WorldWideScience

Sample records for block rna silencing

  1. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

    Science.gov (United States)

    Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

    2004-11-01

    Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

  2. Viral counterdefense on RNA silencing : analysis of RNA silencing suppressors from arthropod-borne negative strand RNA plant viruses

    NARCIS (Netherlands)

    Schnettler, E.

    2010-01-01

    This thesis describes that RNA silencing suppressor (RSS) proteins encoded by negative-stranded RNA plant viruses are able to interfere with different RNA silencing pathways in a variety of organisms by interacting with double stranded (ds)RNA molecules. These RSS proteins are able to counteract the

  3. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  4. Characterization and subcellular localization of an RNA silencing suppressor encoded by Rice stripe tenuivirus

    International Nuclear Information System (INIS)

    Xiong Ruyi; Wu Jianxiang; Zhou Yijun; Zhou Xueping

    2009-01-01

    Rice stripe virus (RSV) is a single-stranded (ss) RNA virus belonging to the genus Tenuivirus. RSV is present in many East Asian countries and causes severe diseases in rice fields, especially in China. In this study, we analyzed six proteins encoded by the virus for their abilities to suppress RNA silencing in plant using a green fluorescent protein (GFP)-based transient expression assay. Our results indicate that NS3 encoded by RSV RNA3, but not other five RSV encoded proteins, can strongly suppress local GFP silencing in agroinfiltrated Nicotiana benthamiana leaves. NS3 can reverse the GFP silencing, it can also prevent long distance spread of silencing signals which have been reported to be necessary for inducing systemic silencing in host plants. The NS3 protein can significantly reduce the levels of small interfering RNAs (siRNAs) in silencing cells, and was found to bind 21-nucleotide ss-siRNA, siRNA duplex and long ssRNA but not long double-stranded (ds)-RNA. Both N and C terminal of the NS3 protein are critical for silencing suppression, and mutation of the putative nuclear localization signal decreases its local silencing suppression efficiency and blocks its systemic silencing suppression. The NS3-GFP fusion protein and NS3 were shown to accumulate predominantly in nuclei of onion, tobacco and rice cells through transient expression assay or immunocytochemistry and electron microscopy. In addition, transgenic rice and tobacco plants expressing the NS3 did not show any apparent alteration in plant growth and morphology, although NS3 was proven to be a pathogenicity determinant in the PVX heterogenous system. Taken together, our results demonstrate that RSV NS3 is a suppressor of RNA silencing in planta, possibly through sequestering siRNA molecules generated in cells that are undergoing gene silencing.

  5. Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors

    Science.gov (United States)

    Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József

    2006-01-01

    RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105

  6. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    Marian A C Groenenboom

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  7. Antiviral RNA silencing viral counter defense in plants

    NARCIS (Netherlands)

    Bucher, E.C.

    2006-01-01

    The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

  8. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  9. Detailed characterization of the posttranscriptional gene-silencing-related small RNA in a GUS gene-silenced tobacco

    NARCIS (Netherlands)

    Hutvágner, G.; Mlynarova, L.; Nap, J.P.H.

    2000-01-01

    Posttranscriptional gene-silencing phenomena such as cosuppression and RNA interference are associated with the occurrence of small, about 21-23 nt short RNA species homologous to the silenced gene. We here show that the small RNA present in silenced transgenic plants can easily be detected in total

  10. RNA silencing is resistant to low-temperature in grapevine.

    Directory of Open Access Journals (Sweden)

    Marjorie Romon

    Full Text Available RNA silencing is a natural defence mechanism against viruses in plants, and transgenes expressing viral RNA-derived sequences were previously shown to confer silencing-based enhanced resistance against the cognate virus in several species. However, RNA silencing was shown to dysfunction at low temperatures in several species, questioning the relevance of this strategy in perennial plants such as grapevines, which are often exposed to low temperatures during the winter season. Here, we show that inverted-repeat (IR constructs trigger a highly efficient silencing reaction in all somatic tissues in grapevines. Similarly to other plant species, IR-derived siRNAs trigger production of secondary transitive siRNAs. However, and in sharp contrast to other species tested to date where RNA silencing is hindered at low temperature, this process remained active in grapevine cultivated at 4°C. Consistently, siRNA levels remained steady in grapevines cultivated between 26°C and 4°C, whereas they are severely decreased in Arabidopsis grown at 15°C and almost undetectable at 4°C. Altogether, these results demonstrate that RNA silencing operates in grapevine in a conserved manner but is resistant to far lower temperatures than ever described in other species.

  11. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... step in the RNA-silencing pathway that occurs after siRNA production (Zrachya et al. 2007). Geminiviruses (family Geminiviridae) are a diverse group of plant viruses with circular single-stranded DNA genomes that are composed of one or two components of 2700–. 3000 bp length which are encapsidated ...

  12. RNA silencing can explain chlorotic infection patterns on plant leaves

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-11-01

    Full Text Available Abstract Background RNA silencing has been implicated in virus symptom development in plants. One common infection symptom in plants is the formation of chlorotic tissue in leaves. Chlorotic and healthy tissue co-occur on a single leaf and form patterns. It has been shown that virus levels in chlorotic tissue are high, while they are low in healthy tissue. Additionally, the presence of siRNAs is confined to the chlorotic spots and the boundaries between healthy and infected tissue. These results strongly indicate that the interaction between virus growth and RNA silencing plays a role in the formation of infection patterns on leaves. However, how RNA silencing leads to the intricate patterns is not known. Results Here we elucidate the mechanisms leading to infection patterns and the conditions which lead to the various patterns observed. We present a modeling approach in which we combine intra- and inter-cellular dynamics of RNA silencing and viral growth. We observe that, due to the spread of viruses and the RNA silencing response, parts of the tissue become infected while other parts remain healthy. As is observed in experiments high virus levels coincide with high levels of siRNAs, and siRNAs are also present in the boundaries between infected and healthy tissue. We study how single- and double-stranded cleavage by Dicer and amplification by RNA-dependent RNA polymerase can affect the patterns formed. Conclusion This work shows that RNA silencing and virus growth within a cell, and the local spread of virions and siRNAs between cells can explain the heterogeneous spread of virus in leaf tissue, and therewith the observed infection patterns in plants.

  13. Viral suppressors of RNA silencing hinder exogenous and endogenous small RNA pathways in Drosophila.

    Directory of Open Access Journals (Sweden)

    Bassam Berry

    2009-06-01

    Full Text Available In plants and insects, RNA interference (RNAi is the main responder against viruses and shapes the basis of antiviral immunity. Viruses counter this defense by expressing viral suppressors of RNAi (VSRs. While VSRs in Drosophila melanogaster were shown to inhibit RNAi through different modes of action, whether they act on other silencing pathways remained unexplored.Here we show that expression of various plant and insect VSRs in transgenic flies does not perturb the Drosophila microRNA (miRNA pathway; but in contrast, inhibits antiviral RNAi and the RNA silencing response triggered by inverted repeat transcripts, and injection of dsRNA or siRNA. Strikingly, these VSRs also suppressed transposon silencing by endogenous siRNAs (endo-siRNAs.Our findings identify VSRs as tools to unravel small RNA pathways in insects and suggest a cosuppression of antiviral RNAi and endo-siRNA silencing by viruses during fly infections.

  14. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  15. Tat RNA silencing suppressor activity contributes to perturbation of lymphocyte miRNA by HIV-1

    Directory of Open Access Journals (Sweden)

    Yu Lianbo

    2011-05-01

    Full Text Available Abstract Background MicroRNA (miRNA-mediated RNA silencing is integral to virtually every cellular process including cell cycle progression and response to virus infection. The interplay between RNA silencing and HIV-1 is multifaceted, and accumulating evidence posits a strike-counterstrike interface that alters the cellular environment to favor virus replication. For instance, miRNA-mediated RNA silencing of HIV-1 translation is antagonized by HIV-1 Tat RNA silencing suppressor activity. The activity of HIV-1 accessory proteins Vpr/Vif delays cell cycle progression, which is a process prominently modulated by miRNA. The expression profile of cellular miRNA is altered by HIV-1 infection in both cultured cells and clinical samples. The open question stands of what, if any, is the contribution of Tat RNA silencing suppressor activity or Vpr/Vif activity to the perturbation of cellular miRNA by HIV-1. Results Herein, we compared the perturbation of miRNA expression profiles of lymphocytes infected with HIV-1NL4-3 or derivative strains that are deficient in Tat RNA silencing suppressor activity (Tat K51A substitution or ablated of the vpr/vif open reading frames. Microarrays recapitulated the perturbation of the cellular miRNA profile by HIV-1 infection. The miRNA expression trends overlapped ~50% with published microarray results on clinical samples from HIV-1 infected patients. Moreover, the number of miRNA perturbed by HIV-1 was largely similar despite ablation of Tat RSS activity and Vpr/Vif; however, the Tat RSS mutation lessened HIV-1 downregulation of twenty-two miRNAs. Conclusions Our study identified miRNA expression changes attributable to Tat RSS activity in HIV-1NL4-3. The results accomplish a necessary step in the process to understand the interface of HIV-1 with host RNA silencing activity. The overlap in miRNA expression trends observed between HIV-1 infected CEMx174 lymphocytes and primary cells supports the utility of cultured

  16. Distinct Effects of p19 RNA Silencing Suppressor on Small RNA Mediated Pathways in Plants.

    Directory of Open Access Journals (Sweden)

    Levente Kontra

    2016-10-01

    Full Text Available RNA silencing is one of the main defense mechanisms employed by plants to fight viruses. In change, viruses have evolved silencing suppressor proteins to neutralize antiviral silencing. Since the endogenous and antiviral functions of RNA silencing pathway rely on common components, it was suggested that viral suppressors interfere with endogenous silencing pathway contributing to viral symptom development. In this work, we aimed to understand the effects of the tombusviral p19 suppressor on endogenous and antiviral silencing during genuine virus infection. We showed that ectopically expressed p19 sequesters endogenous small RNAs (sRNAs in the absence, but not in the presence of virus infection. Our presented data question the generalized model in which the sequestration of endogenous sRNAs by the viral suppressor contributes to the viral symptom development. We further showed that p19 preferentially binds the perfectly paired ds-viral small interfering RNAs (vsiRNAs but does not select based on their sequence or the type of the 5' nucleotide. Finally, co-immunoprecipitation of sRNAs with AGO1 or AGO2 from virus-infected plants revealed that p19 specifically impairs vsiRNA loading into AGO1 but not AGO2. Our findings, coupled with the fact that p19-expressing wild type Cymbidium ringspot virus (CymRSV overcomes the Nicotiana benthamiana silencing based defense killing the host, suggest that AGO1 is the main effector of antiviral silencing in this host-virus combination.

  17. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  18. Recent patents in RNA silencing in plants: constructs, methods and applications in plant biotechnology.

    Science.gov (United States)

    López-Gomollón, Sara; Dalmay, Tamas

    2010-11-01

    RNA silencing is a recently discovered mechanism to regulate gene expression at transcriptional and posttranscriptional levels. It is based on the recognition and methylation of target genes or cleavage of target mRNAs by small RNA molecules, with length varying from 21 to 24 nucleotides. RNA silencing plays an important role modulating most of the important cell processes, such as growth, development or stress response. During the past few years, diverse strategies have been applied to exploit RNA silencing as a tool to create plants with enhanced economical properties or able to cope with pathogens or abiotic stress. This review describes the most important patents related to RNA silencing in plants, which disclose vectors designed to induce RNA silencing by hairpin RNAs, amplicons or virus-based plasmids, methods for detection and quantification of silencing as well as general uses in plant biotechnology.

  19. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Directory of Open Access Journals (Sweden)

    Adrian Valli

    Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  20. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Science.gov (United States)

    Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

    2012-01-01

    RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  1. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    Energy Technology Data Exchange (ETDEWEB)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)

    2009-10-07

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  2. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    Science.gov (United States)

    Ji, A. M.; Su, D.; Che, O.; Li, W. S.; Sun, L.; Zhang, Z. Y.; Yang, B.; Xu, F.

    2009-10-01

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  3. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    International Nuclear Information System (INIS)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B

    2009-01-01

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  4. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  5. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules

    NARCIS (Netherlands)

    Schnettler, E.; Hemmes, J.C.; Huisman, R.; Goldbach, R.W.; Prins, M.W.; Kormelink, R.J.M.

    2010-01-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs

  6. Receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient delivery system for MRTF silencing in conjunctival fibrosis.

    Science.gov (United States)

    Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T

    2016-02-24

    There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.

  7. C. elegans RNA-dependent RNA polymerases rrf-1 and ego-1 silence Drosophila transgenes by differing mechanisms.

    Science.gov (United States)

    Duan, Guowen; Saint, Robert B; Helliwell, Chris A; Behm, Carolyn A; Wang, Ming-Bo; Waterhouse, Peter M; Gordon, Karl H J

    2013-04-01

    Drosophila possesses the core gene silencing machinery but, like all insects, lacks the canonical RNA-dependent RNA polymerases (RdRps) that in C. elegans either trigger or enhance two major small RNA-dependent gene silencing pathways. Introduction of two different nematode RdRps into Drosophila showed them to be functional, resulting in differing silencing activities. While RRF-1 enhanced transitive dsRNA-dependent silencing, EGO-1 triggered dsRNA-independent silencing, specifically of transgenes. The strain w; da-Gal4; UAST-ego-1, constitutively expressing ego-1, is capable of silencing transgene including dsRNA hairpin upon a single cross, which created a powerful tool for research in Drosophila. In C. elegans, EGO-1 is involved in transcriptional gene silencing (TGS) of chromosome regions that are unpaired during meiosis. There was no opportunity for meiotic interactions involving EGO-1 in Drosophila that would explain the observed transgene silencing. Transgene DNA is, however, unpaired during the pairing of chromosomes in embryonic mitosis that is an unusual characteristic of Diptera, suggesting that in Drosophila, EGO-1 triggers transcriptional silencing of unpaired DNA during embryonic mitosis.

  8. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  9. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  10. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  11. MicroRNA mimicry blocks pulmonary fibrosis

    Science.gov (United States)

    Montgomery, Rusty L; Yu, Guoying; Latimer, Paul A; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva

    2014-01-01

    Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular disease. While many studies have shown therapeutic efficacy using miRNA inhibitors, efforts to restore or increase the function of a miRNA have been lagging behind. The miR-29 family has gained a lot of attention for its clear function in tissue fibrosis. This fibroblast-enriched miRNA family is downregulated in fibrotic diseases which induces a coordinate increase of many extracellular matrix genes. Here, we show that intravenous injection of synthetic RNA duplexes can increase miR-29 levels in vivo for several days. Moreover, therapeutic delivery of these miR-29 mimics during bleomycin-induced pulmonary fibrosis restores endogenous miR-29 function whereby decreasing collagen expression and blocking and reversing pulmonary fibrosis. Our data support the feasibility of using miRNA mimics to therapeutically increase miRNAs and indicate miR-29 to be a potent therapeutic miRNA for treating pulmonary fibrosis. PMID:25239947

  12. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing

    2010-05-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  13. Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

    NARCIS (Netherlands)

    Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

    2017-01-01

    Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

  14. On the Grammar of Silence: The Structure of My Undocumented Immigrant Writer's Block

    Science.gov (United States)

    Ledesma, Alberto

    2015-01-01

    In this reflective essay, Alberto Ledesma explores how being undocumented can produce a particular form of writer's block. He argues that there is a pattern of predictable silences and obfuscations inherent in all undocumented immigrant autobiographies that cannot be easily negotiated when undocumented students are asked to write about "their…

  15. Differential Inductions of RNA Silencing among Encapsidated Double-Stranded RNA Mycoviruses in the White Root Rot Fungus Rosellinia necatrix.

    Science.gov (United States)

    Yaegashi, Hajime; Shimizu, Takeo; Ito, Tsutae; Kanematsu, Satoko

    2016-06-15

    RNA silencing acts as a defense mechanism against virus infection in a wide variety of organisms. Here, we investigated inductions of RNA silencing against encapsidated double-stranded RNA (dsRNA) fungal viruses (mycoviruses), including a partitivirus (RnPV1), a quadrivirus (RnQV1), a victorivirus (RnVV1), a mycoreovirus (RnMyRV3), and a megabirnavirus (RnMBV1) in the phytopathogenic fungus Rosellinia necatrix Expression profiling of RNA silencing-related genes revealed that a dicer-like gene, an Argonaute-like gene, and two RNA-dependent RNA polymerase genes were upregulated by RnMyRV3 or RnMBV1 infection but not by other virus infections or by constitutive expression of dsRNA in R. necatrix Massive analysis of viral small RNAs (vsRNAs) from the five mycoviruses showed that 19- to 22-nucleotide (nt) vsRNAs were predominant; however, their ability to form duplexes with 3' overhangs and the 5' nucleotide preferences of vsRNAs differed among the five mycoviruses. The abundances of 19- to 22-nt vsRNAs from RnPV1, RnQV1, RnVV1, RnMyRV3, and RnMBV1 were 6.8%, 1.2%, 0.3%, 13.0%, and 24.9%, respectively. Importantly, the vsRNA abundances and accumulation levels of viral RNA were not always correlated, and the origins of the vsRNAs were distinguishable among the five mycoviruses. These data corroborated diverse interactions between encapsidated dsRNA mycoviruses and RNA silencing. Moreover, a green fluorescent protein (GFP)-based sensor assay in R. necatrix revealed that RnMBV1 infection induced silencing of the target sensor gene (GFP gene and the partial RnMBV1 sequence), suggesting that vsRNAs from RnMBV1 activated the RNA-induced silencing complex. Overall, this study provides insights into RNA silencing against encapsidated dsRNA mycoviruses. Encapsidated dsRNA fungal viruses (mycoviruses) are believed to replicate inside their virions; therefore, there is a question of whether they induce RNA silencing. Here, we investigated inductions of RNA silencing against

  16. On the role of RNA silencing in the pathogenicity and evolution of viroids and viral satellites

    Science.gov (United States)

    Wang, Ming-Bo; Bian, Xue-Yu; Wu, Li-Min; Liu, Li-Xia; Smith, Neil A.; Isenegger, Daniel; Wu, Rong-Mei; Masuta, Chikara; Vance, Vicki B.; Watson, John M.; Rezaian, Ali; Dennis, Elizabeth S.; Waterhouse, Peter M.

    2004-01-01

    Viroids and most viral satellites have small, noncoding, and highly structured RNA genomes. How they cause disease symptoms without encoding proteins and why they have characteristic secondary structures are two longstanding questions. Recent studies have shown that both viroids and satellites are capable of inducing RNA silencing, suggesting a possible role of this mechanism in the pathology and evolution of these subviral RNAs. Here we show that preventing RNA silencing in tobacco, using a silencing suppressor, greatly reduces the symptoms caused by the Y satellite of cucumber mosaic virus. Furthermore, tomato plants expressing hairpin RNA, derived from potato spindle tuber viroid, developed symptoms similar to those of potato spindle tuber viroid infection. These results provide evidence suggesting that viroids and satellites cause disease symptoms by directing RNA silencing against physiologically important host genes. We also show that viroid and satellite RNAs are significantly resistant to RNA silencing-mediated degradation, suggesting that RNA silencing is an important selection pressure shaping the evolution of the secondary structures of these pathogens. PMID:14978267

  17. siRNA Versus miRNA as Therapeutics for Gene Silencing

    Directory of Open Access Journals (Sweden)

    Jenny K W Lam

    2015-01-01

    Full Text Available Discovered a little over two decades ago, small interfering RNAs (siRNAs and microRNAs (miRNAs are noncoding RNAs with important roles in gene regulation. They have recently been investigated as novel classes of therapeutic agents for the treatment of a wide range of disorders including cancers and infections. Clinical trials of siRNA- and miRNA-based drugs have already been initiated. siRNAs and miRNAs share many similarities, both are short duplex RNA molecules that exert gene silencing effects at the post-transcriptional level by targeting messenger RNA (mRNA, yet their mechanisms of action and clinical applications are distinct. The major difference between siRNAs and miRNAs is that the former are highly specific with only one mRNA target, whereas the latter have multiple targets. The therapeutic approaches of siRNAs and miRNAs are therefore very different. Hence, this review provides a comparison between therapeutic siRNAs and miRNAs in terms of their mechanisms of action, physicochemical properties, delivery, and clinical applications. Moreover, the challenges in developing both classes of RNA as therapeutics are also discussed.

  18. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  19. Synthetic RNA Silencing in Bacteria – Antimicrobial Discovery and Resistance Breaking

    OpenAIRE

    Good, Liam; Stach, James E. M.

    2011-01-01

    The increasing incidence and prevalence of antibiotic resistance in bacteria threatens the “antibiotic miracle.” Conventional antimicrobial drug development has failed to replace the armamentarium needed to combat this problem, and novel solutions are urgently required. Here we review both natural and synthetic RNA silencing and its potential to provide new antibacterials through improved target selection, evaluation, and screening. Furthermore, we focus on synthetic RNA silencers as a novel ...

  20. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

    NARCIS (Netherlands)

    Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

    2004-01-01

    RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

  1. Silencing Huntington's chorea: Is RNA Interference a Potential Cure?

    Directory of Open Access Journals (Sweden)

    Gerlinde A. Metz

    2006-01-01

    Full Text Available In 1872, George Huntington described Huntington's disease as characterized by motor, cognitive and psychiatric impairments. Huntington's disease is a dominant and autosomal mutation on chromosome 4 featuring the insertion of numerous CAG repeats. CAG codes for the amino acid, glutmanine that forms part of the Huntingtin protein (htt. Excess glutamine attachments make htt prone to accumulate in neurons. Three genes can be considered when developing therapies for Huntington's disease. They include targeting the symptoms of the disease, the progression of the disease and the cause of the disease. By using RNA interference (RNAi, the cause of the disease can be targeted. RNAi is a method that could potentially silence the formation of abnormal htt. This paper will discuss how RNAi could potentially cure Huntington's disease, by describing the genetic and proteinomic basis of Huntington's disease, the function of RNAi in Huntington's disease and the problems of benefits of RNAi. Preliminary work using RNAi in transgenic mice has shown a decrease in the behavioural expression of the mutant Huntington gene. There are several limitations associated with using RNAi as a gene therapy. For example, the effects of RNAi are short lived. A transposition system such as Sleeping Beauty can be used to increase the integration of the gene, however, for patients who currently have Huntington's disease, RNAi may potentially be used in combination with drugs or other treatments to target both symptoms and the underlying cause of Huntington's disease. This combination could eventually alleviate many painful symptoms associated with Huntington's disease and could even stop the progressive neurodegeneration of Huntington's disease. This review concludes that a substantial amount of new research is still necessary before RNAi is directly applicable to human patients with Huntington's disease.

  2. The influenza A virus NS1 protein binds small interfering RNAs and suppresses RNA silencing in plants

    NARCIS (Netherlands)

    Bucher, E.C.; Hemmes, J.C.; Haan, de P.; Goldbach, R.W.; Prins, M.W.

    2004-01-01

    RNA silencing comprises a set of sequence-specific RNA degradation pathways that occur in a wide range of eukaryotes, including animals, fungi and plants. A hallmark of RNA silencing is the presence of small interfering RNA molecules (siRNAs). The siRNAs are generated by cleavage of larger

  3. Pathways of cellular internalisation of liposomes delivered siRNA and effects on siRNA engagement with target mRNA and silencing in cancer cells.

    Science.gov (United States)

    Alshehri, Abdullah; Grabowska, Anna; Stolnik, Snow

    2018-02-28

    Design of an efficient delivery system is a generally recognised bottleneck in translation of siRNA technology into clinic. Despite research efforts, cellular processes that determine efficiency of siRNA silencing achieved by different delivery formulations remain unclear. Here, we investigated the mechanism(s) of cellular internalisation of a model siRNA-loaded liposome system in a correlation to the engagement of delivered siRNA with its target and consequent silencing by adopting siRNA molecular beacon technology. Probing of cellular internalisation pathways by a panel of pharmacological inhibitors indicated that clathrin-mediated (dynamin-dependent) endocytosis, macropinocytosis (dynamine independent), and cell membrane cholesterol dependent process(es) (clathrin and caveolea-independent) all play a role in the siRNA-liposomes internalization. The inhibition of either of these entry routes was, in general, mirrored by a reduction in the level of siRNA engagement with its target mRNA, as well as in a reduction of the target gene silencing. A dramatic increase in siRNA engagement with its target RNA was observed on disruption of endosomal membrane (by chloroquine), accompanied with an increased silencing. The work thus illustrates that employing molecular beacon siRNA technology one can start to assess the target RNA engagement - a stage between initial cellular internalization and final gene silencing of siRNA delivery systems.

  4. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

    Science.gov (United States)

    Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

    2017-10-10

    The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

  5. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

    OpenAIRE

    Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

    2016-01-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

  6. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  7. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    In the present study suppressor function of ORF C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl Multan betasatellite CLCuMB–[IN:Sri:02] and Luffa leaf distortion betasatellite LuLDB-[IN:Lu:04] were examined. Agroinfiltration of GFP-silenced Nicotiana tabaccum cv.

  8. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... satellite DNA β which are predicted to function as silencing suppressors. In the present study suppressor function ... of plant viruses with circular single-stranded DNA genomes that are composed of one or two components of ..... 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M. Figure 4. Southern blot analysis of DNA ...

  9. Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

    Directory of Open Access Journals (Sweden)

    Elisabeth H. Vollmann

    2017-06-01

    Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

  10. Suppression of RNA silencing by a plant DNA virus satellite requires a host calmodulin-like protein to repress RDR6 expression.

    Directory of Open Access Journals (Sweden)

    Fangfang Li

    2014-02-01

    Full Text Available In plants, RNA silencing plays a key role in antiviral defense. To counteract host defense, plant viruses encode viral suppressors of RNA silencing (VSRs that target different effector molecules in the RNA silencing pathway. Evidence has shown that plants also encode endogenous suppressors of RNA silencing (ESRs that function in proper regulation of RNA silencing. The possibility that these cellular proteins can be subverted by viruses to thwart host defense is intriguing but has not been fully explored. Here we report that the Nicotiana benthamiana calmodulin-like protein Nbrgs-CaM is required for the functions of the VSR βC1, the sole protein encoded by the DNA satellite associated with the geminivirus Tomato yellow leaf curl China virus (TYLCCNV. Nbrgs-CaM expression is up-regulated by the βC1. Transgenic plants over-expressing Nbrgs-CaM displayed developmental abnormities reminiscent of βC1-associated morphological alterations. Nbrgs-CaM suppressed RNA silencing in an Agrobacterium infiltration assay and, when over-expressed, blocked TYLCCNV-induced gene silencing. Genetic evidence showed that Nbrgs-CaM mediated the βC1 functions in silencing suppression and symptom modulation, and was required for efficient virus infection. Moreover, the tobacco and tomato orthologs of Nbrgs-CaM also possessed ESR activity, and were induced by betasatellite to promote virus infection in these Solanaceae hosts. We further demonstrated that βC1-induced Nbrgs-CaM suppressed the production of secondary siRNAs, likely through repressing RNA-DEPENDENT RNA POLYMERASE 6 (RDR6 expression. RDR6-deficient N. benthamiana plants were defective in antiviral response and were hypersensitive to TYLCCNV infection. More significantly, TYLCCNV could overcome host range restrictions to infect Arabidopsis thaliana when the plants carried a RDR6 mutation. These findings demonstrate a distinct mechanism of VSR for suppressing PTGS through usurpation of a host ESR, and

  11. Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

    Directory of Open Access Journals (Sweden)

    Chantelle Ahlenstiel

    2015-01-01

    Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

  12. Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

    Science.gov (United States)

    Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

    2016-11-29

    Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

  13. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  14. Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer.

    Science.gov (United States)

    Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong

    2014-02-01

    The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

  15. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.

    2013-06-13

    Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  16. Biochemical and genetic functional dissection of the P38 viral suppressor of RNA silencing.

    Science.gov (United States)

    Iki, Taichiro; Tschopp, Marie-Aude; Voinnet, Olivier

    2017-05-01

    Phytoviruses encode viral suppressors of RNA silencing (VSRs) to counteract the plant antiviral silencing response, which relies on virus-derived small interfering (si)RNAs processed by Dicer RNaseIII enzymes and subsequently loaded into ARGONAUTE (AGO) effector proteins. Here, a tobacco cell-free system was engineered to recapitulate the key steps of antiviral RNA silencing and, in particular, the most upstream double-stranded (ds)RNA processing reaction, not kinetically investigated thus far in the context of plant VSR studies. Comparative biochemical analyses of distinct VSRs in the reconstituted assay showed that in all cases tested, VSR interactions with siRNA duplexes inhibited the loading, but not the activity, of antiviral AGO1 and AGO2. Turnip crinkle virus P38 displayed the additional and unique property to bind both synthetic and RNA-dependent-RNA-polymerase-generated long dsRNAs, and inhibited the processing into siRNAs. Single amino acid substitutions in P38 could dissociate dsRNA-processing from AGO-loading inhibition in vitro and in vivo, illustrating dual-inhibitory strategies discriminatively deployed within a single viral protein, which, we further show, are bona fide suppressor functions that evolved independently of the conserved coat protein function of P38. © 2017 Iki et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  17. Spatio-temporal requirements for transposable element piRNA-mediated silencing during Drosophila oogenesis.

    Science.gov (United States)

    Dufourt, Jérémy; Dennis, Cynthia; Boivin, Antoine; Gueguen, Nathalie; Théron, Emmanuelle; Goriaux, Coline; Pouchin, Pierre; Ronsseray, Stéphane; Brasset, Emilie; Vaury, Chantal

    2014-02-01

    During Drosophila oogenesis, transposable element (TE) repression involves the Piwi-interacting RNA (piRNA) pathway which ensures genome integrity for the next generation. We developed a transgenic model to study repression of the Idefix retrotransposon in the germline. Using a candidate gene KD-approach, we identified differences in the spatio-temporal requirements of the piRNA pathway components for piRNA-mediated silencing. Some of them (Aub, Vasa, Spn-E) are necessary in very early stages of oogenesis within the germarium and appear to be less important for efficient TE silencing thereafter. Others (Piwi, Ago3, Mael) are required at all stages of oogenesis. Moreover, during early oogenesis, in the dividing cysts within the germarium, Idefix anti-sense transgenes escape host control, and this is associated with very low piwi expression. Silencing of P-element-based transgenes is also strongly weakened in these cysts. This region, termed the 'Piwiless pocket' or Pilp, may ensure that new TE insertions occur and are transmitted to the next generation, thereby contributing to genome dynamics. In contrast, piRNA-mediated silencing is strong in germline stem cells in which TE mobilization is tightly repressed ensuring the continued production of viable germline cysts.

  18. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

    Directory of Open Access Journals (Sweden)

    Adriana F. Fusaro

    2017-10-01

    Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

  19. Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

    DEFF Research Database (Denmark)

    Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

    2011-01-01

    , cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...... by a combination of gel electrophoresis and MALDI-MS techniques, and the silencing capacity was evaluated in cellular luciferase-expressing systems using HB2 cells. Data show that platination of the antisense strand of the siRNAs results in adducts with protection against hydrolytic cleavage in the proximity...... of the platination sites, i.e., with altered degradation patterns compared to native RNAs. The MALDI-MS method was successfully used to further identify and characterize platinated RNA, with the naturally occurring platinum isotopic patterns serving as sensitive fingerprints for metalated sites. Expression assays...

  20. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    In this study, shRNA vectors having different stem length were constructed and their silencing effect was tested in mouse embryonic fibroblast and in vivo. Interfering RNAs were designed with stems of 21, 27, and 29 bp. The enhanced green fluorescent protein gene was used as target gene. The synthesized single strands ...

  1. The splicing machinery promotes RNA-directed DNA methylation and transcriptional silencing in Arabidopsis

    Science.gov (United States)

    Zhang, Cui-Jun; Zhou, Jin-Xing; Liu, Jun; Ma, Ze-Yang; Zhang, Su-Wei; Dou, Kun; Huang, Huan-Wei; Cai, Tao; Liu, Renyi; Zhu, Jian-Kang; He, Xin-Jian

    2013-01-01

    DNA methylation in transposons and other DNA repeats is conserved in plants as well as in animals. In Arabidopsis thaliana, an RNA-directed DNA methylation (RdDM) pathway directs de novo DNA methylation. We performed a forward genetic screen for suppressors of the DNA demethylase mutant ros1 and identified a novel Zinc-finger and OCRE domain-containing Protein 1 (ZOP1) that promotes Pol IV-dependent siRNA accumulation, DNA methylation, and transcriptional silencing. Whole-genome methods disclosed the genome-wide effects of zop1 on Pol IV-dependent siRNA accumulation and DNA methylation, suggesting that ZOP1 has both RdDM-dependent and -independent roles in transcriptional silencing. We demonstrated that ZOP1 is a pre-mRNA splicing factor that associates with several typical components of the splicing machinery as well as with Pol II. Immunofluorescence assay revealed that ZOP1 overlaps with Cajal body and is partially colocalized with NRPE1 and DRM2. Moreover, we found that the other development-defective splicing mutants tested including mac3a3b, mos4, mos12 and mos14 show defects in RdDM and transcriptional silencing. We propose that the splicing machinery rather than specific splicing factors is involved in promoting RdDM and transcriptional silencing. PMID:23524848

  2. The Ebola virus VP35 protein is a suppressor of RNA silencing

    NARCIS (Netherlands)

    Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

    2007-01-01

    RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is

  3. Baculovirus-mediated gene silencing in insect cells using intracellularly produced long double-stranded RNA

    NARCIS (Netherlands)

    Huang, Yi; Deng, F.; Hu, Z.H.; Vlak, J.M.; Wang, H.

    2007-01-01

    Double-stranded RNA-mediated interference (RNAi) has recently emerged as a powerful reverse genetics tool to silence gene expression in multiple organisms, including plants, nematodes and insects. In this study, DNA vectors capable of promoting the synthesis of long hairpin dsRNAs in vivo from a DNA

  4. MicroRNA mimicry blocks pulmonary fibrosis

    NARCIS (Netherlands)

    Montgomery, Rusty L; Yu, Guoying; Latimer, Paul A; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva

    2014-01-01

    Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular

  5. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    applied. LNA oligonucleotides are commercially available, can be transfected using standard techniques, are non-toxic, lead to increased target accessibility, can be designed to activate RNase H, and function in steric block approaches. LNA-Antisense, including gapmer LNA containing a central DNA...

  6. Nanoparticles for siRNA-Based Gene Silencing in Tumor Therapy.

    Science.gov (United States)

    Babu, Anish; Muralidharan, Ranganayaki; Amreddy, Narsireddy; Mehta, Meghna; Munshi, Anupama; Ramesh, Rajagopal

    2016-12-01

    Gene silencing through RNA interference (RNAi) has emerged as a potential strategy in manipulating cancer causing genes by complementary base-pairing mechanism. Small interfering RNA (siRNA) is an important RNAi tool that has found significant application in cancer therapy. However due to lack of stability, poor cellular uptake and high probability of loss-of-function due to degradation, siRNA therapeutic strategies seek safe and efficient delivery vehicles for in vivo applications. The current review discusses various nanoparticle systems currently used for siRNA delivery for cancer therapy, with emphasis on liposome based gene delivery systems. The discussion also includes various methods availed to improve nanoparticle based-siRNA delivery with target specificity and superior efficiency. Further this review describes challenges and perspectives on the development of safe and efficient nanoparticle based-siRNA-delivery systems for cancer therapy.

  7. An efficient method to enhance gene silencing by using precursor microRNA designed small hairpin RNAs.

    Science.gov (United States)

    Shan, Zhixin; Lin, Qiuxiong; Deng, Chunyu; Li, Xiaohong; Huang, Wei; Tan, Honghong; Fu, Yongheng; Yang, Min; Yu, Xi-Yong

    2009-07-01

    Gene silencing can be mediated by small interfering RNA (siRNA) and microRNA (miRNA). To investigate the potential application of using a precursor microRNA (pre-miRNA) backbone for gene silencing, we studied the inhibition efficiency of exogenous GFP and endogenous GAPDH by conventional shRNA- and pre-miRNA-designed hairpins, respectively. In this study, the conventional shRNA-, pre-miRNA-30-, and pre-miRNA-155-designed hairpins targeting either GFP or GAPDH were transfected into the HEK293 cells that were mediated by the pSilencer-4.1-neo vector, which carries a modified RNA polymerase II-type CMV promoter. Comparisons with conventional GFP shRNA showed that GFP levels were reduced markedly by pre-miRNA-30- and pre-miRNA-155-designed GFP shRNAs by fluorescence microscopy. The consistent results from semi-quantitative RT-PCR and Western blot analysis revealed that pre-miRNA-30- and pre-miRNA-155-designed GFP shRNAs could suppress GFP expression significantly. As for endogenous GAPDH, the results from semi-quantitative RT-PCR and Western blot analysis showed that pre-miRNA-30- and pre-miRNA-155-designed GAPDH shRNAs could suppress GAPDH expression even more efficiently than conventional GAPDH shRNA. Together, this study confirmed the efficiency of gene silencing mediated by pre-miRNA-30- and pre-miRNA-155-designed shRNAs, demonstrating that pre-miRNA-designed hairpins are a good strategy for gene silencing.

  8. Gold Nanorod-siRNA Induces Efficient In Vivo Gene Silencing in the Rat Hippocampus

    Science.gov (United States)

    Bonoiu, Adela C.; Bergey, Earl J.; Ding, Hong; Hu, Rui; Kumar, Rajiv; Yong, Ken-Tye; Prasad, Paras N.; Mahajan, Supriya; Picchione, Kelly E.; Bhattacharjee, Arin; Ignatowski, Tracey A.

    2011-01-01

    Gold nanorods (GNRs), cellular imaging nanoprobes, have been used for drug delivery therapy to immunologically privileged regions in the brain. We demonstrate that nanoplexes formed by electrostatic binding between negatively charged RNA and positively charged GNRs, silence the expression of the target housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) within the CA1 hippocampal region of the rat brain, without showing cytotoxicity. Fluorescence imaging with siRNACy3GAPDH and dark field imaging using plasmonic enhanced scattering from GNRs were used to monitor the distribution of the nanoplexes within different neuronal cell types present in the targeted hippocampal region. Our results show robust nanoplex uptake and slow release of the fluorescent gene silencer with significant impact on suppression of GAPDH gene expression (70% gene silencing, >10 days post-injection). The observed gene knockdown using nanoplexes in targeted regions of the brain opens a new era of drug treatment for neurological disorders. PMID:21718174

  9. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  10. Development of RNA Interference Trigger-Mediated Gene Silencing in Entamoeba invadens.

    Science.gov (United States)

    Suresh, Susmitha; Ehrenkaufer, Gretchen; Zhang, Hanbang; Singh, Upinder

    2016-04-01

    Entamoeba histolytica, a protozoan parasite, is an important human pathogen and a leading parasitic cause of death. The organism has two life cycle stages, trophozoites, which are responsible for tissue invasion, and cysts, which are involved in pathogen transmission. Entamoeba invadens is the model system to study Entamoeba developmental biology, as high-grade regulated encystation and excystation are readily achievable. However, the lack of gene-silencing tools in E. invadens has limited the molecular studies that can be performed. Using the endogenous RNA interference (RNAi) pathway in Entamoeba, we developed an RNAi-based trigger gene-silencing approach inE. invadens We demonstrate that a gene's coding region that has abundant antisense small RNAs (sRNAs) can trigger silencing of a gene that is fused to it. The trigger fusion leads to the generation of abundant antisense sRNAs that map to the target gene, with silencing occurring independently of trigger location at the 5' or 3' end of a gene. Gene silencing is stably maintained during development, including encystation and excystation. We have used this approach to successfully silence two E. invadens genes: a putative rhomboid protease gene and a SHAQKY family Myb gene. The Myb gene is upregulated during oxidative stress and development, and its downregulation led, as predicted, to decreased viability under oxidative stress and decreased cyst formation. Thus, the RNAi trigger silencing method can be used to successfully investigate the molecular functions of genes inE. invadens Dissection of the molecular basis of Entamoeba stage conversion is now possible, representing an important technical advance for the system. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense.

    Science.gov (United States)

    Liu, Sheng-Rui; Zhou, Jing-Jing; Hu, Chun-Gen; Wei, Chao-Ling; Zhang, Jin-Zhi

    2017-01-01

    MicroRNAs (miRNAs) are non-coding RNAs of approximately 20-24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant-pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  12. Comparison of approaches for efficient gene silencing induced by microRNA-based short hairpin RNA and indicator gene expression.

    Science.gov (United States)

    Shan, Z X; Lin, Q X; Deng, C Y; Zhou, Z L; Tan, H H; Fu, Y H; Li, X H; Zhu, J N; Mai, L P; Kuang, S J; Lin, S G; Yu, X Y

    2010-04-01

    MicroRNA-based short hairpin RNAs (shRNAs) are natural inducers of RNA interference and have been increasingly used in shRNA expression strategies. In the present study, we compared the efficiencies of exogenous green fluorescence protein (GFP) and endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) knockdown and red fluorescent protein (RFP) indicator expression mediated by three differently designed plasmids. RFP was introduced either at the 5' end, at the 3' end of the human mir155-based target gene (TG) (e.g., GFP or GAPDH) shRNA expression cassette (EC), or at the 3' end of the chimeric intron-containing TG shRNA EC. Comparisons with the control vector showed an obvious reduction of GFP or GAPDH expression with the various shRNA expression plasmids (P < 0.05). When RFP was located at the 5' end or at the 3' end of the TG shRNA EC, RFP expression was low; whereas when RFP was connected with the chimeric intron-containing TG shRNA EC, RFP expression was high. Taken together, this study demonstrated an efficient plasmid design for both TG silencing induced by microRNA-based shRNA and indicator gene expression in vitro.

  13. Comparing Gene Silencing and Physiochemical Properties in siRNA Bound Cationic Star-Polymer Complexes.

    Science.gov (United States)

    Dearnley, Megan; Reynolds, Nicholas P; Cass, Peter; Wei, Xiaohu; Shi, Shuning; Mohammed, A Aalam; Le, Tam; Gunatillake, Pathiraja; Tizard, Mark L; Thang, San H; Hinton, Tracey M

    2016-11-14

    The translation of siRNA into clinical therapies has been significantly delayed by issues surrounding the delivery of naked siRNA to target cells. Here we investigate siRNA delivery by cationic acrylic polymers developed by Reversible Addition-Fragmentation chain Transfer (RAFT) mediated free radical polymerization. We investigated cell uptake and gene silencing of a series of siRNA-star polymer complexes both in the presence and absence of a protein "corona". Using a multidisciplinary approach including quantitative nanoscale mechanical-atomic force microscopy, dynamic light scattering and nanoparticle tracking analysis we have characterized the nanoscale morphology, stiffness, and surface charge of the complexes with and without the protein corona. This is one of the first examples of a comprehensive physiochemical analysis of siRNA-polymer complexes being performed alongside in vitro biological assays, allowing us to describe a set of desirable physical features of cationic polymer complexes that promote gene silencing. Multifaceted studies such as this will improve our understanding of structure-function relationships in nanotherapeutics, facilitating the rational design of polymer-mediated siRNA delivery systems for novel treatment strategies.

  14. Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat.

    Science.gov (United States)

    Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio

    2016-09-01

    We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    OpenAIRE

    Liu, Sheng-Rui; Zhou, Jing-Jing; Hu, Chun-Gen; Wei, Chao-Ling; Zhang, Jin-Zhi

    2017-01-01

    MicroRNAs (miRNAs) are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense ...

  16. High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

    Directory of Open Access Journals (Sweden)

    Livia Donaire

    Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

  17. High-Throughput Sequencing of RNA Silencing-Associated Small RNAs in Olive (Olea europaea L.)

    Science.gov (United States)

    Donaire, Livia; Pedrola, Laia; de la Rosa, Raúl; Llave, César

    2011-01-01

    Small RNAs (sRNAs) of 20 to 25 nucleotides (nt) in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.). sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA) regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive. PMID:22140484

  18. Gene silencing by RNA interference in Sarcoptes scabiei: a molecular tool to identify novel therapeutic targets.

    Science.gov (United States)

    Fernando, Deepani D; Marr, Edward J; Zakrzewski, Martha; Reynolds, Simone L; Burgess, Stewart T G; Fischer, Katja

    2017-06-10

    Scabies is one of the most common and widespread parasitic skin infections globally, affecting a large range of mammals including humans, yet the molecular biology of Sarcoptes scabiei is astonishingly understudied. Research has been hampered primarily due to the difficulty of sampling or culturing these obligatory parasitic mites. A further and major impediment to identify and functionally analyse potential therapeutic targets from the recently emerging molecular databases is the lack of appropriate molecular tools. We performed standard BLAST based searches of the existing S. scabiei genome databases using sequences of genes described to be involved in RNA interference in Drosophila and the mite model organism Tetranychus urticae. Experimenting with the S. scabiei mu-class glutathione S-transferase (SsGST-mu1) as a candidate gene we explored the feasibility of gene knockdown in S. scabiei by double-stranded RNA-interference (dsRNAi). We provide here an analysis of the existing S. scabiei draft genomes, confirming the presence of a double stranded RNA (dsRNA) - mediated silencing machinery. We report for the first time experimental gene silencing by RNA interference (RNAi) in S. scabiei. Non-invasive immersion of S. scabiei in dsRNA encoding an S. scabiei glutathione S-transferase mu-class 1 enzyme (SsGST-mu1) resulted in a 35% reduction in the transcription of the target gene compared to controls. A series of experiments identified the optimal conditions allowing systemic experimental RNAi without detrimental side effects on mite viability. This technique can now be used to address the key questions on the fundamental aspects of mite biology and pathogenesis, and to assess the potential therapeutic benefits of silencing S. scabiei target genes.

  19. Virus-induced gene silencing of RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    Science.gov (United States)

    In eukaryotic cells, RNA polymerase III is highly conserved, contains 17 subunits and transcribes housekeeping genes such as ribosomal 50S rRNA, tRNA and other small RNAs. Functional roles of the RPC5 are poorly characterized in the literature. In this work, we report that virus-induced gene silenci...

  20. The Silencing of Carotenoid β-Hydroxylases by RNA Interference in Different Maize Genetic Backgrounds Increases the β-Carotene Content of the Endosperm

    Science.gov (United States)

    Berman, Judit; Zorrilla-López, Uxue; Sandmann, Gerhard; Capell, Teresa; Christou, Paul

    2017-01-01

    Maize (Zea mays L.) is a staple food in many parts of Africa, but the endosperm generally contains low levels of the pro-vitamin A carotenoid β-carotene, leading to vitamin A deficiency disease in populations relying on cereal-based diets. However, maize endosperm does accumulate high levels of other carotenoids, including zeaxanthin, which is derived from β-carotene via two hydroxylation reactions. Blocking these reactions could therefore improve the endosperm β-carotene content. Accordingly, we used RNA interference (RNAi) to silence the endogenous ZmBCH1 and ZmBCH2 genes, which encode two non-heme di-iron carotenoid β-hydroxylases. The genes were silenced in a range of maize genetic backgrounds by introgressing the RNAi cassette, allowing us to determine the impact of ZmBCH1/ZmBCH2 silencing in diverse hybrids. The β-carotene content of the endosperm increased substantially in all hybrids in which ZmBCH2 was silenced, regardless of whether or not ZmBCH1 was silenced simultaneously. However, the β-carotene content did not change significantly in C17 hybrids (M7 × C17 and M13 × C17) compared to C17 alone, because ZmBCH2 is already expressed at negligible levels in the C17 parent. Our data indicate that ZmBCH2 is primarily responsible for the conversion of β-carotene to zeaxanthin in maize endosperm. PMID:29186806

  1. Post-transcriptional gene silencing triggered by sense transgenes involves uncapped antisense RNA and differs from silencing intentionally triggered by antisense transgenes.

    Science.gov (United States)

    Parent, Jean-Sébastien; Jauvion, Vincent; Bouché, Nicolas; Béclin, Christophe; Hachet, Mélanie; Zytnicki, Matthias; Vaucheret, Hervé

    2015-09-30

    Although post-transcriptional gene silencing (PTGS) has been studied for more than a decade, there is still a gap in our understanding of how de novo silencing is initiated against genetic elements that are not supposed to produce double-stranded (ds)RNA. Given the pervasive transcription occurring throughout eukaryote genomes, we tested the hypothesis that unintended transcription could produce antisense (as)RNA molecules that participate to the initiation of PTGS triggered by sense transgenes (S-PTGS). Our results reveal a higher level of asRNA in Arabidopsis thaliana lines that spontaneously trigger S-PTGS than in lines that do not. However, PTGS triggered by antisense transgenes (AS-PTGS) differs from S-PTGS. In particular, a hypomorphic ago1 mutation that suppresses S-PTGS prevents the degradation of asRNA but not sense RNA during AS-PTGS, suggesting a different treatment of coding and non-coding RNA by AGO1, likely because of AGO1 association to polysomes. Moreover, the intended asRNA produced during AS-PTGS is capped whereas the asRNA produced during S-PTGS derives from 3' maturation of a read-through transcript and is uncapped. Thus, we propose that uncapped asRNA corresponds to the aberrant RNA molecule that is converted to dsRNA by RNA-DEPENDENT RNA POLYMERASE 6 in siRNA-bodies to initiate S-PTGS, whereas capped asRNA must anneal with sense RNA to produce dsRNA that initiate AS-PTGS. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

    International Nuclear Information System (INIS)

    Beck, Markus; Strand, Michael R.

    2003-01-01

    The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

  3. Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

    Science.gov (United States)

    Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

    2013-05-01

    We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  4. Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

    International Nuclear Information System (INIS)

    Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian

    2004-01-01

    Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

  5. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

    DEFF Research Database (Denmark)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

    2016-01-01

    Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory ha...... of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6 days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing....

  6. Gene silencing activity of siRNA polyplexes based on biodegradable polymers.

    Science.gov (United States)

    Varkouhi, Amir K; Lammers, Twan; Schiffelers, Raymond M; van Steenbergen, Mies J; Hennink, Wim E; Storm, Gert

    2011-04-01

    Cationic polymers are used as non-viral vectors for nucleic acid delivery. In this study, two biodegradable cationic polymers were evaluated for the purpose of siRNA delivery: pHPMA-MPPM (poly((2-hydroxypropyl) methacrylamide 1-methyl-2-piperidine methanol)) and TMC (O-methyl-free N,N,N-trimethylated chitosan). The silencing activity and the cellular cytotoxicity of polyplexes based on these biodegradable polymers were compared with those based on non-biodegradable pDMAEMA (poly(2-dimethylamino)ethyl methacrylate) and PEI (polyethylenimine) and with the regularly used lipidic transfection agent Lipofectamine. To promote endosomal escape, either the endosomolytic peptide diINF-7 was added to the formulations or photochemical internalization (PCI) was applied. Incubation of H1299 human lung cancer cells expressing firefly luciferase with polyplexes based on pHPMA-MPPM and TMC showed 30-40% silencing efficiency. This silencing activity was equal to or better than that obtained with the standard transfectants. Under all experimental conditions tested, the cytotoxicity of the biodegradable polymers was low. The application of PCI, as well as the addition of the diINF-7 peptide to the formulations increased their silencing activity up to 70-80%. This demonstrates that pHPMA-MPPM- and TMC-based polyplexes benefit substantially from endosomal escape enhancement. Importantly, the polyplexes retained their silencing activity in the presence of serum, and they showed low cytotoxicity. These biodegradable vectors are therefore attractive systems for further in vivo evaluations. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Global Effects on Gene Expression in Fission Yeast by Silencing and RNA Interference Machineries

    DEFF Research Database (Denmark)

    Hansen, Klavs R.; Burns, G.; Mata, J.

    2005-01-01

    Histone modifications influence gene expression in complex ways. The RNA interference (RNAi) machinery can repress transcription by recruiting histone-modifying enzymes to chromatin, although it is not clear whether this is a general mechanism for gene silencing or whether it requires repeated...... sequences such as long terminal repeats (LTRs). We analyzed the global effects of the Clr3 and Clr6 histone deacetylases, the Clr4 methyltransferase, the zinc finger protein Clr1, and the RNAi proteins Dicer, RdRP, and Argonaute on the transcriptome of Schizosaccharomyces pombe (fission yeast). The clr...... genes were repressed by both the silencing and RNAi machineries, with transcripts from centromeric repeats and Tf2 retrotransposons being notable exceptions. We found no correlation between repression by RNAi and proximity to LTRs, and the wtf family of repeated sequences seems to be repressed...

  8. The long noncoding RNA Kcnq1ot1 organises a lineage-specific nuclear domain for epigenetic gene silencing.

    Science.gov (United States)

    Redrup, Lisa; Branco, Miguel R; Perdeaux, Elizabeth R; Krueger, Christel; Lewis, Annabelle; Santos, Fátima; Nagano, Takashi; Cobb, Bradley S; Fraser, Peter; Reik, Wolf

    2009-02-01

    Long noncoding RNAs are implicated in a number of regulatory functions in eukaryotic genomes. The paternally expressed long noncoding RNA (ncRNA) Kcnq1ot1 regulates epigenetic gene silencing in an imprinted gene cluster in cis over a distance of 400 kb in the mouse embryo, whereas the silenced region extends over 780 kb in the placenta. Gene silencing by the Kcnq1ot1 RNA involves repressive histone modifications, including H3K9me2 and H3K27me3, which are partly brought about by the G9a and Ezh2 histone methyltransferases. Here, we show that Kcnq1ot1 is transcribed by RNA polymerase II, is unspliced, is relatively stable and is localised in the nucleus. Analysis of conditional Dicer mutants reveals that the RNAi pathway is not involved in gene silencing in the Kcnq1ot1 cluster. Instead, using RNA/DNA FISH we show that the Kcnq1ot1 RNA establishes a nuclear domain within which the genes that are epigenetically inactivated in cis are frequently found, whereas nearby genes that are not regulated by Kcnq1ot1 are localised outside of the domain. The Kcnq1ot1 RNA domain is larger in the placenta than in the embryo, consistent with more genes in the cluster being silenced in the placenta. Our results show for the first time that autosomal long ncRNAs can establish nuclear domains, which might create a repressive environment for epigenetic silencing of adjacent genes. Long ncRNAs in imprinting clusters and the Xist RNA on the inactive X chromosome thus appear to regulate epigenetic gene silencing by similar mechanisms.

  9. Different effects on ACC oxidase gene silencing triggered by RNA interference in transgenic tomato.

    Science.gov (United States)

    Xiong, Ai-Sheng; Yao, Quan-Hong; Peng, Ri-He; Li, Xian; Han, Pei-Lai; Fan, Hui-Qin

    2005-02-01

    RNA interference (RNAi) is a potent trigger for specific gene silencing of expression in a number of organisms and is an efficient way of shutting down gene expression. 1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the oxidation of ACC to ethylene, a plant growth regulator that plays an important role in the tomato ripening process. In this research, to produce double-stranded (ds)RNA of tomato ACC oxidase, we linked the sense and antisense configurations of DNA fragments with 1,002-bp or 7-nt artificially synthesized fragments, respectively, and then placed these under the control of a modified cauliflower mosaic virus 35S promoter. The dsRNA expression unit was successfully introduced into tomato cultivar Hezuo 906 by Agrobacterium tumefaciens-mediated transformation. Molecular analysis of 183 transgenic plants revealed that the dsRNA unit was integrated into the tomato genome. With respect to the construct with the 1,002-bp linker, the severity of phenotypes indicated that 72.3% of the transformed plants had non-RNA interference, about 18.1% had semi-RNA interference, and only 9.6% had full-RNA interference. However when the construct with the 7-nt linker was used for transformation, the results were 13.0%, 18.0%, and 69.0%, respectively, indicating that the short linker was more efficient in RNAi of transgenic tomato plants. When we applied this fast way of shutting down the ACC oxidase gene, transgenic tomato plants were produced that had fruit which released traces of ethylene and had a prolonged shelf life of more than 120 days. The RNA and protein analyses indicated that there was non-RNA interference, semi-RNA interference and full-RNA interference of ACC oxidase in the transgenic tomato plants.

  10. Spliced leader RNA silencing (SLS - a programmed cell death pathway in Trypanosoma brucei that is induced upon ER stress

    Directory of Open Access Journals (Sweden)

    Michaeli Shulamit

    2012-05-01

    Full Text Available Abstract Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite cycles between its insect (procyclic form and mammalian hosts (bloodstream form. Trypanosomes lack conventional transcription regulation, and their genes are transcribed in polycistronic units that are processed by trans-splicing and polyadenylation. In trans-splicing, which is essential for processing of each mRNA, an exon, the spliced leader (SL is added to all mRNAs from a small RNA, the SL RNA. Trypanosomes lack the machinery for the unfolded protein response (UPR, which in other eukaryotes is induced under endoplasmic reticulum (ER stress. Trypanosomes respond to such stress by changing the stability of mRNAs, which are essential for coping with the stress. However, under severe ER stress that is induced by blocking translocation of proteins to the ER, treatment of cells with chemicals that induce misfolding in the ER, or extreme pH, trypanosomes elicit the spliced leader silencing (SLS pathway. In SLS, the transcription of the SL RNA gene is extinguished, and tSNAP42, a specific SL RNA transcription factor, fails to bind to its cognate promoter. SLS leads to complete shut-off of trans-splicing. In this review, I discuss the UPR in mammals and compare it to the ER stress response in T. brucei leading to SLS. I summarize the evidence supporting the notion that SLS is a programmed cell death (PCD pathway that is utilized by the parasites to substitute for the apoptosis observed in higher eukaryotes under prolonged ER stress. I present the hypothesis that SLS evolved to expedite the death process, and rapidly remove from the population unfit parasites that, by elimination via SLS, cause minimal damage to the parasite population.

  11. MicroRNA-208a Silencing Attenuates Doxorubicin Induced Myocyte Apoptosis and Cardiac Dysfunction

    Directory of Open Access Journals (Sweden)

    Hasahya Tony

    2015-01-01

    Full Text Available Aims. GATA4 depletion is a distinct mechanism by which doxorubicin leads to cardiomyocyte apoptosis, and preservation of GATA4 mitigates doxorubicin induced myocyte apoptosis and cardiac dysfunction. We investigated a novel approach of attenuating doxorubicin induced cardiac toxicity by silencing miR-208a, a heart specific microRNA known to target GATA4. Methods and Results. Eight-week-old female Balb/C mice were randomly assigned to sham, antagomir, and control groups. Antagomir group were pretreated with miR-208a antagomir 4 days before doxorubicin administration. At day 0, control and antagomir groups received 20 mg/kg of doxorubicin, while sham mice received phosphate buffered solution. Echocardiography was done at day 7, after which animals were sacrificed and hearts harvested and assessed for apoptosis and expression of miR-208a, GATA4, and BCL-2. Doxorubicin significantly upregulated miR-208a, downregulated GATA4, and increased myocyte apoptosis, with resulting decrease in cardiac function. In contrast, therapeutic silencing of miR-208a salvaged GATA4 and BCL-2 and decreased apoptosis, with improvement in cardiac function. Conclusion. Doxorubicin upregulates miR-208a and promotes cardiomyocyte apoptosis, while therapeutic silencing of miR-208a attenuates doxorubicin induced myocyte apoptosis with subsequent improvement in cardiac function. These novel results highlight the therapeutic potential of targeting miR-208a to prevent doxorubicin cardiotoxicity.

  12. LIM-domain proteins, LIMD1, Ajuba, and WTIP are required for microRNA-mediated gene silencing.

    Science.gov (United States)

    James, Victoria; Zhang, Yining; Foxler, Daniel E; de Moor, Cornelia H; Kong, Yi Wen; Webb, Thomas M; Self, Tim J; Feng, Yungfeng; Lagos, Dimitrios; Chu, Chia-Ying; Rana, Tariq M; Morley, Simon J; Longmore, Gregory D; Bushell, Martin; Sharp, Tyson V

    2010-07-13

    In recent years there have been major advances with respect to the identification of the protein components and mechanisms of microRNA (miRNA) mediated silencing. However, the complete and precise repertoire of components and mechanism(s) of action remain to be fully elucidated. Herein we reveal the identification of a family of three LIM domain-containing proteins, LIMD1, Ajuba and WTIP (Ajuba LIM proteins) as novel mammalian processing body (P-body) components, which highlight a novel mechanism of miRNA-mediated gene silencing. Furthermore, we reveal that LIMD1, Ajuba, and WTIP bind to Ago1/2, RCK, Dcp2, and eIF4E in vivo, that they are required for miRNA-mediated, but not siRNA-mediated gene silencing and that all three proteins bind to the mRNA 5' m(7)GTP cap-protein complex. Mechanistically, we propose the Ajuba LIM proteins interact with the m(7)GTP cap structure via a specific interaction with eIF4E that prevents 4EBP1 and eIF4G interaction. In addition, these LIM-domain proteins facilitate miRNA-mediated gene silencing by acting as an essential molecular link between the translationally inhibited eIF4E-m(7)GTP-5(')cap and Ago1/2 within the miRISC complex attached to the 3'-UTR of mRNA, creating an inhibitory closed-loop complex.

  13. A Convenient In Vivo Model Using Small Interfering RNA Silencing to Rapidly Assess Skeletal Gene Function.

    Directory of Open Access Journals (Sweden)

    Wen Zhang

    Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of

  14. Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

    Science.gov (United States)

    Kelleher, Erin S.

    2016-01-01

    Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

  15. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens

    International Nuclear Information System (INIS)

    Pruss, Gail J.; Lawrence, Christopher B.; Bass, Troy; Li Qingshun Q.; Bowman, Lewis H.; Vance, Vicki

    2004-01-01

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms

  16. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  17. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  18. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia

    Science.gov (United States)

    2013-01-01

    Background Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. Results We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. Conclusions The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these

  19. The cricket paralysis virus suppressor inhibits microRNA silencing mediated by the Drosophila Argonaute-2 protein.

    Directory of Open Access Journals (Sweden)

    Corinne Besnard-Guérin

    Full Text Available Small RNAs are potent regulators of gene expression. They also act in defense pathways against invading nucleic acids such as transposable elements or viruses. To counteract these defenses, viruses have evolved viral suppressors of RNA silencing (VSRs. Plant viruses encoded VSRs interfere with siRNAs or miRNAs by targeting common mediators of these two pathways. In contrast, VSRs identified in insect viruses to date only interfere with the siRNA pathway whose effector Argonaute protein is Argonaute-2 (Ago-2. Although a majority of Drosophila miRNAs exerts their silencing activity through their loading into the Argonaute-1 protein, recent studies highlighted that a fraction of miRNAs can be loaded into Ago-2, thus acting as siRNAs. In light of these recent findings, we re-examined the role of insect VSRs on Ago-2-mediated miRNA silencing in Drosophila melanogaster. Using specific reporter systems in cultured Schneider-2 cells and transgenic flies, we showed here that the Cricket Paralysis virus VSR CrPV1-A but not the Flock House virus B2 VSR abolishes silencing by miRNAs loaded into the Ago-2 protein. Thus, our results provide the first evidence that insect VSR have the potential to directly interfere with the miRNA silencing pathway.

  20. NIR-induced spatiotemporally controlled gene silencing by upconversion nanoparticle-based siRNA nanocarrier.

    Science.gov (United States)

    Chen, Guojun; Ma, Ben; Xie, Ruosen; Wang, Yuyuan; Dou, Kefeng; Gong, Shaoqin

    2017-12-27

    Spatiotemporal control over the release or activation of biomacromolecules such as siRNA remains a significant challenge. Light-controlled release has gained popularity in recent years; however, a major limitation is that most photoactivable compounds/systems respond only to UV irradiation, but not near-infrared (NIR) light that offers a deeper tissue penetration depth and better biocompatibility. This paper reports a simple NIR-to-UV upconversion nanoparticle (UCNP)-based siRNA nanocarrier for NIR-controlled gene silencing. siRNA is complexed onto a NaYF 4 :Yb/Tm/Er UCNP through an azobenzene (Azo)-cyclodextrin (CD) host-guest interaction. The UV emission generated by the NIR-activated UCNP effectively triggers the trans-to-cis photoisomerization of azobenzene, thus leading to the release of siRNA due to unmatched host-guest pairs. The UCNP-siRNA complexes are also functionalized with PEG (i.e., UCNP-(CD/Azo)-siRNA/PEG NPs), targeting ligands (i.e., EGFR-specific GE11 peptide), acid-activatable cell-penetrating peptides (i.e., TH peptide), and imaging probes (i.e., Cy5 fluorophore). The UCNP-(CD/Azo)-siRNA/PEG NPs with both GE11 and TH peptides display a high level of cellular uptake and an excellent endosomal/lysosomal escape capability. More importantly, NIR-controlled spatiotemporal knockdown of GFP expression is successfully achieved in both a 2D monolayer cell model and a 3D multicellular tumor spheroid model. Thus, this simple and versatile nanoplatform has great potential for the selective activation or release of various biomacromolecules. Copyright © 2017. Published by Elsevier B.V.

  1. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-01-01

    Background: microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Methods: Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. Results: microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. Conclusions: microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma. PMID:24346283

  2. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma.

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-02-04

    microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma.

  3. Deep sequencing and proteomic analysis of the microRNA-induced silencing complex in human red blood cells.

    Science.gov (United States)

    Azzouzi, Imane; Moest, Hansjoerg; Wollscheid, Bernd; Schmugge, Markus; Eekels, Julia J M; Speer, Oliver

    2015-05-01

    During maturation, erythropoietic cells extrude their nuclei but retain their ability to respond to oxidant stress by tightly regulating protein translation. Several studies have reported microRNA-mediated regulation of translation during terminal stages of erythropoiesis, even after enucleation. In the present study, we performed a detailed examination of the endogenous microRNA machinery in human red blood cells using a combination of deep sequencing analysis of microRNAs and proteomic analysis of the microRNA-induced silencing complex. Among the 197 different microRNAs detected, miR-451a was the most abundant, representing more than 60% of all read sequences. In addition, miR-451a and its known target, 14-3-3ζ mRNA, were bound to the microRNA-induced silencing complex, implying their direct interaction in red blood cells. The proteomic characterization of endogenous Argonaute 2-associated microRNA-induced silencing complex revealed 26 cofactor candidates. Among these cofactors, we identified several RNA-binding proteins, as well as motor proteins and vesicular trafficking proteins. Our results demonstrate that red blood cells contain complex microRNA machinery, which might enable immature red blood cells to control protein translation independent of de novo nuclei information. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  4. From Embryo to Adult: piRNA-Mediated Silencing throughout Germline Development in Drosophila

    Directory of Open Access Journals (Sweden)

    Pauline P. Marie

    2017-02-01

    Full Text Available In metazoan germ cells, transposable element activity is repressed by small noncoding PIWI-associated RNAs (piRNAs. Numerous studies in Drosophila have elucidated the mechanism of this repression in the adult germline. However, when and how transposable element repression is established during germline development has not been addressed. Here, we show that homology-dependent trans silencing is active in female primordial germ cells from late embryogenesis through pupal stages, and that genes related to the adult piRNA pathway are required for silencing during development. In larval gonads, we detect rhino-dependent piRNAs indicating de novo biogenesis of functional piRNAs during development. Those piRNAs exhibit the molecular signature of the “ping-pong” amplification step. Moreover, we show that Heterochromatin Protein 1a is required for the production of piRNAs coming from telomeric transposable elements. Furthermore, as in adult ovaries, incomplete, bimodal, and stochastic repression resembling variegation can occur at all developmental stages. Clonal analysis indicates that the repression status established in embryonic germ cells is maintained until the adult stage, suggesting the implication of a cellular memory mechanism. Taken together, data presented here show that piRNAs and their associated proteins are epigenetic components of a continuous repression system throughout germ cell development.

  5. Allele-specific Gene Silencing of Mutant mRNA Restores Cellular Function in Ullrich Congenital Muscular Dystrophy Fibroblasts

    Directory of Open Access Journals (Sweden)

    Satoru Noguchi

    2014-01-01

    Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.

  6. Novel siRNA delivery system using a ternary polymer complex with strong silencing effect and no cytotoxicity.

    Science.gov (United States)

    Kodama, Yukinobu; Shiokawa, Yumi; Nakamura, Tadahiro; Kurosaki, Tomoaki; Aki, Keisei; Nakagawa, Hiroo; Muro, Takahiro; Kitahara, Takashi; Higuchi, Norihide; Sasaki, Hitoshi

    2014-01-01

    We developed a novel small interfering RNA (siRNA) delivery system using a ternary complex with polyethyleneimine (PEI) and γ-polyglutamic acid (γ-PGA), which showed silencing effect and no cytotoxicity. The binary complexes of siRNA with PEI were approximately 73-102 nm in particle size and 45-52 mV in ζ-potential. The silencing effect of siRNA/PEI complexes increased with an increase of PEI, and siRNA/PEI complexes with a charge ratio greater than 16 showed significant luciferase knockdown in a mouse colon carcinoma cell line regularly expressing luciferase (Colon26/Luc cells). However, strong cytotoxicity and blood agglutination were observed in the siRNA/Lipofectamine complex and siRNA/PEI16 complex. Recharging cationic complexes with an anionic compound was reported to be a promising method for overcoming these toxicities. We therefore prepared ternary complexes of siRNA with PEI (charge ratio 16) by the addition of γ-PGA to reduce cytotoxicity and deliver siRNA. As expected, the cytotoxicity of the ternary complexes decreased with an increase of γ-PGA content, which decreased the ζ-potential of the complexes. A strong silencing effect comparable to siRNA/Lipofectamine complex was discovered in ternary complexes including γ-PGA with an anionic surface charge. The high incorporation of ternary complexes into Colon26/Luc cells was confirmed with fluorescence microcopy. Having achieved knockdown of an exogenously transfected gene, the ability of the complex to mediate knockdown of an endogenous housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was assessed in B16-F10 cells. The ternary complex (siRNA/PEI16/γ-PGA12 complex) exhibited a significant GAPDH knockdown effect. Thus, we developed a useful siRNA delivery system.

  7. Small RNA-mediated Cry toxin silencing allows Bacillus thuringiensis to evade Caenorhabditis elegans avoidance behavioral defenses

    Science.gov (United States)

    Peng, Donghai; Luo, Xiaoxia; Zhang, Ni; Guo, Suxia; Zheng, Jinshui; Chen, Ling

    2018-01-01

    Abstract Pathogen avoidance behavior protects animal hosts against microbial pathogens. Pathogens have evolved specific strategies during coevolution in response to such host defenses. However, these strategies for combatting host avoidance behavioral defenses remain poorly understood. Here, we used Caenorhabditis elegans and its bacterial pathogen Bacillus thuringiensis as a model and determined that small RNA (sRNA)-mediated Cry toxin silencing allowed pathogens to evade host avoidance behavioral defenses. The B. thuringiensis strain YBT-1518, which encodes three nematicidal cry genes, is highly toxic to C. elegans. However, the expression of the most potent toxin, Cry5Ba, was silenced in this strain when YBT-1518 was outside the host. Cry5Ba silencing was due to the sRNA BtsR1, which bound to the RBS site of the cry5Ba transcript via direct base pairing and inhibited Cry5Ba expression. Upon ingestion by C. elegans, Cry5Ba was expressed in vivo by strain YBT-1518. Cry5Ba silencing may allow B. thuringiensis to avoid nematode behavioral defenses and then express toxins once ingested to kill the host and gain a survival advantage. Our work describes a novel model of sRNA-mediated regulation to aid pathogens in combating host avoidance behavioral defenses. PMID:29069426

  8. Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

    Science.gov (United States)

    Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

    2014-10-01

    Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

  9. microRNA-135b expression silences Ppm1e to provoke AMPK activation and inhibit osteoblastoma cell proliferation.

    Science.gov (United States)

    Li, Zheng-Wei; Zhu, Yun-Rong; Zhou, Xiao-Zhong; Zhuo, Bao-Biao; Wang, Xiao-Dong

    2017-04-18

    Forced-activation of AMP-activated protein kinase (AMPK) can possibly inhibit osteoblastoma cells. Here, we aim to provoke AMPK activation via microRNA silencing its phosphatase Ppm1e (protein phosphatase Mg2+/Mn2+-dependent 1e). We showed that microRNA-135b-5p ("miR-135b-5p"), the anti-Ppm1e microRNA, was significantly downregulated in human osteoblastoma tissues. It was correlated with Ppm1e upregulation and AMPKα1 de-phosphorylation. Forced-expression of miR-135b-5p in human osteoblastoma cells (MG-63 and U2OS lines) silenced Ppm1e, and induced a profound AMPKα1 phosphorylation (at Thr-172). Osteoblastoma cell proliferation was inhibited after miR-135b-5p expression. Intriguingly, Ppm1e shRNA knockdown similarly induced AMPKα1 phosphorylation, causing osteoblastoma cell proliferation. Reversely, AMPKα1 shRNA knockdown or dominant negative mutation almost abolished miR-135b-5p's actions in osteoblastoma cells. Further in vivo studies demonstrated that U2OS tumor growth in mice was dramatically inhibited after expressing miR-135b-5p or Ppm1e shRNA. Together, our results suggest that miR-135b-induced Ppm1e silence induces AMPK activation to inhibit osteoblastoma cell proliferation.

  10. microRNA-135b expression silences Ppm1e to provoke AMPK activation and inhibit osteoblastoma cell proliferation

    Science.gov (United States)

    Li, Zheng-Wei; Zhu, Yun-Rong; Zhou, Xiao-Zhong; Zhuo, Bao-Biao; Wang, Xiao-Dong

    2017-01-01

    Forced-activation of AMP-activated protein kinase (AMPK) can possibly inhibit osteoblastoma cells. Here, we aim to provoke AMPK activation via microRNA silencing its phosphatase Ppm1e (protein phosphatase Mg2+/Mn2+-dependent 1e). We showed that microRNA-135b-5p (“miR-135b-5p”), the anti-Ppm1e microRNA, was significantly downregulated in human osteoblastoma tissues. It was correlated with Ppm1e upregulation and AMPKα1 de-phosphorylation. Forced-expression of miR-135b-5p in human osteoblastoma cells (MG-63 and U2OS lines) silenced Ppm1e, and induced a profound AMPKα1 phosphorylation (at Thr-172). Osteoblastoma cell proliferation was inhibited after miR-135b-5p expression. Intriguingly, Ppm1e shRNA knockdown similarly induced AMPKα1 phosphorylation, causing osteoblastoma cell proliferation. Reversely, AMPKα1 shRNA knockdown or dominant negative mutation almost abolished miR-135b-5p's actions in osteoblastoma cells. Further in vivo studies demonstrated that U2OS tumor growth in mice was dramatically inhibited after expressing miR-135b-5p or Ppm1e shRNA. Together, our results suggest that miR-135b-induced Ppm1e silence induces AMPK activation to inhibit osteoblastoma cell proliferation. PMID:28460435

  11. RNA-mediated gene silencing of superoxide dismutase (bcsod1) in Botrytis cinerea

    NARCIS (Netherlands)

    Patel, R.M.; Kan, van J.A.L.; Bailey, A.M.; Foster, G.D.

    2008-01-01

    Gene silencing is a powerful tool utilized for identification of gene function and analysis in plants, animals, and fungi. Here, we report the silencing of superoxide dismutase (bcsod1) in Botrytis cinerea through sense and antisense-mediated silencing mechanisms. Because superoxide dismutase (SOD)

  12. GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

    Directory of Open Access Journals (Sweden)

    Guillaume Jannot

    2016-12-01

    Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

  13. Exonuclease-mediated degradation of nascent RNA silences genes linked to severe malaria

    DEFF Research Database (Denmark)

    Zhang, Qingfeng; Siegel, T Nicolai; Martins, Rafael M

    2014-01-01

    Antigenic variation of the Plasmodium falciparum multicopy var gene family enables parasite evasion of immune destruction by host antibodies. Expression of a particular var subgroup, termed upsA, is linked to the obstruction of blood vessels in the brain and to the pathogenesis of human cerebral......-associated exoribonuclease, termed PfRNase II, that controls the silencing of upsA var genes by marking their transcription start site and intron-promoter regions leading to short-lived cryptic RNA. Parasites carrying a deficient PfRNase II gene produce full-length upsA var transcripts and intron-derived antisense long non......-coding RNA. The presence of stable upsA var transcripts overcomes monoallelic expression, resulting in the simultaneous expression of both upsA and upsC type PfEMP1 proteins on the surface of individual infected red blood cells. In addition, we observe an inverse relationship between transcript levels of Pf...

  14. The RNA silencing enzyme RNA polymerase v is required for plant immunity.

    Directory of Open Access Journals (Sweden)

    Ana López

    2011-12-01

    Full Text Available RNA-directed DNA methylation (RdDM is an epigenetic control mechanism driven by small interfering RNAs (siRNAs that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1. NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V, which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence

  15. Silencing of microRNA-132 reduces renal fibrosis by selectively inhibiting myofibroblast proliferation.

    Science.gov (United States)

    Bijkerk, Roel; de Bruin, Ruben G; van Solingen, Coen; van Gils, Janine M; Duijs, Jacques M G J; van der Veer, Eric P; Rabelink, Ton J; Humphreys, Benjamin D; van Zonneveld, Anton Jan

    2016-06-01

    Chronic kidney disease is associated with progressive renal fibrosis, where perivascular cells give rise to the majority of α-smooth muscle actin (α-SMA) positive myofibroblasts. Here we sought to identify pericytic miRNAs that could serve as a target to decrease myofibroblast formation. Kidney fibrosis was induced in FoxD1-GC;Z/Red-mice by unilateral ureteral obstruction followed by FACS sorting of dsRed-positive FoxD1-derivative cells and miRNA profiling. MiR-132 selectively increased 21-fold during pericyte-to-myofibroblast formation, whereas miR-132 was only 2.5-fold up in total kidney lysates (both in obstructive and ischemia-reperfusion injury). MiR-132 silencing during obstruction decreased collagen deposition (35%) and tubular apoptosis. Immunohistochemistry, Western blot, and qRT-PCR confirmed a similar decrease in interstitial α-SMA(+) cells. Pathway analysis identified a rate-limiting role for miR-132 in myofibroblast proliferation that was confirmed in vitro. Indeed, antagomir-132-treated mice displayed a reduction in the number of proliferating Ki67(+) interstitial myofibroblasts. Interestingly, this was selective for the interstitial compartment and did not impair the reparative proliferation of tubular epithelial cells, as evidenced by an increase in Ki67(+) epithelial cells, as well as increased phospho-RB1, Cyclin-A and decreased RASA1, p21 levels in kidney lysates. Additional pathway and gene expression analyses suggest miR-132 coordinately regulates genes involved in TGF-β signaling (Smad2/Smad3), STAT3/ERK pathways, and cell proliferation (Foxo3/p300). Thus, silencing miR-132 counteracts the progression of renal fibrosis by selectively decreasing myofibroblast proliferation and could potentially serve as a novel antifibrotic therapy. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  16. AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Changho Eun

    Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

  17. rgs-CaM Detects and Counteracts Viral RNA Silencing Suppressors in Plant Immune Priming.

    Science.gov (United States)

    Jeon, Eun Jin; Tadamura, Kazuki; Murakami, Taiki; Inaba, Jun-Ichi; Kim, Bo Min; Sato, Masako; Atsumi, Go; Kuchitsu, Kazuyuki; Masuta, Chikara; Nakahara, Kenji S

    2017-10-01

    Primary infection of a plant with a pathogen that causes high accumulation of salicylic acid in the plant typically via a hypersensitive response confers enhanced resistance against secondary infection with a broad spectrum of pathogens, including viruses. This phenomenon is called systemic acquired resistance (SAR), which is a plant priming for adaption to repeated biotic stress. However, the molecular mechanisms of SAR-mediated enhanced inhibition, especially of virus infection, remain unclear. Here, we show that SAR against cucumber mosaic virus (CMV) in tobacco plants ( Nicotiana tabacum ) involves a calmodulin-like protein, rgs-CaM. We previously reported the antiviral function of rgs-CaM, which binds to and directs degradation of viral RNA silencing suppressors (RSSs), including CMV 2b, via autophagy. We found that rgs-CaM-mediated immunity is ineffective against CMV infection in normally growing tobacco plants but is activated as a result of SAR induction via salicylic acid signaling. We then analyzed the effect of overexpression of rgs-CaM on salicylic acid signaling. Overexpressed and ectopically expressed rgs-CaM induced defense reactions, including cell death, generation of reactive oxygen species, and salicylic acid signaling. Further analysis using a combination of the salicylic acid analogue benzo-(1,2,3)-thiadiazole-7-carbothioic acid S -methyl ester (BTH) and the Ca 2+ ionophore A23187 revealed that rgs-CaM functions as an immune receptor that induces salicylic acid signaling by simultaneously perceiving both viral RSS and Ca 2+ influx as infection cues, implying its autoactivation. Thus, secondary infection of SAR-induced tobacco plants with CMV seems to be effectively inhibited through 2b recognition and degradation by rgs-CaM, leading to reinforcement of antiviral RNA silencing and other salicylic acid-mediated antiviral responses. IMPORTANCE Even without an acquired immune system like that in vertebrates, plants show enhanced whole

  18. Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins

    Directory of Open Access Journals (Sweden)

    Katherine S. Bridge

    2017-07-01

    Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.

  19. Gene Silencing of 4-1BB by RNA Interference Inhibits Acute Rejection in Rats with Liver Transplantation

    Directory of Open Access Journals (Sweden)

    Yang Shi

    2013-01-01

    Full Text Available The 4-1BB signal pathway plays a key role in organ transplantation tolerance. In this study, we have investigated the effect of gene silencing of 4-1BB by RNA interference (RNAi on the acute rejection in rats with liver transplantation. The recombination vector of lentivirus that contains shRNA targeting the 4-1BB gene (LV-sh4-1BB was constructed. The liver transplantation was performed using the two-cuff technique. Brown-Norway (BN recipient rats were infected by the recombinant LVs. The results showed that gene silencing of 4-1BB by RNAi downregulated the 4-1BB gene expression of the splenic lymphocytes in vitro, and the splenic lymphocytes isolated from the rats with liver transplantation. LV-sh4-1BB decreased the plasma levels of liver injury markers including AST, ALT, and BIL and also decreased the level of plasma IL-2 and IFN-γ in recipient rats with liver transplantation. Lentivirus-mediated delivery of shRNA targeting 4-1BB gene prolonged the survival time of recipient and alleviated the injury of liver morphology in recipient rats with liver transplantation. In conclusion, our results demonstrate that gene silencing of 4-1BB by RNA interference inhibits the acute rejection in rats with liver transplantation.

  20. Gene Overexpression and RNA Silencing Tools for the Genetic Manipulation of the S-(+)-Abscisic Acid Producing Ascomycete Botrytis cinerea.

    Science.gov (United States)

    Ding, Zhong-Tao; Zhang, Zhi; Luo, Di; Zhou, Jin-Yan; Zhong, Juan; Yang, Jie; Xiao, Liang; Shu, Dan; Tan, Hong

    2015-05-06

    The phytopathogenic ascomycete Botrytis cinerea produces several secondary metabolites that have biotechnical significance and has been particularly used for S-(+)-abscisic acid production at the industrial scale. To manipulate the expression levels of specific secondary metabolite biosynthetic genes of B. cinerea with Agrobacterium tumefaciens-mediated transformation system, two expression vectors (pCBh1 and pCBg1 with different selection markers) and one RNA silencing vector, pCBSilent1, were developed with the In-Fusion assembly method. Both expression vectors were highly effective in constitutively expressing eGFP, and pCBSilent1 effectively silenced the eGFP gene in B. cinerea. Bcaba4, a gene suggested to participate in ABA biosynthesis in B. cinerea, was then targeted for gene overexpression and RNA silencing with these reverse genetic tools. The overexpression of bcaba4 dramatically induced ABA formation in the B. cinerea wild type strain Bc-6, and the gene silencing of bcaba4 significantly reduced ABA-production in an ABA-producing B. cinerea strain.

  1. MicroRNA156 improves drought stress tolerance in alfalfa (Medicago sativa) by silencing SPL13.

    Science.gov (United States)

    Arshad, Muhammad; Feyissa, Biruk A; Amyot, Lisa; Aung, Banyar; Hannoufa, Abdelali

    2017-05-01

    Alfalfa (Medicago sativa) is an important forage crop that is often grown in areas that frequently experience drought and water shortage. MicroRNA156 (miR156) is an emerging tool for improving various traits in plants. We tested the role of miR156d in drought response of alfalfa, and observed a significant improvement in drought tolerance of miR156 overexpression (miR156OE) alfalfa genotypes compared to the wild type control (WT). In addition to higher survival and reduced water loss, miR156OE genotypes also maintained higher stomatal conductance compared to WT during drought stress. Furthermore, we observed an enhanced accumulation of compatible solute (proline) and increased levels of abscisic acid (ABA) and antioxidants in miR156OE genotypes. Similarly, alfalfa plants with reduced expression of miR156-targeted SPL13 showed reduced water loss and enhanced stomatal conductance, chlorophyll content and photosynthetic assimilation. Several genes known to be involved in drought tolerance were differentially expressed in leaf and root of miR156 overexpression plants. Taken together, our findings reveal that miR156 improves drought tolerance in alfalfa at least partially by silencing SPL13. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  2. Grafting on a Non-Transgenic Tolerant Tomato Variety Confers Resistance to the Infection of a Sw5-Breaking Strain of Tomato spotted wilt virus via RNA Silencing.

    Directory of Open Access Journals (Sweden)

    Roberta Spanò

    Full Text Available RNA silencing controls endogenous gene expression and drives defensive reactions against invasive nucleic acids like viruses. In plants, it has been demonstrated that RNA silencing can be transmitted through grafting between scions and silenced rootstocks to attenuate virus and viroid accumulation in the scions. This has been obtained mostly using transgenic plants, which may be a drawback in current agriculture. In the present study, we examined the dynamics of infection of a resistance-breaking strain of Tomato spotted wilt virus (RB-TSWV through the graft between an old Apulian (southern Italy tomato variety, denoted Sl-Ma, used as a rootstock and commercial tomato varieties used as scions. In tests with non-grafted plants, Sl-Ma showed resistance to the RB-TSWV infection as viral RNA accumulated at low levels and plants recovered from disease symptoms by 21 days post inoculation. The resistance trait was transmitted to the otherwise highly susceptible tomato genotypes grafted onto Sl-Ma. The results from the analysis of small RNAs hallmark genes involved in RNA silencing and virus-induced gene silencing suggest that RNA silencing is involved in the resistance showed by Sl-Ma against RB-TSWV and in scions grafted on this rootstock. The results from self-grafted susceptible tomato varieties suggest also that RNA silencing is enhanced by the graft itself. We can foresee interesting practical implications of the approach described in this paper.

  3. Effect of silencing HOXA5 gene expression using RNA interference on cell cycle and apoptosis in Jurkat cells.

    Science.gov (United States)

    Huang, Hui-Ping; Liu, Wen-Jun; Guo, Qu-Lian; Bai, Yong-Qi

    2016-03-01

    Acute lymphocytic leukemia (ALL) is a common malignant tumor with a high morbidity rate among children, accounting for approximately 80% of leukemia cases. Although there have been improvements in the treatment of patients frequent relapse lead to a poor prognosis. The aim of the present study was to determine whether HOXA5 may be used as a target for gene therapy in leukemia in order to provide a new treatment. Mononuclear cells were extracted from the bone marrow according to the clinical research aims. After testing for ALL in the acute stage, the relative mRNA and protein expression of HOXA5 was detected in the ALL remission groups (n=25 cases per group) and the control group [n=20 cases, immune thrombocytopenia (ITP)]. Gene silencing by RNA interference (RNAi) was used to investigate the effect of silencing HOXA5 after small interfering RNA (siRNA) transfection to Jurkat cells. The HOXA5-specific siRNA was transfected to Jurkat cells using lipofectamine. The experiment was divided into the experimental group (liposomal transfection of HOXA5 targeting siRNA), the negative control group (liposomal transfection of cells with negative control siRNA) and the control group (plus an equal amount of cells and culture media only). Western blotting and quantitative fluorescent polymerase chain reaction (QF‑PCR) were used to detect the relative HOXA5 mRNA expression and protein distribution in each cell group. Cell distribution in the cell cycle and the rate of cells undergoing apoptosis were determined using flow cytometry. The expression of HOXA5 at the mRNA and protein levels in the acute phase of ALL was significantly higher than that in ALL in the remission and control groups. In cells transfected with HOXA5-specific siRNA, the expression of HOXA5 at the mRNA and protein levels decreased significantly (PJurkat cells, thus inhibiting cell proliferation.

  4. Biotechnological approaches for plant viruses resistance: from general to the modern RNA silencing pathway

    Directory of Open Access Journals (Sweden)

    Silas Pessini Rodrigues

    2009-08-01

    Full Text Available Virus diseases are significant threats to modern agriculture and their control remains a challenge to the management of cultivation. The main virus resistance strategies are based on either natural resistance or engineered virus-resistant plants. Recent progress in understanding the molecular mechanisms underlying the roles of resistance genes has promoted the development of new anti-virus strategies. Engineered plants, in particular plants expressing RNA-silencing nucleotides, are becoming increasingly important and are likely to provide more effective strategies in future. A general discussion on the biotechnology of plant responses to virus infection is followed by recent advances in engineered plant resistance.As viroses são problemas importantes para a agricultura moderna e o seu controle representa um desafio para o manejo de áreas cultivadas. As principais estratégias de resistência a vírus se baseiam em mecanismos naturais ou em engenharia genética. Recentemente, a maior compreensão dos mecanismos moleculares envolvidos na função de genes de resistência da planta facilitou o desenvolvimento de novas estratégias antivirais. Plantas modificadas geneticamente, em particular aquelas expressando a via de silenciamento de RNA, são alvo de interesse crescente e representam a possibilidade de estratégias futuras mais efetivas. Neste trabalho são discutidos diferentes aspectos relacionados à resistência a viroses em plantas. Adicionalmente, a perspectiva de aplicação biotecnológica das diferentes vias de resistência é apresentada.

  5. siRNA delivery using polyelectrolyte-gold nanoassemblies in neuronal cells for BACE1 gene silencing.

    Science.gov (United States)

    Chaudhary, Aparna; Garg, Sanjeev

    2017-11-01

    Small interfering RNA (siRNA) mediated RNA interference is a versatile therapeutic tool for many intractable genetic disorders. Various nanoassemblies specifically designed to deliver the siRNAs could be utilized for efficient siRNA delivery which is one of the major concern for the success of this therapeutic. Thus, in the present study, polyelectrolyte-gold nanoassemblies (PE-Gold NAs) were selected for siRNA delivery of an in vitro verified siRNA. Three different polyelectrolytes (polyethyleneimine, citraconic anhydride modified poly (allylamine) hydrochloride and poly l-arginine) were used to formulate the PE-Gold NAs using the layer-by-layer technique. Successful physico-chemical characterizations of these PE-Gold NAs were performed using UV-Visible, FTIR, 1 H-NMR spectroscopies, XRD, TEM, DLS and Zeta potential measurements. In vitro studies for the cytotoxicity, the uptake of these nanoassemblies and the gene silencing were carried out using these PE-Gold NAs in N2a and NB4 1A3 (murine neuronal) cell lines. The three selected PE-Gold NAs showed significant BACE1 (β-site APP cleaving enzyme 1) gene silencing (50-60%). This work demonstrates the potential of PE-Gold NAs to deliver siRNA targeting BACE1 in neuronal cells. Finally, it was concluded that different polyelectrolytes used in the PE-Gold NAs achieve different gene silencing due to the variation in their delivery efficiencies. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

    Science.gov (United States)

    Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

    2012-01-01

    RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

  7. A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

    Directory of Open Access Journals (Sweden)

    Christiane Noronha Fernandes-Brum

    Full Text Available microRNAs (miRNAs are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs are derived from double-stranded RNA (dsRNA or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL in processing the smallRNAs (sRNAs and ARGONAUTE (AGO as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR, Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated, and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

  8. siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

    Science.gov (United States)

    Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

    2008-09-18

    Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

  9. Multitasking of the piRNA Silencing Machinery: Targeting Transposable Elements and Foreign Genes in the Bdelloid Rotifer Adineta vaga.

    Science.gov (United States)

    Rodriguez, Fernando; Arkhipova, Irina R

    2016-05-01

    RNA-mediated silencing processes play a key role in silencing of transposable elements, especially in the germ line, where piwi-interacting RNAs (piRNAs) are responsible for suppressing transposon mobility and maintaining genome integrity. We previously reported that the genome of Adineta vaga, the first sequenced representative of the phylum Rotifera (class Bdelloidea), is characterized by massive levels of horizontal gene transfer, by unusually low transposon content, and by highly diversified RNA-mediated silencing machinery. Here, we investigate genome-wide distribution of pi-like small RNAs, which in A. vaga are 25-31 nucleotides in length and have a strong 5'-uridine bias, while lacking ping-pong amplification signatures. In agreement with expectations, 71% of mapped reads corresponded to annotated transposons, with 93% of these reads being in the antisense orientation. Unexpectedly, a significant fraction of piRNAs originate from predicted coding regions corresponding to genes of putatively foreign origin. The distribution of piRNAs across foreign genes is not biased toward 3'-UTRs, instead resembling transposons in uniform distribution pattern throughout the gene body, and in predominantly antisense orientation. We also find that genes with small RNA coverage, including a number of genes of metazoan origin, are characterized by higher occurrence of telomeric repeats in the surrounding genomic regions, and by higher density of transposons in the vicinity, which have the potential to promote antisense transcription. Our findings highlight the complex interplay between RNA-based silencing processes and acquisition of genes at the genome periphery, which can result either in their loss or eventual domestication and integration into the host genome. Copyright © 2016 by the Genetics Society of America.

  10. The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

    KAUST Repository

    Chen, Hao

    2010-09-28

    The Arabidopsis FIERY1 (FRY1) locus was originally identified as a negative regulator of stress-responsive gene expression and later shown to be required for suppression of RNA silencing. In this study we discovered that the FRY1 locus also regulates lateral root formation. Compared with the wild type, fry1 mutant seedlings generated significantly fewer lateral roots under normal growth conditions and also exhibited a dramatically reduced sensitivity to auxin in inducing lateral root initiation. Using transgenic plants that overexpress a yeast homolog of FRY1 that possesses only the 3\\', 5\\'-bisphosphate nucleotidase activity but not the inositol 1-phosphatase activity, we demonstrated that the lateral root phenotypes in fry1 result from loss of the nucleotidase activity. Furthermore, a T-DNA insertion mutant of another RNA silencing suppressor, XRN4 (but not XRN2 or XRN3), which is an exoribonuclease that is inhibited by the substrate of the FRY1 3\\', 5\\'-bisphosphate nucleotidase, exhibits similar lateral root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results indicate that RNA silencing modulated by FRY1 and XRN4 plays an important role in shaping root architecture. © 2010 Blackwell Publishing Ltd.

  11. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  12. RNA silencing and HIV: A hypothesis for the etiology of the severe combined immunodeficiency induced by the virus

    Directory of Open Access Journals (Sweden)

    Ludwig Linda B

    2008-09-01

    Full Text Available Abstract A novel intrinsic HIV-1 antisense gene was previously described with RNA initiating from the region of an HIV-1 antisense initiator promoter element (HIVaINR. The antisense RNA is exactly complementary to HIV-1 sense RNA and capable of forming ~400 base-pair (bp duplex RNA in the region of the long terminal repeat (LTR spanning the beginning portion of TAR in the repeat (R region and extending through the U3 region. Duplex or double-stranded RNA of several hundred nucleotides in length is a key initiating element of RNA interference (RNAi in several species. This HIVaINR antisense RNA is also capable of forming multiple stem-loop or hairpin-like secondary structures by M-fold analysis, with at least one that perfectly fits the criteria for a microRNA (miRNA precursor. MicroRNAs (miRNAs interact in a sequence-specific manner with target messenger RNAs (mRNAs to induce either cleavage of the message or impede translation. Human mRNA targets of the predicted HIVaINR antisense RNA (HAA microRNAs include mRNA for the human interleukin-2 receptor gamma chain (IL-2RG, also called the common gamma (γc receptor chain, because it is an integral part of 6 receptors mediating interleukin signalling (IL-2R, IL-4R, IL-7R, IL-9R, IL-15R and IL-21R. Other potential human mRNA targets include interleukin-15 (IL-15 mRNA, the fragile × mental retardation protein (FMRP mRNA, and the IL-1 receptor-associated kinase 1 (IRAK1 mRNA, amongst others. Thus the proposed intrinsic HIVaINR antisense RNA microRNAs (HAAmiRNAs of the human immunodeficiency virus form complementary targets with mRNAs of a key human gene in adaptive immunity, the IL-2Rγc, in which genetic defects are known to cause an X-linked severe combined immunodeficiency syndrome (X-SCID, as well as mRNAs of genes important in innate immunity. A new model of intrinsic RNA silencing induced by the HIVaINR antisense RNA in the absence of Tat is proposed, with elements suggestive of both small

  13. Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes.

    Science.gov (United States)

    Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S

    2016-05-01

    RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    International Nuclear Information System (INIS)

    Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

    2010-01-01

    Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

  15. 2'-O-methyl-modified anti-MDR1 fork-siRNA duplexes exhibiting high nuclease resistance and prolonged silencing activity.

    Science.gov (United States)

    Petrova Kruglova, Natalya S; Meschaninova, Mariya I; Venyaminova, Alya G; Zenkova, Marina A; Vlassov, Valentin V; Chernolovskaya, Elena L

    2010-12-01

    The thermodynamic asymmetry of siRNA duplexes determines their silencing activity. Favorable asymmetry can be achieved by incorporation of mismatches into the 3' part of the sense strand, providing fork-siRNAs, which exhibit higher silencing activity and higher sensitivity to nucleases. Recently, we found that selective 2'-O-methyl modifications of the nuclease-sensitive sites of siRNA significantly improve its nuclease resistance without substantial loss of silencing activity. Here, we examined the impact of nucleotide mismatches and the number and location of 2'-O-methyl modifications on the silencing activity and nuclease resistance of anti-MDR1 siRNAs. We found that both nonmodified and selectively modified fork-siRNAs with 4 mismatches at the 3' end of the sense strand suppress the expression of target gene at lower effective concentrations than the parent siRNAs with classical duplex design. The selective modification of nuclease-sensitive sites significantly improved the stability of fork-siRNAs in the presence of serum. The selectively modified fork-siRNA duplexes provided inhibitory effect over a period of 12 days posttransfection, whereas the gene silencing activity of the nonmodified analogs expired within 6 days. Thus, selective chemical modifications and structural alteration of siRNA duplexes improve their silencing properties and significantly prolong the duration of their silencing effect.

  16. SHARP-2 gene silencing by lentiviral-based short hairpin RNA interference prolonged rat kidney transplant recipients' survival time.

    Science.gov (United States)

    Shou, Z; Xiao, H; Xu, Y; Wang, Y; Yang, Y; Jiang, H; Chen, J; Yamada, K; Miyamoto, K

    2009-01-01

    Split- and hairy-related protein-2 (SHARP-2) controls the expression of interleukin-2 (IL-2) and interferon-gamma (IFN-gamma), which both play a key role in transplant rejection. This study was designed to investigate whether SHARP-2 short hairpin RNA interference (shRNAi) could prolong the survival of rat kidney transplant recipients. A lentiviral-based shRNAi construct, LV-SHARP-2iC, showed a SHARP-2 gene silencing efficiency of 84% in normal rat kidney cells. In activated T-cells, SHARP-2 gene silencing with the LV-SHARP-2iC construct resulted in 61% and 69% down-regulation of IL-2 and IFN-gamma, respectively, compared with a scramble control construct. When donor kidney was perfused with 5 x 10(7) transforming units of the LV-SHARP-2iC construct, the median survival time of the transplant recipients was prolonged by 4 - 5 days compared with control groups. In conclusion, recombinant lentiviral LV-SHARP-2iC construct effectively silenced SHARP-2 gene expression, which reduced IL-2 and IFN-gamma mRNA expression and prolonged rat kidney transplant recipients' survival.

  17. Development of Gold Nanoparticle towards Radioenhancement Therapy, Renal Clearance, siRNA Delivery and Light-Controlled Gene Silencing

    Science.gov (United States)

    Wang, Jianxin

    Gold nanoparticles (GNPs) have been widely studied and used in research for diagnostic, prophylactic or therapeutic purposes. However, they still face many technical challenges before they can be used to effectively address unmet biomedical needs. The theme of this dissertation is focused on addressing challenges of GNPs in clinical translation, and to improve their potential for application in radioenhancement therapy and siRNA delivery. We demonstrate the facile self-assembly of micellar gold nanocapsules using zwitterionic surfactants, with hydrodynamic diameters below 10 nm, which holds promise for good renal clearance to promote the excretion of GNPs in human body. We also prepared PEI- and PEG-coated GNPs and demonstrated their uptake into HeLa cells with exposure to soft X-rays (120 kVp), based on the consideration that the proximity of GNPs to nuclear DNA may be beneficial for enhancing low-energy ionizing radiotherapy. GNP-mediated siRNA delivery may be challenged by nonspecific siRNA desorption during circulation, which can cause off-target effects and immunogenicity. The use of gold nanorods (GNRs) for siRNA delivery also faces challenges like reduced dispersion stability during siRNA functionalization. We developed an effective way to load siRNA onto GNRs at high density, using oleylsulfobetaine (OSB) as an intermediate surfactant and dithiocarbamates (DTCs) as desorption-resistant anchors for siRNA. The GNR?siRNA complexes provided excellent control for laser-triggered gene silencing.

  18. Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

    International Nuclear Information System (INIS)

    Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

    2004-01-01

    Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

  19. siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Keshava Mysore

    2015-11-01

    Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

  20. RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).

    Science.gov (United States)

    Dare, Andrew P; Hellens, Roger P

    2013-08-01

    Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.

  1. Persistent ER stress induces the spliced leader RNA silencing pathway (SLS, leading to programmed cell death in Trypanosoma brucei.

    Directory of Open Access Journals (Sweden)

    Hanoch Goldshmidt

    2010-01-01

    Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.

  2. Artificial MiRNA Knockdown of Platelet Glycoprotein lbα: A Tool for Platelet Gene Silencing.

    Directory of Open Access Journals (Sweden)

    Tim Thijs

    Full Text Available In recent years, candidate genes and proteins implicated in platelet function have been identified by various genomic approaches. To elucidate their exact role, we aimed to develop a method to apply miRNA interference in platelet progenitor cells by using GPIbα as a proof-of-concept target protein. After in silico and in vitro screening of siRNAs targeting GPIbα (siGPIBAs, we developed artificial miRNAs (miGPIBAs, which were tested in CHO cells stably expressing GPIb-IX complex and megakaryoblastic DAMI cells. Introduction of siGPIBAs in CHO GPIb-IX cells resulted in 44 to 75% and up to 80% knockdown of GPIbα expression using single or combined siRNAs, respectively. Conversion of siGPIBAs to miGPIBAs resulted in reduced silencing efficiency, which could however be circumvented by tandem integration of two hairpins targeting different regions of GPIBA mRNA where 72% GPIbα knockdown was achieved. CHO GPIb-IX cells transfected with the miGPIBA construct displayed a significant decrease in their ability to aggregate characterized by lower aggregate numbers and size compared to control CHO GPIb-IX cells. More importantly, we successfully silenced GPIbα in differentiating megakaryoblastic DAMI cells that exhibited morphological changes associated with actin organization. In conclusion, we here report the successful use of miRNA technology to silence a platelet protein in megakaryoblastic cells and demonstrate its usefulness in functional assays. Hence, we believe that artificial miRNAs are suitable tools to unravel the role of a protein of interest in stem cells, megakaryocytes and platelets, thereby expanding their application to novel fields of basic and translational research.

  3. IAPV, a bee-affecting virus associated with Colony Collapse Disorder can be silenced by dsRNA ingestion.

    Science.gov (United States)

    Maori, E; Paldi, N; Shafir, S; Kalev, H; Tsur, E; Glick, E; Sela, I

    2009-02-01

    Colony Collapse Disorder (CCD) has been associated with Israeli acute paralysis virus (IAPV). CCD poses a serious threat to apiculture and agriculture as a whole, due to the consequent inability to provide the necessary amount of bees for pollination of critical crops. Here we report on RNAi-silencing of IAPV infection by feeding bees with double-stranded RNA, as an efficient and feasible way of controlling this viral disease. The association of CCD with IAPV is discussed, as well as the potential of controlling CCD.

  4. Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

    Directory of Open Access Journals (Sweden)

    Masaki Takahashi

    2015-01-01

    Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

  5. Delivery of siRNA silencing P-gp in peptide-functionalized nanoparticles causes efflux modulation at the blood-brain barrier

    DEFF Research Database (Denmark)

    Gomes, Maria João; Kennedy, Patrick J; Martins, Susana

    2017-01-01

    AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expressio...

  6. Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

    Science.gov (United States)

    Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

    2006-10-01

    Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

  7. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  8. Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

    Science.gov (United States)

    Saathoff, Aaron J; Sarath, Gautam; Chow, Elaine K; Dien, Bruce S; Tobias, Christian M

    2011-01-27

    Cinnamyl alcohol dehydrogenase (CAD) catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

  9. LncRNA-SNHG16 predicts poor prognosis and promotes tumor proliferation through epigenetically silencing p21 in bladder cancer.

    Science.gov (United States)

    Cao, Xianxiang; Xu, Jing; Yue, Dong

    2018-02-01

    More and more evidences have ensured the crucial functions of long non-coding RNAs (lncRNAs) in multiple tumors. It has been discovered that lncRNA-SNHG16 is involved in many tumors. Even so, it is still necessary to study SNHG16 comprehensively in bladder cancer. In terms of our study, the level of SNHG16 both in the tumor tissues and cell lines was measured and the relationship among SNHG16, clinicopathological traits and prognosis was explored. Interference assays were applied to determine the biological functions of SNHG16. It was discovered that the level of SNHG16 was evidently enhanced both in tissues and cell lines of bladder cancer. Patients with highly expressed SNHG16 suffered from poor overall survival. Multivariable Cox proportional hazards regression analysis implied that highly expressed SNHG16 could be used as an independent prognostic marker. It could be known from functional assays that silenced SNHG16 impaired cell proliferation, owing to the effects of SNHG16 on cell cycle and apoptosis. Finally, mechanism experiments revealed that SNHG16 could epigenetically silence the expression of p21. The facts above pointed out that lncRNA-SNHG16 might be quite vital for the diagnosis and development of bladder cancer, and could even become an important therapeutic target for bladder cancer.

  10. A novel sweet potato potyvirus open reading frame (ORF) is expressed via polymerase slippage and suppresses RNA silencing

    Science.gov (United States)

    Untiveros, Milton; Olspert, Allan; Artola, Katrin

    2016-01-01

    Summary The single‐stranded, positive‐sense RNA genome of viruses in the genus Potyvirus encodes a large polyprotein that is cleaved to yield 10 mature proteins. The first three cleavage products are P1, HCpro and P3. An additional short open reading frame (ORF), called pipo, overlaps the P3 region of the polyprotein ORF. Four related potyviruses infecting sweet potato (Ipomoea batatas) are predicted to contain a third ORF, called pispo, which overlaps the 3′ third of the P1 region. Recently, pipo has been shown to be expressed via polymerase slippage at a conserved GA6 sequence. Here, we show that pispo is also expressed via polymerase slippage at a GA6 sequence, with higher slippage efficiency (∼5%) than at the pipo site (∼1%). Transient expression of recombinant P1 or the ‘transframe’ product, P1N‐PISPO, in Nicotiana benthamiana suppressed local RNA silencing (RNAi), but only P1N‐PISPO inhibited short‐distance movement of the silencing signal. These results reveal that polymerase slippage in potyviruses is not limited to pipo expression, but can be co‐opted for the evolution and expression of further novel gene products. PMID:26757490

  11. Nek1 silencing slows down DNA repair and blocks DNA damage-induced cell cycle arrest.

    Science.gov (United States)

    Pelegrini, Alessandra Luíza; Moura, Dinara Jaqueline; Brenner, Bethânia Luise; Ledur, Pitia Flores; Maques, Gabriela Porto; Henriques, João Antônio Pegas; Saffi, Jenifer; Lenz, Guido

    2010-09-01

    Never in mitosis A (NIMA)-related kinases (Nek) are evolutionarily conserved proteins structurally related to the Aspergillus nidulans mitotic regulator NIMA. Nek1 is one of the 11 isoforms of the Neks identified in mammals. Different lines of evidence suggest the participation of Nek1 in response to DNA damage, which is also supported by the interaction of this kinase with proteins involved in DNA repair pathways and cell cycle regulation. In this report, we show that cells with Nek1 knockdown (KD) through stable RNA interference present a delay in DNA repair when treated with methyl-methanesulfonate (MMS), hydrogen peroxide (H(2)O(2)) and cisplatin (CPT). In particular, interstrand cross links induced by CPT take much longer to be resolved in Nek1 KD cells when compared to wild-type (WT) cells. In KD cells, phosphorylation of Chk1 in response to CPT was strongly reduced. While WT cells accumulate in G(2)/M after DNA damage with MMS and H(2)O(2), Nek1 KD cells do not arrest, suggesting that G(2)/M arrest induced by the DNA damage requires Nek1. Surprisingly, CPT-treated Nek1 KD cells arrest with a 4N DNA content similar to WT cells. This deregulation in cell cycle control in Nek1 KD cells leads to an increased sensitivity to genotoxic agents when compared to WT cells. These results suggest that Nek1 is involved in the beginning of the cellular response to genotoxic stress and plays an important role in preventing cell death induced by DNA damage.

  12. Transient expression of artificial microRNAs targeting Grapevine fanleaf virus and evidence for RNA silencing in grapevine somatic embryos.

    Science.gov (United States)

    Jelly, Noémie S; Schellenbaum, Paul; Walter, Bernard; Maillot, Pascale

    2012-12-01

    Grapevines are affected worldwide by viruses that compromise fruit yield and quality. Grapevine fanleaf virus (GFLV) causes fanleaf degeneration disease, a major threat to grapevine production. Transgenic approaches exploiting the RNA silencing machinery have proven suitable for engineering viral resistance in several crop species. However, the artificial microRNA (amiRNA)-based strategy has not yet been reported in grapevine. We developed two amiRNA precursors (pre-amiRNAs) targeting the coat protein (CP) gene of GFLV and characterised their functionality in grapevine somatic embryos. To create these pre-amiRNAs, natural pre-miR319a of Arabidopsis thaliana was modified by overlapping PCR in order to replace miR319a with two amiRNAs targeting different regions of the CP gene: amiR(CP)-1 or amiR(CP)-2. Transient expression of these two pre-amiRNA constructs was tested in grapevine somatic embryos after co-cultivation with Agrobacterium tumefaciens. Expression of amiR(CP)-1 and amiR(CP)-2 was detected in plant tissues by an endpoint stem-loop RT-PCR as early as 1 day after a 48-h co-cultivation, indicating active processing of pre-amiRNAs by the plant machinery. In parallel, GUS-sensor constructs (G(CP)-1 and G(CP)-2) were obtained by fusing the target sequence of amiR(CP)-1 or amiR(CP)-2 to the 3' terminus of the GUS gene. Co-transformation assays with GUS-sensors and the pre-amiRNA constructs provided evidence for in vivo recognition and cleavage of the 21-nt target sequence of GUS-sensors by the corresponding amiRNA. This is the first report of amiRNA ectopic expression in grapevine. The constructs we developed could be useful for engineering GFLV-resistant grapes in the future.

  13. In vivo therapeutic efficacy of TNFα silencing by folate-PEG-chitosan-DEAE/siRNA nanoparticles in arthritic mice.

    Science.gov (United States)

    Shi, Qin; Rondon-Cavanzo, Elsa-Patricia; Dalla Picola, Isadora Pfeifer; Tiera, Marcio José; Zhang, Xiaoling; Dai, Kerong; Benabdoune, Houda Abir; Benderdour, Mohamed; Fernandes, Julio Cesar

    2018-01-01

    Tumor necrosis factor-alpha (TNFα), a pro-inflammatory cytokine, has been shown to play a role in the pathophysiology of rheumatoid arthritis. Silencing TNFα expression with small interfering RNA (siRNA) is a promising approach to treatment of the condition. Towards this end, our team has developed a modified chitosan (CH) nanocarrier, deploying folic acid, diethylethylamine (DEAE) and polyethylene glycol (PEG) (folate-PEG-CH-DEAE 15 ). The gene carrier protects siRNA against nuclease destruction, its ligands facilitate siRNA uptake via cell surface receptors, and it provides improved solubility at neutral pH with transport of its load into target cells. In the present study, nanoparticles were prepared with siRNA-TNFα, DEAE, and folic acid-CH derivative. Nanoparticle size and zeta potential were verified by dynamic light scattering. Their TNFα-knockdown effects were tested in a murine collagen antibody-induced arthritis model. TNFα expression was examined along with measurements of various cartilage and bone turnover markers by performing histology and microcomputed tomography analysis. We demonstrated that folate-PEG-CH-DEAE 15 /siRNA nanoparticles did not alter cell viability, and significantly decreased inflammation, as demonstrated by improved clinical scores and lower TNFα protein concentrations in target tissues. This siRNA nanocarrier also decreased articular cartilage destruction and bone loss. The results indicate that folate-PEG-CH-DEAE 15 nanoparticles are a safe and effective platform for nonviral gene delivery of siRNA, and their potential clinical applications warrant further investigation.

  14. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    AJL

    2011-02-14

    Feb 14, 2011 ... and are presumably processed similar to the microRNA maturation pathways. The basic structure of an ordinary. shRNA consists of paired antisense and sense strands connected by a loop of unpaired nucleotides. A duplex stem of 19 to 29 bp, either fully paired or with miRNA- style internal mismatches, is ...

  15. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  16. Gene Silencing in Skin After Deposition of Self-Delivery siRNA With a Motorized Microneedle Array Device

    Directory of Open Access Journals (Sweden)

    Robyn P Hickerson

    2013-01-01

    Full Text Available Despite the development of potent siRNAs that effectively target genes responsible for skin disorders, translation to the clinic has been hampered by inefficient delivery through the stratum corneum barrier and into the live cells of the epidermis. Although hypodermic needles can be used to transport siRNA through the stratum corneum, this approach is limited by pain caused by the injection and the small volume of tissue that can be accessed by each injection. The use of microneedle arrays is a less painful method for siRNA delivery, but restricted payload capacity limits this approach to highly potent molecules. To address these challenges, a commercially available motorized microneedle array skin delivery device was evaluated. This device combines the positive elements of both hypodermic needles and microneedle array technologies with little or no pain to the patient. Application of fluorescently tagged self-delivery (sd-siRNA to both human and murine skin resulted in distribution throughout the treated skin. In addition, efficient silencing (78% average reduction of reporter gene expression was achieved in a transgenic fluorescent reporter mouse skin model. These results indicate that this device effectively delivers functional sd-siRNA with an efficiency that predicts successful clinical translation.

  17. Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

    Science.gov (United States)

    Laldinsangi, C; Senthilkumaran, B

    2018-04-03

    C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

  18. Silencing the roadblocks to effective triple-negative breast cancer treatments by siRNA nanoparticles.

    Science.gov (United States)

    Parvani, Jenny G; Jackson, Mark W

    2017-04-01

    Over the past decade, RNA interference (RNAi) has been ubiquitously utilized to study biological function in vitro ; however, limitations were associated with its utility in vivo More recently, small interfering RNA (siRNA) nanoparticles with improved biocompatibility have gained prevalence as a potential therapeutic option for the treatment of various diseases. The adaptability of siRNA nanoparticles enables the delivery of virtually any siRNA, which is especially advantageous for therapeutic applications in heterogeneous diseases that lack unifying molecular features, such as triple-negative breast cancer (TNBC). TNBC is an aggressive subtype of breast cancer that is stratified by the lack of estrogen receptor/progesterone receptor expression and HER2 amplification. There are currently no FDA-approved targeted therapies for the treatment of TNBCs, making cytotoxic chemotherapy the only treatment option available to these patients. In this review, we outline the current status of siRNA nanoparticles in clinical trials for cancer treatment and discuss the promising preclinical approaches that have utilized siRNA nanoparticles for TNBC treatment. Next, we address TNBC subtype-specific therapeutic interventions and highlight where and how siRNA nanoparticles fit into these strategies. Lastly, we point out ongoing challenges in the field of siRNA nanoparticle research that, if addressed, would significantly improve the efficacy of siRNA nanoparticles as a therapeutic option for cancer treatment. © 2017 Society for Endocrinology.

  19. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Directory of Open Access Journals (Sweden)

    Justine M Pompey

    Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  20. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Science.gov (United States)

    Pompey, Justine M; Foda, Bardees; Singh, Upinder

    2015-01-01

    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  1. Inhibition of Taura syndrome virus replication in Litopenaeus vannamei through silencing the LvRab7 gene using double-stranded RNA.

    Science.gov (United States)

    Ongvarrasopone, Chalermporn; Saejia, Pipop; Chanasakulniyom, Mayuree; Panyim, Sakol

    2011-07-01

    Taura syndrome virus (TSV) is a major cause of high mortality in Pacific white shrimp (Litopenaeus vannamei, Lv). Previously, silencing of Penaeus monodon Rab7 (PmRab7) by injecting double-stranded RNA corresponding to PmRab7 (dsRNA-PmRab7) prevented white spot syndrome virus or yellow head virus infection. Rab7 is proposed to be involved in intracellular trafficking of the viruses. This study aimed to investigate whether knockdown of Rab7 in L. vannamei by dsRNA-PmRab7 could inhibit replication of TSV. RNA interference (RNAi) technology using dsRNA targeting the LvRab7 gene was used to silence the mRNA expression of LvRab7. The silencing of the LvRab7 gene inhibited TSV replication dramatically when compared to groups receiving dsRNA-GFP or NaCl. This is the first demonstration that dsRNA targeting the endogenous shrimp gene LvRab7 strongly reduces TSV replication. It provides further evidence that LvRab7 is involved in the endosomal trafficking pathway of viruses infecting penaeid shrimp.

  2. Polymer nanoparticles for drug and small silencing RNA delivery to treat cancers of different phenotypes

    Science.gov (United States)

    Devulapally, Rammohan; Paulmurugan, Ramasamy

    2013-01-01

    Advances in nanotechnology have provided powerful and efficient tools in development of cancer diagnosis and therapy. There are numerous nanocarriers that are currently approved for clinical use in cancer therapy. In recent years, biodegradable polymer nanoparticles (NPs) have attracted a considerable attention for their ability to function as a possible carrier for target-specific delivery of various drugs, genes, proteins, peptides, vaccines, and other biomolecules in humans without much toxicity. This review will specifically focus on the recent advances in polymer-based nanocarriers for various drugs and small silencing RNA’s loading and delivery to treat different types of cancer. PMID:23996830

  3. Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

    Czech Academy of Sciences Publication Activity Database

    Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

    2011-01-01

    Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

  4. Highly activated RNA silencing via strong induction of dicer by one virus can interfere with the replication of an unrelated virus

    Science.gov (United States)

    Chiba, Sotaro; Suzuki, Nobuhiro

    2015-01-01

    Viruses often coinfect single host organisms in nature. Depending on the combination of viruses in such coinfections, the interplay between them may be synergistic, apparently neutral with no effect on each other, or antagonistic. RNA silencing is responsible for many cases of interference or cross-protection between viruses, but such antagonistic interactions are usually restricted to closely related strains of the same viral species. In this study, we present an unprecedented example of RNA silencing-mediated one-way interference between unrelated viruses in a filamentous model fungus, Cryphonectria parasitica. The replication of Rosellinia necatrix victorivirus 1 (RnVV1; Totiviridae) was strongly impaired by coinfection with the prototypic member of the genus Mycoreovirus (MyRV1) or a mutant of the prototype hypovirus (Cryphonectria hypovirus 1, CHV1) lacking the RNA silencing suppressor (CHV1-Δp69). This interference was associated with marked transcriptional induction of key genes in antiviral RNA silencing, dicer-like 2 (dcl2) and argonaute-like 2 (agl2), following MyRV1 or CHV1-Δp69 infection. Interestingly, the inhibition of RnVV1 replication was reproduced when the levels of dcl2 and agl2 transcripts were elevated by transgenic expression of a hairpin construct of an endogenous C. parasitica gene. Disruption of dcl2 completely abolished the interference, whereas that of agl2 did not always lead to its abolishment, suggesting more crucial roles of dcl2 in antiviral defense. Taken altogether, these results demonstrated the susceptible nature of RnVV1 to the antiviral silencing in C. parasitica activated by distinct viruses or transgene-derived double-stranded RNAs and provide insight into the potential for broad-spectrum virus control mediated by RNA silencing. PMID:26283371

  5. Enhancer-driven chromatin interactions during development promote escape from silencing by a long non-coding RNA

    Directory of Open Access Journals (Sweden)

    Korostowski Lisa

    2011-11-01

    Full Text Available Abstract Background Gene regulation in eukaryotes is a complex process entailing the establishment of transcriptionally silent chromatin domains interspersed with regions of active transcription. Imprinted domains consist of clusters of genes, some of which exhibit parent-of-origin dependent monoallelic expression, while others are biallelic. The Kcnq1 imprinted domain illustrates the complexities of long-range regulation that coexists with local exceptions. A paternally expressed repressive non-coding RNA, Kcnq1ot1, regulates a domain of up to 750 kb, encompassing 14 genes. We study how the Kcnq1 gene, initially silenced by Kcnq1ot1, undergoes tissue-specific escape from imprinting during development. Specifically, we uncover the role of chromosome conformation during these events. Results We show that Kcnq1 transitions from monoallelic to biallelic expression during mid gestation in the developing heart. This transition is not associated with the loss of methylation on the Kcnq1 promoter. However, by exploiting chromosome conformation capture (3C technology, we find tissue-specific and stage-specific chromatin loops between the Kcnq1 promoter and newly identified DNA regulatory elements. These regulatory elements showed in vitro activity in a luciferase assay and in vivo activity in transgenic embryos. Conclusions By exploring the spatial organization of the Kcnq1 locus, our results reveal a novel mechanism by which local activation of genes can override the regional silencing effects of non-coding RNAs.

  6. Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection

    DEFF Research Database (Denmark)

    Lanford, Robert E; Hildebrandt-Eriksen, Elisabeth S; Petri, Andreas

    2010-01-01

    The liver-expressed microRNA-122 (miR-122) is essential for hepatitis C virus (HCV) RNA accumulation in cultured liver cells, but its potential as a target for antiviral intervention has not been assessed. We found that treatment of chronically infected chimpanzees with a locked nucleic acid (LNA...

  7. Cystathionine-γ-lyase gene silencing with siRNA in monocytes ...

    Indian Academy of Sciences (India)

    Hydrogen sulphide is an endogenous inflammatory mediator produced by cystathionine-γ-lyase (CSE) in macrophages. To determine the role of H2S and macrophages in sepsis, we used small interference RNA (siRNA) to target the CSE gene and investigated its effect in a mouse model of sepsis. Cecal ligation puncture ...

  8. Silence of long noncoding RNA PANDAR switches low-dose curcumin-induced senescence to apoptosis in colorectal cancer cells

    Directory of Open Access Journals (Sweden)

    Chen T

    2017-01-01

    Full Text Available Tao Chen,1,* Peng Yang,1,* Hui Wang,1 Zhen-Yu He2 1Department of General Surgery, The Second Clinical Medical College of Nanjing Medical University, 2Department of General Surgery, The Second Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu, People’s Republic of China *These authors contributed equally to this work Abstract: Long noncoding RNAs (lncRNAs are emerging as having multiple roles in cancer progression. However, roles of lncRNAs in chemotherapy for colorectal cancer (CRC remain unclear. This study investigated the biological functions of lncRNA PANDAR in CRC cells treated with curcumin chemotherapy. Herein, we identified that PANDAR expression was not notably differential in CRC tissues compared with the corresponding normal tissues. Consistently, in vitro experiments revealed that knockdown of PANDAR could not change the proliferation, apoptosis, or senescence of CRC cells. Further analyses showed that low-dose curcumin could induce senescence in CRC cells without affecting cell apoptosis. Moreover, expression of PANDAR was increased in curcumin-treated CRC cells. Furthermore, silencing PANDAR in curcumin-treated cells increased apoptosis and greatly attenuated senescence possibly by stimulating the expression of PUMA. Together, these findings indicate that knockdown of lncRNA PANDAR switches curcumin-induced senescence to apoptosis, which may be potentially valuable in CRC therapy. Keywords: colorectal cancer, long noncoding RNA, PANDAR, curcumin, chemotherapy

  9. Tomato chlorotic mottle virus is a target of RNA silencing but the presence of specific short interfering RNAs does not guarantee resistance in transgenic plants

    NARCIS (Netherlands)

    Ribeiro, S.G.; Lohuis, H.; Goldbach, R.W.; Prins, M.

    2007-01-01

    Tomato chlorotic mottle virus (ToCMoV) is a begomovirus found widespread in tomato fields in Brazil. ToCMoV isolate BA-Se1 (ToCMoV-[BA-Se1]) was shown to trigger the plant RNA silencing surveillance in different host plants and, coinciding with a decrease in viral DNA levels, small interfering RNAs

  10. Carbon nanotube-mediated siRNA delivery for gene silencing in cancer cells

    Science.gov (United States)

    Hong, Tu; Guo, Honglian; Xu, Yaqiong

    2011-10-01

    Small interfering RNA (siRNA) is potentially a promising tool in influencing gene expression with a high degree of target specificity. However, its poor intracellular uptake, instability in vivo, and non-specific immune stimulations impeded its effect in clinical applications. In this study, carbon nanotubes (CNTs) functionalized with two types of phospholipid-polyethylene glycol (PEG) have shown capabilities to stabilize siRNA in cell culture medium during the transfection and efficiently deliver siRNA into neuroblastoma and breast cancer cells. Moreover, the intrinsic optical properties of CNTs have been investigated through absorption and fluorescence measurements. We have found that the directly-functionalized groups play an important role on the fluorescence imaging of functionalized CNTs. The unique fluorescence imaging and high delivery efficiency make CNTs a promising material to deliver drugs and evaluate the treatment effect simultaneously.

  11. Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA

    Science.gov (United States)

    2012-01-01

    2 Beeologics Inc., Miami, Florida, USA Introduction Mosquitoes ( Diptera : Culicidae) are the most medi- cally important arthropods worldwide, vectoring...insecticides can create a long-term burden on species diversity and ecosystem sustainability. Double-stranded RNA (dsRNA) is an attractive alternative as a...insecticide against a variety of insect orders including Coleoptera (Baum et al. 2007; Whyard et al. 2009), Diptera (Walshe et al. 2009; Whyard et al. 2009

  12. Competition between siRNA duplexes: impact of RNA-induced silencing complex loading efficiency and comparison between conventional-21 bp and Dicer-substrate siRNAs.

    Science.gov (United States)

    Tanudji, Marcel; Machalek, Dorothy; Arndt, Greg M; Rivory, Laurent

    2010-02-01

    Cotransfection of a mixture of siRNAs species is typically used when simultaneous targeting of more than one mRNA is required. However, competition between siRNAs could occur and reduce the activity of some siRNAs within the mixture. To further study the factors affecting the degree of competition between siRNAs, we cotransfected luciferase targeting siRNAs with various irrelevant (ie, nonluciferase targeting) siRNAs into cells and examined differences in their competition profiles by assessing the effect on luciferase expression. We show that the degree of competition varies between irrelevant siRNAs and occurs at the point of RISC loading. Although the competition profile appears to be related to the calculated RNA-induced silencing complex (RISC) loading potential, empirical testing is required to confirm the competitive effects. We also observed reduced competition with siRNAs in the Dicer-substrate format, presumably due to more efficient RISC loading as a consequence of the physical transfer of the processed siRNA from Dicer.

  13. Enhanced Anti-Tumor Efficacy of Lipid-Modified Platinum Derivatives in Combination with Survivin Silencing siRNA in Resistant Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Mattheolabakis, George; Ling, Dandan; Ahmad, Gulzar; Amiji, Mansoor

    2016-12-01

    Cisplatin, is recognized as a first line therapeutic for the treatment of non-small cell lung cancer (NSCLC). Cisplatin resistance is identified as the most detrimental complication during treatment and has been associated with upregulation of several genes, such as the anti-apoptotic gene survivin. In this study, we have evaluated the cytotoxic activity of lipid (C6 and C8)-modified platinum compounds in combination with a survivin-silencing siRNA against cisplatin resistant tumors. We synthesized and characterized several lipid-modified platinum compounds and evaluated their cytotoxic activity alone or in combination with survivin-silencing siRNA in vitro and in vivo against A549 DDP cells and in vivo in tumor xenograft model. The lipid-modified compounds exhibited significantly stronger cytotoxic activity in vitro compared to cisplatin, with CDDP-C6 and CDDP-C8 producing the most pronounced effect, in both A549 and A549 DDP cells. Pre-treatment of the A549 DDP cells with survivin-silencing siRNA enhanced the cytotoxic activity of these compounds. In vivo, the co-treatment of the survivin-silencing siRNA and CDDP-C8 produced the strongest tumor growth inhibition effect (64.5%, p cancer mouse model of chemoresistant lung cancer. In contrast, cisplatin treatment exhibited no significant tumor growth inhibition (4.5%, no p). Co-treatment of lipid-modified compounds and survivin-silencing siRNA can constitute a reliable alternative to cisplatin treatment for cisplatin-resistant lung tumors that merit further evaluation.

  14. Resistance to Sri Lankan Cassava Mosaic Virus (SLCMV) in Genetically Engineered Cassava cv. KU50 through RNA Silencing

    KAUST Repository

    Ntui, Valentine Otang

    2015-04-22

    Cassava ranks fifth among the starch producing crops of the world, its annual bioethanol yield is higher than for any other crop. Cassava cultivar KU50, the most widely grown cultivar for non-food purposes is susceptible to Sri Lankan cassava mosaic virus (SLCMV). The objective of this work was to engineer resistance to SLCMV by RNA interference (RNAi) in order to increase biomass yield, an important aspect for bioethanol production. Here, we produced transgenic KU50 lines expressing dsRNA homologous to the region between the AV2 and AV1 of DNA A of SLCMV. High level expression of dsRNA of SLCMV did not induce any growth abnormality in the transgenic plants. Transgenic lines displayed high levels of resistance to SLCMV compared to the wild-type plants and no virus load could be detected in uninoculated new leaves of the infected resistant lines after PCR amplification and RT-PCR analysis. The agronomic performance of the transgenic lines was unimpaired after inoculation with the virus as the plants presented similar growth when compared to the mock inoculated control plants and revealed no apparent reduction in the amount and weight of tubers produced. We show that the resistance is correlated with post-transcriptional gene silencing because of the production of transgene specific siRNA. The results demonstrate that transgenic lines exhibited high levels of resistance to SLCMV. This resistance coupled with the desirable yield components in the transgenic lines makes them better candidates for exploitation in the production of biomass as well as bioethanol.

  15. Silencing of xylose isomerase and cellulose synthase by siRNA inhibits encystation in Acanthamoeba castellanii.

    Science.gov (United States)

    Aqeel, Yousuf; Siddiqui, Ruqaiyyah; Khan, Naveed Ahmed

    2013-03-01

    A key challenge in the successful treatment of Acanthamoeba infections is its ability to transform into a dormant cyst form that is resistant to physiological conditions and pharmacological therapies, resulting in recurrent infections. The carbohydrate linkage analysis of cyst walls of Acanthamoeba castellanii showed variously linked sugar residues, including xylofuranose/xylopyranose, glucopyranose, mannopyranose, and galactopyranose. Here, it is shown that exogenous xylose significantly reduced A. castellanii differentiation in encystation assays (P castellanii. Inhibition of both enzymes using siRNA against xylose isomerase and cellulose synthase but not scrambled siRNA attenuated A. castellanii metamorphosis, as demonstrated by the arrest of encystation of A. castellanii. Neither inhibitor nor siRNA probes had any effect on the viability and extracellular proteolytic activities of A. castellanii.

  16. Effect of siRNA silencing of inducible co-stimulatory molecule on myocardial cell hypertrophy after cardiac infarction in rats.

    Science.gov (United States)

    Wang, W M; Liu, Z; Chen, G

    2016-05-20

    As the most common cardiac disease, myocardial infarction is followed by hypertrophy of cardiac myocytes and reconstruction of ventricular structure. The up-regulation of a series of factors including metalloproteinases, inflammatory factors, and growth factors after primary infarction lead to the hypertrophy, apoptosis, necrosis, and fibroblast proliferation in cardiac muscle tissues. Recent studies have reported on the potency of small interfering RNA (siRNA) in treating cardiac diseases. We thus investigated the efficacy of inducible co-stimulatory molecule (ICOS)-specific siRNA silencing in myocardial hypertrophy in a cardiac infarction rat model. This cardiac infarction model was prepared by ligating the left anterior descending coronary artery. ICOS-siRNA treatment was administered in parallel with non-sense siRNA. After 18 days, the cross-sectional area of cardiac muscle tissues and the left ventricle weight index were measured, along with ICOS mRNA and protein expression levels, and pathological staining. Compared to those in the control groups, in myocardial infarcted rats, the application of ICOS-siRNA effectively decreased the left ventricle weight index, as well as the surface area of cardiac myocytes. Both mRNA and protein levels of ICOS were also significantly decreased. HE staining was consistent with these results. In conclusion, ICOS-targeted siRNA can effectively silence gene expression of ICOS, and provided satisfactory treatment efficacy for myocardial cell hypertrophy after infarction.

  17. Two amino acids near the N-terminus of Cucumber mosaic virus 2b play critical roles in the suppression of RNA silencing and viral infectivity.

    Science.gov (United States)

    Dong, Kai; Wang, Ying; Zhang, Zhen; Chai, Long-Xiang; Tong, Xin; Xu, Jin; Li, Dawei; Wang, Xian-Bing

    2016-02-01

    Cucumber mosaic virus (CMV) 2b suppresses RNA silencing primarily through the binding of double-stranded RNA (dsRNA) of varying sizes. However, the biologically active form of 2b remains elusive. Here, we demonstrate that the single and double alanine substitution mutants in the N-terminal 15th leucine and 18th methionine of CMV 2b exhibit drastically attenuated virulence in wild-type plants, but are efficiently rescued in mutant plants defective in RNA-dependent RNA polymerase 6 (RDR6) and Dicer-like 4 (DCL4). Moreover, the transgenic plants of 2b, but not 2blm (L15A/M18A), rescue the high infectivity of CMV-Δ2b through the suppression of antiviral silencing. L15A, M18A or both weaken 2b suppressor activity on local and systemic transgene silencing. In contrast with the high affinity of 2b to short and long dsRNAs, 2blm is significantly compromised in 21-bp duplex small interfering RNA (siRNA) binding ability, but maintains a strong affinity for long dsRNAs. In cross-linking assays, 2b can form dimers, tetramers and oligomers after treatment with glutaraldehyde, whereas 2blm only forms dimers, rather than tetramers and oligomers, in vitro. Together, these findings suggest that L15 and M18 of CMV 2b are required for high affinity to ds-siRNAs and oligomerization activity, which are essential for the suppression activity of 2b on antiviral silencing. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  18. Arabidopsis RNA Polymerase V Mediates Enhanced Compaction and Silencing of Geminivirus and Transposon Chromatin during Host Recovery from Infection.

    Science.gov (United States)

    Coursey, Tami; Regedanz, Elizabeth; Bisaro, David M

    2018-04-01

    Plants employ RNA-directed DNA methylation (RdDM) and dimethylation of histone 3 lysine 9 (H3K9me2) to silence geminiviruses and transposable elements (TEs). We previously showed that canonical RdDM (Pol IV-RdDM) involving RNA polymerases IV and V (Pol IV and Pol V) is required for Arabidopsis thaliana to recover from infection with Beet curly top virus lacking a suppressor protein that inhibits methylation (BCTV L2 - ). Recovery, which is characterized by reduced viral DNA levels and symptom remission, allows normal floral development. Here, we used formaldehyde-assisted isolation of regulatory elements (FAIRE) to confirm that >90% of BCTV L2 - chromatin is highly compacted during recovery, and a micrococcal nuclease-chromatin immunoprecipitation assay showed that this is largely due to increased nucleosome occupancy. Physical compaction correlated with augmented cytosine and H3K9 methylation and with reduced viral gene expression. We additionally demonstrated that these phenomena are dependent on Pol V and by extension the Pol IV-RdDM pathway. BCTV L2 - was also used to evaluate the impact of viral infection on host loci, including repressed retrotransposons Ta3 and Athila6A Remarkably, an unexpected Pol V-dependent hypersuppression of these TEs was observed, resulting in transcript levels even lower than those detected in uninfected plants. Hypersuppression is likely to be especially important for natural recovery from wild-type geminiviruses, as viral L2 and AL2 proteins cause ectopic TE expression. Thus, Pol IV-RdDM targets both viral and TE chromatin during recovery, simultaneously silencing the majority of viral genomes and maintaining host genome integrity by enforcing tighter control of TEs in future reproductive tissues. IMPORTANCE In plants, RdDM pathways use small RNAs to target cytosine and H3K9 methylation, thereby silencing DNA virus genomes and transposable elements (TEs). Further, Pol IV-RdDM involving Pol IV and Pol V is a key aspect of host

  19. Robust RNA silencing-mediated resistance to Plum pox virus under variable abiotic and biotic conditions.

    Science.gov (United States)

    Di Nicola, Elisa; Tavazza, Mario; Lucioli, Alessandra; Salandri, Laura; Ilardi, Vincenza

    2014-10-01

    Some abiotic and biotic conditions are known to have a negative impact on post-transcriptional gene silencing (PTGS), thus representing a potential concern for the production of stable engineered virus resistance traits. However, depending on the strategy followed to achieve PTGS of the transgene, different responses to external conditions can be expected. In the present study, we utilized the Nicotiana benthamiana–Plum pox virus (PPV) pathosystem to evaluate in detail the stability of intron-hairpin(ihp)-mediated virus resistance under conditions known to adversely affect PTGS. The ihp plants grown at low or high temperatures were fully resistant to multiple PPV challenges, different PPV inoculum concentrations and even to a PPV isolate differing from the ihp construct by more than 28% at the nucleotide level. In addition, infections of ihp plants with viruses belonging to Cucumovirus, Potyvirus or Tombusvirus, all known to affect PTGS at different steps, were not able to defeat PPV resistance. Low temperatures did not affect the accumulation of transgenic small interfering RNAs (siRNAs), whereas a clear increase in the amount of siRNAs was observed during infections sustained by Cucumber mosaic virus and Potato virus Y. Our results show that the above stress factors do not represent an important concern for the production,through ihp-PTGS technology, of transgenic plants having robust virus resistance traits.

  20. MicroRNA silencing in primates: towards development of novel therapeutics

    DEFF Research Database (Denmark)

    Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

    2009-01-01

    MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic...

  1. Knockdown of TFIIS by RNA silencing inhibits cancer cell proliferation and induces apoptosis

    International Nuclear Information System (INIS)

    Hubbard, Kyle; Catalano, Jennifer; Puri, Raj K; Gnatt, Averell

    2008-01-01

    A common element among cancer cells is the presence of improperly controlled transcription. In these cells, the degree of specific activation of some genes is abnormal, and altering the aberrant transcription may therefore directly target cancer. TFIIS is a transcription elongation factor, which directly binds the transcription motor, RNA Polymerase II and allows it to read through various transcription arrest sites. We report on RNA interference of TFIIS, a transcription elongation factor, and its affect on proliferation of cancer cells in culture. RNA interference was performed by transfecting siRNA to specifically knock down TFIIS expression in MCF7, MCF10A, PL45 and A549 cells. Levels of TFIIS expression were determined by the Quantigene method, and relative protein levels of TFIIS, c-myc and p53 were determined by C-ELISA. Induction of apoptosis was determined by an enzymatic Caspase 3/7 assay, as well as a non-enzymatic assay detecting cytoplasmic mono- and oligonucleosomes. A gene array analysis was conducted for effects of TFIIS siRNA on MCF7 and MCF10A cell lines. Knockdown of TFIIS reduced cancer cell proliferation in breast, lung and pancreatic cancer cell lines. More specifically, TFIIS knockdown in the MCF7 breast cancer cell line induced cancer cell death and increased c-myc and p53 expression whereas TFIIS knockdown in the non-cancerous breast cell line MCF10A was less affected. Differential effects of TFIIS knockdown in MCF7 and MCF10A cells included the estrogenic, c-myc and p53 pathways, as observed by C-ELISA and gene array, and were likely involved in MCF7 cell-death. Although transcription is a fundamental process, targeting select core transcription factors may provide for a new and potent avenue for cancer therapeutics. In the present study, knockdown of TFIIS inhibited cancer cell proliferation, suggesting that TFIIS could be studied as a potential cancer target within the transcription machinery

  2. APC/C-mediated degradation of dsRNA-binding protein 4 (DRB4 involved in RNA silencing.

    Directory of Open Access Journals (Sweden)

    Katia Marrocco

    Full Text Available Selective protein degradation via the ubiquitin-26S proteasome is a major mechanism underlying DNA replication and cell division in all Eukaryotes. In particular, the APC/C (Anaphase Promoting Complex or Cyclosome is a master ubiquitin protein ligase (E3 that targets regulatory proteins for degradation allowing sister chromatid separation and exit from mitosis. Interestingly, recent work also indicates that the APC/C remains active in differentiated animal and plant cells. However, its role in post-mitotic cells remains elusive and only a few substrates have been characterized.In order to identify novel APC/C substrates, we performed a yeast two-hybrid screen using as the bait Arabidopsis APC10/DOC1, one core subunit of the APC/C, which is required for substrate recruitment. This screen identified DRB4, a double-stranded RNA binding protein involved in the biogenesis of different classes of small RNA (sRNA. This protein interaction was further confirmed in vitro and in plant cells. Moreover, APC10 interacts with DRB4 through the second dsRNA binding motif (dsRBD2 of DRB4, which is also required for its homodimerization and binding to its Dicer partner DCL4. We further showed that DRB4 protein accumulates when the proteasome is inactivated and, most importantly, we found that DRB4 stability depends on APC/C activity. Hence, depletion of Arabidopsis APC/C activity by RNAi leads to a strong accumulation of endogenous DRB4, far beyond its normal level of accumulation. However, we could not detect any defects in sRNA production in lines where DRB4 was overexpressed.Our work identified a first plant substrate of the APC/C, which is not a regulator of the cell cycle. Though we cannot exclude that APC/C-dependent degradation of DRB4 has some regulatory roles under specific growth conditions, our work rather points to a housekeeping function of APC/C in maintaining precise cellular-protein concentrations and homeostasis of DRB4.

  3. miRNA-mediated post-transcriptional silencing of transgenes leads to increased adeno-associated viral vector yield and targeting specificity.

    Science.gov (United States)

    Reid, C A; Boye, S L; Hauswirth, W W; Lipinski, D M

    2017-08-01

    The production of high-titer recombinant adeno-associated virus (rAAV) vector is essential for treatment of genetic diseases affecting the retina and choroid, where anatomical constraints may limit injectable volumes. Problematically, cytotoxicity arising from overexpression of the transgene during vector production frequently leads to a reduction in vector yield. Herein, we evaluate the use of microRNA (miRNA)-mediated silencing to limit overexpression of cytotoxic transgenes during packaging as a method of increasing vector yield. We examined if post-transcriptional regulation of transgenes during packaging via miRNA technology would lead to increased rAAV yields. Our results demonstrate that silencing of cytotoxic transgenes during production resulted in up to a 22-fold increase in vector yield. The inclusion of organ-specific miRNA sequences improved biosafety by limiting off-target expression following systemic rAAV administration. The small size (22-23 bp) of the target site allows for the inclusion of multiple copies into the vector with minimal impact on coding capacity. Taken together, our results suggest that inclusion of miRNA target sites into the 3'-untranslated region of the AAV cassette allow for silencing of cytotoxic transgenes during vector production leading to improved vector yield, in addition to increasing targeting specificity without reliance on cell-specific promoters.

  4. Silencing of ecdysone receptor, insect intestinal mucin and sericotropin genes by bacterially produced double-stranded RNA affects larval growth and development in Plutella xylostella and Helicoverpa armigera.

    Science.gov (United States)

    Israni, B; Rajam, M V

    2017-04-01

    RNA interference mediated gene silencing, which is triggered by double-stranded RNA (dsRNA), has become a important tool for functional genomics studies in various systems, including insects. Bacterially produced dsRNA employs the use of a bacterial strain lacking in RNaseIII activity and harbouring a vector with dual T7 promoter sites, which allow the production of intact dsRNA molecules. Here, we report an assessment of the functional relevance of the ecdysone receptor, insect intestinal mucin and sericotropin genes through silencing by dsRNA in two lepidopteran insect pests, Helicoverpa armigera and Plutella xylostella, both of which cause serious crop losses. Oral feeding of dsRNA led to significant reduction in transcripts of the target insect genes, which caused significant larval mortality with various moulting anomalies and an overall developmental delay. We also found a significant decrease in reproductive potential in female moths, with a drop in egg laying and compromised egg hatching from treated larvae as compared to controls. dsRNA was stable in the insect gut and was efficiently processed into small interfering RNAs (siRNAs), thus accounting for the phenotypes observed in the present work. The study revealed the importance of these genes in core insect processes, which are essential for insect development and survival. © 2016 The Royal Entomological Society.

  5. Silencing herpes simplex virus type 1 capsid protein encoding genes by siRNA: a promising antiviral therapeutic approach.

    Directory of Open Access Journals (Sweden)

    Fujun Jin

    Full Text Available Herpes simplex virus type 1 (HSV-1, a member of the herpesviridae, causes a variety of human viral diseases globally. Although a series of antiviral drugs are available for the treatment of infection and suppression of dissemination, HSV-1 remains highly prevalent worldwide. Therefore, the development of novel antiviral agents with different mechanisms of action is a matter of extreme urgency. During the proliferation of HSV-1, capsid assembly is essential for viral growth, and it is highly conserved in all HSV-1 strains. In this study, small interfering RNAs (siRNAs against the HSV-1 capsid protein were screened to explore the influence of silencing capsid expression on the replication of HSV-1. We designed and chemically synthesized siRNAs for the capsid gene and assessed their inhibitory effects on the expression of target mRNA and the total intracellular viral genome loads by quantitative real-time PCR, as well as on the replication of HSV-1 via plaque reduction assays and electron microscopy. Our results showed that siRNA was an effective approach to inhibit the expression of capsid protein encoding genes including UL18, UL19, UL26, UL26.5, UL35 and UL38 in vitro. Interference of capsid proteins VP23 (UL18 and VP5 (UL19 individually or jointly greatly affected the replication of clinically isolated acyclovir-resistant HSV-1 as well as HSV-1/F and HSV-2/333. Plaque numbers and intracellular virions were significantly reduced by simultaneous knockdown of UL18 and UL19. The total intracellular viral genome loads were also significantly decreased in the UL18 and UL19 knockdown groups compared with the viral control. In conclusion, interfering with UL18 and UL19 gene expression could inhibit HSV-1 replication efficiently in vitro. Our research offers new targets for an RNA interference-based therapeutic strategy against HSV-1.

  6. Silencing herpes simplex virus type 1 capsid protein encoding genes by siRNA: a promising antiviral therapeutic approach.

    Science.gov (United States)

    Jin, Fujun; Li, Shen; Zheng, Kai; Zhuo, Cuiqin; Ma, Kaiqi; Chen, Maoyun; Wang, Qiaoli; Zhang, Peizhuo; Fan, Jianglin; Ren, Zhe; Wang, Yifei

    2014-01-01

    Herpes simplex virus type 1 (HSV-1), a member of the herpesviridae, causes a variety of human viral diseases globally. Although a series of antiviral drugs are available for the treatment of infection and suppression of dissemination, HSV-1 remains highly prevalent worldwide. Therefore, the development of novel antiviral agents with different mechanisms of action is a matter of extreme urgency. During the proliferation of HSV-1, capsid assembly is essential for viral growth, and it is highly conserved in all HSV-1 strains. In this study, small interfering RNAs (siRNAs) against the HSV-1 capsid protein were screened to explore the influence of silencing capsid expression on the replication of HSV-1. We designed and chemically synthesized siRNAs for the capsid gene and assessed their inhibitory effects on the expression of target mRNA and the total intracellular viral genome loads by quantitative real-time PCR, as well as on the replication of HSV-1 via plaque reduction assays and electron microscopy. Our results showed that siRNA was an effective approach to inhibit the expression of capsid protein encoding genes including UL18, UL19, UL26, UL26.5, UL35 and UL38 in vitro. Interference of capsid proteins VP23 (UL18) and VP5 (UL19) individually or jointly greatly affected the replication of clinically isolated acyclovir-resistant HSV-1 as well as HSV-1/F and HSV-2/333. Plaque numbers and intracellular virions were significantly reduced by simultaneous knockdown of UL18 and UL19. The total intracellular viral genome loads were also significantly decreased in the UL18 and UL19 knockdown groups compared with the viral control. In conclusion, interfering with UL18 and UL19 gene expression could inhibit HSV-1 replication efficiently in vitro. Our research offers new targets for an RNA interference-based therapeutic strategy against HSV-1.

  7. Transitive RNA silencing signals induce cytosine methylation of a transgenic but not an endogenous target

    Czech Academy of Sciences Publication Activity Database

    Vermeersch, L.; De Winne, N.; Nolf, J.; Bleys, A.; Kovařík, Aleš; Depicker, A.

    2013-01-01

    Roč. 74, č. 5 (2013), s. 867-879 ISSN 0960-7412 R&D Projects: GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : DIRECTED DNA METHYLATION * POTATO-VIRUS-X * DOUBLE-STRANDED-RNA Subject RIV: BO - Biophysics Impact factor: 6.815, year: 2013

  8. Silencing of Target Chitinase Genes via Oral Delivery of dsRNA Caused Lethal Phenotypic Effects in Mythimna separata (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Cao, Budao; Bao, Wenhua; Wuriyanghan, Hada

    2017-02-01

    Mythimna separata walker (Lepidoptera: Noctuidae) is a polyphagous, migratory corn pest. Outbreak of M. separata has led to severe damage to corn production recently in China. RNAi (RNA interference) is a gene silencing technology applied both in model and non-model organisms, and it is especially useful for the latter in which the reverse genetic research tools are not available. RNAi approach was broadly investigated in many plant pathogens and was used for the generation of anti-pest transgenic plants. We are proposing to use this technology to silence M. separata endogenous genes, thereby, providing a biocontrol method for this insect. Feeding of dsRNAs for target Chitinase genes resulted in substantial decreases of their transcript levels in M. separata. Furthermore, silencing of target Chitinase genes led to phenotypic effects such as reduced body weight and increased mortality. Our study provided both reverse genetic research tool and potential control strategy for this insect species.

  9. Well-Defined Degradable Cationic Polylactide as Nanocarrier for the Delivery of siRNA to Silence Angiogenesis in Prostate Cancer

    OpenAIRE

    Chen, Chih-Kuang; Law, Wing-Cheung; Aalinkeel, Ravikumar; Nair, Bindukumar; Kopwitthaya, Atcha; Mahajan, Supriya D.; Reynolds, Jessica L.; Zou, Jiong; Schwartz, Stanley A.; Prasad, Paras N.; Cheng, Chong

    2012-01-01

    Well-defined tertiary amine-functionalized cationic polylactides (CPLAs) are synthesized by thiol-ene click functionalization of an allyl-functionalized polylactide, and utilized here for the delivery of interleukin-8 (IL-8) siRNA via CPLA-IL-8 siRNA nanoplexes. The CPLAs possess remarkable hydrolytic degradability, and their cytotoxicity is relatively low. The CPLA-IL-8 siRNA nanoplexes can be readily taken up by prostate cancer cells, resulting in significant IL-8 gene silencing. It is foun...

  10. Knockdown of TFIIS by RNA silencing inhibits cancer cell proliferation and induces apoptosis

    Directory of Open Access Journals (Sweden)

    Puri Raj K

    2008-05-01

    Full Text Available Abstract Background A common element among cancer cells is the presence of improperly controlled transcription. In these cells, the degree of specific activation of some genes is abnormal, and altering the aberrant transcription may therefore directly target cancer. TFIIS is a transcription elongation factor, which directly binds the transcription motor, RNA Polymerase II and allows it to read through various transcription arrest sites. We report on RNA interference of TFIIS, a transcription elongation factor, and its affect on proliferation of cancer cells in culture. Methods RNA interference was performed by transfecting siRNA to specifically knock down TFIIS expression in MCF7, MCF10A, PL45 and A549 cells. Levels of TFIIS expression were determined by the Quantigene method, and relative protein levels of TFIIS, c-myc and p53 were determined by C-ELISA. Induction of apoptosis was determined by an enzymatic Caspase 3/7 assay, as well as a non-enzymatic assay detecting cytoplasmic mono- and oligonucleosomes. A gene array analysis was conducted for effects of TFIIS siRNA on MCF7 and MCF10A cell lines. Results Knockdown of TFIIS reduced cancer cell proliferation in breast, lung and pancreatic cancer cell lines. More specifically, TFIIS knockdown in the MCF7 breast cancer cell line induced cancer cell death and increased c-myc and p53 expression whereas TFIIS knockdown in the non-cancerous breast cell line MCF10A was less affected. Differential effects of TFIIS knockdown in MCF7 and MCF10A cells included the estrogenic, c-myc and p53 pathways, as observed by C-ELISA and gene array, and were likely involved in MCF7 cell-death. Conclusion Although transcription is a fundamental process, targeting select core transcription factors may provide for a new and potent avenue for cancer therapeutics. In the present study, knockdown of TFIIS inhibited cancer cell proliferation, suggesting that TFIIS could be studied as a potential cancer target within the

  11. RNA and RNP as Building Blocks for Nanotechnology and Synthetic Biology.

    Science.gov (United States)

    Ohno, Hirohisa; Saito, Hirohide

    2016-01-01

    Recent technologies that aimed to elucidate cellular function have revealed essential roles for RNA molecules in living systems. Our knowledge concerning functional and structural information of naturally occurring RNA and RNA-protein (RNP) complexes is increasing rapidly. RNA and RNP interaction motifs are structural units that function as building blocks to constitute variety of complex structures. RNA-central synthetic biology and nanotechnology are constructive approaches that employ the accumulated information and build synthetic RNA (RNP)-based circuits and nanostructures. Here, we describe how to design and construct synthetic RNA (RNP)-based devices and structures at the nanometer-scale for biological and future therapeutic applications. RNA/RNP nanostructures can also be utilized as the molecular scaffold to control the localization or interactions of target molecule(s). Moreover, RNA motifs recognized by RNA-binding proteins can be applied to make protein-responsive translational "switches" that can turn gene expression "on" or "off" depending on the intracellular environment. This "synthetic RNA and RNP world" will expand tools for nanotechnology and synthetic biology. In addition, these reconstructive approaches would lead to a greater understanding of building principle in naturally occurring RNA/RNP molecules and systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Expression of RNA-interference/antisense transgenes by the cognate promoters of target genes is a better gene-silencing strategy to study gene functions in rice.

    Science.gov (United States)

    Li, Jing; Jiang, Dagang; Zhou, Hai; Li, Feng; Yang, Jiawei; Hong, Laifa; Fu, Xiao; Li, Zhibin; Liu, Zhenlan; Li, Jianming; Zhuang, Chuxiong

    2011-03-03

    Antisense and RNA interference (RNAi)-mediated gene silencing systems are powerful reverse genetic methods for studying gene function. Most RNAi and antisense experiments used constitutive promoters to drive the expression of RNAi/antisense transgenes; however, several reports showed that constitutive promoters were not expressed in all cell types in cereal plants, suggesting that the constitutive promoter systems are not effective for silencing gene expression in certain tissues/organs. To develop an alternative method that complements the constitutive promoter systems, we constructed RNAi and/or antisense transgenes for four rice genes using a constitutive promoter or a cognate promoter of a selected rice target gene and generated many independent transgenic lines. Genetic, molecular, and phenotypic analyses of these RNAi/antisense transgenic rice plants, in comparison to previously-reported transgenic lines that silenced similar genes, revealed that expression of the cognate promoter-driven RNAi/antisense transgenes resulted in novel growth/developmental defects that were not observed in transgenic lines expressing constitutive promoter-driven gene-silencing transgenes of the same target genes. Our results strongly suggested that expression of RNAi/antisense transgenes by cognate promoters of target genes is a better gene-silencing approach to discovery gene function in rice.

  13. Phenylmethimazole Blocks dsRNA-Induced IRF3 Nuclear Translocation and Homodimerization

    Directory of Open Access Journals (Sweden)

    Maria C. Courreges

    2012-10-01

    Full Text Available Previous studies revealed that phenylmethimazole (C10 inhibits IRF3 signaling, preventing dsRNA-induction of type 1 interferon gene expression, production, and downstream signaling. In the present study, we investigated the molecular basis for C10 inhibition of dsRNA-stimulated IRF3 signaling. IRF-3 Trans-AM assays were used to measure C10 effects on dsRNA induction of IRF3 DNA binding. Green fluorescent protein-labeled IRF3 was used to measure C10 effects on dsRNA-induced IRF3 nuclear translocation. Native PAGE, SDS PAGE, and western blotting were used to identify effects of C10 on IRF3 homodimer formation and phosphorylation, respectively. There was a significant impairment of dsRNA-induced IRF3 DNA binding activity in human embryonic kidney and pancreatic cancer cells with C10 treatment. C10 also blocked dsRNA-induced IRF3 nuclear translocation and homodimer formation without blocking serine 396 phosphorylation of IRF3. Together, these results indicate that C10 interferes with IRF3 signaling by blocking dsRNA-induced IRF3 homodimer formation, a prerequisite for nuclear translocation and DNA binding activities.

  14. Structure of the Cmr2 Subunit of the CRISPR-Cas RNA Silencing Complex

    Energy Technology Data Exchange (ETDEWEB)

    Cocozaki, Alexis I.; Ramia, Nancy F.; Shao, Yaming; Hale, Caryn R.; Terns, Rebecca M.; Terns, Michael P.; Li, Hong (FSU); (Georgia)

    2012-08-10

    Cmr2 is the largest and an essential subunit of a CRISPR RNA-Cas protein complex (the Cmr complex) that cleaves foreign RNA to protect prokaryotes from invading genetic elements. Cmr2 is thought to be the catalytic subunit of the effector complex because of its N-terminal HD nuclease domain. Here, however, we report that the HD domain of Cmr2 is not required for cleavage by the complex in vitro. The 2.3 {angstrom} crystal structure of Pyrococcus furiosus Cmr2 (lacking the HD domain) reveals two adenylyl cyclase-like and two {alpha}-helical domains. The adenylyl cyclase-like domains are arranged as in homodimeric adenylyl cyclases and bind ADP and divalent metals. However, mutagenesis studies show that the metal- and ADP-coordinating residues of Cmr2 are also not critical for cleavage by the complex. Our findings suggest that another component provides the catalytic function and that the essential role by Cmr2 does not require the identified ADP- or metal-binding or HD domains in vitro.

  15. The use of pH-sensitive functional selenium nanoparticles shows enhanced in vivo VEGF-siRNA silencing and fluorescence imaging

    Science.gov (United States)

    Yu, Qianqian; Liu, Yanan; Cao, Chengwen; Le, Fangling; Qin, Xiuying; Sun, Dongdong; Liu, Jie

    2014-07-01

    The utility of small interfering RNAs (siRNAs) has shown great promise in treating a variety of diseases including many types of cancer. While their ability to silence a wide range of target genes underlies their effectiveness, the application of therapies remains hindered by a lack of an effective delivery system. In this study, we sought to develop an siRNA-delivery system for VEGF, a known signaling molecule involved in cancer, that consists of two selenium nanoparticles SeNPs and G2/PAH-Cit/SeNPs. A G2/PAH-Cit/SeNP is a pH-sensitive delivery system that is capable of enhancing siRNA loading, thus increasing siRNA release efficiency and subsequent target gene silencing both in vitro and in vivo. In vivo experiments using G2/PAH-Cit/SeNPs@siRNA led to significantly higher accumulation of siRNA within the tumor itself, VEGF gene silencing, and reduced angiogenesis in the tumor. Furthermore, the G2/PAH-Cit/SeNP delivery system not only enhanced anti-tumor effects on tumor-bearing nude mice as compared to SeNPs@siRNA, but also resulted in weak occurrence of lesions in major target organs. In sum, this study provides a new class of siRNA delivery system, thereby providing an alternative therapeutic route for cancer treatment.The utility of small interfering RNAs (siRNAs) has shown great promise in treating a variety of diseases including many types of cancer. While their ability to silence a wide range of target genes underlies their effectiveness, the application of therapies remains hindered by a lack of an effective delivery system. In this study, we sought to develop an siRNA-delivery system for VEGF, a known signaling molecule involved in cancer, that consists of two selenium nanoparticles SeNPs and G2/PAH-Cit/SeNPs. A G2/PAH-Cit/SeNP is a pH-sensitive delivery system that is capable of enhancing siRNA loading, thus increasing siRNA release efficiency and subsequent target gene silencing both in vitro and in vivo. In vivo experiments using G2/PAH-Cit/SeNPs@siRNA

  16. Silencing the Snail-dependent RNA splice regulator ESRP1 drives malignant transformation of human pulmonary epithelial cells.

    Science.gov (United States)

    Walser, Tonya C; Jing, Zhe; Tran, Linh M; Lin, Ying Q; Yakobian, Natalie; Wang, Gerald; Krysan, Kostyantyn; Zhu, Li X; Sharma, Sherven; Lee, Mi-Heon; Belperio, John A; Ooi, Aik T; Gomperts, Brigitte N; Shay, Jerry W; Larsen, Jill E; Minna, John D; Hong, Long-Sheng; Fishbein, Michael C; Dubinett, Steven M

    2018-02-05

    Epithelial-to-mesenchymal transition (EMT) is organized in cancer cells by a set of key transcription factors, but the significance of this process is still debated including in non-small cell lung cancer (NSCLC). Here we report increased expression of the EMT-inducing transcription factor Snail in premalignant pulmonary lesions, relative to histologically normal pulmonary epithelium. In immortalized human pulmonary epithelial cells and isogenic derivatives, we documented Snail-dependent anchorage-independent growth in vitro and primary tumor growth and metastatic behavior in vivo. Snail-mediated transformation relied upon silencing of the tumor suppressive RNA splicing regulatory protein ESRP1. In clinical specimens of NSCLC, ESRP1 loss was documented in Snail-expressing premalignant pulmonary lesions. Mechanistic investigations showed that Snail drives malignant progression in an ALDH+CD44+CD24- pulmonary stem cell subset in which ESRP1 and stemness-repressing microRNAs are inhibited. Collectively, our results show how ESRP1 loss is a critical event in lung carcinogenesis, and they identify new candidate directions for targeted therapy of NSCLC. Copyright ©2018, American Association for Cancer Research.

  17. Inhalable delivery of AAV-based MRP4/ABCC4 silencing RNA prevents monocrotaline-induced pulmonary hypertension

    Directory of Open Access Journals (Sweden)

    Caroline Claude

    Full Text Available The ATP-binding cassette transporter MRP4 (encoded by ABCC4 regulates membrane cyclic nucleotides concentrations in arterial cells including smooth muscle cells. MRP4/ABCC4 deficient mice display a reduction in smooth muscle cells proliferation and a prevention of pulmonary hypertension in response to hypoxia. We aimed to study gene transfer of a MRP4/ABCC4 silencing RNA via intratracheal delivery of aerosolized adeno-associated virus 1 (AAV1.shMRP4 or AAV1.control in a monocrotaline-induced model of pulmonary hypertension in rats. Gene transfer was performed at the time of monocrotaline administration and the effect on the development of pulmonary vascular remodeling was assessed 35 days later. AAV1.shMRP4 dose-dependently reduced right ventricular systolic pressure and hypertrophy with a significant reduction with the higher doses (i.e., >1011 DRP/animal as compared to AAV1.control. The higher dose of AAV1.shMRP4 was also associated with a significant reduction in distal pulmonary arteries remodeling. AAV1.shMRP4 was finally associated with a reduction in the expression of ANF, a marker of cardiac hypertrophy. Collectively, these results support a therapeutic potential for downregulation of MRP4 for the treatment of pulmonary artery hypertension.

  18. Silencing of GPNMB by siRNA Inhibits the Formation of Melanosomes in Melanocytes in a MITF-Independent Fashion

    Science.gov (United States)

    Zhu, Cansheng; Yuan, Xiaoying; Li, Dongguang; Gu, Weijie; Ma, Huimin; Xie, Xin; Gao, Tianwen

    2012-01-01

    Background Melanosomes are specialized membrane-surrounded organelles, which are involved in the synthesis, storage and transport of melanin. Glycoprotein (transmembrane) non-metastatic melanoma protein b (GPNMB), a melanosome-specific structural protein, shares significant amino acid sequence homology with Pmel-17. Proteomic analysis demonstrated that GPNMB is present in all stages (I-IV) of melanosomes. However, little is known about the role of GPNMB in melanosomes. Methodology/Principal Findings Using real-time quantitative PCR, Western blotting and immunofluorescence analysis, we demonstrated that the expression of GPNMB in PIG1 melanocytes was up-regulated by ultraviolet B (UVB) radiation. Transmission electron microscopy analysis showed that the total number of melanosomes in PIG1 melanocytes was sharply reduced by GPNMB-siRNA transfection. Simultaneously, the expression levels of tyrosinase (Tyr), tyrosinase related protein 1 (Trp1), Pmel17/gp100 and ocular albinism type 1 protein (OA1) were all significantly attenuated. But the expression of microphthalmia-associated transcription factor (MITF) was up-regulated. Intriguingly, in GPNMB silenced PIG1 melanocytes, UVB radiation sharply reduced MITF expression. Conclusion Our present work revealed that the GPNMB was critical for the formation of melanosomes. And GPNMB expression down-regulation attenuated melanosome formation in a MITF-independent fashion. PMID:22912767

  19. Cucumber mosaic virus and its 2b RNA silencing suppressor modify plant-aphid interactions in tobacco

    Science.gov (United States)

    Ziebell, Heiko; Murphy, Alex M.; Groen, Simon C.; Tungadi, Trisna; Westwood, Jack H.; Lewsey, Mathew G.; Moulin, Michael; Kleczkowski, Adam; Smith, Alison G.; Stevens, Mark; Powell, Glen; Carr, John P.

    2011-01-01

    The cucumber mosaic virus (CMV) 2b protein not only inhibits anti-viral RNA silencing but also quenches transcriptional responses of plant genes to jasmonic acid, a key signalling molecule in defence against insects. This suggested that it might affect interactions between infected plants and aphids, insects that transmit CMV. We found that infection of tobacco with a 2b gene deletion mutant (CMVΔ2b) induced strong resistance to aphids (Myzus persicae) while CMV infection fostered aphid survival. Using electrical penetration graph methodology we found that higher proportions of aphids showed sustained phloem ingestion on CMV-infected plants than on CMVΔ2b-infected or mock-inoculated plants although this did not increase the rate of growth of individual aphids. This indicates that while CMV infection or certain viral gene products might elicit aphid resistance, the 2b protein normally counteracts this during a wild-type CMV infection. Our findings suggest that the 2b protein could indirectly affect aphid-mediated virus transmission. PMID:22355702

  20. Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

    Directory of Open Access Journals (Sweden)

    Kevin J Paik

    Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

  1. Silencing β3 Integrin by Targeted ECO/siRNA Nanoparticles Inhibits EMT and Metastasis of Triple Negative Breast Cancer

    Science.gov (United States)

    Mack, Margaret A.; Schiemann, William P.; Lu, Zheng-Rong

    2015-01-01

    Metastatic breast cancer is the second leading cause of cancer-related deaths amongst women. Triple-negative breast cancer (TNBC) is a highly aggressive subcategory of breast cancer and currently lacks well-defined molecular targets for effective targeted therapies. Disease relapse, metastasis, and drug resistance render standard chemotherapy ineffective in the treatment of TNBC. Since previous studies coupled β3 integrin to epithelial-mesenchymal transition (EMT) and metastasis, we exploited β3 integrin as a therapeutic target to treat TNBC by delivering β3 integrin siRNA via lipid ECO-based nanoparticles (ECO/siβ3). Treatment of TNBC cells with ECO/siβ3 was sufficient to effectively silence β3 integrin expression, attenuate TGF-β-mediated EMT and invasion, restore TGF-β-mediated cytostasis, and inhibit 3-dimensional organoid growth. Modification of ECO/siβ3 nanoparticles with an RGD peptide via a PEG spacer enhanced siRNA uptake by post-EMT cells. Intravenous injections of RGD-targeted ECO/siβ3 nanoparticles in vivo alleviated primary tumor burden, and more importantly, significantly inhibited metastasis. Mice bearing orthotopic, TGF-β-pre-stimulated MDA-MB-231 tumors that were treated with RGD-targeted ECO/siβ3 nanoparticles were free of metastases and relapse after primary tumor resection and 4 weeks after release from the treatment, in comparison to untreated mice. Collectively, these results highlight ECO/siβ3 nanoparticles as a promising therapeutic regimen to combat TNBC. PMID:25858145

  2. Nanoparticle mediated P-glycoprotein silencing for improved drug delivery across the blood-brain barrier: a siRNA-chitosan approach.

    Directory of Open Access Journals (Sweden)

    Jostein Malmo

    Full Text Available The blood-brain barrier (BBB, composed of tightly organized endothelial cells, limits the availability of drugs to therapeutic targets in the central nervous system. The barrier is maintained by membrane bound efflux pumps efficiently transporting specific xenobiotics back into the blood. The efflux pump P-glycoprotein (P-gp, expressed at high levels in brain endothelial cells, has several drug substrates. Consequently, siRNA mediated silencing of the P-gp gene is one possible strategy how to improve the delivery of drugs to the brain. Herein, we investigated the potential of siRNA-chitosan nanoparticles in silencing P-gp in a BBB model. We show that the transfection of rat brain endothelial cells mediated effective knockdown of P-gp with subsequent decrease in P-gp substrate efflux. This resulted in increased cellular delivery and efficacy of the model drug doxorubicin.

  3. Specific degradation of 3' regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5'-3' spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  4. Transgenic sugarcane resistant to Sorghum mosaic virus based on coat protein gene silencing by RNA interference.

    Science.gov (United States)

    Guo, Jinlong; Gao, Shiwu; Lin, Qinliang; Wang, Hengbo; Que, Youxiong; Xu, Liping

    2015-01-01

    As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV) and/or Sorghum mosaic virus (SrMV), with additional differences in viral strains. RNA interference (RNAi) is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP) genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  5. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  6. Changes in Oleic Acid Content of Transgenic Soybeans by Antisense RNA Mediated Posttranscriptional Gene Silencing

    Directory of Open Access Journals (Sweden)

    Ling Zhang

    2014-01-01

    Full Text Available The Delta-12 oleate desaturase gene (FAD2-1, which converts oleic acid into linoleic acid, is the key enzyme determining the fatty acid composition of seed oil. In this study, we inhibited the expression of endogenous Delta-12 oleate desaturase GmFad2-1b gene by using antisense RNA in soybean Williams 82. By employing the soybean cotyledonary-node method, a part of the cDNA of soybean GmFad2-1b 801 bp was cloned for the construction of a pCAMBIA3300 vector under the soybean seed promoter BCSP. Leaf painting, LibertyLink strip, PCR, Southern blot, qRT-PCR, and fatty acid analysis were used to detect the insertion and expression of GmFad2-1b in the transgenic soybean lines. The results indicate that the metabolically engineered plants exhibited a significant increase in oleic acid (up to 51.71% and a reduction in palmitic acid (to <3% in their seed oil content. No structural differences were observed between the fatty acids of the transgenic and the nontransgenic oil extracts.

  7. In vitro transcription activities of Pol IV, Pol V and RDR2 reveal coupling of Pol IV and RDR2 for dsRNA synthesis in plant RNA silencing

    Energy Technology Data Exchange (ETDEWEB)

    Haag, Jeremy R.; Ream, Thomas S.; Marasco, Michelle; Nicora, Carrie D.; Norbeck, Angela D.; Pasa-Tolic, Ljiljana; Pikaard, Craig S.

    2012-12-14

    In Arabidopsis, RNA-dependent DNA methylation and transcriptional silencing involves three nuclear RNA polymerases that are biochemically undefined: the presumptive DNA-dependent RNA polymerases, Pol IV and Pol V and the putative RNA-dependent RNA polymerase, RDR2. Here, we demonstrate their RNA polymerase activities in vitro. Unlike Pol II, Pols IV and V require an RNA primer, are insensitive to alpha-amanitin and differ in their ability to displace non-template DNA during transcription. Biogenesis of 24 nt small interfering RNAs (siRNAs) requires both Pol IV and RDR2, which physically associate in vivo. Pol IV does not require RDR2 for activity, but RDR2 is nonfunctional in the absence of associated Pol IV, suggesting that their coupling explains the channeling of Pol IV transcripts into double-stranded RNAs that are then diced into 24 nt siRNAs.

  8. Retracted: Silencing of the COPS3 Gene by siRNA Reduces Proliferation of Lung Cancer Cells Most Likely via Induction of Cell Cycle Arrest and Apoptosis

    Science.gov (United States)

    2017-11-17

    Retraction: Retracted: Silencing of the COPS3 Gene by siRNA Reduces Proliferation of Lung Cancer Cells Most Likely via Induction of Cell Cycle Arrest and Apoptosis Asian Pacific Journal of Cancer Prevention has retracted the article titled “Silencing of the COPS3 Gene by siRNA Reduces Proliferation of Lung Cancer Cells Most Likely via Induction of Cell Cycle Arrest and Apoptosis”(1) for reason of similarity with a series of articles identified by Byrne and Labbé (2). Xue-Mei Wang, Jiu-Wei Cui1&, Wei Li , Lu Cai, Wei Song , Guan-Jun Wang 1. Xue-Mei Wang, Jiu-Wei Cui1&, Wei Li , Lu Cai, Wei Song , Guan-Jun Wang. Silencing of the COPS3 Gene by siRNA Reduces Proliferation of Lung Cancer Cells Most Likely via Induction of Cell Cycle Arrest and Apoptosis. Asian Pac J Cancer Prev. 2012;13(5):1823-7. 2. J. A. Byrne and C. Labbé, “Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines,” Scientometrics, vol. 110, no. 3, pp. 1471–1493, 2017. Authors did not respond to request for comment.

  9. Retracted: siRNA Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells

    Science.gov (United States)

    Huang, Wei-Yi; Chen, Dong-Hui; Ning, Li; Wang, Li-Wei

    2017-10-27

    Retraction: Retracted: siRNA mediated silencing of NIN1/RPN12 binding protein 1 homolog inhibits proliferation and growth of breast cancer cells Asian Pacific Journal of Cancer Prevention has retracted the article titled “siRNA mediated silencing of NIN1/RPN12 binding protein 1 homolog inhibits proliferation and growth of breast cancer cells”(1) for reason of similarity with a series of articles identified by Byrne and Labbé (2). 1. Huang WY1, Chen DH, Ning L, Wang LW. siRNA mediated silencing of NIN1/RPN12 binding protein 1 homolog inhibits proliferation and growth of breast cancer cells. Asian Pac J Cancer Prev. 2012;13(5):1823-7. 2. J. A. Byrne and C. Labbé, “Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines,” Scientometrics, vol. 110, no. 3, pp. 1471–1493, 2017. Authors did not respond to request for comment.

  10. Phytophthora suppressor of RNA silencing 2 is a conserved RxLR effector that promotes infection in soybean and Arabidopsis thaliana.

    Science.gov (United States)

    Xiong, Qin; Ye, Wenwu; Choi, Duseok; Wong, James; Qiao, Yongli; Tao, Kai; Wang, Yuanchao; Ma, Wenbo

    2014-12-01

    The genus Phytophthora consists of notorious and emerging pathogens of economically important crops. Each Phytophthora genome encodes several hundreds of cytoplasmic effectors, which are believed to manipulate plant immune response inside the host cells. However, the majority of Phytophthora effectors remain functionally uncharacterized. We recently discovered two effectors from the soybean stem and root rot pathogen Phytophthora sojae with the activity to suppress RNA silencing in plants. These effectors are designated Phytophthora suppressor of RNA silencing (PSRs). Here, we report that the P. sojae PSR2 (PsPSR2) belongs to a conserved and widespread effector family in Phytophthora. A PsPSR2-like effector produced by P. infestans (PiPSR2) can also suppress RNA silencing in plants and promote Phytophthora infection, suggesting that the PSR2 family effectors have conserved functions in plant hosts. Using Agrobacterium rhizogenes-mediated hairy roots induction, we demonstrated that the expression of PsPSR2 rendered hypersusceptibility of soybean to P. sojae. Enhanced susceptibility was also observed in PsPSR2-expressing Arabidopsis thaliana plants during Phytophthora but not bacterial infection. These experiments provide strong evidence that PSR2 is a conserved Phytophthora effector family that performs important virulence functions specifically during Phytophthora infection of various plant hosts.

  11. Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Timo Faltus

    2004-11-01

    Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

  12. Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II

    NARCIS (Netherlands)

    B. Steurer (Barbara); J.A. Marteijn (Jurgen)

    2016-01-01

    textabstractThe faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The

  13. Silencing of RhoA and RhoC expression by RNA interference suppresses human colorectal carcinoma growth in vivo

    Directory of Open Access Journals (Sweden)

    Wang Haibo

    2010-09-01

    Full Text Available Abstract Background RhoA and RhoC have been proved to be over-expressed in many solid cancers, including colorectal cancer. The reduction of RhoA and RhoC expression by RNA interference (RNAi resulted growth inhibition of cancer cells. The present study was to evaluate the effect of silencing of RhoA and RhoC expression by RNAi on growth of human colorectal carcinoma (CRC in tumor-bearing nude mice in vivo. Methods To establish HCT116 cell transplantable model, the nude mice were subcutaneously inoculated with 1.0 × 107 HCT116 cells and kept growing till the tumor xenografts reached 5-7 mm in diameter. Then the mice were randomly assigned to three groups(seven mice in each group: (1 normal saline(NS group, (2replication-defective recombinant adenovirus carrying the negative control shRNA (Ad-HK group and (3replication-defective recombinant adenovirus carrying the 4-tandem linked RhoA and RhoC shRNAs (Ad-RhoA-RhoC group. Ad-HK (4 × 108 pfu, 30 ul/mouse, Ad-RhoA-RhoC (4 × 108 pfu, 30 ul/mouse or PBS (30 ul/mouse was injected intratumorally four times once every other day. The weight and volumes of tumor xenografts were recorded. The levels of RhoA and RhoC mRNA transcripts and proteins in tumor xenografts were detected by reverse quantitative transcription polymerase chain reaction (QRT-PCR and immunohistochemical staining respectively. The terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL assay was used to detect the death of cells. Results The xenografts in mice could be seen at 5th day from the implantation of HCT116 cells and all had reached 5-7 mm in size at 9th day. After injection intratumorally, the growth speed of tumor xenografts in Ad-RhoA-RhoC group was significantly delayed compared with those in NS and Ad-HK group(P RhoA and RhoC reduced more in Ad-RhoA-RhoC group than those in NS and Ad-HK group. The relative RhoA and RhoC mRNA transcripts were decreased to 48% and 43% respectively (P RhoA and Rho

  14. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  15. Effects of shRNA-Mediated Silencing of PKM2 Gene on Aerobic Glycolysis, Cell Migration, Cell Invasion, and Apoptosis in Colorectal Cancer Cells.

    Science.gov (United States)

    Yan, Xiao-Ling; Zhang, Xue-Bin; Ao, Ran; Guan, Lin

    2017-12-01

    This study aims to explore the effects of shRNA-mediated silencing on Pyruvate kinase type M2 (PKM2) gene during aerobic glycolysis in colorectal cancer (CRC) cells. CRC tissues and adjacent normal tissues were obtained from 136 patients diagnosed with qRT-PCR, Western blotting, and immunohistochemistry (IHC) were performed to detect mRNA and protein expressions of PKM2. CRC cells were divided into a blank, vector, and PKM2-shRNA groups. Hexokinase (HK) and PKM2 activity were both determined by glucose-6-phosphate dehydrogenase (G-6-PD) coupled colorimetric assay and enzyme coupling rate method. The extracellular lactate concentration was measured by ultraviolet spectrophotometer and caspase activity was measured using spectrophotometry. The proliferation, cell cycle, apoptosis, invasion, and migration of CRC cells were detected by cell counting kit-8 (CCK-8) assay, flow cytometry, transwell assay, and scratch test. Three groups of nude mice were injected with 0.2 mL single-cell suspension from the blank, vector, and PKM2-shRNA groups, respectively. PKM2 protein content in CRC tissues was higher than that in adjacent normal tissues. Results showed that the PKM2-shRNA group exhibited significantly lower mRNA and protein expressions of PKM2, decreased PKM2 activity, reduced lactate metabolism level, increased cell apoptosis rate, elevated caspase-3 and caspase-9 activity, weakened proliferation, and a reduction in cell invasion and migration ability compared to the vector and blank groups. The optical density (OD) value was lower in the PKM2-shRNA group than in the blank and vector groups. These findings indicate that shRNA-mediated silencing of PKM2 gene promotes apoptosis and inhibits aerobic glycolysis, proliferation, migration, and invasion in CRC cells. J. Cell. Biochem. 118: 4792-4803, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  16. Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

    Science.gov (United States)

    Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

    2017-08-15

    Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

  17. Structural Dynamics of the GW182 Silencing Domain Including its RNA Recognition motif (RRM) Revealed by Hydrogen-Deuterium Exchange Mass Spectrometry

    Science.gov (United States)

    Cieplak-Rotowska, Maja K.; Tarnowski, Krzysztof; Rubin, Marcin; Fabian, Marc R.; Sonenberg, Nahum; Dadlez, Michal; Niedzwiecka, Anna

    2018-01-01

    The human GW182 protein plays an essential role in micro(mi)RNA-dependent gene silencing. miRNA silencing is mediated, in part, by a GW182 C-terminal region called the silencing domain, which interacts with the poly(A) binding protein and the CCR4-NOT deadenylase complex to repress protein synthesis. Structural studies of this GW182 fragment are challenging due to its predicted intrinsically disordered character, except for its RRM domain. However, detailed insights into the properties of proteins containing disordered regions can be provided by hydrogen-deuterium exchange mass spectrometry (HDX/MS). In this work, we applied HDX/MS to define the structural state of the GW182 silencing domain. HDX/MS analysis revealed that this domain is clearly divided into a natively unstructured part, including the CCR4-NOT interacting motif 1, and a distinct RRM domain. The GW182 RRM has a very dynamic structure, since water molecules can penetrate the whole domain in 2 h. The finding of this high structural dynamics sheds new light on the RRM structure. Though this domain is one of the most frequently occurring canonical protein domains in eukaryotes, these results are - to our knowledge - the first HDX/MS characteristics of an RRM. The HDX/MS studies show also that the α2 helix of the RRM can display EX1 behavior after a freezing-thawing cycle. This means that the RRM structure is sensitive to environmental conditions and can change its conformation, which suggests that the state of the RRM containing proteins should be checked by HDX/MS in regard of the conformational uniformity. [Figure not available: see fulltext.

  18. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7

    Directory of Open Access Journals (Sweden)

    Bi YZ

    2016-11-01

    Full Text Available Yanzhao Bi, Yifan Zhang, Chunying Cui, Lulu Ren, Xueyun Jiang School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, People’s Republic of China Abstract: Nanodiamond (ND is a renowned material in nonviral small interfering RNA (siRNA carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH22NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR assay, enzyme-linked immunosorbent assay (ELISA, flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH22NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V–fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH22NH-VDGR/survivin-siRNA nanoparticle with 60–110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH22NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH22NH-VDGR was suggested

  19. Nuclear TRIM25 Specifically Targets Influenza Virus Ribonucleoproteins to Block the Onset of RNA Chain Elongation.

    Science.gov (United States)

    Meyerson, Nicholas R; Zhou, Ligang; Guo, Yusong R; Zhao, Chen; Tao, Yizhi J; Krug, Robert M; Sawyer, Sara L

    2017-11-08

    TRIM25 is an E3 ubiquitin ligase that activates RIG-I to promote the antiviral interferon response. The NS1 protein from all strains of influenza A virus binds TRIM25, although not all virus strains block the interferon response, suggesting alternative mechanisms for TRIM25 action. Here we present a nuclear role for TRIM25 in specifically restricting influenza A virus replication. TRIM25 inhibits viral RNA synthesis through a direct mechanism that is independent of its ubiquitin ligase activity and the interferon pathway. This activity can be inhibited by the viral NS1 protein. TRIM25 inhibition of viral RNA synthesis results from its binding to viral ribonucleoproteins (vRNPs), the structures containing individual viral RNA segments, the viral polymerase, and multiple viral nucleoproteins. TRIM25 binding does not inhibit initiation of capped-RNA-primed viral mRNA synthesis by the viral polymerase. Rather, the onset of RNA chain elongation is inhibited because TRIM25 prohibits the movement of RNA into the polymerase complex. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Silence of the Genes

    Indian Academy of Sciences (India)

    Srimath

    The human genome codes for ~35,000 genes and all these genes are not expressed in every cell. The time and site of gene expression is very precisely regulated. In any cell, only. Silence of the Genes. 2006 Nobel Prize in Physiology or Medicine. Utpal Nath and Saumitra Das. Keywords. RNA interference, siRNA,.

  1. The RNA interference revolution

    Directory of Open Access Journals (Sweden)

    G. Lenz

    2005-12-01

    Full Text Available The discovery of double-stranded RNA-mediated gene silencing has rapidly led to its use as a method of choice for blocking a gene, and has turned it into one of the most discussed topics in cell biology. Although still in its infancy, the field of RNA interference has already produced a vast array of results, mainly in Caenorhabditis elegans, but recently also in mammalian systems. Micro-RNAs are short hairpins of RNA capable of blocking translation, which are transcribed from genomic DNA and are implicated in several aspects from development to cell signaling. The present review discusses the main methods used for gene silencing in cell culture and animal models, including the selection of target sequences, delivery methods and strategies for a successful silencing. Expected developments are briefly discussed, ranging from reverse genetics to therapeutics. Thus, the development of the new paradigm of RNA-mediated gene silencing has produced two important advances: knowledge of a basic cellular mechanism present in the majority of eukaryotic cells and access to a potent and specific new method for gene silencing.

  2. Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant.

    Science.gov (United States)

    Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit

    2009-08-01

    Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.

  3. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7.

    Science.gov (United States)

    Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun

    Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.

  4. Silencing Bag-1 gene via magnetic gold nanoparticle-delivered siRNA plasmid for colorectal cancer therapy in vivo and in vitro.

    Science.gov (United States)

    Huang, Wenbai; Liu, Zhan'ao; Zhou, Guanzhou; Ling, Jianmin; Tian, Ailing; Sun, Nianfeng

    2016-08-01

    Apoptosis disorder is generally regarded as an important mechanism of carcinogenesis. Inducement of tumor cell apoptosis can be an effectual way to treat cancer. Bcl-2-associated athanogene 1 (Bag-1) is a positive regulator of Bcl-2 which is an anti-apoptotic gene. Bag-1 is highly expressed in colorectal cancer, which plays a critical role in promoting metastasis, poor prognosis, especially in anti-apoptotic function, and is perhaps a valuable gene target for colorectal cancer therapy. Recently, we applied a novel non-viral gene carrier, magnetic gold nanoparticle, and mediated plasmid pGPH1/GFP/Neo-Bag-1-homo-825 silencing Bag-1 gene for treating colorectal cancer in vivo and in vitro. By mediating with magnetic gold nanoparticle, siRNA plasmid was successfully transfected into cell. In 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) assay, magnetic gold nanoparticle had no significant cytotoxicity and by which delivered RNA plasmid inhibited cell viability significantly (P nanoparticle plasmid complex-transfected Balb c/nude tumor xenograft. In conclusion, Bag-1 is confirmed an anti-apoptosis gene that functioned in colorectal cancer, and the mechanism of Bag-1 gene causing colorectal cancer may be related to Wnt/β-catenin signaling pathway abnormality and suggested that magnetic gold nanoparticle-delivered siRNA plasmid silencing Bag-1 is an effective gene therapy method for colorectal cancer.

  5. Saturation of recognition elements blocks evolution of new tRNA identities

    Science.gov (United States)

    Saint-Léger, Adélaïde; Bello, Carla; Dans, Pablo D.; Torres, Adrian Gabriel; Novoa, Eva Maria; Camacho, Noelia; Orozco, Modesto; Kondrashov, Fyodor A.; Ribas de Pouplana, Lluís

    2016-01-01

    Understanding the principles that led to the current complexity of the genetic code is a central question in evolution. Expansion of the genetic code required the selection of new transfer RNAs (tRNAs) with specific recognition signals that allowed them to be matured, modified, aminoacylated, and processed by the ribosome without compromising the fidelity or efficiency of protein synthesis. We show that saturation of recognition signals blocks the emergence of new tRNA identities and that the rate of nucleotide substitutions in tRNAs is higher in species with fewer tRNA genes. We propose that the growth of the genetic code stalled because a limit was reached in the number of identity elements that can be effectively used in the tRNA structure. PMID:27386510

  6. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  7. Silencing of neurotropic flavivirus replication in the central nervous system by combining multiple microRNA target insertions in two distinct viral genome regions

    Science.gov (United States)

    Teterina, Natalya L.; Liu, Guangping; Maximova, Olga A.; Pletnev, Alexander G.

    2014-01-01

    In recent years, microRNA-targeting has become an effective strategy for selective control of tissue-tropism and pathogenesis of both DNA and RNA viruses. Here, using a neurotropic flavivirus as a model, we demonstrate that simultaneous miRNA targeting of the viral genome in the open reading frame and 3′-noncoding regions for brain-expressed miRNAs had an additive effect and produced a more potent attenuation of the virus compared to separate targeting of those regions. Multiple miRNA co-targeting of these two distantly located regions completely abolished the virus neurotropism as no viral replication was detected in the developing brain of neonatal mice. Furthermore, no viral antigens were detected in neurons, and neuronal integrity in the brain of mice was well preserved. This miRNA co-targeting approach can be adapted for other viruses in order to minimize their replication in a cell- or tissue-type specific manner, but most importantly, to prevent virus escape from miRNA-mediated silencing. PMID:24889244

  8. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  9. Silencing of P2X7R by RNA interference in the hippocampus can attenuate morphological and behavioral impact of pilocarpine-induced epilepsy.

    Science.gov (United States)

    Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José

    2017-12-01

    Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.

  10. Genomic Characterization of Variable Surface Antigens Reveals a Telomere Position Effect as a Prerequisite for RNA Interference-Mediated Silencing in Paramecium tetraurelia

    Science.gov (United States)

    Baranasic, Damir; Oppermann, Timo; Cheaib, Miriam; Cullum, John; Schmidt, Helmut

    2014-01-01

    ABSTRACT Antigenic or phenotypic variation is a widespread phenomenon of expression of variable surface protein coats on eukaryotic microbes. To clarify the mechanism behind mutually exclusive gene expression, we characterized the genetic properties of the surface antigen multigene family in the ciliate Paramecium tetraurelia and the epigenetic factors controlling expression and silencing. Genome analysis indicated that the multigene family consists of intrachromosomal and subtelomeric genes; both classes apparently derive from different gene duplication events: whole-genome and intrachromosomal duplication. Expression analysis provides evidence for telomere position effects, because only subtelomeric genes follow mutually exclusive transcription. Microarray analysis of cultures deficient in Rdr3, an RNA-dependent RNA polymerase, in comparison to serotype-pure wild-type cultures, shows cotranscription of a subset of subtelomeric genes, indicating that the telomere position effect is due to a selective occurrence of Rdr3-mediated silencing in subtelomeric regions. We present a model of surface antigen evolution by intrachromosomal gene duplication involving the maintenance of positive selection of structurally relevant regions. Further analysis of chromosome heterogeneity shows that alternative telomere addition regions clearly affect transcription of closely related genes. Consequently, chromosome fragmentation appears to be of crucial importance for surface antigen expression and evolution. Our data suggest that RNAi-mediated control of this genetic network by trans-acting RNAs allows rapid epigenetic adaptation by phenotypic variation in combination with long-term genetic adaptation by Darwinian evolution of antigen genes. PMID:25389173

  11. Correction of Mutant p63 in EEC Syndrome Using siRNA Mediated Allele-Specific Silencing Restores Defective Stem Cell Function.

    Science.gov (United States)

    Barbaro, Vanessa; Nasti, Annamaria A; Del Vecchio, Claudia; Ferrari, Stefano; Migliorati, Angelo; Raffa, Paolo; Lariccia, Vincenzo; Nespeca, Patrizia; Biasolo, Mariangela; Willoughby, Colin E; Ponzin, Diego; Palù, Giorgio; Parolin, Cristina; Di Iorio, Enzo

    2016-06-01

    Ectrodactyly-Ectodermal dysplasia-Clefting (EEC) syndrome is a rare autosomal dominant disease caused by heterozygous mutations in the p63 gene and characterized by limb defects, orofacial clefting, ectodermal dysplasia, and ocular defects. Patients develop progressive total bilateral limbal stem cell deficiency, which eventually results in corneal blindness. Medical and surgical treatments are ineffective and of limited benefit. Oral mucosa epithelial stem cells (OMESCs) represent an alternative source of stem cells capable of regenerating the corneal epithelium and, combined with gene therapy, could provide an attractive therapeutic avenue. OMESCs from EEC patients carrying the most severe p63 mutations (p.R279H and p.R304Q) were characterized and the genetic defect of p.R279H silenced using allele-specific (AS) small interfering RNAs (siRNAs). Systematic screening of locked nucleic acid (LNA)-siRNAs against R279H-p63 allele in (i) stable WT-ΔNp63α-RFP and R279H-ΔNp63α-EGFP cell lines, (ii) transient doubly transfected cell lines, and (iii) p.R279H OMESCs, identified a number of potent siRNA inhibitors for the mutant allele, which had no effect on wild-type p63. In addition, siRNA treatment led to longer acquired life span of mutated stem cells compared to controls, less accelerated stem cell differentiation in vitro, reduced proliferation properties, and effective ability in correcting the epithelial hypoplasia, thus giving rise to full thickness stratified and differentiated epithelia. This study demonstrates the phenotypic correction of mutant stem cells (OMESCs) in EEC syndrome by means of siRNA mediated AS silencing with restoration of function. The application of siRNA, alone or in combination with cell-based therapies, offers a therapeutic strategy for corneal blindness in EEC syndrome. Stem Cells 2016;34:1588-1600. © 2016 AlphaMed Press.

  12. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  13. Effects of siRNA Silencing of TUG1 and LCAL6 Long Non-coding RNAs on Patient-derived Xenograft of Non-small Cell Lung Cancer.

    Science.gov (United States)

    Fang, Tian; Huang, Hairong; Li, Xiaoyou; Liao, Jing; Yang, Zhijian; Hoffman, Robert M; Cheng, X I; Liang, Lei; Hu, Wenjuan; Yun, Shifeng

    2018-01-01

    The aim of the present study was to establish a patient-derived xenograft (PDX) mouse model of non-small cell lung cancer (NSCLC) and investigate the anti-tumor efficacy of silencing of TUG1 and LCAL6 long non-coding RNA in the PDX model. PDXs were established by subcutaneously implanting NSCLC surgical tumor fragments into immunodeficient mice. PDX characterization was performed by histopathological, immunohistochemical and real-time polymerase chain reaction (RT-PCR) analyses for NSCLC subtype-specific markers and expression of LCAL6 and TUG1. Anti-tumor efficacy of siRNA silencing of TUG1 and LCAL6 was also investigated in the PDX model. The effect of TUG1 and LCAL6 silencing on protein expression of proliferation marker Ki67 and HOX-gene family HOXB7 in the tumors was assessed by immunohistochemical staining and Western blotting. Establishment of NSCLC PDX models resulted in 9 of 26 cases (34.6%). Lung squamous cell carcinomas (SCC) had a higher engraftment rate (58.3%) than lung adenocarcinomas (ADC) (18.2%) (pTUG1. The tumor volume and weight were significantly reduced in the TUG1-silenced group as compared to the control group (p0.05). Expression of both TUG1and LCAL6 was reduced by siRNA treatment. Expression of Ki67 and HOXB7 was significantly suppressed in both the TUG1- and LCAL6-silenced groups compared to the control group (pTUG1-silenced group showed more reduced Ki67 expression than the LCAL6-silenced group (pTUG1 and LCAL6. Silencing of TUG1 inhibited both tumor growth and expression of the proliferation marker Ki67 and HOX-gene family HOXB7 in the PDX model of NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  14. Blocking c-myc and stat3 by E. coli expressed and enzyme digested siRNA in mouse melanoma

    International Nuclear Information System (INIS)

    Hong Jie; Zhao Yingchun; Huang Weida

    2006-01-01

    Tumour cells often show alteration in the signal-transduction pathways, leading to proliferation in response to external signals. Oncogene overexpression and constitutive expression is a common phenomenon in the development and progression of many human cancers. Therefore oncogenes provide potential targets for cancer therapy. RNA interference (RNAi), mediated by small interfering RNA (siRNA), silences genes with a high degree of specificity and potentially represents a general approach for molecularly targeted anti-cancer therapy. The data presented in this report evaluated the method of systemically administering combined esiRNAs to multiple targets as compared with the method of using a single kind of esiRNA to a single target. Our experimental data revealed that the mixed treatment of esiC-MYC and esiSTAT3 had a better inhibition effect than the single treatment of esiC-MYC or esiSTAT3 on mouse B16 melanoma

  15. The cyclin-dependent kinase 8 module sterically blocks Mediator interactions with RNA polymerase II

    DEFF Research Database (Denmark)

    Elmlund, Hans; Baraznenok, Vera; Lindahl, Martin

    2006-01-01

    CDK8 (cyclin-dependent kinase 8), along with CycC, Med12, and Med13, form a repressive module (the Cdk8 module) that prevents RNA polymerase II (pol II) interactions with Mediator. Here, we report that the ability of the Cdk8 module to prevent pol II interactions is independent of the Cdk8......-dependent kinase activity. We use electron microscopy and single-particle reconstruction to demonstrate that the Cdk8 module forms a distinct structural entity that binds to the head and middle region of Mediator, thereby sterically blocking interactions with pol II....

  16. Ferritin Heavy Subunit Silencing Blocks the Erythroid Commitment of K562 Cells via miR-150 up-Regulation and GATA-1 Repression.

    Science.gov (United States)

    Zolea, Fabiana; Battaglia, Anna Martina; Chiarella, Emanuela; Malanga, Donatella; De Marco, Carmela; Bond, Heather Mandy; Morrone, Giovanni; Costanzo, Francesco; Biamonte, Flavia

    2017-10-17

    Erythroid differentiation is a complex and multistep process during which an adequate supply of iron for hemoglobinization is required. The role of ferritin heavy subunit, in this process, has been mainly attributed to its capacity to maintain iron in a non-toxic form. We propose a new role for ferritin heavy subunit (FHC) in controlling the erythroid commitment of K562 erythro-myeloid cells. FHC knockdown induces a change in the balance of GATA transcription factors and significantly reduces the expression of a repertoire of erythroid-specific genes, including α- and γ-globins, as well as CD71 and CD235a surface markers, in the absence of differentiation stimuli. These molecular changes are also reflected at the morphological level. Moreover, the ability of FHC-silenced K562 cells to respond to the erythroid-specific inducer hemin is almost completely abolished. Interestingly, we found that this new role for FHC is largely mediated via regulation of miR-150, one of the main microRNA implicated in the cell-fate choice of common erythroid/megakaryocytic progenitors. These findings shed further insight into the biological properties of FHCand delineate a role in erythroid differentiation where this protein does not act as a mere iron metabolism-related factor but also as a critical regulator of the expression of genes of central relevance for erythropoiesis.

  17. High Throughput Sequencing of Entamoeba 27nt Small RNA Population Reveals Role in Permanent Gene Silencing But No Effect on Regulating Gene Expression Changes during Stage Conversion, Oxidative, or Heat Shock Stress.

    Science.gov (United States)

    Zhang, Hanbang; Ehrenkaufer, Gretchen M; Manna, Dipak; Hall, Neil; Singh, Upinder

    2015-01-01

    The human parasite Entamoeba histolytica has an active RNA interference (RNAi) pathway with an extensive repertoire of 27nt small RNAs that silence genes. However the role of this pathway in regulating amebic biology remains unknown. In this study, we address whether silencing via 27nt small RNAs may be a mechanism for controlling gene expression changes during conversion between the trophozoite and cyst stages of the parasite. We sequenced small RNA libraries generated from trophozoites, early cysts, mature cysts, and excysting cells and mapped them to the E. invadens genome. Our results show that, as in E. histolytica, small RNAs in E. invadens are largely ~27nt in length, have an unusual 5'-polyphosphate structure and mediate gene silencing. However, when comparing the libraries from each developmental time-point we found few changes in the composition of the small RNA populations. Furthermore, genes targeted by small RNAs were permanently silenced with no changes in transcript abundance during development. Thus, the E. invadens 27nt small RNA population does not mediate gene expression changes during development. In order to assess the generalizability of our observations, we examined whether small RNAs may be regulating gene expression changes during stress response in E. histolytica. Comparison of the 27nt small RNA populations from E. histolytica trophozoites from basal conditions, or after heat shock or exposure to oxidative stress showed few differences. Similar to data in E. invadens development, genes targeted by small RNAs were consistently silenced and did not change expression under tested stress conditions. Thus, the biological roles of the 27nt small RNA population in Entamoeba remain elusive. However, as the first characterization of the RNAi pathway in E. invadens these data serve as a useful resource for the study of Entamoeba development and open the door to the development of RNAi-based gene silencing tools in E. invadens.

  18. Overcoming cisplatin resistance in non-small cell lung cancer with Mad2 silencing siRNA delivered systemically using EGFR-targeted chitosan nanoparticles.

    Science.gov (United States)

    Nascimento, Ana Vanessa; Singh, Amit; Bousbaa, Hassan; Ferreira, Domingos; Sarmento, Bruno; Amiji, Mansoor M

    2017-01-01

    Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered. However, adverse side effects are usually increased as a consequence. A potentially effective approach is to combine chemotherapy with other therapeutic strategies such as small interfering RNAs (siRNAs) that allow the use of lower yet efficient doses of the anticancer drugs. We previously developed epidermal growth factor receptor (EGFR)-targeted chitosan (CS) nanoparticles as a versatile delivery system for silencing the essential mitotic checkpoint gene Mad2, and induce cell death. Here, we tested this system as a single therapy and in combination with cisplatin in cisplatin sensitive and resistant lung cancer models, and characterized its in vivo efficacy and safety. Combination treatment resulted in significant improvement in tumor inhibition that was strikingly more effective in cisplatin-resistant tumors. Importantly, effective cisplatin dosage was dramatically reduced in the co-therapy regimen resulting in negligible toxic effects from the drug as confirmed by parameters such as body weight gain, biochemical markers of hepatic and renal function, and histopathology of liver/kidney/spleen tissues. Overall, we demonstrate that the combination of Mad2 siRNA-loaded CS nanoparticles strategy with chemotherapeutic agents such as cisplatin constitutes an efficient and safe approach for the treatment of drug resistant tumors. Lung cancer remains one of the leading killers in the United States and around the world. Platinum agents, including cisplatin, are the first line treatment in lung cancer, including non-small cell lung cancer (NSCLC), which is the predominant form of lung cancer. In this study, we have evaluated Mad2 cell-cycle checkpoint gene silencing using small interfering RNA (siRNA) delivered

  19. Zinc Salts Block Hepatitis E Virus Replication by Inhibiting the Activity of Viral RNA-Dependent RNA Polymerase.

    Science.gov (United States)

    Kaushik, Nidhi; Subramani, Chandru; Anang, Saumya; Muthumohan, Rajagopalan; Shalimar; Nayak, Baibaswata; Ranjith-Kumar, C T; Surjit, Milan

    2017-11-01

    Hepatitis E virus (HEV) causes an acute, self-limiting hepatitis in healthy individuals and leads to chronic disease in immunocompromised individuals. HEV infection in pregnant women results in a more severe outcome, with the mortality rate going up to 30%. Though the virus usually causes sporadic infection, epidemics have been reported in developing and resource-starved countries. No specific antiviral exists against HEV. A combination of interferon and ribavirin therapy has been used to control the disease with some success. Zinc is an essential micronutrient that plays crucial roles in multiple cellular processes. Zinc salts are known to be effective in reducing infections caused by few viruses. Here, we investigated the effect of zinc salts on HEV replication. In a human hepatoma cell (Huh7) culture model, zinc salts inhibited the replication of genotype 1 (g-1) and g-3 HEV replicons and g-1 HEV infectious genomic RNA in a dose-dependent manner. Analysis of a replication-defective mutant of g-1 HEV genomic RNA under similar conditions ruled out the possibility of zinc salts acting on replication-independent processes. An ORF4-Huh7 cell line-based infection model of g-1 HEV further confirmed the above observations. Zinc salts did not show any effect on the entry of g-1 HEV into the host cell. Furthermore, our data reveal that zinc salts directly inhibit the activity of viral RNA-dependent RNA polymerase (RdRp), leading to inhibition of viral replication. Taken together, these studies unravel the ability of zinc salts in inhibiting HEV replication, suggesting their possible therapeutic value in controlling HEV infection. IMPORTANCE Hepatitis E virus (HEV) is a public health concern in resource-starved countries due to frequent outbreaks. It is also emerging as a health concern in developed countries owing to its ability to cause acute and chronic infection in organ transplant and immunocompromised individuals. Although antivirals such as ribavirin have been used

  20. DICER/AGO-dependent epigenetic silencing of D4Z4 repeats enhanced by exogenous siRNA suggests mechanisms and therapies for FSHD.

    Science.gov (United States)

    Lim, Jong-Won; Snider, Lauren; Yao, Zizhen; Tawil, Rabi; Van Der Maarel, Silvère M; Rigo, Frank; Bennett, C Frank; Filippova, Galina N; Tapscott, Stephen J

    2015-09-01

    Facioscapulohumeral muscular dystrophy (FSHD) is caused by the aberrant expression of the DUX4 transcription factor in skeletal muscle. The DUX4 retrogene is encoded in the D4Z4 macrosatellite repeat array, and smaller array size or a mutation in the SMCHD1 gene results in inefficient epigenetic repression of DUX4 in skeletal muscle, causing FSHD1 and FSHD2, respectively. Previously we showed that the entire D4Z4 repeat is bi-directionally transcribed with the generation of small si- or miRNA-like fragments and suggested that these might suppress DUX4 expression through the endogenous RNAi pathway. Here we show that exogenous siRNA targeting the region upstream of the DUX4 transcription start site suppressed DUX4 mRNA expression and increased both H3K9 methylation and AGO2 recruitment. In contrast, similarly targeted MOE-gapmer antisense oligonucleotides that degrade RNA but do not engage the RNAi pathway did not repress DUX4 expression. In addition, knockdown of DICER or AGO2 using either siRNA or MOE-gapmer chemistries resulted in the induction of DUX4 expression in control muscle cells that normally do not express DUX4, indicating that the endogenous RNAi pathway is necessary to maintain repression of DUX4 in control muscle cells. Together these data demonstrate a role of the endogenous RNAi pathway in repeat-mediated epigenetic repression of the D4Z4 macrosatellite repeat, and show that enhancing the activity of this pathway by supplying exogenous siRNA oligonucleotides represents a potential therapeutic approach to silencing DUX4 in FSHD. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Novel AgoshRNA molecules for silencing of the CCR5 co-receptor for HIV-1 infection.

    Science.gov (United States)

    Herrera-Carrillo, Elena; Berkhout, Ben

    2017-01-01

    Allogeneic transplantation of blood stem cells from a CCR5-Δ32 homozygous donor to an HIV-infected individual, the "Berlin patient", led to a cure. Since then there has been a search for approaches that mimic this intervention in a gene therapy setting. RNA interference (RNAi) has evolved as a powerful tool to regulate gene expression in a sequence-specific manner and can be used to inactivate the CCR5 mRNA. Short hairpin RNA (shRNA) molecules can impair CCR5 expression, but these molecules may cause unintended side effects and they will not be processed in cells that lack Dicer, such as monocytes. Dicer-independent RNAi pathways have opened opportunities for new AgoshRNA designs that rely exclusively on Ago2 for maturation. Furthermore, AgoshRNA processing yields a single active guide RNA, thus reducing off-target effects. In this study, we tested different AgoshRNA designs against CCR5. We selected AgoshRNAs that potently downregulated CCR5 expression on human T cells and peripheral blood mononuclear cells (PBMC) and that had no apparent adverse effect on T cell development as assessed in a competitive cell growth assay. CCR5 knockdown significantly protected T cells from CCR5 tropic HIV-1 infection.

  2. RNA interference-mediated silencing of eukaryotic translation initiation factor 3, subunit B (EIF3B) gene expression inhibits proliferation of colon cancer cells.

    Science.gov (United States)

    Wang, Zheng; Chen, Jinxian; Sun, Jianhua; Cui, Zhe; Wu, Hui

    2012-06-26

    A key factor underlying the control of the cellular growth, size and proliferation involves the regulation of the total protein synthesis. Most often, the initial stages of mRNA translation are rate limiting, which involves a group of eukaryotic translation initiation factors (EIFs). Research advances focused on the inhibition of their expression and activity hold the key to the initiation and progression of tumor and tumor prognosis. We performed RNA interference (RNAi) with the lentivirus vector system to silence the EIF3B gene using the colon cancer cell strain SW1116. The negative control included the normal target cells infected with the negative control virus whereas the knockdown cells included the normal target cells transfected with the RNAi target virus. We tested the inhibition resulting from the decreased expression of EIF3B gene on the proliferation rate of SW1116 cells, including the cell cycle, apoptosis and clonability. Compared with the negative control, the impact of EIF3B gene expression in SW1116 cells on the levels of mRNA and protein in the knockdown group, was significantly inhibited (P cell proliferation rate and clonability were also significantly inhibited (P cells in the G1 phase (P cells.

  3. Dynamic Contrast Enhanced MRI Assessing the Antiangiogenic Effect of Silencing HIF-1α with Targeted Multifunctional ECO/siRNA Nanoparticles.

    Science.gov (United States)

    Malamas, Anthony S; Jin, Erlei; Gujrati, Maneesh; Lu, Zheng-Rong

    2016-07-05

    Stabilization of hypoxia inducible factor 1α (HIF-1α), a biomarker of hypoxia, in hypoxic tumors mediates a variety of downstream genes promoting tumor angiogenesis and cancer cell survival as well as invasion, and compromising therapeutic outcome. In this study, dynamic contrast enhanced MRI (DCE-MRI) with a biodegradable macromolecular MRI contrast agent was used to noninvasively assess the antiangiogenic effect of RGD-targeted multifunctional lipid ECO/siHIF-1α nanoparticles in a mouse HT29 colon cancer model. The RGD-targeted ECO/siHIF-1α nanoparticles resulted in over 50% reduction in tumor size after intravenous injection at a dose of 2.0 mg of siRNA/kg every 3 days for 3 weeks compared to a saline control. DCE-MRI revealed significant decline in vascularity and over a 70% reduction in the tumor blood flow, permeability-surface area product, and plasma volume fraction vascular parameters in the tumor treated with the targeted ECO/siHIF-1α nanoparticles. The treatment with targeted ECO/siRNA nanoparticles resulted in significant silencing of HIF-1α expression at the protein level, which also significantly suppressed the expression of VEGF, Glut-1, HKII, PDK-1, LDHA, and CAIX, which are all important players in tumor angiogenesis, glycolytic metabolism, and pH regulation. By possessing the ability to elicit a multifaceted effect on tumor biology, silencing HIF-1α with RGD-targeted ECO/siHIF-1α nanoparticles has great promise as a single therapy or in combination with traditional chemotherapy or radiation strategies to improve cancer treatment.

  4. Crystallization and preliminary X-ray diffraction analysis of the CRISPR-Cas RNA-silencing Cmr complex.

    Science.gov (United States)

    Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki

    2015-06-01

    Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.

  5. Enhancement of Gene Silencing Effect and Membrane Permeability by Peptide-Conjugated 27-Nucleotide Small Interfering RNA

    Directory of Open Access Journals (Sweden)

    Toshio Seyama

    2012-09-01

    Full Text Available Two different sizes of siRNAs, of which one type was 21-nucleotide (nt siRNA containing 2-nt dangling ends and the other type was 27-nt siRNA with blunt ends, were conjugated with a nuclear export signal peptide of HIV-1 Rev at the 5′-sense end. Processing by Dicer enzyme, cell membrane permeability, and RNAi efficiency of the peptide-conjugated siRNAs were examined. Dicer cleaved the peptide-conjugated 27-nt siRNA leading to the release of 21-nt siRNA, whereas the peptide-conjugated 21-nt siRNA was not cleaved. High membrane permeability and cytoplasmic localization was found in the conjugates. Moreover, the peptide-conjugated 27-nt siRNA showed increased potency of RNAi in comparison with the nonmodified 21-nt and 27-nt siRNAs, whereas the peptide-conjugated 21-nt siRNA showed decreased RNAi efficacy. This potent RNAi efficacy is probably owing to acceleration of RISC through recognition by Dicer, as well as to the improvement of cell membrane permeability and intracellular accumulation.

  6. Promoting Vaginal Distribution of E7 and MCL-1 siRNA-Silencing Nanoparticles for Cervical Cancer Treatment.

    Science.gov (United States)

    Lechanteur, Anna; Furst, Tania; Evrard, Brigitte; Delvenne, Philippe; Piel, Géraldine; Hubert, Pascale

    2017-05-01

    There is an urgent need to develop a less aggressive and more effective treatment against cervical lesions induced by different high-risk human papillomavirus (HR-HPV). We investigated the potential of a cocktail of small interfering RNA (siRNA) directed against the oncoprotein E6 (E6), the oncoprotein E7 (E7), or the antiapoptotic protein MCL-1 (MCL-1). The combination of siRNA anti-E7 and anti-MCL-1 demonstrated high efficacy on multiple HPV16 and HPV18 cell lines and no effects on healthy keratinocytes. This gene therapy has been considered for a vaginal administration since this route of application holds high potential for the treatment of diseases in the female reproductive tracts. Therefore, PEGylated lipoplexes have been designed and characterized to protect siRNA and to diffuse in the mucosal environment before they reach the cervico/vaginal epithelium. This new nanovector complexed to the combination of active siRNA induced an efficient mRNA knockdown since biological effects were obtained in vitro. This work also provided evidence that the PEGylated lipoplexes had appropriate physicochemical properties to diffuse into a mucin network according to size measurement experiments in artificial mucus. After demonstrating the distribution and the efficacy of siRNA into a 3D-cervical model lesion and through porcine vaginal mucosa, in vivo experiments in mouse have been performed under physiological conditions. This study revealed a complete and sustained coverage of the mucosal epithelium following an unique vaginal administration of fluorescent PEGylated lipoplexes. Overall, our results showed the potential of the PEGylated lipoplexes for the prolonged delivery of active siRNA to treat HPV-induced lesions.

  7. Strategies of highly pathogenic RNA viruses to block dsRNA detection by RIG-I-like receptors: hide, mask, hit.

    Science.gov (United States)

    Zinzula, Luca; Tramontano, Enzo

    2013-12-01

    Double-stranded RNA (dsRNA) is synthesized during the course of infection by RNA viruses as a byproduct of replication and transcription and acts as a potent trigger of the host innate antiviral response. In the cytoplasm of the infected cell, recognition of the presence of viral dsRNA as a signature of "non-self" nucleic acid is carried out by RIG-I-like receptors (RLRs), a set of dedicated helicases whose activation leads to the production of type I interferon α/β (IFN-α/β). To overcome the innate antiviral response, RNA viruses encode suppressors of IFN-α/β induction, which block RLRs recognition of dsRNA by means of different mechanisms that can be categorized into: (i) dsRNA binding and/or shielding ("hide"), (ii) dsRNA termini processing ("mask") and (iii) direct interaction with components of the RLRs pathway ("hit"). In light of recent functional, biochemical and structural findings, we review the inhibition mechanisms of RLRs recognition of dsRNA displayed by a number of highly pathogenic RNA viruses with different disease phenotypes such as haemorrhagic fever (Ebola, Marburg, Lassa fever, Lujo, Machupo, Junin, Guanarito, Crimean-Congo, Rift Valley fever, dengue), severe respiratory disease (influenza, SARS, Hendra, Hantaan, Sin Nombre, Andes) and encephalitis (Nipah, West Nile). Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Long non-coding RNA TUG1 is up-regulated in hepatocellular carcinoma and promotes cell growth and apoptosis by epigenetically silencing of KLF2.

    Science.gov (United States)

    Huang, Ming-De; Chen, Wen-Ming; Qi, Fu-Zhen; Sun, Ming; Xu, Tong-Peng; Ma, Pei; Shu, Yong-Qian

    2015-09-04

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death worldwide, and the biology of this cancer remains poorly understood. Recent evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in a variety of cancers, including HCC. Taurine Up-regulated Gene 1 (TUG1), a 7.1-kb lncRNA, recruiting and binding to polycomb repressive complex 2 (PRC2), is found to be disregulated in non-small cell lung carcinoma (NSCLC) and esophageal squamous cell carcinoma (ESCC). However, its clinical significance and potential role in HCC remain unclear. In this study, expression of TUG1 was analyzed in 77 HCC tissues and matched normal tissues by using quantitative polymerase chain reaction (qPCR). TUG1 expression was up-regulated in HCC tissues and the higher expression of TUG1 was significantly correlated with tumor size and Barcelona Clinic Liver Cancer (BCLC) stage. Moreover, silencing of TUG1 expression inhibited HCC cell proliferation, colony formation, tumorigenicity and induced apoptosis in HCC cell lines. We also found that TUG1 overexpression was induced by nuclear transcription factor SP1 and TUG1 could epigeneticly repress Kruppel-like factor 2 (KLF2) transcription in HCC cells by binding with PRC2 and recruiting it to KLF2 promoter region. Our results suggest that lncRNA TUG1, as a growth regulator, may serve as a new diagnostic biomarker and therapy target for HCC.

  9. The P0 gene of Sugarcane yellow leaf virus encodes an RNA silencing suppressor with unique activities

    International Nuclear Information System (INIS)

    Mangwende, Tichaona; Wang Mingli; Borth, Wayne; Hu, John; Moore, Paul H.; Mirkov, T. Erik; Albert, Henrik H.

    2009-01-01

    The Sugarcane yellow leaf virus (SCYLV) P0, a member of the highly heterologous proteins of poleroviruses, is a suppressor of posttranscriptional gene silencing (PTGS) and has additional activities not seen in other P0 proteins. The P0 protein in previously tested poleroviruses (Beet western yellows virus and Cucurbit aphid-borne yellows virus), suppresses local, but not systemic, PTGS induced by both sense GFP and inverted repeat GF using its F-box-like domain to mediate destabilization of the Argonaute1 protein. We now report that the SCYLV P0 protein not only suppressed local PTGS induced by sense GFP and inverted repeat GF in Nicotiana benthamiana, but also triggered a dosage dependent cell death phenotype in infiltrated leaves and suppressed systemic sense GFP-PTGS. Deletion of the first 15 N-terminal amino acid residues of SCYLV P0 abolished suppression of both local and systemic PTGS and the induction of cell death. In contrast, only systemic PTGS and cell death were lost when the 15 C-terminal amino acid residues were deleted. We conclude that the 15 C-terminal amino acid residue region of SCYLV P0 is necessary for suppressing systemic PTGS and inducing cell death, but is not required for suppression of local PTGS

  10. Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

    Science.gov (United States)

    2008-02-01

    mediated shift of Bcl-x pre-mRNA splicing and antineoplastic agents. J Biol Chem 2002;277:49374–82. 39. Wright ME, Tsai MJ, Aebersold R. Androgen receptor...two orders of magnitude better than nanowire arrays, but these assays require extensive labeling and mul- tiple chemical and biochemical manipulations

  11. Methylation-associated Silencing of microRNA-126 and its Host Gene EGFL7 in Malignant Pleural Mesothelioma

    DEFF Research Database (Denmark)

    Andersen, Morten; Trapani, Davide; Ravn, Jesper

    2015-01-01

    BACKGROUND/AIM: We recently reported that miR-126 is down-regulated in malignant pleural mesothelioma (MPM) and can be combined into a 4-microRNA-classifier that can accurately diagnose MPM with high sensitivity and specificity. Herein we analyzed the epigenetic regulation of miR-126 and its host...

  12. Novel AgoshRNA molecules for silencing of the CCR5 co-receptor for HIV-1 infection

    NARCIS (Netherlands)

    Herrera-Carrillo, Elena; Berkhout, Ben

    2017-01-01

    Allogeneic transplantation of blood stem cells from a CCR5-Δ32 homozygous donor to an HIV-infected individual, the "Berlin patient", led to a cure. Since then there has been a search for approaches that mimic this intervention in a gene therapy setting. RNA interference (RNAi) has evolved as a

  13. A CDC45 Homolog in Arabidopsis Is Essential for Meiosis, as Shown by RNA Interference–Induced Gene Silencing

    Science.gov (United States)

    Stevens, Rebecca; Grelon, Mathilde; Vezon, Daniel; Oh, Jaesung; Meyer, Peter; Perennes, Claudette; Domenichini, Severine; Bergounioux, Catherine

    2004-01-01

    CDC45 is required for the initiation of DNA replication in yeast and cell proliferation in mammals and functions as a DNA polymerase α loading factor in Xenopus. We have cloned a CDC45 homolog from Arabidopsis whose expression is upregulated at the G1/S transition and in young meiotic flower buds. One-third of Arabidopsis 35S:CDC45 T1 RNA interference lines are partially to completely sterile, and the proportion of sterile plants is increased by using a dmc1 promoter. T1 plants have decreased levels of the CDC45 transcript and contain 21- to 23-bp RNA fragments specific to the CDC45 gene. T2 transgenic lines, in which small RNA fragments are still present, were used to analyze S-phase entry by 5-bromodeoxyuridine incorporation, which was not altered compared with that in the wild type. However, microarray data show that other cell cycle genes are upregulated or downregulated. T2 plants also have highly reduced fertility. The severity of the phenotype is correlated with the levels of the CDC45 transcript and small RNA fragments. Severe chromosome fragmentation arising during meiosis, which is not the result of a defect in the repair of SPO11-induced double strand breaks, leads to abnormal chromosome segregation and defective pollen and ovule development. PMID:14660803

  14. MicroRNA-146a regulates both transcription silencing and translation disruption of TNF-α during TLR4-induced gene reprogramming.

    Science.gov (United States)

    El Gazzar, Mohamed; Church, Ashley; Liu, Tiefu; McCall, Charles E

    2011-09-01

    Following the TLR-dependent initiation phase of acute systemic proinflammatory responses such as sepsis, an adaptive phase represses or activates a specific pattern of gene expression until the inflammation resolves. Here, we used the THP-1 sepsis cell model of bacterial LPS/endotoxin tolerance to show that TLR4-induced miR-146a supports the feed-forward adaptive processes that silence transcription and disrupt translation of acute proinflammatory genes. First, we found that miR-146a regulates a pathway that promotes the binding of transcription repressor RelB to the TNF-α promoter, a step known to precede histone and DNA modifications, which generate facultative heterochromatin to silence acute proinflammatory genes. However, once RelB binding occurred, miR-146a inhibition could not reverse compacted chromatin, and endotoxin tolerance persisted. Second, we observed that miR-146a regulates a pathway that supports assembly of the translation repressor complex of TNF-α by preventing the interaction of the RNA-binding protein effector Ago2 and RBM4. We also determined that once endotoxin tolerance is established, and specific genes have been reprogrammed, transcription and translation disruption can be reversed only by simultaneously depleting RelB and inhibiting miR-146a. Thus, miR-146a induction supports the TLR4-dependent shift from initiation to gene-specific repression at two levels. Our results also imply that therapies designed to reverse endotoxin tolerance as potential therapies for sepsis should be directed at the transcription and translation pathways of reprogramming.

  15. A developmental window of opportunity for imprinted gene silencing mediated by DNA methylation and the Kcnq1ot1 noncoding RNA.

    Science.gov (United States)

    Green, Kelly; Lewis, Annabelle; Dawson, Claire; Dean, Wendy; Reinhart, Bonnie; Chaillet, J Richard; Reik, Wolf

    2007-01-01

    The Kcnq1 imprinted domain encodes a paternally expressed noncoding RNA Kcnq1ot1 and several paternally repressed protein-coding genes. Transcriptional regulation is controlled by the Kcnq1ot1 gene whose maternal germline methylation imprint overlaps with the Kcnq1ot1 promoter. The domain can be divided into two groups of genes. One group is imprinted in all lineages and is reliant on DNA methylation for its imprinting. The other group contains genes that are imprinted specifically in the placenta and retain their imprinting in the absence of Dnmt1, the primary DNA maintenance methylase. In the placenta paternal Kcnq1ot1 expression is associated with the acquisition of repressive histone modifications throughout the domain. Using the Dnmt1o knockout, we have analyzed the effect of removing DNA maintenance methylation at the eight-cell stage on the Kcnq1 imprinted domain. In the placenta the expression of the normally silent maternal Kcnq1ot1 allele leads to reduced expression of the surrounding maternally expressed genes. This repression is seen in both the placental-specific imprinted genes and the ubiquitously imprinted genes. Conversely, reduction of functional Dnmt1 results solely in reduced expression of the ubiquitously imprinted genes in the placenta. This suggests that Kcnq1ot1 expression can epigenetically silence placentally imprinted genes in the cluster only during a specific developmental window. This highlights the possibility that Kcnq1ot1-mediated repression is temporally regulated leading to epigenetic silencing of placental-specific genes. We show that allele-specific histone modifications are still present in the Dnmt1 ( -/- ) trophoblast at placental-specific imprinted loci and are likely responsible for maintaining the imprinting of these genes in the absence of DNA methylation.

  16. RDR1 and SGS3, Components of RNA-Mediated Gene Silencing, Are Required for the Regulation of Cuticular Wax Biosynthesis in Developing Inflorescence Stems of Arabidopsis1[W][OA

    Science.gov (United States)

    Lam, Patricia; Zhao, Lifang; McFarlane, Heather E.; Aiga, Mytyl; Lam, Vivian; Hooker, Tanya S.; Kunst, Ljerka

    2012-01-01

    The cuticle is a protective layer that coats the primary aerial surfaces of land plants and mediates plant interactions with the environment. It is synthesized by epidermal cells and is composed of a cutin polyester matrix that is embedded and covered with cuticular waxes. Recently, we have discovered a novel regulatory mechanism of cuticular wax biosynthesis that involves the ECERIFERUM7 (CER7) ribonuclease, a core subunit of the exosome. We hypothesized that at the onset of wax production, the CER7 ribonuclease degrades an mRNA specifying a repressor of CER3, a wax biosynthetic gene whose protein product is required for wax formation via the decarbonylation pathway. In the absence of this repressor, CER3 is expressed, leading to wax production. To identify the putative repressor of CER3 and to unravel the mechanism of CER7-mediated regulation of wax production, we performed a screen for suppressors of the cer7 mutant. Our screen resulted in the isolation of components of the RNA-silencing machinery, RNA-DEPENDENT RNA POLYMERASE1 and SUPPRESSOR OF GENE SILENCING3, implicating RNA silencing in the control of cuticular wax deposition during inflorescence stem development in Arabidopsis (Arabidopsis thaliana). PMID:22689894

  17. Blocking the Wnt/β-Catenin Pathway by Lentivirus-Mediated Short Hairpin RNA Targeting β-Catenin Gene Suppresses Silica-Induced Lung Fibrosis in Mice

    Science.gov (United States)

    Wang, Xin; Dai, Wujing; Wang, Yanrang; Gu, Qing; Yang, Deyi; Zhang, Ming

    2015-01-01

    Silicosis is a form of occupational lung disease caused by inhalation of crystalline silica dust. While the pathogenesis of silicosis is not clearly understood, the Wnt/β-catenin signaling pathway is thought to play a major role in lung fibrosis. To explore the role of Wnt/β-catenin pathway in silicosis, we blocked Wnt/β-catenin pathway both in silica-treated MLE-12 cells (a mouse pulmonary epithelial cell line) and in a mouse silicosis model by using a lentiviral vector expressing a short hairpin RNA silencing β-catenin (Lv-shβ-catenin). In vitro, Lv-shβ-catenin significantly decreased the expression of β-catenin, MMP2 and MMP9, and secretion of TGF-β1. In vivo, intratracheal treatment with Lv-shβ-catenin significantly reduced expression of β-catenin in the lung and levels of TGF-β1 in bronchoalveolar lavage fluid, and notably attenuated pulmonary fibrosis as evidenced by hydroxyproline content and collagen I\\III synthesis in silica-administered mice. These results indicate that blockade of the Wnt/β-catenin pathway can prevent the development of silica-induced lung fibrosis. Thus Wnt/β-catenin pathway may be a target in prevention and treatment of silicosis. PMID:26340635

  18. Polymer nanocarrier system for endosome escape and timed release of siRNA with complete gene silencing and cell death in cancer cells.

    Science.gov (United States)

    Gu, Wenyi; Jia, Zhongfan; Truong, Nghia P; Prasadam, Indira; Xiao, Yin; Monteiro, Michael J

    2013-10-14

    An influenza virus-inspired polymer mimic nanocarrier was used to deliver siRNA for specific and near complete gene knockdown of an osteoscarcom cell line (U-2SO). The polymer was synthesized by single-electron transfer living radical polymerization (SET-LRP) at room temperature to avoid complexities of transfer to monomer or polymer. It was the only LRP method that allowed good block copolymer formation with a narrow molecular weight distribution. At nitrogen to phosphorus (N/P) ratios of equal to or greater than 20 (greater than a polymer concentration of 13.8 μg/mL) with polo-like kinase 1 (PLK1) siRNA gave specific and near complete (>98%) cell death. The polymer further degrades to a benign polymer that showed no toxicity even at polymer concentrations of 200 μg/mL (or N/P ratio of 300), suggesting that our polymer nanocarrier can be used as a very effective siRNA delivery system and in a multiple dose administration. This work demonstrates that with a well-designed delivery device, siRNA can specifically kill cells without the inclusion of an additional clinically used highly toxic cochemotherapeutic agent. Our work also showed that this excellent delivery is sensitive for the study of off-target knockdown of siRNA.

  19. Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis

    International Nuclear Information System (INIS)

    Di Fulvio, Mauricio; Henkels, Karen M.; Gomez-Cambronero, Julian

    2007-01-01

    Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7 shGrb2 ), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7 shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation

  20. Nanolayered siRNA delivery platforms for local silencing of CTGF reduce cutaneous scar contraction in third-degree burns.

    Science.gov (United States)

    Castleberry, Steven A; Golberg, Alexander; Sharkh, Malak Abu; Khan, Saiqa; Almquist, Benjamin D; Austen, William G; Yarmush, Martin L; Hammond, Paula T

    2016-07-01

    Wound healing is an incredibly complex biological process that often results in thickened collagen-enriched healed tissue called scar. Cutaneous scars lack many functional structures of the skin such as hair follicles, sweat glands, and papillae. The absence of these structures contributes to a number of the long-term morbidities of wound healing, including loss of function for tissues, increased risk of re-injury, and aesthetic complications. Scar formation is a pervasive factor in our daily lives; however, in the case of serious traumatic injury, scars can create long-lasting complications due to contraction and poor tissue remodeling. Within this report we target the expression of connective tissue growth factor (CTGF), a key mediator of TGFβ pro-fibrotic response in cutaneous wound healing, with controlled local delivery of RNA interference. Through this work we describe both a thorough in vitro analysis of nanolayer coated sutures for the controlled delivery of siRNA and its application to improve scar outcomes in a third-degree burn induced scar model in rats. We demonstrate that the knockdown of CTGF significantly altered the local expression of αSMA, TIMP1, and Col1a1, which are known to play roles in scar formation. The knockdown of CTGF within the healing burn wounds resulted in improved tissue remodeling, reduced scar contraction, and the regeneration of papillary structures within the healing tissue. This work adds support to a number of previous reports that indicate CTGF as a potential therapeutic target for fibrosis. Additionally, we believe that the controlled local delivery of siRNA from ultrathin polymer coatings described within this work is a promising approach in RNA interference that could be applied in developing improved cancer therapies, regenerative medicine, and fundamental scientific research. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. A comparison of CRISPR/Cas9 and siRNA-mediated ALDH2 gene silencing in human cell lines.

    Science.gov (United States)

    Wang, Fei; Guo, Tao; Jiang, Hongmei; Li, Ruobi; Wang, Ting; Zeng, Ni; Dong, Guanghui; Zeng, Xiaowen; Li, Daochuan; Xiao, Yongmei; Hu, Qiansheng; Chen, Wen; Xing, Xiumei; Wang, Qing

    2018-01-30

    Gene knockdown and knockout using RNAi and CRISPR/Cas9 allow for efficient evaluation of gene function, but it is unclear how the choice of technology can influence the results. To compare the phenotypes obtained using siRNA and CRISPR/Cas9 technologies, aldehyde dehydrogenase 2 (ALDH2) was selected as an example. In this study, we constructed one HepG2 cell line with a homozygous mutation in the fifth exon of ALDH2 (ALDH2-KO1 cell) using the eukaryotic CRISPR/Cas9 expression system followed by the limited dilution method and one HepG2 cell line with different mutations in the ALDH2 gene (ALDH2-KO2 cell) using the lentivirus CRISPR/Cas9 system. Additionally, one ALDH2-knockdown (KD) HepG2 cell line was created using siRNA. The reproducibility of these methods was further verified in the HEK293FT cell line. We found that the mRNA expression level of ALDH2 was significantly decreased and the protein expression level of ALDH2 was completely abolished in the ALDH2-KO cell lines, but not in ALDH2-KD cells. Furthermore, the functional activity of ALDH2 was also markedly disrupted in the two ALDH2-KO cell lines compared with ALDH2-KD and wild-type cells. The lack of ALDH2 expression mediated by CRIPSR/Cas9 resulted in a more dramatic increase in the cellular susceptibility to chemical-induced reactive oxygen species generation, cytotoxicity, apoptosis, and inflammation, especially at low concentrations compared with ALDH2-KD and WT cells. Therefore, we consider the gene knockout cell line created by CRISPR/Cas9 to be a more useful tool for identifying the function of a gene.

  2. RNA interference-mediated silencing of a Halloween gene spookier affects nymph performance in the small brown planthopper Laodelphax striatellus.

    Science.gov (United States)

    Jia, Shuang; Wan, Pin-Jun; Zhou, Li-Tao; Mu, Li-Li; Li, Guo-Qing

    2015-04-01

    Post-embryonic development of insects is highly dependent on ecdysteroid hormone 20-hydroxyecdysone. Halloween gene spookier (spok, cyp307a2) has been documented to be involved in ecdysteroidogenesis in Drosophila melanogaster and Bombyx mori. We describe here the cloning and characterization of Halloween gene spookier (Lsspok, Lscyp307a2) in the small brown planthopper Laodelphax striatellus, a hemipteran insect species. LsSPOK has three insect-conserved P450 motifs, that is, Helix-K, PERF motif and heme-binding domain. Temporal and spatial expression patterns of Lsspok were evaluated by quantitative polymerase chain reaction. Through the fouth-instar and the early fifth-instar stages, Lsspok showed two expression peaks in the second- and fifth-day fourth-instar nymphs, and two troughs in the first-day fourth and fifth instars. On day 5 of the fourth-instar nymphs, Lsspok clearly had a high transcript level in the thorax where prothoracic glands were located. Dietary introduction of double-stranded RNA of Lsspok in the nymph stage successfully knocked down the target gene, decreased expression level of ecdysone receptor (LsEcR) gene, caused nymphal lethality and delayed development. Ingestion of 20-hydroxyecdysone in Lsspok-dsRNA-exposed nymphs did not increase Lsspok expression level, but almost completely rescued the LsEcR mRNA level and relieved the negative effects on survival and development. Thus, our data suggest that the ecdysteroidogenic pathway is conserved in insects and LsSPOK is responsible for specific steps in ecdysteroidogenesis in L. striatellus. © 2013 Institute of Zoology, Chinese Academy of Sciences.

  3. Long noncoding RNA TUG1 is a diagnostic factor in lung adenocarcinoma and suppresses apoptosis via epigenetic silencing of BAX.

    Science.gov (United States)

    Liu, Huan; Zhou, Guizhi; Fu, Xin; Cui, Haiyan; Pu, Guangrui; Xiao, Yao; Sun, Wei; Dong, Xinhua; Zhang, Libin; Cao, Sijia; Li, Guiqin; Wu, Xiaowei; Yang, Xu

    2017-11-24

    Lung cancer is one of the leading causes of cancer-related mortality, and responds badly to existing treatment. Thus, it is of urgent need to identify novel diagnostic markers and therapeutic targets. Increasing evidences have indicated that long non-coding RNAs (lncRNAs) play an important role in initiation and progression of lung cancer. However, the role of lncRNA Taurine upregulated 1 (TUG1) in lung adenocarcinoma (LAD) progression is not well known. In this study, we determined the diagnostic value of TUG1 in LAD patients, and further uncovered the underlying functional mechanism. Our results showed that TUG1 was significantly upregulated in LAD cells and serum samples. Receiver operator characteristic (ROC) analysis suggested a relatively higher area under the curve (AUC) of TUG1 (0.756) contrast to cyfra21-1 (0.619). In addition, high TUG1 level was associated with enhanced tumor size, degree of differentiation, lymph node metastases, distant metastasis and TNM stage. Cell functional assays showed that knockdown of TUG1 suppressed LAD cell viability and promoted cell apoptosis. We then sought to reveal the underlying regulatory mechanism, and the pro-apoptotic protein BAX was then identified as the downstream target of TUG1. Gain and loss functional assays showed that inhibition of BAX reversed the induced apoptosis by TUG1 knockdown. Finally, RNA immunoprecipitation and Chromatin immunoprecipitation revealed that TUG1 suppressed BAX expression through physically interacting with EZH2. In conclusion, lncRNA TUG1 is a promising diagnostic marker for LAD patients and suppression of TUG1 levels could be a future direction to promote the prognosis of LAD patients.

  4. Long noncoding RNA TUG1 is a diagnostic factor in lung adenocarcinoma and suppresses apoptosis via epigenetic silencing of BAX

    OpenAIRE

    Liu, Huan; Zhou, Guizhi; Fu, Xin; Cui, Haiyan; Pu, Guangrui; Xiao, Yao; Sun, Wei; Dong, Xinhua; Zhang, Libin; Cao, Sijia; Li, Guiqin; Wu, Xiaowei; Yang, Xu

    2017-01-01

    Lung cancer is one of the leading causes of cancer-related mortality, and responds badly to existing treatment. Thus, it is of urgent need to identify novel diagnostic markers and therapeutic targets. Increasing evidences have indicated that long non-coding RNAs (lncRNAs) play an important role in initiation and progression of lung cancer. However, the role of lncRNA Taurine upregulated 1 (TUG1) in lung adenocarcinoma (LAD) progression is not well known. In this study, we determined the diagn...

  5. RK-33 Radiosensitizes Prostate Cancer Cells by Blocking the RNA Helicase DDX3

    Science.gov (United States)

    Xie, Min; Vesuna, Farhad; Tantravedi, Saritha; Bol, Guus M.; Heerma van Voss, Marise R.; Nugent, Katriana; Malek, Reem; Gabrielson, Kathleen; van Diest, Paul J.; Tran, Phuoc T.; Raman, Venu

    2017-01-01

    Despite advances in diagnosis and treatment, prostate cancer is the most prevalent cancer in males and the second highest cause of cancer-related mortality. We identified an RNA helicase gene, DDX3 (DDX3X), which is overexpressed in prostate cancers, and whose expression is directly correlated with high Gleason scores. Knockdown of DDX3 in the aggressive prostate cancer cell lines DU145 and 22Rv1 resulted in significantly reduced clonogenicity. To target DDX3, we rationally designed a small molecule, RK-33, which docks into the ATP-binding domain of DDX3. Functional studies indicated that RK-33 preferentially bound to DDX3 and perturbed its activity. RK-33 treatment of prostate cancer cell lines DU145, 22Rv1, and LNCaP (which have high DDX3 levels) decreased proliferation and induced a G1 phase cell-cycle arrest. Conversely, the low DDX3–expressing cell line, PC3, exhibited few changes following RK-33 treatment. Importantly, combination studies using RK-33 and radiation exhibited synergistic effects both in vitro and in a xenograft model of prostate cancer demonstrating the role of RK-33 as a radiosensitizer. Taken together, these results indicate that blocking DDX3 by RK-33 in combination with radiation treatment is a viable option for treating locally advanced prostate cancer. PMID:27634756

  6. Wolbachia Blocks Viral Genome Replication Early in Infection without a Transcriptional Response by the Endosymbiont or Host Small RNA Pathways.

    Directory of Open Access Journals (Sweden)

    Stephanie M Rainey

    2016-04-01

    Full Text Available The intracellular endosymbiotic bacterium Wolbachia can protect insects against viral infection, and is being introduced into mosquito populations in the wild to block the transmission of arboviruses that infect humans and are a major public health concern. To investigate the mechanisms underlying this antiviral protection, we have developed a new model system combining Wolbachia-infected Drosophila melanogaster cell culture with the model mosquito-borne Semliki Forest virus (SFV; Togaviridae, Alphavirus. Wolbachia provides strong antiviral protection rapidly after infection, suggesting that an early stage post-infection is being blocked. Wolbachia does appear to have major effects on events distinct from entry, assembly or exit as it inhibits the replication of an SFV replicon transfected into the cells. Furthermore, it causes a far greater reduction in the expression of proteins from the 3' open reading frame than the 5' non-structural protein open reading frame, indicating that it is blocking the replication of viral RNA. Further to this separation of the replicase proteins and viral RNA in transreplication assays shows that uncoupling of viral RNA and replicase proteins does not overcome Wolbachia's antiviral activity. This further suggests that replicative processes are disrupted, such as translation or replication, by Wolbachia infection. This may occur by Wolbachia mounting an active antiviral response, but the virus did not cause any transcriptional response by the bacterium, suggesting that this is not the case. Host microRNAs (miRNAs have been implicated in protection, but again we found that host cell miRNA expression was unaffected by the bacterium and neither do our findings suggest any involvement of the antiviral siRNA pathway. We conclude that Wolbachia may directly interfere with early events in virus replication such as translation of incoming viral RNA or RNA transcription, and this likely involves an intrinsic (as opposed to

  7. RNA interference-based silencing of the alpha-amylase (amy1) gene in Aspergillus flavus decreases fungal growth and aflatoxin production in maize kernels.

    Science.gov (United States)

    Gilbert, Matthew K; Majumdar, Rajtilak; Rajasekaran, Kanniah; Chen, Zhi-Yuan; Wei, Qijian; Sickler, Christine M; Lebar, Matthew D; Cary, Jeffrey W; Frame, Bronwyn R; Wang, Kan

    2018-03-14

    Expressing an RNAi construct in maize kernels that targets the gene for alpha-amylase in Aspergillus flavus resulted in suppression of alpha-amylase (amy1) gene expression and decreased fungal growth during in situ infection resulting in decreased aflatoxin production. Aspergillus flavus is a saprophytic fungus and pathogen to several important food and feed crops, including maize. Once the fungus colonizes lipid-rich seed tissues, it has the potential to produce toxic secondary metabolites, the most dangerous of which is aflatoxin. The pre-harvest control of A. flavus contamination and aflatoxin production is an area of intense research, which includes breeding strategies, biological control, and the use of genetically-modified crops. Host-induced gene silencing, whereby the host crop produces siRNA molecules targeting crucial genes in the invading fungus and targeting the gene for degradation, has shown to be promising in its ability to inhibit fungal growth and decrease aflatoxin contamination. Here, we demonstrate that maize inbred B104 expressing an RNAi construct targeting the A. flavus alpha-amylase gene amy1 effectively reduces amy1 gene expression resulting in decreased fungal colonization and aflatoxin accumulation in kernels. This work contributes to the development of a promising technology for reducing the negative economic and health impacts of A. flavus growth and aflatoxin contamination in food and feed crops.

  8. Silencing β3 Integrin by Targeted ECO/siRNA Nanoparticles Inhibits EMT and Metastasis of Triple-Negative Breast Cancer.

    Science.gov (United States)

    Parvani, Jenny G; Gujrati, Maneesh D; Mack, Margaret A; Schiemann, William P; Lu, Zheng-Rong

    2015-06-01

    Metastatic breast cancer is the second leading cause of cancer-related deaths among women. Triple-negative breast cancer (TNBC) is a highly aggressive subcategory of breast cancer and currently lacks well-defined molecular targets for effective targeted therapies. Disease relapse, metastasis, and drug resistance render standard chemotherapy ineffective in the treatment of TNBC. Because previous studies coupled β3 integrin (ITGB3) to epithelial-mesenchymal transition (EMT) and metastasis, we exploited β3 integrin as a therapeutic target to treat TNBC by delivering β3 integrin siRNA via lipid ECO-based nanoparticles (ECO/siβ3). Treatment of TNBC cells with ECO/siβ3 was sufficient to effectively silence β3 integrin expression, attenuate TGFβ-mediated EMT and invasion, restore TGFβ-mediated cytostasis, and inhibit three-dimensional organoid growth. Modification of ECO/siβ3 nanoparticles with an RGD peptide via a PEG spacer enhanced siRNA uptake by post-EMT cells. Intravenous injections of RGD-targeted ECO/siβ3 nanoparticles in vivo alleviated primary tumor burden and, more importantly, significantly inhibited metastasis. In the span of 16 weeks of the experiments and observations, including primary tumor resection at week 9 and release from the treatment for 4 weeks, the mice bearing orthotopic, TGFβ-prestimulated MDA-MB-231 tumors that were treated with RGD-targeted ECO/siβ3 nanoparticles were free of metastases and relapse, in comparison with untreated mice. Collectively, these results highlight ECO/siβ3 nanoparticles as a promising therapeutic regimen to combat TNBC. ©2015 American Association for Cancer Research.

  9. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Directory of Open Access Journals (Sweden)

    Yao Han

    Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

  10. Silencing of Entamoeba histolytica Glucosamine 6-Phosphate Isomerase by RNA Interference Inhibits the Formation of Cyst-Like Structures

    Directory of Open Access Journals (Sweden)

    Hugo Aguilar-Díaz

    2013-01-01

    Full Text Available Encystment is an essential process in the biological cycle of the human parasite Entamoeba histolytica. In the present study, we evaluated the participation of E. histolytica Gln6Pi in the formation of amoeba cyst-like structures by RNA interference assay. Amoeba trophozoites transfected with two Gln6Pi siRNAs reduced the expression of the enzyme in 85%, which was confirmed by western blot using an anti-Gln6Pi antibody. The E. histolytica Gln6Pi knockdown with the mix of both siRNAs resulted in the loss of its capacity to form cyst-like structures (CLSs and develop a chitin wall under hydrogen peroxide treatment, as evidenced by absence of both resistance to detergent treatment and calcofluor staining. Thus, only 5% of treated trophozoites were converted to CLS, from which only 15% were calcofluor stained. These results represent an advance in the understanding of chitin biosynthesis in E. histolytica and provide insight into the encystment process in this parasite, which could allow for the developing of new control strategies for this parasite.

  11. The Heterologous Expression of the p22 RNA Silencing Suppressor of the Crinivirus Tomato Chlorosis Virus from Tobacco Rattle Virus and Potato Virus X Enhances Disease Severity but Does Not Complement Suppressor-Defective Mutant Viruses.

    Science.gov (United States)

    Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen

    2017-11-24

    To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.

  12. Posttranscriptional gene silencing in nuclei

    Science.gov (United States)

    Hoffer, Paul; Ivashuta, Sergey; Pontes, Olga; Vitins, Alexa; Pikaard, Craig; Mroczka, Andrew; Wagner, Nicholas; Voelker, Toni

    2011-01-01

    In plants, small interfering RNAs (siRNAs) with sequence homology to transcribed regions of genes can guide the sequence-specific degradation of corresponding mRNAs, leading to posttranscriptional gene silencing (PTGS). The current consensus is that siRNA-mediated PTGS occurs primarily in the cytoplasm where target mRNAs are localized and translated into proteins. However, expression of an inverted-repeat double-stranded RNA corresponding to the soybean FAD2-1A desaturase intron is sufficient to silence FAD2-1, implicating nuclear precursor mRNA (pre-mRNA) rather than cytosolic mRNA as the target of PTGS. Silencing FAD2-1 using intronic or 3′-UTR sequences does not affect transcription rates of the target genes but results in the strong reduction of target transcript levels in the nucleus. Moreover, siRNAs corresponding to pre-mRNA–specific sequences accumulate in the nucleus. In Arabidopsis, we find that two enzymes involved in PTGS, Dicer-like 4 and RNA-dependent RNA polymerase 6, are localized in the nucleus. Collectively, these results demonstrate that siRNA-directed RNA degradation can take place in the nucleus, suggesting the need for a more complex view of the subcellular compartmentation of PTGS in plants. PMID:21173264

  13. Silence of the Genes

    Indian Academy of Sciences (India)

    Srimath

    tary to the endogenous sense mRNA produced by the normal gene. The antisense strand binds to the sense strand and blocks protein synthesis. This method of gene inhibition was termed antisense technology. The antisense technology soon became a. RNA interference. (RNAi) is a novel mechanism for controlling gene.

  14. Remnant cationic dendrimers block RNA migration in electrophoresis after monophasic lysis.

    Science.gov (United States)

    Kuo, Jung-Hua Steven; Lin, Yi-Lin

    2007-05-01

    Cationic dendrimers such as poly(amidoamine) (PAMAM) and poly(propyleneimine) (PPI) have attractive characteristics for the delivery of nucleic acid and various biomedical applications. Most studies have focused on cationic dendrimer-based intracellular delivery, and very few studies have focused on the non-specific interaction of remnant cationic dendrimers with total RNA after isolation directly from cells in vitro. We examined RNA isolation using the common method of monophasic lysis from human macrophage-like cells (U937) and mouse fibroblast cells (NIH/3T3) that had been exposed to dendrimers and DNA/dendrimer complexes using gel electrophoresis. We found that PAMAM and PPI dendrimers strongly altered the mobility of RNA in the gels. In addition, the extent of dendrimer-induced alteration in RNA mobility was directly dendrimer-generation-dependent: the alteration was greater with higher-generation dendrimers. We also found that DNA/dendrimer complexes at higher dendrimer to DNA ratios interacted with RNA after isolation while gene expression was maintained. The interactions between RNA and remnant dendrimers after isolation were caused by electrostatic bindings, and we recovered total RNA using high ionic strength solvents (2M NaCl solution) to disrupt the electrostatic forces binding dendrimers to RNA. Because RNA isolation is routinely used for biological applications, such dendrimer-induced alteration in RNA mobility should be accounted for in the further processing of RNA-related applications.

  15. Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: Enhanced gene silencing and reduced adversed effects in vitro

    DEFF Research Database (Denmark)

    Zeng, Xianghui; de Groot, A. M.; Sijts, Alice

    2015-01-01

    giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did...... not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA–peptidomimetic nanocomplex core...

  16. Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach.

    Science.gov (United States)

    Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah; Tejlmann, Sarah; Falkenberg, Emily; Van Driessche, Elize; Mørck Nielsen, Hanne; Franzyk, Henrik; Foged, Camilla

    2017-11-01

    Safety and efficacy of therapeutics based on RNA interference, e.g., small interfering RNA (siRNA), are dependent on the optimal engineering of the delivery technology, which is used for intracellular delivery of siRNA to the cytosol of target cells. We investigated the hypothesis that commonly used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties (hydrodynamic size, zeta potential, siRNA encapsulation/loading) and the biological performance (in vitro gene silencing and cell viability). Model fitting of the obtained data to construct predictive models revealed non-linear relationships for all CQAs, which can be readily overlooked in one-factor-at-a-time optimization approaches. The response surface methodology further enabled the identification of an OOS that met the desired quality target product profile. The optimized lipidoid-modified LPNs revealed more than 50-fold higher in vitro gene silencing at well-tolerated doses and approx. a twofold increase in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly

  17. Understanding the sequence preference of recurrent RNA building blocks using quantum chemistry: The intrastrand RNA dinucleotide platform

    Czech Academy of Sciences Publication Activity Database

    Mládek, Arnošt; Šponer, Judit E.; Kulhánek, P.; Lu, X.-J.; Olson, W.K.; Šponer, Jiří

    2012-01-01

    Roč. 8, č. 1 (2012), s. 335-347 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GAP208/10/2302; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA ČR(CZ) GD203/09/H046 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : RNA dinucleotide platform * quantum-chemical calculation Subject RIV: BO - Biophysics Impact factor: 5.389, year: 2012

  18. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...... to mammalian cells, the technology of RNAi expanded from being a valuable experimental tool to being an applicable method for gene-specific therapeutic regulation, and much effort has been put into further refinement of the technique. This review will focus on how RNAi has developed over the years and how...

  19. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

    Science.gov (United States)

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

    2015-05-26

    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. New Kids on the Block: RNA-Based Influenza Virus Vaccines.

    Science.gov (United States)

    Scorza, Francesco Berlanda; Pardi, Norbert

    2018-04-01

    RNA-based immunization strategies have emerged as promising alternatives to conventional vaccine approaches. A substantial body of published work demonstrates that RNA vaccines can elicit potent, protective immune responses against various pathogens. Consonant with its huge impact on public health, influenza virus is one of the best studied targets of RNA vaccine research. Currently licensed influenza vaccines show variable levels of protection against seasonal influenza virus strains but are inadequate against drifted and pandemic viruses. In recent years, several types of RNA vaccines demonstrated efficacy against influenza virus infections in preclinical models. Additionally, comparative studies demonstrated the superiority of some RNA vaccines over the currently used inactivated influenza virus vaccines in animal models. Based on these promising preclinical results, clinical trials have been initiated and should provide valuable information about the translatability of the impressive preclinical data to humans. This review briefly describes RNA-based vaccination strategies, summarizes published preclinical and clinical data, highlights the roadblocks that need to be overcome for clinical applications, discusses the landscape of industrial development, and shares the authors' personal perspectives about the future of RNA-based influenza virus vaccines.

  1. Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach

    DEFF Research Database (Denmark)

    Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah

    2017-01-01

    used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex......), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties...... in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly promising prospects for efficient and safe intracellular delivery of siRNA....

  2. Specific degradation of 3[prime prime or minute] regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5[prime prime or minute]-3[prime prime or minute] spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, T.H.; Moury, B.; Johannessen, M.M.

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  3. An RNA-binding compound that stabilizes the HIV-1 gRNA packaging signal structure and specifically blocks HIV-1 RNA encapsidation.

    Science.gov (United States)

    Ingemarsdotter, Carin K; Zeng, Jingwei; Long, Ziqi; Lever, Andrew M L; Kenyon, Julia C

    2018-03-14

    NSC260594, a quinolinium derivative from the NCI diversity set II compound library, was previously identified in a target-based assay as an inhibitor of the interaction between the HIV-1 (ψ) stem-loop 3 (SL3) RNA and Gag. This compound was shown to exhibit potent antiviral activity. Here, the effects of this compound on individual stages of the viral lifecycle were examined by qRT-PCR, ELISA and Western blot, to see if its actions were specific to the viral packaging stage. The structural effects of NSC260594 binding to the HIV-1 gRNA were also examined by SHAPE and dimerization assays. Treatment of cells with NSC260594 did not reduce the number of integration events of incoming virus, and treatment of virus producing cells did not affect the level of intracellular Gag protein or viral particle release as determined by immunoblot. However, NSC260594 reduced the incorporation of gRNA into virions by up to 82%, without affecting levels of gRNA inside the cell. This reduction in packaging correlated closely with the reduction in infectivity of the released viral particles. To establish the structural effects of NSC260594 on the HIV-1 gRNA, we performed SHAPE analyses to pinpoint RNA structural changes. NSC260594 had a stabilizing effect on the wild type RNA that was not confined to SL3, but that was propagated across the structure. A packaging mutant lacking SL3 did not show this effect. NSC260594 acts as a specific inhibitor of HIV-1 RNA packaging. No other viral functions are affected. Its action involves preventing the interaction of Gag with SL3 by stabilizing this small RNA stem-loop which then leads to stabilization of the global packaging signal region (psi or ψ). This confirms data, previously only shown in analyses of isolated SL3 oligonucleotides, that SL3 is structurally labile in the presence of Gag and that this is critical for the complete psi region to be able to adopt different conformations. Since replication is otherwise unaffected by NSC260594

  4. Datasets for the validation of the "in vivo" siRNA-silencing of CD40 and for the detection of new markers of atherosclerosis progression in ApoE-deficient mice

    Directory of Open Access Journals (Sweden)

    Miguel Hueso

    2016-12-01

    Full Text Available Data presented in this Data in Brief article correspond to the article "in vivo" silencing of CD40 reduces progression of experimental atherogenesis through a NFκB/miR-125b axis and reveals new potential mediators in the pathogenesis of atherosclerosis" (M. Hueso, L. De Ramon, E. Navarro, E. Ripoll, J.M. Cruzado, J.M. Grinyo, J. Torras, 2016 [1]. Here, we describe the validation of the silencing of CD40 expression with a specific siRNA in ApoE−/− mouse aortas, and its systemic effects on splenic lymphocytic subpopulations as well as on the infiltration of aortic intima by F4/80+, galectin-3+ macrophages or by NF-κB+ cells. We also show the output of a Gene Ontology and TLDA analysis which allowed the detection of potential mediators of atherosclerosis progression. We provide the scientific community with a set of genes whose expression is increased during atherosclerosis progression but downregulated upon CD40 silencing.

  5. s8ORF2 protein of infectious salmon anaemia virus is a RNA-silencing suppressor and interacts with Salmon salar Mov10 (SsMov10) of the host RNAi machinery.

    Science.gov (United States)

    Thukral, Vandana; Varshney, Bhavna; Ramly, Rimatulhana B; Ponia, Sanket S; Mishra, Sumona Karjee; Olsen, Christel M; Banerjea, Akhil C; Mukherjee, Sunil K; Zaidi, Rana; Rimstad, Espen; Lal, Sunil K

    2018-04-01

    The infectious salmon anaemia virus (ISAV) is a piscine virus, a member of Orthomyxoviridae family. It encodes at least 10 proteins from eight negative-strand RNA segments. Since ISAV belongs to the same virus family as Influenza A virus, with similarities in protein functions, they may hence be characterised by analogy. Like NS1 protein of Influenza A virus, s8ORF2 of ISAV is implicated in interferon antagonism and RNA-binding functions. In this study, we investigated the role of s8ORF2 in RNAi suppression in a well-established Agrobacterium transient suppression assay in stably silenced transgenic Nicotiana xanthi. In addition, s8ORF2 was identified as a novel interactor with SsMov10, a key molecule responsible for RISC assembly and maturation in the RNAi pathway. This study thus sheds light on a novel route undertaken by viral proteins in promoting viral growth, using the host RNAi machinery.

  6. Structure of human telomeric RNA (TERRA): stacking of two G-quadruplex blocks in K(+) solution.

    Science.gov (United States)

    Martadinata, Herry; Phan, Anh Tuân

    2013-04-02

    Telomeric repeat-containing RNAs (TERRA) are transcription products of the telomeres. Human TERRA sequences containing UUAGGG repeats can form parallel-stranded G-quadruplexes. The stacking interaction of such structures was shown to be important for ligand targeting and higher-order arrangement of G-quadruplexes in long TERRA sequences. Here we report on the first high-resolution structure of a stacked G-quadruplex formed by the 10-nucleotide human TERRA sequence r(GGGUUAGGGU) in potassium solution. This structure comprises two dimeric three-layer parallel-stranded G-quadruplex blocks, which stack on each other at their 5'-ends. The adenine in each UUA loop is nearly coplanar with the 5'-end G-tetrad forming an A·(G·G·G·G)·A hexad, thereby increasing the stacking contacts between the two blocks. Interestingly, this stacking and loop conformation is different from all structures previously reported for the free human TERRA but resembles the structure previously determined for a complex between a human TERRA sequence and an acridine ligand. This stacking conformation is a potential target for drugs that recognize or induce the stacking interface.

  7. LncRNA SNHG6 is Associated with Poor Prognosis of Gastric Cancer and Promotes Cell Proliferation and EMT through Epigenetically Silencing p27 and Sponging miR-101-3p

    Directory of Open Access Journals (Sweden)

    Kai Yan

    2017-06-01

    Full Text Available Background/Amis: Long non-coding RNAs (lncRNAs, a novel class of transcripts, have been shown to play critical roles in diverse cellular biological processes, including tumorigenesis. Small nucleolar RNA host gene 6 (SNHG6 regulates various biological processes in cancer cells. However, the biological role of SNHG6 in gastric cancer still remains to be explored. The aim of this study is to investigate the characteristic of the SNHG6 in gastric cancer. Methods: Quantitative real-time polymerase chain reaction (qRT-PCR was used to measure the expression of SNHG6 in gastric cancer tissues and cell lines. MTT assays, colony formation assays were used to determine the impact of SNHG6 on tumorigenesis . Flow cytometric analysis of cell cycle and apoptosis was performed to measure the effect of SNHG6 on cell cycle and apoptosis rate. Transwell assay was performed to measure the effect of SNHG6 on cell migration. Western blotting and immunofuorescence were utilized to examine the effect of SNHG6 on epithelial-mesenchymal transition (EMT of GC cells. Chromatin immunoprecipitation (ChIP, RNA immunoprecipitation (RIP, RNA-pulldown and luciferase reporter assays were employed to dissect molecular mechanisms. Results: In this study, we revealed that SNHG6 was overexpressed in gastric cancer tissues and cell lines. High expression levels of SNHG6 wereassociated with invasion depth, lymph node metastasis, distant metastasis and tumor/node/metastasis (TNM stage, and predicted poor prognosis. Loss-of-function assays revealed that silenced SNHG6 obviously inhibited gastric cancer cell growth, weakened cell migration capacity and suppressed the EMT processes of gastric cancer cells. Additionally, ChIP, RIP, RNA-pulldown and luciferase reporter assays evidenced that SNHG6 could epigenetically silenced p27 and could competitively sponging miR-101-3p thereby regulating zinc finger E-box-binding homeobox 1 (ZEB1. Conclusion: In summary, our findings demonstrated that

  8. An Epstein-Barr Virus MicroRNA Blocks Interleukin-1 (IL-1) Signaling by Targeting IL-1 Receptor 1.

    Science.gov (United States)

    Skinner, Camille M; Ivanov, Nikita S; Barr, Sarah A; Chen, Yan; Skalsky, Rebecca L

    2017-11-01

    Epstein-Barr virus (EBV) encodes >44 viral microRNAs (miRNAs) that are differentially expressed throughout infection, can be detected in Epstein-Barr virus (EBV)-positive tumors, and manipulate several biological processes, including cell proliferation, apoptosis, and immune responses. Here, we show that EBV BHRF1-2 miRNAs block NF-κB activation following treatment with proinflammatory cytokines, specifically interleukin-1β (IL-1β). Analysis of EBV PAR-CLIP miRNA targetome data sets combined with pathway analysis revealed multiple BHRF1-2 miRNA targets involved in interleukin signaling pathways. By further analyzing changes in cellular gene expression patterns, we identified the IL-1 receptor 1 (IL1R1) as a direct target of miR-BHRF1-2-5p. Targeting the IL1R1 3' untranslated region (UTR) by EBV miR-BHRF1-2-5p was confirmed using 3'-UTR luciferase reporter assays and Western blot assays. Manipulation of EBV BHRF1-2 miRNA activity in latently infected B cells altered steady-state cytokine levels and disrupted IL-1β responsiveness. These studies demonstrate functionally relevant BHRF1-2 miRNA interactions during EBV infection, which is an important step in understanding their roles in pathogenesis. IMPORTANCE IL-1 signaling plays an important role in inflammation and early activation of host innate immune responses following virus infection. Here, we demonstrate that a viral miRNA downregulates the IL-1 receptor 1 during EBV infection, which consequently alters the responsiveness of cells to IL-1 stimuli and changes the cytokine expression levels within infected cell populations. We postulate that this viral miRNA activity not only disrupts IL-1 autocrine and paracrine signaling loops that can alert effector cells to sites of infection but also provides a survival advantage by dampening excessive inflammation that may be detrimental to the infected cell. Copyright © 2017 American Society for Microbiology.

  9. Bioinformatics tools for achieving better gene silencing in plants.

    Science.gov (United States)

    Ahmed, Firoz; Dai, Xinbin; Zhao, Patrick Xuechun

    2015-01-01

    RNA interference (RNAi) is one of the most popular and effective molecular technologies for knocking down the expression of an individual gene of interest in living organisms. Yet the technology still faces the major issue of nonspecific gene silencing, which can compromise gene functional characterization and the interpretation of phenotypes associated with individual gene knockdown. Designing an effective and target-specific small interfering RNA (siRNA) for induction of RNAi is therefore the major challenge in RNAi-based gene silencing. A 'good' siRNA molecule must possess three key features: (a) the ability to specifically silence an individual gene of interest, (b) little or no effect on the expressions of unintended siRNA gene targets (off-target genes), and (c) no cell toxicity. Although several siRNA design and analysis algorithms have been developed, only a few of them are specifically focused on gene silencing in plants. Furthermore, current algorithms lack a comprehensive consideration of siRNA specificity, efficacy, and nontoxicity in siRNA design, mainly due to lack of integration of all known rules that govern different steps in the RNAi pathway. In this review, we first describe popular RNAi methods that have been used for gene silencing in plants and their serious limitations regarding gene-silencing potency and specificity. We then present novel, rationale-based strategies in combination with computational and experimental approaches to induce potent, specific, and nontoxic gene silencing in plants.

  10. Silencing expression of the catalytic subunit of DNA-dependent protein kinase by small interfering RNA sensitizes human cells for radiation-induced chromosome damage, cell killing, and mutation

    Science.gov (United States)

    Peng, Yuanlin; Zhang, Qinming; Nagasawa, Hatsumi; Okayasu, Ryuichi; Liber, Howard L.; Bedford, Joel S.

    2002-01-01

    Targeted gene silencing in mammalian cells by RNA interference (RNAi) using small interfering RNAs (siRNAs) was recently described by Elbashir et al. (S. M. Elbashir et al., Nature (Lond.), 411: 494-498, 2001). We have used this methodology in several human cell strains to reduce expression of the Prkdc (DNA-PKcs) gene coding for the catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs) that is involved in the nonhomologous end joining of DNA double-strand breaks. We have also demonstrated a radiosensitization for several phenotypic endpoints of radiation damage. In low-passage normal human fibroblasts, siRNA knock-down of DNA-PKcs resulted in a reduced capacity for restitution of radiation-induced interphase chromosome breaks as measured by premature chromosome condensation, an increased yield of acentric chromosome fragments at the first postirradiation mitosis, and an increased radiosensitivity for cell killing. For three strains of related human lymphoblasts, DNA-PKcs-targeted siRNA transfection resulted in little or no increase in radiosensitivity with respect to cell killing, a 1.5-fold decrease in induced mutant yield in TK6- and p53-null NH32 cells, but about a 2-fold increase in induced mutant yield in p53-mutant WTK1 cells at both the hypoxanthine quanine phosphoribosyl transferase (hprt) and the thymidine kinase loci.

  11. Silencing of a large microRNA cluster on human chromosome 14q32 in melanoma: biological effects of mir-376a and mir-376c on insulin growth factor 1 receptor

    Directory of Open Access Journals (Sweden)

    Zehavi Liron

    2012-07-01

    Full Text Available Abstract Background Metastatic melanoma is a devastating disease with limited therapeutic options. MicroRNAs (miRNAs are small non coding RNA molecules with important roles in post-transcriptional gene expression regulation, whose aberrant expression has been implicated in cancer. Results We show that the expression of miRNAs from a large cluster on human chromosome 14q32 is significantly down-regulated in melanoma cell lines, benign nevi and melanoma samples relative to normal melanocytes. This miRNA cluster resides within a parentally imprinted chromosomal region known to be important in development and differentiation. In some melanoma cell lines, a chromosomal deletion or loss-of-heterozygosity was observed in the cis-acting regulatory region of this cluster. In several cell lines we were able to re-express two maternally-induced genes and several miRNAs from the cluster with a combination of de-methylating agents and histone de-acetylase inhibitors, suggesting that epigenetic modifications take part in their silencing. Stable over-expression of mir-376a and mir-376c, two miRNAs from this cluster that could be re-expressed following epigenetic manipulation, led to modest growth retardation and to a significant decrease in migration in-vitro. Bioinformatic analysis predicted that both miRNAs could potentially target the 3'UTR of IGF1R. Indeed, stable expression of mir-376a and mir-376c in melanoma cells led to a decrease in IGF1R mRNA and protein, and a luciferase reporter assay indicated that the 3'UTR of IGF1R is a target of both mir-376a and mir-376c. Conclusions Our work is the first to show that the large miRNA cluster on chromosome 14q32 is silenced in melanoma. Our results suggest that down-regulation of mir-376a and mir-376c may contribute to IGF1R over-expression and to aberrant negative regulation of this signaling pathway in melanoma, thus promoting tumorigenesis and metastasis.

  12. Effects of RNA interference-mediated gene silencing of JMJD2A on human breast cancer cell line MDA-MB-231 in vitro

    Directory of Open Access Journals (Sweden)

    Shen Yi-Wen

    2011-10-01

    Full Text Available Abstract Previous data demonstrate that JMJD2A is a cancer-associated gene and may be involved in human breast cancer by demethylation of H3K9me3. The aim of this study was to investigate depressive effects on JMJD2A by transfection with JMJD2A-sepcific siRNA in human breast cancer cell line MDA-MB-231 and effects on cell proliferation, invasion and migration. JMJD2A-specific siRNA was chemically synthesised and transfected into human breast cancer cell line MDA-MB-231. Expression levels of JMJD2A were detected by quantitative real-time PCR and Western blot analysis. Cells proliferation was evaluated by using flow cytometric anlysis and MTT assay. The abilities of invasion and migration were evaluated by cell migration and invasion assay with Boyden chambers. The results showed that the transfection was successful and expression levels of JMJD2A mRNA and protein in siRNA group were both down-regulated. By MTT assay, the mean actual absorbance in siRNA group was significantly lower than that in blank control group (P

  13. Silver nanoparticles-quercetin conjugation to siRNA against drug-resistant Bacillus subtilis for effective gene silencing: in vitro and in vivo.

    Science.gov (United States)

    Sun, Dongdong; Zhang, Weiwei; Li, Nuan; Zhao, Zhiwei; Mou, Zhipeng; Yang, Endong; Wang, Weiyun

    2016-06-01

    Quercetin (Qe) exhibited extremely low water solubility, and thus, it was modified using silver nanoparticles (AgNPs). We fabricated AgNPs combined with Qe (AgNPs-Qe). The modification suggested that the synergistic properties of Qe enhanced the antibacterial activity of AgNPs. However, AgNPs-Qe exerted no effect on many kinds of drug-resistant bacteria, including Pseudomonas aeruginosa and Bacillus subtilis. RNA interference has considerable therapeutic potential because of its high specificity and potential capability to evade drug resistance. Therefore, we stabilized AgNPs-Qe with a layer of molecules (siRNA). The newly fabricated nanoparticles exerted improved effect on many kinds of bacteria, including the most prominent drug-resistant species B. subtilis. Agarose gel electrophoresis showed that the highest critical nitrogen-to-phosphorus (N/P) ratio occurred at a vector/siRNA with a w/w ratio of 7:1. Characterization experiment indicated that the diameter of siRNA/AgNPs-Qe was approximately 40 nm (40 ± 10 nm). Moreover, AgNPs-Qe were stabilized with a layer of siRNA that was approximately 10nm thick. Results of the in vitro study suggested that siRNA/AgNPs-Qe could destroy the cell wall and inhibit bacterial propagation. Meanwhile, the in vivo experiment on the animal bacteremia model, as well as the optical imaging of nude mice and their isolated organs, demonstrated that bacteria accumulated in the blood, heart, liver, spleen, lungs, and kidneys after the intravenous injection of B. subtilis. The bacteria in the blood and organs, as well as the inflamed cells in the tissues, gradually decreased after the mice received intravenous tail injection of siRNA/AgNPs-Qe for treatment. Both the in vitro and the in vivo studies exhibit that siRNA/AgNPs-Qe can be a potential nanoscale drug delivery system for B. subtilis targeting bacterimia. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. A Cardiac-enriched MicroRNA, miR-378, Blocks Cardiac Hypertrophy by Targeting Ras Signaling*

    Science.gov (United States)

    Nagalingam, Raghu S.; Sundaresan, Nagalingam R.; Gupta, Mahesh P.; Geenen, David L.; Solaro, R. John; Gupta, Madhu

    2013-01-01

    Understanding the regulation of cardiomyocyte growth is crucial for the management of adverse ventricular remodeling and heart failure. MicroRNA-378 (miR-378) is a newly described member of the cardiac-enriched miRNAs, which is expressed only in cardiac myocytes and not in cardiac fibroblasts. We have previously shown that miR-378 regulates cardiac growth during the postnatal period by direct targeting of IGF1R (Knezevic, I., Patel, A., Sundaresan, N. R., Gupta, M. P., Solaro, R. J., Nagalingam, R. S., and Gupta, M. (2012) J. Biol. Chem. 287, 12913–12926). Here, we report that miR-378 is an endogenous negative regulator of cardiac hypertrophy, and its levels are down-regulated during hypertrophic growth of the heart and during heart failure. In primary cultures of cardiomyocytes, overexpression of miR-378 blocked phenylephrine (PE)-stimulated Ras activity and also prevented activation of two major growth-promoting signaling pathways, PI3K-AKT and Raf1-MEK1-ERK1/2, acting downstream of Ras signaling. Overexpression of miR-378 suppressed PE-induced phosphorylation of S6 ribosomal kinase, pERK1/2, pAKT, pGSK-3β, and nuclear accumulation of NFAT. There was also suppression of the fetal gene program that was induced by PE. Experiments carried out to delineate the mechanism behind the suppression of Ras, led us to identify Grb2, an upstream component of Ras signaling, as a bona fide direct target of miR-378-mediated regulation. Deficiency of miR-378 alone was sufficient to induce fetal gene expression, which was prevented by knocking down Grb2 expression and blocking Ras activation, thus suggesting that miR-378 interferes with Ras activation by targeting Grb2. Our study demonstrates that miR-378 is an endogenous negative regulator of Ras signaling and cardiac hypertrophy and its deficiency contributes to the development of cardiac hypertrophy. PMID:23447532

  15. Influence of Bxpel1 Gene Silencing by dsRNA Interference on the Development and Pathogenicity of the Pine Wood Nematode, Bursaphelenchus xylophilus

    Science.gov (United States)

    Qiu, Xiu-Wen; Wu, Xiao-Qin; Huang, Lin; Ye, Jian-Ren

    2016-01-01

    As the causal agent of pine wilt disease (PWD), the pine wood nematode (PWN), Bursaphelenchus xylophilus, causes huge economic losses by devastating pine forests worldwide. The pectate lyase gene is essential for successful invasion of their host plants by plant-parasitic nematodes. To demonstrate the role of pectate lyase gene in the PWD process, RNA interference (RNAi) is used to analyze the function of the pectate lyase 1 gene in B. xylophilus (Bxpel1). The efficiency of RNAi was detected by real-time PCR. The result demonstrated that the quantity of B. xylophilus propagated with control solution treatment was 62 times greater than that soaking in double-stranded RNA (dsRNA) after B. xylophilus inoculation in Botrytis cinerea for the first generation (F1). The number of B. xylophilus soaking in control solution was doubled compared to that soaking in Bxpel1 dsRNA four days after inoculation in Pinus thunbergii. The quantity of B. xylophilus was reduced significantly (p < 0.001) after treatment with dsRNAi compared with that using a control solution treatment. Bxpel1 dsRNAi reduced the migration speed and reproduction of B. xylophilus in pine trees. The pathogenicity to P. thunbergii seedling of B. xylophilus was weaker after soaking in dsRNA solution compared with that after soaking in the control solution. Our results suggest that Bxpel1 gene is a significant pathogenic factor in the PWD process and this basic information may facilitate a better understanding of the molecular mechanism of PWD. PMID:26797602

  16. Epigenetic Silencing of miRNA-34a in Human Cholangiocarcinoma via EZH2 and DNA Methylation: Impact on Regulation of Notch Pathway.

    Science.gov (United States)

    Kwon, Hyunjoo; Song, Kyoungsub; Han, Chang; Zhang, Jinqiang; Lu, Lu; Chen, Weina; Wu, Tong

    2017-10-01

    Aberrant expression and regulation of miRNAs have been implicated in multiple stages of tumorigenic processes. The current study was designed to explore the biological function and epigenetic regulation of miR-34a in human cholangiocarcinoma (CCA). Our data show that the expression of miR-34a is decreased significantly in CCA cells compared with non-neoplastic biliary epithelial cells. Forced overexpression of miR-34a in CCA cells inhibited their proliferation and clonogenic capacity in vitro, and suppressed tumor xenograft growth in severe combined immunodeficiency mice. We identified three key components of the Notch pathway, Notch1, Notch2, and Jagged 1, as direct targets of miR-34a. Our further studies show that down-regulation of miR-34a is caused by Enhancer of zeste homolog 2 (EZH2)-mediated H3 lysine 27 trimethylation as well as DNA methylation. Accordingly, treatment with the EZH2 inhibitor, selective S-adenosyl-methionine-competitive small-molecule (GSK126), or the DNA methylation inhibitor, 5-Aza-2'-deoxycytidine, partially restored miR-34a levels in human CCA cells. Immunohistochemical staining and Western blot analyses showed increased EZH2 expression in human CCA tissues and cell lines. We observed that GSK126 significantly reduced CCA cell growth in vitro and intrahepatic metastasis in vivo. Our findings provide novel evidence that miR-34a expression is silenced epigenetically by EZH2 and DNA methylation, which promotes CCA cell growth through activation of the Notch pathway. Consequently, these signaling cascades may represent potential therapeutic targets for effective treatment of human CCA. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  17. Methylation-associated Silencing of microRNA-126 and its Host Gene EGFL7 in Malignant Pleural Mesothelioma

    DEFF Research Database (Denmark)

    Andersen, Morten; Trapani, Davide; Ravn, Jesper

    2015-01-01

    BACKGROUND/AIM: We recently reported that miR-126 is down-regulated in malignant pleural mesothelioma (MPM) and can be combined into a 4-microRNA-classifier that can accurately diagnose MPM with high sensitivity and specificity. Herein we analyzed the epigenetic regulation of miR-126 and its host...... proliferation (PTHX) were analyzed. miR-126 and EGFL7 mRNA were quantified by RT-qPCR. CpG-islands' methylation in the EGFL7 promoter was analyzed using methylation-specific PCR and in the MIR126-containing intron 7 was quantified by pyrosequencing. RESULTS: Relative to NNP, EGFL7 was under-expressed more than...... 4-fold in MPM (pmiR-126 levels correlated in MPM (p

  18. Silencing of the hTERT gene by shRNA inhibits colon cancer SW480 cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Ai-Qun Liu

    Full Text Available Human telomerase reverse transcriptase (hTERT is the key enzyme responsible for synthesizing and maintaining the telomeres on the ends of chromosomes, and it is essential for cell proliferation. This has made hTERT a focus of oncology research and an attractive target for anticancer drug development. In this study, we designed a small interfering RNA (siRNA targeting the catalytic subunit of hTERT and tested its effects on the growth of telomerase-positive human colon carcinoma SW480 cells in vitro, as well as on the tumorigenicity of these cells in nude mice. Transient and stable transfection of hTERT siRNA into colon cancer SW480 cells suppressed hTERT expression, reduced telomerase activity and inhibited cell growth and proliferation. Knocking down hTERT expression in SW480 tumors xenografted into nude mice significantly slowed tumor growth and promoted tumor cell apoptosis. Our results suggest that hTERT is involved in carcinogenesis of human colon carcinoma, and they highlight the therapeutic potential of a hTERT knock-down approach.

  19. Small RNAs derived from lncRNA RNase MRP have gene-silencing activity relevant to human cartilage–hair hypoplasia

    Science.gov (United States)

    Rogler, Leslie E.; Kosmyna, Brian; Moskowitz, David; Bebawee, Remon; Rahimzadeh, Joseph; Kutchko, Katrina; Laederach, Alain; Notarangelo, Luigi D.; Giliani, Silvia; Bouhassira, Eric; Frenette, Paul; Roy-Chowdhury, Jayanta; Rogler, Charles E.

    2014-01-01

    Post-transcriptional processing of some long non-coding RNAs (lncRNAs) reveals that they are a source of miRNAs. We show that the 268-nt non-coding RNA component of mitochondrial RNA processing endoribonuclease, (RNase MRP), is the source of at least two short (∼20 nt) RNAs designated RMRP-S1 and RMRP-S2, which function as miRNAs. Point mutations in RNase MRP cause human cartilage–hair hypoplasia (CHH), and several disease-causing mutations map to RMRP-S1 and -S2. SHAPE chemical probing identified two alternative secondary structures altered by disease mutations. RMRP-S1 and -S2 are significantly reduced in two fibroblast cell lines and a B-cell line derived from CHH patients. Tests of gene regulatory activity of RMRP-S1 and -S2 identified over 900 genes that were significantly regulated, of which over 75% were down-regulated, and 90% contained target sites with seed complements of RMRP-S1 and -S2 predominantly in their 3′ UTRs. Pathway analysis identified regulated genes that function in skeletal development, hair development and hematopoietic cell differentiation including PTCH2 and SOX4 among others, linked to major CHH phenotypes. Also, genes associated with alternative RNA splicing, cell proliferation and differentiation were highly targeted. Therefore, alterations RMRP-S1 and -S2, caused by point mutations in RMRP, are strongly implicated in the molecular mechanism of CHH. PMID:24009312

  20. siRNA-mediated Allele-specific Silencing of a COL6A3 Mutation in a Cellular Model of Dominant Ullrich Muscular Dystrophy

    Directory of Open Access Journals (Sweden)

    Véronique Bolduc

    2014-01-01

    Full Text Available Congenital muscular dystrophy type Ullrich (UCMD is a severe disorder of early childhood onset for which currently there is no effective treatment. UCMD commonly is caused by dominant-negative mutations in the genes coding for collagen type VI, a major microfibrillar component of the extracellular matrix surrounding the muscle fibers. To explore RNA interference (RNAi as a potential therapy for UCMD, we designed a series of small interfering RNA (siRNA oligos that specifically target the most common mutations resulting in skipping of exon 16 in the COL6A3 gene and tested them in UCMD-derived dermal fibroblasts. Transcript analysis by semiquantitative and quantitative reverse transcriptase PCR showed that two of these siRNAs were the most allele-specific, i.e., they efficiently knocked down the expression from the mutant allele, without affecting the normal allele. In HEK293T cells, these siRNAs selectively suppressed protein expression from a reporter construct carrying the mutation, with no or minimal suppression of the wild-type (WT construct, suggesting that collagen VI protein levels are as also reduced in an allele-specific manner. Furthermore, we found that treating UCMD fibroblasts with these siRNAs considerably improved the quantity and quality of the collagen VI matrix, as assessed by confocal microscopy. Our current study establishes RNAi as a promising molecular approach for treating dominant COL6-related dystrophies.

  1. In vivo post-transcriptional gene silencing of alpha-1 antitrypsin by adeno-associated virus vectors expressing siRNA.

    Science.gov (United States)

    Cruz, Pedro E; Mueller, Christian; Cossette, Travis L; Golant, Alexandra; Tang, Qiushi; Beattie, Stuart G; Brantly, Mark; Campbell-Thompson, Martha; Blomenkamp, Keith S; Teckman, Jeffrey H; Flotte, Terence R

    2007-09-01

    alpha-1 Antitrypsin (AAT) deficiency is one of the most common genetic diseases in North America, with a carrier frequency of approximately 4% in the US population. Homozygosity for the most common mutation (Glu342Lys, PI(*)Z) leads to the synthesis of a mutant protein, which accumulates and polymerizes within hepatocytes rather than being efficiently secreted. This lack of secretion causes severe serum deficiency predisposing to chronic lung disease. Twelve to fifteen percent of patients with PI(*)ZZ also develop liver disease, which can be severe, even in infancy. This is thought to be due to toxic effects of the accumulated mutant Z-AAT within the hepatocyte. Thus, an approach to reduce AAT-deficient liver disease will likely require some mechanism to decrease the amount of Z-AAT within hepatocytes. In this report, we describe studies of small-interfering RNAs (siRNAs) designed to downregulate endogenous AAT within hepatocytes. Three different siRNA sequences were identified and cloned into a recombinant adeno-associated virus (rAAV) backbone, either singly or as a trifunctional (3X) construct. Each had activity independently, but the levels of AAT expression in cell culture models showed the greatest decrease with the 3X construct, resulting in levels that were five-fold lower than controls. The rAAV-3X-siRNA was then packaged into AAV8 capsids and used in vivo to transduce the livers of human Z-AAT overexpressing transgenic mice. Those studies showed a decrease in total human AAT, a clearing of Z-AAT accumulation by immunohistochemistry, and a decrease in monomer Z-AAT within the liver within 3 weeks after vector injection. The rAAV8-3X-siRNA vector may hold promise as a potential therapy for patients with AAT liver disease.

  2. [Effects on survival of shRNA mediated APE/Ref1 gene silencing in rat spiral ganglion cells in oxidative stress].

    Science.gov (United States)

    Jiang, Zhendong; Zhong, Cheng; Li, Taijun; Xiang, Zhaolan; Zhang, Xueyuan

    2014-02-01

    To investigate the effects of reducing APE/Ref1 expression in the cultures of rat spiral ganglion cells with oxidative damage induced by H(2)O(2). Primary cultured rat spiral ganglion cells were infected with small interfering RNA to APE/Ref1 (Ape1siRNA) for 72 h, followed by treating with H(2)O(2) (0, 10, 25, 50, 100 and 300 µmol/L) for 1 h , and then cultured in normal medium for 24 h. Western blot were used to detect the level of APE/Ref1 protein and phosphorylation of histone protein H2AX in the infected cells. The caspase3 activation was tested by spectrophotometric method . The cell viability was determined by MTT and the apoptosis of spiral ganglion cells was determined by terminal-deoxynucleotidyl transferase mediated nick and labeling (TUNEL). Western blot showed that infection with Ape1siRNA resulted in APE/Ref1 reduced expression in the spiral ganglion cells. Exposing spiral ganglion cultures with reduced expression of APE/Ref1 to H(2)O(2) (50, 100, 300 µmol/L) for 1 h resulted in increasing in the phosphorylation of histone protein H2AX. The reduction in APE/Ref1 significantly reduced cell viability in cultures 24 h after 1 h expression to 50-300 µmol/L H(2)O(2). The apoptosis of cells and caspase 3 activity was detected significantly improved. The induced of APE/Ref1 results in significantly decrease in spiral ganglion cells viability in oxidative stress. The repairing function of APE/Ref1 is necessary for optimal levels of neuronal rat spiral ganglion cells survival.

  3. My Day of Silence.

    Science.gov (United States)

    Brown, Scott C.

    1999-01-01

    A heterosexual doctoral student discusses his experiences when he tries to take part in a day of silence to help combat homophobia and heterosexism. His vow of silence teaches him that he will never fully understand the experience of a person who has been historically, socially, and legally silent. (Author/MKA)

  4. Crystallization and preliminary X-ray diffraction analysis of the Cmr2–Cmr3 subcomplex in the CRISPR–Cas RNA-silencing effector complex

    International Nuclear Information System (INIS)

    Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki

    2013-01-01

    The Cmr2–Cmr3 subcomplex from P. furiosus was co-crystallized with 3′-AMP. X-ray diffraction data for the crystals were collected to 2.6 Å resolution using a synchrotron-radiation source. Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci, found in prokaryotes, are transcribed to produce CRISPR RNAs (crRNAs). The Cmr proteins (Cmr1–6) and crRNA form a ribonucleoprotein complex that degrades target RNAs derived from invading genetic elements. Cmr2dHD, a Cmr2 variant lacking the N-terminal putative HD nuclease domain, and Cmr3 were co-expressed in Escherichia coli cells and co-purified as a complex. The Cmr2dHD–Cmr3 complex was co-crystallized with 3′-AMP by the vapour-diffusion method. The crystals diffracted to 2.6 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the orthorhombic space group I222, with unit-cell parameters a = 103.9, b = 136.7, c = 192.0 Å. The asymmetric unit of the crystals is expected to contain one Cmr2dHD–Cmr3 complex with a Matthews coefficient of 3.0 Å 3 Da −1 and a solvent content of 59%

  5. Increased expression of long noncoding RNA TUG1 predicts a poor prognosis of gastric cancer and regulates cell proliferation by epigenetically silencing of p57.

    Science.gov (United States)

    Zhang, E; He, X; Yin, D; Han, L; Qiu, M; Xu, T; Xia, R; Xu, L; Yin, R; De, W

    2016-02-25

    Recent evidence highlights long noncoding RNAs (lncRNAs) as crucial regulators of cancer biology that contribute to tumorigenesis. LncRNA TUG1 was initially detected in a genomic screen for genes upregulated in response to taurine treatment in developing mouse retinal cells. Our previous study showed that TUG1 could affect cell proliferation through epigenetically regulating HOXB7 in human non-small cell lung cancer. However, the clinical significance and potential role of TUG1 in GC remains unclear. In this study, we found that TUG1 is significantly increased and is correlated with outcomes in gastric cancer (GC). Further experiments revealed that knockdown of TUG1 repressed GC proliferation both in vitro and in vivo. Mechanistic investigations showed that TUG1 has a key role in G0/G1 arrest. We further demonstrated that TUG1 was associated with PRC2 and that this association was required for epigenetic repression of cyclin-dependent protein kinase inhibitors, including p15, p16, p21, p27 and p57, thus contributing to the regulation of GC cell cycle and proliferation. Together, our results suggest that TUG1, as a regulator of proliferation, may serve as a candidate prognostic biomarker and target for new therapies in human GC.

  6. Effects of Nogo-A Silencing on TNF-α and IL-6 Secretion and TH Downregulation in Lipopolysaccharide-Stimulated PC12 Cells

    Directory of Open Access Journals (Sweden)

    Jianbin Zhong

    2015-01-01

    Full Text Available Parkinson’s disease (PD is a common degenerative disease that lacks efficient treatment. Myelin-associated neurite outgrowth inhibitor A (Nogo-A is relevant with inhibition of nerve regeneration and may play vital role in pathogenesis of PD. The study aimed to establish the shRNA expression plasmids of Nogo-A gene and explore the regulatory effects of Nogo-A silencing on the expression of inflammation factor tumor necrosis factor-alpha (TNF-alpha and interleukin-6 (IL-6 as well as tyrosine hydroxylase (TH in lipopolysaccharide- (LPS- stimulated rat PC12 cells. The results showed that both mRNA and protein levels of Nogo-A in pGenesil-nogoA-shRNA group were downregulated. The viabilities of PC12 cells decreased with increase of LPS concentrations. LPS significantly increased the supernatant TNF-alpha and IL-6 concentrations and reduced TH protein expression in PC12 cells, while silencing Nogo-A could block these effects. These results suggested that LPS can activate PC12 cells to secrete inflammatory cytokines and lower the TH expression, which can be regulated by Nogo-A gene silencing. Nogo-A silencing might provide new ideas for PD treatment in the future.

  7. Mutations in Ran system affected telomere silencing in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Murakami, Seishi; Nishimoto, Takeharu

    2007-01-01

    The Ran GTPase system regulates the direction and timing of several cellular events, such as nuclear-cytosolic transport, centrosome formation, and nuclear envelope assembly in telophase. To gain insight into the Ran system's involvement in chromatin formation, we investigated gene silencing at the telomere in several mutants of the budding yeast Saccharomyces cerevisiae, which had defects in genes involved in the Ran system. A mutation of the RanGAP gene, rna1-1, caused reduced silencing at the telomere, and partial disruption of the nuclear Ran binding factor, yrb2-Δ2, increased this silencing. The reduced telomere silencing in rna1-1 cells was suppressed by a high dosage of the SIR3 gene or the SIT4 gene. Furthermore, hyperphosphorylated Sir3 protein accumulated in the rna1-1 mutant. These results suggest that RanGAP is required for the heterochromatin structure at the telomere in budding yeast

  8. Rapid evolution and gene expression: a rapidly evolving Mendelian trait that silences field crickets has widespread effects on mRNA and protein expression.

    Science.gov (United States)

    Pascoal, S; Liu, X; Ly, T; Fang, Y; Rockliffe, N; Paterson, S; Shirran, S L; Botting, C H; Bailey, N W

    2016-06-01

    A major advance in modern evolutionary biology is the ability to start linking phenotypic evolution in the wild with genomic changes that underlie that evolution. We capitalized on a rapidly evolving Hawaiian population of crickets (Teleogryllus oceanicus) to test hypotheses about the genomic consequences of a recent Mendelian mutation of large effect which disrupts the development of sound-producing structures on male forewings. The resulting silent phenotype, flatwing, persists because of natural selection imposed by an acoustically orienting parasitoid, but it interferes with mate attraction. We examined gene expression differences in developing wing buds of wild-type and flatwing male crickets using RNA-seq and quantitative proteomics. Most differentially expressed (DE) transcripts were down-regulated in flatwing males (625 up vs. 1716 down), whereas up- and down-regulated proteins were equally represented (30 up and 34 down). Differences between morphs were clearly not restricted to a single pathway, and we recovered annotations associated with a broad array of functions that would not be predicted a priori. Using a candidate gene detection test based on homology, we identified 30% of putative Drosophila wing development genes in the cricket transcriptome, but only 10% were DE. In addition to wing-related annotations, endocrine pathways and several biological processes such as reproduction, immunity and locomotion were DE in the mutant crickets at both biological levels. Our results illuminate the breadth of genetic pathways that are potentially affected in the early stages of adaptation. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

  9. ss-siRNAs allele selectively inhibit ataxin-3 expression: multiple mechanisms for an alternative gene silencing strategy.

    Science.gov (United States)

    Liu, Jing; Yu, Dongbo; Aiba, Yuichiro; Pendergraff, Hannah; Swayze, Eric E; Lima, Walt F; Hu, Jiaxin; Prakash, Thazha P; Corey, David R

    2013-11-01

    Single-stranded silencing RNAs (ss-siRNAs) provide an alternative approach to gene silencing. ss-siRNAs combine the simplicity and favorable biodistribution of antisense oligonucleotides with robust silencing through RNA interference (RNAi). Previous studies reported potent and allele-selective inhibition of human huntingtin expression by ss-siRNAs that target the expanded CAG repeats within the mutant allele. Mutant ataxin-3, the genetic cause of Machado-Joseph Disease, also contains an expanded CAG repeat. We demonstrate here that ss-siRNAs are allele-selective inhibitors of ataxin-3 expression and then redesign ss-siRNAs to optimize their selectivity. We find that both RNAi-related and non-RNAi-related mechanisms affect gene expression by either blocking translation or affecting alternative splicing. These results have four broad implications: (i) ss-siRNAs will not always behave similarly to analogous RNA duplexes; (ii) the sequences surrounding CAG repeats affect allele-selectivity of anti-CAG oligonucleotides; (iii) ss-siRNAs can function through multiple mechanisms and; and (iv) it is possible to use chemical modification to optimize ss-siRNA properties and improve their potential for drug discovery.

  10. Ro60-associated single-stranded RNA links inflammation with fetal cardiac fibrosis via ligation of TLRs: a novel pathway to autoimmune-associated heart block.

    Science.gov (United States)

    Clancy, Robert M; Alvarez, David; Komissarova, Elena; Barrat, Franck J; Swartz, Jordan; Buyon, Jill P

    2010-02-15

    Activation of TLR by ssRNA after FcgammaR-mediated phagocytosis of immune complexes (IC) may be relevant in autoimmune-associated congenital heart block (CHB) where the obligate factor is a maternal anti-SSA/Ro Ab and the fetal factors, protein/RNA on an apoptotic cardiocyte and infiltrating macrophages. This study addressed the hypothesis that Ro60-associated ssRNAs link macrophage activation to fibrosis via TLR engagement. Both macrophage transfection with noncoding ssRNA that bind Ro60 and an IC generated by incubation of Ro60-ssRNA with an IgG fraction from a CHB mother or affinity purified anti-Ro60 significantly increased TNF-alpha secretion, an effect not observed using control RNAs or normal IgG. Dependence on TLR was supported by the significant inhibition of TNF-alpha release by IRS661 and chloroquine. The requirement for FcgammaRIIIa-mediated delivery was provided by inhibition with an anti-CD16a Ab. Fibrosis markers were noticeably increased in fetal cardiac fibroblasts after incubation with supernatants generated from macrophages transfected with ssRNA or incubated with the IC. Supernatants generated from macrophages with ssRNA in the presence of IRS661 or chloroquine did not cause fibrosis. In a CHB heart, but not a healthy heart, TLR7 immunostaining was localized to a region near the atrioventricular groove at a site enriched in mononuclear cells and fibrosis. These data support a novel injury model in CHB, whereby endogenous ligand, Ro60-associated ssRNA, forges a nexus between TLR ligation and fibrosis instigated by binding of anti-Ro Abs to the target protein likely accessible via apoptosis.

  11. Silencing criticism in Mexico

    Directory of Open Access Journals (Sweden)

    Ximena Suárez

    2017-10-01

    Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

  12. Ombuds’ corner: Employee silence

    CERN Multimedia

    Vincent Vuillemin

    2013-01-01

    Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

  13. RNA

    African Journals Online (AJOL)

    SARAH

    30 nov. 2013 ... RÉSUMÉ. Objectif : La présente étude est conduite dans les régions de Maradi et Zinder situées dans le Centre-Sud du. Niger où la pratique de la régénération naturelle assistée des ligneux dans les champs (RNA) a permis de reverdir plus de 5 millions d'hectares. Le but de ce travail est d'évaluer ...

  14. Cytoplasmic Male Sterility of Rice with Boro II Cytoplasm Is Caused by a Cytotoxic Peptide and Is Restored by Two Related PPR Motif Genes via Distinct Modes of mRNA Silencing[W

    Science.gov (United States)

    Wang, Zhonghua; Zou, Yanjiao; Li, Xiaoyu; Zhang, Qunyu; Chen, Letian; Wu, Hao; Su, Dihua; Chen, Yuanling; Guo, Jingxin; Luo, Da; Long, Yunming; Zhong, Yang; Liu, Yao-Guang

    2006-01-01

    Cytoplasmic male sterility (CMS) and nucleus-controlled fertility restoration are widespread plant reproductive features that provide useful tools to exploit heterosis in crops. However, the molecular mechanism underlying this kind of cytoplasmic–nuclear interaction remains unclear. Here, we show in rice (Oryza sativa) with Boro II cytoplasm that an abnormal mitochondrial open reading frame, orf79, is cotranscribed with a duplicated atp6 (B-atp6) gene and encodes a cytotoxic peptide. Expression of orf79 in CMS lines and transgenic rice plants caused gametophytic male sterility. Immunoblot analysis showed that the ORF79 protein accumulates specifically in microspores. Two fertility restorer genes, Rf1a and Rf1b, were identified at the classical locus Rf-1 as members of a multigene cluster that encode pentatricopeptide repeat proteins. RF1A and RF1B are both targeted to mitochondria and can restore male fertility by blocking ORF79 production via endonucleolytic cleavage (RF1A) or degradation (RF1B) of dicistronic B-atp6/orf79 mRNA. In the presence of both restorers, RF1A was epistatic over RF1B in the mRNA processing. We have also shown that RF1A plays an additional role in promoting the editing of atp6 mRNAs, independent of its cleavage function. PMID:16489123

  15. Cytoplasmic male sterility of rice with boro II cytoplasm is caused by a cytotoxic peptide and is restored by two related PPR motif genes via distinct modes of mRNA silencing.

    Science.gov (United States)

    Wang, Zhonghua; Zou, Yanjiao; Li, Xiaoyu; Zhang, Qunyu; Chen, Letian; Wu, Hao; Su, Dihua; Chen, Yuanling; Guo, Jingxin; Luo, Da; Long, Yunming; Zhong, Yang; Liu, Yao-Guang

    2006-03-01

    Cytoplasmic male sterility (CMS) and nucleus-controlled fertility restoration are widespread plant reproductive features that provide useful tools to exploit heterosis in crops. However, the molecular mechanism underlying this kind of cytoplasmic-nuclear interaction remains unclear. Here, we show in rice (Oryza sativa) with Boro II cytoplasm that an abnormal mitochondrial open reading frame, orf79, is cotranscribed with a duplicated atp6 (B-atp6) gene and encodes a cytotoxic peptide. Expression of orf79 in CMS lines and transgenic rice plants caused gametophytic male sterility. Immunoblot analysis showed that the ORF79 protein accumulates specifically in microspores. Two fertility restorer genes, Rf1a and Rf1b, were identified at the classical locus Rf-1 as members of a multigene cluster that encode pentatricopeptide repeat proteins. RF1A and RF1B are both targeted to mitochondria and can restore male fertility by blocking ORF79 production via endonucleolytic cleavage (RF1A) or degradation (RF1B) of dicistronic B-atp6/orf79 mRNA. In the presence of both restorers, RF1A was epistatic over RF1B in the mRNA processing. We have also shown that RF1A plays an additional role in promoting the editing of atp6 mRNAs, independent of its cleavage function.

  16. Assessment of RNAi-induced silencing in banana (Musa spp.).

    Science.gov (United States)

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

  17. Mycobacterium tuberculosis lipomannan blocks TNF biosynthesis by regulating macrophage MAPK-activated protein kinase 2 (MK2) and microRNA miR-125b.

    Science.gov (United States)

    Rajaram, Murugesan V S; Ni, Bin; Morris, Jessica D; Brooks, Michelle N; Carlson, Tracy K; Bakthavachalu, Baskar; Schoenberg, Daniel R; Torrelles, Jordi B; Schlesinger, Larry S

    2011-10-18

    Contact of Mycobacterium tuberculosis (M.tb) with the immune system requires interactions between microbial surface molecules and host pattern recognition receptors. Major M.tb-exposed cell envelope molecules, such as lipomannan (LM), contain subtle structural variations that affect the nature of the immune response. Here we show that LM from virulent M.tb (TB-LM), but not from avirulent Myocobacterium smegmatis (SmegLM), is a potent inhibitor of TNF biosynthesis in human macrophages. This difference in response is not because of variation in Toll-like receptor 2-dependent activation of the signaling kinase MAPK p38. Rather, TB-LM stimulation leads to destabilization of TNF mRNA transcripts and subsequent failure to produce TNF protein. In contrast, SmegLM enhances MAPK-activated protein kinase 2 phosphorylation, which is critical for maintaining TNF mRNA stability in part by contributing microRNAs (miRNAs). In this context, human miRNA miR-125b binds to the 3' UTR region of TNF mRNA and destabilizes the transcript, whereas miR-155 enhances TNF production by increasing TNF mRNA half-life and limiting expression of SHIP1, a negative regulator of the PI3K/Akt pathway. We show that macrophages incubated with TB-LM and live M.tb induce high miR-125b expression and low miR-155 expression with correspondingly low TNF production. In contrast, SmegLM and live M. smegmatis induce high miR-155 expression and low miR-125b expression with high TNF production. Thus, we identify a unique cellular mechanism underlying the ability of a major M.tb cell wall component, TB-LM, to block TNF biosynthesis in human macrophages, thereby allowing M.tb to subvert host immunity and potentially increase its virulence.

  18. Crop-associated virus reduces the rooting depth of non-crop perennial native grass more than non-crop-associated virus with known viral suppressor of RNA silencing (VSR).

    Science.gov (United States)

    Malmstrom, Carolyn M; Bigelow, Patrick; Trębicki, Piotr; Busch, Anna K; Friel, Colleen; Cole, Ellen; Abdel-Azim, Heba; Phillippo, Colin; Alexander, Helen M

    2017-09-15

    As agricultural acreage expanded and came to dominate landscapes across the world, viruses gained opportunities to move between crop and wild native plants. In the Midwestern USA, virus exchange currently occurs between widespread annual Poaceae crops and remnant native perennial prairie grasses now under consideration as bioenergy feedstocks. In this region, the common aphid species Rhopalosiphum padi L. (the bird cherry-oat aphid) transmits several virus species in the family Luteoviridae, including Barley yellow dwarf virus (BYDV-PAV, genus Luteovirus) and Cereal yellow dwarf virus (CYDV-RPV and -RPS, genus Polerovirus). The yellow dwarf virus (YDV) species in these two genera share genetic similarities in their 3'-ends, but diverge in the 5'-regions. Most notably, CYDVs encode a P0 viral suppressor of RNA silencing (VSR) absent in BYDV-PAV. Because BYDV-PAV has been reported more frequently in annual cereals and CYDVs in perennial non-crop grasses, we examine the hypothesis that the viruses' genetic differences reflect different affinities for crop and non-crop hosts. Specifically, we ask (i) whether CYDVs might persist within and affect a native non-crop grass more strongly than BYDV-PAV, on the grounds that the polerovirus VSR could better moderate the defenses of a well-defended perennial, and (ii) whether the opposite pattern of effects might occur in a less defended annual crop. Because previous work found that the VSR of CYDV-RPS possessed greater silencing suppressor efficiency than that of CYDV-RPV, we further explored (iii) whether a novel grass-associated CYDV-RPS isolate would influence a native non-crop grass more strongly than a comparable CYDV-RPV isolate. In growth chamber studies, we found support for this hypothesis: only grass-associated CYDV-RPS stunted the shoots and crowns of Panicum virgatum L. (switchgrass), a perennial native North American prairie grass, whereas crop-associated BYDV-PAV (and coinfection with BYDV-PAV and CYDV-RPS) most

  19. RNA interference in Lepidoptera

    DEFF Research Database (Denmark)

    Terenius, Ole; Papanicolaou, Alexie; Garbutt, Jennie S.

    2011-01-01

    Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive...... is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success...

  20. Memories Persist in Silence

    Directory of Open Access Journals (Sweden)

    Sandra Patricia Arenas Grisales

    2012-08-01

    Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

  1. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

    Science.gov (United States)

    Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

    2016-11-22

    Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

  2. The Fruit of Silence

    Science.gov (United States)

    Nelson, Marilyn

    2006-01-01

    This presentation explores how contemplative practices, especially those anchored in an active listening to silence, are integrated into creative writing courses. It pays particular attention to a course taught at the United States Military Academy at West Point and to a course on the poetry of war and peace taught at the University of…

  3. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  4. RNA Interference - Towards RNA becoming a Medicine -42 ...

    Indian Academy of Sciences (India)

    ph~nomenon in C.elegans. They were attempting'to use antisens'c'RNA as an approach to Inhibit gene expression. They found that sense and antisense RNA forming a double. stranded RNA was a better silencing trigger than antisense RNA. After the discovery ofRNAi in C.elegans, identification of the RNAi pathway was ...

  5. FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

    Science.gov (United States)

    Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

    2014-01-01

    Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

  6. Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Praveen Guleria

    Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

  7. Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

    Science.gov (United States)

    Guleria, Praveen; Yadav, Sudesh Kumar

    2013-01-01

    Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

  8. A translational silencing function of MCPIP1/Regnase-1 specified by the target site context.

    Science.gov (United States)

    Behrens, Gesine; Winzen, Reinhard; Rehage, Nina; Dörrie, Anneke; Barsch, Monika; Hoffmann, Anne; Hackermüller, Jörg; Tiedje, Christopher; Heissmeyer, Vigo; Holtmann, Helmut

    2018-02-19

    The expression of proteins during inflammatory and immune reactions is coordinated by post-transcriptional mechanisms. A particularly strong suppression of protein expression is exerted by a conserved translational silencing element (TSE) identified in the 3' UTR of NFKBIZ mRNA, which is among the targets of the RNA-binding proteins Roquin-1/2 and MCPIP1/Regnase-1. We present evidence that in the context of the TSE MCPIP1, so far known for its endonuclease activity toward mRNAs specified by distinct stem-loop (SL) structures, also suppresses translation. Overexpression of MCPIP1 silenced translation in a TSE-dependent manner and reduced ribosome occupancy of the mRNA. Correspondingly, MCPIP1 depletion alleviated silencing and increased polysomal association of the mRNA. Translationally silenced NFKBIZ or reporter mRNAs were mostly capped, polyadenylated and ribosome associated. Furthermore, MCPIP1 silenced also cap-independent, CrPV-IRES-dependent translation. This suggests that MCPIP1 suppresses a post-initiation step. The TSE is predicted to form five SL structures. SL4 and 5 resemble target structures reported for MCPIP1 and together were sufficient for MCPIP1 binding and mRNA destabilization. Translational silencing, however, required SL1-3 in addition. Thus the NFKBIZ TSE functions as an RNA element in which sequences adjacent to the site of interaction with MCPIP1 and dispensable for accelerated mRNA degradation extend the functional repertoire of MCPIP1 to translational silencing.

  9. Phylogenetic analysis of partial RNA-polymerase blocks II and III of Rabies virus isolated from the main rabies reservoirs in Brazil.

    Science.gov (United States)

    Carnieli, Pedro; de Novaes Oliveira, Rafael; de Oliveira Fahl, Willian; de Carvalho Ruthner Batista, Helena Beatriz; Scheffer, Karin Corrêa; Iamamoto, Keila; Castilho, Juliana Galera

    2012-08-01

    This study describes the results of the sequencing and analysis of segments of Blocks II and III of the RNA polymerase L gene of Rabies virus isolates from different reservoir species of Brazil. The phylogenetic relations of the virus were determined and a variety of species-specific nucleotides were found in the analyzed areas, but the majority of these mutations were found to be synonymous. However, an analysis of the putative amino acid sequences were shown to have some characteristic mutations between some reservoir species of Brazil, indicating that there was positive selection in the RNA polymerase L gene of Rabies virus. On comparing the putative viral sequences obtained from the Brazilian isolates and other Lyssavirus, it was determined that amino acid mutations occurred in low-restriction areas. This study of the L gene of Rabies virus is the first to be conducted with samples of virus isolates from Brazil, and the results obtained will help in the determination of the phylogenetic relations of the virus.

  10. Stable expression of silencing-suppressor protein enhances the performance and longevity of an engineered metabolic pathway.

    Science.gov (United States)

    Naim, Fatima; Shrestha, Pushkar; Singh, Surinder P; Waterhouse, Peter M; Wood, Craig C

    2016-06-01

    Transgenic engineering of plants is important in both basic and applied research. However, the expression of a transgene can dwindle over time as the plant's small (s)RNA-guided silencing pathways shut it down. The silencing pathways have evolved as antiviral defence mechanisms, and viruses have co-evolved viral silencing-suppressor proteins (VSPs) to block them. Therefore, VSPs have been routinely used alongside desired transgene constructs to enhance their expression in transient assays. However, constitutive, stable expression of a VSP in a plant usually causes pronounced developmental abnormalities, as their actions interfere with endogenous microRNA-regulated processes, and has largely precluded the use of VSPs as an aid to stable transgene expression. In an attempt to avoid the deleterious effects but obtain the enhancing effect, a number of different VSPs were expressed exclusively in the seeds of Arabidopsis thaliana alongside a three-step transgenic pathway for the synthesis of arachidonic acid (AA), an ω-6 long chain polyunsaturated fatty acid. Results from independent transgenic events, maintained for four generations, showed that the VSP-AA-transformed plants were developmentally normal, apart from minor phenotypes at the cotyledon stage, and could produce 40% more AA than plants transformed with the AA transgene cassette alone. Intriguingly, a geminivirus VSP, V2, was constitutively expressed without causing developmental defects, as it acts on the siRNA amplification step that is not part of the miRNA pathway, and gave strong transgene enhancement. These results demonstrate that VSP expression can be used to protect and enhance stable transgene performance and has significant biotechnological application. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  11. A comprehensive survey of 3' animal miRNA modification events and a possible role for 3' adenylation in modulating miRNA targeting effectiveness.

    Science.gov (United States)

    Burroughs, A Maxwell; Ando, Yoshinari; de Hoon, Michiel J L; Tomaru, Yasuhiro; Nishibu, Takahiro; Ukekawa, Ryo; Funakoshi, Taku; Kurokawa, Tsutomu; Suzuki, Harukazu; Hayashizaki, Yoshihide; Daub, Carsten O

    2010-10-01

    Animal microRNA sequences are subject to 3' nucleotide addition. Through detailed analysis of deep-sequenced short RNA data sets, we show adenylation and uridylation of miRNA is globally present and conserved across Drosophila and vertebrates. To better understand 3' adenylation function, we deep-sequenced RNA after knockdown of nucleotidyltransferase enzymes. The PAPD4 nucleotidyltransferase adenylates a wide range of miRNA loci, but adenylation does not appear to affect miRNA stability on a genome-wide scale. Adenine addition appears to reduce effectiveness of miRNA targeting of mRNA transcripts while deep-sequencing of RNA bound to immunoprecipitated Argonaute (AGO) subfamily proteins EIF2C1-EIF2C3 revealed substantial reduction of adenine addition in miRNA associated with EIF2C2 and EIF2C3. Our findings show 3' addition events are widespread and conserved across animals, PAPD4 is a primary miRNA adenylating enzyme, and suggest a role for 3' adenine addition in modulating miRNA effectiveness, possibly through interfering with incorporation into the RNA-induced silencing complex (RISC), a regulatory role that would complement the role of miRNA uridylation in blocking DICER1 uptake.

  12. A comprehensive survey of 3′ animal miRNA modification events and a possible role for 3′ adenylation in modulating miRNA targeting effectiveness

    Science.gov (United States)

    Burroughs, A. Maxwell; Ando, Yoshinari; de Hoon, Michiel J.L.; Tomaru, Yasuhiro; Nishibu, Takahiro; Ukekawa, Ryo; Funakoshi, Taku; Kurokawa, Tsutomu; Suzuki, Harukazu; Hayashizaki, Yoshihide; Daub, Carsten O.

    2010-01-01

    Animal microRNA sequences are subject to 3′ nucleotide addition. Through detailed analysis of deep-sequenced short RNA data sets, we show adenylation and uridylation of miRNA is globally present and conserved across Drosophila and vertebrates. To better understand 3′ adenylation function, we deep-sequenced RNA after knockdown of nucleotidyltransferase enzymes. The PAPD4 nucleotidyltransferase adenylates a wide range of miRNA loci, but adenylation does not appear to affect miRNA stability on a genome-wide scale. Adenine addition appears to reduce effectiveness of miRNA targeting of mRNA transcripts while deep-sequencing of RNA bound to immunoprecipitated Argonaute (AGO) subfamily proteins EIF2C1–EIF2C3 revealed substantial reduction of adenine addition in miRNA associated with EIF2C2 and EIF2C3. Our findings show 3′ addition events are widespread and conserved across animals, PAPD4 is a primary miRNA adenylating enzyme, and suggest a role for 3′ adenine addition in modulating miRNA effectiveness, possibly through interfering with incorporation into the RNA-induced silencing complex (RISC), a regulatory role that would complement the role of miRNA uridylation in blocking DICER1 uptake. PMID:20719920

  13. Novel inhibitors of the rRNA ErmC' methyltransferase to block resistance to macrolides, lincosamides, streptogramine B antibiotics.

    Science.gov (United States)

    Foik, Ilona P; Tuszynska, Irina; Feder, Marcin; Purta, Elzbieta; Stefaniak, Filip; Bujnicki, Janusz M

    2018-02-25

    In erythromycin-resistant bacteria, the N6 position of A2058 in 23S rRNA is mono- or dimethylated by Erm family methyltransferases. This modification results in cross-resistance to macrolides, lincosamides and streptogramin B. Most inhibitors of Erm methyltransferases developed up-to-date target the cofactor-binding pocket, resulting in a lack of selectivity whereas inhibitors that bind the substrate-binding pocket demonstrate low in vitro activity. In this study, a molecular docking approach followed by biochemical screening was applied to search for inhibitors targeting both cofactor- and substrate-binding pockets of ErmC' methyltransferase. Based on the results of the molecular docking-based virtual screening of the clean-leads subset of the ZINC database, 29 compounds were chosen for experimental verification. Among them inhibitor 28 (ZINC code 32747906), with an IC 50 of 100 μM, decreased the minimal inhibitory concentration of erythromycin in the Escherichia coli strain overexpressing ErmC'. Docking analysis of 28 to the ErmC' structure and the competitive ligand binding assay revealed a non-competitive model of inhibition. Inhibitor 28 served as a template for similarity-based virtual screening, which resulted in the identification of two derivatives 3s (ZINC code 62022572) and 4s (ZINC code 49032257) with an IC 50 of 116 μM and 110 μM, respectively. Our results provide a basis for the development of inhibitors against the Erm-family of enzymes. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  14. Addition of poly (propylene glycol) to multiblock copolymer to optimize siRNA delivery.

    Science.gov (United States)

    Dai, Zhi; Arévalo, Maria T; Li, Junwei; Zeng, Mingtao

    2014-01-01

    Previous studies have examined different strategies for siRNA delivery with varying degrees of success. These include use of viral vectors, cationic liposomes, and polymers. Several copolymers were designed and synthesized based on blocks of poly(ethylene glycol) PEG, poly(propylene glycol) PPG, and poly(l-lysine). These were designated as P1, P2, and P3. We studied the copolymer self-assembly, siRNA binding, particle size, surface potential, architecture of the complexes, and siRNA delivery. Silencing of GFP using copolymer P3 to deliver GFP-specific siRNA to Neuro-2a cells expressing GFP was almost as effective as using Lipofectamine 2000, with minimal cytotoxicity. Thus, we have provided a new copolymer platform for siRNA delivery that we can continue to modify for improved delivery of siRNA in vitro and eventually in vivo.

  15. PERK silence inhibits glioma cell growth under low glucose stress by blockage of p-AKT and subsequent HK2's mitochondria translocation

    KAUST Repository

    Hou, Xu

    2015-03-12

    Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)\\'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.

  16. Specific Delivery of MiRNA for High Efficient Inhibition of Prostate Cancer by RNA Nanotechnology.

    Science.gov (United States)

    Binzel, Daniel W; Shu, Yi; Li, Hui; Sun, Meiyan; Zhang, Qunshu; Shu, Dan; Guo, Bin; Guo, Peixuan

    2016-08-01

    Both siRNA and miRNA can serve as powerful gene-silencing reagents but their specific delivery to cancer cells in vivo without collateral damage to healthy cells remains challenging. We report here the application of RNA nanotechnology for specific and efficient delivery of anti-miRNA seed-targeting sequence to block the growth of prostate cancer in mouse models. Utilizing the thermodynamically ultra-stable three-way junction of the pRNA of phi29 DNA packaging motor, RNA nanoparticles were constructed by bottom-up self-assembly containing the anti-prostate-specific membrane antigen (PSMA) RNA aptamer as a targeting ligand and anti-miR17 or anti-miR21 as therapeutic modules. The 16 nm RNase-resistant and thermodynamically stable RNA nanoparticles remained intact after systemic injection in mice and strongly bound to tumors with little or no accumulation in healthy organs 8 hours postinjection, and subsequently repressed tumor growth at low doses with high efficiency.

  17. Sinorhizobium meliloti YbeY is an endoribonuclease with unprecedented catalytic features, acting as silencing enzyme in riboregulation.

    Science.gov (United States)

    Saramago, Margarida; Peregrina, Alexandra; Robledo, Marta; Matos, Rute G; Hilker, Rolf; Serrania, Javier; Becker, Anke; Arraiano, Cecilia M; Jiménez-Zurdo, José I

    2017-02-17

    Structural and biochemical features suggest that the almost ubiquitous bacterial YbeY protein may serve catalytic and/or Hfq-like protective functions central to small RNA (sRNA)-mediated regulation and RNA metabolism. We have biochemically and genetically characterized the YbeY ortholog of the legume symbiont Sinorhizobium meliloti (SmYbeY). Co-immunoprecipitation (CoIP) with a FLAG-tagged SmYbeY yielded a poor enrichment in RNA species, compared to Hfq CoIP-RNA uncovered previously by a similar experimental setup. Purified SmYbeY behaved as a monomer that indistinctly cleaved single- and double-stranded RNA substrates, a unique ability among bacterial endoribonucleases. SmYbeY-mediated catalysis was supported by the divalent metal ions Mg2+, Mn2+ and Ca2+, which influenced in a different manner cleavage efficiency and reactivity patterns, with Ca2+ specifically blocking activity on double-stranded and some structured RNA molecules. SmYbeY loss-of-function compromised expression of core energy and RNA metabolism genes, whilst promoting accumulation of motility, late symbiotic and transport mRNAs. Some of the latter transcripts are known Hfq-binding sRNA targets and might be SmYbeY substrates. Genetic reporter and in vitro assays confirmed that SmYbeY is required for sRNA-mediated down-regulation of the amino acid ABC transporter prbA mRNA. We have thus discovered a bacterial endoribonuclease with unprecedented catalytic features, acting also as gene silencing enzyme.

  18. Multifunctional pH-Sensitive Amino Lipids for siRNA Delivery.

    Science.gov (United States)

    Gujrati, Maneesh; Vaidya, Amita; Lu, Zheng-Rong

    2016-01-20

    RNA interference (RNAi) represents a powerful modality for human disease therapy that can regulate gene expression signature using small interfering RNA (siRNA). Successful delivery of siRNA into the cytoplasm of target cells is imperative for efficient RNAi and also constitutes the primary stumbling block in the clinical applicability of RNAi. Significant progress has been made in the development of lipid-based siRNA delivery systems, which have practical advantages like simple chemistry and easy formulation of nanoparticles with siRNA. This review discusses the recent development of pH-sensitive amino lipids, with particular focus on multifunctional pH-sensitive amino lipids for siRNA delivery. The key components of these multifunctional lipids include a protonatable amino head group, distal lipid tails, and two cross-linkable thiol groups, which together facilitate the facile formation of stable siRNA-nanoparticles, easy surface modification for target-specific delivery, endosomal escape in response to the pH decrease during subcellular trafficking, and reductive dissociation of the siRNA-nanoparticles for cytoplasmic release of free siRNA. By virtue of these properties, multifunctional pH-sensitive lipids can mediate efficient cytosolic siRNA delivery and gene silencing. Targeted siRNA nanoparticles can be readily formulated with these lipids, without the need for other helper lipids, to promote systemic delivery of therapeutic siRNAs. Such targeted siRNA nanoparticles have been shown to effectively regulate the expression of cancer-related genes, resulting in significant efficacy in the treatment of aggressive tumors, including metastatic triple negative breast cancer. These multifunctional pH-sensitive lipids constitute a promising platform for the systemic and targeted delivery of therapeutic siRNA for the treatment of human diseases. This review summarizes the structure-property relationship of the multifunctional pH-sensitive lipids and their efficacy in

  19. Memories Persist in Silence

    OpenAIRE

    Sandra Patricia Arenas Grisales

    2012-01-01

    This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form ...

  20. Voice and silence in organizations

    Directory of Open Access Journals (Sweden)

    Moaşa, H.

    2011-01-01

    Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

  1. "Listening Silence" and Its Discursive Effects

    Science.gov (United States)

    Applebaum, Barbara

    2016-01-01

    While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

  2. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  3. Identification of a maize chlorotic dwarf virus silencing suppressor protein

    Science.gov (United States)

    Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

  4. Inhibition of tobacco axillary bud differentiation by silencing CUP ...

    African Journals Online (AJOL)

    Yomi

    2012-02-23

    Feb 23, 2012 ... exhibited some important phenotypes, such as leaf fusion, leaf curl and incomplete leaf. CUC3 in N. tabacum was silenced successfully by RNA interference (RNAi), which .... 0.1 mg NAA L-1 and 1.0 mg BAP L-1 was used as co-culture medium. Co-culture medium with hygromycin B 50 mg hygromycin.

  5. Studies of the silencing of Baculovirus DNA binding protein

    NARCIS (Netherlands)

    Quadt, I.; Lent, van J.W.M.; Knebel-Morsdorf, D.

    2007-01-01

    Baculovirus DNA binding protein (DBP) binds preferentially single-stranded DNA in vitro and colocalizes with viral DNA replication sites. Here, its putative role as viral replication factor has been addressed by RNA interference. Silencing of DBP in Autographa californica multiple

  6. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  7. Transcriptional silencing of multiple genes in trophozoites of Entamoeba histolytica.

    Directory of Open Access Journals (Sweden)

    Rivka Bracha

    2006-05-01

    Full Text Available In a previous work we described the transcriptional silencing of the amoebapore A (AP-A gene (Ehap-a of Entamoeba histolytica strain HM-1:IMSS. The silencing occurred following transfection with a plasmid containing a 5' upstream region (473 bp of Ehap-a that included a truncated segment (140 bp of a short interspersed nuclear element (SINE1. Silencing remained in effect even after removal of the plasmid (clone G3. Neither short interfering RNA nor methylated DNA were detected, but the chromatin domain of Ehap-a in the gene-silenced trophozoites was modified. Two other similar genes (Ehap-b and one encoding a Saposin-like protein, SAPLIP 1 also became silenced. In the present work we demonstrate the silencing of a second gene of choice, one that encodes the light subunit of the Gal/GalNAc inhibitable lectin (Ehlgl1 and the other, the cysteine proteinase 5 (EhCP-5. This silencing occurred in G3 trophozoites transfected with a plasmid in which the 473 bp 5' upstream Ehap-a fragment was directly ligated to the second gene. Transcriptional silencing occurred in both the transgene and the chromosomal gene. SINE1 sequences were essential, as was a direct connection between the Ehap-a upstream region and the beginning of the open reading frame of the second gene. Gene silencing did not occur in strain HM-1:IMSS with any of these plasmid constructs. The trophozoites with two silenced genes were virulence-attenuated as were those of clone G3. In addition, trophozoites not expressing Lgl1 and AP-A proteins had a significantly reduced ability to cap the Gal/GalNAc-lectin to the uroid region when incubated with antibodies against the heavy (170 kDa subunit of the lectin. Lysates of trophozoites lacking cysteine proteinase 5 and AP-A proteins had 30% less cysteine proteinase activity than those of HM-1:IMSS strain or the G3 clone. Silencing of other genes in G3 amoebae could provide a model to study their various functions. In addition, double gene-silenced

  8. Bodies, Spaces, Voices, Silences

    Directory of Open Access Journals (Sweden)

    Donatella Mazzoleni

    2013-07-01

    Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

  9. The 3' untranslated region of the cyclin B mRNA is not sufficient to enhance the synthesis of cyclin B during a mitotic block in human cells.

    Directory of Open Access Journals (Sweden)

    Dominik Schnerch

    Full Text Available Antimitotic agents are frequently used to treat solid tumors and hematologic malignancies. However, one major limitation of antimitotic approaches is mitotic slippage, which is driven by slow degradation of cyclin B during a mitotic block. The extent to which cyclin B levels decline is proposed to be governed by an equilibrium between cyclin B synthesis and degradation. It was recently shown that the 3' untranslated region (UTR of the murine cyclin B mRNA contributes to the synthesis of cyclin B during mitosis in murine cells. Using a novel live-cell imaging-based technique allowing us to study synthesis and degradation of cyclin B simultaneously at the single cell level, we tested here the role of the human cyclin B 3'UTR in regulating cyclin B synthesis during mitosis in human cells. We observed that the cyclin B 3'UTR was not sufficient to enhance cyclin B synthesis in human U2Os, HeLa or hTERT RPE-1 cells. A better understanding of how the equilibrium of cyclin B is regulated in mitosis may contribute to the development of improved therapeutic approaches to prevent mitotic slippage in cancer cells treated with antimitotic agents.

  10. Structure of long human telomeric RNA (TERRA): G-quadruplexes formed by four and eight UUAGGG repeats are stable building blocks.

    Science.gov (United States)

    Martadinata, Herry; Heddi, Brahim; Lim, Kah Wai; Phan, Anh Tuân

    2011-07-26

    The discovery of long RNA transcripts of telomeric repeats (TERRA) and their potential to form G-quadruplexes stimulated studies on the possible arrangements of G-quadruplexes along TERRA. Here we performed ribonuclease protection assay to investigate the structures formed by long human TERRA. We found that G-quadruplexes comprising four and eight UUAGGG repeats were most resistant to RNase T1 digestion, presumably with the former adopting an all-parallel-stranded propeller-type conformation and the latter forming a structure with two tandemly stacked G-quadruplex subunits each containing three G-tetrad layers. Molecular dynamics simulations of eight-repeat human TERRA sequences consisting of different stacking interfaces between the two G-quadruplex subunits, i.e., 5'-5', 3'-3', 3'-5', and 5'-3', demonstrated stacking feasibility for all but the 5'-3' arrangement. A continuous stacking of the loop bases from one G-quadruplex subunit to the next was observed for the 5'-5' stacking conformation. We also put forward other possible stacking arrangements that involve more than one linker connecting the two G-quadruplex subunits. On the basis of these results, we propose a "beads-on-a-string"-like arrangement along human TERRA, whereby each bead is made up of either four or eight UUAGGG repeats in a one- or two-block G-quadruplex arrangement, respectively. © 2011 American Chemical Society

  11. Lack of pairing during meiosis triggers multigenerational transgene silencing in Caenorhabditis elegans

    Science.gov (United States)

    Leopold, Luciana E.; Heestand, Bree N.; Seong, Soobin; Shtessel, Ludmila; Ahmed, Shawn

    2015-01-01

    Single-copy transgenes in Caenorhabditis elegans can be subjected to a potent, irreversible silencing process termed small RNA-induced epigenetic silencing (RNAe). RNAe is promoted by the Piwi Argonaute protein PRG-1 and associated Piwi-interacting RNAs (piRNAs), as well as by proteins that promote and respond to secondary small interfering RNA (siRNA) production. Here we define a related siRNA-mediated silencing process, termed “multigenerational RNAe,” which can occur for transgenes that are maintained in a hemizygous state for several generations. We found that transgenes that contain either GFP or mCherry epitope tags can be silenced via multigenerational RNAe, whereas a transgene that possesses GFP and a perfect piRNA target site can be rapidly and permanently silenced via RNAe. Although previous studies have shown that PRG-1 is typically dispensable for maintenance of RNAe, we found that both initiation and maintenance of multigenerational RNAe requires PRG-1 and the secondary siRNA biogenesis protein RDE-2. Although silencing via RNAe is irreversible, we found that transgene expression can be restored when hemizygous transgenes that were silenced via multigenerational RNAe become homozygous. Furthermore, multigenerational RNAe was accelerated when meiotic pairing of the chromosome possessing the transgene was abolished. We propose that persistent lack of pairing during meiosis elicits a reversible multigenerational silencing response, which can lead to permanent transgene silencing. Multigenerational RNAe may be broadly relevant to single-copy transgenes used in experimental biology and to shaping the epigenomic landscape of diverse species, where genomic polymorphisms between homologous chromosomes commonly result in unpaired DNA during meiosis. PMID:25941370

  12. Organizational Silence in Sports Employees

    Science.gov (United States)

    Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

    2016-01-01

    Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

  13. Silence, an Eye of Knowledge

    Science.gov (United States)

    Aghamohammadi, Mehdi

    2017-01-01

    One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

  14. RNA interference mediated inhibition of dengue virus multiplication and entry in HepG2 cells.

    Directory of Open Access Journals (Sweden)

    Mohammed Abdelfatah Alhoot

    Full Text Available BACKGROUND: Dengue virus-host cell interaction initiates when the virus binds to the attachment receptors followed by endocytic internalization of the virus particle. Successful entry into the cell is necessary for infection initiation. Currently, there is no protective vaccine or antiviral treatment for dengue infection. Targeting the viral entry pathway has become an attractive therapeutic strategy to block infection. This study aimed to investigate the effect of silencing the GRP78 and clathrin-mediated endocytosis on dengue virus entry and multiplication into HepG2 cells. METHODOLOGY/PRINCIPAL FINDINGS: HepG2 cells were transfected using specific siRNAs to silence the cellular surface receptor (GRP78 and clathrin-mediated endocytosis pathway. Gene expression analysis showed a marked down-regulation of the targeted genes (87.2%, 90.3%, and 87.8% for GRP78, CLTC, and DNM2 respectively in transfected HepG2 cells when measured by RT-qPCR. Intracellular and extracellular viral RNA loads were quantified by RT-qPCR to investigate the effect of silencing the attachment receptor and clathrin-mediated endocytosis on dengue virus entry. Silenced cells showed a significant reduction of intracellular (92.4% and extracellular viral RNA load (71.4% compared to non-silenced cells. Flow cytometry analysis showed a marked reduction of infected cells (89.7% in silenced HepG2 cells compared to non-silenced cells. Furthermore, the ability to generate infectious virions using the plaque assay was reduced 1.07 log in silenced HepG2 cells. CONCLUSIONS/SIGNIFICANCE: Silencing the attachment receptor and clathrin-mediated endocytosis using siRNA could inhibit dengue virus entry and multiplication into HepG2 cells. This leads to reduction of infected cells as well as the viral load, which might function as a unique and promising therapeutic agent for attenuating dengue infection and prevent the development of dengue fever to the severe life-threatening DHF or DSS

  15. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  16. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  17. Identification of a maize chlorotic dwarf virus silencing suppressor protein.

    Science.gov (United States)

    Stewart, Lucy R; Jarugula, Sridhar; Zhao, Yujing; Qu, Feng; Marty, DeeMarie

    2017-04-01

    Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389kDa proteolytically processed polyprotein. We show that the N-terminal 78kDa polyprotein (R78) of MCDV acts as a suppressor of RNA silencing in a well-established assay system. We further demonstrate that R78 is cleaved by the viral 3C-like protease into 51 and 27kDa proteins (p51 and p27), and that p51 is responsible for silencing suppressor activity. Silencing suppressor activity of R78 is conserved in three divergent MCDV strains (MCDV-Severe, MCDV-M1, and MCDV-Tennessee), as well as the waikavirus Bellflower vein chlorosis virus, but was not detected for orthologous protein of Rice tungro spherical virus (RTSV-A) or the similarly-positioned protein from the sequivirus Parsnip yellow fleck virus (PYFV). This is the first identification of a virus suppressor of RNA silencing encoded by a waikavirus. Copyright © 2017. Published by Elsevier Inc.

  18. Mannan-Binding Lectin-Associated Serine Protease 1/3 Cleavage of Pro-Factor D into Factor D In Vivo and Attenuation of Collagen Antibody-Induced Arthritis through Their Targeted Inhibition by RNA Interference-Mediated Gene Silencing

    Science.gov (United States)

    Banda, Nirmal K.; Acharya, Sumitra; Scheinman, Robert I.; Mehta, Gaurav; Coulombe, Marilyne; Takahashi, Minoru; Sekine, Hideharu; Thiel, Steffen; Fujita, Teizo; Holers, V Michael

    2016-01-01

    The complement system is proposed to play an important role in the pathogenesis of rheumatoid arthritis (RA). The complement system mannan-binding lectin associated serine proteases 1 and 3 (MASP-1/3) cleave proDf (inactive) into Df (active), but it is unknown where this cleavage occurs and whether inhibition of MASP-1/3 is a relevant therapeutic strategy for RA. We show herein that the cleavage of proDf into Df by MASP-1/3 can occur in the circulation and that inhibition of MASP-1/3 by gene silencing is sufficient to ameliorate collagen antibody-induced arthritis (CAIA) in mice. Specifically, to examine the cleavage of proDf into Df, MASP-1/3 producing Df−/− liver tissue (donor) was transplanted under the kidney capsule of MASP-1/3−/− (recipient) mice. Five weeks after the liver transplantation, cleaved Df was present in the circulation of MASP-1/3−/− mice. To determine the individual effects of MASP-1/3 and Df gene silencing on CAIA, mice were injected with scrambled, MASP-1/3 targeted, or Df targeted siRNAs. The mRNA levels for MASP-1 and 3 decreased in the liver to 62% and 58%, respectively, in mice injected with MASP-1/3 siRNAs, and Df mRNA decreased to 53% in the adipose tissue of mice injected with Df siRNAs; additionally, circulating MASP-1/3 and Df protein levels were decreased. In mice injected with both siRNAs the clinical disease activity, histopathologic injury scores, C3 deposition, and synovial macrophage/ neutrophil infiltration were significantly decreased. Thus MASP-1/3 is a new therapeutic target for the treatment of RA, likely through both direct effects on the LP and indirect through the AP. PMID:27707997

  19. Engineered chloroplast dsRNA silences cytochrome p450 monooxygenase, V-ATPase and chitin synthase genes in the insect gut and disrupts Helicoverpa zea larval development and pupation.

    Science.gov (United States)

    Jin, Shuangxia; Singh, Nameirakpam D; Li, Lebin; Zhang, Xianlong; Daniell, Henry

    2015-04-01

    In the past two decades, chloroplast genetic engineering has been advanced to achieve high-level protein accumulation but not for down-regulation of targeted genes. Therefore, in this report, lepidopteran chitin synthase (Chi), cytochrome P450 monooxygenase (P450) and V-ATPase dsRNAs were expressed via the chloroplast genome to study RNA interference (RNAi) of target genes in intended hosts. PCR and Southern blot analysis confirmed homoplasmy and site-specific integration of transgene cassettes into the chloroplast genomes. Northern blots and real-time qRT-PCR confirmed abundant processed and unprocessed dsRNA transcripts (up to 3.45 million copies of P450 dsRNAs/μg total RNA); the abundance of cleaved dsRNA was greater than the endogenous psbA transcript. Feeding of leaves expressing P450, Chi and V-ATPase dsRNA decreased transcription of the targeted gene to almost undetectable levels in the insect midgut, likely after further processing of dsRNA in their gut. Consequently, the net weight of larvae, growth and pupation rates were significantly reduced by chloroplast-derived dsRNAs. Taken together, successful expression of dsRNAs via the chloroplast genome for the first time opens the door to study RNA interference/processing within plastids. Most importantly, dsRNA expressed in chloroplasts can be utilized for gene inactivation to confer desired agronomic traits or for various biomedical applications, including down-regulation of dysfunctional genes in cancer or autoimmune disorders, after oral delivery of dsRNA bioencapsulated within plant cells. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Apparent ploidy effects on silencing are post-transcriptional at HML and telomeres in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Jenny M McLaughlan

    Full Text Available The repression of genes in regions of heterochromatin is known as transcriptional silencing. It occurs in a wide range of organisms and can have importance in adaptation to the environment, developmental changes and disease. The model organism Saccharomyces cerevisiae has been used for many years to study transcriptional silencing, but until recently no study has been made in relation to ploidy. The aim of this work was to compare transcriptional silencing in haploids and diploids at both telomeres and the hidden mating-type (HM loci. Transcriptional silencing was assayed, by growth on 5-fluoroorotic acid (5-FOA media or by flow cytometry, on strains where a telomere or HM locus was marked. RNA levels were measured by quantitative RT-PCR to confirm that effects were transcriptional. 5-FOA assays and flow cytometry were consistent with transcriptional silencing at telomeres and at HML being reduced as ploidy increases which agreed with conclusions in previous publications. However, QRT-PCR revealed that transcriptional silencing was unaffected by ploidy and thus protein levels were increasing independently of RNA levels. At telomere XI left (XI-L, changes in protein level were strongly influenced by mating-type, whereas at HML mating-type had much less influence. The post-transcriptional effects seen in this study, illustrate the often ignored need to measure RNA levels when assaying transcriptional silencing in Saccharomyces cerevisiae.

  1. Silence, an Eye of Knowledge

    Directory of Open Access Journals (Sweden)

    Mehdi Aghamohammadi

    2017-04-01

    Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

  2. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA)...

  3. Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

    Directory of Open Access Journals (Sweden)

    Sirjana Devi Shrestha

    Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

  4. Host-induced gene silencing: a tool for understanding fungal host interaction and for developing novel disease control strategies.

    Science.gov (United States)

    Nunes, Cristiano C; Dean, Ralph A

    2012-06-01

    Recent discoveries regarding small RNAs and the mechanisms of gene silencing are providing new opportunities to explore fungal pathogen-host interactions and potential strategies for novel disease control. Plant pathogenic fungi are a constant and major threat to global food security; they represent the largest group of disease-causing agents on crop plants on the planet. An initial understanding of RNA silencing mechanisms and small RNAs was derived from model fungi. Now, new knowledge with practical implications for RNA silencing is beginning to emerge from the study of plant-fungus interactions. Recent studies have shown that the expression of silencing constructs in plants designed on fungal genes can specifically silence their targets in invading pathogenic fungi, such as Fusarium verticillioides, Blumeria graminis and Puccinia striiformis f.sp. tritici. Here, we highlight the important general aspects of RNA silencing mechanisms and emphasize recent findings from plant pathogenic fungi. Strategies to employ RNA silencing to investigate the basis of fungal pathogenesis are discussed. Finally, we address important aspects for the development of fungal-derived resistance through the expression of silencing constructs in host plants as a powerful strategy to control fungal disease. © 2011 The Authors. Molecular Plant Pathology © 2011 BSPP and Blackwell Publishing Ltd.

  5. Silencing long non-coding RNA ROR improves sensitivity of non-small-cell lung cancer to cisplatin resistance by inhibiting PI3K/Akt/mTOR signaling pathway.

    Science.gov (United States)

    Shi, Hui; Pu, Jin; Zhou, Xiao-Li; Ning, Yun-Ye; Bai, Chong

    2017-05-01

    This study aimed to investigate the effects of long non-coding RNA ROR (regulator of reprogramming) on cisplatin (DDP) resistance in patients with non-small-cell lung cancer by regulating PI3K/Akt/mTOR signaling pathway. Human cisplatin-resistant A549/DDP cell lines were selected and divided into control group, negative control group, si-ROR group, ROR over-expression group, Wortmannin group, and ROR over-expression + Wortmannin group. MTT assay was used to determine the optimum inhibitory concentration of DDP. Quantitative real-time polymerase chain reaction and western blotting were applied to detect expressions of long non-coding RNA ROR, PI3K, Akt, and mTOR. Colony-forming assay, scratch test, Transwell assay, and flow cytometry were conducted to detect cell proliferation, migration, invasion, and apoptosis, respectively. Tumor-formation assay was performed to detect the growth of transplanted tumors. Long non-coding RNA ROR expression was high in human A549/DDP cell lines. Compared with the control and negative control groups, the mRNA and protein expressions of PI3K, Akt, mTOR, and bcl-2 decreased, whereas the mRNA and protein expression of bax and the sensitivity of cells to DDP significantly increased. Cell proliferation, migration, and invasion abilities decreased in the si-ROR and Wortmannin groups. In comparison with control and negative control groups, the mRNA and protein expressions of PI3K, Akt, mTOR, and bcl-2 increased, whereas the mRNA and protein expressions of bax decreased, the sensitivity of cells to DDP significantly increased, and cell proliferation, migration, and invasion abilities decreased in the ROR over-expression group. For nude mice in tumor-formation assay, compared with control and negative control groups, the tumor weight was found to be lighter (1.03 ± 0.15) g, the protein expressions of PI3K, Akt, mTOR, and bcl-2 decreased, and the protein expression of bax increased in the si-ROR group. Long non-coding RNA ROR may affect

  6. Effect of blocking Rac1 expression in cholangiocarcinoma QBC939 cells

    Directory of Open Access Journals (Sweden)

    Liu Xudong

    2011-05-01

    Full Text Available Cholangiocarcinomas (CCs are malignant tumors that originate from epithelial cells lining the biliary tree and gallbladder. Ras correlative C3 creotoxin substrate 1 (Rac1, a small guanosine triphosphatase, is a critical mediator of various aspects of endothelial cell functions. The objective of the present investigation was to study the effect of blocking Rac1 expression in CCs. Seventy-four extrahepatic CC (ECC specimens and matched adjacent normal mucosa were obtained from the Department of Pathology, Inner Mongolia Medicine Hospital, between 2007 and 2009. Our results showed that the expression of Rac1 was significantly higher (53.12% in tumor tissues than in normal tissues. Western blotting data indicated a significant reduction in Rac1-miRNA cell protein levels. Rac1-miRNA cell growth rate was significantly different at 24, 48, and 72 h after transfection. Flow cytometry analysis showed that Rac1-miRNA cells undergo apoptosis more effectively than control QBC939 cells. Blocking Rac1 expression by RNAi effectively inhibits the growth of CCs. miRNA silencing of the Rac1 gene suppresses proliferation and induces apoptosis of QBC939 cells. These results suggest that Rac1 may be a new gene therapy target for CC. Blocking Rac1 expression in CC cells induces apoptosis of these tumor cells and may thus represent a new therapeutic approach.

  7. Gene silencing of stearoyl-ACP desaturase enhances the stearic acid content in Chlamydomonas reinhardtii

    NARCIS (Netherlands)

    Jaeger, de L.; Springer, J.; Wolbert, E.J.H.; Martens, D.E.; Eggink, G.; Wijffels, R.H.

    2017-01-01

    In this study, stearoyl-ACP desaturase (SAD), the enzyme that converts stearic acid into oleic acid, is silenced by artificial microRNA in the green microalga Chlamydomonas reinhardtii. Two different constructs, which target different positions on the mRNA of stearoyl-ACP desaturase, were tested.

  8. Processing of abasic DNA clusters in hApeI-silenced primary ...

    Indian Academy of Sciences (India)

    Eagle Medium; DSB, double-strand break; DTT, dithiothreitol; EDTA, ethylenediaminetetraacetic acid; HEPES, .... #3 to be used for RNA-silencing experiments. ..... and HeLa cells (Fantini et al. 2008). Although a non-viral- mediated approach is effective for ApeI RNA interference experiments involving cancer cell lines, there ...

  9. IL-2 induction of IL-1 beta mRNA expression in monocytes. Regulation by agents that block second messenger pathways

    DEFF Research Database (Denmark)

    Kovacs, E J; Brock, B; Varesio, L

    1989-01-01

    beta mRNA could be directly induced in purified human monocytes by treatment with Il-2 and, if so, to analyze the second messenger pathways by which it may be controlled. Human monocytes do not spontaneously express IL-1 beta mRNA, but can express the gene as soon as 1 h after treatment with IL-2...

  10. The effects of age-in-block on RNA-seq analysis of archival formalin-fixed paraffin-embedded (FFPE) samples

    Science.gov (United States)

    Archival samples represent a vast resource for identification of chemical and pharmaceutical targets. Previous use of formalin-fixed paraffin-embedded (FFPE) samples has been limited due to changes in RNA introduced by fixation and embedding procedures. Recent advances in RNA-seq...

  11. Branched RNA: A New Architecture for RNA Interference

    Directory of Open Access Journals (Sweden)

    Anna Aviñó

    2011-01-01

    Full Text Available Branched RNAs with two and four strands were synthesized. These structures were used to obtain branched siRNA. The branched siRNA duplexes had similar inhibitory capacity as those of unmodified siRNA duplexes, as deduced from gene silencing experiments of the TNF-α protein. Branched RNAs are considered novel structures for siRNA technology, and they provide an innovative tool for specific gene inhibition. As the method described here is compatible with most RNA modifications described to date, these compounds may be further functionalized to obtain more potent siRNA derivatives and can be attached to suitable delivery systems.

  12. Transcription-dependent silencing of inducible convergent transgenes in transgenic mice

    Directory of Open Access Journals (Sweden)

    Calero-Nieto Fernando J

    2010-01-01

    Full Text Available Abstract Background Silencing of transgenes in mice is a common phenomenon typically associated with short multi-copy transgenes. We have investigated the regulation of the highly inducible human granulocyte-macrophage colony-stimulating-factor gene (Csf2 in transgenic mice. Results In the absence of any previous history of transcriptional activation, this transgene was expressed in T lineage cells at the correct inducible level in all lines of mice tested. In contrast, the transgene was silenced in a specific subset of lines in T cells that had encountered a previous episode of activation. Transgene silencing appeared to be both transcription-dependent and mediated by epigenetic mechanisms. Silencing was accompanied by loss of DNase I hypersensitive sites and inability to recruit RNA polymerase II upon stimulation. This pattern of silencing was reflected by increased methylation and decreased acetylation of histone H3 K9 in the transgene. We found that silenced lines were specifically associated with a single pair of tail-to-tail inverted repeated copies of the transgene embedded within a multi-copy array. Conclusions Our study suggests that epigenetic transgene silencing can result from convergent transcription of inverted repeats which can lead to silencing of an entire multi-copy transgene array. This mechanism may account for a significant proportion of the reported cases of transgene inactivation in mice.

  13. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

    Science.gov (United States)

    Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E

    2014-02-21

    Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

  14. Scavenger receptors in human airway epithelial cells: role in response to double-stranded RNA.

    Directory of Open Access Journals (Sweden)

    Audrey Dieudonné

    Full Text Available Scavenger receptors and Toll-like receptors (TLRs cooperate in response to danger signals to adjust the host immune response. The TLR3 agonist double stranded (dsRNA is an efficient activator of innate signalling in bronchial epithelial cells. In this study, we aimed at defining the role played by scavenger receptors expressed by bronchial epithelial cells in the control of the innate response to dsRNA both in vitro and in vivo. Expression of several scavenger receptor involved in pathogen recognition was first evaluated in human bronchial epithelial cells in steady-state and inflammatory conditions. Their implication in the uptake of dsRNA and the subsequent cell activation was evaluated in vitro by competition with ligand of scavenger receptors including maleylated ovalbumin and by RNA silencing. The capacity of maleylated ovalbumin to modulate lung inflammation induced by dsRNA was also investigated in mice. Exposure to tumor necrosis factor-α increased expression of the scavenger receptors LOX-1 and CXCL16 and the capacity to internalize maleylated ovalbumin, whereas activation by TLR ligands did not. In contrast, the expression of SR-B1 was not modulated in these conditions. Interestingly, supplementation with maleylated ovalbumin limited dsRNA uptake and inhibited subsequent activation of bronchial epithelial cells. RNA silencing of LOX-1 and SR-B1 strongly blocked the dsRNA-induced cytokine production. Finally, administration of maleylated ovalbumin in mice inhibited the dsRNA-induced infiltration and activation of inflammatory cells in bronchoalveolar spaces and lung draining lymph nodes. Together, our data characterize the function of SR-B1 and LOX-1 in bronchial epithelial cells and their implication in dsRNA-induced responses, a finding that might be relevant during respiratory viral infections.

  15. The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

    Directory of Open Access Journals (Sweden)

    Logan M. Decker

    2017-04-01

    Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

  16. Communicative Silences: Forms and Functions

    Science.gov (United States)

    Bruneau, Thomas J.

    1973-01-01

    The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

  17. Silence in the creative process

    Directory of Open Access Journals (Sweden)

    Francesco Wilhelm

    2015-01-01

    Full Text Available A research about silence as the moment where creative thinking takes place, as an art object and as a way of interpreting artworks, is the main issue of the graduation thesis named Il silenzio nel processo creativo (2014. Here is proposed an offprint, which summarizes its fundamental steps.

  18. The silence of the archive

    CERN Document Server

    Thomas, David; Thomas, David

    2017-01-01

    This new book will provide a ground breaking discussion of a major but little considered issue - the silence of the archive: why archives, sometimes seen as the repositories of truth, often fail to satisfy users because they do not contain information which they expect to find.

  19. Blocking miRNA Biogenesis in Adult Forebrain Neurons Enhances Seizure Susceptibility, Fear Memory, and Food Intake by Increasing Neuronal Responsiveness.

    Science.gov (United States)

    Fiorenza, Anna; Lopez-Atalaya, Jose P; Rovira, Victor; Scandaglia, Marilyn; Geijo-Barrientos, Emilio; Barco, Angel

    2016-04-01

    The RNase Dicer is essential for the maturation of most microRNAs, a molecular system that plays an essential role in fine-tuning gene expression. To gain molecular insight into the role of Dicer and the microRNA system in brain function, we conducted 2 complementary RNA-seq screens in the hippocampus of inducible forebrain-restricted Dicer1 mutants aimed at identifying the microRNAs primarily affected by Dicer loss and their targets, respectively. Functional genomics analyses predicted the main biological processes and phenotypes associated with impaired microRNA maturation, including categories related to microRNA biology, signal transduction, seizures, and synaptic transmission and plasticity. Consistent with these predictions, we found that, soon after recombination, Dicer-deficient mice exhibited an exaggerated seizure response, enhanced induction of immediate early genes in response to different stimuli, stronger and more stable fear memory, hyperphagia, and increased excitability of CA1 pyramidal neurons. In the long term, we also observed slow and progressive excitotoxic neurodegeneration. Overall, our results indicate that interfering with microRNA biogenesis causes an increase in neuronal responsiveness and disrupts homeostatic mechanisms that protect the neuron against overactivation, which may explain both the initial and late phenotypes associated with the loss of Dicer in excitatory neurons. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Breaching cultural silence: enhancing resilience among Ugandan ...

    African Journals Online (AJOL)

    Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

  1. AMFR gene silencing inhibits the differentiation of porcine preadipocytes.

    Science.gov (United States)

    Chen, C Z; Zhu, Y N; Chai, M L; Dai, L S; Gao, Y; Jiang, H; Zhang, L J; Ding, Y; Liu, S Y; Li, Q Y; Lu, W F; Zhang, J B

    2016-04-07

    Our study clarifies the role of the autocrine motility factor receptor (AMFR) gene in porcine preadipocyte differentiation. AMFR-siRNA was transfected into porcine preadipocytes and the preadipocytes were induced to differentiation. Subsequently, qRT-PCR was conducted to examine changes in mRNA expression of a series of genes in porcine preadipocytes, including AMFR, sterol-regulatory element-binding protein-1a (SREBP1a), SREBP2, insulin-induced gene 1 (Insig1), and Insig2. Expression changes in the mRNA of genes regulating adipocyte differentiation were also analyzed using qRT-PCR, including peroxisome proliferator-activated receptor gamma (PPARγ), CCAAT/enhancer-binding protein alpha (C/EBPα), and Kruppel-like factor 2 (KLF2). Western blot analysis was conducted to examine the changes in AMFR protein expression in porcine preadipocytes. Additionally, morphological changes in differentiated porcine preadipocytes were examined by oil red O staining, and changes in optical density (OD) values were measured using an ultraviolet spectrophotometer. At 24 h after transfection with AMFR-siRNA, AMFR mRNA expression significantly reduced (P SREBP1a, SREBP2, Insig1, and C/EBPα was significantly reduced (P < 0.01), whereas the expression of KLF2 mRNA was significantly elevated (P < 0.01). After induction of preadipocyte differentiation, the number of lipid droplets decreased in the AMFR-silenced group, and the OD value markedly reduced (P < 0.05). In addition, the expression of C/EBPα mRNA significantly decreased (P < 0.05), whereas the expression of KLF2 mRNA considerably increased (P < 0.05). Taken together, silencing of the AMFR gene inhibits the differentiation of porcine preadipocytes.

  2. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.

    Science.gov (United States)

    Velásquez, André C; Chakravarthy, Suma; Martin, Gregory B

    2009-06-10

    RNA interference (RNAi) is a highly specific gene-silencing phenomenon triggered by dsRNA. This silencing mechanism uses two major classes of RNA regulators: microRNAs, which are produced from non-protein coding genes and short interfering RNAs (siRNAs). Plants use RNAi to control transposons and to exert tight control over developmental processes such as flower organ formation and leaf development. Plants also use RNAi to defend themselves against infection by viruses. Consequently, many viruses have evolved suppressors of gene silencing to allow their successful colonization of their host. Virus-induced gene silencing (VIGS) is a method that takes advantage of the plant RNAi-mediated antiviral defense mechanism. In plants infected with unmodified viruses the mechanism is specifically targeted against the viral genome. However, with virus vectors carrying sequences derived from host genes, the process can be additionally targeted against the corresponding host mRNAs. VIGS has been adapted for high-throughput functional genomics in plants by using the plant pathogen Agrobacterium tumefaciens to deliver, via its Ti plasmid, a recombinant virus carrying the entire or part of the gene sequence targeted for silencing. Systemic virus spread and the endogenous plant RNAi machinery take care of the rest. dsRNAs corresponding to the target gene are produced and then cleaved by the ribonuclease Dicer into siRNAs of 21 to 24 nucleotides in length. These siRNAs ultimately guide the RNA-induced silencing complex (RISC) to degrade the target transcript. Different vectors have been employed in VIGS and one of the most frequently used is based on tobacco rattle virus (TRV). TRV is a bipartite virus and, as such, two different A. tumefaciens strains are used for VIGS. One carries pTRV1, which encodes the replication and movement viral functions while the other, pTRV2, harbors the coat protein and the sequence used for VIGS. Inoculation of Nicotiana benthamiana and tomato seedlings

  3. Plasma hydrogenated cationic detonation nanodiamonds efficiently deliver to human cells in culture functional siRNA targeting the Ewing sarcoma junction oncogene.

    Science.gov (United States)

    Bertrand, Jean-Rémi; Pioche-Durieu, Catherine; Ayala, Juan; Petit, Tristan; Girard, Hugues A; Malvy, Claude P; Le Cam, Eric; Treussart, François; Arnault, Jean-Charles

    2015-03-01

    The expression of a defective gene can lead to major cell dysfunctions among which cell proliferation and tumor formation. One promising therapeutic strategy consists in silencing the defective gene using small interfering RNA (siRNA). In previous publications we showed that diamond nanocrystals (ND) of primary size 35 nm, rendered cationic by polyethyleneimine-coating, can efficiently deliver siRNA into cell, which further block the expression of EWS/FLI-1 oncogene in a Ewing sarcoma disease model. However, a therapeutic application of such nanodiamonds requires their elimination by the organism, particularly in urine, which is impossible for 35 nm particles. Here, we report that hydrogenated cationic nanodiamonds of primary size 7 nm (ND-H) have also a high affinity for siRNA and are capable of delivering them in cells. With siRNA/ND-H complexes, we measured a high inhibition efficacy of EWS/FLI-1 gene expression in Ewing sarcoma cell line. Electron microscopy investigations showed ND-H in endocytosis compartments, and especially in macropinosomes from which they can escape before siRNA degradation occurred. In addition, the association of EWS/FLI-1 silencing by the siRNA/ND-H complex with a vincristine treatment yielded a potentiation of the toxic effect of this chemotherapeutic drug. Therefore ND-H appears as a promising delivery agent in anti-tumoral gene therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    Although retroviral vector systems have been found to efficiently transduce a variety of cell types in vitro, the use of vectors based on murine leukemia virus in preclinical models of somatic gene therapy has led to the identification of transcriptional silencing in vivo as an important problem....... Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t...

  5. MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans

    NARCIS (Netherlands)

    Correa, R.L.; Steiner, F.A.; Berezikov, E.; Ketting, R.F.

    2010-01-01

    RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the

  6. Transforming growth factor-betas block cytokine induction of catalase and xanthine oxidase mRNA levels in cultured rat cardiac cells.

    Science.gov (United States)

    Flanders, K C; Bhandiwad, A R; Winokur, T S

    1997-01-01

    We examined the effects of transforming growth factor-beta (TGF-beta) on the mRNA expression of the antioxidative enzymes, catalase, manganese superoxide dismutase (MnSOD), and copper-zinc superoxide dismutase (CuZnSOD), as well as the oxidative enzyme, xanthine oxidase (XO), in cultures of cardiomyocytes, cardiac non-myocytes, and fetal bovine heart endothelial cells. TGF-betas alone had little effect on expression of these enzymes, but treatment with a combination of interleukin-1beta, interferon-gamma, and tumor necrosis factor-alpha increased expression of MnSOD, catalase, and XO in some cell types with little effect on CuZnSOD expression. When TGF-betas were added along with these inflammatory cytokines there was a return to control levels of catalase expression, as well as a dramatic reduction in XO expression. In fetal bovine heart endothelial cells, treatment with inflammatory cytokines increased XO mRNA expression 11.5-fold and inclusion of TGF-betas reduced this 4-5-fold: effects on XO enzyme activity paralleled those seen on mRNA expression. Similar changes in XO expression were seen in cardiomyocytes. In contrast, TGF-betas did not change cytokine-induced MnSOD expression. All three mammalian isoforms of TGF-beta showed similar effects. In summary, TGF-betas may be able to decrease superoxide anion production and subsequent tissue damage by decreasing levels of XO.

  7. Population Blocks.

    Science.gov (United States)

    Smith, Martin H.

    1992-01-01

    Describes an educational game called "Population Blocks" that is designed to illustrate the concept of exponential growth of the human population and some potential effects of overpopulation. The game material consists of wooden blocks; 18 blocks are painted green (representing land), 7 are painted blue (representing water); and the remaining…

  8. Transcriptionally Silenced Transgenes in Maize Are Activated by Three Mutations Defective in Paramutation

    Science.gov (United States)

    McGinnis, Karen M.; Springer, Catherine; Lin, Yan; Carey, Charles C.; Chandler, Vicki

    2006-01-01

    Plants with mutations in one of three maize genes, mop1, rmr1, and rmr2, are defective in paramutation, an allele-specific interaction that leads to meiotically heritable chromatin changes. Experiments reported here demonstrate that these genes are required to maintain the transcriptional silencing of two different transgenes, suggesting that paramutation and transcriptional silencing of transgenes share mechanisms. We hypothesize that the transgenes are silenced through an RNA-directed chromatin mechanism, because mop1 encodes an RNA-dependent RNA polymerase. In all the mutants, DNA methylation was reduced in the active transgenes relative to the silent transgenes at all of the CNG sites monitored within the transgene promoter. However, asymmetrical methylation persisted at one site within the reactivated transgene in the rmr1-1 mutant. With that one mutant, rmr1-1, the transgene was efficiently resilenced upon outcrossing to reintroduce the wild-type protein. In contrast, with the mop1-1 and rmr2-1 mutants, the transgene remained active in a subset of progeny even after the wild-type proteins were reintroduced by outcrossing. Interestingly, this immunity to silencing increased as the generations progressed, consistent with a heritable chromatin state being formed at the transgene in plants carrying the mop1-1 and rmr2-1 mutations that becomes more resistant to silencing in subsequent generations. PMID:16702420

  9. Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

    Directory of Open Access Journals (Sweden)

    Jiexiong Feng

    Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

  10. Specific tandem repeats are sufficient for paramutation-induced trans-generational silencing.

    Directory of Open Access Journals (Sweden)

    Christiane L Belele

    Full Text Available Paramutation is a well-studied epigenetic phenomenon in which trans communication between two different alleles leads to meiotically heritable transcriptional silencing of one of the alleles. Paramutation at the b1 locus involves RNA-mediated transcriptional silencing and requires specific tandem repeats that generate siRNAs. This study addressed three important questions: 1 are the tandem repeats sufficient for paramutation, 2 do they need to be in an allelic position to mediate paramutation, and 3 is there an association between the ability to mediate paramutation and repeat DNA methylation levels? Paramutation was achieved using multiple transgenes containing the b1 tandem repeats, including events with tandem repeats of only one half of the repeat unit (413 bp, demonstrating that these sequences are sufficient for paramutation and an allelic position is not required for the repeats to communicate. Furthermore, the transgenic tandem repeats increased the expression of a reporter gene in maize, demonstrating the repeats contain transcriptional regulatory sequences. Transgene-mediated paramutation required the mediator of paramutation1 gene, which is necessary for endogenous paramutation, suggesting endogenous and transgene-mediated paramutation both require an RNA-mediated transcriptional silencing pathway. While all tested repeat transgenes produced small interfering RNAs (siRNAs, not all transgenes induced paramutation suggesting that, as with endogenous alleles, siRNA production is not sufficient for paramutation. The repeat transgene-induced silencing was less efficiently transmitted than silencing induced by the repeats of endogenous b1 alleles, which is always 100% efficient. The variability in the strength of the repeat transgene-induced silencing enabled testing whether the extent of DNA methylation within the repeats correlated with differences in efficiency of paramutation. Transgene-induced paramutation does not require extensive

  11. V2 from a curtovirus is a suppressor of post-transcriptional gene silencing.

    Science.gov (United States)

    Luna, Ana P; Rodríguez-Negrete, Edgar A; Morilla, Gabriel; Wang, Liping; Lozano-Durán, Rosa; Castillo, Araceli G; Bejarano, Eduardo R

    2017-10-01

    The suppression of gene silencing is a key mechanism for the success of viral infection in plants. DNA viruses from the Geminiviridae family encode several proteins that suppress transcriptional and post-transcriptional gene silencing (TGS/PTGS). In Begomovirus, the most abundant genus of this family, three out of six genome-encoded proteins, namely C2, C4 and V2, have been shown to suppress PTGS, with V2 being the strongest PTGS suppressor in transient assays. Beet curly top virus (BCTV), the model species for the Curtovirus genus, is able to infect the widest range of plants among geminiviruses. In this genus, only one protein, C2/L2, has been described as inhibiting PTGS. We show here that, despite the lack of sequence homology with its begomoviral counterpart, BCTV V2 acts as a potent PTGS suppressor, possibly by impairing the RDR6 (RNA-dependent RNA polymerase 6)/suppressor of gene silencing 3 (SGS3) pathway.

  12. Long Double-Stranded Multiplex siRNAs for Dual Genes Silencing

    Science.gov (United States)

    Peng, Wei; Chen, Jianxin; Qin, Yinchao; Yang, Zhenjun

    2013-01-01

    Simultaneous suppression of multiple oncogenes is an attractive strategy to treat cancers. Herein we present a series of long double-stranded multiplex small interfering RNAs (multi-siRNAs) that is suitable for dual genes silencing through a sequence-specific RNA interference process without inducing significant immune responses. A gap feature structurally designed in either of the nucleotide strands of the multi-siRNAs was proved to be essential toward silencing target genes and avoiding immune responses. Furthermore, the silencing effect of multi-siRNAs against SURVIVIN and BCL-2 genes was shown to be effective and resulted in up-regulation of caspase-3 related apoptosis and, in turn, inhibition of bladder cancer cell proliferation. Our observation suggested that the rationally designed multi-siRNAs would have great potential for therapeutic siRNA design. PMID:23656495

  13. The Caenorhabditis elegans RDE-10/RDE-11 complex regulates RNAi by promoting secondary siRNA amplification

    NARCIS (Netherlands)

    Zhang, Chi; Montgomery, Taiowa A; Fischer, Sylvia E J; Garcia, Susana M D A; Riedel, Christian G; Fahlgren, Noah; Sullivan, Christopher M; Carrington, James C; Ruvkun, Gary

    2012-01-01

    BACKGROUND: In nematodes, plants, and fungi, RNAi is remarkably potent and persistent due to the amplification of initial silencing signals by RNA-dependent RNA polymerases (RdRPs). In Caenorhabditis elegans (C. elegans), the interaction between the RNA-induced silencing complex (RISC) loaded with

  14. RNA Interference - Towards RNA becoming a Medicine -42 ...

    Indian Academy of Sciences (India)

    RN Ai in Therapeutics and Research. RNAi possesses great potential as a therapeutic agent by its virtue to silence genes. Many diseases are being targeted, like. AIDS, tumors, Hepatitis C, Malaria, Polio to name a few. Inacti- vation of critical proteins involved in pathogenesis is the prin- ciple use of siRNA. In case of AIDS, ...

  15. [E. M. Jellinek's silenced and silencing transgenerational story].

    Science.gov (United States)

    Kelemen, Gábor; Márk, Mónika

    2013-01-01

    Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

  16. Cucumber mosaic virus coat protein modulates the accumulation of 2b protein and antiviral silencing that causes symptom recovery in planta.

    Directory of Open Access Journals (Sweden)

    Xiao-Peng Zhang

    2017-07-01

    Full Text Available Shoot apical meristems (SAM are resistant to most plant viruses due to RNA silencing, which is restrained by viral suppressors of RNA silencing (VSRs to facilitate transient viral invasion of the SAM. In many cases chronic symptoms and long-term virus recovery occur, but the underlying mechanisms are poorly understood. Here, we found that wild-type Cucumber mosaic virus (CMVWT invaded the SAM transiently, but was subsequently eliminated from the meristems. Unexpectedly, a CMV mutant, designated CMVRA that harbors an alanine substitution in the N-terminal arginine-rich region of the coat protein (CP persistently invaded the SAM and resulted in visible reductions in apical dominance. Notably, the CMVWT virus elicited more potent antiviral silencing than CMVRA in newly emerging leaves of infected plants. However, both viruses caused severe symptoms with minimal antiviral silencing effects in the Arabidopsis mutants lacking host RNA-DEPENDENT RNA POLYMERASE 6 (RDR6 or SUPPRESSOR OF GENE SILENCING 3 (SGS3, indicating that CMVWT induced host RDR6/SGS3-dependent antiviral silencing. We also showed that reduced accumulation of the 2b protein is elicited in the CMVWT infection and consequently rescues potent antiviral RNA silencing. Indeed, co-infiltration assays showed that the suppression of posttranscriptional gene silencing mediated by 2b is more severely compromised by co-expression of CPWT than by CPRA. We further demonstrated that CPWT had high RNA binding activity leading to translation inhibition in wheat germ systems, and CPWT was associated with SGS3 into punctate granules in vivo. Thus, we propose that the RNAs bound and protected by CPWT possibly serve as templates of RDR6/SGS3 complexes for siRNA amplification. Together, these findings suggest that the CMV CP acts as a central hub that modulates antiviral silencing and VSRs activity, and mediates viral self-attenuation and long-term symptom recovery.

  17. Silence

    Science.gov (United States)

    Cogswell, J.

    2011-06-01

    On the occasion of the International Year of Astronomy, I was commissioned to create a mural for the University of Michigan Department of Astronomy, responding to an array of scientific images based on astronomical research, with special focus on the work of University of Michigan astronomers carried out within the building. My paper illustrates the development of this and several subsequent projects, explaining the implications for my artistic practice of entering into this conversation with astronomers and their work.

  18. Bidirectional transfer of RNAi between honey bee and Varroa destructor: Varroa gene silencing reduces Varroa population.

    Directory of Open Access Journals (Sweden)

    Yael Garbian

    2012-12-01

    Full Text Available The mite Varroa destructor is an obligatory ectoparasite of the honey bee (Apis mellifera and is one of the major threats to apiculture worldwide. We previously reported that honey bees fed on double-stranded RNA (dsRNA with a sequence homologous to that of the Israeli acute paralysis virus are protected from the viral disease. Here we show that dsRNA ingested by bees is transferred to the Varroa mite and from mite on to a parasitized bee. This cross-species, reciprocal exchange of dsRNA between bee and Varroa engendered targeted gene silencing in the latter, and resulted in an over 60% decrease in the mite population. Thus, transfer of gene-silencing-triggering molecules between this invertebrate host and its ectoparasite could lead to a conceptually novel approach to Varroa control.

  19. Bidirectional transfer of RNAi between honey bee and Varroa destructor: Varroa gene silencing reduces Varroa population.

    Science.gov (United States)

    Garbian, Yael; Maori, Eyal; Kalev, Haim; Shafir, Sharoni; Sela, Ilan

    2012-12-01

    The mite Varroa destructor is an obligatory ectoparasite of the honey bee (Apis mellifera) and is one of the major threats to apiculture worldwide. We previously reported that honey bees fed on double-stranded RNA (dsRNA) with a sequence homologous to that of the Israeli acute paralysis virus are protected from the viral disease. Here we show that dsRNA ingested by bees is transferred to the Varroa mite and from mite on to a parasitized bee. This cross-species, reciprocal exchange of dsRNA between bee and Varroa engendered targeted gene silencing in the latter, and resulted in an over 60% decrease in the mite population. Thus, transfer of gene-silencing-triggering molecules between this invertebrate host and its ectoparasite could lead to a conceptually novel approach to Varroa control.

  20. Arctiin blocks hydrogen peroxide-induced senescence and cell death though microRNA expression changes in human dermal papilla cells

    Directory of Open Access Journals (Sweden)

    Seunghee Bae

    2014-01-01

    Full Text Available BACKGROUND: Accumulating evidence indicates that reactive oxygen species (ROS are an important etiological factor for the induction of dermal papilla cell senescence and hair loss, which is also known alopecia. Arctiin is an active lignin isolated from Arctium lappa and has anti-inflammation, anti-microbial, and anti-carcinogenic effects. In the present study, we found that arctiin exerts anti-oxidative effects on human hair dermal papilla cells (HHDPCs. RESULTS: To better understand the mechanism, we analyzed the level of hydrogen peroxide (H2O2-induced cytotoxicity, cell death, ROS production and senescence after arctiin pretreatment of HHDPCs. The results showed that arctiin pretreatment significantly inhibited the H2O2-induced reduction in cell viability. Moreover, H2O2-induced sub-G1 phase accumulation and G2 cell cycle arrest were also downregulated by arctiin pretreatment. Interestingly, the increase in intracellular ROS mediated by H2O2 was drastically decreased in HHDPCs cultured in the presence of arctiin. This effect was confirmed by senescence associated-beta galactosidase (SA-β-gal assay results; we found that arctiin pretreatment impaired H2O2-induced senescence in HHDPCs. Using microRNA (miRNA microarray and bioinformatic analysis, we showed that this anti-oxidative effect of arctiin in HHDPCs was related with mitogen-activated protein kinase (MAPK and Wnt signaling pathways. CONCLUSIONS: Taken together, our data suggest that arctiin has a protective effect on ROS-induced cell dysfunction in HHDPCs and may therefore be useful for alopecia prevention and treatment strategies.

  1. Surface functionalisation of PLGA nanoparticles for gene silencing

    DEFF Research Database (Denmark)

    Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

    2010-01-01

    . In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles.......This work presents a method for decorating the surface of poly (lactide-co-glycolide) (PLGA) nanoparticles with polyethyleneimine (PEI) utilising a cetyl derivative to improve surface functionalisation and siRNA delivery. Sub-micron particles were produced by an emulsion-diffusion method using...

  2. Development of male sterility by silencing Bcp1 gene of Arabidopsis ...

    African Journals Online (AJOL)

    The development of male sterility is one of the most important steps in hybrid seed production. Several methods for the abortion of pollens based on conventional as well as genetic engineering are reported for the various crop species. Here we have investigated the use of RNA interference (RNAi) technology to silence a ...

  3. [Effects of Sam68 gene silence on proliferation of acute T lymphoblastic leukemia cell line Jurkat].

    Science.gov (United States)

    Wang, Chi-Juan; Xu, Hua; Zhang, Hai-Rui; Wang, Jian; Lin, Ya-Ni; Pang, Tian-Xiang; Li, Qing-Hua

    2014-08-01

    This study was purpose to investigate the effect of Sam68 gene silence on proliferation of human acute T lymphoblastic leukemia cell line Jurkat. The sequence of shRNA targeting the site 531-552 of Sam68 mRNA was designed and chemically synthesized, then a single-vector lentiviral, Tet-inducible shRNA-Sam68 system (pLKO-Tet-On) was constructed; next the Jurkat cells were infected with lentivirus to create stable cell clones with regulatable Sam68 gene expression. The inhibitory efficiency of Sam68 gene was assayed by Real-time PCR and Western blot; the cell activity of Jurkat cells was detected with MTT assay; the change of colony forming potential of Jurkat cells was analyzed by colony forming test; the cell cycle distribution was tested by flow cytometry. The results indicated that the expression of Sam68 in experimental cells was statistically decreased as compared with that of the control cells; the cells activity and colony forming capacity of the Jurkat cells with Sam68 gene silence were significantly inhibited; with Sam68 gene silencing, the percentage of S phase cells was significantly increased, while the percentage of G2 phase cells was significantly decreased. It is concluded that the silencing Sam68 gene using shRNA interference can effectively inhibit the proliferation of human acute T lymphoblastic leukemia cell line Jurkat.

  4. Silencing honey bee naked cuticle (nkd) reduces Nosema ceranae replication and disease levels

    Science.gov (United States)

    Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera that has been implicated in alarming colony losses worldwide. RNA interference (RNAi), a post-transcriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling in...

  5. Small RNA Deep Sequencing Reveals Role for Arabidopsis thaliana RNA-Dependent RNA Polymerases in Viral siRNA Biogenesis

    OpenAIRE

    Qi, Xiaopeng; Bao, Forrest Sheng; Xie, Zhixin

    2009-01-01

    RNA silencing functions as an important antiviral defense mechanism in a broad range of eukaryotes. In plants, biogenesis of several classes of endogenous small interfering RNAs (siRNAs) requires RNA-dependent RNA Polymerase (RDR) activities. Members of the RDR family proteins, including RDR1and RDR6, have also been implicated in antiviral defense, although a direct role for RDRs in viral siRNA biogenesis has yet to be demonstrated. Using a crucifer-infecting strain of Tobacco Mosaic Virus (T...

  6. "The Silence Itself Is Enough of a Statement": The Day of Silence and LGBTQ Awareness Raising

    Science.gov (United States)

    Woolley, Susan W.

    2012-01-01

    This ethnographic study of a high school gay-straight alliance club examines unintended consequences of silence during the Day of Silence, a day of action aimed at addressing anti-LGBTQ bias in schools. While this strategy calls for students to engage in intentional silences to raise awareness of anti-LGBTQ bias, it does not necessarily lead…

  7. Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

    2011-11-01

    Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

  8. RNA interference against viruses: strike and counterstrike

    NARCIS (Netherlands)

    Haasnoot, Joost; Westerhout, Ellen M.; Berkhout, Ben

    2007-01-01

    RNA interference (RNAi) is a conserved sequence-specific, gene-silencing mechanism that is induced by double-stranded RNA. RNAi holds great promise as a novel nucleic acid-based therapeutic against a wide variety of diseases, including cancer, infectious diseases and genetic disorders. Antiviral

  9. The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

    Science.gov (United States)

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

    2013-12-23

    Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

  10. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recrui...

  11. An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

    Science.gov (United States)

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

  12. An ImprovedBrome mosaic virusSilencing Vector: Greater Insert Stability and More Extensive VIGS.

    Science.gov (United States)

    Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

  13. Position-Dependent Methylation and Transcriptional Silencing of Transgenes in Inverted T-DNA Repeats: Implications for Posttranscriptional Silencing of Homologous Host Genes in Plants

    Science.gov (United States)

    Stam, Maike; Viterbo, Ada; Mol, Joseph N. M.; Kooter, Jan M.

    1998-01-01

    Posttranscriptional silencing of chalcone synthase (Chs) genes in petunia transformants occurs by introducing T-DNAs that contain a promoter-driven or promoterless Chs transgene. With the constructs we used, silencing occurs only by T-DNA loci which are composed of two or more T-DNA copies that are arranged as inverted repeats (IRs). Since we are interested in the mechanism by which these IR loci induce silencing, we have analyzed different IR loci and nonsilencing single-copy (S) T-DNA loci with respect to the expression and methylation of the transgenes residing in these loci. We show that in an IR locus, the transgenes located proximal to the IR center are much more highly methylated than are the distal genes. A strong silencing locus composed of three inverted T-DNAs bearing promoterless Chs transgenes was methylated across the entire locus. The host Chs genes in untransformed plants were moderately methylated, and no change in methylation was detected when the genes were silenced. Run-on transcription assays showed that promoter-driven transgenes located proximal to the center of a particular IR are transcriptionally more repressed than are the distal genes of the same IR locus. Transcription of the promoterless Chs transgenes could not be detected. In the primary transformant, some of the IR loci were detected together with an unlinked S locus. We observed that the methylation and expression characteristics of the transgenes of these S loci were comparable to those of the partner IR loci, suggesting that there has been cross talk between the two types of loci. Despite the similar features, S loci are unable to induce silencing, indicating that the palindromic arrangement of the Chs transgenes in the IR loci is critical for silencing. Since transcriptionally silenced transgenes in IRs can trigger posttranscriptional silencing of the host genes, our data are most consistent with a model of silencing in which the transgenes physically interact with the

  14. Cytokine-dependent and–independent gene expression changes and cell cycle block revealed in Trypanosoma cruzi-infected host cells by comparative mRNA profiling

    Directory of Open Access Journals (Sweden)

    Burleigh Barbara A

    2009-05-01

    Full Text Available Abstract Background The requirements for growth and survival of the intracellular pathogen Trypanosoma cruzi within mammalian host cells are poorly understood. Transcriptional profiling of the host cell response to infection serves as a rapid read-out for perturbation of host physiology that, in part, reflects adaptation to the infective process. Using Affymetrix oligonucleotide array analysis we identified common and disparate host cell responses triggered by T. cruzi infection of phenotypically diverse human cell types. Results We report significant changes in transcript abundance in T. cruzi-infected fibroblasts, endothelial cells and smooth muscle cells (2852, 2155 and 531 genes respectively; fold-change ≥ 2, p-value T. cruzi-infected fibroblasts and endothelial cells transwell plates were used to distinguish cytokine-dependent and -independent gene expression profiles. This approach revealed the induction of metabolic and signaling pathways involved in cell proliferation, amino acid catabolism and response to wounding as common themes in T. cruzi-infected cells. In addition, the downregulation of genes involved in mitotic cell cycle and cell division predicted that T. cruzi infection may impede host cell cycle progression. The observation of impaired cytokinesis in T. cruzi-infected cells, following nuclear replication, confirmed this prediction. Conclusion Metabolic pathways and cellular processes were identified as significantly altered at the transcriptional level in response to T. cruzi infection in a cytokine-independent manner. Several of these alterations are supported by previous studies of T. cruzi metabolic requirements or effects on the host. However, our methods also revealed a T. cruzi-dependent block in the host cell cycle, at the level of cytokinesis, previously unrecognized for this pathogen-host cell interaction.

  15. Identification and validation of a virus-inducible ta-siRNA-generating ...

    Indian Academy of Sciences (India)

    2016-02-01

    Feb 1, 2016 ... Trans-acting small interfering RNAs (ta-siRNAs) are a class of endogenous small RNA, associated with post- transcriptional gene silencing. Their biogenesis requires an initial microRNA (miRNA)-mediated cleavage of precur- sor RNA. Around 20 different ta-siRNA-producing loci (TASs), whose sequences ...

  16. In Vivo Imaging of RNA Interference

    OpenAIRE

    Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    RNA interference (RNAi), an effective technique for regulating/silencing specific genes, can be applied to treat various diseases. Multiple clinical trials using RNAi are ongoing and molecular imaging can serve as a powerful tool in RNAi-based therapies. This brief review will highlight the current progress on in vivo imaging of RNAi delivery and silencing effects. Incorporation of suitable molecular imaging techniques into future RNAi-based clinical trials will provide more pieces of the puz...

  17. Suppressors of RNA silencing encoded by tomato leaf curl

    Indian Academy of Sciences (India)

    Whitefly-transmitted begomoviruses infecting tomato crop code for five different proteins, ORF AC4, ORF AC2 and ORF AV2 in DNA-A component, ORF BV1 in DNA-B ... In the present study suppressor function of ORF C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl ...

  18. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...

  19. Exon silencing by UAGG motifs in response to neuronal excitation.

    Directory of Open Access Journals (Sweden)

    Ping An

    2007-02-01

    Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.

  20. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2004-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  1. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2005-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  2. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2006-01-01

    ...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

  3. Silencing of Hsp27 and Hsp72 in glioma cells as a tool for programmed cell death induction upon temozolomide and quercetin treatment

    Energy Technology Data Exchange (ETDEWEB)

    Jakubowicz-Gil, Joanna, E-mail: jjgil@poczta.umcs.lublin.pl [Department of Comparative Anatomy and Anthropology, Maria Curie-Sklodowska University, Akademicka 19, 20-033 Lublin (Poland); Langner, Ewa [Department of Medical Biology, Institute of Agricultural Medicine, Jaczewskiego 2, 20-950 Lublin (Poland); Bądziul, Dorota [Department of Comparative Anatomy and Anthropology, Maria Curie-Sklodowska University, Akademicka 19, 20-033 Lublin (Poland); Wertel, Iwona [1st Department of Gynaecology, University School of Medicine, Staszica 16, 20-081 Lublin (Poland); Rzeski, Wojciech [Department of Medical Biology, Institute of Agricultural Medicine, Jaczewskiego 2, 20-950 Lublin (Poland); Department of Immunology and Virology, Maria Curie-Sklodowska University, Akademicka 19, 20-033 Lublin (Poland)

    2013-12-15

    The aim of the present study was to investigate whether silencing of Hsp27 or Hsp72 expression in glioblastoma multiforme T98G and anaplastic astrocytoma MOGGCCM cells increases their sensitivity to programmed cell death induction upon temozolomide and/or quercetin treatment. Transfection with specific siRNA was performed for the Hsp gene silencing. As revealed by microscopic observation and flow cytometry, the inhibition of Hsp expression was correlated with severe apoptosis induction upon the drug treatment studied. No signs of autophagy were detected. This was correlated with a decreased mitochondrial membrane potential, increased level of cytochrome c in the cytoplasm, and activation of caspase 3 and caspase 9. All these results suggest that the apoptotic signal was mediated by an internal pathway. Additionally, in a large percentage of cells treated with temozolomide, with or without quercetin, granules within the ER system were found, which was accompanied by an increased level of caspase 12 expression. This might be correlated with ER stress. Quercetin and temozolomide also changed the shape of nuclei from circular to “croissant like” in both transfected cell lines. Our results indicate that blocking of Hsp27 and Hsp72 expression makes T98G cells and MOGGCCM cells extremely vulnerable to apoptosis induction upon temozolomide and quercetin treatment and that programmed cell death is initiated by an internal signal. - Highlights: • Hsps gene silencing induced severe apoptosis upon temozolomide–quercetin treatment • Apoptosis in transfected glioma cells was initiated by internal signal • Programmed cell death was preceded by ER stress • Temozolomide–quercetin treatment changed nuclei shape in transfected glioma cells.

  4. RNAi-mediated gene silencing as a principle of action of venoms and poisons.

    Science.gov (United States)

    Pereira, Tiago Campos; Lopes-Cendes, Iscia

    2008-01-01

    RNA interference (RNAi) is a natural phenomenon in which double-stranded RNA molecules (dsRNAs) promote silencing of genes with similar sequence. It is noteworthy that in some instances the effects of gene silencing are similar to those caused by venoms and natural poisons (e.g., hemorrhage and low blood pressure). This observation raises the possibility that venomous/poisonous species in fact produce dsRNAs in their venoms/poisons and leading to the deleterious effects in the victim by RNAi-mediated gene silencing. Two approaches could be used to test this hypothesis, first, the neutralization of the dsRNAs and comparing to a non-treated venom sample; and second, to identify the dsRNA present in the venom and attempt to artificially reproduce its effects in the laboratory. In addition, we present three innovative treatment strategies for accidental interactions with venomous or poisonous species. RNAi has several roles in biological systems: gene regulation, antiviral defense, transposon silencing and heterochromatin formation. The hypothesis presented here provides a new role: a natural attack mechanism.

  5. miRNA cassettes in viral vectors: problems and solutions

    NARCIS (Netherlands)

    Liu, Ying Poi; Berkhout, Ben

    2011-01-01

    The discovery of RNA interference (RNAi), an evolutionary conserved gene silencing mechanism that is triggered by double stranded RNA, has led to tremendous efforts to use this technology for basic research and new RNA therapeutics. RNAi can be induced via transfection of synthetic small interfering

  6. Preparation and isolation of siRNA-loaded extracellular vesicles

    NARCIS (Netherlands)

    Vader, Pieter; Mäger, Imre; Lee, Yi; Nordin, Joel Z.; Andaloussi, Samir E L; Wood, Matthew J A

    2017-01-01

    RNA interference (RNAi) has tremendous potential for specific silencing of disease-causing genes. Its clinical usage however critically depends on the development of carrier systems that can transport the RNAimediating small interfering RNA (siRNA) molecules to the cytosol of target cells. Recent

  7. Pulmonary administration of small interfering RNA : The route to go?

    NARCIS (Netherlands)

    Ruigrok, Mitchel; Frijlink, Henderik W.; Hinrichs, Wouter

    2016-01-01

    Ever since the discovery of RNA interference (RNAi), which is a post-transcriptional gene silencing mechanism, researchers have been studying the therapeutic potential of using small interfering RNA (siRNA) to treat diseases that are characterized by excessive gene expression. Excessive gene

  8. Personalized gene silencing therapeutics for Huntington disease.

    Science.gov (United States)

    Kay, C; Skotte, N H; Southwell, A L; Hayden, M R

    2014-07-01

    Gene silencing offers a novel therapeutic strategy for dominant genetic disorders. In specific diseases, selective silencing of only one copy of a gene may be advantageous over non-selective silencing of both copies. Huntington disease (HD) is an autosomal dominant disorder caused by an expanded CAG trinucleotide repeat in the Huntingtin gene (HTT). Silencing both expanded and normal copies of HTT may be therapeutically beneficial, but preservation of normal HTT expression is preferred. Allele-specific methods can selectively silence the mutant HTT transcript by targeting either the expanded CAG repeat or single nucleotide polymorphisms (SNPs) in linkage disequilibrium with the expansion. Both approaches require personalized treatment strategies based on patient genotypes. We compare the prospect of safe treatment of HD by CAG- and SNP-specific silencing approaches and review HD population genetics used to guide target identification in the patient population. Clinical implementation of allele-specific HTT silencing faces challenges common to personalized genetic medicine, requiring novel solutions from clinical scientists and regulatory authorities. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Gene expression: RNA interference in adult mice

    Science.gov (United States)

    McCaffrey, Anton P.; Meuse, Leonard; Pham, Thu-Thao T.; Conklin, Douglas S.; Hannon, Gregory J.; Kay, Mark A.

    2002-07-01

    RNA interference is an evolutionarily conserved surveillance mechanism that responds to double-stranded RNA by sequence-specific silencing of homologous genes. Here we show that transgene expression can be suppressed in adult mice by synthetic small interfering RNAs and by small-hairpin RNAs transcribed in vivo from DNA templates. We also show the therapeutic potential of this technique by demonstrating effective targeting of a sequence from hepatitis C virus by RNA interference in vivo.

  10. Promotion of Hendra virus replication by microRNA 146a.

    Science.gov (United States)

    Stewart, Cameron R; Marsh, Glenn A; Jenkins, Kristie A; Gantier, Michael P; Tizard, Mark L; Middleton, Deborah; Lowenthal, John W; Haining, Jessica; Izzard, Leonard; Gough, Tamara J; Deffrasnes, Celine; Stambas, John; Robinson, Rachel; Heine, Hans G; Pallister, Jackie A; Foord, Adam J; Bean, Andrew G; Wang, Lin-Fa

    2013-04-01

    Hendra virus is a highly pathogenic zoonotic paramyxovirus in the genus Henipavirus. Thirty-nine outbreaks of Hendra virus have been reported since its initial identification in Queensland, Australia, resulting in seven human infections and four fatalities. Little is known about cellular host factors impacting Hendra virus replication. In this work, we demonstrate that Hendra virus makes use of a microRNA (miRNA) designated miR-146a, an NF-κB-responsive miRNA upregulated by several innate immune ligands, to favor its replication. miR-146a is elevated in the blood of ferrets and horses infected with Hendra virus and is upregulated by Hendra virus in human cells in vitro. Blocking miR-146a reduces Hendra virus replication in vitro, suggesting a role for this miRNA in Hendra virus replication. In silico analysis of miR-146a targets identified ring finger protein (RNF)11, a member of the A20 ubiquitin editing complex that negatively regulates NF-κB activity, as a novel component of Hendra virus replication. RNA interference-mediated silencing of RNF11 promotes Hendra virus replication in vitro, suggesting that increased NF-κB activity aids Hendra virus replication. Furthermore, overexpression of the IκB superrepressor inhibits Hendra virus replication. These studies are the first to demonstrate a host miRNA response to Hendra virus infection and suggest an important role for host miRNAs in Hendra virus disease.

  11. Designing of highly effective complementary and mismatch siRNAs for silencing a gene.

    Science.gov (United States)

    Ahmed, Firoz; Raghava, Gajendra P S

    2011-01-01

    In past, numerous methods have been developed for predicting efficacy of short interfering RNA (siRNA). However these methods have been developed for predicting efficacy of fully complementary siRNA against a gene. Best of author's knowledge no method has been developed for predicting efficacy of mismatch siRNA against a gene. In this study, a systematic attempt has been made to identify highly effective complementary as well as mismatch siRNAs for silencing a gene.Support vector machine (SVM) based models have been developed for predicting efficacy of siRNAs using composition, binary and hybrid pattern siRNAs. We achieved maximum correlation 0.67 between predicted and actual efficacy of siRNAs using hybrid model. All models were trained and tested on a dataset of 2182 siRNAs and performance was evaluated using five-fold cross validation techniques. The performance of our method desiRm is comparable to other well-known methods. In this study, first time attempt has been made to design mutant siRNAs (mismatch siRNAs). In this approach we mutated a given siRNA on all possible sites/positions with all possible nucleotides. Efficacy of each mutated siRNA is predicted using our method desiRm. It is well known from literature that mismatches between siRNA and target affects the silencing efficacy. Thus we have incorporated the rules derived from base mismatches experimental data to find out over all efficacy of mutated or mismatch siRNAs. Finally we developed a webserver, desiRm (http://www.imtech.res.in/raghava/desirm/) for designing highly effective siRNA for silencing a gene. This tool will be helpful to design siRNA to degrade disease isoform of heterozygous single nucleotide polymorphism gene without depleting the wild type protein.

  12. The gifts of silence and solitude.

    Science.gov (United States)

    Schmidt Bunkers, Sandra

    2008-01-01

    In this column the author describes the importance of finding silence and solitude amid the noise and technology present today in the teaching-learning academy. Three gifts of silence and solitude are identified: the gift of comforting aloneness, the gift of vision for new horizons, and the gift of a sense of freedom. A humanbecoming perspective is used to explore the implications of these gifts. This column introduces a column by Diana Vander Woude describing her teaching-learning experience in leadership focusing on silence and solitude.

  13. Analysis of geminivirus AL2 and L2 proteins reveals a novel AL2 silencing suppressor activity.

    Science.gov (United States)

    Jackel, Jamie N; Buchmann, R Cody; Singhal, Udit; Bisaro, David M

    2015-03-01

    Both posttranscriptional and transcriptional gene silencing (PTGS and TGS, respectively) participate in defense against the DNA-containing geminiviruses. As a countermeasure, members of the genus Begomovirus (e.g., Cabbage leaf curl virus) encode an AL2 protein that is both a transcriptional activator and a silencing suppressor. The related L2 protein of Beet curly top virus (genus Curtovirus) lacks transcription activation activity. Previous studies showed that both AL2 and L2 suppress silencing by a mechanism that correlates with adenosine kinase (ADK) inhibition, while AL2 in addition activates transcription of cellular genes that negatively regulate silencing pathways. The goal of this study was to clarify the general means by which these viral proteins inhibit various aspects of silencing. We confirmed that AL2 inhibits systemic silencing spread by a mechanism that requires transcription activation activity. Surprisingly, we also found that reversal of PTGS and TGS by ADK inactivation depended on whether experiments were conducted in vegetative or reproductive Nicotiana benthamiana plants (i.e., before or after the vegetative-to-reproductive transition). While AL2 was able to reverse silencing in both vegetative and reproductive plants, L2 and ADK inhibition were effective only in vegetative plants. This suggests that silencing maintenance mechanisms can change during development or in response to stress. Remarkably, we also observed that AL2 lacking its transcription activation domain could reverse TGS in reproductive plants, revealing a third, previously unsuspected AL2 suppression mechanism that depends on neither ADK inactivation nor transcription activation. RNA silencing in plants is a multivalent antiviral defense, and viruses respond by elaborating multiple and sometimes multifunctional proteins that inhibit various aspects of silencing. The studies described here add an additional layer of complexity to this interplay. By examining geminivirus AL2 and

  14. Resveratrol via sirtuin-1 downregulates RE1-silencing transcription factor (REST) expression preventing PCB-95-induced neuronal cell death.

    Science.gov (United States)

    Guida, Natascia; Laudati, Giusy; Anzilotti, Serenella; Secondo, Agnese; Montuori, Paolo; Di Renzo, Gianfranco; Canzoniero, Lorella M T; Formisano, Luigi

    2015-11-01

    Resveratrol (3,5,4'-trihydroxystilbene) (RSV), a polyphenol widely present in plants, exerts a neuroprotective function in several neurological conditions; it is an activator of class III histone deacetylase sirtuin1 (SIRT1), a crucial regulator in the pathophysiology of neurodegenerative diseases. By contrast, the RE1-silencing transcription factor (REST) is involved in the neurotoxic effects following exposure to polychlorinated biphenyl (PCB) mixture A1254. The present study investigated the effects of RSV-induced activation of SIRT1 on REST expression in SH-SY5Y cells. Further, we investigated the possible relationship between the non-dioxin-like (NDL) PCB-95 and REST through SIRT1 to regulate neuronal death in rat cortical neurons. Our results revealed that RSV significantly decreased REST gene and protein levels in a dose- and time-dependent manner. Interestingly, overexpression of SIRT1 reduced REST expression, whereas EX-527, an inhibitor of SIRT1, increased REST expression and blocked RSV-induced REST downregulation. These results suggest that RSV downregulates REST through SIRT1. In addition, RSV enhanced activator protein 1 (AP-1) transcription factor c-Jun expression and its binding to the REST promoter gene. Indeed, c-Jun knockdown reverted RSV-induced REST downregulation. Intriguingly, in SH-SY5Y cells and rat cortical neurons the NDL PCB-95 induced necrotic cell death in a concentration-dependent manner by increasing REST mRNA and protein expression. In addition, SIRT1 knockdown blocked RSV-induced neuroprotection in rat cortical neurons treated with PCB-95. Collectively, these results indicate that RSV via SIRT1 activates c-Jun, thereby reducing REST expression in SH-SY5Y cells under physiological conditions and blocks PCB-95-induced neuronal cell death by activating the same SIRT1/c-Jun/REST pathway. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Virus-Induced Gene Silencing in Maize with a Foxtail mosaic virus Vector.

    Science.gov (United States)

    Mei, Yu; Whitham, Steven A

    2018-01-01

    Virus-induced gene silencing (VIGS) is a powerful technology for rapidly and transiently knocking down the expression of plant genes to study their functions. A VIGS vector for maize derived from Foxtail mosaic virus (FoMV), a positive-sense single-stranded RNA virus, was recently developed. A cloning site created near the 3' end of the FoMV genome enables insertion of 200-400 nucleotide fragments of maize genes targeted for silencing. The recombinant FoMV clones are inoculated into leaves of maize seedlings by biolistic particle delivery, and silencing is typically observed within 2 weeks after inoculation. This chapter provides a protocol for constructing FoMV VIGS clones and inoculating them into maize seedlings.

  16. Mechanisms of epigenetic silencing of the c21 gene in Y1 adrenocortical tumor cells.

    Science.gov (United States)

    Szyf, M; Slack, A D

    2000-11-01

    We utilized Y1 adrenocortical carcinoma cell line as a model system to dissect the events regulating epigenomic gene silencing in tumor cells. We show here that the chromatin structure of c21 gene is inactive in Y1 cells and that it could be reconfigured to an active form by either expressing antisense mRNA to DNA methyltransferase 1 (dnmt1) or an attenuator of Ras protooncogenic signaling hGAP. Surprisingly however, the known inducer of active chromatin structure the histone deacetylase inhibitor trichostatin A TSA fails to induce expression of c21. These results suggest that the primary cause of c21 gene silencing is independent of histone deacetylation. We present a model to explain the possible roles of the different components of the epigenome and the DNA methylation and demethylation machineries in silencing c21 gene expression.

  17. Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

    Science.gov (United States)

    Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

    2017-05-01

    Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Use of guanidinopropyl-modified siRNAs to silence gene expression.

    Science.gov (United States)

    Buff, Maximilian C R; Bernhardt, Stefan; Marimani, Musa D; Ely, Abdullah; Engels, Joachim W; Arbuthnot, Patrick

    2015-01-01

    Silencing gene expression by harnessing the RNA interference (RNAi) pathway with short interfering RNAs (siRNAs) has useful analytical and potentially therapeutic application. To augment silencing efficacy of siRNAs, chemical modification has been employed to improve stability, target specificity, and delivery to target tissues. siRNAs incorporating guanidinopropyl (GP) moieties have demonstrated enhanced target gene silencing in cell culture and in vivo models of hepatitis B virus replication. Here we describe the synthesis of GP-modified siRNAs and use of 5' rapid amplification of cDNA ends (5' RACE) to verify an RNAi-mediated mechanism of action of these novel chemically modified siRNAs.

  19. QM Computations on Complete Nucleic Acids Building Blocks: Analysis of the Sarcin-Ricin RNA Motif Using DFT-D3, HF-3c, PM6-D3H, and MM Approaches.

    Science.gov (United States)

    Kruse, Holger; Havrila, Marek; Šponer, Jiřı

    2014-06-10

    A set of conformations obtained from explicit solvent molecular dynamics (MD) simulations of the Sarcin-Ricin internal loop (SRL) RNA motif is investigated using quantum mechanical (QM, TPSS-D3/def2-TZVP DFT-D3) and molecular mechanics (MM, AMBER parm99bsc0+χol3 force field) methods. Solvent effects are approximated using implicit solvent methods (COSMO for DFT-D3; GB and PB for MM). Large-scale DFT-D3 optimizations of the full 11-nucleotide motif are compared to MM results and reveal a higher flexibility of DFT-D3 over the MM in the optimization procedure. Conformational energies of the SRL motif expose significant differences in the DFT-D3 and MM energy descriptions that explain difficulties in MD simulations of the SRL motif. The TPSS-D3 data are in excellent agreement with results obtained by the hybrid functionals PW6B95-D3 and M06-2X. Computationally more efficient methods such as PM6-D3H and HF-3c show promising but partly inconsistent results. It is demonstrated that large-scale DFT-D3 computations on complete nucleic acids building blocks are a viable tool to complement the picture obtained from MD simulations and can be used as benchmarks for faster computational methods. Methodological challenges of large-scale QM computations on nucleic acids such as missing solvent-solute interactions and the truncation of the studied systems are discussed.

  20. Gene silencing for epidermal growth factor receptor variant III induces cell-specific cytotoxicity.

    Science.gov (United States)

    Yamoutpour, Farnaz; Bodempudi, Vidya; Park, Shay E; Pan, Weihong; Mauzy, Mary Jean; Kratzke, Robert A; Dudek, Arkadiusz; Potter, David A; Woo, Richard A; O'Rourke, Donald M; Tindall, Donald J; Farassati, Faris

    2008-11-01

    Epidermal growth factor receptor variant III (EGFRvIII) is a constitutively active mutant form of EGFR that is expressed in 40% to 50% of gliomas and several other malignancies. Here, we describe the therapeutic effects of silencing EGFRvIII on glioma cell lines in vitro and in vivo. A small interfering RNA molecule against EGFRvIII was introduced into EGFRvIII-expressing glioma cells (U87Delta) by electroporation resulting in complete inhibition of expression of EGFRvIII as early as 48 h post-treatment. During EGFRvIII silencing, a decrease in the proliferation and invasiveness of U87Delta cells was accompanied by an increase in apoptosis (P < 0.05). Notably, EGFRvIII silencing inhibited the signal transduction machinery downstream of EGFRvIII as evidenced by decreases in the activated levels of Ras and extracellular signal-regulated kinase. A lentivirus capable of expressing anti-EGFRvIII short hairpin RNA was also able to achieve progressive silencing of EGFRvIII in U87Delta cells in addition to inhibiting cell proliferation, invasiveness, and colony formation in a significant manner (P < 0.05). Silencing EGFRvIII in U87Delta cultures with this virus reduced the expression of factors involved in epithelial-mesenchymal transition including N-cadherin, beta-catenin, Snail, Slug, and paxillin but not E-cadherin. The anti-EGFRvIII lentivirus also affected the cell cycle progression of U87Delta cells with a decrease in G(1) and increase in S and G(2) fractions. In an in vivo model, tumor growth was completely inhibited in severe combined immunodeficient mice (n = 10) injected s.c. with U87Delta cells treated with the anti-EGFRvIII lentivirus (P = 0.005). We conclude that gene specific silencing of EGFRvIII is a promising strategy for treating cancers that contain this mutated receptor.

  1. Selective silencing of Na(V)1.7 decreases excitability and conduction in vagal sensory neurons.

    Science.gov (United States)

    Muroi, Yukiko; Ru, Fei; Kollarik, Marian; Canning, Brendan J; Hughes, Stephen A; Walsh, Stacey; Sigg, Martin; Carr, Michael J; Undem, Bradley J

    2011-12-01

    There has been much information learned in recent years about voltage gated sodium channel (Na(V)) subtypes in somatosensory pain signalling, but much less is known about the role of specific sodium channel subtypes in the vagal sensory system. In this study, we developed a technique using adeno-associated viruses (AAVs) to directly introduce shRNA against Na(V)1.7 subtype gene into the vagal sensory ganglia of guinea pigs in vivo. Na(V)1.7 gene expression in nodose ganglia was effectively and selectively reduced without influencing the expression of other sodium channel subtype genes including Na(V)1.1, 1.2, 1.3 1.6, 1.8, or 1.9. Using a whole cell patch-clamp technique, this effect on Na(V)1.7 gene expression coincided with a reduction in tetrodotoxin-sensitive sodium current, a requirement for much larger depolarizing stimulus to initiate action potentials, and reduction in repetitive action potential discharge. Extracellular recordings in the isolated vagus nerve revealed that the conduction of action potentials in sensory A- and C-fibres in many neurons was effectively abolished after Na(V)1.7 shRNA introduction. Moreover, bilateral Na(V)1.7 shRNA injected animals survived for several months and the vagal reflex behaviour, exemplified by citric acid-induced coughing, was significantly suppressed. These data indicate that selectively silencing Na(V)1.7 ion channel expression leads to a substantial decrease in neural excitability and conduction block in vagal afferent nerves.

  2. Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury.

    Science.gov (United States)

    Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

    2014-04-15

    We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group.

  3. Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

    Science.gov (United States)

    Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

    2014-01-01

    We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

  4. Preclinical Evaluation of a Lentiviral Vector for Huntingtin Silencing

    Directory of Open Access Journals (Sweden)

    Karine Cambon

    2017-06-01

    Full Text Available Huntington’s disease (HD is an autosomal dominant neurodegenerative disorder resulting from a polyglutamine expansion in the huntingtin (HTT protein. There is currently no cure for this disease, but recent studies suggest that RNAi to downregulate the expression of both normal and mutant HTT is a promising therapeutic approach. We previously developed a small hairpin RNA (shRNA, vectorized in an HIV-1-derived lentiviral vector (LV, that reduced pathology in an HD rodent model. Here, we modified this vector for preclinical development by using a tat-independent third-generation LV (pCCL backbone and removing the original reporter genes. We demonstrate that this novel vector efficiently downregulated HTT expression in vitro in striatal neurons derived from induced pluripotent stem cells (iPSCs of HD patients. It reduced two major pathological HD hallmarks while triggering a minimal inflammatory response, up to 6 weeks after injection, when administered by stereotaxic surgery in the striatum of an in vivo rodent HD model. Further assessment of this shRNA vector in vitro showed proper processing by the endogenous silencing machinery, and we analyzed gene expression changes to identify potential off-targets. These preclinical data suggest that this new shRNA vector fulfills primary biosafety and efficiency requirements for further development in the clinic as a cure for HD.

  5. Flexible tools for gene expression and silencing in tomato.

    Science.gov (United States)

    Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

    2009-12-01

    As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

  6. Titration and hysteresis in epigenetic chromatin silencing

    Science.gov (United States)

    Dayarian, Adel; Sengupta, Anirvan M.

    2013-06-01

    Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs.

  7. Titration and hysteresis in epigenetic chromatin silencing

    International Nuclear Information System (INIS)

    Dayarian, Adel; Sengupta, Anirvan M

    2013-01-01

    Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

  8. MiRNA Biogenesis and Intersecting Pathways

    DEFF Research Database (Denmark)

    Ben Chaabane, Samir

    (DCL1) protein complex. Mature miRNAs are loaded onto and guide an ARGONAUTE1 (AGO1) effector complex, leading to target mRNA silencing. The miRNA pathway is under tight temporal and spatial control and is regulated at multiple levels from transcription and precursor processing through miRNA mode...... questions need to be addressed to establish a valid link, we provide encouraging evidence of the involvement of chromatin remodeling factors FAS1 and FAS2 in miRNA biogenesis. Together, we have expanded our understanding of the intersections between miRNA biogenesis and other pathways....

  9. MicroRNA-16 Modulates HuR Regulation of Cyclin E1 in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xun Guo

    2015-03-01

    Full Text Available RNA binding protein (RBPs and microRNAs (miRNAs or miRs are post-transcriptional regulators of gene expression that are implicated in development of cancers. Although their individual roles have been studied, the crosstalk between RBPs and miRNAs is under intense investigation. Here, we show that in breast cancer cells, cyclin E1 upregulation by the RBP HuR is through specific binding to regions in the cyclin E1 mRNA 3' untranslated region (3'UTR containing U-rich elements. Similarly, miR-16 represses cyclin E1, dependent on its cognate binding sites in the cyclin E1 3'UTR. Evidence in the literature indicates that HuR can regulate miRNA expression and recruit or dissociate RNA-induced silencing complexes (RISC. Despite this, miR-16 and HuR do not affect the other’s expression level or binding to the cyclin E1 3'UTR. While HuR overexpression partially blocks miR-16 repression of a reporter mRNA containing the cyclin E1 3'UTR, it does not block miR-16 repression of endogenous cyclin E1 mRNA. In contrast, miR-16 blocks HuR-mediated upregulation of cyclin E1. Overall our results suggest that miR-16 can override HuR upregulation of cyclin E1 without affecting HuR expression or association with the cyclin E1 mRNA.

  10. KDR gene silencing inhibits proliferation of A549 cells and enhances their sensitivity to docetaxel.

    Science.gov (United States)

    Wei, R; Zang, J-P

    2015-11-23

    We investigated the effects of kinase-domain insert containing receptor (KDR) gene silencing on the proliferation of A549 cells and their sensitivity to docetaxel. After designing and synthesizing the KDR siRNA sequence, the sequence was transfected into A549 cells using Lipofectamine 2000. The expression of KDR mRNA and protein after KDR gene silencing was detected by reverse transcription-polymerase chain reaction and western blotting; A549 cell cycle was detected by flow cytometry. An MTT assay and colony formation was performed to determine the sensitivity of A549 cells to docetaxel after KDR gene silencing. After 48-h KDR gene silencing, KDR gene and protein expression significantly decreased (P A549 cell cycle was significantly arrested in G0/G1 phase, and the number of cells in S phase was reduced; the difference was statistically significant (P A549 cells to docetaxel showed a significant enhancement (P A549 cells, inhibit the proliferation of A549 cells, and enhance their sensitivity to docetaxel.

  11. Transient receptor potential vanilloid 4 (TRPV4) silencing in Helicobacter pylori-infected human gastric epithelium.

    Science.gov (United States)

    Mihara, Hiroshi; Suzuki, Nobuhiro; Muhammad, Jibran Sualeh; Nanjo, Sohachi; Ando, Takayuki; Fujinami, Haruka; Kajiura, Shinya; Hosokawa, Ayumu; Sugiyama, Toshiro

    2017-04-01

    Helicobacter pylori (HP) infection induces methylation silencing of specific genes in gastric epithelium. Various stimuli activate the nonselective cation channel TRPV4, which is expressed in gastric epithelium where it detects mechanical stimuli and promotes ATP release. As CpG islands in TRPV4 are methylated in HP-infected gastric epithelium, we evaluated HP infection-dependent changes in TRPV4 expression in gastric epithelium. Human gastric biopsy samples, a human gastric cancer cell line (AGS), and a normal gastric epithelial cell line (GES-1) were used to detect TRPV4 mRNA and protein expression by RT-PCR and Western blotting, respectively. Ca 2+ imaging was used to evaluate TRPV4 ion channel activity. TRPV4 methylation status was assessed by methylation-specific PCR (MSP). ATP release was measured by a luciferin-luciferase assay. TRPV4 mRNA and protein were detected in human gastric biopsy samples and in GES-1 cells. MSP and demethylation assays showed TRPV4 methylation silencing in AGS cells. HP coculture directly induced methylation silencing of TRPV4 in GES-1 cells. In human samples, HP infection was associated with TRPV4 methylation silencing that recovered after HP eradication in a time-dependent manner. HP infection-dependent DNA methylation suppressed TRPV4 expression in human gastric epithelia, suggesting that TRPV4 methylation may be involved in HP-associated dyspepsia. © 2016 The Authors. Helicobacter Published by John Wiley & Sons Ltd.

  12. A new component of the Nasonia sex determining cascade is maternally silenced and regulates transformer expression.

    Science.gov (United States)

    Verhulst, Eveline C; Lynch, Jeremy A; Bopp, Daniel; Beukeboom, Leo W; van de Zande, Louis

    2013-01-01

    Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators.

  13. MicroRNA-Mediated Downregulation of the Potassium Channel Kv4.2 Contributes to Seizure Onset

    Directory of Open Access Journals (Sweden)

    Christina Gross

    2016-09-01

    Full Text Available Seizures are bursts of excessive synchronized neuronal activity, suggesting that mechanisms controlling brain excitability are compromised. The voltage-gated potassium channel Kv4.2, a major mediator of hyperpolarizing A-type currents in the brain, is a crucial regulator of neuronal excitability. Kv4.2 expression levels are reduced following seizures and in epilepsy, but the underlying mechanisms remain unclear. Here, we report that Kv4.2 mRNA is recruited to the RNA-induced silencing complex shortly after status epilepticus in mice and after kainic acid treatment of hippocampal neurons, coincident with reduction of Kv4.2 protein. We show that the microRNA miR-324-5p inhibits Kv4.2 protein expression and that antagonizing miR-324-5p is neuroprotective and seizure suppressive. MiR-324-5p inhibition also blocks kainic-acid-induced reduction of Kv4.2 protein in vitro and in vivo and delays kainic-acid-induced seizure onset in wild-type but not in Kcnd2 knockout mice. These results reveal an important role for miR-324-5p-mediated silencing of Kv4.2 in seizure onset.

  14. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    Energy Technology Data Exchange (ETDEWEB)

    Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)

    2012-09-10

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.

  15. Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

    Directory of Open Access Journals (Sweden)

    Gyöngyi Munkácsy

    2016-01-01

    Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

  16. Topology of RNA-RNA Interaction Structures

    DEFF Research Database (Denmark)

    Andersen, Hans Jørgen; Huang, Fenix Wenda; Penner, Robert

    2012-01-01

    Abstract The topological filtration of interacting RNA complexes is studied, and the role is analyzed of certain diagrams called irreducible shadows, which form suitable building blocks for more general structures. We prove that, for two interacting RNAs, called interaction structures, there exist...

  17. TGF-β Mediates Renal Fibrosis via the Smad3-Erbb4-IR Long Noncoding RNA Axis.

    Science.gov (United States)

    Feng, Min; Tang, Patrick Ming-Kuen; Huang, Xiao-Ru; Sun, Si-Fan; You, Yong-Ke; Xiao, Jun; Lv, Lin-Li; Xu, An-Ping; Lan, Hui-Yao

    2018-01-03

    Transforming growth factor β (TGF-β)/Smad3 signaling plays a role in tissue fibrosis. We report here that Erbb4-IR is a novel long non-coding RNA (lncRNA) responsible for TGF-β/Smad3-mediated renal fibrosis and is a specific therapeutic target for chronic kidney disease. Erbb4-IR was induced by TGF-β1 via a Smad3-dependent mechanism and was highly upregulated in the fibrotic kidney of mouse unilateral ureteral obstructive nephropathy (UUO). Silencing Erbb4-IR blocked TGF-β1-induced collagen I and alpha-smooth muscle actin (α-SMA) expressions in vitro and effectively attenuated renal fibrosis in the UUO kidney by blocking TGF-β/Smad3 signaling. Mechanistic studies revealed that Smad7, a downstream negative regulator of TGF-β/Smad signaling, is a target gene of Erbb4-IR because a binding site of Erbb4-IR was found on the 3' UTR of Smad7 gene. Mutation of this binding site prevented the suppressive effect of Erbb4-IR on the Smad7 reporter activity; in contrast, overexpression of Erbb4-IR largely inhibited Smad7 but increased collagen I and α-SMA transcriptions. Thus, kidney-specific silencing of Erbb4-IR upregulated renal Smad7 and thus blocked TGF-β/Smad3-mediated renal fibrosis in vivo and in vitro. In conclusion, the present study identified that Erbb4-IR is a novel lncRNA responsible for TGF-β/Smad3-mediated renal fibrosis by downregulating Smad7. Targeting Erbb4-IR may represent a precise therapeutic strategy for progressive renal fibrosis. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  18. Long non-coding RNA ROR decoys gene-specific histone methylation to promote tumorigenesis.

    Science.gov (United States)

    Fan, Jiayan; Xing, Yue; Wen, Xuyang; Jia, Renbin; Ni, Hongyan; He, Jie; Ding, Xia; Pan, Hui; Qian, Guanxiang; Ge, Shengfang; Hoffman, Andrew R; Zhang, He; Fan, Xianqun

    2015-07-14

    Long non-coding RNAs (lncRNAs) are not translated into proteins and were initially considered to be part of the 'dark matter' of the genome. Recently, it has been shown that lncRNAs play a role in the recruitment of chromatin modifying complexes and can influence gene expression. However, it is unknown if lncRNAs function in a similar way in cancer. Here, we show that the lncRNA ROR occupies and activates the TESC promoter by repelling the histone G9A methyltransferase and promoting the release of histone H3K9 methylation. Suppression of ROR in tumors results in silencing of TESC expression, and G9A-mediated histone H3K9 methylation in the TESC promoter is restored, which significantly reduces tumor growth and metastasis. Without ROR silencing, TESC knockdown presents consistent and significant reductions in tumor progression. Our results reveal a novel mechanism by which ROR may serve as a decoy oncoRNA that blocks binding surfaces, preventing the recruitment of histone modifying enzymes, thereby specifying a new pattern of histone modifications that promote tumorigenesis.

  19. Small Molecule Modifiers of the microRNA and RNA Interference Pathway

    OpenAIRE

    Deiters, Alexander

    2009-01-01

    Recently, the RNA interference (RNAi) pathway has become the target of small molecule inhibitors and activators. RNAi has been well established as a research tool in the sequence-specific silencing of genes in eukaryotic cells and organisms by using exogenous, small, double-stranded RNA molecules of approximately 20 nucleotides. Moreover, a recently discovered post-transcriptional gene regulatory mechanism employs microRNAs (miRNAs), a class of endogenously expressed small RNA molecules, whic...

  20. Switching of dominant retrotransposon silencing strategies from posttranscriptional to transcriptional mechanisms during male germ-cell development in mice.

    Directory of Open Access Journals (Sweden)

    Kota Inoue

    2017-07-01

    Full Text Available Mammalian genomes harbor millions of retrotransposon copies, some of which are transpositionally active. In mouse prospermatogonia, PIWI-interacting small RNAs (piRNAs combat retrotransposon activity to maintain the genomic integrity. The piRNA system destroys retrotransposon-derived RNAs and guides de novo DNA methylation at some retrotransposon promoters. However, it remains unclear whether DNA methylation contributes to retrotransposon silencing in prospermatogonia. We have performed comprehensive studies of DNA methylation and polyA(+ RNAs (transcriptome in developing male germ cells from Pld6/Mitopld and Dnmt3l knockout mice, which are defective in piRNA biogenesis and de novo DNA methylation, respectively. The Dnmt3l mutation greatly reduced DNA methylation levels at most retrotransposons, but its impact on their RNA abundance was limited in prospermatogonia. In Pld6 mutant germ cells, although only a few retrotransposons exhibited reduced DNA methylation, many showed increased expression at the RNA level. More detailed analysis of RNA sequencing, nascent RNA quantification, profiling of cleaved RNA ends, and the results obtained from double knockout mice suggest that PLD6 works mainly at the posttranscriptional level. The increase in retrotransposon expression was larger in Pld6 mutants than it was in Dnmt3l mutants, suggesting that RNA degradation by the piRNA system plays a more important role than does DNA methylation in prospermatogonia. However, DNA methylation had a long-term effect: hypomethylation caused by the Pld6 or Dnmt3l mutation resulted in increased retrotransposon expression in meiotic spermatocytes. Thus, posttranscriptional silencing plays an important role in the early stage of germ cell development, then transcriptional silencing becomes important in later stages. In addition, intergenic and intronic retrotransposon sequences, in particular those containing the antisense L1 promoters, drove ectopic expression of nearby

  1. Virus-induced gene silencing in detached tomatoes and biochemical effects of phytoene desaturase gene silencing

    NARCIS (Netherlands)

    Romero, I.; Tikunov, Y.M.; Bovy, A.G.

    2011-01-01

    Virus-induced gene silencing (VIGS) is a technology that has rapidly emerged for gene function studies in plants. Many advances have been made in applying this technique in an increasing number of crops. Recently, VIGS has been successfully used to silence genes in tomato fruit through

  2. Dentin sialophosphoprotein (DSPP gene-silencing inhibits key tumorigenic activities in human oral cancer cell line, OSC2.

    Directory of Open Access Journals (Sweden)

    Rajeshree Joshi

    2010-11-01

    Full Text Available We determined recently that dentin sialophosphoprotein (DSPP, a member of the SIBLING (Small integrin-binding ligand N-linked glycoproteins family of phosphoglycoproteins, is highly upregulated in human oral squamous cell carcinomas (OSCCs where upregulation is associated with tumor aggressiveness. To investigate the effects of DSPP-silencing on the tumorigenic profiles of the oral cancer cell line, OSC2, short-hairpin RNA (shRNA interference was employed to silence DSPP in OSC2 cells.Multiple regions of DSPP transcript were targeted for shRNA interference using hDSP-shRNA lentiviral particles designed to silence DSPP gene expression. Control shRNA plasmid encoding a scrambled sequence incapable of degrading any known cellular mRNA was used for negative control. Following puromycin selection of stable lines of DSSP-silenced OSC2 cells, phenotypic hallmarks of oral carcinogenesis were assayed by western blot and RT-PCR analyses, MTT (cell-viability, colony-formation, modified Boyden-Chamber (migration and invasion, and flow cytometry (cell-cycle and apoptosis analyses. DSPP-silenced OSC2 cells showed altered cell morphology, reduced viability, decreased colony-formation ability, decreased migration and invasion, G0/G1 cell-cycle arrest, and increased tumor cell sensitivity to cisplatin-induced apoptosis. Furthermore, MMP-2, MMP-3, MMP-9, VEGF, Ki-67, p53, and EGFR were down-regulated. There was a direct correlation between the degree of DSPP-silencing and MMP suppression, as indicated by least squares regression: MMP-2 {(y = 0.850x, p<0.001 (y = 1.156x, p<0.001}, MMP-3 {(y = 0.994x, p<0.001 (y = 1.324x, p = 0.004}, and MMP-9 {(y = 1.248x, p = 0.005, y = 0.809, p = 0.013}.DSPP-silencing in OSC2 cell decreased salient hallmarks of oral tumorigenesis and provides the first functional evidence of a potential key role for DSPP in oral cancer biology. The down-regulation of MMP-2, MMP-3, MMP-9, p53 and VEGF in DSPP-silenced

  3. Distinct features of post-transcriptional gene silencing by antisense transgenes in single copy and inverted T-DNA repeat loci.

    NARCIS (Netherlands)

    Stam, M.; de Bruin, R.A.M.; van Blokland, H.J.M.; van der Hoorn, R.; Mol, J.N.M.; Kooter, J.M.

    2000-01-01

    The application of antisense transgenes in plants is a powerful tool to inhibit gene expression. The underlying mechanism of this inhibition is still poorly understood. High levels of antisense RNA (as-RNA) are expected to result in strong silencing but often there is no clear correlation between

  4. Spatiotemporal flicker detector model of motion silencing.

    Science.gov (United States)

    Choi, Lark Kwon; Bovik, Alan C; Cormack, Lawrence K

    2014-01-01

    Motion can impair the perception of other visual changes. Suchow and Alvarez (2011a, Current Biology, 21, 140-143) recently demonstrated a striking 'motion silencing' illusion, in which the salient changes among a group of objects' luminances (or colors, etc) appear to cease in the presence of large, coherent object motion. To understand why the visual system might be insensitive to changes in object luminances ('flicker') in the presence of object motion, we constructed similar stimuli and did a systematic spectral analysis of them. We conducted human psychophysical experiments to examine motion silencing as a function of stimulus velocity, flicker frequency, and spacing; and we created a simple filter-based model as a working hypothesis of motion silencing. From the results, we found that the threshold of silencing occurs when the log frequency of object replacement is roughly one quarter of the log flicker frequency (the mean slope is approximately 0.27). The dependence of silencing on object spacing may be explained as a phenomenon of temporal sampling of the stimuli by the visual system. Our proposed model successfully captures the psychophysical data over a wide range of velocities and flicker frequencies.

  5. SOCS3 Silencing Attenuates Eosinophil Functions in Asthma Patients

    Science.gov (United States)

    Zafra, Mª Paz; Cañas, Jose A.; Mazzeo, Carla; Gámez, Cristina; Sanz, Veronica; Fernández-Nieto, Mar; Quirce, Santiago; Barranco, Pilar; Ruiz-Hornillos, Javier; Sastre, Joaquín; del Pozo, Victoria

    2015-01-01

    Eosinophils are one of the key inflammatory cells in asthma. Eosinophils can exert a wide variety of actions through expression and secretion of multiple molecules. Previously, we have demonstrated that eosinophils purified from peripheral blood from asthma patients express high levels of suppressor of cytokine signaling 3 (SOCS3). In this article, SOCS3 gene silencing in eosinophils from asthmatics has been carried out to achieve a better understanding of the suppressor function in eosinophils. SOCS3 siRNA treatment drastically reduced SOCS3 expression in eosinophils, leading to an inhibition of the regulatory transcription factors GATA-3 and FoxP3, also interleukin (IL)-10; in turn, an increased STAT3 phosphorilation was observed. Moreover, SOCS3 abrogation in eosinophils produced impaired migration, adhesion and degranulation. Therefore, SOCS3 might be regarded as an important regulator implicated in eosinophil mobilization from the bone marrow to the lungs during the asthmatic process. PMID:25764157

  6. Silencing MIG1 in Saccharomyces cerevisiae: Effects of antisense MIG1 expression and MIG1 gene disruption

    DEFF Research Database (Denmark)

    Olsson, Lisbeth; Larsen, M.E.; Rønnow, B.

    1997-01-01

    , However, silencing of MIG1 expression was not achieved by expressing antisense MIG1, even though antisense MIG1 RNA was sufficiently stable to be detected. In the wild-type and Delta mig1 strains, the specific growth rate was 0.32 to 0.33 h(-1), whereas it was lower in the antisense strains, 0.25 to 0...

  7. Human health and ecological risk assessments for SmartStax PRO (MON 89034 x TC1507 x MON 87411 x DAS-59122-7), a plant-incorporated protectant intended to control corn rootworm through ribonucleic acid (RNA) interference

    Science.gov (United States)

    The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...

  8. Polyphenoloxidase Silencing Affects Latex Coagulation in Taraxacum Species1[W

    Science.gov (United States)

    Wahler, Daniela; Gronover, Christian Schulze; Richter, Carolin; Foucu, Florence; Twyman, Richard M.; Moerschbacher, Bruno M.; Fischer, Rainer; Muth, Jost; Prüfer, Dirk

    2009-01-01

    Latex is the milky sap that is found in many different plants. It is produced by specialized cells known as laticifers and can comprise a mixture of proteins, carbohydrates, oils, secondary metabolites, and rubber that may help to prevent herbivory and protect wound sites against infection. The wound-induced browning of latex suggests that it contains one or more phenol-oxidizing enzymes. Here, we present a comprehensive analysis of the major latex proteins from two dandelion species, Taraxacum officinale and Taraxacum kok-saghyz, and enzymatic studies showing that polyphenoloxidase (PPO) is responsible for latex browning. Electrophoretic analysis and amino-terminal sequencing of the most abundant proteins in the aqueous latex fraction revealed the presence of three PPO-related proteins generated by the proteolytic cleavage of a single precursor (pre-PPO). The laticifer-specific pre-PPO protein contains a transit peptide that can target reporter proteins into chloroplasts when constitutively expressed in dandelion protoplasts, perhaps indicating the presence of structures similar to plastids in laticifers, which lack genuine chloroplasts. Silencing the PPO gene by constitutive RNA interference in transgenic plants reduced PPO activity compared with wild-type controls, allowing T. kok-saghyz RNA interference lines to expel four to five times more latex than controls. Latex fluidity analysis in silenced plants showed a strong correlation between residual PPO activity and the coagulation rate, indicating that laticifer-specific PPO plays a major role in latex coagulation and wound sealing in dandelions. In contrast, very little PPO activity is found in the latex of the rubber tree Hevea brasiliensis, suggesting functional divergence of latex proteins during plant evolution. PMID:19605551

  9. Silence as a Response to Everyday Violence

    DEFF Research Database (Denmark)

    Gammeltoft, Tine

    2016-01-01

    Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...... violence. Closer ethnographic attention to the fantasy-constructions that sustain day-to-day lives can, I argue, strengthen the capacity of anthropology to comprehend how systems of everyday violence are upheld and rendered socially invisible....

  10. Disruption of Rpp1-mediated soybean rust immunity by virus-induced gene silencing

    Science.gov (United States)

    Cooper, Bret; Campbell, Kimberly B; McMahon, Michael B; Luster, Douglas G

    2013-01-01

    Phakopsora pachyrhizi, a fungus that causes rust disease on soybean, has potential to impart significant yield loss and disrupt food security and animal feed production. Rpp1 is a soybean gene that confers immunity to soybean rust, and it is important to understand how it regulates the soybean defense system and to use this knowledge to protect commercial crops. It was previously discovered that some soybean proteins resembling transcription factors accumulate in the nucleus of Rpp1 soybeans. To determine if they contribute to immunity, Bean pod mottle virus was used to attenuate or silence the expression of their genes. Rpp1 plants subjected to virus-induced gene silencing exhibited reduced amounts of RNA for 5 of the tested genes, and the plants developed rust-like symptoms after subsequent inoculation with fungal spores. Symptoms were associated with the accumulation of rust fungal RNA and protein. Silenced plants also had reduced amounts of RNA for the soybean Myb84 transcription factor and soybean isoflavone O-methyltransferase, both of which are important to phenylpropanoid biosynthesis and lignin formation, crucial components of rust resistance. These results help resolve some of the genes that contribute to Rpp1-mediated immunity and improve upon the knowledge of the soybean defense system. It is possible that these genes could be manipulated to enhance rust resistance in otherwise susceptible soybean cultivars. PMID:24401541

  11. HIGS: host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis.

    Science.gov (United States)

    Nowara, Daniela; Gay, Alexandra; Lacomme, Christophe; Shaw, Jane; Ridout, Christopher; Douchkov, Dimitar; Hensel, Götz; Kumlehn, Jochen; Schweizer, Patrick

    2010-09-01

    Powdery mildew fungi are obligate biotrophic pathogens that only grow on living hosts and cause damage in thousands of plant species. Despite their agronomical importance, little direct functional evidence for genes of pathogenicity and virulence is currently available because mutagenesis and transformation protocols are lacking. Here, we show that the accumulation in barley (Hordeum vulgare) and wheat (Triticum aestivum) of double-stranded or antisense RNA targeting fungal transcripts affects the development of the powdery mildew fungus Blumeria graminis. Proof of concept for host-induced gene silencing was obtained by silencing the effector gene Avra10, which resulted in reduced fungal development in the absence, but not in the presence, of the matching resistance gene Mla10. The fungus could be rescued from the silencing of Avra10 by the transient expression of a synthetic gene that was resistant to RNA interference (RNAi) due to silent point mutations. The results suggest traffic of RNA molecules from host plants into B. graminis and may lead to an RNAi-based crop protection strategy against fungal pathogens.

  12. Lentiviral Vector Mediated Claudin1 Silencing Inhibits Epithelial to Mesenchymal Transition in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xianqi Zhao

    2015-06-01

    Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.

  13. Disruption of Rpp1-mediated soybean rust immunity by virus-induced gene silencing.

    Science.gov (United States)

    Cooper, Bret; Campbell, Kimberly B; McMahon, Michael B; Luster, Douglas G

    2013-01-01

    Phakopsora pachyrhizi, a fungus that causes rust disease on soybean, has potential to impart significant yield loss and disrupt food security and animal feed production. Rpp1 is a soybean gene that confers immunity to soybean rust, and it is important to understand how it regulates the soybean defense system and to use this knowledge to protect commercial crops. It was previously discovered that some soybean proteins resembling transcription factors accumulate in the nucleus of Rpp1 soybeans. To determine if they contribute to immunity, Bean pod mottle virus was used to attenuate or silence the expression of their genes. Rpp1 plants subjected to virus-induced gene silencing exhibited reduced amounts of RNA for 5 of the tested genes, and the plants developed rust-like symptoms after subsequent inoculation with fungal spores. Symptoms were associated with the accumulation of rust fungal RNA and protein. Silenced plants also had reduced amounts of RNA for the soybean Myb84 transcription factor and soybean isoflavone O-methyltransferase, both of which are important to phenylpropanoid biosynthesis and lignin formation, crucial components of rust resistance. These results help resolve some of the genes that contribute to Rpp1-mediated immunity and improve upon the knowledge of the soybean defense system. It is possible that these genes could be manipulated to enhance rust resistance in otherwise susceptible soybean cultivars.

  14. Transgene-induced gene silencing is not affected by a change in ploidy level.

    Directory of Open Access Journals (Sweden)

    Daniela Pignatta

    Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

  15. The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Dashuai Mu

    Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening eff