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

    International Nuclear Information System (INIS)

    Beck, Markus; Strand, Michael R.

    2003-01-01

    The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

  4. Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

    Science.gov (United States)

    Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

    2013-05-01

    We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  5. Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

    International Nuclear Information System (INIS)

    Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian

    2004-01-01

    Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

  6. PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

    2017-02-01

    Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  7. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  8. The Ebola virus VP35 protein is a suppressor of RNA silencing.

    Directory of Open Access Journals (Sweden)

    Joost Haasnoot

    2007-06-01

    Full Text Available RNA silencing or interference (RNAi is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is triggered by virus-specific double-stranded RNA molecules (dsRNAs that are produced during infection. To overcome antiviral RNAi responses, many plant and insect viruses encode RNA silencing suppressors (RSSs that enable them to replicate at higher titers. Recently, several human viruses were shown to encode RSSs, suggesting that RNAi also serves as an innate defence response in mammals. Here, we demonstrate that the Ebola virus VP35 protein is a suppressor of RNAi in mammalian cells and that its RSS activity is functionally equivalent to that of the HIV-1 Tat protein. We show that VP35 can replace HIV-1 Tat and thereby support the replication of a Tat-minus HIV-1 variant. The VP35 dsRNA-binding domain is required for this RSS activity. Vaccinia virus E3L protein and influenza A virus NS1 protein are also capable of replacing the HIV-1 Tat RSS function. These findings support the hypothesis that RNAi is part of the innate antiviral response in mammalian cells. Moreover, the results indicate that RSSs play a critical role in mammalian virus replication.

  9. Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

    Science.gov (United States)

    Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-09-01

    The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

  10. Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

    Science.gov (United States)

    Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

    2010-12-15

    N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

  11. The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

    Science.gov (United States)

    Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

    2014-02-13

    Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Science.gov (United States)

    Moser, Joanna J; Fritzler, Marvin J

    2010-10-18

    GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA)-mediated messenger RNA (mRNA) silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC). To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells. RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1) miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2) astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3) miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4) the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells. The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  13. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Directory of Open Access Journals (Sweden)

    Joanna J Moser

    2010-10-01

    Full Text Available GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA-mediated messenger RNA (mRNA silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC. To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells.RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1 miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2 astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3 miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4 the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells.The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  14. Efficient transformation and artificial miRNA gene silencing in Lemna minor.

    Science.gov (United States)

    Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

    2015-01-01

    Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  15. Spliced leader RNA silencing (SLS - a programmed cell death pathway in Trypanosoma brucei that is induced upon ER stress

    Directory of Open Access Journals (Sweden)

    Michaeli Shulamit

    2012-05-01

    Full Text Available Abstract Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite cycles between its insect (procyclic form and mammalian hosts (bloodstream form. Trypanosomes lack conventional transcription regulation, and their genes are transcribed in polycistronic units that are processed by trans-splicing and polyadenylation. In trans-splicing, which is essential for processing of each mRNA, an exon, the spliced leader (SL is added to all mRNAs from a small RNA, the SL RNA. Trypanosomes lack the machinery for the unfolded protein response (UPR, which in other eukaryotes is induced under endoplasmic reticulum (ER stress. Trypanosomes respond to such stress by changing the stability of mRNAs, which are essential for coping with the stress. However, under severe ER stress that is induced by blocking translocation of proteins to the ER, treatment of cells with chemicals that induce misfolding in the ER, or extreme pH, trypanosomes elicit the spliced leader silencing (SLS pathway. In SLS, the transcription of the SL RNA gene is extinguished, and tSNAP42, a specific SL RNA transcription factor, fails to bind to its cognate promoter. SLS leads to complete shut-off of trans-splicing. In this review, I discuss the UPR in mammals and compare it to the ER stress response in T. brucei leading to SLS. I summarize the evidence supporting the notion that SLS is a programmed cell death (PCD pathway that is utilized by the parasites to substitute for the apoptosis observed in higher eukaryotes under prolonged ER stress. I present the hypothesis that SLS evolved to expedite the death process, and rapidly remove from the population unfit parasites that, by elimination via SLS, cause minimal damage to the parasite population.

  16. Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Maciej Pietrzak

    Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

  17. A Convenient In Vivo Model Using Small Interfering RNA Silencing to Rapidly Assess Skeletal Gene Function.

    Directory of Open Access Journals (Sweden)

    Wen Zhang

    Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of

  18. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

    Science.gov (United States)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

    2016-06-28

    Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

    Science.gov (United States)

    Kelleher, Erin S.

    2016-01-01

    Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

  20. The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

    Science.gov (United States)

    Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

    1999-10-15

    Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

  1. STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma

    Directory of Open Access Journals (Sweden)

    Carla Lucia Esposito

    2018-03-01

    Full Text Available Glioblastoma (GBM is the most frequent and aggressive primary brain tumor in adults, and despite advances in neuro-oncology, the prognosis for patients remains dismal. The signal transducer and activator of transcription-3 (STAT3 has been reported as a key regulator of the highly aggressive mesenchymal GBM subtype, and its direct silencing (by RNAi oligonucleotides has revealed a great potential as an anti-cancer therapy. However, clinical use of oligonucleotide-based therapies is dependent on safer ways for tissue-specific targeting and increased membrane penetration. The objective of this study is to explore the use of nucleic acid aptamers as carriers to specifically drive a STAT3 siRNA to GBM cells in a receptor-dependent manner. Using an aptamer that binds to and antagonizes the oncogenic receptor tyrosine kinase PDGFRβ (Gint4.T, here we describe the design of a novel aptamer-siRNA chimera (Gint4.T-STAT3 to target STAT3. We demonstrate the efficient delivery and silencing of STAT3 in PDGFRβ+ GBM cells. Importantly, the conjugate reduces cell viability and migration in vitro and inhibits tumor growth and angiogenesis in vivo in a subcutaneous xenograft mouse model. Our data reveals Gint4.T-STAT3 conjugate as a novel molecule with great translational potential for GBM therapy.

  2. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens

    International Nuclear Information System (INIS)

    Pruss, Gail J.; Lawrence, Christopher B.; Bass, Troy; Li Qingshun Q.; Bowman, Lewis H.; Vance, Vicki

    2004-01-01

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms

  3. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens.

    Science.gov (United States)

    Pruss, Gail J; Lawrence, Christopher B; Bass, Troy; Li, Qingshun Q; Bowman, Lewis H; Vance, Vicki

    2004-03-01

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms.

  4. Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

    Science.gov (United States)

    Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

    2017-09-01

    RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

  5. A conserved small RNA promotes silencing of the outer membrane protein YbfM

    DEFF Research Database (Denmark)

    Rasmussen, Anders Aamann; Johansen, Jesper; Nielsen, Jesper S

    2009-01-01

    important physiological role of regulatory RNA molecules in Gram-negative bacteria is to modulate the cell surface and/or to prevent accumulation of OMPs in the envelope. Here, we extend the OMP-sRNA network by showing that the expression of the outer membrane protein YbfM is silenced by a conserved sRNA......In the past few years an increasing number of small non-coding RNAs (sRNAs) in enterobacteria have been found to negatively regulate the expression of outer membrane proteins (OMPs) at the post-transcriptional level. These RNAs act under various growth and stress conditions, suggesting that one......, designated MicM (also known as RybC/SroB). The regulation is strictly dependent on the RNA chaperone Hfq, and mutational analysis indicates that MicM sequesters the ribosome binding site of ybfM mRNA by an antisense mechanism. Furthermore, we provide evidence that Hfq strongly enhances the on-rate of duplex...

  6. E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.

    Science.gov (United States)

    Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2010-06-01

    Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.

  7. The microRNA effector RNA-induced silencing complex in hidradenitis suppurativa: a significant dysregulation within active inflammatory lesions.

    Science.gov (United States)

    Hessam, S; Sand, M; Skrygan, M; Bechara, Falk G

    2017-09-01

    Recently, we could show that the expression levels of the key regulators of the microRNA (miRNA) maturation and transport were dysregulated in inflamed hidradenitis suppurativa (HS) tissue (Heyam et al. in Wiley Interdiscip Rev RNA 6:271-289, 2015). The RNA-induced silencing complex (RISC) is the central element of the miRNA pathway and regulates miRNA formation and function. We investigated the expression of the RISC components, namely transactivation-responsive RNA-binding protein-1 (TRBP1), TRBP2, protein activator (PACT) of the interferon-induced protein kinase R, Argonaute RISC Catalytic Component-1 (AGO1) and Component-2 (AGO2), metadherin, and staphylococcal nuclease and Tudor domain-containing-1 (SND1) in inflamed HS tissue compared to healthy and psoriatic controls by real-time reverse transcription polymerase chain reaction. Expression levels of all investigated components were significantly lower in lesional HS skin (n = 18) compared to healthy controls (n = 10). TRBP1, PACT, AGO1, AGO2, and SND1 expression levels were significantly down-regulated in lesional HS skin compared to healthy-appearing perilesional skin (n = 7). TRBP2 and SND1 expression levels were significantly lower in healthy-appearing perilesional skin compared to healthy controls. In lesional HS skin, expression levels of PACT, AGO1, and AGO2 were significantly lower compared to psoriatic skin (n = 10). In summary, our data showed that all investigated components of RISC are dysregulated in the skin of HS patients, providing support for the hypothesis that miRNAs may have a pathological role in the inflammatory pathogenesis of HS.

  8. Layer-by-layer nanoparticles as an efficient siRNA delivery vehicle for SPARC silencing.

    Science.gov (United States)

    Tan, Yang Fei; Mundargi, Raghavendra C; Chen, Min Hui Averil; Lessig, Jacqueline; Neu, Björn; Venkatraman, Subbu S; Wong, Tina T

    2014-05-14

    Efficient and safe delivery systems for siRNA therapeutics remain a challenge. Elevated secreted protein, acidic, and rich in cysteine (SPARC) protein expression is associated with tissue scarring and fibrosis. Here we investigate the feasibility of encapsulating SPARC-siRNA in the bilayers of layer-by-layer (LbL) nanoparticles (NPs) with poly(L-arginine) (ARG) and dextran (DXS) as polyelectrolytes. Cellular binding and uptake of LbL NPs as well as siRNA delivery were studied in FibroGRO cells. siGLO-siRNA and SPARC-siRNA were efficiently coated onto hydroxyapatite nanoparticles. The multilayered NPs were characterized with regard to particle size, zeta potential and surface morphology using dynamic light scattering and transmission electron microscopy. The SPARC-gene silencing and mRNA levels were analyzed using ChemiDOC western blot technique and RT-PCR. The multilayer SPARC-siRNA incorporated nanoparticles are about 200 nm in diameter and are efficiently internalized into FibroGRO cells. Their intracellular fate was also followed by tagging with suitable reporter siRNA as well as with lysotracker dye; confocal microscopy clearly indicates endosomal escape of the particles. Significant (60%) SPARC-gene knock down was achieved by using 0.4 pmole siRNA/μg of LbL NPs in FibroGRO cells and the relative expression of SPARC mRNA reduced significantly (60%) against untreated cells. The cytotoxicity as evaluated by xCelligence real-time cell proliferation and MTT cell assay, indicated that the SPARC-siRNA-loaded LbL NPs are non-toxic. In conclusion, the LbL NP system described provides a promising, safe and efficient delivery platform as a non-viral vector for siRNA delivery that uses biopolymers to enhance the gene knock down efficiency for the development of siRNA therapeutics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

    Science.gov (United States)

    Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

    2013-01-30

    Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

  10. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  11. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  12. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-01-01

    Background: microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Methods: Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. Results: microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. Conclusions: microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma. PMID:24346283

  13. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma.

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-02-04

    microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma.

  14. Effect of silencing of ATM expression by siRNA on radiosensitivity of human lung adenocarcinoma A549 cells

    International Nuclear Information System (INIS)

    Liu Xiaoqun; Qiao Tiankui

    2014-01-01

    Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)

  15. Dysregulated RNA-Induced Silencing Complex (RISC) Assembly within CNS Corresponds with Abnormal miRNA Expression during Autoimmune Demyelination.

    Science.gov (United States)

    Lewkowicz, Przemysław; Cwiklińska, Hanna; Mycko, Marcin P; Cichalewska, Maria; Domowicz, Małgorzata; Lewkowicz, Natalia; Jurewicz, Anna; Selmaj, Krzysztof W

    2015-05-13

    MicroRNAs (miRNAs) associate with Argonaute (Ago), GW182, and FXR1 proteins to form RNA-induced silencing complexes (RISCs). RISCs represent a critical checkpoint in the regulation and bioavailability of miRNAs. Recent studies have revealed dysregulation of miRNAs in multiple sclerosis (MS) and its animal model, experimental autoimmune encephalomyelitis (EAE); however, the function of RISCs in EAE and MS is largely unknown. Here, we examined the expression of Ago, GW182, and FXR1 in CNS tissue, oligodendrocytes (OLs), brain-infiltrating T lymphocytes, and CD3(+)splenocytes (SCs) of EAE mic, and found that global RISC protein levels were significantly dysregulated. Specifically, Ago2 and FXR1 levels were decreased in OLs and brain-infiltrating T cells in EAE mice. Accordingly, assembly of Ago2/GW182/FXR1 complexes in EAE brain tissues was disrupted, as confirmed by immunoprecipitation experiments. In parallel with alterations in RISC complex content in OLs, we found downregulation of miRNAs essential for differentiation and survival of OLs and myelin synthesis. In brain-infiltrating T lymphocytes, aberrant RISC formation contributed to miRNA-dependent proinflammatory helper T-cell polarization. In CD3(+) SCs, we found increased expression of both Ago2 and FXR1 in EAE compared with nonimmunized mice. Therefore, our results demonstrate a gradient in expression of miRNA between primary activated T cells in the periphery and polarized CNS-infiltrating T cells. These results suggest that, in polarized autoreactive effector T cells, miRNA synthesis is inhibited in response to dysregulated RISC assembly, allowing these cells to maintain a highly specific proinflammatory program. Therefore, our findings may provide a mechanism that leads to miRNA dysregulation in EAE/MS. Copyright © 2015 the authors 0270-6474/15/357521-17$15.00/0.

  16. Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

    Science.gov (United States)

    Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

    2012-07-01

    A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

  17. Soilborne wheat mosaic virus (SBWMV 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing

    Directory of Open Access Journals (Sweden)

    Howard Amanda

    2005-03-01

    Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.

  18. Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

    Directory of Open Access Journals (Sweden)

    Satoshi Iizuka

    Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

  19. Allele-specific Gene Silencing of Mutant mRNA Restores Cellular Function in Ullrich Congenital Muscular Dystrophy Fibroblasts

    Directory of Open Access Journals (Sweden)

    Satoru Noguchi

    2014-01-01

    Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.

  20. Novel siRNA delivery system using a ternary polymer complex with strong silencing effect and no cytotoxicity.

    Science.gov (United States)

    Kodama, Yukinobu; Shiokawa, Yumi; Nakamura, Tadahiro; Kurosaki, Tomoaki; Aki, Keisei; Nakagawa, Hiroo; Muro, Takahiro; Kitahara, Takashi; Higuchi, Norihide; Sasaki, Hitoshi

    2014-01-01

    We developed a novel small interfering RNA (siRNA) delivery system using a ternary complex with polyethyleneimine (PEI) and γ-polyglutamic acid (γ-PGA), which showed silencing effect and no cytotoxicity. The binary complexes of siRNA with PEI were approximately 73-102 nm in particle size and 45-52 mV in ζ-potential. The silencing effect of siRNA/PEI complexes increased with an increase of PEI, and siRNA/PEI complexes with a charge ratio greater than 16 showed significant luciferase knockdown in a mouse colon carcinoma cell line regularly expressing luciferase (Colon26/Luc cells). However, strong cytotoxicity and blood agglutination were observed in the siRNA/Lipofectamine complex and siRNA/PEI16 complex. Recharging cationic complexes with an anionic compound was reported to be a promising method for overcoming these toxicities. We therefore prepared ternary complexes of siRNA with PEI (charge ratio 16) by the addition of γ-PGA to reduce cytotoxicity and deliver siRNA. As expected, the cytotoxicity of the ternary complexes decreased with an increase of γ-PGA content, which decreased the ζ-potential of the complexes. A strong silencing effect comparable to siRNA/Lipofectamine complex was discovered in ternary complexes including γ-PGA with an anionic surface charge. The high incorporation of ternary complexes into Colon26/Luc cells was confirmed with fluorescence microcopy. Having achieved knockdown of an exogenously transfected gene, the ability of the complex to mediate knockdown of an endogenous housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was assessed in B16-F10 cells. The ternary complex (siRNA/PEI16/γ-PGA12 complex) exhibited a significant GAPDH knockdown effect. Thus, we developed a useful siRNA delivery system.

  1. Multifunctional triblock co-polymer mP3/4HB-b-PEG-b-lPEI for efficient intracellular siRNA delivery and gene silencing.

    Science.gov (United States)

    Zhou, Li; Chen, Zhifei; Wang, Feifei; Yang, Xiuqun; Zhang, Biliang

    2013-04-01

    A non-viral siRNA carrier composed of mono-methoxy-poly (3-hydroxybutyrate-co-4-hydroxybutyrate)-block-polyethylene glycol-block-linear polyethyleneimine (mP3/4HB-b-PEG-b-lPEI) was synthesized using 1800 Da linear polyethyleneimine and evaluated for siRNA delivery. Our study demonstrated that siRNA could be efficiently combined with mP3/4HB-b-PEG-b-lPEI (mAG) co-polymer and was protected from nuclease degradation. The combined siRNA were released from the complexes easily under heparin competition. The particle size of the mAG/siRNA complexes was 158 nm, with a ζ-potential of around 28 mV. Atomic force microscopy images displayed spherical and homogeneously distributed complexes. The mAG block co-polymer displayed low cytotoxicity and efficient cellular uptake of Cy3-siRNA in A549 cells by flow cytometry and confocal microscopy. In vitro transfection efficiency of the block co-polymer was assessed using siRNA against luciferase in cultured A549-Luc, HeLa-Luc, HLF-Luc, A375-Luc and MCF-7-Luc cells. A higher transfection efficiency and lower cytotoxicity was obtained by mAG block co-polymer in five cell lines. Furthermore, a remarkable improvement in luciferase gene silencing efficiency of the mAG complex (up to 90-95%) over that of Lipofectamine™ 2000 (70-82%) was observed in HLF-Luc and A375-Luc cells. Additionally, a mAG/p65-siRNA complex also showed a better capability than Lipofectamine™ 2000/p65-siRNA complex to drastically reduce the p65 mRNA level down to 10-16% in HeLa, U251 and HUVEC cells at an N/P ratio of 70. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  2. Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

    Science.gov (United States)

    Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

    2015-01-01

    The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

  3. Heterologous RNA-silencing suppressors from both plant- and animal-infecting viruses support plum pox virus infection.

    Science.gov (United States)

    Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian

    2012-07-01

    HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.

  4. Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

    Science.gov (United States)

    Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

    2014-10-01

    Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

  5. Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

    Science.gov (United States)

    Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

    2010-01-25

    Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

  6. GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

    Directory of Open Access Journals (Sweden)

    Guillaume Jannot

    2016-12-01

    Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

  7. Comparison of three techniques for generation of tolerogenic dendritic cells: siRNA, oligonucleotide antisense, and antibody blocking.

    Science.gov (United States)

    Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Moazzeni, Mohammad; Soheili, Zahra Soheila; Samiee, Shahram

    2010-12-01

    In recent years, a new view of dendritic cells (DCs) as a main regulator of immunity to induce and maintain tolerance has been established. In vitro manipulation of their development and maturation is a topic of DC therapeutic application, which utilizes their inherent tolerogenicity. In this field, the therapeutic potential of antisense, siRNA, and blocking antibody are an interesting goal. In the present study, the efficiency of these three methods--siRNA, antisense, and blocking antibody--against CD40 molecule and its function in DCs and BCL1 cell line are compared. DCs were separated from mouse spleen and then cultured in vitro using Lipofectamine 2000 to deliver both silencers; the efficacy of transfection was estimated by flow cytometry. mRNA expression and protein synthesis were assessed by real time-PCR and flow cytometry, respectively. By Annexin V and propidium iodine staining, we could evaluate the viability of transfected cells. Knocking down the CD40 gene into separate groups of DCs by siRNA, antisense, and blocking antibody treated DCs can cause an increase in IL-4, decrease in IL-12, IFN-γ production, and allostimulation activity. Our results indicated that, in comparison to antisense and blocking antibody, siRNAs appear to be quantitatively more efficient in CD40 downregulation and their differences are significant.

  8. In vivo silencing of alpha-synuclein using naked siRNA

    Directory of Open Access Journals (Sweden)

    Charisse Klaus

    2008-11-01

    Full Text Available Abstract Background Overexpression of α-synuclein (SNCA in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD, possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked, murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression.

  9. In vivo silencing of alpha-synuclein using naked siRNA

    Science.gov (United States)

    Lewis, Jada; Melrose, Heather; Bumcrot, David; Hope, Andrew; Zehr, Cynthia; Lincoln, Sarah; Braithwaite, Adam; He, Zhen; Ogholikhan, Sina; Hinkle, Kelly; Kent, Caroline; Toudjarska, Ivanka; Charisse, Klaus; Braich, Ravi; Pandey, Rajendra K; Heckman, Michael; Maraganore, Demetrius M; Crook, Julia; Farrer, Matthew J

    2008-01-01

    Background Overexpression of α-synuclein (SNCA) in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD), possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked), murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression. PMID:18976489

  10. The RNA silencing enzyme RNA polymerase v is required for plant immunity.

    Directory of Open Access Journals (Sweden)

    Ana López

    2011-12-01

    Full Text Available RNA-directed DNA methylation (RdDM is an epigenetic control mechanism driven by small interfering RNAs (siRNAs that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1. NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V, which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence

  11. The RNA silencing enzyme RNA polymerase v is required for plant immunity.

    Science.gov (United States)

    López, Ana; Ramírez, Vicente; García-Andrade, Javier; Flors, Victor; Vera, Pablo

    2011-12-01

    RNA-directed DNA methylation (RdDM) is an epigenetic control mechanism driven by small interfering RNAs (siRNAs) that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1). NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V), which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA)-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA)-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence, but whether

  12. Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

    Science.gov (United States)

    Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

    2018-07-01

    Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Changho Eun

    Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

  14. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

    Science.gov (United States)

    Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

    2016-01-01

    This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

  15. Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo

    Directory of Open Access Journals (Sweden)

    Tasleem Arif

    2014-01-01

    Full Text Available Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1, a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA. A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF. VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs.

  16. A long noncoding RNA contributes to neuropathic pain by silencing Kcna2 in primary afferent neurons

    Science.gov (United States)

    Zhao, Xiuli; Tang, Zongxiang; Zhang, Hongkang; Atianjoh, Fidelis E.; Zhao, Jian-Yuan; Liang, Lingli; Wang, Wei; Guan, Xiaowei; Kao, Sheng-Chin; Tiwari, Vinod; Gao, Yong-Jing; Hoffman, Paul N.; Cui, Hengmi; Li, Min; Dong, Xinzhong; Tao, Yuan-Xiang

    2013-01-01

    Neuropathic pain is a refractory disease characterized by maladaptive changes in gene transcription and translation within the sensory pathway. Long noncoding RNAs (lncRNAs) are emerging as new players in gene regulation, but how lncRNAs operate in the development of neuropathic pain is unclear. Here we identify a conserved lncRNA for Kcna2 (named Kcna2 antisense RNA) in first-order sensory neurons of rat dorsal root ganglion (DRG). Peripheral nerve injury increases Kcna2 antisense RNA expression in injured DRG through activation of myeloid zinc finger protein 1, a transcription factor that binds to Kcna2 antisense RNA gene promoter. Mimicking this increase downregulates Kcna2, reduces total Kv current, increases excitability in DRG neurons, and produces neuropathic pain symptoms. Blocking this increase reverses nerve injury-induced downregulation of DRG Kcna2 and attenuates development and maintenance of neuropathic pain. These findings suggest native Kcna2 antisense RNA as a new therapeutic target for the treatment of neuropathic pain. PMID:23792947

  17. DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Sizolwenkosi Mlotshwa

    2008-03-01

    Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

  18. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

    DEFF Research Database (Denmark)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

    2016-01-01

    /2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

  19. Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins

    Directory of Open Access Journals (Sweden)

    Katherine S. Bridge

    2017-07-01

    Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.

  20. A Medicago truncatula rdr6 allele impairs transgene silencing and endogenous phased siRNA production but not development.

    Science.gov (United States)

    Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine

    2014-12-01

    RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  1. A novel RNA transcript with antiapoptotic function is silenced in fragile X syndrome.

    Directory of Open Access Journals (Sweden)

    Ahmad M Khalil

    2008-01-01

    Full Text Available Several genome-wide transcriptomics efforts have shown that a large percentage of the mammalian genome is transcribed into RNAs, however, only a small percentage (1-2% of these RNAs is translated into proteins. Currently there is an intense interest in characterizing the function of the different classes of noncoding RNAs and their relevance to human disease. Using genomic approaches we discovered FMR4, a primate-specific noncoding RNA transcript (2.4 kb that resides upstream and likely shares a bidirectional promoter with FMR1. FMR4 is a product of RNA polymerase II and has a similar half-life to FMR1. The CGG expansion in the 5' UTR of FMR1 appears to affect transcription in both directions as we found FMR4, similar to FMR1, to be silenced in fragile X patients and up-regulated in premutation carriers. Knockdown of FMR4 by several siRNAs did not affect FMR1 expression, nor vice versa, suggesting that FMR4 is not a direct regulatory transcript for FMR1. However, FMR4 markedly affected human cell proliferation in vitro; siRNAs knockdown of FMR4 resulted in alterations in the cell cycle and increased apoptosis, while the overexpression of FMR4 caused an increase in cell proliferation. Collectively, our results demonstrate an antiapoptotic function of FMR4 and provide evidence that a well-studied genomic locus can show unexpected functional complexity. It cannot be excluded that altered FMR4 expression might contribute to aspects of the clinical presentation of fragile X syndrome and/or related disorders.

  2. RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

    Science.gov (United States)

    Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

    2012-01-01

    RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

  3. A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

    Directory of Open Access Journals (Sweden)

    Christiane Noronha Fernandes-Brum

    Full Text Available microRNAs (miRNAs are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs are derived from double-stranded RNA (dsRNA or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL in processing the smallRNAs (sRNAs and ARGONAUTE (AGO as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR, Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated, and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

  4. siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

    Science.gov (United States)

    Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

    2008-09-18

    Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

  5. Oral cancer cells may rewire alternative metabolic pathways to survive from siRNA silencing of metabolic enzymes

    International Nuclear Information System (INIS)

    Zhang, Min; Chai, Yang D; Brumbaugh, Jeffrey; Liu, Xiaojun; Rabii, Ramin; Feng, Sizhe; Misuno, Kaori; Messadi, Diana; Hu, Shen

    2014-01-01

    Cancer cells may undergo metabolic adaptations that support their growth as well as drug resistance properties. The purpose of this study is to test if oral cancer cells can overcome the metabolic defects introduced by using small interfering RNA (siRNA) to knock down their expression of important metabolic enzymes. UM1 and UM2 oral cancer cells were transfected with siRNA to transketolase (TKT) or siRNA to adenylate kinase (AK2), and Western blotting was used to confirm the knockdown. Cellular uptake of glucose and glutamine and production of lactate were compared between the cancer cells with either TKT or AK2 knockdown and those transfected with control siRNA. Statistical analysis was performed with student T-test. Despite the defect in the pentose phosphate pathway caused by siRNA knockdown of TKT, the survived UM1 or UM2 cells utilized more glucose and glutamine and secreted a significantly higher amount of lactate than the cells transferred with control siRNA. We also demonstrated that siRNA knockdown of AK2 constrained the proliferation of UM1 and UM2 cells but similarly led to an increased uptake of glucose/glutamine and production of lactate by the UM1 or UM2 cells survived from siRNA silencing of AK2. Our results indicate that the metabolic defects introduced by siRNA silencing of metabolic enzymes TKT or AK2 may be compensated by alternative feedback metabolic mechanisms, suggesting that cancer cells may overcome single defective pathways through secondary metabolic network adaptations. The highly robust nature of oral cancer cell metabolism implies that a systematic medical approach targeting multiple metabolic pathways may be needed to accomplish the continued improvement of cancer treatment

  6. The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

    KAUST Repository

    Chen, Hao

    2010-09-28

    The Arabidopsis FIERY1 (FRY1) locus was originally identified as a negative regulator of stress-responsive gene expression and later shown to be required for suppression of RNA silencing. In this study we discovered that the FRY1 locus also regulates lateral root formation. Compared with the wild type, fry1 mutant seedlings generated significantly fewer lateral roots under normal growth conditions and also exhibited a dramatically reduced sensitivity to auxin in inducing lateral root initiation. Using transgenic plants that overexpress a yeast homolog of FRY1 that possesses only the 3\\', 5\\'-bisphosphate nucleotidase activity but not the inositol 1-phosphatase activity, we demonstrated that the lateral root phenotypes in fry1 result from loss of the nucleotidase activity. Furthermore, a T-DNA insertion mutant of another RNA silencing suppressor, XRN4 (but not XRN2 or XRN3), which is an exoribonuclease that is inhibited by the substrate of the FRY1 3\\', 5\\'-bisphosphate nucleotidase, exhibits similar lateral root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results indicate that RNA silencing modulated by FRY1 and XRN4 plays an important role in shaping root architecture. © 2010 Blackwell Publishing Ltd.

  7. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

    2013-01-01

    .Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  8. Control of HIV-1 env RNA splicing and transport: investigating the role of hnRNP A1 in exon splicing silencer (ESS3a) function

    International Nuclear Information System (INIS)

    Asai, Kengo; Platt, Craig; Cochrane, Alan

    2003-01-01

    The control of HIV-1 viral RNA splicing and transport plays an important role in the successful replication of the virus. Previous studies have identified both an exon splicing enhancer (ESE) and a bipartite exon splicing silencer (ESS3a and ESS3b) within the terminal exon of HIV-1 that are involved in modulating both splicing and Rev-mediated export of viral RNA. To define the mechanism of ESS3a function, experiments were carried out to better define the cis and trans components required for ESS3a activity. Mutations throughout the 30-nt element resulted in partial loss of ESS function. Combining mutations was found to have an additive effect, suggesting the presence of multiple binding sites. Analysis of interacting factors identified hnRNP A1 as one component of the complex that modulates ESS3a activity. However, subsequent binding analyses determined that hnRNP A1 interacts with only one portion of ESS3a, suggesting the involvement of another host factor. Parallel analysis of the effect of the mutations on Rev-mediated export determined that there is not a direct correlation between the effect of the mutations on splicing and RNA transport. Consistent with this hypothesis, replacement of ESS3a with consensus hnRNP A1 binding sites was found to be insufficient to block Rev-mediated RNA export

  9. RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

    Science.gov (United States)

    Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

    2012-09-01

    The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

  10. Elicitation of hypersensitive responses in Nicotiana glutinosa by the suppressor of RNA silencing protein P0 from poleroviruses.

    Science.gov (United States)

    Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann

    2015-06-01

    Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  11. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  12. Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes.

    Science.gov (United States)

    Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S

    2016-05-01

    RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators.

    Science.gov (United States)

    Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J

    2013-04-16

    The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.

  14. The Role of piRNA-Mediated Epigenetic Silencing in the Population Dynamics of Transposable Elements in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Yuh Chwen G Lee

    2015-06-01

    Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously

  15. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    International Nuclear Information System (INIS)

    Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

    2010-01-01

    Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

  16. Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

    Science.gov (United States)

    Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

    2017-10-13

    Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

    Directory of Open Access Journals (Sweden)

    Liu X

    2016-04-01

    Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

  18. Development of Gold Nanoparticle towards Radioenhancement Therapy, Renal Clearance, siRNA Delivery and Light-Controlled Gene Silencing

    Science.gov (United States)

    Wang, Jianxin

    Gold nanoparticles (GNPs) have been widely studied and used in research for diagnostic, prophylactic or therapeutic purposes. However, they still face many technical challenges before they can be used to effectively address unmet biomedical needs. The theme of this dissertation is focused on addressing challenges of GNPs in clinical translation, and to improve their potential for application in radioenhancement therapy and siRNA delivery. We demonstrate the facile self-assembly of micellar gold nanocapsules using zwitterionic surfactants, with hydrodynamic diameters below 10 nm, which holds promise for good renal clearance to promote the excretion of GNPs in human body. We also prepared PEI- and PEG-coated GNPs and demonstrated their uptake into HeLa cells with exposure to soft X-rays (120 kVp), based on the consideration that the proximity of GNPs to nuclear DNA may be beneficial for enhancing low-energy ionizing radiotherapy. GNP-mediated siRNA delivery may be challenged by nonspecific siRNA desorption during circulation, which can cause off-target effects and immunogenicity. The use of gold nanorods (GNRs) for siRNA delivery also faces challenges like reduced dispersion stability during siRNA functionalization. We developed an effective way to load siRNA onto GNRs at high density, using oleylsulfobetaine (OSB) as an intermediate surfactant and dithiocarbamates (DTCs) as desorption-resistant anchors for siRNA. The GNR?siRNA complexes provided excellent control for laser-triggered gene silencing.

  19. Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

    International Nuclear Information System (INIS)

    Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

    2004-01-01

    Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

  20. Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

    Science.gov (United States)

    Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

    2006-12-20

    MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

  1. siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Keshava Mysore

    2015-11-01

    Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

  2. MeCP2 silencing of LncRNA H19 controls hepatic stellate cell proliferation by targeting IGF1R

    International Nuclear Information System (INIS)

    Yang, Jing-Jing; Liu, Li-Ping; Tao, Hui; Hu, Wei; Shi, Peng; Deng, Zi-Yu; Li, Jun

    2016-01-01

    Highlights: • H19 plays a key role in HSCs proliferation and fibrosis. • MeCP2/H19 axis involvement in HSCs activation and fibrosis. • MeCP2 negative controls H19 expression in activated HSCs. • Identification of IGF1R as new target of H19 in HSC. - Abstract: Methyl-CpG-binding protein 2 (MeCP2) plays a key role in liver fibrosis. However, the potential mechanism of MeCP2 in liver fibrosis remains unclear. Early reports suggest that LncRNA H19 is important epigenetic regulator with critical roles in cell proliferation, but its role in hepatic fibrosis remains elusive. Sprague-Dawley rats liver fibrosis was generated by 12-weeks treatment with CCl 4 intraperitoneal injection. HSC-T6 cells were used in vitro study. The expression levels of MeCP2, H19, IGF1R, α-SMA, and Col1A1 were estimated by Western blotting, qRT-PCR and Immunohistochemistry. HSC-T6 cells were transfected with MeCP2-siRNA, pEGF-C1-MeCP2, pEX-3-H19, and H19-siRNA. Finally, cell proliferation ability was assessed by the MTT assay. Here, we found that H19 was significantly down-regulated in HSCs and fibrosis tissues, and an opposite pattern is observed for MeCP2 and IGF1R. Silencing of MeCP2 blocked HSCs proliferation. Knockdown of MeCP2 elevated H19 expression in activated HSCs, and over-expression of MeCP2 inhibited H19 expression in activated HSCs. Moreover, we investigated the effect of H19 on IGF1R expression. Overexpression of H19 in HSCs repressed the expression of IGF1R, and an opposite pattern is observed for H19 silenced. In addition, we reported that overexpression of H19 inhibited the TGF-β1-induced proliferation of HSCs. Furthermore, MeCP2 negative regulation of H19 by targeting the protein IGF1R. Taken together, these results demonstrated that MeCP2 silencing of H19 can alter the IGF1R overexpression, thus contributing to HSCs proliferation. These data could suggest the development of combination therapies that target the MeCP2.

  3. Computational analysis of siRNA recognition by the Ago2 PAZ domain and identification of the determinants of RNA-induced gene silencing.

    Directory of Open Access Journals (Sweden)

    Mahmoud Kandeel

    Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.

  4. E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

    Directory of Open Access Journals (Sweden)

    Minami Mazda

    Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

  5. Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

    Science.gov (United States)

    Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

    2007-11-01

    Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

  6. Persistent ER stress induces the spliced leader RNA silencing pathway (SLS, leading to programmed cell death in Trypanosoma brucei.

    Directory of Open Access Journals (Sweden)

    Hanoch Goldshmidt

    2010-01-01

    Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.

  7. RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).

    Science.gov (United States)

    Dare, Andrew P; Hellens, Roger P

    2013-08-01

    Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.

  8. Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

    Directory of Open Access Journals (Sweden)

    Masaki Takahashi

    2015-01-01

    Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

  9. Delivery of siRNA silencing P-gp in peptide-functionalized nanoparticles causes efflux modulation at the blood-brain barrier

    DEFF Research Database (Denmark)

    Gomes, Maria João; Kennedy, Patrick J; Martins, Susana

    2017-01-01

    AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...

  10. Development of Novel Antisense Oligonucleotides for the Functional Regulation of RNA-Induced Silencing Complex (RISC) by Promoting the Release of microRNA from RISC.

    Science.gov (United States)

    Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako

    2015-12-16

    MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.

  11. Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

    Science.gov (United States)

    Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

    2006-10-01

    Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

  12. The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Ling Yang

    2013-01-01

    Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

  13. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  14. Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

    Directory of Open Access Journals (Sweden)

    Aaron J Saathoff

    Full Text Available Cinnamyl alcohol dehydrogenase (CAD catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

  15. Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

    Science.gov (United States)

    Saathoff, Aaron J; Sarath, Gautam; Chow, Elaine K; Dien, Bruce S; Tobias, Christian M

    2011-01-27

    Cinnamyl alcohol dehydrogenase (CAD) catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

  16. LncRNA-SNHG16 predicts poor prognosis and promotes tumor proliferation through epigenetically silencing p21 in bladder cancer.

    Science.gov (United States)

    Cao, Xianxiang; Xu, Jing; Yue, Dong

    2018-02-01

    More and more evidences have ensured the crucial functions of long non-coding RNAs (lncRNAs) in multiple tumors. It has been discovered that lncRNA-SNHG16 is involved in many tumors. Even so, it is still necessary to study SNHG16 comprehensively in bladder cancer. In terms of our study, the level of SNHG16 both in the tumor tissues and cell lines was measured and the relationship among SNHG16, clinicopathological traits and prognosis was explored. Interference assays were applied to determine the biological functions of SNHG16. It was discovered that the level of SNHG16 was evidently enhanced both in tissues and cell lines of bladder cancer. Patients with highly expressed SNHG16 suffered from poor overall survival. Multivariable Cox proportional hazards regression analysis implied that highly expressed SNHG16 could be used as an independent prognostic marker. It could be known from functional assays that silenced SNHG16 impaired cell proliferation, owing to the effects of SNHG16 on cell cycle and apoptosis. Finally, mechanism experiments revealed that SNHG16 could epigenetically silence the expression of p21. The facts above pointed out that lncRNA-SNHG16 might be quite vital for the diagnosis and development of bladder cancer, and could even become an important therapeutic target for bladder cancer.

  17. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  18. Silencing of ATM expression by siRNA technique contributes to glioma stem cell radiosensitivity in vitro and in vivo.

    Science.gov (United States)

    Li, Yan; Li, Luchun; Wu, Zhijuan; Wang, Lulu; Wu, Yongzhong; Li, Dairong; Ma, Uiwen; Shao, Jianghe; Yu, Huiqing; Wang, Donglin

    2017-07-01

    Evidence has shown that both high expression of the ataxia-telangiectasia mutated (ATM) gene and glioma stem cells (GSCs) are responsible for radioresistance in glioma. Thus, we hypothesized that brain tumor radiosensitivity may be enhanced via silencing of the ATM gene in GSCs. In the present study we successfully induced GSCs from two cell lines and used CD133 and nestin to identify GSCs. A lentivirus was used to deliver siRNA-ATMPuro (A group) to GSCs prior to radiation, while siRNA-HKPuro (N group) and GSCs (C group) were used as negative and blank controls, respectively. RT-qPCR and western blotting were performed to verify the efficiency of the siRNA-ATM technique. The expression of the ATM gene and ATM protein were significantly downregulated post-transfection. Cell Counting Kit-8 (CCK-8) and colony formation assays revealed that the A group demonstrated weak cell proliferation and lower survival fractions post-irradiation compared to the C/N groups. Flow cytometry was used to examine the percentage of cell apoptosis and G2 phase arrest, which were both higher in the A group than in the C/N groups. We found that the comet tail percentage evaluated by comet assay was higher in the A group than in the C/N groups. After radiation treatment, three radiosensitive genes [p53, proliferating cell nuclear antigen (PCNA), survivin] exhibited a decreasing tendency as determined by RT-qPCR. Mice underwent subcutaneous implantation, followed by radiation, and the resulting necrosis and hemorrhage were more obvious in the A group than in the N groups. In conclusion, silencing of ATM via the siRNA technique improved radiosensitivity of GSCs both in vitro and in vivo.

  19. In vivo therapeutic efficacy of TNFα silencing by folate-PEG-chitosan-DEAE/siRNA nanoparticles in arthritic mice.

    Science.gov (United States)

    Shi, Qin; Rondon-Cavanzo, Elsa-Patricia; Dalla Picola, Isadora Pfeifer; Tiera, Marcio José; Zhang, Xiaoling; Dai, Kerong; Benabdoune, Houda Abir; Benderdour, Mohamed; Fernandes, Julio Cesar

    2018-01-01

    Tumor necrosis factor-alpha (TNFα), a pro-inflammatory cytokine, has been shown to play a role in the pathophysiology of rheumatoid arthritis. Silencing TNFα expression with small interfering RNA (siRNA) is a promising approach to treatment of the condition. Towards this end, our team has developed a modified chitosan (CH) nanocarrier, deploying folic acid, diethylethylamine (DEAE) and polyethylene glycol (PEG) (folate-PEG-CH-DEAE 15 ). The gene carrier protects siRNA against nuclease destruction, its ligands facilitate siRNA uptake via cell surface receptors, and it provides improved solubility at neutral pH with transport of its load into target cells. In the present study, nanoparticles were prepared with siRNA-TNFα, DEAE, and folic acid-CH derivative. Nanoparticle size and zeta potential were verified by dynamic light scattering. Their TNFα-knockdown effects were tested in a murine collagen antibody-induced arthritis model. TNFα expression was examined along with measurements of various cartilage and bone turnover markers by performing histology and microcomputed tomography analysis. We demonstrated that folate-PEG-CH-DEAE 15 /siRNA nanoparticles did not alter cell viability, and significantly decreased inflammation, as demonstrated by improved clinical scores and lower TNFα protein concentrations in target tissues. This siRNA nanocarrier also decreased articular cartilage destruction and bone loss. The results indicate that folate-PEG-CH-DEAE 15 nanoparticles are a safe and effective platform for nonviral gene delivery of siRNA, and their potential clinical applications warrant further investigation.

  20. Effective silencing of ENaC by siRNA delivered with epithelial-targeted nanocomplexes in human cystic fibrosis cells and in mouse lung.

    Science.gov (United States)

    Tagalakis, Aristides D; Munye, Mustafa M; Ivanova, Rositsa; Chen, Hanpeng; Smith, Claire M; Aldossary, Ahmad M; Rosa, Luca Z; Moulding, Dale; Barnes, Josephine L; Kafetzis, Konstantinos N; Jones, Stuart A; Baines, Deborah L; Moss, Guy W J; O'Callaghan, Christopher; McAnulty, Robin J; Hart, Stephen L

    2018-05-10

    Loss of the cystic fibrosis transmembrane conductance regulator in cystic fibrosis (CF) leads to hyperabsorption of sodium and fluid from the airway due to upregulation of the epithelial sodium channel (ENaC). Thickened mucus and depleted airway surface liquid (ASL) then lead to impaired mucociliary clearance. ENaC regulation is thus a promising target for CF therapy. Our aim was to develop siRNA nanocomplexes that mediate effective silencing of airway epithelial ENaC in vitro and in vivo with functional correction of epithelial ion and fluid transport. We investigated translocation of nanocomplexes through mucus and their transfection efficiency in primary CF epithelial cells grown at air-liquid interface (ALI).Short interfering RNA (SiRNA)-mediated silencing was examined by quantitative RT-PCR and western analysis of ENaC. Transepithelial potential (V t ), short circuit current (I sc ), ASL depth and ciliary beat frequency (CBF) were measured for functional analysis. Inflammation was analysed by histological analysis of normal mouse lung tissue sections. Nanocomplexes translocated more rapidly than siRNA alone through mucus. Transfections of primary CF epithelial cells with nanocomplexes targeting αENaC siRNA, reduced αENaC and βENaC mRNA by 30%. Transfections reduced V t , the amiloride-sensitive I sc and mucus protein concentration while increasing ASL depth and CBF to normal levels. A single dose of siRNA in mouse lung silenced ENaC by approximately 30%, which persisted for at least 7 days. Three doses of siRNA increased silencing to approximately 50%. Nanoparticle-mediated delivery of ENaCsiRNA to ALI cultures corrected aspects of the mucociliary defect in human CF cells and offers effective delivery and silencing in vivo. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  1. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  2. Nek1 silencing slows down DNA repair and blocks DNA damage-induced cell cycle arrest.

    Science.gov (United States)

    Pelegrini, Alessandra Luíza; Moura, Dinara Jaqueline; Brenner, Bethânia Luise; Ledur, Pitia Flores; Maques, Gabriela Porto; Henriques, João Antônio Pegas; Saffi, Jenifer; Lenz, Guido

    2010-09-01

    Never in mitosis A (NIMA)-related kinases (Nek) are evolutionarily conserved proteins structurally related to the Aspergillus nidulans mitotic regulator NIMA. Nek1 is one of the 11 isoforms of the Neks identified in mammals. Different lines of evidence suggest the participation of Nek1 in response to DNA damage, which is also supported by the interaction of this kinase with proteins involved in DNA repair pathways and cell cycle regulation. In this report, we show that cells with Nek1 knockdown (KD) through stable RNA interference present a delay in DNA repair when treated with methyl-methanesulfonate (MMS), hydrogen peroxide (H(2)O(2)) and cisplatin (CPT). In particular, interstrand cross links induced by CPT take much longer to be resolved in Nek1 KD cells when compared to wild-type (WT) cells. In KD cells, phosphorylation of Chk1 in response to CPT was strongly reduced. While WT cells accumulate in G(2)/M after DNA damage with MMS and H(2)O(2), Nek1 KD cells do not arrest, suggesting that G(2)/M arrest induced by the DNA damage requires Nek1. Surprisingly, CPT-treated Nek1 KD cells arrest with a 4N DNA content similar to WT cells. This deregulation in cell cycle control in Nek1 KD cells leads to an increased sensitivity to genotoxic agents when compared to WT cells. These results suggest that Nek1 is involved in the beginning of the cellular response to genotoxic stress and plays an important role in preventing cell death induced by DNA damage.

  3. Gene Silencing in Skin After Deposition of Self-Delivery siRNA With a Motorized Microneedle Array Device

    Directory of Open Access Journals (Sweden)

    Robyn P Hickerson

    2013-01-01

    Full Text Available Despite the development of potent siRNAs that effectively target genes responsible for skin disorders, translation to the clinic has been hampered by inefficient delivery through the stratum corneum barrier and into the live cells of the epidermis. Although hypodermic needles can be used to transport siRNA through the stratum corneum, this approach is limited by pain caused by the injection and the small volume of tissue that can be accessed by each injection. The use of microneedle arrays is a less painful method for siRNA delivery, but restricted payload capacity limits this approach to highly potent molecules. To address these challenges, a commercially available motorized microneedle array skin delivery device was evaluated. This device combines the positive elements of both hypodermic needles and microneedle array technologies with little or no pain to the patient. Application of fluorescently tagged self-delivery (sd-siRNA to both human and murine skin resulted in distribution throughout the treated skin. In addition, efficient silencing (78% average reduction of reporter gene expression was achieved in a transgenic fluorescent reporter mouse skin model. These results indicate that this device effectively delivers functional sd-siRNA with an efficiency that predicts successful clinical translation.

  4. Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

    Science.gov (United States)

    Laldinsangi, C; Senthilkumaran, B

    2018-04-03

    C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

  5. Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

    OpenAIRE

    Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

    2009-01-01

    Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

  6. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Science.gov (United States)

    Pompey, Justine M; Foda, Bardees; Singh, Upinder

    2015-01-01

    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  7. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Directory of Open Access Journals (Sweden)

    Justine M Pompey

    Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  8. Polymer nanoparticles for drug and small silencing RNA delivery to treat cancers of different phenotypes

    Science.gov (United States)

    Devulapally, Rammohan; Paulmurugan, Ramasamy

    2013-01-01

    Advances in nanotechnology have provided powerful and efficient tools in development of cancer diagnosis and therapy. There are numerous nanocarriers that are currently approved for clinical use in cancer therapy. In recent years, biodegradable polymer nanoparticles (NPs) have attracted a considerable attention for their ability to function as a possible carrier for target-specific delivery of various drugs, genes, proteins, peptides, vaccines, and other biomolecules in humans without much toxicity. This review will specifically focus on the recent advances in polymer-based nanocarriers for various drugs and small silencing RNA’s loading and delivery to treat different types of cancer. PMID:23996830

  9. Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

    Czech Academy of Sciences Publication Activity Database

    Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

    2011-01-01

    Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

  10. Enhancer-driven chromatin interactions during development promote escape from silencing by a long non-coding RNA

    Directory of Open Access Journals (Sweden)

    Korostowski Lisa

    2011-11-01

    Full Text Available Abstract Background Gene regulation in eukaryotes is a complex process entailing the establishment of transcriptionally silent chromatin domains interspersed with regions of active transcription. Imprinted domains consist of clusters of genes, some of which exhibit parent-of-origin dependent monoallelic expression, while others are biallelic. The Kcnq1 imprinted domain illustrates the complexities of long-range regulation that coexists with local exceptions. A paternally expressed repressive non-coding RNA, Kcnq1ot1, regulates a domain of up to 750 kb, encompassing 14 genes. We study how the Kcnq1 gene, initially silenced by Kcnq1ot1, undergoes tissue-specific escape from imprinting during development. Specifically, we uncover the role of chromosome conformation during these events. Results We show that Kcnq1 transitions from monoallelic to biallelic expression during mid gestation in the developing heart. This transition is not associated with the loss of methylation on the Kcnq1 promoter. However, by exploiting chromosome conformation capture (3C technology, we find tissue-specific and stage-specific chromatin loops between the Kcnq1 promoter and newly identified DNA regulatory elements. These regulatory elements showed in vitro activity in a luciferase assay and in vivo activity in transgenic embryos. Conclusions By exploring the spatial organization of the Kcnq1 locus, our results reveal a novel mechanism by which local activation of genes can override the regional silencing effects of non-coding RNAs.

  11. Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection

    DEFF Research Database (Denmark)

    Lanford, Robert E; Hildebrandt-Eriksen, Elisabeth S; Petri, Andreas

    2010-01-01

    The liver-expressed microRNA-122 (miR-122) is essential for hepatitis C virus (HCV) RNA accumulation in cultured liver cells, but its potential as a target for antiviral intervention has not been assessed. We found that treatment of chronically infected chimpanzees with a locked nucleic acid (LNA...

  12. Silencing of Tumor Necrosis Factor Receptor 1 by siRNA in EC109 Cells Affects Cell Proliferation and Apoptosis

    Directory of Open Access Journals (Sweden)

    Ma Changhui

    2009-01-01

    Full Text Available Tumor necrosis factor receptor 1 (TNFR1 is a membrane receptor able to bind TNF-α or TNF-β. TNFR1 can suppress apoptosis by activating the NF-κB or JNK/SAPK signal transduction pathway, or it can induce apoptosis through a series of caspase cascade reactions; the particular effect may depend on the cell line. In the present study, we first showed that TNFR1 is expressed at both the gene and protein levels in the esophageal carcinoma cell line EC109. Then, by applying a specific siRNA, we silenced the expression of TNFR1; this resulted in a significant time-dependent promotion of cell proliferation and downregulation of the apoptotic rate. These results suggest that TNFR1 is strongly expressed in the EC109 cell line and that it may play an apoptosis-mediating role, which may be suppressed by highly activated NF-κB.

  13. Silencing of BCR/ABL Chimeric Gene in Human Chronic Myelogenous Leukemia Cell Line K562 by siRNA-Nuclear Export Signal Peptide Conjugates.

    Science.gov (United States)

    Shinkai, Yasuhiro; Kashihara, Shinichi; Minematsu, Go; Fujii, Hirofumi; Naemura, Madoka; Kotake, Yojiro; Morita, Yasutaka; Ohnuki, Koichiro; Fokina, Alesya A; Stetsenko, Dmitry A; Filichev, Vyacheslav V; Fujii, Masayuki

    2017-06-01

    Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES conjugates were prepared, and both sense strands at 5' ends were covalently linked to a NES peptide derived from TFIIIA and HIV-1 REV, respectively. Significant enhancement of silencing efficiency was observed for both of them. siRNA-TFIIIA NES conjugate suppressed the expression of BCR/ABL gene to 8.3% at 200 nM and 11.6% at 50 nM, and siRNA-HIV-1REV NES conjugate suppressed to 4.0% at 200 nM and 6.3% at 50 nM, whereas native siRNA suppressed to 36.3% at 200 nM and 30.2% at 50 nM. We could also show complex of siRNA-NES conjugate and designed amphiphilic peptide peptideβ7 could be taken up into cells with no cytotoxicity and showed excellent silencing efficiency. We believe that the complex siRNA-NES conjugate and peptideβ7 is a promising candidate for in vivo use and therapeutic applications.

  14. In vivo therapeutic efficacy of TNFα silencing by folate-PEG-chitosan-DEAE/siRNA nanoparticles in arthritic mice

    Directory of Open Access Journals (Sweden)

    Shi Q

    2018-01-01

    Full Text Available Qin Shi,1 Elsa-Patricia Rondon-Cavanzo,1 Isadora Pfeifer Dalla Picola,1,2 Marcio José Tiera,2 Xiaoling Zhang,3 Kerong Dai,4 Houda Abir Benabdoune,1 Mohamed Benderdour,1 Julio Cesar Fernandes1 1Orthopedic Research Laboratory, Hôpital du Sacré-Coeur de Montréal, Université de Montréal, Montréal, QC, Canada; 2Department of Chemistry and Environmental Sciences, UNESP-São Paulo State University, São José do Rio Preto, Brazil; 3Orthopedic Cellular and Molecular Biology Laboratories, Institute of Health Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai, 4Department of Orthopedics, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China Background: Tumor necrosis factor-alpha (TNFα, a pro-inflammatory cytokine, has been shown to play a role in the pathophysiology of rheumatoid arthritis. Silencing TNFα expression with small interfering RNA (siRNA is a promising approach to treatment of the condition. Methods: Towards this end, our team has developed a modified chitosan (CH nanocarrier, deploying folic acid, diethylethylamine (DEAE and polyethylene glycol (PEG (folate-PEG-CH-DEAE15. The gene carrier protects siRNA against nuclease destruction, its ligands facilitate siRNA uptake via cell surface receptors, and it provides improved solubility at neutral pH with transport of its load into target cells. In the present study, nanoparticles were prepared with siRNA-TNFα, DEAE, and folic acid-CH derivative. Nanoparticle size and zeta potential were verified by dynamic light scattering. Their TNFα-knockdown effects were tested in a murine collagen antibody-induced arthritis model. TNFα expression was examined along with measurements of various cartilage and bone turnover markers by performing histology and microcomputed tomography analysis.Results: We demonstrated that folate-PEG-CH-DEAE15/siRNA nanoparticles did not alter cell viability, and significantly

  15. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  16. Characterization of white shrimp Litopenaeus vannamei integrin β and its role in immunomodulation by dsRNA-mediated gene silencing.

    Science.gov (United States)

    Lin, Yong-Chin; Chen, Jiann-Chu; Chen, Yu-Yuan; Liu, Chun-Hung; Cheng, Winton; Hsu, Chih-Hung; Tsui, Wen-Ching

    2013-06-01

    The full sequence of white shrimp Litopenaeus vannamei integrin β (LV-B) is 2879bp which encodes 787 amino acids (aa) of the open reading frame (ORF). The mature protein (764 aa) contains (1) an extracellular domain (ED) of 692 aa, (2) a transmembrane domain (TD) of 23 aa, and (3) a cytoplasmic domain (CD) of 49 aa. The cloned LV-B grouped together with crayfish Pacifastacus leniusculus integrin β (PL-B1), but was far away from vertebrate integrin β1, β3, β5, β6, β7, and β8, and another L. vannamei integrin β (LV). A Southern blot analysis indicated that the cloned LV-B was a single copy of genomic DNA. LV-B mRNA was expressed in all tissues, and was highly expressed in haemocytes. LV-B was downregulated in shrimp 24 and 96h after having received white spot syndrome virus (WSSV). LV-B expression by haemocytes of shrimp was higher in the postmoult (A and B) stage, and lower in the premoult (D2/D3) stage. LV-B expression was significantly higher by shrimp reared in 2.5‰ and 5‰ salinities. Shrimp injected with integrin β dsRNA showed gene silencing of integrin β after 36h. LV-B-silenced shrimp showed decreased hyaline cells (HCs), granular cells (GCs, including semi-granular cells), the total haemocyte count (THC), respiratory bursts (RBs), and lysozyme activity, but showed increased RB/HC, superoxide dismutase (SOD) activity/HC, and the phenoloxidase (PO) activity/GC. LV-B-silenced shrimp showed upregulated expressions of lipopolysaccharide- and β-glucan-binding protein (LGBP), peroxinectin (PX), prophenoloxidase I (proPO I), proPO II, proPO-activating enzyme (ppA), α2-macroglobulin (α2-M), cytMnSOD, mtMnSOD, and heat shock protein 70 (HSP70). It was concluded that integrin β plays important roles in proPO activation, phagocytosis, and the antioxidant system for immunomodulation in shrimp. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal for avirulence and RNA silencing suppression

    NARCIS (Netherlands)

    Ronde, de D.; Pasquier, A.; Ying, S.; Butterbach, P.B.E.; Lohuis, D.; Kormelink, R.J.M.

    2014-01-01

    Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS)

  18. Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

    Directory of Open Access Journals (Sweden)

    Barik Sailen

    2001-12-01

    Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

  19. Resistance to Sri Lankan Cassava Mosaic Virus (SLCMV) in Genetically Engineered Cassava cv. KU50 through RNA Silencing

    KAUST Repository

    Ntui, Valentine Otang

    2015-04-22

    Cassava ranks fifth among the starch producing crops of the world, its annual bioethanol yield is higher than for any other crop. Cassava cultivar KU50, the most widely grown cultivar for non-food purposes is susceptible to Sri Lankan cassava mosaic virus (SLCMV). The objective of this work was to engineer resistance to SLCMV by RNA interference (RNAi) in order to increase biomass yield, an important aspect for bioethanol production. Here, we produced transgenic KU50 lines expressing dsRNA homologous to the region between the AV2 and AV1 of DNA A of SLCMV. High level expression of dsRNA of SLCMV did not induce any growth abnormality in the transgenic plants. Transgenic lines displayed high levels of resistance to SLCMV compared to the wild-type plants and no virus load could be detected in uninoculated new leaves of the infected resistant lines after PCR amplification and RT-PCR analysis. The agronomic performance of the transgenic lines was unimpaired after inoculation with the virus as the plants presented similar growth when compared to the mock inoculated control plants and revealed no apparent reduction in the amount and weight of tubers produced. We show that the resistance is correlated with post-transcriptional gene silencing because of the production of transgene specific siRNA. The results demonstrate that transgenic lines exhibited high levels of resistance to SLCMV. This resistance coupled with the desirable yield components in the transgenic lines makes them better candidates for exploitation in the production of biomass as well as bioethanol.

  20. Resistance to Sri Lankan Cassava Mosaic Virus (SLCMV) in Genetically Engineered Cassava cv. KU50 through RNA Silencing

    KAUST Repository

    Ntui, Valentine Otang; Kong, Kynet; Khan, Raham Sher; Igawa, Tomoko; Janavi, Gnanaguru Janaky; Rabindran, Ramalingam; Nakamura, Ikuo; Mii, Masahiro

    2015-01-01

    Cassava ranks fifth among the starch producing crops of the world, its annual bioethanol yield is higher than for any other crop. Cassava cultivar KU50, the most widely grown cultivar for non-food purposes is susceptible to Sri Lankan cassava mosaic virus (SLCMV). The objective of this work was to engineer resistance to SLCMV by RNA interference (RNAi) in order to increase biomass yield, an important aspect for bioethanol production. Here, we produced transgenic KU50 lines expressing dsRNA homologous to the region between the AV2 and AV1 of DNA A of SLCMV. High level expression of dsRNA of SLCMV did not induce any growth abnormality in the transgenic plants. Transgenic lines displayed high levels of resistance to SLCMV compared to the wild-type plants and no virus load could be detected in uninoculated new leaves of the infected resistant lines after PCR amplification and RT-PCR analysis. The agronomic performance of the transgenic lines was unimpaired after inoculation with the virus as the plants presented similar growth when compared to the mock inoculated control plants and revealed no apparent reduction in the amount and weight of tubers produced. We show that the resistance is correlated with post-transcriptional gene silencing because of the production of transgene specific siRNA. The results demonstrate that transgenic lines exhibited high levels of resistance to SLCMV. This resistance coupled with the desirable yield components in the transgenic lines makes them better candidates for exploitation in the production of biomass as well as bioethanol.

  1. Synaptotagmin 11 interacts with components of the RNA-induced silencing complex RISC in clonal pancreatic β-cells.

    Science.gov (United States)

    Milochau, Alexandra; Lagrée, Valérie; Benassy, Marie-Noëlle; Chaignepain, Stéphane; Papin, Julien; Garcia-Arcos, Itsaso; Lajoix, Anne; Monterrat, Carole; Coudert, Laetitia; Schmitter, Jean-Marie; Ochoa, Begoña; Lang, Jochen

    2014-06-27

    Synaptotagmins are two C2 domain-containing transmembrane proteins. The function of calcium-sensitive members in the regulation of post-Golgi traffic has been well established whereas little is known about the calcium-insensitive isoforms constituting half of the protein family. Novel binding partners of synaptotagmin 11 were identified in β-cells. A number of them had been assigned previously to ER/Golgi derived-vesicles or linked to RNA synthesis, translation and processing. Whereas the C2A domain interacted with the Q-SNARE Vti1a, the C2B domain of syt11 interacted with the SND1, Ago2 and FMRP, components of the RNA-induced silencing complex (RISC). Binding to SND was direct via its N-terminal tandem repeats. Our data indicate that syt11 may provide a link between gene regulation by microRNAs and membrane traffic. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  2. Arabidopsis RNA Polymerase V Mediates Enhanced Compaction and Silencing of Geminivirus and Transposon Chromatin during Host Recovery from Infection.

    Science.gov (United States)

    Coursey, Tami; Regedanz, Elizabeth; Bisaro, David M

    2018-04-01

    Plants employ RNA-directed DNA methylation (RdDM) and dimethylation of histone 3 lysine 9 (H3K9me2) to silence geminiviruses and transposable elements (TEs). We previously showed that canonical RdDM (Pol IV-RdDM) involving RNA polymerases IV and V (Pol IV and Pol V) is required for Arabidopsis thaliana to recover from infection with Beet curly top virus lacking a suppressor protein that inhibits methylation (BCTV L2 - ). Recovery, which is characterized by reduced viral DNA levels and symptom remission, allows normal floral development. Here, we used formaldehyde-assisted isolation of regulatory elements (FAIRE) to confirm that >90% of BCTV L2 - chromatin is highly compacted during recovery, and a micrococcal nuclease-chromatin immunoprecipitation assay showed that this is largely due to increased nucleosome occupancy. Physical compaction correlated with augmented cytosine and H3K9 methylation and with reduced viral gene expression. We additionally demonstrated that these phenomena are dependent on Pol V and by extension the Pol IV-RdDM pathway. BCTV L2 - was also used to evaluate the impact of viral infection on host loci, including repressed retrotransposons Ta3 and Athila6A Remarkably, an unexpected Pol V-dependent hypersuppression of these TEs was observed, resulting in transcript levels even lower than those detected in uninfected plants. Hypersuppression is likely to be especially important for natural recovery from wild-type geminiviruses, as viral L2 and AL2 proteins cause ectopic TE expression. Thus, Pol IV-RdDM targets both viral and TE chromatin during recovery, simultaneously silencing the majority of viral genomes and maintaining host genome integrity by enforcing tighter control of TEs in future reproductive tissues. IMPORTANCE In plants, RdDM pathways use small RNAs to target cytosine and H3K9 methylation, thereby silencing DNA virus genomes and transposable elements (TEs). Further, Pol IV-RdDM involving Pol IV and Pol V is a key aspect of host

  3. Robust RNA silencing-mediated resistance to Plum pox virus under variable abiotic and biotic conditions.

    Science.gov (United States)

    Di Nicola, Elisa; Tavazza, Mario; Lucioli, Alessandra; Salandri, Laura; Ilardi, Vincenza

    2014-10-01

    Some abiotic and biotic conditions are known to have a negative impact on post-transcriptional gene silencing (PTGS), thus representing a potential concern for the production of stable engineered virus resistance traits. However, depending on the strategy followed to achieve PTGS of the transgene, different responses to external conditions can be expected. In the present study, we utilized the Nicotiana benthamiana–Plum pox virus (PPV) pathosystem to evaluate in detail the stability of intron-hairpin(ihp)-mediated virus resistance under conditions known to adversely affect PTGS. The ihp plants grown at low or high temperatures were fully resistant to multiple PPV challenges, different PPV inoculum concentrations and even to a PPV isolate differing from the ihp construct by more than 28% at the nucleotide level. In addition, infections of ihp plants with viruses belonging to Cucumovirus, Potyvirus or Tombusvirus, all known to affect PTGS at different steps, were not able to defeat PPV resistance. Low temperatures did not affect the accumulation of transgenic small interfering RNAs (siRNAs), whereas a clear increase in the amount of siRNAs was observed during infections sustained by Cucumber mosaic virus and Potato virus Y. Our results show that the above stress factors do not represent an important concern for the production,through ihp-PTGS technology, of transgenic plants having robust virus resistance traits.

  4. Exonuclease-mediated degradation of nascent RNA silences genes linked to severe malaria

    DEFF Research Database (Denmark)

    Zhang, Qingfeng; Siegel, T Nicolai; Martins, Rafael M

    2014-01-01

    -coding RNA. The presence of stable upsA var transcripts overcomes monoallelic expression, resulting in the simultaneous expression of both upsA and upsC type PfEMP1 proteins on the surface of individual infected red blood cells. In addition, we observe an inverse relationship between transcript levels of Pf...

  5. Influence of silencing the MC4R gene by lentivirusmediated RNA ...

    African Journals Online (AJOL)

    Melanocortin receptor 4 (MC4R) is a key element in the mechanisms used to regulate both aspects of keeping the balance between energy uptake and energy expenditure. MC4R was knocked down by lentivirus-mediated shRNA expressing plasmids, which were controlled by the U6 promoter in bovine fibroblast cells, and ...

  6. Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA

    Science.gov (United States)

    2012-01-01

    able to reduce resistance to permethrin in Plutella xylostella. To develop dsRNA as a means of population con- trol of mosquitoes, either alone or in...diamondback moth, Plutella xylostella, reduces larval resistance to permethrin. Insect Biochem. Mol. Biol. 39, 38–46. Blandin S, Moita LF, Kocher T, Wilm M

  7. Novel targeted therapy for neuroblastoma: silencing the MXD3 gene using siRNA.

    Science.gov (United States)

    Duong, Connie; Yoshida, Sakiko; Chen, Cathy; Barisone, Gustavo; Diaz, Elva; Li, Yueju; Beckett, Laurel; Chung, Jong; Antony, Reuben; Nolta, Jan; Nitin, Nitin; Satake, Noriko

    2017-09-01

    BackgroundNeuroblastoma is the second most common extracranial cancer in children. Current therapies for neuroblastoma, which use a combination of chemotherapy drugs, have limitations for high-risk subtypes and can cause significant long-term adverse effects in young patients. Therefore, a new therapy is needed. In this study, we investigated the transcription factor MXD3 as a potential therapeutic target in neuroblastoma.MethodsMXD3 expression was analyzed in five neuroblastoma cell lines by immunocytochemistry and quantitative real-time reverse transcription PCR, and in 18 primary patient tumor samples by immunohistochemistry. We developed nanocomplexes using siRNA and superparamagnetic iron oxide nanoparticles to target MXD3 in neuroblastoma cell lines in vitro as a single-agent therapeutic and in combination with doxorubicin, vincristine, cisplatin, or maphosphamide-common drugs used in current neuroblastoma treatment.ResultsMXD3 was highly expressed in neuroblastoma cell lines and in patient tumors that had high-risk features. Neuroblastoma cells treated in vitro with the MXD3 siRNA nanocomplexes showed MXD3 protein knockdown and resulted in cell apoptosis. Furthermore, on combining MXD3 siRNA nanocomplexes with each of the four drugs, all showed additive efficacy.ConclusionThese results indicate that MXD3 is a potential new target and that the use of MXD3 siRNA nanocomplexes is a novel therapeutic approach for neuroblastoma.

  8. APC/C-mediated degradation of dsRNA-binding protein 4 (DRB4 involved in RNA silencing.

    Directory of Open Access Journals (Sweden)

    Katia Marrocco

    Full Text Available Selective protein degradation via the ubiquitin-26S proteasome is a major mechanism underlying DNA replication and cell division in all Eukaryotes. In particular, the APC/C (Anaphase Promoting Complex or Cyclosome is a master ubiquitin protein ligase (E3 that targets regulatory proteins for degradation allowing sister chromatid separation and exit from mitosis. Interestingly, recent work also indicates that the APC/C remains active in differentiated animal and plant cells. However, its role in post-mitotic cells remains elusive and only a few substrates have been characterized.In order to identify novel APC/C substrates, we performed a yeast two-hybrid screen using as the bait Arabidopsis APC10/DOC1, one core subunit of the APC/C, which is required for substrate recruitment. This screen identified DRB4, a double-stranded RNA binding protein involved in the biogenesis of different classes of small RNA (sRNA. This protein interaction was further confirmed in vitro and in plant cells. Moreover, APC10 interacts with DRB4 through the second dsRNA binding motif (dsRBD2 of DRB4, which is also required for its homodimerization and binding to its Dicer partner DCL4. We further showed that DRB4 protein accumulates when the proteasome is inactivated and, most importantly, we found that DRB4 stability depends on APC/C activity. Hence, depletion of Arabidopsis APC/C activity by RNAi leads to a strong accumulation of endogenous DRB4, far beyond its normal level of accumulation. However, we could not detect any defects in sRNA production in lines where DRB4 was overexpressed.Our work identified a first plant substrate of the APC/C, which is not a regulator of the cell cycle. Though we cannot exclude that APC/C-dependent degradation of DRB4 has some regulatory roles under specific growth conditions, our work rather points to a housekeeping function of APC/C in maintaining precise cellular-protein concentrations and homeostasis of DRB4.

  9. Knockdown of TFIIS by RNA silencing inhibits cancer cell proliferation and induces apoptosis

    International Nuclear Information System (INIS)

    Hubbard, Kyle; Catalano, Jennifer; Puri, Raj K; Gnatt, Averell

    2008-01-01

    A common element among cancer cells is the presence of improperly controlled transcription. In these cells, the degree of specific activation of some genes is abnormal, and altering the aberrant transcription may therefore directly target cancer. TFIIS is a transcription elongation factor, which directly binds the transcription motor, RNA Polymerase II and allows it to read through various transcription arrest sites. We report on RNA interference of TFIIS, a transcription elongation factor, and its affect on proliferation of cancer cells in culture. RNA interference was performed by transfecting siRNA to specifically knock down TFIIS expression in MCF7, MCF10A, PL45 and A549 cells. Levels of TFIIS expression were determined by the Quantigene method, and relative protein levels of TFIIS, c-myc and p53 were determined by C-ELISA. Induction of apoptosis was determined by an enzymatic Caspase 3/7 assay, as well as a non-enzymatic assay detecting cytoplasmic mono- and oligonucleosomes. A gene array analysis was conducted for effects of TFIIS siRNA on MCF7 and MCF10A cell lines. Knockdown of TFIIS reduced cancer cell proliferation in breast, lung and pancreatic cancer cell lines. More specifically, TFIIS knockdown in the MCF7 breast cancer cell line induced cancer cell death and increased c-myc and p53 expression whereas TFIIS knockdown in the non-cancerous breast cell line MCF10A was less affected. Differential effects of TFIIS knockdown in MCF7 and MCF10A cells included the estrogenic, c-myc and p53 pathways, as observed by C-ELISA and gene array, and were likely involved in MCF7 cell-death. Although transcription is a fundamental process, targeting select core transcription factors may provide for a new and potent avenue for cancer therapeutics. In the present study, knockdown of TFIIS inhibited cancer cell proliferation, suggesting that TFIIS could be studied as a potential cancer target within the transcription machinery

  10. Bugs Are Not to Be Silenced: Small RNA Pathways and Antiviral Responses in Insects.

    Science.gov (United States)

    Mongelli, Vanesa; Saleh, Maria-Carla

    2016-09-29

    Like every other organism on Earth, insects are infected with viruses, and they rely on RNA interference (RNAi) mechanisms to circumvent viral infections. A remarkable characteristic of RNAi is that it is both broadly acting, because it is triggered by double-stranded RNA molecules derived from virtually any virus, and extremely specific, because it targets only the particular viral sequence that initiated the process. Reviews covering the different facets of the RNAi antiviral immune response in insects have been published elsewhere. In this review, we build a framework to guide future investigation. We focus on the remaining questions and avenues of research that need to be addressed to move the field forward, including issues such as the activity of viral suppressors of RNAi, comparative genomics, the development of detailed maps of the subcellular localization of viral replication complexes with the RNAi machinery, and the regulation of the antiviral RNAi response.

  11. In vivo silencing of alpha-synuclein using naked siRNA

    OpenAIRE

    Charisse Klaus; Toudjarska Ivanka; Kent Caroline; Hinkle Kelly; Ogholikhan Sina; He Zhen; Braithwaite Adam; Lincoln Sarah; Zehr Cynthia; Hope Andrew; Bumcrot David; Melrose Heather; Lewis Jada; Braich Ravi; Pandey Rajendra K

    2008-01-01

    Abstract Background Overexpression of α-synuclein (SNCA) in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD), possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a...

  12. Transitive RNA silencing signals induce cytosine methylation of a transgenic but not an endogenous target

    Czech Academy of Sciences Publication Activity Database

    Vermeersch, L.; De Winne, N.; Nolf, J.; Bleys, A.; Kovařík, Aleš; Depicker, A.

    2013-01-01

    Roč. 74, č. 5 (2013), s. 867-879 ISSN 0960-7412 R&D Projects: GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : DIRECTED DNA METHYLATION * POTATO-VIRUS-X * DOUBLE-STRANDED-RNA Subject RIV: BO - Biophysics Impact factor: 6.815, year: 2013

  13. Computational strategies for the automated design of RNA nanoscale structures from building blocks using NanoTiler.

    Science.gov (United States)

    Bindewald, Eckart; Grunewald, Calvin; Boyle, Brett; O'Connor, Mary; Shapiro, Bruce A

    2008-10-01

    One approach to designing RNA nanoscale structures is to use known RNA structural motifs such as junctions, kissing loops or bulges and to construct a molecular model by connecting these building blocks with helical struts. We previously developed an algorithm for detecting internal loops, junctions and kissing loops in RNA structures. Here we present algorithms for automating or assisting many of the steps that are involved in creating RNA structures from building blocks: (1) assembling building blocks into nanostructures using either a combinatorial search or constraint satisfaction; (2) optimizing RNA 3D ring structures to improve ring closure; (3) sequence optimisation; (4) creating a unique non-degenerate RNA topology descriptor. This effectively creates a computational pipeline for generating molecular models of RNA nanostructures and more specifically RNA ring structures with optimized sequences from RNA building blocks. We show several examples of how the algorithms can be utilized to generate RNA tecto-shapes.

  14. Computational strategies for the automated design of RNA nanoscale structures from building blocks using NanoTiler☆

    Science.gov (United States)

    Bindewald, Eckart; Grunewald, Calvin; Boyle, Brett; O’Connor, Mary; Shapiro, Bruce A.

    2013-01-01

    One approach to designing RNA nanoscale structures is to use known RNA structural motifs such as junctions, kissing loops or bulges and to construct a molecular model by connecting these building blocks with helical struts. We previously developed an algorithm for detecting internal loops, junctions and kissing loops in RNA structures. Here we present algorithms for automating or assisting many of the steps that are involved in creating RNA structures from building blocks: (1) assembling building blocks into nanostructures using either a combinatorial search or constraint satisfaction; (2) optimizing RNA 3D ring structures to improve ring closure; (3) sequence optimisation; (4) creating a unique non-degenerate RNA topology descriptor. This effectively creates a computational pipeline for generating molecular models of RNA nanostructures and more specifically RNA ring structures with optimized sequences from RNA building blocks. We show several examples of how the algorithms can be utilized to generate RNA tecto-shapes. PMID:18838281

  15. Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.

    Science.gov (United States)

    Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

    2014-02-01

    We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  16. Structure of the Cmr2 Subunit of the CRISPR-Cas RNA Silencing Complex

    Energy Technology Data Exchange (ETDEWEB)

    Cocozaki, Alexis I.; Ramia, Nancy F.; Shao, Yaming; Hale, Caryn R.; Terns, Rebecca M.; Terns, Michael P.; Li, Hong (FSU); (Georgia)

    2012-08-10

    Cmr2 is the largest and an essential subunit of a CRISPR RNA-Cas protein complex (the Cmr complex) that cleaves foreign RNA to protect prokaryotes from invading genetic elements. Cmr2 is thought to be the catalytic subunit of the effector complex because of its N-terminal HD nuclease domain. Here, however, we report that the HD domain of Cmr2 is not required for cleavage by the complex in vitro. The 2.3 {angstrom} crystal structure of Pyrococcus furiosus Cmr2 (lacking the HD domain) reveals two adenylyl cyclase-like and two {alpha}-helical domains. The adenylyl cyclase-like domains are arranged as in homodimeric adenylyl cyclases and bind ADP and divalent metals. However, mutagenesis studies show that the metal- and ADP-coordinating residues of Cmr2 are also not critical for cleavage by the complex. Our findings suggest that another component provides the catalytic function and that the essential role by Cmr2 does not require the identified ADP- or metal-binding or HD domains in vitro.

  17. Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

    Directory of Open Access Journals (Sweden)

    Malgorzata Sierant

    2011-01-01

    Full Text Available RNA interference (RNAi technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G alleles of human Presenilin1 gene (PSEN1. This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide.

  18. RNA and RNP as Building Blocks for Nanotechnology and Synthetic Biology.

    Science.gov (United States)

    Ohno, Hirohisa; Saito, Hirohide

    2016-01-01

    Recent technologies that aimed to elucidate cellular function have revealed essential roles for RNA molecules in living systems. Our knowledge concerning functional and structural information of naturally occurring RNA and RNA-protein (RNP) complexes is increasing rapidly. RNA and RNP interaction motifs are structural units that function as building blocks to constitute variety of complex structures. RNA-central synthetic biology and nanotechnology are constructive approaches that employ the accumulated information and build synthetic RNA (RNP)-based circuits and nanostructures. Here, we describe how to design and construct synthetic RNA (RNP)-based devices and structures at the nanometer-scale for biological and future therapeutic applications. RNA/RNP nanostructures can also be utilized as the molecular scaffold to control the localization or interactions of target molecule(s). Moreover, RNA motifs recognized by RNA-binding proteins can be applied to make protein-responsive translational "switches" that can turn gene expression "on" or "off" depending on the intracellular environment. This "synthetic RNA and RNP world" will expand tools for nanotechnology and synthetic biology. In addition, these reconstructive approaches would lead to a greater understanding of building principle in naturally occurring RNA/RNP molecules and systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Inhalable delivery of AAV-based MRP4/ABCC4 silencing RNA prevents monocrotaline-induced pulmonary hypertension

    Directory of Open Access Journals (Sweden)

    Caroline Claude

    Full Text Available The ATP-binding cassette transporter MRP4 (encoded by ABCC4 regulates membrane cyclic nucleotides concentrations in arterial cells including smooth muscle cells. MRP4/ABCC4 deficient mice display a reduction in smooth muscle cells proliferation and a prevention of pulmonary hypertension in response to hypoxia. We aimed to study gene transfer of a MRP4/ABCC4 silencing RNA via intratracheal delivery of aerosolized adeno-associated virus 1 (AAV1.shMRP4 or AAV1.control in a monocrotaline-induced model of pulmonary hypertension in rats. Gene transfer was performed at the time of monocrotaline administration and the effect on the development of pulmonary vascular remodeling was assessed 35 days later. AAV1.shMRP4 dose-dependently reduced right ventricular systolic pressure and hypertrophy with a significant reduction with the higher doses (i.e., >1011 DRP/animal as compared to AAV1.control. The higher dose of AAV1.shMRP4 was also associated with a significant reduction in distal pulmonary arteries remodeling. AAV1.shMRP4 was finally associated with a reduction in the expression of ANF, a marker of cardiac hypertrophy. Collectively, these results support a therapeutic potential for downregulation of MRP4 for the treatment of pulmonary artery hypertension.

  20. shRNA-mediated EMMPRIN silencing inhibits human leukemic monocyte lymphoma U937 cell proliferation and increases chemosensitivity to adriamycin.

    Science.gov (United States)

    Gao, Hui; Jiang, Qixiao; Han, Yantao; Peng, Jianjun; Wang, Chunbo

    2015-03-01

    EMMPRIN is a widely distributed cell surface glycoprotein, which plays an important role in tumor progression and confers resistance to some chemotherapeutic drugs. Recent studies have shown that EMMPRIN overexpression indicates poor prognosis in acute myeloid leukemia (AML). However, little was known on the role of EMMPRIN in leukemia. Human leukemia cell line U937 was stably transfected with a EMMPRIN-targeted shRNA-containing vector to investigate the effect of EMMPRIN on cellular functions. EMMPRIN expression was monitored by qRT-PCR and Western blotting. Cell viability and proliferation were determined by trypan blue exclusion and BrdU labeling, respectively. Cell cycle and apoptosis were analyzed by flow cytometry. Cytotoxicity of chemotherapeutic agent adriamycin on cells was assessed by MTT assay. Knockdown of EMMPRIN gene significantly inhibited cell viability and decreased cell proliferation. Fluorescence-activated cell-sorting analysis revealed that the reduced EMMPRIN expression resulted in cell cycle arrest at G1 phase and induced apoptosis. Meanwhile, western blotting analysis showed that EMMPRIN knockdown was associated with downregulation of cell cycle- and apoptosis-related molecules including cyclin D1, cyclin E, as well as increase in cleavage of caspase-3 and PARP. This study also showed that silencing of EMMPRIN sensitized U937 cells to Adriamycin. EMMPRIN is involved in proliferation, growth, and chemosensitivity of human AML line U937, indicating that EMMPRIN may be a promising therapeutic target for AML.

  1. Silencing of GPNMB by siRNA Inhibits the Formation of Melanosomes in Melanocytes in a MITF-Independent Fashion

    Science.gov (United States)

    Zhu, Cansheng; Yuan, Xiaoying; Li, Dongguang; Gu, Weijie; Ma, Huimin; Xie, Xin; Gao, Tianwen

    2012-01-01

    Background Melanosomes are specialized membrane-surrounded organelles, which are involved in the synthesis, storage and transport of melanin. Glycoprotein (transmembrane) non-metastatic melanoma protein b (GPNMB), a melanosome-specific structural protein, shares significant amino acid sequence homology with Pmel-17. Proteomic analysis demonstrated that GPNMB is present in all stages (I-IV) of melanosomes. However, little is known about the role of GPNMB in melanosomes. Methodology/Principal Findings Using real-time quantitative PCR, Western blotting and immunofluorescence analysis, we demonstrated that the expression of GPNMB in PIG1 melanocytes was up-regulated by ultraviolet B (UVB) radiation. Transmission electron microscopy analysis showed that the total number of melanosomes in PIG1 melanocytes was sharply reduced by GPNMB-siRNA transfection. Simultaneously, the expression levels of tyrosinase (Tyr), tyrosinase related protein 1 (Trp1), Pmel17/gp100 and ocular albinism type 1 protein (OA1) were all significantly attenuated. But the expression of microphthalmia-associated transcription factor (MITF) was up-regulated. Intriguingly, in GPNMB silenced PIG1 melanocytes, UVB radiation sharply reduced MITF expression. Conclusion Our present work revealed that the GPNMB was critical for the formation of melanosomes. And GPNMB expression down-regulation attenuated melanosome formation in a MITF-independent fashion. PMID:22912767

  2. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  3. Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

    Science.gov (United States)

    Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2008-08-01

    The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

  4. Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

    Directory of Open Access Journals (Sweden)

    Kevin J Paik

    Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

  5. Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

    Science.gov (United States)

    Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

    2016-04-15

    Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II.

    Science.gov (United States)

    Steurer, Barbara; Marteijn, Jurgen A

    2017-10-27

    The faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The stalling of RNAP2 on a transcription-blocking lesion triggers a series of highly regulated events, including RNAP2 processing to make the lesion accessible for DNA repair, R-loop-mediated DNA damage signaling, and the initiation of transcription-coupled DNA repair. The correct execution and coordination of these processes is vital for resuming transcription following the successful repair of transcription-blocking lesions. Here, we outline recent insights into the molecular consequences of RNAP2 stalling on transcription-blocking DNA lesions and how these lesions are resolved to restore mRNA synthesis. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  7. Blocking Breast Cancer Metastasis by Targeting RNA-Binding Protein HuR

    Science.gov (United States)

    2017-10-01

    AWARD NUMBER: W81XWH-16-1-0730 TITLE: Blocking Breast Cancer Metastasis by Targeting RNA-Binding Protein HuR PRINCIPAL INVESTIGATOR: Danny Welch...NUMBER Blocking Breast Cancer Metastasis by Targeting RNA-Binding Protein HuR 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT...increased aggressiveness in breast cancer , the primary objective of this proposal is to assess whether HuR (or analogs) prevent and/or treat metastasis and/or

  8. Specific degradation of 3' regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5'-3' spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  9. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  10. Changes in Oleic Acid Content of Transgenic Soybeans by Antisense RNA Mediated Posttranscriptional Gene Silencing

    Directory of Open Access Journals (Sweden)

    Ling Zhang

    2014-01-01

    Full Text Available The Delta-12 oleate desaturase gene (FAD2-1, which converts oleic acid into linoleic acid, is the key enzyme determining the fatty acid composition of seed oil. In this study, we inhibited the expression of endogenous Delta-12 oleate desaturase GmFad2-1b gene by using antisense RNA in soybean Williams 82. By employing the soybean cotyledonary-node method, a part of the cDNA of soybean GmFad2-1b 801 bp was cloned for the construction of a pCAMBIA3300 vector under the soybean seed promoter BCSP. Leaf painting, LibertyLink strip, PCR, Southern blot, qRT-PCR, and fatty acid analysis were used to detect the insertion and expression of GmFad2-1b in the transgenic soybean lines. The results indicate that the metabolically engineered plants exhibited a significant increase in oleic acid (up to 51.71% and a reduction in palmitic acid (to <3% in their seed oil content. No structural differences were observed between the fatty acids of the transgenic and the nontransgenic oil extracts.

  11. Phytophthora suppressor of RNA silencing 2 is a conserved RxLR effector that promotes infection in soybean and Arabidopsis thaliana.

    Science.gov (United States)

    Xiong, Qin; Ye, Wenwu; Choi, Duseok; Wong, James; Qiao, Yongli; Tao, Kai; Wang, Yuanchao; Ma, Wenbo

    2014-12-01

    The genus Phytophthora consists of notorious and emerging pathogens of economically important crops. Each Phytophthora genome encodes several hundreds of cytoplasmic effectors, which are believed to manipulate plant immune response inside the host cells. However, the majority of Phytophthora effectors remain functionally uncharacterized. We recently discovered two effectors from the soybean stem and root rot pathogen Phytophthora sojae with the activity to suppress RNA silencing in plants. These effectors are designated Phytophthora suppressor of RNA silencing (PSRs). Here, we report that the P. sojae PSR2 (PsPSR2) belongs to a conserved and widespread effector family in Phytophthora. A PsPSR2-like effector produced by P. infestans (PiPSR2) can also suppress RNA silencing in plants and promote Phytophthora infection, suggesting that the PSR2 family effectors have conserved functions in plant hosts. Using Agrobacterium rhizogenes-mediated hairy roots induction, we demonstrated that the expression of PsPSR2 rendered hypersusceptibility of soybean to P. sojae. Enhanced susceptibility was also observed in PsPSR2-expressing Arabidopsis thaliana plants during Phytophthora but not bacterial infection. These experiments provide strong evidence that PSR2 is a conserved Phytophthora effector family that performs important virulence functions specifically during Phytophthora infection of various plant hosts.

  12. Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Timo Faltus

    2004-11-01

    Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

  13. Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

    Science.gov (United States)

    Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

    2015-11-01

    Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine

  14. Low-weight polyethylenimine cross-linked 2-hydroxypopyl-ß-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA

    Directory of Open Access Journals (Sweden)

    Li JM

    2013-06-01

    Full Text Available Jin-Ming Li, Yuan-Yuan Wang, Wei Zhang, Hua Su, Liang-Nian Ji, Zong-Wan Mao MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, People's Republic of China Background: Targeted delivery of small interfering RNA (siRNA has been regarded as one of the most important technologies for the development of siRNA therapeutics. However, the need for safe and efficient delivery systems is a barrier to further development of RNA interference therapeutics. In this work, a nontoxic and efficient siRNA carrier delivery system of low molecular weight polyethyleneimine (PEI-600 Da cross-linked with 2-hydroxypopyl-β-cyclodextrin (HP-β-CD and folic acid (FA was synthesized for biomedical application. Methods: The siRNA carrier was prepared using a simple method and characterized by nuclear magnetic resonance and Fourier transform infrared spectroscopy. The siRNA carrier nanoparticles were characterized in terms of morphology, size and zeta potential, stability, efficiency of delivery, and gene silencing efficiency in vitro and in vivo. Results: The siRNA carrier was synthesized successfully. It showed good siRNA binding capacity and ability to protect siRNA. Further, the toxicity of the carrier measured in vitro and in vivo appeared to be negligible, probably because of degradation of the low molecular weight PEI and HP-β-CD in the cytosol. Flow cytometry and confocal microscopy confirmed that the FA receptor-mediated endocytosis of the FA-HP-β-CD-PEI/siRNA complexes was greater than that of the HP-β-CD-PEI/siRNA complexes in FA receptor-enriched HeLa cells. The FA-HP-β-CD-PEI/siRNA complexes also demonstrated excellent gene silencing efficiency in vitro (in the range of 90%, and reduced vascular endothelial growth factor (VEGF protein expression in the presence of 20% serum. FA-HP-β-CD-PEI/siRNA complexes administered via tail vein injection resulted in marked

  15. Silencing of RhoA and RhoC expression by RNA interference suppresses human colorectal carcinoma growth in vivo

    Directory of Open Access Journals (Sweden)

    Wang Haibo

    2010-09-01

    Full Text Available Abstract Background RhoA and RhoC have been proved to be over-expressed in many solid cancers, including colorectal cancer. The reduction of RhoA and RhoC expression by RNA interference (RNAi resulted growth inhibition of cancer cells. The present study was to evaluate the effect of silencing of RhoA and RhoC expression by RNAi on growth of human colorectal carcinoma (CRC in tumor-bearing nude mice in vivo. Methods To establish HCT116 cell transplantable model, the nude mice were subcutaneously inoculated with 1.0 × 107 HCT116 cells and kept growing till the tumor xenografts reached 5-7 mm in diameter. Then the mice were randomly assigned to three groups(seven mice in each group: (1 normal saline(NS group, (2replication-defective recombinant adenovirus carrying the negative control shRNA (Ad-HK group and (3replication-defective recombinant adenovirus carrying the 4-tandem linked RhoA and RhoC shRNAs (Ad-RhoA-RhoC group. Ad-HK (4 × 108 pfu, 30 ul/mouse, Ad-RhoA-RhoC (4 × 108 pfu, 30 ul/mouse or PBS (30 ul/mouse was injected intratumorally four times once every other day. The weight and volumes of tumor xenografts were recorded. The levels of RhoA and RhoC mRNA transcripts and proteins in tumor xenografts were detected by reverse quantitative transcription polymerase chain reaction (QRT-PCR and immunohistochemical staining respectively. The terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL assay was used to detect the death of cells. Results The xenografts in mice could be seen at 5th day from the implantation of HCT116 cells and all had reached 5-7 mm in size at 9th day. After injection intratumorally, the growth speed of tumor xenografts in Ad-RhoA-RhoC group was significantly delayed compared with those in NS and Ad-HK group(P RhoA and RhoC reduced more in Ad-RhoA-RhoC group than those in NS and Ad-HK group. The relative RhoA and RhoC mRNA transcripts were decreased to 48% and 43% respectively (P RhoA and Rho

  16. Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II

    NARCIS (Netherlands)

    B. Steurer (Barbara); J.A. Marteijn (Jurgen)

    2016-01-01

    textabstractThe faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The

  17. Reconstruction of gene regulatory modules from RNA silencing of IFN-α modulators: experimental set-up and inference method.

    Science.gov (United States)

    Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria

    2016-03-12

    Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.

  18. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  19. Influence of RNA Strand Rigidity on Polyion Complex Formation with Block Catiomers.

    Science.gov (United States)

    Hayashi, Kotaro; Chaya, Hiroyuki; Fukushima, Shigeto; Watanabe, Sumiyo; Takemoto, Hiroyasu; Osada, Kensuke; Nishiyama, Nobuhiro; Miyata, Kanjiro; Kataoka, Kazunori

    2016-03-01

    Polyion complexes (b-PICs) are prepared by mixing single- or double-stranded oligo RNA (aniomer) with poly(ethylene glycol)-b-poly(L-lysine) (PEG-PLL) (block catiomer) to clarify the effect of aniomer chain rigidity on association behaviors at varying concentrations. Here, a 21-mer single-stranded RNA (ssRNA) (persistence length: 1.0 nm) and a 21-mer double-stranded RNA (small interfering RNA, siRNA) (persistence length: 62 nm) are compared. Both oligo RNAs form a minimal charge-neutralized ionomer pair with a single PEG-PLL chain, termed unit b-PIC (uPIC), at low concentrations (<≈ 0.01 mg mL(-1)). Above the critical association concentration (≈ 0.01 mg mL(-1)), ssRNA b-PICs form secondary associates, PIC micelles, with sizes up to 30-70 nm, while no such multimolecular assembly is observed for siRNA b-PICs. The entropy gain associated with the formation of a segregated PIC phase in the multimolecular PIC micelles may not be large enough for rigid siRNA strands to compensate with appreciably high steric repulsion derived from PEG chains. Chain rigidity appears to be a critical parameter in polyion complex association. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

    Science.gov (United States)

    Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

    2005-07-20

    Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

  1. A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

    Science.gov (United States)

    Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

    2009-11-01

    Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

  2. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Directory of Open Access Journals (Sweden)

    Ivyna Pau Ni Bong

    2016-11-01

    Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.

  3. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Science.gov (United States)

    Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah

    2016-01-01

    Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828

  4. Structural Dynamics of the GW182 Silencing Domain Including its RNA Recognition motif (RRM) Revealed by Hydrogen-Deuterium Exchange Mass Spectrometry

    Science.gov (United States)

    Cieplak-Rotowska, Maja K.; Tarnowski, Krzysztof; Rubin, Marcin; Fabian, Marc R.; Sonenberg, Nahum; Dadlez, Michal; Niedzwiecka, Anna

    2018-01-01

    The human GW182 protein plays an essential role in micro(mi)RNA-dependent gene silencing. miRNA silencing is mediated, in part, by a GW182 C-terminal region called the silencing domain, which interacts with the poly(A) binding protein and the CCR4-NOT deadenylase complex to repress protein synthesis. Structural studies of this GW182 fragment are challenging due to its predicted intrinsically disordered character, except for its RRM domain. However, detailed insights into the properties of proteins containing disordered regions can be provided by hydrogen-deuterium exchange mass spectrometry (HDX/MS). In this work, we applied HDX/MS to define the structural state of the GW182 silencing domain. HDX/MS analysis revealed that this domain is clearly divided into a natively unstructured part, including the CCR4-NOT interacting motif 1, and a distinct RRM domain. The GW182 RRM has a very dynamic structure, since water molecules can penetrate the whole domain in 2 h. The finding of this high structural dynamics sheds new light on the RRM structure. Though this domain is one of the most frequently occurring canonical protein domains in eukaryotes, these results are - to our knowledge - the first HDX/MS characteristics of an RRM. The HDX/MS studies show also that the α2 helix of the RRM can display EX1 behavior after a freezing-thawing cycle. This means that the RRM structure is sensitive to environmental conditions and can change its conformation, which suggests that the state of the RRM containing proteins should be checked by HDX/MS in regard of the conformational uniformity. [Figure not available: see fulltext.

  5. Amino acid sequence motifs essential for P0-mediated suppression of RNA silencing in an isolate of potato leafroll virus from Inner Mongolia.

    Science.gov (United States)

    Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2014-06-01

    Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.

  6. Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

    Science.gov (United States)

    Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

    2017-08-15

    Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

  7. Viral RNA silencing suppression

    NARCIS (Netherlands)

    Hedil, Marcio; Kormelink, Richard

    2016-01-01

    The Bunyaviridae is a family of arboviruses including both plant-and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative

  8. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7

    Directory of Open Access Journals (Sweden)

    Bi YZ

    2016-11-01

    Full Text Available Yanzhao Bi, Yifan Zhang, Chunying Cui, Lulu Ren, Xueyun Jiang School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, People’s Republic of China Abstract: Nanodiamond (ND is a renowned material in nonviral small interfering RNA (siRNA carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH22NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR assay, enzyme-linked immunosorbent assay (ELISA, flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH22NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V–fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH22NH-VDGR/survivin-siRNA nanoparticle with 60–110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH22NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH22NH-VDGR was suggested

  9. Structural insight into RNA recognition motifs: versatile molecular Lego building blocks for biological systems.

    Science.gov (United States)

    Muto, Yutaka; Yokoyama, Shigeyuki

    2012-01-01

    'RNA recognition motifs (RRMs)' are common domain-folds composed of 80-90 amino-acid residues in eukaryotes, and have been identified in many cellular proteins. At first they were known as RNA binding domains. Through discoveries over the past 20 years, however, the RRMs have been shown to exhibit versatile molecular recognition activities and to behave as molecular Lego building blocks to construct biological systems. Novel RNA/protein recognition modes by RRMs are being identified, and more information about the molecular recognition by RRMs is becoming available. These RNA/protein recognition modes are strongly correlated with their biological significance. In this review, we would like to survey the recent progress on these versatile molecular recognition modules. Copyright © 2012 John Wiley & Sons, Ltd.

  10. Silencing of cytosolic NADP(+)-dependent isocitrate dehydrogenase by small interfering RNA enhances the sensitivity of HeLa cells toward staurosporine.

    Science.gov (United States)

    Lee, Su-Min; Park, Sin Young; Shin, Seoung Woo; Kil, In Sup; Yang, Eun Sun; Park, Jeen-Woo

    2009-02-01

    Staurosporine induces the production of reactive oxygen species, which play an important causative role in apoptotic cell death. Recently, it was demonstrated that the control of cellular redox balance and the defense against oxidative damage is one of the primary functions of cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) by supplying NADPH for antioxidant systems. The present report shows that silencing of IDPc expression in HeLa cells greatly enhances apoptosis induced by staurosporine. Transfection of HeLa cells with an IDPc small interfering RNA (siRNA) markedly decreased activity of IDPc, enhancing the susceptibility of staurosporine-induced apoptosis reflected by DNA fragmentation, cellular redox status and the modulation of apoptotic marker proteins. These results indicate that IDPc may play an important role in regulating the apoptosis induced by staurosporine and the sensitizing effect of IDPc siRNA on the apoptotic cell death of HeLa cells offers the possibility of developing a modifier of cancer chemotherapy.

  11. Interference RNA (RNAi)-based silencing of endogenous thrombopoietin receptor (Mpl) in Dami cells resulted in decreased hNUDC-mediated megakaryocyte proliferation and differentiation

    International Nuclear Information System (INIS)

    Pang, Shi-Feng; Li, Xiao-Kun; Zhang, Qiang; Yang, Fang; Xu, Peilin

    2009-01-01

    Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.

  12. Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant.

    Science.gov (United States)

    Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit

    2009-08-01

    Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.

  13. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7.

    Science.gov (United States)

    Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun

    Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.

  14. Nuclear TRIM25 Specifically Targets Influenza Virus Ribonucleoproteins to Block the Onset of RNA Chain Elongation.

    Science.gov (United States)

    Meyerson, Nicholas R; Zhou, Ligang; Guo, Yusong R; Zhao, Chen; Tao, Yizhi J; Krug, Robert M; Sawyer, Sara L

    2017-11-08

    TRIM25 is an E3 ubiquitin ligase that activates RIG-I to promote the antiviral interferon response. The NS1 protein from all strains of influenza A virus binds TRIM25, although not all virus strains block the interferon response, suggesting alternative mechanisms for TRIM25 action. Here we present a nuclear role for TRIM25 in specifically restricting influenza A virus replication. TRIM25 inhibits viral RNA synthesis through a direct mechanism that is independent of its ubiquitin ligase activity and the interferon pathway. This activity can be inhibited by the viral NS1 protein. TRIM25 inhibition of viral RNA synthesis results from its binding to viral ribonucleoproteins (vRNPs), the structures containing individual viral RNA segments, the viral polymerase, and multiple viral nucleoproteins. TRIM25 binding does not inhibit initiation of capped-RNA-primed viral mRNA synthesis by the viral polymerase. Rather, the onset of RNA chain elongation is inhibited because TRIM25 prohibits the movement of RNA into the polymerase complex. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Induction of cell death by tospoviral protein NSs and the motif critical for cell death does not control RNA silencing suppression activity.

    Science.gov (United States)

    Singh, Ajeet; Permar, Vipin; Jain, R K; Goswami, Suneha; Kumar, Ranjeet Ranjan; Canto, Tomas; Palukaitis, Peter; Praveen, Shelly

    2017-08-01

    Groundnut bud necrosis virus induces necrotic symptoms in different hosts. Previous studies showed reactive oxygen species-mediated programmed cell death (PCD) resulted in necrotic symptoms. Transgenic expression of viral protein NSs mimics viral symptoms. Here, we showed a role for NSs in influencing oxidative burst in the cell, by analyzing H 2 O 2 accumulation, activities of antioxidant enzymes and expression levels of vacuolar processing enzymes, H 2 O 2 -responsive microRNA 319a.2 plus its possible target metacaspase-8. The role of NSs in PCD, was shown using two NSs mutants: one in the Trp/GH3 motif (a homologue of pro-apototic domain) (NSs S189R ) and the other in a non-Trp/GH3 motif (NSs L172R ). Tobacco rattle virus (TRV) expressing NSs S189R enhanced the PCD response, but not TRV-NSs L172R , while RNA silencing suppression activity was lost in TRV-NSs L172R , but not in TRV-NSs S189R . Therefore, we propose dual roles of NSs in RNA silencing suppression and induction of cell death, controlled by different motifs. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com

    2016-08-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  17. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    International Nuclear Information System (INIS)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan

    2016-01-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  18. Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

    Science.gov (United States)

    Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L

    2014-01-01

    Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

  19. Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

    Directory of Open Access Journals (Sweden)

    Nabil Killiny

    Full Text Available Silencing of genes through RNA interference (RNAi in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4 in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

  20. Silencing of microRNA-155 in mice during acute inflammatory response leads to derepression of c/ebp Beta and down-regulation of G-CSF

    DEFF Research Database (Denmark)

    Worm, Jesper; Stenvang, Jan; Petri, Andreas

    2009-01-01

    microRNA-155 (miR-155) has been implicated as a central regulator of the immune system, but its function during acute inflammatory responses is still poorly understood. Here we show that exposure of cultured macrophages and mice to lipopolysaccharide (LPS) leads to up-regulation of miR-155......-stimulating factor (G-CSF), a central regulator of granulopoiesis during inflammatory responses. Consistent with these data, we show that silencing of miR-155 in LPS-treated mice by systemically administered LNA-antimiR results in derepression of the c/ebp Beta isoforms and down-regulation of G-CSF expression...

  1. Blocking of an intronic splicing silencer completely rescues IKBKAP exon 20 splicing in familial dysautonomia patient cells

    DEFF Research Database (Denmark)

    Bruun, Gitte H; Bang, Jeanne Mv; Christensen, Lise L

    2018-01-01

    designed splice switching oligonucleotides (SSO) that blocks the intronic hnRNP A1 binding site, and demonstrate that this completely rescues splicing of IKBKAP exon 20 in FD patient fibroblasts and increases the amounts of IKAP protein. We propose that this may be developed into a potential new specific...

  2. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  3. Double-stranded RNA delivery through soaking mediates silencing of the muscle protein 20 and increases mortality to the Asian citrus psyllid, Diaphorina citri.

    Science.gov (United States)

    Yu, Xiudao; Gowda, Siddarame; Killiny, Nabil

    2017-09-01

    Asian citrus psyllid, Diaphorina citri Kuwayama, is the most important economic pest of citrus because it transmits Candidatus Liberibacter asiaticus (CLas), the causal agent of huanglongbing (HLB). Silencing genes by RNA interference (RNAi) is a promising approach for controlling D. citri. RNAi-based insect management strategies depend on the selection of suitable target genes. The muscle protein 20 gene DcMP20 was characterized from D. citri in an effort to impair proper muscle development through RNAi. Phylogenetic analysis showed that DcMP20 was more closely related to MP20 from Drosophila compared with its counterpart from other insect species. Developmental expression analysis revealed that transcription of DcMP20 was development dependent and reached a maximum level in the last instar (fourth-fifth) of the nymphal stage. The extent of RNAi in D. citri was dose dependent, with dsRNA-DcMP20 at 75 ng µL -1 being sufficient to knock down endogenous DcMP20 expression, which resulted in significant mortality and reduced body weight that positively correlated with the silencing of DcMP20. No effect was found when dsRNA-GFP or water was used, indicating the specific effect of dsRNA-DcMP20. Our results suggest that dsRNA can be delivered to D. citri through soaking, and DcMP20 is an effective RNAi target to be used in the management of D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  4. Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera.

    Science.gov (United States)

    Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis

    2018-01-01

    The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.

  5. Microbial Disruption of Autophagy Alters Expression of the RISC Component AGO2, a Critical Regulator of the miRNA Silencing Pathway.

    Science.gov (United States)

    Sibony, Michal; Abdullah, Majd; Greenfield, Laura; Raju, Deepa; Wu, Ted; Rodrigues, David M; Galindo-Mata, Esther; Mascarenhas, Heidi; Philpott, Dana J; Silverberg, Mark S; Jones, Nicola L

    2015-12-01

    Autophagy is implicated in Crohn's disease (CD) pathogenesis. Recent evidence suggests autophagy regulates the microRNA (miRNA)-induced silencing complex (miRISC). Therefore, autophagy may play a novel role in CD by regulating expression of miRISC, thereby altering miRNA silencing. As microbes associated with CD can alter autophagy, we hypothesized that microbial disruption of autophagy affects the critical miRISC component AGO2. AGO2 expression was assessed in epithelial and immune cells, and intestinal organoids with disrupted autophagy. Microarray technology was used to determine the expression of downstream miRNAs in cells with defective autophagy. Increased AGO2 was detected in autophagy-deficient ATG5-/- and ATG16-/- mouse embryonic fibroblast cells (MEFs) in comparison with wild-type MEFs. Chemical agents and VacA toxin, which disrupt autophagy, increased AGO2 expression in MEFs, epithelial cells lines, and human monocytes, respectively. Increased AGO2 was also detected in ATG7-/- intestinal organoids, in comparison with wild-type organoids. Five miRNAs were differentially expressed in autophagy-deficient MEFs. Pathway enrichment analysis of the differentially expressed miRNAs implicated signaling pathways previously associated with CD. Taken together, our results suggest that autophagy is involved in the regulation of the critical miRISC component AGO2 in epithelial and immune cells and primary intestinal epithelial cells. We propose a mechanism by which autophagy alters miRNA expression, which likely impacts the regulation of CD-associated pathways. Furthermore, as enteric microbial products can manipulate autophagy and AGO2, our findings suggest a novel mechanism by which enteric microbes could influence miRNA to promote disease.

  6. Negative Energy Balance Blocks Neural and Behavioral Responses to Acute Stress by "Silencing" Central Glucagon-Like Peptide 1 Signaling in Rats.

    Science.gov (United States)

    Maniscalco, James W; Zheng, Huiyuan; Gordon, Patrick J; Rinaman, Linda

    2015-07-29

    Previous reports indicate that caloric restriction attenuates anxiety and other behavioral responses to acute stress, and blunts the ability of stress to increase anterior pituitary release of adrenocorticotropic hormone. Since hindbrain glucagon-like peptide-1 (GLP-1) neurons and noradrenergic prolactin-releasing peptide (PrRP) neurons participate in behavioral and endocrine stress responses, and are sensitive to the metabolic state, we examined whether overnight food deprivation blunts stress-induced recruitment of these neurons and their downstream hypothalamic and limbic forebrain targets. A single overnight fast reduced anxiety-like behavior assessed in the elevated-plus maze and acoustic startle test, including marked attenuation of light-enhanced startle. Acute stress [i.e., 30 min restraint (RES) or 5 min elevated platform exposure] robustly activated c-Fos in GLP-1 and PrRP neurons in fed rats, but not in fasted rats. Fasting also significantly blunted the ability of acute stress to activate c-Fos expression within the anterior ventrolateral bed nucleus of the stria terminalis (vlBST). Acute RES stress suppressed dark-onset food intake in rats that were fed ad libitum, whereas central infusion of a GLP-1 receptor antagonist blocked RES-induced hypophagia, and reduced the ability of RES to activate PrRP and anterior vlBST neurons in ad libitum-fed rats. Thus, an overnight fast "silences" GLP-1 and PrRP neurons, and reduces both anxiety-like and hypophagic responses to acute stress. The partial mimicking of these fasting-induced effects in ad libitum-fed rats after GLP-1 receptor antagonism suggests a potential mechanism by which short-term negative energy balance attenuates neuroendocrine and behavioral responses to acute stress. The results from this study reveal a potential central mechanism for the "metabolic tuning" of stress responsiveness. A single overnight fast, which markedly reduces anxiety-like behavior in rats, reduces or blocks the ability of

  7. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  8. Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro - A quantitative study

    NARCIS (Netherlands)

    Asgeirsdottir, Sigridur A.; Talman, Eduard G.; de Graaf, Inge A.; Kamps, Jan A. A. M.; Satchell, Simon C.; Mathieson, Peter W.; Ruiters, Marcel H. J.; Molema, Grietje

    2010-01-01

    Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic

  9. Effect of Circular RNA UBAP2 Silencing on Proliferation and Invasion of Human Lung Cancer A549 Cells and Its Mechanism

    Directory of Open Access Journals (Sweden)

    Yujing YIN

    2017-12-01

    Full Text Available Background and objective It has been proven that circular RNAs (circRNAs play an important role on the process of many types cancer and circUBAP2 was a cancer-promoting circRNA, however, the role and mechanism in lung cancer was not clear. The aim of this study is to investigate the effects of circUBAP2 on cell proliferation and invasion of human lung cancer A549 cells. Methods CCK-8 assay was employed to detect the effect of circUBAP2 sliencing on cell proliferation of A549 cells. Fow cytometry was applied to detect the impact of circUBAP2 sliencing on cell cycle and cell anoikis, and Transwell invasion assay was applied to determine cell invasion of A549 cells. We also employed Western blot and Real-time PCR to determine the expressions of CDK6, cyclin D1, p27 and c-IAP1, Bcl-2, Survivin, Bax, FAK, Rac1 and MMP2, and the activities of JNK and ERK1/2, luciferase report gene assay was used to detect the targets. Results CCK-8 assay showed that the inhibition of cell proliferation in the circUBAP2-siRNA group compared to untreated group and siRNA control group. Results of cell cycle detected by flow cytometry showed that cell cycle arrestd at G0/G1 after circUBAP2 silencing, cell apoptosis rate increased also. We also found that after circUBAP2 silencing, cell invasion of A549 cells was significantly inhibited. Western blot and Real-time PCR results showed that expression of CDK6, cyclin D1, c-IAP1, Bcl-2, Survivin, FAK, Rac1 and MMP2 were down-regulated, and the expression of p27 and Bax were up-regulated. Moreover, the activities of JNK and ERK1/2 were inhibited because of circUBAP2 silencing, the target genes were miR-339-5p, miR-96-3p and miR-135b-3p. Conclusion CircUBAP2 plays an important role in the proliferation and invasion of human lung cancer. Silencing of circUBAP2 might be a novel target for molecular targeted therapy of patients with lung cancer.

  10. Genomic Characterization of Variable Surface Antigens Reveals a Telomere Position Effect as a Prerequisite for RNA Interference-Mediated Silencing in Paramecium tetraurelia

    Science.gov (United States)

    Baranasic, Damir; Oppermann, Timo; Cheaib, Miriam; Cullum, John; Schmidt, Helmut

    2014-01-01

    ABSTRACT Antigenic or phenotypic variation is a widespread phenomenon of expression of variable surface protein coats on eukaryotic microbes. To clarify the mechanism behind mutually exclusive gene expression, we characterized the genetic properties of the surface antigen multigene family in the ciliate Paramecium tetraurelia and the epigenetic factors controlling expression and silencing. Genome analysis indicated that the multigene family consists of intrachromosomal and subtelomeric genes; both classes apparently derive from different gene duplication events: whole-genome and intrachromosomal duplication. Expression analysis provides evidence for telomere position effects, because only subtelomeric genes follow mutually exclusive transcription. Microarray analysis of cultures deficient in Rdr3, an RNA-dependent RNA polymerase, in comparison to serotype-pure wild-type cultures, shows cotranscription of a subset of subtelomeric genes, indicating that the telomere position effect is due to a selective occurrence of Rdr3-mediated silencing in subtelomeric regions. We present a model of surface antigen evolution by intrachromosomal gene duplication involving the maintenance of positive selection of structurally relevant regions. Further analysis of chromosome heterogeneity shows that alternative telomere addition regions clearly affect transcription of closely related genes. Consequently, chromosome fragmentation appears to be of crucial importance for surface antigen expression and evolution. Our data suggest that RNAi-mediated control of this genetic network by trans-acting RNAs allows rapid epigenetic adaptation by phenotypic variation in combination with long-term genetic adaptation by Darwinian evolution of antigen genes. PMID:25389173

  11. Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

    Science.gov (United States)

    2008-02-01

    and then photographed using a digital camera . AAV production and infection. To silence AR gene expression, a hairpin- structured expression vector...Sandusky GE, Vessella RL, Neubauer BL. Increased AKT activity contributes to prostate cancer progression by dramatically accelerating prostate tumor...HeNe laser. The spectrograph has an f/2.0 Czerny–Turner imaging spec- trometer plus a thermo-electrically cooled Kodak 0401 CCD camera . The fiberoptic

  12. Effects of siRNA Silencing of TUG1 and LCAL6 Long Non-coding RNAs on Patient-derived Xenograft of Non-small Cell Lung Cancer.

    Science.gov (United States)

    Fang, Tian; Huang, Hairong; Li, Xiaoyou; Liao, Jing; Yang, Zhijian; Hoffman, Robert M; Cheng, X I; Liang, Lei; Hu, Wenjuan; Yun, Shifeng

    2018-01-01

    The aim of the present study was to establish a patient-derived xenograft (PDX) mouse model of non-small cell lung cancer (NSCLC) and investigate the anti-tumor efficacy of silencing of TUG1 and LCAL6 long non-coding RNA in the PDX model. PDXs were established by subcutaneously implanting NSCLC surgical tumor fragments into immunodeficient mice. PDX characterization was performed by histopathological, immunohistochemical and real-time polymerase chain reaction (RT-PCR) analyses for NSCLC subtype-specific markers and expression of LCAL6 and TUG1. Anti-tumor efficacy of siRNA silencing of TUG1 and LCAL6 was also investigated in the PDX model. The effect of TUG1 and LCAL6 silencing on protein expression of proliferation marker Ki67 and HOX-gene family HOXB7 in the tumors was assessed by immunohistochemical staining and Western blotting. Establishment of NSCLC PDX models resulted in 9 of 26 cases (34.6%). Lung squamous cell carcinomas (SCC) had a higher engraftment rate (58.3%) than lung adenocarcinomas (ADC) (18.2%) (pTUG1. The tumor volume and weight were significantly reduced in the TUG1-silenced group as compared to the control group (p0.05). Expression of both TUG1and LCAL6 was reduced by siRNA treatment. Expression of Ki67 and HOXB7 was significantly suppressed in both the TUG1- and LCAL6-silenced groups compared to the control group (pTUG1-silenced group showed more reduced Ki67 expression than the LCAL6-silenced group (pTUG1 and LCAL6. Silencing of TUG1 inhibited both tumor growth and expression of the proliferation marker Ki67 and HOX-gene family HOXB7 in the PDX model of NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  13. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  14. Blocking c-myc and stat3 by E. coli expressed and enzyme digested siRNA in mouse melanoma

    International Nuclear Information System (INIS)

    Hong Jie; Zhao Yingchun; Huang Weida

    2006-01-01

    Tumour cells often show alteration in the signal-transduction pathways, leading to proliferation in response to external signals. Oncogene overexpression and constitutive expression is a common phenomenon in the development and progression of many human cancers. Therefore oncogenes provide potential targets for cancer therapy. RNA interference (RNAi), mediated by small interfering RNA (siRNA), silences genes with a high degree of specificity and potentially represents a general approach for molecularly targeted anti-cancer therapy. The data presented in this report evaluated the method of systemically administering combined esiRNAs to multiple targets as compared with the method of using a single kind of esiRNA to a single target. Our experimental data revealed that the mixed treatment of esiC-MYC and esiSTAT3 had a better inhibition effect than the single treatment of esiC-MYC or esiSTAT3 on mouse B16 melanoma

  15. The RNA helicase Rm62 cooperates with SU(VAR3-9 to re-silence active transcription in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Joern Boeke

    Full Text Available Gene expression is highly dynamic and many genes show a wide range in expression over several orders of magnitude. This regulation is often mediated by sequence specific transcription factors. In addition, the tight packaging of DNA into chromatin can provide an additional layer of control resulting in a dynamic range of gene expression covering several orders of magnitude. During transcriptional activation, chromatin barriers have to be eliminated to allow an efficient progression of the RNA polymerase. This repressive chromatin structure has to be re-established quickly after it has been activated in order to tightly regulate gene activity. We show that the DExD/H box containing RNA helicase Rm62 is targeted to a site of rapid induction of transcription where it is responsible for an increased degree of methylation at H3K9 at the heat shock locus after removal of the heat shock stimulus. The RNA helicase interacts with the well-characterized histone methyltransferase SU(VAR3-9 via its N-terminus, which provides a potential mechanism for the targeting of H3K9 methylation to highly regulated genes. The recruitment of SU(VAR3-9 through interaction with a RNA helicase to a site of active transcription might be a general mechanism that allows an efficient silencing of highly regulated genes thereby enabling a cell to fine tune its gene activity over a wide range.

  16. The cyclin-dependent kinase 8 module sterically blocks Mediator interactions with RNA polymerase II

    DEFF Research Database (Denmark)

    Elmlund, Hans; Baraznenok, Vera; Lindahl, Martin

    2006-01-01

    CDK8 (cyclin-dependent kinase 8), along with CycC, Med12, and Med13, form a repressive module (the Cdk8 module) that prevents RNA polymerase II (pol II) interactions with Mediator. Here, we report that the ability of the Cdk8 module to prevent pol II interactions is independent of the Cdk8......-dependent kinase activity. We use electron microscopy and single-particle reconstruction to demonstrate that the Cdk8 module forms a distinct structural entity that binds to the head and middle region of Mediator, thereby sterically blocking interactions with pol II....

  17. Silêncios Silences

    Directory of Open Access Journals (Sweden)

    Luciano Marcondes Godoy

    1999-01-01

    Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

  18. Overcoming cisplatin resistance in non-small cell lung cancer with Mad2 silencing siRNA delivered systemically using EGFR-targeted chitosan nanoparticles.

    Science.gov (United States)

    Nascimento, Ana Vanessa; Singh, Amit; Bousbaa, Hassan; Ferreira, Domingos; Sarmento, Bruno; Amiji, Mansoor M

    2017-01-01

    Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered. However, adverse side effects are usually increased as a consequence. A potentially effective approach is to combine chemotherapy with other therapeutic strategies such as small interfering RNAs (siRNAs) that allow the use of lower yet efficient doses of the anticancer drugs. We previously developed epidermal growth factor receptor (EGFR)-targeted chitosan (CS) nanoparticles as a versatile delivery system for silencing the essential mitotic checkpoint gene Mad2, and induce cell death. Here, we tested this system as a single therapy and in combination with cisplatin in cisplatin sensitive and resistant lung cancer models, and characterized its in vivo efficacy and safety. Combination treatment resulted in significant improvement in tumor inhibition that was strikingly more effective in cisplatin-resistant tumors. Importantly, effective cisplatin dosage was dramatically reduced in the co-therapy regimen resulting in negligible toxic effects from the drug as confirmed by parameters such as body weight gain, biochemical markers of hepatic and renal function, and histopathology of liver/kidney/spleen tissues. Overall, we demonstrate that the combination of Mad2 siRNA-loaded CS nanoparticles strategy with chemotherapeutic agents such as cisplatin constitutes an efficient and safe approach for the treatment of drug resistant tumors. Lung cancer remains one of the leading killers in the United States and around the world. Platinum agents, including cisplatin, are the first line treatment in lung cancer, including non-small cell lung cancer (NSCLC), which is the predominant form of lung cancer. In this study, we have evaluated Mad2 cell-cycle checkpoint gene silencing using small interfering RNA (siRNA) delivered

  19. Zinc Salts Block Hepatitis E Virus Replication by Inhibiting the Activity of Viral RNA-Dependent RNA Polymerase.

    Science.gov (United States)

    Kaushik, Nidhi; Subramani, Chandru; Anang, Saumya; Muthumohan, Rajagopalan; Shalimar; Nayak, Baibaswata; Ranjith-Kumar, C T; Surjit, Milan

    2017-11-01

    Hepatitis E virus (HEV) causes an acute, self-limiting hepatitis in healthy individuals and leads to chronic disease in immunocompromised individuals. HEV infection in pregnant women results in a more severe outcome, with the mortality rate going up to 30%. Though the virus usually causes sporadic infection, epidemics have been reported in developing and resource-starved countries. No specific antiviral exists against HEV. A combination of interferon and ribavirin therapy has been used to control the disease with some success. Zinc is an essential micronutrient that plays crucial roles in multiple cellular processes. Zinc salts are known to be effective in reducing infections caused by few viruses. Here, we investigated the effect of zinc salts on HEV replication. In a human hepatoma cell (Huh7) culture model, zinc salts inhibited the replication of genotype 1 (g-1) and g-3 HEV replicons and g-1 HEV infectious genomic RNA in a dose-dependent manner. Analysis of a replication-defective mutant of g-1 HEV genomic RNA under similar conditions ruled out the possibility of zinc salts acting on replication-independent processes. An ORF4-Huh7 cell line-based infection model of g-1 HEV further confirmed the above observations. Zinc salts did not show any effect on the entry of g-1 HEV into the host cell. Furthermore, our data reveal that zinc salts directly inhibit the activity of viral RNA-dependent RNA polymerase (RdRp), leading to inhibition of viral replication. Taken together, these studies unravel the ability of zinc salts in inhibiting HEV replication, suggesting their possible therapeutic value in controlling HEV infection. IMPORTANCE Hepatitis E virus (HEV) is a public health concern in resource-starved countries due to frequent outbreaks. It is also emerging as a health concern in developed countries owing to its ability to cause acute and chronic infection in organ transplant and immunocompromised individuals. Although antivirals such as ribavirin have been used

  20. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  1. SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

    Directory of Open Access Journals (Sweden)

    Fangfang Li

    2017-09-01

    Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

  2. Therapeutic Silencing of Bcl-2 by Systemically Administered siRNA Nanotherapeutics Inhibits Tumor Growth by Autophagy and Apoptosis and Enhances the Efficacy of Chemotherapy in Orthotopic Xenograft Models of ER (− and ER (+ Breast Cancer

    Directory of Open Access Journals (Sweden)

    Ibrahim Tekedereli

    2013-01-01

    Full Text Available Bcl-2 is overexpressed in about a half of human cancers and 50–70% of breast cancer patients, thereby conferring resistance to conventional therapies and making it an excellent therapeutic target. Small interfering RNA (siRNA offers novel and powerful tools for specific gene silencing and molecularly targeted therapy. Here, we show that therapeutic silencing of Bcl-2 by systemically administered nanoliposomal (NL-Bcl-2 siRNA (0.15 mg siRNA/kg, intravenous twice a week leads to significant antitumor activity and suppression of growth in both estrogen receptor-negative (ER(− MDA-MB-231 and ER-positive (+ MCF7 breast tumors in orthotopic xenograft models (P < 0.05. A single intravenous injection of NL-Bcl-2-siRNA provided robust and persistent silencing of the target gene expression in xenograft tumors. NL-Bcl-2-siRNA treatment significantly increased the efficacy of chemotherapy when combined with doxorubicin in both MDA-MB-231 and MCF-7 animal models (P < 0.05. NL-Bcl-2-siRNA treatment-induced apoptosis and autophagic cell death, and inhibited cyclin D1, HIF1α and Src/Fak signaling in tumors. In conclusion, our data provide the first evidence that in vivo therapeutic targeting Bcl-2 by systemically administered nanoliposomal-siRNA significantly inhibits growth of both ER(− and ER(+ breast tumors and enhances the efficacy of chemotherapy, suggesting that therapeutic silencing of Bcl-2 by siRNA is a viable approach in breast cancers.

  3. Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal domain for avirulence and RNA silencing suppression.

    Science.gov (United States)

    de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard

    2014-02-01

    Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  4. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    NARCIS (Netherlands)

    Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

  5. Crystallization and preliminary X-ray diffraction analysis of the CRISPR-Cas RNA-silencing Cmr complex.

    Science.gov (United States)

    Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki

    2015-06-01

    Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.

  6. Enhancement of Gene Silencing Effect and Membrane Permeability by Peptide-Conjugated 27-Nucleotide Small Interfering RNA

    Directory of Open Access Journals (Sweden)

    Toshio Seyama

    2012-09-01

    Full Text Available Two different sizes of siRNAs, of which one type was 21-nucleotide (nt siRNA containing 2-nt dangling ends and the other type was 27-nt siRNA with blunt ends, were conjugated with a nuclear export signal peptide of HIV-1 Rev at the 5′-sense end. Processing by Dicer enzyme, cell membrane permeability, and RNAi efficiency of the peptide-conjugated siRNAs were examined. Dicer cleaved the peptide-conjugated 27-nt siRNA leading to the release of 21-nt siRNA, whereas the peptide-conjugated 21-nt siRNA was not cleaved. High membrane permeability and cytoplasmic localization was found in the conjugates. Moreover, the peptide-conjugated 27-nt siRNA showed increased potency of RNAi in comparison with the nonmodified 21-nt and 27-nt siRNAs, whereas the peptide-conjugated 21-nt siRNA showed decreased RNAi efficacy. This potent RNAi efficacy is probably owing to acceleration of RISC through recognition by Dicer, as well as to the improvement of cell membrane permeability and intracellular accumulation.

  7. Posttranscriptional silencing of the lncRNA MALAT1 by miR-217 inhibits the epithelial–mesenchymal transition via enhancer of zeste homolog 2 in the malignant transformation of HBE cells induced by cigarette smoke extract

    International Nuclear Information System (INIS)

    Lu, Lu; Luo, Fei; Liu, Yi; Liu, Xinlu; Shi, Le; Lu, Xiaolin; Liu, Qizhan

    2015-01-01

    Lung cancer is regarded as the leading cause of cancer-related deaths, and cigarette smoking is one of the strongest risk factors for the development of lung cancer. However, the mechanisms for cigarette smoke-induced lung carcinogenesis remain unclear. The present study investigated the effects of an miRNA (miR-217) on levels of an lncRNA (MALAT1) and examined the role of these factors in the epithelial–mesenchymal transition (EMT) induced by cigarette smoke extract (CSE) in human bronchial epithelial (HBE) cells. In these cells, CSE caused decreases of miR-217 levels and increases in lncRNA MALAT1 levels. Over-expression of miR-217 with a mimic attenuated the CSE-induced increase of MALAT1 levels, and reduction of miR-217 levels by an inhibitor enhanced expression of MALAT1. Moreover, the CSE-induced increase of MALAT1 expression was blocked by an miR-217 mimic, indicating that miR-217 negatively regulates MALAT1 expression. Knockdown of MALAT1 reversed CSE-induced increases of EZH2 (enhancer of zeste homolog 2) and H3K27me3 levels. In addition to the alteration from epithelial to spindle-like mesenchymal morphology, chronic exposure of HBE cells to CSE increased the levels of EZH2, H3K27me3, vimentin, and N-cadherin and decreased E-cadherin levels, effects that were reversed by MALAT1 siRNA or EZH2 siRNA. The results indicate that miR-217 regulation of EZH2/H3K27me3 via MALAT1 is involved in CSE-induced EMT and malignant transformation of HBE cells. The posttranscriptional silencing of MALAT1 by miR-217 provides a link, through EZH2, between ncRNAs and the EMT and establishes a mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure decreases miR-217 levels and increases MALAT1 levels. • miR-217 negatively regulates MALAT1 expression. • MALAT1, via EZH2, is involved in the EMT of CSE-transformed HBE cells.

  8. Japanese encephalitis virus non-coding RNA inhibits activation of interferon by blocking nuclear translocation of interferon regulatory factor 3.

    Science.gov (United States)

    Chang, Ruey-Yi; Hsu, Ta-Wen; Chen, Yen-Lin; Liu, Shu-Fan; Tsai, Yi-Jer; Lin, Yun-Tong; Chen, Yi-Shiuan; Fan, Yi-Hsin

    2013-09-27

    Noncoding RNA (ncRNA) plays a critical role in modulating a broad range of diseases. All arthropod-borne flaviviruses produce short fragment ncRNA (sfRNA) collinear with highly conserved regions of the 3'-untranslated region (UTR) in the viral genome. We show that the molar ratio of sfRNA to genomic RNA in Japanese encephalitis virus (JEV) persistently infected cells is greater than that in acutely infected cells, indicating an sfRNA role in establishing persistent infection. Transfecting excess quantities of sfRNA into JEV-infected cells reduced interferon-β (IFN-β) promoter activity by 57% and IFN-β mRNA levels by 52%, compared to mock-transfected cells. Transfection of sfRNA into JEV-infected cells also reduced phosphorylation of interferon regulatory factor-3 (IRF-3), the IFN-β upstream regulator, and blocked roughly 30% of IRF-3 nuclear localization. Furthermore, JEV-infected sfRNA transfected cells produced 23% less IFN-β-stimulated apoptosis than mock-transfected groups did. Taken together, these results suggest that sfRNA plays a role against host-cell antiviral responses, prevents cells from undergoing apoptosis, and thus contributes to viral persistence. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Rare Coumarins Induce Apoptosis, G1 Cell Block and Reduce RNA Content in HL60 Cells

    Directory of Open Access Journals (Sweden)

    Widelski Jarosław

    2017-02-01

    Full Text Available The rare coumarins stenocarpin, stenocarpin isobutyrate, oficinalin, oficinalin isobutyrate, 8-methoxypeucedanin and the known xanthotoxin, isoimperatorin, bergapten, peucedanin and 8–methoxyisoimperatorin were isolated from Peucedanum luxurians Tamamsch. (Apiaceae and identified by means of spectral data (1D and 2D NMR. Their immunomodulating activity was evaluated by flow cytometry and their influence on HL60 cells as well as on PHA-stimulated PBLs was tested. All tested coumarins induce apoptosis (maximal in the 48 h culture and decrease cell proliferation in a time- and dose-dependent manner, especially in HL60 cells. They also induce partial G1 block, but only in HL60 cells (at 100 µM concentrations. Dose-dependent reduction of RNA content was also found in G1 cells treated by the coumarins. All of the tested coumarins also possessed immunomodulatory activities. Bergapten and xanthotoxin were found to be the best candidates for further evaluation as anti-cancer drugs.

  10. Long non-coding RNA TUG1 is up-regulated in hepatocellular carcinoma and promotes cell growth and apoptosis by epigenetically silencing of KLF2.

    Science.gov (United States)

    Huang, Ming-De; Chen, Wen-Ming; Qi, Fu-Zhen; Sun, Ming; Xu, Tong-Peng; Ma, Pei; Shu, Yong-Qian

    2015-09-04

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death worldwide, and the biology of this cancer remains poorly understood. Recent evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in a variety of cancers, including HCC. Taurine Up-regulated Gene 1 (TUG1), a 7.1-kb lncRNA, recruiting and binding to polycomb repressive complex 2 (PRC2), is found to be disregulated in non-small cell lung carcinoma (NSCLC) and esophageal squamous cell carcinoma (ESCC). However, its clinical significance and potential role in HCC remain unclear. In this study, expression of TUG1 was analyzed in 77 HCC tissues and matched normal tissues by using quantitative polymerase chain reaction (qPCR). TUG1 expression was up-regulated in HCC tissues and the higher expression of TUG1 was significantly correlated with tumor size and Barcelona Clinic Liver Cancer (BCLC) stage. Moreover, silencing of TUG1 expression inhibited HCC cell proliferation, colony formation, tumorigenicity and induced apoptosis in HCC cell lines. We also found that TUG1 overexpression was induced by nuclear transcription factor SP1 and TUG1 could epigeneticly repress Kruppel-like factor 2 (KLF2) transcription in HCC cells by binding with PRC2 and recruiting it to KLF2 promoter region. Our results suggest that lncRNA TUG1, as a growth regulator, may serve as a new diagnostic biomarker and therapy target for HCC.

  11. Performative Silences

    DEFF Research Database (Denmark)

    Dupret, Katia

    2018-01-01

    static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

  12. Xist RNA is confined to the nuclear territory of the silenced X chromosome throughout the cell cycle

    NARCIS (Netherlands)

    I.H. Jonkers (Iris); K. Monkhorst (Kim); E. Rentmeester (Eveline); J.A. Grootegoed (Anton); F.G. Grosveld (Frank); J.H. Gribnau (Joost)

    2008-01-01

    textabstractIn mammalian female cells, one X chromosome is inactivated to prevent a dose difference in the expression of X-encoded proteins between males and females. Xist RNA, required for X chromosome inactivation, is transcribed from the future inactivated X chromosome (Xi), where it spreads in

  13. A novel artificial microRNA expressing AAV vector for phospholamban silencing in cardiomyocytes improves Ca2+ uptake into the sarcoplasmic reticulum.

    Directory of Open Access Journals (Sweden)

    Tobias Gröβl

    Full Text Available In failing rat hearts, post-transcriptonal inhibition of phospholamban (PLB expression by AAV9 vector-mediated cardiac delivery of short hairpin RNAs directed against PLB (shPLBr improves both impaired SERCA2a controlled Ca2+ cycling and contractile dysfunction. Cardiac delivery of shPLB, however, was reported to cause cardiac toxicity in canines. Thus we developed a new AAV vector, scAAV6-amiR155-PLBr, expressing a novel engineered artificial microRNA (amiR155-PLBr directed against PLB under control of a heart-specific hybrid promoter. Its PLB silencing efficiency and safety were compared with those of an AAV vector expressing shPLBr (scAAV6-shPLBr from an ubiquitously active U6 promoter. Investigations were carried out in cultured neonatal rat cardiomyocytes (CM over a period of 14 days. Compared to shPLBr, amiR155-PLBr was expressed at a significantly lower level, resulting in delayed and less pronounced PLB silencing. Despite decreased knockdown efficiency of scAAV6-amiR155-PLBr, a similar increase of the SERCA2a-catalyzed Ca2+ uptake into sarcoplasmic reticulum (SR vesicles was observed for both the shPLBr and amiR155-PLBr vectors. Proteomic analysis confirmed PLB silencing of both therapeutic vectors and revealed that shPLBr, but not the amiR155-PLBr vector, increased the proinflammatory proteins STAT3, STAT1 and activated STAT1 phosphorylation at the key amino acid residue Tyr701. Quantitative RT-PCR analysis detected alterations in the expression of several cardiac microRNAs after treatment of CM with scAAV6-shPLBr and scAAV6-amiR155-PLBr, as well as after treatment with its related amiR155- and shRNAs-expressing control AAV vectors. The results demonstrate that scAAV6-amiR155-PLBr is capable of enhancing the Ca2+ transport function of the cardiac SR PLB/SERCA2a system as efficiently as scAAV6-shPLBr while offering a superior safety profile.

  14. Expression levels of the microRNA maturing microprocessor complex component DGCR8 and the RNA-induced silencing complex (RISC) components argonaute-1, argonaute-2, PACT, TARBP1, and TARBP2 in epithelial skin cancer.

    Science.gov (United States)

    Sand, Michael; Skrygan, Marina; Georgas, Dimitrios; Arenz, Christoph; Gambichler, Thilo; Sand, Daniel; Altmeyer, Peter; Bechara, Falk G

    2012-11-01

    The microprocessor complex mediates intranuclear biogenesis of precursor microRNAs from the primary microRNA transcript. Extranuclear, mature microRNAs are incorporated into the RNA-induced silencing complex (RISC) before interaction with complementary target mRNA leads to transcriptional repression or cleavage. In this study, we investigated the expression profiles of the microprocessor complex subunit DiGeorge syndrome critical region gene 8 (DGCR8) and the RISC components argonaute-1 (AGO1), argonaute-2 (AGO2), as well as double-stranded RNA-binding proteins PACT, TARBP1, and TARBP2 in epithelial skin cancer and its premalignant stage. Patients with premalignant actinic keratoses (AK, n = 6), basal cell carcinomas (BCC, n = 15), and squamous cell carcinomas (SCC, n = 7) were included in the study. Punch biopsies were harvested from the center of the tumors (lesional), from healthy skin sites (intraindividual controls), and from healthy skin sites in a healthy control group (n = 16; interindividual control). The DGCR8, AGO1, AGO2, PACT, TARBP1, and TARBP2 mRNA expression levels were detected by quantitative real-time reverse transcriptase polymerase chain reaction. The DGCR8, AGO1, AGO2, PACT, and TARBP1 expression levels were significantly higher in the AK, BCC, and SCC groups than the healthy controls (P  0.05). This study indicates that major components of the miRNA pathway, such as the microprocessor complex and RISC, are dysregulated in epithelial skin cancer. Copyright © 2011 Wiley Periodicals, Inc.

  15. Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis

    International Nuclear Information System (INIS)

    Di Fulvio, Mauricio; Henkels, Karen M.; Gomez-Cambronero, Julian

    2007-01-01

    Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7 shGrb2 ), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7 shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation

  16. dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid.

    Science.gov (United States)

    Lau, Su-Ee; Schwarzacher, Trude; Othman, Rofina Yasmin; Harikrishna, Jennifer Ann

    2015-08-11

    The R2R3-MYB genes regulate pigmentation and morphogenesis of flowers, including flower and cell shape, and therefore have importance in the development of new varieties of orchids. However, new variety development is limited by the long breeding time required in orchids. In this study, we identified a cDNA, DhMYB1, that is expressed during flower development in a hybrid orchid, Dendrobium hybrida (Dendrobium bobby messina X Dendrobium chao phraya) then used the direct application of dsRNA to observe the effect of gene silencing on flower phenotype and floral epidermal cell shape. Flower bud development in the Dendrobium hybrid was characterised into seven stages and the time of meiosis was determined as between stages 3 to 5 when the bud is approximately half of the mature size. Scanning electron microscopy characterisation of adaxial epidermal cells of the flower perianth, showed that the petals and sepals each are divided into two distinct domains based on cell shape and size, while the labellum comprises seven domains. Thirty-two partial cDNA fragments representing R2R3-MYB gene sequences were isolated from D. hybrida. Phylogenetic analysis revealed that nine of the translated sequences were clustered with MYB sequences that are known to be involved in cell shape development and from these, DhMYB1 was selected for full length cDNA cloning and functional study. Direct application of a 430 bp dsRNA from the 3' region of DhMYB1 to emerging orchid flower buds reduced expression of DhMYB1 RNA compared with untreated control. Scanning electron microscopy of adaxial epidermal cells within domain one of the labellum of flowers treated with DhMYB1 dsRNA showed flattened epidermal cells whilst those of control flowers were conical. DhMYB1 is expressed throughout flower bud development and is involved in the development of the conical cell shape of the epidermal cells of the Dendrobium hybrida flower labellum. The direct application of dsRNA changed the phenotype of

  17. Long noncoding RNA TUG1 is a diagnostic factor in lung adenocarcinoma and suppresses apoptosis via epigenetic silencing of BAX.

    Science.gov (United States)

    Liu, Huan; Zhou, Guizhi; Fu, Xin; Cui, Haiyan; Pu, Guangrui; Xiao, Yao; Sun, Wei; Dong, Xinhua; Zhang, Libin; Cao, Sijia; Li, Guiqin; Wu, Xiaowei; Yang, Xu

    2017-11-24

    Lung cancer is one of the leading causes of cancer-related mortality, and responds badly to existing treatment. Thus, it is of urgent need to identify novel diagnostic markers and therapeutic targets. Increasing evidences have indicated that long non-coding RNAs (lncRNAs) play an important role in initiation and progression of lung cancer. However, the role of lncRNA Taurine upregulated 1 (TUG1) in lung adenocarcinoma (LAD) progression is not well known. In this study, we determined the diagnostic value of TUG1 in LAD patients, and further uncovered the underlying functional mechanism. Our results showed that TUG1 was significantly upregulated in LAD cells and serum samples. Receiver operator characteristic (ROC) analysis suggested a relatively higher area under the curve (AUC) of TUG1 (0.756) contrast to cyfra21-1 (0.619). In addition, high TUG1 level was associated with enhanced tumor size, degree of differentiation, lymph node metastases, distant metastasis and TNM stage. Cell functional assays showed that knockdown of TUG1 suppressed LAD cell viability and promoted cell apoptosis. We then sought to reveal the underlying regulatory mechanism, and the pro-apoptotic protein BAX was then identified as the downstream target of TUG1. Gain and loss functional assays showed that inhibition of BAX reversed the induced apoptosis by TUG1 knockdown. Finally, RNA immunoprecipitation and Chromatin immunoprecipitation revealed that TUG1 suppressed BAX expression through physically interacting with EZH2. In conclusion, lncRNA TUG1 is a promising diagnostic marker for LAD patients and suppression of TUG1 levels could be a future direction to promote the prognosis of LAD patients.

  18. A comparison of CRISPR/Cas9 and siRNA-mediated ALDH2 gene silencing in human cell lines.

    Science.gov (United States)

    Wang, Fei; Guo, Tao; Jiang, Hongmei; Li, Ruobi; Wang, Ting; Zeng, Ni; Dong, Guanghui; Zeng, Xiaowen; Li, Daochuan; Xiao, Yongmei; Hu, Qiansheng; Chen, Wen; Xing, Xiumei; Wang, Qing

    2018-06-01

    Gene knockdown and knockout using RNAi and CRISPR/Cas9 allow for efficient evaluation of gene function, but it is unclear how the choice of technology can influence the results. To compare the phenotypes obtained using siRNA and CRISPR/Cas9 technologies, aldehyde dehydrogenase 2 (ALDH2) was selected as an example. In this study, we constructed one HepG2 cell line with a homozygous mutation in the fifth exon of ALDH2 (ALDH2-KO1 cell) using the eukaryotic CRISPR/Cas9 expression system followed by the limited dilution method and one HepG2 cell line with different mutations in the ALDH2 gene (ALDH2-KO2 cell) using the lentivirus CRISPR/Cas9 system. Additionally, one ALDH2-knockdown (KD) HepG2 cell line was created using siRNA. The reproducibility of these methods was further verified in the HEK293FT cell line. We found that the mRNA expression level of ALDH2 was significantly decreased and the protein expression level of ALDH2 was completely abolished in the ALDH2-KO cell lines, but not in ALDH2-KD cells. Furthermore, the functional activity of ALDH2 was also markedly disrupted in the two ALDH2-KO cell lines compared with ALDH2-KD and wild-type cells. The lack of ALDH2 expression mediated by CRIPSR/Cas9 resulted in a more dramatic increase in the cellular susceptibility to chemical-induced reactive oxygen species generation, cytotoxicity, apoptosis, and inflammation, especially at low concentrations compared with ALDH2-KD and WT cells. Therefore, we consider the gene knockout cell line created by CRISPR/Cas9 to be a more useful tool for identifying the function of a gene.

  19. Long noncoding RNA TUG1 is a diagnostic factor in lung adenocarcinoma and suppresses apoptosis via epigenetic silencing of BAX

    OpenAIRE

    Liu, Huan; Zhou, Guizhi; Fu, Xin; Cui, Haiyan; Pu, Guangrui; Xiao, Yao; Sun, Wei; Dong, Xinhua; Zhang, Libin; Cao, Sijia; Li, Guiqin; Wu, Xiaowei; Yang, Xu

    2017-01-01

    Lung cancer is one of the leading causes of cancer-related mortality, and responds badly to existing treatment. Thus, it is of urgent need to identify novel diagnostic markers and therapeutic targets. Increasing evidences have indicated that long non-coding RNAs (lncRNAs) play an important role in initiation and progression of lung cancer. However, the role of lncRNA Taurine upregulated 1 (TUG1) in lung adenocarcinoma (LAD) progression is not well known. In this study, we determined the diagn...

  20. miRNA-431 Prevents Amyloid-β-Induced Synapse Loss in Neuronal Cell Culture Model of Alzheimer's Disease by Silencing Kremen1.

    Science.gov (United States)

    Ross, Sean P; Baker, Kelly E; Fisher, Amanda; Hoff, Lee; Pak, Elena S; Murashov, Alexander K

    2018-01-01

    Synapse loss is well regarded as the underlying cause for the progressive decline of memory function over the course of Alzheimer's disease (AD) development. Recent observations suggest that the accumulation of the Wnt antagonist Dickkopf-1 (Dkk1) in the AD brain plays a critical role in triggering synaptic degeneration. Mechanistically, Dkk1 cooperates with Kremen1 (Krm1), its transmembrane receptor, to block the Wnt/β-catenin signaling pathway. Here, we show that silencing Krm1 with miR-431 prevents amyloid-β-mediated synapse loss in cortico-hippocampal cultures isolated from triple transgenic 3xTg-AD mice. Exposure to AβDDL (an amyloid-β derived diffusive ligand) or Dkk1 reduced the number of pre- and post-synaptic puncta in primary neuronal cultures, while treatment with miR-431 prevented synapse loss. In addition, treatment with miR-431 also prevented neurite degeneration. Our findings demonstrate that miR-431 protects synapses and neurites from Aβ-toxicity in an AD cell culture model and may be a promising therapeutic target.

  1. Nanoparticles containing siRNA to silence CD4 and CCR5 reduce expression of these receptors and inhibit HIV-1 infection in human female reproductive tract tissue explants

    Directory of Open Access Journals (Sweden)

    Susan K. Eszterhas

    2011-09-01

    Full Text Available Human Immunodeficiency Virus-type 1 (HIV- 1 binds to CD4 and CCR5 receptors on target cells in the human female reproductive tract. We sought to determine whether reducing levels of messenger RNA (mRNA transcripts that encode these receptors in female reproductive tract cells could protect mucosal tissue explants from HIV- 1 infection. Explants prepared from the endometrium, endocervix, and ectocervix of hysterectomy tissues from HIV-1 sero-negative women were exposed to nanoparticles containing CD4- and CCR5-specific short-interfering RNA (siRNA sequences. Explants were then exposed two days later to HIV-1, and HIV-1 reverse transcripts were measured five days post-infection. Explants treated with nanoparticles containing CD4- and CCR5-specific siRNA showed reduced levels of CD4 and CCR5 transcripts, and significantly lower levels of HIV-1 reverse transcripts compared to those treated with an irrelevant siRNA. In female reproductive tract explants and in peripheral blood cell cultures, siRNA transfection induced the secretion of IFN-alpha (IFN-α, a potent antiviral cytokine. In female mice, murine-specific Cd4-siRNA nanoparticles instilled within the uterus significantly reduced murine Cd4 transcripts by day 3. Our findings demonstrate that siRNA nanoparticles reduce expression of HIV-1 infectivity receptors in human female reproductive tract tissues and also inhibit HIV-1 infection. Murine studies demonstrate that nanoparticles can penetrate the reproductive tract tissues in vivo and silence gene expression. The induction of IFN-α after siRNA transfection can potentially contribute to the antiviral effect. These findings support the therapeutic development of nanoparticles to deliver siRNA molecules to silence host cell receptors in the female reproductive tract as a novel microbicide to inhibit mucosal HIV-1 transmission.

  2. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage

    Directory of Open Access Journals (Sweden)

    María José Benítez-Galeano

    2015-07-01

    Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.

  3. AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals.

    Science.gov (United States)

    Fagard, M; Boutet, S; Morel, J B; Bellini, C; Vaucheret, H

    2000-10-10

    Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants.

  4. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Directory of Open Access Journals (Sweden)

    Yao Han

    Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

  5. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Science.gov (United States)

    Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

    2015-01-01

    MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

  6. Regulation of epithelial differentiation in rat intestine by intraluminal delivery of an adenoviral vector or silencing RNA coding for Schlafen 3.

    Directory of Open Access Journals (Sweden)

    Pavlo L Kovalenko

    Full Text Available Although we stimulate enterocytic proliferation to ameliorate short gut syndrome or mucosal atrophy, less effort has been directed at enterocytic differentiation. Schlafen 3 (Slfn3 is a poorly understood protein induced during IEC-6 enterocytic differentiation. We hypothesized that exogenous manipulation of Slfn3 would regulate enterocytic differentiation in vivo. Adenoviral vector coding for Slfn3 cDNA (Ad-GFP-Slfn3 or silencing RNA for Slfn3 (siSlfn3 was introduced intraluminally into rat intestine. We assessed Slfn3, villin, sucrase-isomaltase (SI, Dpp4, and Glut2 by qRT-PCR, Western blot, and immunohistochemistry. We also studied Slfn3 and these differentiation markers in atrophic defunctionalized jejunal mucosa and the crypt-villus axis of normal jejunum. Ad-GFP-Slfn3 but not Ad-GFP increased Slfn3, villin and Dpp4 expression in human Caco-2 intestinal epithelial cells. Injecting Ad-GFP-Slfn3 into rat jejunum in vivo increased mucosal Slfn3 mRNA three days later vs. intraluminal Ad-GFP. This Slfn3 overexpression was associated with increases in all four differentiation markers. Injecting siSlfn3 into rat jejunum in vivo substantially reduced Slfn3 and all four intestinal mucosal differentiation markers three days later, as well as Dpp4 specific activity. Endogenous Slfn3 was reduced in atrophic mucosa from a blind-end Roux-en-Y anastomosis in parallel with differentiation marker expression together with AKT and p38 signaling. Slfn3 was more highly expressed in the villi than the crypts, paralleling Glut2, SI and Dpp4. Slfn3 is a key intracellular regulator of rat enterocytic differentiation. Understanding how Slfn3 works may identify targets to promote enterocytic differentiation and maintain mucosal function in vivo, facilitating enteral nutrition and improving survival in patients with mucosal atrophy or short gut syndrome.

  7. Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways.

    Directory of Open Access Journals (Sweden)

    Stephanie M Rainey

    2016-04-01

    Full Text Available The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection, and is being introduced into mosquito populations in the wild to block the transmission of arboviruses that infect humans and are a major public health concern. To investigate the mechanisms underlying this antiviral protection, we have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture with the model mosquito-borne Semliki Forest virus (SFV; Togaviridae, Alphavirus. Wolbachia provides strong antiviral protection rapidly after infection, suggesting that an early stage post-infection is being blocked. Wolbachia does appear to have major effects on events distinct from entry, assembly or exit as it inhibits the replication of an SFV replicon transfected into the cells. Furthermore, it causes a far greater reduction in the expression of proteins from the 3' open reading frame than the 5' non-structural protein open reading frame, indicating that it is blocking the replication of viral RNA. Further to this separation of the replicase proteins and viral RNA in transreplication assays shows that uncoupling of viral RNA and replicase proteins does not overcome Wolbachia's antiviral activity. This further suggests that replicative processes are disrupted, such as translation or replication, by Wolbachia infection. This may occur by Wolbachia mounting an active antiviral response, but the virus did not cause any transcriptional response by the bacterium, suggesting that this is not the case. Host microRNAs (miRNAs have been implicated in protection, but again we found that host cell miRNA expression was unaffected by the bacterium and neither do our findings suggest any involvement of the antiviral siRNA pathway. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed to

  8. The silence.

    Science.gov (United States)

    Millenson, Michael L

    2003-01-01

    Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

  9. Epigenetic silencing of MicroRNA-503 regulates FANCA expression in non-small cell lung cancer cell.

    Science.gov (United States)

    Li, Ning; Zhang, Fangfang; Li, Suyun; Zhou, Suzhen

    2014-02-21

    It is reported that MicroRNA-503 (miR-503) regulates cell apoptosis, and thus modulates the resistance of non-small cell lung cancer cells (NSCLC) to cisplatin. However, the exact role of miR-503 in NSCLC remains unknown. In the present study, the level of miR-503 expression in NSCLC was evaluated using realtime PCR, and the DNA methylation status within miR-503 promoter was analyzed by Combined Bisulfite Restriction Analysis (COBRA) or bisulfite-treated DNA sequencing assays (BSP). We found that the expression of miR-503 was significantly decreased in NSCLC tissues compared to normal tissues. A statistically significant inverse association was found between miR-503 methylation status and expression of the miR-503 in tumor tissues (PFANCA) gene and represses its expression at the transcriptional level. Taken together, our results suggest that miR-503 regulates the resistance of non-small cell lung cancer cells to cisplatin at least in part by targeting FANCA. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. The Heterologous Expression of the p22 RNA Silencing Suppressor of the Crinivirus Tomato Chlorosis Virus from Tobacco Rattle Virus and Potato Virus X Enhances Disease Severity but Does Not Complement Suppressor-Defective Mutant Viruses.

    Science.gov (United States)

    Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen

    2017-11-24

    To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.

  11. Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach.

    Science.gov (United States)

    Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah; Tejlmann, Sarah; Falkenberg, Emily; Van Driessche, Elize; Mørck Nielsen, Hanne; Franzyk, Henrik; Foged, Camilla

    2017-11-01

    Safety and efficacy of therapeutics based on RNA interference, e.g., small interfering RNA (siRNA), are dependent on the optimal engineering of the delivery technology, which is used for intracellular delivery of siRNA to the cytosol of target cells. We investigated the hypothesis that commonly used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties (hydrodynamic size, zeta potential, siRNA encapsulation/loading) and the biological performance (in vitro gene silencing and cell viability). Model fitting of the obtained data to construct predictive models revealed non-linear relationships for all CQAs, which can be readily overlooked in one-factor-at-a-time optimization approaches. The response surface methodology further enabled the identification of an OOS that met the desired quality target product profile. The optimized lipidoid-modified LPNs revealed more than 50-fold higher in vitro gene silencing at well-tolerated doses and approx. a twofold increase in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly

  12. Understanding the sequence preference of recurrent RNA building blocks using quantum chemistry: The intrastrand RNA dinucleotide platform

    Czech Academy of Sciences Publication Activity Database

    Mládek, Arnošt; Šponer, Judit E.; Kulhánek, P.; Lu, X.-J.; Olson, W.K.; Šponer, Jiří

    2012-01-01

    Roč. 8, č. 1 (2012), s. 335-347 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GAP208/10/2302; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA ČR(CZ) GD203/09/H046 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : RNA dinucleotide platform * quantum-chemical calculation Subject RIV: BO - Biophysics Impact factor: 5.389, year: 2012

  13. New Kids on the Block: RNA-Based Influenza Virus Vaccines.

    Science.gov (United States)

    Scorza, Francesco Berlanda; Pardi, Norbert

    2018-04-01

    RNA-based immunization strategies have emerged as promising alternatives to conventional vaccine approaches. A substantial body of published work demonstrates that RNA vaccines can elicit potent, protective immune responses against various pathogens. Consonant with its huge impact on public health, influenza virus is one of the best studied targets of RNA vaccine research. Currently licensed influenza vaccines show variable levels of protection against seasonal influenza virus strains but are inadequate against drifted and pandemic viruses. In recent years, several types of RNA vaccines demonstrated efficacy against influenza virus infections in preclinical models. Additionally, comparative studies demonstrated the superiority of some RNA vaccines over the currently used inactivated influenza virus vaccines in animal models. Based on these promising preclinical results, clinical trials have been initiated and should provide valuable information about the translatability of the impressive preclinical data to humans. This review briefly describes RNA-based vaccination strategies, summarizes published preclinical and clinical data, highlights the roadblocks that need to be overcome for clinical applications, discusses the landscape of industrial development, and shares the authors' personal perspectives about the future of RNA-based influenza virus vaccines.

  14. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

    Science.gov (United States)

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

    2015-05-26

    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Specific degradation of 3[prime prime or minute] regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5[prime prime or minute]-3[prime prime or minute] spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, T.H.; Moury, B.; Johannessen, M.M.

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  16. An RNA-binding compound that stabilizes the HIV-1 gRNA packaging signal structure and specifically blocks HIV-1 RNA encapsidation.

    Science.gov (United States)

    Ingemarsdotter, Carin K; Zeng, Jingwei; Long, Ziqi; Lever, Andrew M L; Kenyon, Julia C

    2018-03-14

    NSC260594, a quinolinium derivative from the NCI diversity set II compound library, was previously identified in a target-based assay as an inhibitor of the interaction between the HIV-1 (ψ) stem-loop 3 (SL3) RNA and Gag. This compound was shown to exhibit potent antiviral activity. Here, the effects of this compound on individual stages of the viral lifecycle were examined by qRT-PCR, ELISA and Western blot, to see if its actions were specific to the viral packaging stage. The structural effects of NSC260594 binding to the HIV-1 gRNA were also examined by SHAPE and dimerization assays. Treatment of cells with NSC260594 did not reduce the number of integration events of incoming virus, and treatment of virus producing cells did not affect the level of intracellular Gag protein or viral particle release as determined by immunoblot. However, NSC260594 reduced the incorporation of gRNA into virions by up to 82%, without affecting levels of gRNA inside the cell. This reduction in packaging correlated closely with the reduction in infectivity of the released viral particles. To establish the structural effects of NSC260594 on the HIV-1 gRNA, we performed SHAPE analyses to pinpoint RNA structural changes. NSC260594 had a stabilizing effect on the wild type RNA that was not confined to SL3, but that was propagated across the structure. A packaging mutant lacking SL3 did not show this effect. NSC260594 acts as a specific inhibitor of HIV-1 RNA packaging. No other viral functions are affected. Its action involves preventing the interaction of Gag with SL3 by stabilizing this small RNA stem-loop which then leads to stabilization of the global packaging signal region (psi or ψ). This confirms data, previously only shown in analyses of isolated SL3 oligonucleotides, that SL3 is structurally labile in the presence of Gag and that this is critical for the complete psi region to be able to adopt different conformations. Since replication is otherwise unaffected by NSC260594

  17. Datasets for the validation of the "in vivo" siRNA-silencing of CD40 and for the detection of new markers of atherosclerosis progression in ApoE-deficient mice

    Directory of Open Access Journals (Sweden)

    Miguel Hueso

    2016-12-01

    Full Text Available Data presented in this Data in Brief article correspond to the article "in vivo" silencing of CD40 reduces progression of experimental atherogenesis through a NFκB/miR-125b axis and reveals new potential mediators in the pathogenesis of atherosclerosis" (M. Hueso, L. De Ramon, E. Navarro, E. Ripoll, J.M. Cruzado, J.M. Grinyo, J. Torras, 2016 [1]. Here, we describe the validation of the silencing of CD40 expression with a specific siRNA in ApoE−/− mouse aortas, and its systemic effects on splenic lymphocytic subpopulations as well as on the infiltration of aortic intima by F4/80+, galectin-3+ macrophages or by NF-κB+ cells. We also show the output of a Gene Ontology and TLDA analysis which allowed the detection of potential mediators of atherosclerosis progression. We provide the scientific community with a set of genes whose expression is increased during atherosclerosis progression but downregulated upon CD40 silencing.

  18. Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach

    DEFF Research Database (Denmark)

    Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah

    2017-01-01

    used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex...... formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS......), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties...

  19. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    . Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

  20. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

    Science.gov (United States)

    Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

  1. Two classes of silencing RNAs move between C. elegans tissues

    Science.gov (United States)

    Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

    2011-01-01

    Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

  2. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    OpenAIRE

    Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

  3. Knockdown of Rice microRNA166 by Short Tandem Target Mimic (STTM).

    Science.gov (United States)

    Teotia, Sachin; Zhang, Dabing; Tang, Guiliang

    2017-01-01

    Small RNAs, including microRNAs (miRNAs), are abundant in plants and play key roles in controlling plant development and physiology. miRNAs regulate the expression of the target genes involved in key plant processes. Due to functional redundancy among miRNA family members in plants, an ideal approach to silence the expression of all members simultaneously, for their functional characterization, is desirable. Target mimic (TM) was the first approach to achieve this goal. Short tandem target mimic (STTM) is a potent approach complementing TM for silencing miRNAs in plants. STTMs have been successfully used in dicots to block miRNA functions. Here, we describe in detail the protocol for designing STTM construct to block miRNA functions in rice. Such approach can be applied to silence miRNAs in other monocots as well.

  4. LncRNA SNHG6 is Associated with Poor Prognosis of Gastric Cancer and Promotes Cell Proliferation and EMT through Epigenetically Silencing p27 and Sponging miR-101-3p

    Directory of Open Access Journals (Sweden)

    Kai Yan

    2017-06-01

    Full Text Available Background/Amis: Long non-coding RNAs (lncRNAs, a novel class of transcripts, have been shown to play critical roles in diverse cellular biological processes, including tumorigenesis. Small nucleolar RNA host gene 6 (SNHG6 regulates various biological processes in cancer cells. However, the biological role of SNHG6 in gastric cancer still remains to be explored. The aim of this study is to investigate the characteristic of the SNHG6 in gastric cancer. Methods: Quantitative real-time polymerase chain reaction (qRT-PCR was used to measure the expression of SNHG6 in gastric cancer tissues and cell lines. MTT assays, colony formation assays were used to determine the impact of SNHG6 on tumorigenesis . Flow cytometric analysis of cell cycle and apoptosis was performed to measure the effect of SNHG6 on cell cycle and apoptosis rate. Transwell assay was performed to measure the effect of SNHG6 on cell migration. Western blotting and immunofuorescence were utilized to examine the effect of SNHG6 on epithelial-mesenchymal transition (EMT of GC cells. Chromatin immunoprecipitation (ChIP, RNA immunoprecipitation (RIP, RNA-pulldown and luciferase reporter assays were employed to dissect molecular mechanisms. Results: In this study, we revealed that SNHG6 was overexpressed in gastric cancer tissues and cell lines. High expression levels of SNHG6 wereassociated with invasion depth, lymph node metastasis, distant metastasis and tumor/node/metastasis (TNM stage, and predicted poor prognosis. Loss-of-function assays revealed that silenced SNHG6 obviously inhibited gastric cancer cell growth, weakened cell migration capacity and suppressed the EMT processes of gastric cancer cells. Additionally, ChIP, RIP, RNA-pulldown and luciferase reporter assays evidenced that SNHG6 could epigenetically silenced p27 and could competitively sponging miR-101-3p thereby regulating zinc finger E-box-binding homeobox 1 (ZEB1. Conclusion: In summary, our findings demonstrated that

  5. An Epstein-Barr Virus MicroRNA Blocks Interleukin-1 (IL-1) Signaling by Targeting IL-1 Receptor 1.

    Science.gov (United States)

    Skinner, Camille M; Ivanov, Nikita S; Barr, Sarah A; Chen, Yan; Skalsky, Rebecca L

    2017-11-01

    Epstein-Barr virus (EBV) encodes >44 viral microRNAs (miRNAs) that are differentially expressed throughout infection, can be detected in Epstein-Barr virus (EBV)-positive tumors, and manipulate several biological processes, including cell proliferation, apoptosis, and immune responses. Here, we show that EBV BHRF1-2 miRNAs block NF-κB activation following treatment with proinflammatory cytokines, specifically interleukin-1β (IL-1β). Analysis of EBV PAR-CLIP miRNA targetome data sets combined with pathway analysis revealed multiple BHRF1-2 miRNA targets involved in interleukin signaling pathways. By further analyzing changes in cellular gene expression patterns, we identified the IL-1 receptor 1 (IL1R1) as a direct target of miR-BHRF1-2-5p. Targeting the IL1R1 3' untranslated region (UTR) by EBV miR-BHRF1-2-5p was confirmed using 3'-UTR luciferase reporter assays and Western blot assays. Manipulation of EBV BHRF1-2 miRNA activity in latently infected B cells altered steady-state cytokine levels and disrupted IL-1β responsiveness. These studies demonstrate functionally relevant BHRF1-2 miRNA interactions during EBV infection, which is an important step in understanding their roles in pathogenesis. IMPORTANCE IL-1 signaling plays an important role in inflammation and early activation of host innate immune responses following virus infection. Here, we demonstrate that a viral miRNA downregulates the IL-1 receptor 1 during EBV infection, which consequently alters the responsiveness of cells to IL-1 stimuli and changes the cytokine expression levels within infected cell populations. We postulate that this viral miRNA activity not only disrupts IL-1 autocrine and paracrine signaling loops that can alert effector cells to sites of infection but also provides a survival advantage by dampening excessive inflammation that may be detrimental to the infected cell. Copyright © 2017 American Society for Microbiology.

  6. The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation.

    Science.gov (United States)

    Baumberger, Nicolas; Tsai, Ching-Hsui; Lie, Miranda; Havecker, Ericka; Baulcombe, David C

    2007-09-18

    Plant and animal viruses encode suppressor proteins of an adaptive immunity mechanism in which viral double-stranded RNA is processed into 21-25 nt short interfering (si)RNAs. The siRNAs guide ARGONAUTE (AGO) proteins so that they target viral RNA. Most viral suppressors bind long dsRNA or siRNAs and thereby prevent production of siRNA or binding of siRNA to AGO. The one exception is the 2b suppressor of Cucumoviruses that binds to and inhibits AGO1. Here we describe a novel suppressor mechanism in which a Polerovirus-encoded F box protein (P0) targets the PAZ motif and its adjacent upstream sequence in AGO1 and mediates its degradation. F box proteins are components of E3 ubiquitin ligase complexes that add polyubiquitin tracts on selected lysine residues and thereby mark a protein for proteasome-mediated degradation. With P0, however, the targeted degradation of AGO is insensitive to inhibition of the proteasome, indicating that the proteasome is not involved. We also show that P0 does not block a mobile signal of silencing, indicating that the signal molecule does not have AGO protein components. The ability of P0 to block silencing without affecting signal movement may contribute to the phloem restriction of viruses in the Polerovirus group.

  7. Inhibition of the 26S proteasome blocks progesterone receptor-dependent transcription through failed recruitment of RNA polymerase II.

    Science.gov (United States)

    Dennis, Andrew P; Lonard, David M; Nawaz, Zafar; O'Malley, Bert W

    2005-03-01

    In the present study, we investigated the involvement of protein degradation via the 26S proteasome during progesterone receptor (PR)-mediated transcription in T-47D cells containing a stably integrated MMTV-CAT reporter construct (CAT0 cells). Progesterone induced CAT and HSD11beta2 transcription while co-treatment with the proteasome inhibitor, MG132, blocked PR-induced transcription in a time-dependent fashion. MG132 treatment also inhibited transcription of beta-actin and cyclophilin, but not two proteasome subunit genes, PSMA1 and PSMC1, indicating that proteasome inhibition affects a subset of RNA polymerase II (RNAP(II))-regulated genes. Progesterone-mediated recruitment of RNAP(II) was blocked by MG132 treatment at time points later than 1 h that was not dependent on the continued presence of PR, associated cofactors, and components of the general transcription machinery, supporting the concept that proteasome-mediated degradation is needed for continued transcription. Surprisingly, progesterone-mediated acetylation of histone H4 was inhibited by MG132 with the concomitant recruitment of HDAC3, NCoR, and SMRT. We demonstrate that the steady-state protein levels of SMRT and NCoR are higher in the presence of MG132 in CAT0 cells, consistent with other reports that SMRT and NCoR are targets of the 26S proteasome. However, inhibition of histone deacetylation by trichostatin A (TSA) treatment or SMRT/NCoR knockdown by siRNA did not restore MG132-inhibited progesterone-dependent transcription. Therefore, events other than histone deacetylation and stability of SMRT and NCoR must also play a role in inhibition of PR-mediated transcription.

  8. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  9. Synthesis of 4'-Selenoribonucleosides, the Building Blocks of 4'-SelenoRNA, Using a Hypervalent Iodine.

    Science.gov (United States)

    Saito-Tarashima, Noriko; Ota, Masashi; Minakawa, Noriaki

    2017-09-18

    Herein is described a detailed protocol for the synthesis of 4'-selenoribonucleoside derivatives that involves the use of a hypervalent iodine species. These derivatives are versatile units for the preparation of 4'-selenoRNA. Large-scale synthesis of a 4-selenosugar starting from D-ribose is achieved in eight steps, including a final chromatographic purification. The resulting 4-selenosugar is then subjected to the one-pot Pummerer-like reaction using hypervalent iodine in the presence of silylated nucleobases. The reaction with silylated uracil affords the desired 4'-selenouridine derivatives with excellent β-selectivity and in good yield. Conversely, when purine nucleobases are used in the Pummerer-like reaction, N7 4'-selenoribonucleoside isomers are obtained alongside the desired N9 isomers. However, the undesired N7 isomers can be converted to the desired N9 ones under acidic conditions. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  10. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  11. Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

    Science.gov (United States)

    Kim, K H; Hemenway, C

    1997-05-26

    The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

  12. Effective RNA-silencing strategy of Lv-MSTN/GDF11 gene and its effects on the growth in shrimp, Litopenaeus vannamei.

    Science.gov (United States)

    Lee, Ji-Hyun; Momani, Jalal; Kim, Young Mog; Kang, Chang-Keun; Choi, Jung-Hwa; Baek, Hae-Ja; Kim, Hyun-Woo

    2015-01-01

    Myostatin (MSTN), also known as GDF8, is a member of the transforming growth factor-β (TGF-β) superfamily and plays an important role in muscle growth, development, and differentiation. Recently, Lv-MSTN/GDF11, the primitive isoform of MSTN and GDF11, was identified from the shrimp Litopenaeus vannamei. The major production site for Lv-MSTN/GDF11 is in the heart, not the tail muscle, which differs from MSTNs in mammals. Among the three injected RNAs, long dsRNA was the most effective for Lv-MSTN/GDF11 knockdown and transcripts of Lv-MSTN/GDF11 decreased in both the heart (88.85%) and skeletal muscles (43.36%) 72h after injection of 10pmol of long dsRNA. We also found that higher doses of dsRNA did not lead to greater decreases in Lv-MSTN/GDF11 transcripts for amounts between 1pmol and 100pmol. Injection of Lv-MSTN/GDF11 dsRNA did not affect the upregulation of the skeletal actin gene (Lv-ACTINSK) in the tail muscle, but the expression of cytoplasmic and cardiac actins were upregulated in both the heart and tail muscle. Over the course of 8weeks of dsRNA injection, considerably higher mortality (~71%) was seen in the dsRNA-injected group compared to the control group (40%). Surviving shrimp in the dsRNA injected group had a lower growth rate due to the adverse effects of Lv-MSTN/GDF11 knockdown. Lv-MSTN/GDF11 appears to be involved in muscular or neuronal development, but not in doubling muscle fibers, as is the case with mammalian MSTN. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Megalin-mediated specific uptake of chitosan/siRNA nanoparticles in mouse kidney proximal tubule epithelial cells enables AQP1 gene silencing.

    Science.gov (United States)

    Gao, Shan; Hein, San; Dagnæs-Hansen, Frederik; Weyer, Kathrin; Yang, Chuanxu; Nielsen, Rikke; Christensen, Erik I; Fenton, Robert A; Kjems, Jørgen

    2014-01-01

    RNAi-based strategies provide a great therapeutic potential for treatment of various human diseases including kidney disorders, but face the challenge of in vivo delivery and specific targeting. The chitosan delivery system has previously been shown to target siRNA specifically to the kidneys in mice when administered intravenously. Here we confirm by 2D and 3D bioimaging that chitosan formulated siRNA is retained in the kidney for more than 48 hours where it accumulates in proximal tubule epithelial cells (PTECs), a process that was strongly dependent on the molecular weight of chitosan. Chitosan/siRNA nanoparticles, administered to chimeric mice with conditional knockout of the megalin gene, distributed almost exclusively in cells that expressed megalin, implying that the chitosan/siRNA particle uptake was mediated by a megalin-dependent endocytotic pathway. Knockdown of the water channel aquaporin 1 (AQP1) by up to 50% in PTECs was achieved utilizing the systemic i.v. delivery of chitosan/AQP1 siRNA in mice. In conclusion, specific targeting PTECs with the chitosan nanoparticle system may prove to be a useful strategy for knockdown of specific genes in PTECs, and provides a potential therapeutic strategy for treating various kidney diseases.

  14. Cholesterol-Containing Nuclease-Resistant siRNA Accumulates in Tumors in a Carrier-free Mode and Silences MDR1 Gene

    Directory of Open Access Journals (Sweden)

    Ivan V. Chernikov

    2017-03-01

    Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.

  15. The 5'-end heterogeneity of adenovirus virus-associated RNAI contributes to the asymmetric guide strand incorporation into the RNA-induced silencing complex.

    Science.gov (United States)

    Xu, Ning; Gkountela, Sofia; Saeed, Khalid; Akusjärvi, Göran

    2009-11-01

    Human Adenovirus type 5 encodes two short RNA polymerase III transcripts, the virus-associated (VA) RNAI and VA RNAII, which can adopt stable hairpin structures that resemble micro-RNA precursors. The terminal stems of the VA RNAs are processed into small RNAs (mivaRNAs) that are incorporated into RISC. It has been reported that VA RNAI has two transcription initiation sites, which produce two VA RNAI species; a major species, VA RNAI(G), which accounts for 75% of the VA RNAI pool, and a minor species, VA RNAI(A), which initiates transcription three nucleotides upstream compared to VA RNAI(G). We show that this 5'-heterogeneity results in a dramatic difference in RISC assembly. Thus, both VA RNAI(G) and VA RNAI(A) are processed by Dicer at the same position in the terminal stem generating the same 3'-strand mivaRNA. This mivaRNA is incorporated into RISC with 200-fold higher efficiency compared to the 5'-strand of mivaRNAI. Of the small number of 5'-strands used in RISC assembly only VA RNAI(A) generated active RISC complexes. We also show that the 3'-strand of mivaRNAI, although being the preferred substrate for RISC assembly, generates unstable RISC complexes with a low in vitro cleavage activity, only around 2% compared to RISC assembled on the VA RNAI(A) 5'-strand.

  16. Stable shRNA Silencing of Lactate Dehydrogenase A (LDHA) in Human MDA-MB-231 Breast Cancer Cells Fails to Alter Lactic Acid Production, Glycolytic Activity, ATP or Survival.

    Science.gov (United States)

    Mack, Nzinga; Mazzio, Elizabeth A; Bauer, David; Flores-Rozas, Hernan; Soliman, Karam F A

    2017-03-01

    In the US, African Americans have a high death rate from triple-negative breast cancer (TNBC), characterized by lack of hormone receptors (ER, PR, HER2/ERRB2) which are otherwise valuable targets of chemotherapy. There is a need to identify novel targets that negatively impact TNBC tumorigenesis. TNBCs release an abundance of lactic acid, under normoxic, hypoxic and hyperoxic conditions; this referred to as the Warburg effect. Accumulated lactic acid sustains peri-cellular acidity which propels metastatic invasion and malignant aggressive transformation. The source of lactic acid is believed to be via conversion of pyruvate by lactate dehydrogenase (LDH) in the last step of glycolysis, with most studies focusing on the LDHA isoform. In this study, LDHA was silenced using long-term MISSION® shRNA lentivirus in human breast cancer MDA-MB-231 cells. Down-regulation of LDHA transcription and protein expression was confirmed by western blot, immunocytochemistry and qPCR. A number of parameters were measured in fully viable vector controls versus knock-down (KD) clones, including levels of lactic acid produced, glucose consumed, ATP and basic metabolic rates. The data show that lentivirus V-165 generated a knock-down clone most effective in reducing both gene and protein levels to less than 1% of vector controls. Stable KD showed absolutely no changes in cell viability, lactic acid production, ATP, glucose consumption or basic metabolic rate. Given the complete absence of impact on any observed parameter by LDH-A KD and this being somewhat contrary to findings in the literature, further analysis was required to determine why. Whole-transcriptome analytic profile on MDA-MB-231 for LDH subtypes using Agilent Human Genome 4×44k microarrays, where the data show the following component breakdown. Transcripts: 30.47 % LDHA, 69.36% LDHB, 0.12% LDHC and 0.05% LDHD. These findings underscore the importance of alternative isoforms of LDH in cancer cells to produce lactic acid

  17. Influence of Bxpel1 Gene Silencing by dsRNA Interference on the Development and Pathogenicity of the Pine Wood Nematode, Bursaphelenchus xylophilus

    Science.gov (United States)

    Qiu, Xiu-Wen; Wu, Xiao-Qin; Huang, Lin; Ye, Jian-Ren

    2016-01-01

    As the causal agent of pine wilt disease (PWD), the pine wood nematode (PWN), Bursaphelenchus xylophilus, causes huge economic losses by devastating pine forests worldwide. The pectate lyase gene is essential for successful invasion of their host plants by plant-parasitic nematodes. To demonstrate the role of pectate lyase gene in the PWD process, RNA interference (RNAi) is used to analyze the function of the pectate lyase 1 gene in B. xylophilus (Bxpel1). The efficiency of RNAi was detected by real-time PCR. The result demonstrated that the quantity of B. xylophilus propagated with control solution treatment was 62 times greater than that soaking in double-stranded RNA (dsRNA) after B. xylophilus inoculation in Botrytis cinerea for the first generation (F1). The number of B. xylophilus soaking in control solution was doubled compared to that soaking in Bxpel1 dsRNA four days after inoculation in Pinus thunbergii. The quantity of B. xylophilus was reduced significantly (p < 0.001) after treatment with dsRNAi compared with that using a control solution treatment. Bxpel1 dsRNAi reduced the migration speed and reproduction of B. xylophilus in pine trees. The pathogenicity to P. thunbergii seedling of B. xylophilus was weaker after soaking in dsRNA solution compared with that after soaking in the control solution. Our results suggest that Bxpel1 gene is a significant pathogenic factor in the PWD process and this basic information may facilitate a better understanding of the molecular mechanism of PWD. PMID:26797602

  18. PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

    Science.gov (United States)

    Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

    2017-07-01

    Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  19. Silencing of the hTERT gene by shRNA inhibits colon cancer SW480 cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Ai-Qun Liu

    Full Text Available Human telomerase reverse transcriptase (hTERT is the key enzyme responsible for synthesizing and maintaining the telomeres on the ends of chromosomes, and it is essential for cell proliferation. This has made hTERT a focus of oncology research and an attractive target for anticancer drug development. In this study, we designed a small interfering RNA (siRNA targeting the catalytic subunit of hTERT and tested its effects on the growth of telomerase-positive human colon carcinoma SW480 cells in vitro, as well as on the tumorigenicity of these cells in nude mice. Transient and stable transfection of hTERT siRNA into colon cancer SW480 cells suppressed hTERT expression, reduced telomerase activity and inhibited cell growth and proliferation. Knocking down hTERT expression in SW480 tumors xenografted into nude mice significantly slowed tumor growth and promoted tumor cell apoptosis. Our results suggest that hTERT is involved in carcinogenesis of human colon carcinoma, and they highlight the therapeutic potential of a hTERT knock-down approach.

  20. siRNA-mediated Allele-specific Silencing of a COL6A3 Mutation in a Cellular Model of Dominant Ullrich Muscular Dystrophy

    Directory of Open Access Journals (Sweden)

    Véronique Bolduc

    2014-01-01

    Full Text Available Congenital muscular dystrophy type Ullrich (UCMD is a severe disorder of early childhood onset for which currently there is no effective treatment. UCMD commonly is caused by dominant-negative mutations in the genes coding for collagen type VI, a major microfibrillar component of the extracellular matrix surrounding the muscle fibers. To explore RNA interference (RNAi as a potential therapy for UCMD, we designed a series of small interfering RNA (siRNA oligos that specifically target the most common mutations resulting in skipping of exon 16 in the COL6A3 gene and tested them in UCMD-derived dermal fibroblasts. Transcript analysis by semiquantitative and quantitative reverse transcriptase PCR showed that two of these siRNAs were the most allele-specific, i.e., they efficiently knocked down the expression from the mutant allele, without affecting the normal allele. In HEK293T cells, these siRNAs selectively suppressed protein expression from a reporter construct carrying the mutation, with no or minimal suppression of the wild-type (WT construct, suggesting that collagen VI protein levels are as also reduced in an allele-specific manner. Furthermore, we found that treating UCMD fibroblasts with these siRNAs considerably improved the quantity and quality of the collagen VI matrix, as assessed by confocal microscopy. Our current study establishes RNAi as a promising molecular approach for treating dominant COL6-related dystrophies.

  1. Small silencing RNAs: an expanding universe.

    Science.gov (United States)

    Ghildiyal, Megha; Zamore, Phillip D

    2009-02-01

    Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.

  2. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-01-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response

  3. MicroRNA-15b silencing inhibits IL-1β-induced extracellular matrix degradation by targeting SMAD3 in human nucleus pulposus cells.

    Science.gov (United States)

    Kang, Liang; Yang, Cao; Yin, Huipeng; Zhao, Kangcheng; Liu, Wei; Hua, Wenbin; Wang, Kun; Song, Yu; Tu, Ji; Li, Shuai; Luo, Rongjin; Zhang, Yukun

    2017-04-01

    To determine the role of microRNA-15b (miR-15b) in interleukin-1 beta (IL-1β)-induced extracellular matrix (ECM) degradation in the nucleus pulposus (NP). MiR-15b was up-regulated in degenerative NP tissues and in IL-1β-stimulated NP cells, as compared to the levels in normal controls (normal tissue specimens from patients with idiopathic scoliosis). Bioinformatics and luciferase activity analyses showed that mothers against decapentaplegic homolog 3 (SMAD3), a key mediator of the transforming growth factor-β signaling pathway, was directly targeted by miR-15b. Functional analysis demonstrated that miR-15b overexpression aggravated IL-1β-induced ECM degradation in NP cells, while miR-15b inhibition had the opposite effects. Prevention of IL-1β-induced NP ECM degeneration by the miR-15b inhibitor was attenuated by small-interfering-RNA-mediated knockdown of SMAD3. In addition, activation of MAP kinase and nuclear factor-κB up-regulated miR-15b expression and down-regulated SMAD3 expression in IL-1β-stimulated NP cells. MiR-15b contributes to ECM degradation in intervertebral disc degeneration (IDD) via targeting of SMAD3, thus providing a novel therapeutic target for IDD treatment.

  4. Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

    Science.gov (United States)

    Whitten, Miranda; Dyson, Paul

    2017-03-01

    Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

  5. Increased expression of long noncoding RNA TUG1 predicts a poor prognosis of gastric cancer and regulates cell proliferation by epigenetically silencing of p57.

    Science.gov (United States)

    Zhang, E; He, X; Yin, D; Han, L; Qiu, M; Xu, T; Xia, R; Xu, L; Yin, R; De, W

    2016-02-25

    Recent evidence highlights long noncoding RNAs (lncRNAs) as crucial regulators of cancer biology that contribute to tumorigenesis. LncRNA TUG1 was initially detected in a genomic screen for genes upregulated in response to taurine treatment in developing mouse retinal cells. Our previous study showed that TUG1 could affect cell proliferation through epigenetically regulating HOXB7 in human non-small cell lung cancer. However, the clinical significance and potential role of TUG1 in GC remains unclear. In this study, we found that TUG1 is significantly increased and is correlated with outcomes in gastric cancer (GC). Further experiments revealed that knockdown of TUG1 repressed GC proliferation both in vitro and in vivo. Mechanistic investigations showed that TUG1 has a key role in G0/G1 arrest. We further demonstrated that TUG1 was associated with PRC2 and that this association was required for epigenetic repression of cyclin-dependent protein kinase inhibitors, including p15, p16, p21, p27 and p57, thus contributing to the regulation of GC cell cycle and proliferation. Together, our results suggest that TUG1, as a regulator of proliferation, may serve as a candidate prognostic biomarker and target for new therapies in human GC.

  6. Genome comparison of barley and maize smut fungi reveals targeted loss of RNA silencing components and species-specific presence of transposable elements.

    Science.gov (United States)

    Laurie, John D; Ali, Shawkat; Linning, Rob; Mannhaupt, Gertrud; Wong, Philip; Güldener, Ulrich; Münsterkötter, Martin; Moore, Richard; Kahmann, Regine; Bakkeren, Guus; Schirawski, Jan

    2012-05-01

    Ustilago hordei is a biotrophic parasite of barley (Hordeum vulgare). After seedling infection, the fungus persists in the plant until head emergence when fungal spores develop and are released from sori formed at kernel positions. The 26.1-Mb U. hordei genome contains 7113 protein encoding genes with high synteny to the smaller genomes of the related, maize-infecting smut fungi Ustilago maydis and Sporisorium reilianum but has a larger repeat content that affected genome evolution at important loci, including mating-type and effector loci. The U. hordei genome encodes components involved in RNA interference and heterochromatin formation, normally involved in genome defense, that are lacking in the U. maydis genome due to clean excision events. These excision events were possibly a result of former presence of repetitive DNA and of an efficient homologous recombination system in U. maydis. We found evidence of repeat-induced point mutations in the genome of U. hordei, indicating that smut fungi use different strategies to counteract the deleterious effects of repetitive DNA. The complement of U. hordei effector genes is comparable to the other two smuts but reveals differences in family expansion and clustering. The availability of the genome sequence will facilitate the identification of genes responsible for virulence and evolution of smut fungi on their respective hosts.

  7. Genome Comparison of Barley and Maize Smut Fungi Reveals Targeted Loss of RNA Silencing Components and Species-Specific Presence of Transposable Elements[W

    Science.gov (United States)

    Laurie, John D.; Ali, Shawkat; Linning, Rob; Mannhaupt, Gertrud; Wong, Philip; Güldener, Ulrich; Münsterkötter, Martin; Moore, Richard; Kahmann, Regine; Bakkeren, Guus; Schirawski, Jan

    2012-01-01

    Ustilago hordei is a biotrophic parasite of barley (Hordeum vulgare). After seedling infection, the fungus persists in the plant until head emergence when fungal spores develop and are released from sori formed at kernel positions. The 26.1-Mb U. hordei genome contains 7113 protein encoding genes with high synteny to the smaller genomes of the related, maize-infecting smut fungi Ustilago maydis and Sporisorium reilianum but has a larger repeat content that affected genome evolution at important loci, including mating-type and effector loci. The U. hordei genome encodes components involved in RNA interference and heterochromatin formation, normally involved in genome defense, that are lacking in the U. maydis genome due to clean excision events. These excision events were possibly a result of former presence of repetitive DNA and of an efficient homologous recombination system in U. maydis. We found evidence of repeat-induced point mutations in the genome of U. hordei, indicating that smut fungi use different strategies to counteract the deleterious effects of repetitive DNA. The complement of U. hordei effector genes is comparable to the other two smuts but reveals differences in family expansion and clustering. The availability of the genome sequence will facilitate the identification of genes responsible for virulence and evolution of smut fungi on their respective hosts. PMID:22623492

  8. Crystallization and preliminary X-ray diffraction analysis of the Cmr2–Cmr3 subcomplex in the CRISPR–Cas RNA-silencing effector complex

    Energy Technology Data Exchange (ETDEWEB)

    Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki [National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Higashi, Tsukuba-shi, Ibaraki 305-8566 (Japan)

    2013-04-30

    The Cmr2–Cmr3 subcomplex from P. furiosus was co-crystallized with 3′-AMP. X-ray diffraction data for the crystals were collected to 2.6 Å resolution using a synchrotron-radiation source. Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci, found in prokaryotes, are transcribed to produce CRISPR RNAs (crRNAs). The Cmr proteins (Cmr1–6) and crRNA form a ribonucleoprotein complex that degrades target RNAs derived from invading genetic elements. Cmr2dHD, a Cmr2 variant lacking the N-terminal putative HD nuclease domain, and Cmr3 were co-expressed in Escherichia coli cells and co-purified as a complex. The Cmr2dHD–Cmr3 complex was co-crystallized with 3′-AMP by the vapour-diffusion method. The crystals diffracted to 2.6 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the orthorhombic space group I222, with unit-cell parameters a = 103.9, b = 136.7, c = 192.0 Å. The asymmetric unit of the crystals is expected to contain one Cmr2dHD–Cmr3 complex with a Matthews coefficient of 3.0 Å{sup 3} Da{sup −1} and a solvent content of 59%.

  9. Crystallization and preliminary X-ray diffraction analysis of the Cmr2–Cmr3 subcomplex in the CRISPR–Cas RNA-silencing effector complex

    International Nuclear Information System (INIS)

    Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki

    2013-01-01

    The Cmr2–Cmr3 subcomplex from P. furiosus was co-crystallized with 3′-AMP. X-ray diffraction data for the crystals were collected to 2.6 Å resolution using a synchrotron-radiation source. Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci, found in prokaryotes, are transcribed to produce CRISPR RNAs (crRNAs). The Cmr proteins (Cmr1–6) and crRNA form a ribonucleoprotein complex that degrades target RNAs derived from invading genetic elements. Cmr2dHD, a Cmr2 variant lacking the N-terminal putative HD nuclease domain, and Cmr3 were co-expressed in Escherichia coli cells and co-purified as a complex. The Cmr2dHD–Cmr3 complex was co-crystallized with 3′-AMP by the vapour-diffusion method. The crystals diffracted to 2.6 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the orthorhombic space group I222, with unit-cell parameters a = 103.9, b = 136.7, c = 192.0 Å. The asymmetric unit of the crystals is expected to contain one Cmr2dHD–Cmr3 complex with a Matthews coefficient of 3.0 Å 3 Da −1 and a solvent content of 59%

  10. Uncoupling of the hnRNP Npl3p from mRNAs during the stress-induced block in mRNA export.

    Science.gov (United States)

    Krebber, H; Taura, T; Lee, M S; Silver, P A

    1999-08-01

    Npl3p, the major mRNA-binding protein of the yeast Saccharomyces cerevisiae shuttles between the nucleus and the cytoplasm. A single amino acid change in the carboxyl terminus of Npl3p (E409 --> K) renders the mutant protein largely cytoplasmic because of a delay in its import into the nucleus. This import defect can be reversed by increasing the intracellular concentration of Mtr10p, the nuclear import receptor for Npl3p. Conversely, using this mutant, we show that Npl3p and mRNA export out of the nucleus is significantly slowed in cells bearing mutations in XPO1/CRM1, which encodes the export receptor for NES-containing proteins and in RAT7, which encodes an essential nucleoporin. Interestingly, following induction of stress by heat shock, high salt, or ethanol, conditions under which most mRNA export is blocked, Npl3p is still exported from the nucleus. The stress-induced export of Npl3p is independent of both the activity of Xpo1p and the continued selective export of heat-shock mRNAs that occurs following stress. UV-cross-linking experiments show that Npl3p is bound to mRNA under normal conditions, but is no longer RNA associated in stressed cells. Taken together, we suggest that the uncoupling of Npl3p and possibly other mRNA-binding proteins from mRNAs in the nucleus provides a general switch that regulates mRNA export. By this model, under normal conditions Npl3p is a major component of an export-competent RNP complex. However, under conditions of stress, Npl3p no longer associates with the export complex, rendering it export incompetent and thus nuclear.

  11. Silencing criticism in Mexico

    Directory of Open Access Journals (Sweden)

    Ximena Suárez

    2017-10-01

    Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

  12. Ombuds’ corner: Employee silence

    CERN Multimedia

    Vincent Vuillemin

    2013-01-01

    Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

  13. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  14. Silencing of microRNA-138-5p promotes IL-1β-induced cartilage degradation in human chondrocytes by targeting FOXC1: miR-138 promotes cartilage degradation.

    Science.gov (United States)

    Yuan, Y; Zhang, G Q; Chai, W; Ni, M; Xu, C; Chen, J Y

    2016-10-01

    . Y. Chen. Silencing of microRNA-138-5p promotes IL-1β-induced cartilage degradation in human chondrocytes by targeting FOXC1: miR-138 promotes cartilage degradation. Bone Joint Res 2016;5:523-530. DOI: 10.1302/2046-3758.510.BJR-2016-0074.R2. © 2016 Chen et al.

  15. Cytoplasmic Male Sterility of Rice with Boro II Cytoplasm Is Caused by a Cytotoxic Peptide and Is Restored by Two Related PPR Motif Genes via Distinct Modes of mRNA Silencing[W

    Science.gov (United States)

    Wang, Zhonghua; Zou, Yanjiao; Li, Xiaoyu; Zhang, Qunyu; Chen, Letian; Wu, Hao; Su, Dihua; Chen, Yuanling; Guo, Jingxin; Luo, Da; Long, Yunming; Zhong, Yang; Liu, Yao-Guang

    2006-01-01

    Cytoplasmic male sterility (CMS) and nucleus-controlled fertility restoration are widespread plant reproductive features that provide useful tools to exploit heterosis in crops. However, the molecular mechanism underlying this kind of cytoplasmic–nuclear interaction remains unclear. Here, we show in rice (Oryza sativa) with Boro II cytoplasm that an abnormal mitochondrial open reading frame, orf79, is cotranscribed with a duplicated atp6 (B-atp6) gene and encodes a cytotoxic peptide. Expression of orf79 in CMS lines and transgenic rice plants caused gametophytic male sterility. Immunoblot analysis showed that the ORF79 protein accumulates specifically in microspores. Two fertility restorer genes, Rf1a and Rf1b, were identified at the classical locus Rf-1 as members of a multigene cluster that encode pentatricopeptide repeat proteins. RF1A and RF1B are both targeted to mitochondria and can restore male fertility by blocking ORF79 production via endonucleolytic cleavage (RF1A) or degradation (RF1B) of dicistronic B-atp6/orf79 mRNA. In the presence of both restorers, RF1A was epistatic over RF1B in the mRNA processing. We have also shown that RF1A plays an additional role in promoting the editing of atp6 mRNAs, independent of its cleavage function. PMID:16489123

  16. Cytoplasmic male sterility of rice with boro II cytoplasm is caused by a cytotoxic peptide and is restored by two related PPR motif genes via distinct modes of mRNA silencing.

    Science.gov (United States)

    Wang, Zhonghua; Zou, Yanjiao; Li, Xiaoyu; Zhang, Qunyu; Chen, Letian; Wu, Hao; Su, Dihua; Chen, Yuanling; Guo, Jingxin; Luo, Da; Long, Yunming; Zhong, Yang; Liu, Yao-Guang

    2006-03-01

    Cytoplasmic male sterility (CMS) and nucleus-controlled fertility restoration are widespread plant reproductive features that provide useful tools to exploit heterosis in crops. However, the molecular mechanism underlying this kind of cytoplasmic-nuclear interaction remains unclear. Here, we show in rice (Oryza sativa) with Boro II cytoplasm that an abnormal mitochondrial open reading frame, orf79, is cotranscribed with a duplicated atp6 (B-atp6) gene and encodes a cytotoxic peptide. Expression of orf79 in CMS lines and transgenic rice plants caused gametophytic male sterility. Immunoblot analysis showed that the ORF79 protein accumulates specifically in microspores. Two fertility restorer genes, Rf1a and Rf1b, were identified at the classical locus Rf-1 as members of a multigene cluster that encode pentatricopeptide repeat proteins. RF1A and RF1B are both targeted to mitochondria and can restore male fertility by blocking ORF79 production via endonucleolytic cleavage (RF1A) or degradation (RF1B) of dicistronic B-atp6/orf79 mRNA. In the presence of both restorers, RF1A was epistatic over RF1B in the mRNA processing. We have also shown that RF1A plays an additional role in promoting the editing of atp6 mRNAs, independent of its cleavage function.

  17. Assessment of RNAi-induced silencing in banana (Musa spp.).

    Science.gov (United States)

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

  18. Crop-associated virus reduces the rooting depth of non-crop perennial native grass more than non-crop-associated virus with known viral suppressor of RNA silencing (VSR).

    Science.gov (United States)

    Malmstrom, Carolyn M; Bigelow, Patrick; Trębicki, Piotr; Busch, Anna K; Friel, Colleen; Cole, Ellen; Abdel-Azim, Heba; Phillippo, Colin; Alexander, Helen M

    2017-09-15

    As agricultural acreage expanded and came to dominate landscapes across the world, viruses gained opportunities to move between crop and wild native plants. In the Midwestern USA, virus exchange currently occurs between widespread annual Poaceae crops and remnant native perennial prairie grasses now under consideration as bioenergy feedstocks. In this region, the common aphid species Rhopalosiphum padi L. (the bird cherry-oat aphid) transmits several virus species in the family Luteoviridae, including Barley yellow dwarf virus (BYDV-PAV, genus Luteovirus) and Cereal yellow dwarf virus (CYDV-RPV and -RPS, genus Polerovirus). The yellow dwarf virus (YDV) species in these two genera share genetic similarities in their 3'-ends, but diverge in the 5'-regions. Most notably, CYDVs encode a P0 viral suppressor of RNA silencing (VSR) absent in BYDV-PAV. Because BYDV-PAV has been reported more frequently in annual cereals and CYDVs in perennial non-crop grasses, we examine the hypothesis that the viruses' genetic differences reflect different affinities for crop and non-crop hosts. Specifically, we ask (i) whether CYDVs might persist within and affect a native non-crop grass more strongly than BYDV-PAV, on the grounds that the polerovirus VSR could better moderate the defenses of a well-defended perennial, and (ii) whether the opposite pattern of effects might occur in a less defended annual crop. Because previous work found that the VSR of CYDV-RPS possessed greater silencing suppressor efficiency than that of CYDV-RPV, we further explored (iii) whether a novel grass-associated CYDV-RPS isolate would influence a native non-crop grass more strongly than a comparable CYDV-RPV isolate. In growth chamber studies, we found support for this hypothesis: only grass-associated CYDV-RPS stunted the shoots and crowns of Panicum virgatum L. (switchgrass), a perennial native North American prairie grass, whereas crop-associated BYDV-PAV (and coinfection with BYDV-PAV and CYDV-RPS) most

  19. Mycobacterium tuberculosis lipomannan blocks TNF biosynthesis by regulating macrophage MAPK-activated protein kinase 2 (MK2) and microRNA miR-125b.

    Science.gov (United States)

    Rajaram, Murugesan V S; Ni, Bin; Morris, Jessica D; Brooks, Michelle N; Carlson, Tracy K; Bakthavachalu, Baskar; Schoenberg, Daniel R; Torrelles, Jordi B; Schlesinger, Larry S

    2011-10-18

    Contact of Mycobacterium tuberculosis (M.tb) with the immune system requires interactions between microbial surface molecules and host pattern recognition receptors. Major M.tb-exposed cell envelope molecules, such as lipomannan (LM), contain subtle structural variations that affect the nature of the immune response. Here we show that LM from virulent M.tb (TB-LM), but not from avirulent Myocobacterium smegmatis (SmegLM), is a potent inhibitor of TNF biosynthesis in human macrophages. This difference in response is not because of variation in Toll-like receptor 2-dependent activation of the signaling kinase MAPK p38. Rather, TB-LM stimulation leads to destabilization of TNF mRNA transcripts and subsequent failure to produce TNF protein. In contrast, SmegLM enhances MAPK-activated protein kinase 2 phosphorylation, which is critical for maintaining TNF mRNA stability in part by contributing microRNAs (miRNAs). In this context, human miRNA miR-125b binds to the 3' UTR region of TNF mRNA and destabilizes the transcript, whereas miR-155 enhances TNF production by increasing TNF mRNA half-life and limiting expression of SHIP1, a negative regulator of the PI3K/Akt pathway. We show that macrophages incubated with TB-LM and live M.tb induce high miR-125b expression and low miR-155 expression with correspondingly low TNF production. In contrast, SmegLM and live M. smegmatis induce high miR-155 expression and low miR-125b expression with high TNF production. Thus, we identify a unique cellular mechanism underlying the ability of a major M.tb cell wall component, TB-LM, to block TNF biosynthesis in human macrophages, thereby allowing M.tb to subvert host immunity and potentially increase its virulence.

  20. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Switching off small RNA regulation with trap-mRNA

    DEFF Research Database (Denmark)

    Overgaard, Martin; Johansen, Jesper; Møller-Jensen, Jakob

    2009-01-01

    to operate at the level of transcription initiation. By employing a highly sensitive genetic screen we uncovered a novel RNA-based regulatory principle in which induction of a trap-mRNA leads to selective degradation of a small regulatory RNA molecule, thereby abolishing the sRNA-based silencing of its...

  2. Memories Persist in Silence

    Directory of Open Access Journals (Sweden)

    Sandra Patricia Arenas Grisales

    2012-08-01

    Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

  3. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

    Science.gov (United States)

    Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

    2016-11-22

    Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

  4. The Gift of Silence

    Science.gov (United States)

    Haskins, Cathleen

    2011-01-01

    Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

  5. Breaking the silence

    DEFF Research Database (Denmark)

    Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

    2012-01-01

    and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

  6. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  7. FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

    Science.gov (United States)

    Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

    2014-01-01

    Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

  8. Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

    Science.gov (United States)

    Guleria, Praveen; Yadav, Sudesh Kumar

    2013-01-01

    Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

  9. Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Praveen Guleria

    Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

  10. A comprehensive survey of 3' animal miRNA modification events and a possible role for 3' adenylation in modulating miRNA targeting effectiveness.

    Science.gov (United States)

    Burroughs, A Maxwell; Ando, Yoshinari; de Hoon, Michiel J L; Tomaru, Yasuhiro; Nishibu, Takahiro; Ukekawa, Ryo; Funakoshi, Taku; Kurokawa, Tsutomu; Suzuki, Harukazu; Hayashizaki, Yoshihide; Daub, Carsten O

    2010-10-01

    Animal microRNA sequences are subject to 3' nucleotide addition. Through detailed analysis of deep-sequenced short RNA data sets, we show adenylation and uridylation of miRNA is globally present and conserved across Drosophila and vertebrates. To better understand 3' adenylation function, we deep-sequenced RNA after knockdown of nucleotidyltransferase enzymes. The PAPD4 nucleotidyltransferase adenylates a wide range of miRNA loci, but adenylation does not appear to affect miRNA stability on a genome-wide scale. Adenine addition appears to reduce effectiveness of miRNA targeting of mRNA transcripts while deep-sequencing of RNA bound to immunoprecipitated Argonaute (AGO) subfamily proteins EIF2C1-EIF2C3 revealed substantial reduction of adenine addition in miRNA associated with EIF2C2 and EIF2C3. Our findings show 3' addition events are widespread and conserved across animals, PAPD4 is a primary miRNA adenylating enzyme, and suggest a role for 3' adenine addition in modulating miRNA effectiveness, possibly through interfering with incorporation into the RNA-induced silencing complex (RISC), a regulatory role that would complement the role of miRNA uridylation in blocking DICER1 uptake.

  11. A comprehensive survey of 3′ animal miRNA modification events and a possible role for 3′ adenylation in modulating miRNA targeting effectiveness

    Science.gov (United States)

    Burroughs, A. Maxwell; Ando, Yoshinari; de Hoon, Michiel J.L.; Tomaru, Yasuhiro; Nishibu, Takahiro; Ukekawa, Ryo; Funakoshi, Taku; Kurokawa, Tsutomu; Suzuki, Harukazu; Hayashizaki, Yoshihide; Daub, Carsten O.

    2010-01-01

    Animal microRNA sequences are subject to 3′ nucleotide addition. Through detailed analysis of deep-sequenced short RNA data sets, we show adenylation and uridylation of miRNA is globally present and conserved across Drosophila and vertebrates. To better understand 3′ adenylation function, we deep-sequenced RNA after knockdown of nucleotidyltransferase enzymes. The PAPD4 nucleotidyltransferase adenylates a wide range of miRNA loci, but adenylation does not appear to affect miRNA stability on a genome-wide scale. Adenine addition appears to reduce effectiveness of miRNA targeting of mRNA transcripts while deep-sequencing of RNA bound to immunoprecipitated Argonaute (AGO) subfamily proteins EIF2C1–EIF2C3 revealed substantial reduction of adenine addition in miRNA associated with EIF2C2 and EIF2C3. Our findings show 3′ addition events are widespread and conserved across animals, PAPD4 is a primary miRNA adenylating enzyme, and suggest a role for 3′ adenine addition in modulating miRNA effectiveness, possibly through interfering with incorporation into the RNA-induced silencing complex (RISC), a regulatory role that would complement the role of miRNA uridylation in blocking DICER1 uptake. PMID:20719920

  12. Silencing of Stress-Regulated miRNAs in Plants by Short Tandem Target Mimic (STTM) Approach.

    Science.gov (United States)

    Teotia, Sachin; Tang, Guiliang

    2017-01-01

    In plants, microRNAs (miRNAs) regulate more than hundred target genes comprising largely transcription factors that control growth and development as well as stress responses. However, the exact functions of miRNA families could not be deciphered because each miRNA family has multiple loci in the genome, thus are functionally redundant. Therefore, an ideal approach to study the function of a miRNA family is to silence the expression of all members simultaneously, which is a daunting task. However, this can be partly overcome by Target Mimic (TM) approach that can knockdown an entire miRNA family. STTM is a modification of TM approach and complements it. STTMs have been successfully used in monocots and dicots to block miRNA functions. miR159 has been shown to be differentially regulated by various abiotic stresses including ABA in various plant species. Here, we describe in detail the protocol for designing STTM construct to block miR159 functions in Arabidopsis, with the potential to apply this technique on a number of other stress-regulated miRNAs in plants.

  13. Phylogenetic analysis of partial RNA-polymerase blocks II and III of Rabies virus isolated from the main rabies reservoirs in Brazil.

    Science.gov (United States)

    Carnieli, Pedro; de Novaes Oliveira, Rafael; de Oliveira Fahl, Willian; de Carvalho Ruthner Batista, Helena Beatriz; Scheffer, Karin Corrêa; Iamamoto, Keila; Castilho, Juliana Galera

    2012-08-01

    This study describes the results of the sequencing and analysis of segments of Blocks II and III of the RNA polymerase L gene of Rabies virus isolates from different reservoir species of Brazil. The phylogenetic relations of the virus were determined and a variety of species-specific nucleotides were found in the analyzed areas, but the majority of these mutations were found to be synonymous. However, an analysis of the putative amino acid sequences were shown to have some characteristic mutations between some reservoir species of Brazil, indicating that there was positive selection in the RNA polymerase L gene of Rabies virus. On comparing the putative viral sequences obtained from the Brazilian isolates and other Lyssavirus, it was determined that amino acid mutations occurred in low-restriction areas. This study of the L gene of Rabies virus is the first to be conducted with samples of virus isolates from Brazil, and the results obtained will help in the determination of the phylogenetic relations of the virus.

  14. The Silence of Michelangelo

    DEFF Research Database (Denmark)

    Foote, Jonathan

    2016-01-01

    In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

  15. Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

    Directory of Open Access Journals (Sweden)

    Rita Marta

    2014-10-01

    Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

  16. Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

    African Journals Online (AJOL)

    To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

  17. PERK silence inhibits glioma cell growth under low glucose stress by blockage of p-AKT and subsequent HK2's mitochondria translocation

    KAUST Repository

    Hou, Xu

    2015-03-12

    Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)\\'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.

  18. PERK silence inhibits glioma cell growth under low glucose stress by blockage of p-AKT and subsequent HK2's mitochondria translocation

    KAUST Repository

    Hou, Xu; Liu, Yaohua; Liu, Huailei; Chen, Xin; Liu, Min; Che, Hui; Guo, Fei; Wang, Chunlei; Zhang, Daming; Wu, Jianing; Chen, Xiaofeng; Shen, Chen; Li, Chenguang; Peng, Fei; Bi, Yunke; Yang, Zhuowen; Yang, Guang; Ai, Jing; Gao, Xin; Zhao, Shiguang

    2015-01-01

    Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.

  19. RNA interference: a new strategy in the evolutionary arms race between human control strategies and insect pests.

    Science.gov (United States)

    Machado, Vilmar; Rodríguez-García, María Juliana; Sánchez-García, Francisco Javier; Galan, Jose

    2014-01-01

    The relationship between humans and the insect pests of cultivated plants may be considered to be an indirect coevolutionary process, i.e., an arms race. Over time, humans have developed several strategies to minimize the negative impacts of insects on agricultural production. However, insects have made adaptive responses via the evolution of resistance to insecticides, and more recently against Bacillus thuriengiensis. Thus, we need to continuously invest resources in the development of new strategies for crop protection. Recent advances in genomics have demonstrated the possibility of a new weapon or strategy in this war, i.e., gene silencing, which involves blocking the expression of specific genes via mRNA inactivation. In the last decade, several studies have demonstrated the effectiveness of this strategy in the control of different species of insects. However, several technical difficulties need to be overcome to transform this potential into reality, such as the selection of target genes, the concentration of dsRNA, the nucleotide sequence of the dsRNA, the length of dsRNA, persistence in the insect body, and the life stage of the target species where gene silencing is most efficient. This study analyzes several aspects related to the use of gene silencing in pest control and it includes an overview of the inactivation process, as well as the problems that need to be resolved to transform gene silencing into an effective pest control method.

  20. SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

    Science.gov (United States)

    Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

    2011-01-01

    In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

  1. Identification of a maize chlorotic dwarf virus silencing suppressor protein

    Science.gov (United States)

    Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

  2. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  3. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  4. Voice and silence in organizations

    Directory of Open Access Journals (Sweden)

    Moaşa, H.

    2011-01-01

    Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

  5. "Listening Silence" and Its Discursive Effects

    Science.gov (United States)

    Applebaum, Barbara

    2016-01-01

    While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

  6. LncRNA GAS5 Represses Osteosarcoma Cells Growth and Metastasis via Sponging MiR-203a

    Directory of Open Access Journals (Sweden)

    Yang Wang

    2018-01-01

    Full Text Available Background/Aims: LncRNA GAS5, a growth suppressor, has been reported to exert anti-tumor actions in various cancers, whereas the exact mechanism underling the anti-tumor action is still unclear. This study was aimed to investigate the effect of lncRNA GAS5 on osteosarcoma and tried to decode the underling mechanisms. Methods: Expressions of lncRNA GAS5 in MG-63 cells were silenced by shRNA transfection, while were overexpressed by vector transfection. Cell viability, migration, invasion and apoptosis were respectively assessed by MTT, Transwell assay and flow cytometry. Regulations between lncRNA GAS5 and miR-203a, as well as between miR-203a and TIMP2 were detected by qPCR, western blot and dual luciferase activity assay. Results: LncRNA GAS5 was down-regulated in MG-63 and OS-732 cells compared to hFOB1.19 cells. Silence of lncRNA GAS5 significantly promoted MG-63 cells viability, migration and invasion, and up-regulated Cyclin D1, Cyclin B1, CDK1 and CDK4 expressions. miR-203a was negatively regulated by lncRNA GAS5. The promoting activities of lncRNA GAS5 silence on MG-63 cells growth and metastasis were reversed by miR-203a suppression. TIMP2 was a target of miR-203a and the anti-growth and anti-metastasis actions of miR-203a suppression were reversed by TIMP2 silence. Further, lncRNA GAS5 silence, miR-203a overexpression, and TIMP2 silence could activate PI3K/AKT/GSK3β signaling while block NF-κB signaling. Conclusion: LncRNA GAS5 might be a tumor suppressor in osteosarcoma via sponging miR-203a, sequestering miR-203a away from TIMP2.

  7. Plant RNA Regulatory Network and RNA Granules in Virus Infection

    Directory of Open Access Journals (Sweden)

    Kristiina Mäkinen

    2017-12-01

    Full Text Available Regulation of post-transcriptional gene expression on mRNA level in eukaryotic cells includes translocation, translation, translational repression, storage, mRNA decay, RNA silencing, and nonsense-mediated decay. These processes are associated with various RNA-binding proteins and cytoplasmic ribonucleoprotein complexes many of which are conserved across eukaryotes. Microscopically visible aggregations formed by ribonucleoprotein complexes are termed RNA granules. Stress granules where the translationally inactive mRNAs are stored and processing bodies where mRNA decay may occur present the most studied RNA granule types. Diverse RNP-granules are increasingly being assigned important roles in viral infections. Although the majority of the molecular level studies on the role of RNA granules in viral translation and replication have been conducted in mammalian systems, some studies link also plant virus infection to RNA granules. An increasing body of evidence indicates that plant viruses require components of stress granules and processing bodies for their replication and translation, but how extensively the cellular mRNA regulatory network is utilized by plant viruses has remained largely enigmatic. Antiviral RNA silencing, which is an important regulator of viral RNA stability and expression in plants, is commonly counteracted by viral suppressors of RNA silencing. Some of the RNA silencing suppressors localize to cellular RNA granules and have been proposed to carry out their suppression functions there. Moreover, plant nucleotide-binding leucine-rich repeat protein-mediated virus resistance has been linked to enhanced processing body formation and translational repression of viral RNA. Many interesting questions relate to how the pathways of antiviral RNA silencing leading to viral RNA degradation and/or repression of translation, suppression of RNA silencing and viral RNA translation converge in plants and how different RNA granules and

  8. Plant RNA Regulatory Network and RNA Granules in Virus Infection.

    Science.gov (United States)

    Mäkinen, Kristiina; Lõhmus, Andres; Pollari, Maija

    2017-01-01

    Regulation of post-transcriptional gene expression on mRNA level in eukaryotic cells includes translocation, translation, translational repression, storage, mRNA decay, RNA silencing, and nonsense-mediated decay. These processes are associated with various RNA-binding proteins and cytoplasmic ribonucleoprotein complexes many of which are conserved across eukaryotes. Microscopically visible aggregations formed by ribonucleoprotein complexes are termed RNA granules. Stress granules where the translationally inactive mRNAs are stored and processing bodies where mRNA decay may occur present the most studied RNA granule types. Diverse RNP-granules are increasingly being assigned important roles in viral infections. Although the majority of the molecular level studies on the role of RNA granules in viral translation and replication have been conducted in mammalian systems, some studies link also plant virus infection to RNA granules. An increasing body of evidence indicates that plant viruses require components of stress granules and processing bodies for their replication and translation, but how extensively the cellular mRNA regulatory network is utilized by plant viruses has remained largely enigmatic. Antiviral RNA silencing, which is an important regulator of viral RNA stability and expression in plants, is commonly counteracted by viral suppressors of RNA silencing. Some of the RNA silencing suppressors localize to cellular RNA granules and have been proposed to carry out their suppression functions there. Moreover, plant nucleotide-binding leucine-rich repeat protein-mediated virus resistance has been linked to enhanced processing body formation and translational repression of viral RNA. Many interesting questions relate to how the pathways of antiviral RNA silencing leading to viral RNA degradation and/or repression of translation, suppression of RNA silencing and viral RNA translation converge in plants and how different RNA granules and their individual

  9. Bodies, Spaces, Voices, Silences

    Directory of Open Access Journals (Sweden)

    Donatella Mazzoleni

    2013-07-01

    Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

  10. The 3' untranslated region of the cyclin B mRNA is not sufficient to enhance the synthesis of cyclin B during a mitotic block in human cells.

    Directory of Open Access Journals (Sweden)

    Dominik Schnerch

    Full Text Available Antimitotic agents are frequently used to treat solid tumors and hematologic malignancies. However, one major limitation of antimitotic approaches is mitotic slippage, which is driven by slow degradation of cyclin B during a mitotic block. The extent to which cyclin B levels decline is proposed to be governed by an equilibrium between cyclin B synthesis and degradation. It was recently shown that the 3' untranslated region (UTR of the murine cyclin B mRNA contributes to the synthesis of cyclin B during mitosis in murine cells. Using a novel live-cell imaging-based technique allowing us to study synthesis and degradation of cyclin B simultaneously at the single cell level, we tested here the role of the human cyclin B 3'UTR in regulating cyclin B synthesis during mitosis in human cells. We observed that the cyclin B 3'UTR was not sufficient to enhance cyclin B synthesis in human U2Os, HeLa or hTERT RPE-1 cells. A better understanding of how the equilibrium of cyclin B is regulated in mitosis may contribute to the development of improved therapeutic approaches to prevent mitotic slippage in cancer cells treated with antimitotic agents.

  11. Organizational Silence in Sports Employees

    Science.gov (United States)

    Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

    2016-01-01

    Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

  12. Silence, an Eye of Knowledge

    Science.gov (United States)

    Aghamohammadi, Mehdi

    2017-01-01

    One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

  13. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  14. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  15. MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

    Science.gov (United States)

    Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

    2014-01-01

    Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

  16. Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

    Science.gov (United States)

    Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-01-01

    RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

  17. Nerve Blocks

    Science.gov (United States)

    ... News Physician Resources Professions Site Index A-Z Nerve Blocks A nerve block is an injection to ... the limitations of Nerve Block? What is a Nerve Block? A nerve block is an anesthetic and/ ...

  18. Engineered chloroplast dsRNA silences cytochrome p450 monooxygenase, V-ATPase and chitin synthase genes in the insect gut and disrupts Helicoverpa zea larval development and pupation.

    Science.gov (United States)

    Jin, Shuangxia; Singh, Nameirakpam D; Li, Lebin; Zhang, Xianlong; Daniell, Henry

    2015-04-01

    In the past two decades, chloroplast genetic engineering has been advanced to achieve high-level protein accumulation but not for down-regulation of targeted genes. Therefore, in this report, lepidopteran chitin synthase (Chi), cytochrome P450 monooxygenase (P450) and V-ATPase dsRNAs were expressed via the chloroplast genome to study RNA interference (RNAi) of target genes in intended hosts. PCR and Southern blot analysis confirmed homoplasmy and site-specific integration of transgene cassettes into the chloroplast genomes. Northern blots and real-time qRT-PCR confirmed abundant processed and unprocessed dsRNA transcripts (up to 3.45 million copies of P450 dsRNAs/μg total RNA); the abundance of cleaved dsRNA was greater than the endogenous psbA transcript. Feeding of leaves expressing P450, Chi and V-ATPase dsRNA decreased transcription of the targeted gene to almost undetectable levels in the insect midgut, likely after further processing of dsRNA in their gut. Consequently, the net weight of larvae, growth and pupation rates were significantly reduced by chloroplast-derived dsRNAs. Taken together, successful expression of dsRNAs via the chloroplast genome for the first time opens the door to study RNA interference/processing within plastids. Most importantly, dsRNA expressed in chloroplasts can be utilized for gene inactivation to confer desired agronomic traits or for various biomedical applications, including down-regulation of dysfunctional genes in cancer or autoimmune disorders, after oral delivery of dsRNA bioencapsulated within plant cells. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Judicial review of administrative silence

    Directory of Open Access Journals (Sweden)

    Radošević Ratko S.

    2015-01-01

    Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

  20. Silence, an Eye of Knowledge

    Directory of Open Access Journals (Sweden)

    Mehdi Aghamohammadi

    2017-04-01

    Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

  1. Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

    Directory of Open Access Journals (Sweden)

    Sirjana Devi Shrestha

    Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

  2. Gene silencing of stearoyl-ACP desaturase enhances the stearic acid content in Chlamydomonas reinhardtii

    NARCIS (Netherlands)

    Jaeger, de L.; Springer, J.; Wolbert, E.J.H.; Martens, D.E.; Eggink, G.; Wijffels, R.H.

    2017-01-01

    In this study, stearoyl-ACP desaturase (SAD), the enzyme that converts stearic acid into oleic acid, is silenced by artificial microRNA in the green microalga Chlamydomonas reinhardtii. Two different constructs, which target different positions on the mRNA of stearoyl-ACP desaturase, were tested.

  3. Branched RNA: A New Architecture for RNA Interference

    Directory of Open Access Journals (Sweden)

    Anna Aviñó

    2011-01-01

    Full Text Available Branched RNAs with two and four strands were synthesized. These structures were used to obtain branched siRNA. The branched siRNA duplexes had similar inhibitory capacity as those of unmodified siRNA duplexes, as deduced from gene silencing experiments of the TNF-α protein. Branched RNAs are considered novel structures for siRNA technology, and they provide an innovative tool for specific gene inhibition. As the method described here is compatible with most RNA modifications described to date, these compounds may be further functionalized to obtain more potent siRNA derivatives and can be attached to suitable delivery systems.

  4. Effect of blocking Rac1 expression in cholangiocarcinoma QBC939 cells

    Directory of Open Access Journals (Sweden)

    Liu Xudong

    2011-05-01

    Full Text Available Cholangiocarcinomas (CCs are malignant tumors that originate from epithelial cells lining the biliary tree and gallbladder. Ras correlative C3 creotoxin substrate 1 (Rac1, a small guanosine triphosphatase, is a critical mediator of various aspects of endothelial cell functions. The objective of the present investigation was to study the effect of blocking Rac1 expression in CCs. Seventy-four extrahepatic CC (ECC specimens and matched adjacent normal mucosa were obtained from the Department of Pathology, Inner Mongolia Medicine Hospital, between 2007 and 2009. Our results showed that the expression of Rac1 was significantly higher (53.12% in tumor tissues than in normal tissues. Western blotting data indicated a significant reduction in Rac1-miRNA cell protein levels. Rac1-miRNA cell growth rate was significantly different at 24, 48, and 72 h after transfection. Flow cytometry analysis showed that Rac1-miRNA cells undergo apoptosis more effectively than control QBC939 cells. Blocking Rac1 expression by RNAi effectively inhibits the growth of CCs. miRNA silencing of the Rac1 gene suppresses proliferation and induces apoptosis of QBC939 cells. These results suggest that Rac1 may be a new gene therapy target for CC. Blocking Rac1 expression in CC cells induces apoptosis of these tumor cells and may thus represent a new therapeutic approach.

  5. Plant RNA binding proteins for control of RNA virus infection

    Directory of Open Access Journals (Sweden)

    Sung Un eHuh

    2013-12-01

    Full Text Available Plant RNA viruses have effective strategies to infect host plants through either direct or indirect interactions with various host proteins, thus suppressing the host immune system. When plant RNA viruses enter host cells exposed RNAs of viruses are recognized by the host immune system through processes such as siRNA-dependent silencing. Interestingly, some host RNA binding proteins have been involved in the inhibition of RNA virus replication, movement, and translation through RNA-specific binding. Host plants intensively use RNA binding proteins for defense against viral infections in nature. In this mini review, we will summarize the function of some host RNA binding proteins which act in a sequence-specific binding manner to the infecting virus RNA. It is important to understand how plants effectively suppresses RNA virus infections via RNA binding proteins, and this defense system can be potentially developed as a synthetic virus defense strategy for use in crop engineering.

  6. The effects of age-in-block on RNA-seq analysis of archival formalin-fixed paraffin-embedded (FFPE) samples

    Science.gov (United States)

    Archival samples represent a vast resource for identification of chemical and pharmaceutical targets. Previous use of formalin-fixed paraffin-embedded (FFPE) samples has been limited due to changes in RNA introduced by fixation and embedding procedures. Recent advances in RNA-seq...

  7. Scavenger receptors in human airway epithelial cells: role in response to double-stranded RNA.

    Directory of Open Access Journals (Sweden)

    Audrey Dieudonné

    Full Text Available Scavenger receptors and Toll-like receptors (TLRs cooperate in response to danger signals to adjust the host immune response. The TLR3 agonist double stranded (dsRNA is an efficient activator of innate signalling in bronchial epithelial cells. In this study, we aimed at defining the role played by scavenger receptors expressed by bronchial epithelial cells in the control of the innate response to dsRNA both in vitro and in vivo. Expression of several scavenger receptor involved in pathogen recognition was first evaluated in human bronchial epithelial cells in steady-state and inflammatory conditions. Their implication in the uptake of dsRNA and the subsequent cell activation was evaluated in vitro by competition with ligand of scavenger receptors including maleylated ovalbumin and by RNA silencing. The capacity of maleylated ovalbumin to modulate lung inflammation induced by dsRNA was also investigated in mice. Exposure to tumor necrosis factor-α increased expression of the scavenger receptors LOX-1 and CXCL16 and the capacity to internalize maleylated ovalbumin, whereas activation by TLR ligands did not. In contrast, the expression of SR-B1 was not modulated in these conditions. Interestingly, supplementation with maleylated ovalbumin limited dsRNA uptake and inhibited subsequent activation of bronchial epithelial cells. RNA silencing of LOX-1 and SR-B1 strongly blocked the dsRNA-induced cytokine production. Finally, administration of maleylated ovalbumin in mice inhibited the dsRNA-induced infiltration and activation of inflammatory cells in bronchoalveolar spaces and lung draining lymph nodes. Together, our data characterize the function of SR-B1 and LOX-1 in bronchial epithelial cells and their implication in dsRNA-induced responses, a finding that might be relevant during respiratory viral infections.

  8. A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.

    Science.gov (United States)

    Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C

    2015-01-29

    Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

    Directory of Open Access Journals (Sweden)

    Logan M. Decker

    2017-04-01

    Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

  10. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  11. Communicative Silences: Forms and Functions

    Science.gov (United States)

    Bruneau, Thomas J.

    1973-01-01

    The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

  12. Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

    Science.gov (United States)

    Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

    2017-08-15

    Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

  13. Breaching cultural silence: enhancing resilience among Ugandan ...

    African Journals Online (AJOL)

    Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

  14. RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

    Science.gov (United States)

    Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

    2014-04-01

    Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.

  15. Blocking miRNA Biogenesis in Adult Forebrain Neurons Enhances Seizure Susceptibility, Fear Memory, and Food Intake by Increasing Neuronal Responsiveness.

    Science.gov (United States)

    Fiorenza, Anna; Lopez-Atalaya, Jose P; Rovira, Victor; Scandaglia, Marilyn; Geijo-Barrientos, Emilio; Barco, Angel

    2016-04-01

    The RNase Dicer is essential for the maturation of most microRNAs, a molecular system that plays an essential role in fine-tuning gene expression. To gain molecular insight into the role of Dicer and the microRNA system in brain function, we conducted 2 complementary RNA-seq screens in the hippocampus of inducible forebrain-restricted Dicer1 mutants aimed at identifying the microRNAs primarily affected by Dicer loss and their targets, respectively. Functional genomics analyses predicted the main biological processes and phenotypes associated with impaired microRNA maturation, including categories related to microRNA biology, signal transduction, seizures, and synaptic transmission and plasticity. Consistent with these predictions, we found that, soon after recombination, Dicer-deficient mice exhibited an exaggerated seizure response, enhanced induction of immediate early genes in response to different stimuli, stronger and more stable fear memory, hyperphagia, and increased excitability of CA1 pyramidal neurons. In the long term, we also observed slow and progressive excitotoxic neurodegeneration. Overall, our results indicate that interfering with microRNA biogenesis causes an increase in neuronal responsiveness and disrupts homeostatic mechanisms that protect the neuron against overactivation, which may explain both the initial and late phenotypes associated with the loss of Dicer in excitatory neurons. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Plasma hydrogenated cationic detonation nanodiamonds efficiently deliver to human cells in culture functional siRNA targeting the Ewing sarcoma junction oncogene.

    Science.gov (United States)

    Bertrand, Jean-Rémi; Pioche-Durieu, Catherine; Ayala, Juan; Petit, Tristan; Girard, Hugues A; Malvy, Claude P; Le Cam, Eric; Treussart, François; Arnault, Jean-Charles

    2015-03-01

    The expression of a defective gene can lead to major cell dysfunctions among which cell proliferation and tumor formation. One promising therapeutic strategy consists in silencing the defective gene using small interfering RNA (siRNA). In previous publications we showed that diamond nanocrystals (ND) of primary size 35 nm, rendered cationic by polyethyleneimine-coating, can efficiently deliver siRNA into cell, which further block the expression of EWS/FLI-1 oncogene in a Ewing sarcoma disease model. However, a therapeutic application of such nanodiamonds requires their elimination by the organism, particularly in urine, which is impossible for 35 nm particles. Here, we report that hydrogenated cationic nanodiamonds of primary size 7 nm (ND-H) have also a high affinity for siRNA and are capable of delivering them in cells. With siRNA/ND-H complexes, we measured a high inhibition efficacy of EWS/FLI-1 gene expression in Ewing sarcoma cell line. Electron microscopy investigations showed ND-H in endocytosis compartments, and especially in macropinosomes from which they can escape before siRNA degradation occurred. In addition, the association of EWS/FLI-1 silencing by the siRNA/ND-H complex with a vincristine treatment yielded a potentiation of the toxic effect of this chemotherapeutic drug. Therefore ND-H appears as a promising delivery agent in anti-tumoral gene therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. IL-2 induction of IL-1 beta mRNA expression in monocytes. Regulation by agents that block second messenger pathways

    DEFF Research Database (Denmark)

    Kovacs, E J; Brock, B; Varesio, L

    1989-01-01

    We have previously shown that in mixed cultures of PBL incubation with human rIL-2 induces the rapid expression of IL-1 alpha and IL-1 beta mRNA. Because studies have demonstrated that IL-2R can be expressed on the surface of human peripheral blood monocytes, we chose to investigate whether IL-1 ...

  18. Distinct functions for the Drosophila piRNA pathway in genome maintenance and telomere protection.

    Directory of Open Access Journals (Sweden)

    Jaspreet S Khurana

    2010-12-01

    Full Text Available Transposons and other selfish DNA elements can be found in all phyla, and mobilization of these elements can compromise genome integrity. The piRNA (PIWI-interacting RNA pathway silences transposons in the germline, but it is unclear if this pathway has additional functions during development. Here we show that mutations in the Drosophila piRNA pathway genes, armi, aub, ago3, and rhi, lead to extensive fragmentation of the zygotic genome during the cleavage stage of embryonic divisions. Additionally, aub and armi show defects in telomere resolution during meiosis and the cleavage divisions; and mutations in lig-IV, which disrupt non-homologous end joining, suppress these fusions. By contrast, lig-IV mutations enhance chromosome fragmentation. Chromatin immunoprecipitation studies show that aub and armi mutations disrupt telomere binding of HOAP, which is a component of the telomere protection complex, and reduce expression of a subpopulation of 19- to 22-nt telomere-specific piRNAs. Mutations in rhi and ago3, by contrast, do not block HOAP binding or production of these piRNAs. These findings uncover genetically separable functions for the Drosophila piRNA pathway. The aub, armi, rhi, and ago3 genes silence transposons and maintain chromosome integrity during cleavage-stage embryonic divisions. However, the aub and armi genes have an additional function in assembly of the telomere protection complex.

  19. Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

    Directory of Open Access Journals (Sweden)

    Jiexiong Feng

    Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

  20. Post-translational regulation of miRNA pathway components, AGO1 and HYL1, in plants

    DEFF Research Database (Denmark)

    Cho, Seok Keun; Ryu, Moon Young; Shah, Pratik

    2016-01-01

    , the complexity of the proteome increases, and this then influences most biological processes. Although small RNAs are crucial regulatory elements for gene expression in most eukaryotes, PTMs of small RNA microprocessor and RNA silencing components have not been extensively investigated in plants. To date...... findings on the PTMs of microprocessor and RNA silencing components in plants....

  1. Epidural block

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/patientinstructions/000484.htm Epidural block - pregnancy To use the sharing features on this page, please enable JavaScript. An epidural block is a numbing medicine given by injection (shot) ...

  2. Engineering nanoparticles to silence bacterial communication

    Directory of Open Access Journals (Sweden)

    Kristen Publicover Miller

    2015-03-01

    Full Text Available The alarming spread of bacterial resistance to traditional antibiotics has warranted the study of alternative antimicrobial agents. Quorum sensing is a chemical cell-to-cell communication mechanism utilized by bacteria to coordinate group behaviors and establish infections. Quorum sensing is integral to bacterial survival, and therefore provides a unique target for antimicrobial therapy. In this study, silicon dioxide nanoparticles (Si-NP were engineered to target the signaling molecules (i.e. acylhomoserine lactones (HSL used for quorum sensing in order to halt bacterial communication. Specifically, when Si-NP were surface functionalized with beta-cyclodextrin (beta-CD, then added to cultures of bacteria (Vibrio fischeri, whose luminous output depends upon HSL-mediated quorum sensing, the cell-to-cell communication was dramatically reduced. Reductions in luminescence were further verified by quantitative polymerase chain reaction (qPCR analyses of luminescence genes. Binding of AHLs to Si-NPs was examined using nuclear magnetic resonance (NMR spectroscopy. The results indicated that by delivering high concentrations of engineered NPs with associated quenching compounds, the chemical signals were removed from the immediate bacterial environment. In actively-metabolizing cultures, this treatment blocked the ability of bacteria to communicate and regulate quorum sensing, effectively silencing and isolating the cells. Si-NPs provide a scaffold and critical stepping-stone for more pointed developments in antimicrobial therapy, especially with regard to quorum sensing – a target that will reduce resistance pressures imposed by traditional antibiotics.

  3. Population Blocks.

    Science.gov (United States)

    Smith, Martin H.

    1992-01-01

    Describes an educational game called "Population Blocks" that is designed to illustrate the concept of exponential growth of the human population and some potential effects of overpopulation. The game material consists of wooden blocks; 18 blocks are painted green (representing land), 7 are painted blue (representing water); and the remaining…

  4. The fission yeast ubiquitin-conjugating enzymes UbcP3, Ubc15, and Rhp6 affect transcriptional silencing of the mating-type region

    DEFF Research Database (Denmark)

    Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M

    2002-01-01

    Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...

  5. [E. M. Jellinek's silenced and silencing transgenerational story].

    Science.gov (United States)

    Kelemen, Gábor; Márk, Mónika

    2013-01-01

    Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

  6. Silencing honey bee naked cuticle (nkd) reduces Nosema ceranae replication and disease levels

    Science.gov (United States)

    Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera that has been implicated in alarming colony losses worldwide. RNA interference (RNAi), a post-transcriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling in...

  7. Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

    Science.gov (United States)

    Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

    2018-02-01

    Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco

    Science.gov (United States)

    An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...

  9. The origin and effect of small RNA signaling in plants

    Directory of Open Access Journals (Sweden)

    Jean-Sébastien eParent

    2012-08-01

    Full Text Available Given their sessile condition, land plants need to integrate environmental cues rapidly and send signal throughout the organism to modify their metabolism accordingly. Small RNA (sRNA molecules are among the messengers that plant cells use to carry such signals. These molecules originate from fold-back stem-loops transcribed from endogenous loci or from perfect double-stranded RNA produced through the action of RNA-dependent RNA polymerases. Once produced, sRNAs associate with Argonaute and other proteins to form the RNA-induced silencing complex (RISC that executes silencing of complementary RNA molecules. Depending on the nature of the RNA target and the Argonaute protein involved, RISC triggers either DNA methylation and chromatin modification (leading to transcriptional gene silencing, TGS or RNA cleavage or translational inhibition (leading to post-transcriptional gene silencing, PTGS. In some cases, sRNAs move to neighboring cells and/or to the vascular tissues for long-distance trafficking. Many genes are involved in the biogenesis of sRNAs and recent studies have shown that both their origin and their protein partners have great influence on their activity and range. Here we summarize the work done to uncover the mode of action of the different classes of small RNA with special emphasis on their movement and how plants can take advantage of their mobility. We also review the various genetic requirements needed for production, movement and perception of the silencing signal.

  10. Silence

    Science.gov (United States)

    Cogswell, J.

    2011-06-01

    On the occasion of the International Year of Astronomy, I was commissioned to create a mural for the University of Michigan Department of Astronomy, responding to an array of scientific images based on astronomical research, with special focus on the work of University of Michigan astronomers carried out within the building. My paper illustrates the development of this and several subsequent projects, explaining the implications for my artistic practice of entering into this conversation with astronomers and their work.

  11. DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

    Science.gov (United States)

    Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

    2003-04-24

    Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

  12. Arctiin blocks hydrogen peroxide-induced senescence and cell death though microRNA expression changes in human dermal papilla cells

    Directory of Open Access Journals (Sweden)

    Seunghee Bae

    2014-01-01

    Full Text Available BACKGROUND: Accumulating evidence indicates that reactive oxygen species (ROS are an important etiological factor for the induction of dermal papilla cell senescence and hair loss, which is also known alopecia. Arctiin is an active lignin isolated from Arctium lappa and has anti-inflammation, anti-microbial, and anti-carcinogenic effects. In the present study, we found that arctiin exerts anti-oxidative effects on human hair dermal papilla cells (HHDPCs. RESULTS: To better understand the mechanism, we analyzed the level of hydrogen peroxide (H2O2-induced cytotoxicity, cell death, ROS production and senescence after arctiin pretreatment of HHDPCs. The results showed that arctiin pretreatment significantly inhibited the H2O2-induced reduction in cell viability. Moreover, H2O2-induced sub-G1 phase accumulation and G2 cell cycle arrest were also downregulated by arctiin pretreatment. Interestingly, the increase in intracellular ROS mediated by H2O2 was drastically decreased in HHDPCs cultured in the presence of arctiin. This effect was confirmed by senescence associated-beta galactosidase (SA-β-gal assay results; we found that arctiin pretreatment impaired H2O2-induced senescence in HHDPCs. Using microRNA (miRNA microarray and bioinformatic analysis, we showed that this anti-oxidative effect of arctiin in HHDPCs was related with mitogen-activated protein kinase (MAPK and Wnt signaling pathways. CONCLUSIONS: Taken together, our data suggest that arctiin has a protective effect on ROS-induced cell dysfunction in HHDPCs and may therefore be useful for alopecia prevention and treatment strategies.

  13. Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

    2011-11-01

    Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

  14. The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

    Science.gov (United States)

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

    2013-12-23

    Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

  15. Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

    Directory of Open Access Journals (Sweden)

    Tatiana I Novobrantseva

    2012-01-01

    Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

  16. Mild and severe cereal yellow dwarf viruses differ in silencing suppressor efficiency of the P0 protein.

    Science.gov (United States)

    Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique

    2015-10-02

    Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

    Directory of Open Access Journals (Sweden)

    Yixiang Han

    Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

  18. The double-stranded RNA binding protein RDE-4 can act cell autonomously during feeding RNAi in C. elegans.

    Science.gov (United States)

    Raman, Pravrutha; Zaghab, Soriayah M; Traver, Edward C; Jose, Antony M

    2017-08-21

    Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

    Science.gov (United States)

    Fujii, Yoichi Robertus

    2013-01-01

    MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

  20. How Silent is the Right to Silence?

    Directory of Open Access Journals (Sweden)

    Katherine Biber

    2012-11-01

    Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

  1. Listen and the question of silence

    DEFF Research Database (Denmark)

    Doubinsky, Sebastien

    2018-01-01

    Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

  2. Suppressors of RNA silencing encoded by tomato leaf curl

    Indian Academy of Sciences (India)

    Whitefly-transmitted begomoviruses infecting tomato crop code for five different proteins, ORF AC4, ORF AC2 and ORF AV2 in DNA-A component, ORF BV1 in DNA-B ... In the present study suppressor function of ORF C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl ...

  3. Pulmonary administration of small interfering RNA : The route to go?

    NARCIS (Netherlands)

    Ruigrok, Mitchel; Frijlink, Henderik W.; Hinrichs, Wouter

    2016-01-01

    Ever since the discovery of RNA interference (RNAi), which is a post-transcriptional gene silencing mechanism, researchers have been studying the therapeutic potential of using small interfering RNA (siRNA) to treat diseases that are characterized by excessive gene expression. Excessive gene

  4. Argonaute: The executor of small RNA function.

    Science.gov (United States)

    Azlan, Azali; Dzaki, Najat; Azzam, Ghows

    2016-08-20

    The discovery of small non-coding RNAs - microRNA (miRNA), short interfering RNA (siRNA) and PIWI-interacting RNA (piRNA) - represents one of the most exciting frontiers in biology specifically on the mechanism of gene regulation. In order to execute their functions, these small RNAs require physical interactions with their protein partners, the Argonaute (AGO) family proteins. Over the years, numerous studies have made tremendous progress on understanding the roles of AGO in gene silencing in various organisms. In this review, we summarize recent progress of AGO-mediated gene silencing and other cellular processes in which AGO proteins have been implicated with a particular focus on progress made in flies, humans and other model organisms as compliment. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  5. Neutral Polymeric Micelles for RNA Delivery

    Science.gov (United States)

    Lundy, Brittany B.; Convertine, Anthony; Miteva, Martina; Stayton, Patrick S.

    2013-01-01

    RNA interference (RNAi) drugs have significant therapeutic potential but delivery systems with appropriate efficacy and toxicity profiles are still needed. Here, we describe a neutral, ampholytic polymeric delivery system based on conjugatable diblock polymer micelles. The diblock copolymer contains a hydrophilic poly[N-(2-hydroxypropyl) methacrylamide-co-N-(2-(pyridin-2- yldisulfanyl)ethyl)methacrylamide) (poly[HPMA-co-PDSMA]) segment to promote aqueous stability and facilitate thiol-disulfide exchange reactions, and a second ampholytic block composed of propyl acrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The poly[(HPMA-co-PDSMA)-b-(PAA-co-DMAEMA-co-BMA)] was synthesized using Reversible Addition-Fragmentation chain Transfer (RAFT) polymerization with an overall molecular weight of 22,000 g/mol and a PDI of 1.88. Dynamic light scattering and fluorescence measurements indicated that the diblock copolymers self-assemble under aqueous conditions to form polymeric micelles with a hydrodynamic radius and critical micelle concentration of 25 nm and 25 μg/mL respectively. Red blood cell hemolysis experiments show that the neutral hydrophilic micelles have potent membrane destabilizing activity at endosomal pH values. Thiolated siRNA targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was directly conjugated to the polymeric micelles via thiol exchange reactions with the pyridal disulfide groups present in the micelle corona. Maximum silencing activity in HeLa cells was observed at a 1:10 molar ratio of siRNA to polymer following a 48 h incubation period. Under these conditions 90 % mRNA knockdown and 65 % and protein knockdown of at 48 h was achieved with negligible toxicity. In contrast the polymeric micelles lacking a pH-responsive endosomalytic segment demonstrated negligible mRNA and protein knockdown under these conditions. The potent mRNA knockdown and excellent biocompatibility of the neutral siRNA conjugates

  6. Exon silencing by UAGG motifs in response to neuronal excitation.

    Directory of Open Access Journals (Sweden)

    Ping An

    2007-02-01

    Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.

  7. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2004-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  8. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2005-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  9. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2006-01-01

    ...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

  10. Silencing of Hsp27 and Hsp72 in glioma cells as a tool for programmed cell death induction upon temozolomide and quercetin treatment

    Energy Technology Data Exchange (ETDEWEB)

    Jakubowicz-Gil, Joanna, E-mail: jjgil@poczta.umcs.lublin.pl [Department of Comparative Anatomy and Anthropology, Maria Curie-Sklodowska University, Akademicka 19, 20-033 Lublin (Poland); Langner, Ewa [Department of Medical Biology, Institute of Agricultural Medicine, Jaczewskiego 2, 20-950 Lublin (Poland); Bądziul, Dorota [Department of Comparative Anatomy and Anthropology, Maria Curie-Sklodowska University, Akademicka 19, 20-033 Lublin (Poland); Wertel, Iwona [1st Department of Gynaecology, University School of Medicine, Staszica 16, 20-081 Lublin (Poland); Rzeski, Wojciech [Department of Medical Biology, Institute of Agricultural Medicine, Jaczewskiego 2, 20-950 Lublin (Poland); Department of Immunology and Virology, Maria Curie-Sklodowska University, Akademicka 19, 20-033 Lublin (Poland)

    2013-12-15

    The aim of the present study was to investigate whether silencing of Hsp27 or Hsp72 expression in glioblastoma multiforme T98G and anaplastic astrocytoma MOGGCCM cells increases their sensitivity to programmed cell death induction upon temozolomide and/or quercetin treatment. Transfection with specific siRNA was performed for the Hsp gene silencing. As revealed by microscopic observation and flow cytometry, the inhibition of Hsp expression was correlated with severe apoptosis induction upon the drug treatment studied. No signs of autophagy were detected. This was correlated with a decreased mitochondrial membrane potential, increased level of cytochrome c in the cytoplasm, and activation of caspase 3 and caspase 9. All these results suggest that the apoptotic signal was mediated by an internal pathway. Additionally, in a large percentage of cells treated with temozolomide, with or without quercetin, granules within the ER system were found, which was accompanied by an increased level of caspase 12 expression. This might be correlated with ER stress. Quercetin and temozolomide also changed the shape of nuclei from circular to “croissant like” in both transfected cell lines. Our results indicate that blocking of Hsp27 and Hsp72 expression makes T98G cells and MOGGCCM cells extremely vulnerable to apoptosis induction upon temozolomide and quercetin treatment and that programmed cell death is initiated by an internal signal. - Highlights: • Hsps gene silencing induced severe apoptosis upon temozolomide–quercetin treatment • Apoptosis in transfected glioma cells was initiated by internal signal • Programmed cell death was preceded by ER stress • Temozolomide–quercetin treatment changed nuclei shape in transfected glioma cells.

  11. RNA interference in Lepidoptera

    DEFF Research Database (Denmark)

    Terenius, Ole; Papanicolaou, Alexie; Garbutt, Jennie S.

    2011-01-01

    in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our...... experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi...... is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success...

  12. Promotion of Hendra Virus Replication by MicroRNA 146a

    Science.gov (United States)

    Marsh, Glenn A.; Jenkins, Kristie A.; Gantier, Michael P.; Tizard, Mark L.; Middleton, Deborah; Lowenthal, John W.; Haining, Jessica; Izzard, Leonard; Gough, Tamara J.; Deffrasnes, Celine; Stambas, John; Robinson, Rachel; Heine, Hans G.; Pallister, Jackie A.; Foord, Adam J.; Bean, Andrew G.; Wang, Lin-Fa

    2013-01-01

    Hendra virus is a highly pathogenic zoonotic paramyxovirus in the genus Henipavirus. Thirty-nine outbreaks of Hendra virus have been reported since its initial identification in Queensland, Australia, resulting in seven human infections and four fatalities. Little is known about cellular host factors impacting Hendra virus replication. In this work, we demonstrate that Hendra virus makes use of a microRNA (miRNA) designated miR-146a, an NF-κB-responsive miRNA upregulated by several innate immune ligands, to favor its replication. miR-146a is elevated in the blood of ferrets and horses infected with Hendra virus and is upregulated by Hendra virus in human cells in vitro. Blocking miR-146a reduces Hendra virus replication in vitro, suggesting a role for this miRNA in Hendra virus replication. In silico analysis of miR-146a targets identified ring finger protein (RNF)11, a member of the A20 ubiquitin editing complex that negatively regulates NF-κB activity, as a novel component of Hendra virus replication. RNA interference-mediated silencing of RNF11 promotes Hendra virus replication in vitro, suggesting that increased NF-κB activity aids Hendra virus replication. Furthermore, overexpression of the IκB superrepressor inhibits Hendra virus replication. These studies are the first to demonstrate a host miRNA response to Hendra virus infection and suggest an important role for host miRNAs in Hendra virus disease. PMID:23345523

  13. The Drosophila nerfin-1 mRNA requires multiple microRNAs to regulate its spatial and temporal translation dynamics in the developing nervous system.

    Science.gov (United States)

    Kuzin, Alexander; Kundu, Mukta; Brody, Thomas; Odenwald, Ward F

    2007-10-01

    The mRNA encoding the Drosophila Zn-finger transcription factor Nerfin-1, required for CNS axon pathfinding events, is subject to post-transcriptional silencing. Although nerfin-1 mRNA is expressed in many neural precursor cells including all early delaminating CNS neuroblasts, the encoded Nerfin-1 protein is detected only in the nuclei of neural precursors that divide just once to generate neurons and then only transiently in nascent neurons. Using a nerfin-1 promoter-controlled reporter transgene, replacement of the nerfin-1 3' UTR with the viral SV-40 3' UTR releases the neuroblast translational block and prolongs reporter protein expression in neurons. Comparative genomics analysis reveals that the nerfin-1 mRNA 3' UTR contains multiple highly conserved sequence blocks that either harbor and/or overlap 21 predicted binding sites for 18 different microRNAs. To determine the functional significance of these microRNA-binding sites and less conserved microRNA target sites, we have studied their ability to block or limit the expression of reporter protein in nerfin-1-expressing cells during embryonic development. Our results indicate that no single microRNA is sufficient to fully inhibit protein expression but rather multiple microRNAs that target different binding sites are required to block ectopic protein expression in neural precursor cells and temporally restrict expression in neurons. Taken together, these results suggest that multiple microRNAs play a cooperative role in the post-transcriptional regulation of nerfin-1 mRNA, and the high degree of microRNA-binding site evolutionary conservation indicates that all members of the Drosophila genus employ a similar strategy to regulate the onset and extinction dynamics of Nerfin-1 expression.

  14. Silence as a Response to Everyday Violence

    DEFF Research Database (Denmark)

    Gammeltoft, Tine

    2016-01-01

    Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

  15. Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

    Science.gov (United States)

    Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

    2017-05-01

    Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

    Science.gov (United States)

    Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

    2018-01-01

    Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

  17. In vitro and in vivo delivery of siRNA via VIPER polymer system to lung cells.

    Science.gov (United States)

    Feldmann, Daniel P; Cheng, Yilong; Kandil, Rima; Xie, Yuran; Mohammadi, Mariam; Harz, Hartmann; Sharma, Akhil; Peeler, David J; Moszczynska, Anna; Leonhardt, Heinrich; Pun, Suzie H; Merkel, Olivia M

    2018-04-28

    The block copolymer VIPER (virus-inspired polymer for endosomal release) has been reported to be a promising novel delivery system of DNA plasmids both in vitro and in vivo. VIPER is comprised of a polycation segment for condensation of nucleic acids as well as a pH-sensitive segment that exposes the membrane lytic peptide melittin in acidic environments to facilitate endosomal escape. The objective of this study was to investigate VIPER/siRNA polyplex characteristics, and compare their in vitro and in vivo performance with commercially available transfection reagents and a control version of VIPER lacking melittin. VIPER/siRNA polyplexes were formulated and characterized at various charge ratios and shown to be efficiently internalized in cultured cells. Target mRNA knockdown was confirmed by both flow cytometry and qRT-PCR and the kinetics of knockdown was monitored by live cell spinning disk microscopy, revealing knockdown starting by 4 h post-delivery. Intratracheal instillation of VIPER particles formulated with sequence specific siRNA to the lung of mice resulted in a significantly more efficient knockdown of GAPDH compared to treatment with VIPER particles formulated with scrambled sequence siRNA. We also demonstrated using pH-sensitive labels that VIPER particles experience less acidic environments compared to control polyplexes. In summary, VIPER/siRNA polyplexes efficiently deliver siRNA in vivo resulting in robust gene silencing (>75% knockdown) within the lung. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  19. Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

    International Nuclear Information System (INIS)

    Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

    2010-01-01

    Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

  20. Resveratrol via sirtuin-1 downregulates RE1-silencing transcription factor (REST) expression preventing PCB-95-induced neuronal cell death.

    Science.gov (United States)

    Guida, Natascia; Laudati, Giusy; Anzilotti, Serenella; Secondo, Agnese; Montuori, Paolo; Di Renzo, Gianfranco; Canzoniero, Lorella M T; Formisano, Luigi

    2015-11-01

    Resveratrol (3,5,4'-trihydroxystilbene) (RSV), a polyphenol widely present in plants, exerts a neuroprotective function in several neurological conditions; it is an activator of class III histone deacetylase sirtuin1 (SIRT1), a crucial regulator in the pathophysiology of neurodegenerative diseases. By contrast, the RE1-silencing transcription factor (REST) is involved in the neurotoxic effects following exposure to polychlorinated biphenyl (PCB) mixture A1254. The present study investigated the effects of RSV-induced activation of SIRT1 on REST expression in SH-SY5Y cells. Further, we investigated the possible relationship between the non-dioxin-like (NDL) PCB-95 and REST through SIRT1 to regulate neuronal death in rat cortical neurons. Our results revealed that RSV significantly decreased REST gene and protein levels in a dose- and time-dependent manner. Interestingly, overexpression of SIRT1 reduced REST expression, whereas EX-527, an inhibitor of SIRT1, increased REST expression and blocked RSV-induced REST downregulation. These results suggest that RSV downregulates REST through SIRT1. In addition, RSV enhanced activator protein 1 (AP-1) transcription factor c-Jun expression and its binding to the REST promoter gene. Indeed, c-Jun knockdown reverted RSV-induced REST downregulation. Intriguingly, in SH-SY5Y cells and rat cortical neurons the NDL PCB-95 induced necrotic cell death in a concentration-dependent manner by increasing REST mRNA and protein expression. In addition, SIRT1 knockdown blocked RSV-induced neuroprotection in rat cortical neurons treated with PCB-95. Collectively, these results indicate that RSV via SIRT1 activates c-Jun, thereby reducing REST expression in SH-SY5Y cells under physiological conditions and blocks PCB-95-induced neuronal cell death by activating the same SIRT1/c-Jun/REST pathway. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Detection block

    International Nuclear Information System (INIS)

    Bezak, A.

    1987-01-01

    A diagram is given of a detection block used for monitoring burnup of nuclear reactor fuel. A shielding block is an important part of the detection block. It stabilizes the fuel assembly in the fixing hole in front of a collimator where a suitable gamma beam is defined for gamma spectrometry determination of fuel burnup. The detector case and a neutron source case are placed on opposite sides of the fixing hole. For neutron measurement for which the water in the tank is used as a moderator, the neutron detector-fuel assembly configuration is selected such that neutrons from spontaneous fission and neutrons induced with the neutron source can both be measured. The patented design of the detection block permits longitudinal travel and rotation of the fuel assembly to any position, and thus more reliable determination of nuclear fuel burnup. (E.S.). 1 fig

  2. Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

    Science.gov (United States)

    Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

    2014-01-01

    We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

  3. MicroRNA-16 Modulates HuR Regulation of Cyclin E1 in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xun Guo

    2015-03-01

    Full Text Available RNA binding protein (RBPs and microRNAs (miRNAs or miRs are post-transcriptional regulators of gene expression that are implicated in development of cancers. Although their individual roles have been studied, the crosstalk between RBPs and miRNAs is under intense investigation. Here, we show that in breast cancer cells, cyclin E1 upregulation by the RBP HuR is through specific binding to regions in the cyclin E1 mRNA 3' untranslated region (3'UTR containing U-rich elements. Similarly, miR-16 represses cyclin E1, dependent on its cognate binding sites in the cyclin E1 3'UTR. Evidence in the literature indicates that HuR can regulate miRNA expression and recruit or dissociate RNA-induced silencing complexes (RISC. Despite this, miR-16 and HuR do not affect the other’s expression level or binding to the cyclin E1 3'UTR. While HuR overexpression partially blocks miR-16 repression of a reporter mRNA containing the cyclin E1 3'UTR, it does not block miR-16 repression of endogenous cyclin E1 mRNA. In contrast, miR-16 blocks HuR-mediated upregulation of cyclin E1. Overall our results suggest that miR-16 can override HuR upregulation of cyclin E1 without affecting HuR expression or association with the cyclin E1 mRNA.

  4. Public privacy: Reciprocity and Silence

    Directory of Open Access Journals (Sweden)

    Jenny Kennedy

    2014-10-01

    Full Text Available In his 1958 poem 'Dedication to my Wife' TS Eliot proclaims "these are private words addressed to you in public". Simultaneously written for his wife, Valerie Fletcher, and to the implied you of a discourse network, Eliot's poem helps to illustrate the narrative voices and silences that are constitutive of an intimate public sphere. This paper situates reciprocity as a condition of possibility for public privacy. It shows how reciprocity is enabled by systems of code operating through material and symbolic registers. Code promises to control communication, to produce neutral, systemic forms of meaning. Yet such automation is challenged by uneven and fragmented patterns of reciprocity. Moreover, examining the media of public privacy reveals historical trajectories important for understanding contemporary socio­technical platforms of reciprocity. To explore the implicit requirement of reciprocity in publicly private practices, three sites of communication are investigated framed by a media archaeology perspective: postal networks, the mail­art project PostSecret and the anonymous zine 'You'.

  5. Flexible tools for gene expression and silencing in tomato.

    Science.gov (United States)

    Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

    2009-12-01

    As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

  6. Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo

    NARCIS (Netherlands)

    Mook, Olaf R.; Baas, Frank; de Wissel, Marit B.; Fluiter, Kees

    2007-01-01

    RNA interference has become widely used as an experimental tool to study gene function. In addition, small interfering RNA (siRNA) may have great potential for the treatment of diseases. Recently, it was shown that siRNA can be used to mediate gene silencing in mouse models. Locally administered</