WorldWideScience

Sample records for biphasic voltage dependence

  1. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  2. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  3. Temperature dependence of microwave absorption phenomena in single and biphase soft magnetic microwires

    Energy Technology Data Exchange (ETDEWEB)

    El Kammouni, Rhimou, E-mail: elkammounirhimou@gmail.com [Instituto de Ciencia de Materiales de Madrid, CSIC, 28049 Madrid (Spain); Vázquez, Manuel [Instituto de Ciencia de Materiales de Madrid, CSIC, 28049 Madrid (Spain); Lezama, Luis [Depto. Química Inorgánica, Universidad País Vasco, UPV/EHU, Bilbao (Spain); Kurlyandskaya, Galina [Depto. Electricidad y Electrónica, Universidad País Vasco, UPV/EHU, Bilbao (Spain); Dept. Magnetism and Magnetic Nanomaterials, Ural Federal University, Ekaterinburg (Russian Federation); Kraus, Ludek [Institute of Physics, Academy of Sciences of the Czech Republic, Prague (Czech Republic)

    2014-11-15

    The microwave absorption phenomena of single and biphase magnetic microwires with soft magnetic behavior have been investigated as a function of DC applied magnetic field using two alternative techniques: (i) absorption measurements in the temperature range of 4–300 K using a spectrometer operating at X-band frequency, at 9.5 GHz, and (ii) room-temperature, RT, ferromagnetic resonance measurements in a network analyzer in the frequency range up to 20 GHz. Complementary low-frequency magnetic characterization was performed in a Vibrating Sample Magnetometer. Studies have been performed for 8 μm diameter small-magnetostriction amorphous CoFeSiB single-phase microwire, coated by micrometric Pyrex layer, and after electroplating an external shell, 2 µm or 4 µm thick, of FeNi alloys. For single phase CoFeSiB microwire, a single absorption is observed, whose DC field dependence of resonance frequency at RT fits to a Kittel-law behavior for in-plane magnetized thin film. The temperature dependence behavior shows a monotonic increase in the resonance field, H{sub r}, with temperature. A parallel reduction of the circular anisotropy field, H{sub K}, is deduced from the temperature dependence of hysteresis loops. For biphase, CoFeSiB/FeNi, microwires, the absorption phenomena at RT also follow the Kittel condition. The observed opposite evolution with temperature of resonance field, H{sub r}, in 2 and 4 µm thick FeNi samples is interpreted considering the opposite sign of magnetostriction of the respective FeNi layers. The stress-induced magnetic anisotropy field, H{sub K}, in the FeNi shell is deduced to change sign at around 130 K. - Highlights: • A single absorption phenomenon is observed for single phase CoFeSiB. • The T dependence of the microwave behavior shows a monotonic increase of H{sub r} with T. • The absorption at RT follows the Kittel condition for biphase CoFe/FeNi microwires. • The T dependence of resonant field of CoFe/FeNi is interpreted to be

  4. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  5. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  6. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  7. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  8. Temperature dependence of microwave absorption phenomena in single and biphase soft magnetic microwires

    Czech Academy of Sciences Publication Activity Database

    El Kammouni, R.; Vázquez, M.; Lezama, L.; Kurlyandskaya, G.; Kraus, Luděk

    2014-01-01

    Roč. 368, Nov (2014), 126-132 ISSN 0304-8853 Institutional support: RVO:68378271 Keywords : magnetic microwire * ferromagnetic resonance * microwave absorption * biphase magnetic system Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.970, year: 2014

  9. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  10. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  11. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  12. Induced voltage due to time-dependent magnetisation textures

    International Nuclear Information System (INIS)

    Kudtarkar, Santosh Kumar; Dhadwal, Renu

    2010-01-01

    We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.

  13. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  14. Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage

    International Nuclear Information System (INIS)

    Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji

    2016-01-01

    We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.

  15. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  16. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  17. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  18. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  19. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  20. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  1. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  2. Phosphate regulates chondrogenesis in a biphasic and maturation-dependent manner.

    Science.gov (United States)

    Wu, Biming; Durisin, Emily K; Decker, Joseph T; Ural, Evran E; Shea, Lonnie D; Coleman, Rhima M

    Inorganic phosphate (Pi) has been recognized as an important signaling molecule that modulates chondrocyte maturation and cartilage mineralization. However, conclusive experimental evidence for its involvement in early chondrogenesis is still lacking. Here, using high-density monolayer (2D) and pellet (3D) culture models of chondrogenic ATDC5 cells, we demonstrate that the cell response to Pi does not correlate with the Pi concentration in the culture medium but is better predicted by the availability of Pi on a per cell basis (Pi abundance). Both culture models were treated with ITS+, 10mM β-glycerophosphate (βGP), or ITS+/10mM βGP, which resulted in three levels of Pi abundance in cultures: basal (Pi/DNA 60ng/µg). In chondrogenic medium alone, the abundance levels were at the basal level in 2D culture and moderate in 3D cultures. The addition of 10mM βGP resulted in moderate abundance in 2D and high abundance in 3D cultures. Moderate Pi abundance enhanced early chondrogenesis and production of aggrecan and type II collagen whereas high Pi abundance inhibited chondrogenic differentiation and induced rapid mineralization. Inhibition of sodium phosphate transporters reduced phosphate-induced expression of chondrogenic markers. When 3D ITS+/βGP cultures were treated with levamisole to reduce ALP activity, Pi abundance was decreased to moderate levels, which resulted in significant upregulation of chondrogenic markers, similar to the response in 2D cultures. Delay of phosphate delivery until after early chondrogenesis occurs (7 days) no longer enhanced chondrogenesis, but instead accelerated hypertrophy and mineralization. Together, our data highlights the dependence of chondroprogenitor cell response to Pi on its availability to individual cells and the chondrogenic maturation stage of these cells and suggest that appropriate temporal delivery of phosphate to ATDC5 cells in 3D cultures represents a rapid model for mechanistic studies into the effects of

  3. Methyl jasmonate-induced emission of biogenic volatiles is biphasic in cucumber: a high-resolution analysis of dose dependence.

    Science.gov (United States)

    Jiang, Yifan; Ye, Jiayan; Li, Shuai; Niinemets, Ülo

    2017-07-20

    Methyl jasmonate (MeJA) is a key airborne elicitor activating jasmonate-dependent signaling pathways, including induction of stress-related volatile emissions, but how the magnitude and timing of these emissions scale with MeJA dose is not known. Treatments with exogenous MeJA concentrations ranging from mild (0.2 mM) to lethal (50 mM) were used to investigate quantitative relationships among MeJA dose and the kinetics and magnitude of volatile release in Cucumis sativus by combining high-resolution measurements with a proton-transfer reaction time-of-flight mass spectrometer (PTR-TOF-MS) and GC-MS. The results highlighted biphasic kinetics of elicitation of volatiles. The early phase, peaking in 0.1-1 h after the MeJA treatment, was characterized by emissions of lipoxygenase (LOX) pathway volatiles and methanol. In the subsequent phase, starting in 6-12 h and reaching a maximum in 15-25 h after the treatment, secondary emissions of LOX compounds as well as emissions of monoterpenes and sesquiterpenes were elicited. For both phases, the maximum emission rates and total integrated emissions increased with applied MeJA concentration. Furthermore, the rates of induction and decay, and the duration of emission bursts were positively, and the timing of emission maxima were negatively associated with MeJA dose for LOX compounds and terpenoids, except for the duration of the first LOX burst. These results demonstrate major effects of MeJA dose on the kinetics and magnitude of volatile response, underscoring the importance of biotic stress severity in deciphering the downstream events of biological impacts. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  4. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  5. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  6. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  7. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  8. Species dependent radiotracer study of Cr(VI) and Cr(III) using an aqueous biphasic system

    Energy Technology Data Exchange (ETDEWEB)

    Roy, K.; Lahiri, S. [Chemical Sciences Div., Saha Inst. of Nuclear Physics, Kolkata (India)

    2008-07-01

    The speciation study of Cr(III) and Cr(VI) was carried out using a polyethylene glycol (PEG) based aqueous biphasic extraction system (ABS). Neutron activated Cr(III) and Cr(VI) salts were assayed in a HPGe detector before and after employing aqueous biphasic extraction. Different salts of various salting out abilities were taken as the salt rich phase. The best condition for extraction of Cr(VI) and the maximum differential attitude of ABS to Cr(VI) and Cr(III) was observed when 2 M Na{sub 2}SO{sub 4} and PEG 4000 (50% w/w) solutions were used. Cr(III) can also be extracted by the PEG with prior complexation with diphenylthiocarbazone (dithizone). The chromium dithizonate complex is quantitatively extracted by the PEG rich phase. (orig.)

  9. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  10. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  11. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  12. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  13. Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

    OpenAIRE

    Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

    2000-01-01

    We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

  14. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  15. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  16. Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

    International Nuclear Information System (INIS)

    Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

    2006-01-01

    An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

  17. Monitoring operating temperature and supply voltage in achieving high system dependability

    NARCIS (Netherlands)

    Khan, M.A.; Kerkhoff, Hans G.

    2013-01-01

    System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

  18. Substrate bias voltage and deposition temperature dependence on ...

    Indian Academy of Sciences (India)

    Thin films or a coating of any sort prior to its application into real world has to be studied for the dependence of ..... For line focusing, incident beam mask was employed with ..... org/content/avs/journal/jvst/11/4/10.1116/1.1312732. Thornton J A ...

  19. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  20. Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

    Science.gov (United States)

    Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

    2016-11-14

    Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

  1. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  2. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  3. Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

    Science.gov (United States)

    Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

    2015-03-01

    Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

  4. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  5. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  6. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  7. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  8. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  9. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  10. Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

    International Nuclear Information System (INIS)

    Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

    2015-01-01

    Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

  11. Josephson tunneling current in the presence of a time-dependent voltage

    International Nuclear Information System (INIS)

    Harris, R.E.

    1975-01-01

    The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

  12. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  13. Differential Activity of Voltage- and Ca2+-Dependent Potassium Channels in Leukemic T Cell Lines: Jurkat Cells Represent an Exceptional Case

    Directory of Open Access Journals (Sweden)

    Salvador Valle-Reyes

    2018-05-01

    Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.

  14. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  15. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  16. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  17. Shaping charge excitations in chiral edge states with a time-dependent gate voltage

    Science.gov (United States)

    Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

    2018-02-01

    We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

  18. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  19. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  20. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  1. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  2. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

    Science.gov (United States)

    Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.

    2016-03-01

    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.

  3. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

    International Nuclear Information System (INIS)

    Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L

    2016-01-01

    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)

  4. Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

    Science.gov (United States)

    Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

    2010-01-01

    In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

  5. Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing

    Science.gov (United States)

    Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.

    2013-01-01

    Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the

  6. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  7. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  8. Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

    2014-03-31

    This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

  9. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  10. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  11. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  12. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    International Nuclear Information System (INIS)

    Miah, M. Idrish

    2008-01-01

    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed

  13. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    Energy Technology Data Exchange (ETDEWEB)

    Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au

    2008-10-15

    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.

  14. Exponential dependence of potential barrier height on biased voltages of inorganic/organic static induction transistor

    International Nuclear Information System (INIS)

    Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing

    2010-01-01

    The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)

  15. Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors

    International Nuclear Information System (INIS)

    Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.

    1993-01-01

    The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature

  16. Biphase sinusoidal oscillator based on negative resistor.

    Science.gov (United States)

    Bayard, Jean

    2010-06-01

    This paper describes a biphase sinusoidal generator which provides two signals: v(ref)=V(M) sin(omegat) and v(out)=V(M) sin(omegat+DeltaPhi), where DeltaPhi is in the range 0, pi/2 or -pi/2, 0 and is not dependent on the frequency value. It is based on a negative resistor and it requires very few components. SPICE simulations and measurements on an experimental setup confirm the theoretical analysis.

  17. On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

    Energy Technology Data Exchange (ETDEWEB)

    Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

    2007-04-30

    The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

  18. rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays

    International Nuclear Information System (INIS)

    Hebboul, S.E.; Garland, J.C.

    1993-01-01

    We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations

  19. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  20. Film size-dependent voltage-modulated magnetism in multiferroic heterostructures

    Science.gov (United States)

    Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.

    2014-01-01

    The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375

  1. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  2. 1,25-Dihydroxyvitamin D3 induces biphasic NF-κB responses during HL-60 leukemia cells differentiation through protein induction and PI3K/Akt-dependent phosphorylation/degradation of IκB

    International Nuclear Information System (INIS)

    Tse, A.K.-W.; Wan, C.-K.; Shen, X.-L.; Zhu, G.-Y.; Cheung, H.-Y.; Yang, M.; Fong, W.-F.

    2007-01-01

    1,25-Dihydroxyvitamin D 3 (VD 3 ) induces differentiation in a number of leukemia cell lines and under various conditions is able to either stimulate or inhibit nuclear factor kappa B (NF-κB) activity. Here we report a time-dependent biphasic regulation of NF-κB in VD 3 -treated HL-60 leukemia cells. After VD 3 treatment there was an early ∼ 4 h suppression and a late 8-72 h prolonged reactivation of NF-κB. The reactivation of NF-κB was concomitant with increased IKK activities, IKK-mediated IκBα phosphorylation, p65 phosphorylation at residues S276 and S536, p65 nuclear translocation and p65 recruitment to the NF-κB/vitamin D responsive element promoters. In parallel with NF-κB stimulation, there was an up-regulation of NF-κB controlled inflammatory and anti-apoptotic genes such as TNFα, IL-1β and Bcl-xL. VD 3 -triggered reactivation of NF-κB was associated with PI3K/Akt phosphorylation. PI3K/Akt antagonists suppressed VD 3 -stimulated IκBα phosphorylation as well as NF-κB-controlled gene expression. The early ∼ 4 h VD 3 -mediated NF-κB suppression coincided with a prolonged increase of IκBα protein which require de novo protein synthesis, lasted for as least 72 h and was insensitive to MAPK, IKK or PI3K/Akt inhibitors. Our data suggest a novel biphasic regulation of NF-κB in VD 3 -treated leukemia cells and our results may have provided the first molecular explanation for the contradictory observations reported on VD 3 -mediated immune-regulation

  3. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  4. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  5. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  6. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  7. Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram

    DEFF Research Database (Denmark)

    Nielsen, S.K.; Noat, Y.; Brandbyge, Mads

    2003-01-01

    The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...

  8. Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

    Energy Technology Data Exchange (ETDEWEB)

    Arora, N D

    1987-05-01

    A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

  9. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  10. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  11. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  12. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  13. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  14. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  15. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  16. Temperature Dependences of Torque Generation and Membrane Voltage in the Bacterial Flagellar Motor

    Science.gov (United States)

    Inoue, Yuichi; Baker, Matthew A.B.; Fukuoka, Hajime; Takahashi, Hiroto; Berry, Richard M.; Ishijima, Akihiko

    2013-01-01

    In their natural habitats bacteria are frequently exposed to sudden changes in temperature that have been shown to affect their swimming. With our believed to be new methods of rapid temperature control for single-molecule microscopy, we measured here the thermal response of the Na+-driven chimeric motor expressed in Escherichia coli cells. Motor torque at low load (0.35 μm bead) increased linearly with temperature, twofold between 15°C and 40°C, and torque at high load (1.0 μm bead) was independent of temperature, as reported for the H+-driven motor. Single cell membrane voltages were measured by fluorescence imaging and these were almost constant (∼120 mV) over the same temperature range. When the motor was heated above 40°C for 1–2 min the torque at high load dropped reversibly, recovering upon cooling below 40°C. This response was repeatable over as many as 10 heating cycles. Both increases and decreases in torque showed stepwise torque changes with unitary size ∼150 pN nm, close to the torque of a single stator at room temperature (∼180 pN nm), indicating that dynamic stator dissociation occurs at high temperature, with rebinding upon cooling. Our results suggest that the temperature-dependent assembly of stators is a general feature of flagellar motors. PMID:24359752

  17. Voltage-gated potassium channels regulate calcium-dependent pathways involved in human T lymphocyte activation.

    Science.gov (United States)

    Lin, C S; Boltz, R C; Blake, J T; Nguyen, M; Talento, A; Fischer, P A; Springer, M S; Sigal, N H; Slaughter, R S; Garcia, M L

    1993-03-01

    The role that potassium channels play in human T lymphocyte activation has been investigated by using specific potassium channel probes. Charybdotoxin (ChTX), a blocker of small conductance Ca(2+)-activated potassium channels (PK,Ca) and voltage-gated potassium channels (PK,V) that are present in human T cells, inhibits the activation of these cells. ChTX blocks T cell activation induced by signals (e.g., anti-CD2, anti-CD3, ionomycin) that elicit a rise in intracellular calcium ([Ca2+]i) by preventing the elevation of [Ca2+]i in a dose-dependent manner. However, ChTX has no effect on the activation pathways (e.g., anti-CD28, interleukin 2 [IL-2]) that are independent of a rise in [Ca2+]i. In the former case, both proliferative response and lymphokine production (IL-2 and interferon gamma) are inhibited by ChTX. The inhibitory effect of ChTX can be demonstrated when added simultaneously, or up to 4 h after the addition of the stimulants. Since ChTX inhibits both PK,Ca and PK,V, we investigated which channel is responsible for these immunosuppressive effects with the use of two other peptides, noxiustoxin (NxTX) and margatoxin (MgTX), which are specific for PK,V. These studies demonstrate that, similar to ChTX, both NxTX and MgTX inhibit lymphokine production and the rise in [Ca2+]i. Taken together, these data provide evidence that blockade of PK,V affects the Ca(2+)-dependent pathways involved in T lymphocyte proliferation and lymphokine production by diminishing the rise in [Ca2+]i that occurs upon T cell activation.

  18. The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

    International Nuclear Information System (INIS)

    Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

    2013-01-01

    Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

  19. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  20. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  1. Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer

    DEFF Research Database (Denmark)

    Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev

    1999-01-01

    bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...

  2. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  3. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  4. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  5. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  6. Voltage-probe-position dependence and magnetic-flux contribution to the measured voltage in ac transport measurements: which measuring circuit determines the real losses?

    International Nuclear Information System (INIS)

    Pe, T.; McDonald, J.; Clem, J.R.

    1995-01-01

    The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section

  7. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  8. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  9. Charge-balanced biphasic electrical stimulation inhibits neurite extension of spiral ganglion neurons.

    Science.gov (United States)

    Shen, Na; Liang, Qiong; Liu, Yuehong; Lai, Bin; Li, Wen; Wang, Zhengmin; Li, Shufeng

    2016-06-15

    Intracochlear application of exogenous or transgenic neurotrophins, such as neurotrophin-3 (NT-3) and brain derived neurotrophic factor (BDNF), could promote the resprouting of spiral ganglion neuron (SGN) neurites in deafened animals. These resprouting neurites might reduce the gap between cochlear implant electrodes and their targeting SGNs, allowing for an improvement of spatial resolution of electrical stimulation. This study is to investigate the impact of electrical stimulation employed in CI on the extension of resprouting SGN neurites. We established an in vitro model including the devices delivering charge-balanced biphasic electrical stimulation, and spiral ganglion (SG) dissociated culture treated with BDNF and NT-3. After electrical stimulation with varying durations and intensities, we quantified neurite lengths and Schwann cell densities in SG cultures. Stimulations that were greater than 50μA or longer than 8h significantly decreased SG neurite length. Schwann cell density under 100μA electrical stimulation for 48h was significantly lower compared to that in non-stimulated group. These electrical stimulation-induced decreases of neurite extension and Schwann cell density were attenuated by various types of voltage-dependent calcium channel (VDCC) blockers, or completely prevented by their combination, cadmium or calcium-free medium. Our study suggested that charge-balanced biphasic electrical stimulation inhibited the extension of resprouting SGN neurites and decreased Schwann cell density in vitro. Calcium influx through multiple types of VDCCs was involved in the electrical stimulation-induced inhibition. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Effect of combined platinum and electron on the temperature dependence of forward voltage in fast recovery diode

    International Nuclear Information System (INIS)

    Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei

    2015-01-01

    The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)

  11. Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

    DEFF Research Database (Denmark)

    Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle

    2012-01-01

    The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

  12. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  13. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

    Science.gov (United States)

    Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

    2017-08-01

    This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

  15. Size-dependent cytotoxicity of Fe3O4 nanoparticles induced by biphasic regulation of oxidative stress in different human hepatoma cells

    Directory of Open Access Journals (Sweden)

    Xie Y

    2016-07-01

    Full Text Available Yuexia Xie,1,2,* Dejun Liu,3,* Chenlei Cai,1,* Xiaojing Chen,1 Yan Zhou,1 Liangliang Wu,1 Yongwei Sun,3 Huili Dai,1,2 Xianming Kong,1,2 Peifeng Liu1,2 1Central Laboratory, 2State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, 3Department of Biliary-Pancreatic Surgery, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: The application of Fe3O4 nanoparticles (NPs has made great progress in the diagnosis of disease and in the drug delivery system for cancer therapy, but the relative mecha­nisms of potential toxicity induced by Fe3O4 have not kept pace with its development in the application, which has hampered its further clinical application. In this article, we used two kinds of human hepatoma cell lines, SK-Hep-1 and Hep3B, to investigate the cytotoxic effects and the involved mechanisms of small Fe3O4 NPs with different diameters (6 nm, 9 nm, and 14 nm. Results showed that the size of NPs effectively influences the cytotoxicity of hepatoma cells: 6 nm Fe3O4 NPs exhibited negligible cytotoxicity and 9 nm Fe3O4 NPs affected cytotoxicity via cellular mitochondrial dysfunction and by inducing necrosis mediated through the mitochondria-dependent intracellular reactive oxygen species generation. Meanwhile, 14 nm Fe3O4 NPs induced cytotoxicity by impairing the integrity of plasma membrane and promoting massive lactate dehydrogenase leakage. These results explain the detailed mechanism of different diameters of small Fe3O4 NPs-induced cytotoxicity. We anticipate that this study will provide different insights into the cytotoxicity mechanism of Fe3O4 NPs, so as to make them safer to use in clinical application. Keywords: hepatoma cells, nanoparticles, cytotoxicity, mechanism, oxidative stress

  16. Current-voltage curve of sodium channels and concentration dependence of sodium permeability in frog skin

    DEFF Research Database (Denmark)

    Fuchs, W; Larsen, Erik Hviid; Lindemann, B

    1977-01-01

    1. The inward facing membranes of in vitro frog skin epithelium were depolarized with solutions of high K concentration. The electrical properties of the epithelium are then expected to be governed by the outward facing, Na-selective membrane.2. In this state, the transepithelial voltage (V...... was recorded. This procedure was repeated after blocking the Na channels with amiloride to obtain the current-voltage curve of transmembrane and paracellular shunt pathways. The current-voltage curve of the Na channels was computed by subtracting the shunt current from the total current.4. The instantaneous I...... of the inward facing membranes but reflects the true behaviour of P(Na).6. The steady-state P(Na) at a given (Na)(o) is smaller than the transient P(Na) observed right after a stepwise increase of (Na)(o) to this value. The time constant of P(Na)-relaxation is in the order of seconds.7. In conclusion, Na...

  17. E-cigarettes: voltage- and concentration-dependent loss in human lung adenocarcinoma viability.

    Science.gov (United States)

    Otręba, Michał; Kośmider, Leon; Knysak, Jakub; Warncke, Jared D; Sobczak, Andrzej

    2018-04-17

    E-cigarettes are used by millions of people despite the fact that the harmful effect of aerosol emitted from these products to the human organism is still not clear. In this paper, toxicity of vapor generated using different solutions and battery output voltage on A549 cells viability is presented. The obtained EC 50 values for commercially available propylene glycol/glycerol solution 1:1 e-liquids based on 3.2 V (0.127%), 4.0 V (0.112%) and 4.8 V (0.038%) were about 1.5-4.5 times higher than in tobacco smoke (0.0086%). Furthermore, it was shown that the increase of battery output voltage decreased A549 cell viability. In addition, commercially available extracts were more cytotoxic than laboratory made extracts. Owing to the expansiveness of e-cigarettes, it is very important to estimate their impact on public health. Our results not only confirm less cytotoxicity of e-liquid aerosol than cigarette smoke, but also demonstrate that solutions used in e-liquids and, for the first time, battery output voltage have a significant impact on cytotoxicity of e-cigarette vapor. Thus, the results of this study are very important for the current and future legal regulations on e-cigarettes. Copyright © 2018 John Wiley & Sons, Ltd.

  18. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  19. Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

    Energy Technology Data Exchange (ETDEWEB)

    Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

    2015-01-15

    In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

  20. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  1. Angular dependence of SiO2 etch rate at various bias voltages in a high density CHF3 plasma

    International Nuclear Information System (INIS)

    Lee, Gyeo-Re; Hwang, Sung-Wook; Min, Jae-Ho; Moon, Sang Heup

    2002-01-01

    The dependence of the SiO 2 etch rate on the angle of ions incident on the substrate surface was studied over a bias voltage range from -20 to -600 V in a high-density CHF 3 plasma using a Faraday cage to control the ion incident angle. The effect of the bottom plane on the sidewall etching was also examined. Differences in the characteristics of the etch rate as a function of the ion angle were observed for different bias voltage regions. When the absolute value of the bias voltage was smaller than 200 V, the normalized etch rate (NER) defined as the etch rate normalized by the rate on the horizontal surface, changed following a cosine curve with respect to the ion incident angle, defined as the angle between the ion direction and the normal of the substrate surface. When the magnitude of the bias voltage was larger than 200 V, the NER was deviated to higher values from those given by a cosine curve at ion angles between 30 deg. and 70 deg. , and then drastically decreased at angles higher than 70 deg. until a net deposition was observed at angles near 90 deg. . The characteristic etch-rate patterns at ion angles below 70 deg. were determined by the ion energy transferred to the surface, which affected the SiO 2 etch rate and, simultaneously, the rate of removal of a fluorocarbon polymer film formed on the substrate surface. At high ion angles, particles emitted from the bottom plane contributed to polymer formation on and affected the etching characteristics of the substrate

  2. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  3. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  4. Temperature dependence of current–voltage characteristics of Au/n ...

    Indian Academy of Sciences (India)

    Unknown

    2000-05-05

    May 5, 2000 ... factor with temperature has been explained considering lateral inhomogeneities in the Schottky barrier height ... The dependence of SBH on temperature can give ... effect in MS contacts, Tung has modeled the influence.

  5. A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

    Science.gov (United States)

    Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

    2017-05-01

    Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

  6. Transport characteristics of n-ZnO/p-Si heterojunction as determined from temperature dependent current–voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Djiokap, S.R. Tankio, E-mail: stive.tankiodjiokap@nmmu.ac.za; Urgessa, Z.N.; Mbulanga, C.M.; Venter, A.; Botha, J.R.

    2016-01-01

    Zinc oxide (ZnO) nanorods have been synthesized by a two-step chemical bath deposition process on silicon substrates having different dopant densities and orientations. Scanning electron microscopy and X-ray diffraction analysis reveal that the orientation of the Si substrate does not affect the orientation, distribution or crystallinity of the nanostructures. The electrical properties of the ZnO/Si heterojunction are also investigated by current–voltage (I–V) measurements. The ideality factor is found to be 2.6 at 295 K, indicating that complex current transport mechanisms are at play. Temperature dependent I–V characteristics have been used to determine the dominant transport mechanism. The experimental results suggest that in the low bias region the current is dominated by a trap assisted multi-step tunneling process.

  7. Study of the Dependency on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter

    Science.gov (United States)

    Gottardi, L.; Bruijn, M.; denHartog, R.; Hoevers, H.; deKorte, P.; vanderKuur, J.; Linderman, M.; Adams, J.; Bailey, C.; Bandler, S.; hide

    2012-01-01

    At SRON we are studying the performance of a Goddard Space Flight Center single pixel TES microcalorimeter operated in an AC bias configuration. For x-ray photons at 6 keV the pixel shows an x-ray energy resolution Delta E(sub FWHM) = 3.7 eV, which is about a factor 2 worse than the energy resolution observed in an identical DC-biased pixel. In order to better understand the reasons for this discrepancy we characterized the detector as a function of temperature, bias working point and applied perpendicular magnetic field. A strong periodic dependency of the detector noise on the TES AC bias voltage is measured. We discuss the results in the framework of the recently observed weak-link behaviour of a TES microcalorimeter.

  8. Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

    OpenAIRE

    Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

  9. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua [Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 and Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States); NRE, 202 Nuclear Science Building, University of Florida, P.O. Box 118300, Gainesville, Florida 32611-8300 and Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); ViewRay Inc., 2 Thermo Fisher Way, Oakwood Village, Ohio 44146 (United States); Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States)

    2010-02-15

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm{sup 3} and a diode of surface area 0.64 mm{sup 2}. The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm{sup 2} field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a {+-}0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping

  10. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    International Nuclear Information System (INIS)

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua

    2010-01-01

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm 3 and a diode of surface area 0.64 mm 2 . The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm 2 field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a ±0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping parameter between in

  11. Down-regulation of voltage-dependent sodium channels initiated by sodium influx in developing neurons

    International Nuclear Information System (INIS)

    Dargent, B.; Couraud, F.

    1990-01-01

    To address the issue of whether regulatory feedback exists between the electrical activity of a neuron and ion-channel density, the authors investigated the effect of Na + -channel activators (scorpion α toxin, batrachotoxin, and veratridine) on the density of Na + channels in fetal rat brain neurons in vitro. A partial but rapid (t 1/2 , 15 min) disappearance of surface Na + channels was observed as measured by a decrease in the specific binding of [ 3 H]saxitoxin and 125 I-labeled scorpion β toxin and a decrease in specific 22 Na + uptake. Moreover, the increase in the number of Na + channels that normally occurs during neuronal maturation in vitro was inhibited by chronic channel activator treatment. The induced disappearance of Na + channels was abolished by tetrodotoxin, was found to be dependent on the external Na + concentration, and was prevented when either choline (a nonpermeant ion) or Li + (a permeant ion) was substituted for Na + . Amphotericin B, a Na + ionophore, and monensin were able to mimick the effect of Na + -channel activators, while a KCl depolarization failed to do this. This feedback regulation seems to be a neuronal property since Na + -channel density in cultured astrocytes was not affected by channel activator treatment or by amphotericin B. The present evidence suggests that an increase in intracellular Na + concentration, whether elicited by Na + -channel activators or mediated by a Na + ionophore, can induce a decrease in surface Na + channels and therefore is involved in down-regulation of Na + -channel density in fetal rat brain neurons in vitro

  12. Cell-type-dependent action potentials and voltage-gated currents in mouse fungiform taste buds.

    Science.gov (United States)

    Kimura, Kenji; Ohtubo, Yoshitaka; Tateno, Katsumi; Takeuchi, Keita; Kumazawa, Takashi; Yoshii, Kiyonori

    2014-01-01

    Taste receptor cells fire action potentials in response to taste substances to trigger non-exocytotic neurotransmitter release in type II cells and exocytotic release in type III cells. We investigated possible differences between these action potentials fired by mouse taste receptor cells using in situ whole-cell recordings, and subsequently we identified their cell types immunologically with cell-type markers, an IP3 receptor (IP3 R3) for type II cells and a SNARE protein (SNAP-25) for type III cells. Cells not immunoreactive to these antibodies were examined as non-IRCs. Here, we show that type II cells and type III cells fire action potentials using different ionic mechanisms, and that non-IRCs also fire action potentials with either of the ionic mechanisms. The width of action potentials was significantly narrower and their afterhyperpolarization was deeper in type III cells than in type II cells. Na(+) current density was similar in type II cells and type III cells, but it was significantly smaller in non-IRCs than in the others. Although outwardly rectifying current density was similar between type II cells and type III cells, tetraethylammonium (TEA) preferentially suppressed the density in type III cells and the majority of non-IRCs. Our mathematical model revealed that the shape of action potentials depended on the ratio of TEA-sensitive current density and TEA-insensitive current one. The action potentials of type II cells and type III cells under physiological conditions are discussed. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  13. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  14. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  15. Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

    International Nuclear Information System (INIS)

    Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

  16. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  17. Acute Biphasic Effects of Ayahuasca.

    Science.gov (United States)

    Schenberg, Eduardo Ekman; Alexandre, João Felipe Morel; Filev, Renato; Cravo, Andre Mascioli; Sato, João Ricardo; Muthukumaraswamy, Suresh D; Yonamine, Maurício; Waguespack, Marian; Lomnicka, Izabela; Barker, Steven A; da Silveira, Dartiu Xavier

    2015-01-01

    Ritual use of ayahuasca, an amazonian Amerindian medicine turned sacrament in syncretic religions in Brazil, is rapidly growing around the world. Because of this internationalization, a comprehensive understanding of the pharmacological mechanisms of action of the brew and the neural correlates of the modified states of consciousness it induces is important. Employing a combination of electroencephalogram (EEG) recordings and quantification of ayahuasca's compounds and their metabolites in the systemic circulation we found ayahuasca to induce a biphasic effect in the brain. This effect was composed of reduced power in the alpha band (8-13 Hz) after 50 minutes from ingestion of the brew and increased slow- and fast-gamma power (30-50 and 50-100 Hz, respectively) between 75 and 125 minutes. Alpha power reductions were mostly located at left parieto-occipital cortex, slow-gamma power increase was observed at left centro-parieto-occipital, left fronto-temporal and right frontal cortices while fast-gamma increases were significant at left centro-parieto-occipital, left fronto-temporal, right frontal and right parieto-occipital cortices. These effects were significantly associated with circulating levels of ayahuasca's chemical compounds, mostly N,N-dimethyltryptamine (DMT), harmine, harmaline and tetrahydroharmine and some of their metabolites. An interpretation based on a cognitive and emotional framework relevant to the ritual use of ayahuasca, as well as it's potential therapeutic effects is offered.

  18. Acute Biphasic Effects of Ayahuasca.

    Directory of Open Access Journals (Sweden)

    Eduardo Ekman Schenberg

    Full Text Available Ritual use of ayahuasca, an amazonian Amerindian medicine turned sacrament in syncretic religions in Brazil, is rapidly growing around the world. Because of this internationalization, a comprehensive understanding of the pharmacological mechanisms of action of the brew and the neural correlates of the modified states of consciousness it induces is important. Employing a combination of electroencephalogram (EEG recordings and quantification of ayahuasca's compounds and their metabolites in the systemic circulation we found ayahuasca to induce a biphasic effect in the brain. This effect was composed of reduced power in the alpha band (8-13 Hz after 50 minutes from ingestion of the brew and increased slow- and fast-gamma power (30-50 and 50-100 Hz, respectively between 75 and 125 minutes. Alpha power reductions were mostly located at left parieto-occipital cortex, slow-gamma power increase was observed at left centro-parieto-occipital, left fronto-temporal and right frontal cortices while fast-gamma increases were significant at left centro-parieto-occipital, left fronto-temporal, right frontal and right parieto-occipital cortices. These effects were significantly associated with circulating levels of ayahuasca's chemical compounds, mostly N,N-dimethyltryptamine (DMT, harmine, harmaline and tetrahydroharmine and some of their metabolites. An interpretation based on a cognitive and emotional framework relevant to the ritual use of ayahuasca, as well as it's potential therapeutic effects is offered.

  19. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  20. Annealing-temperature-dependent voltage-sign reversal in all-oxide spin Seebeck devices using RuO2

    Science.gov (United States)

    Kirihara, Akihiro; Ishida, Masahiko; Yuge, Ryota; Ihara, Kazuki; Iwasaki, Yuma; Sawada, Ryohto; Someya, Hiroko; Iguchi, Ryo; Uchida, Ken-ichi; Saitoh, Eiji; Yorozu, Shinichi

    2018-04-01

    Thermoelectric converters based on the spin Seebeck effect (SSE) have attracted great attention due to their potential to offer novel applications such as energy harvesting and heat-flow sensing. For converting a SSE-induced spin current into an electric current, a transition metal film such as Pt, which exhibits large inverse spin-Hall effect (ISHE), has been typically used. In this work, we show an all-oxide SSE device using ruthenium oxide (RuO2) as a conductive film. We found that both the sign and magnitude of the SSE-induced ISHE voltage V appearing in the RuO2 film changes depending on the post annealing temperature, and that the magnitude can become larger than that of a standard SSE device using Pt. The similar sign change was also observed in Hall-resistance measurements of the RuO2 films. X-ray absorption fine structure (XAFS) spectra of as-deposited and annealed RuO2 revealed that the annealing process substantially improved the long-range crystalline order in RuO2. This suggests that change in the crystalline order may modify the dominant ISHE mechanism or electronic states in RuO2, leading to the sign reversal of V as well as the Hall coefficient. Our result demonstrates that RuO2 is an interesting material not only as a practical ISHE film but also as a testbed to study physics of spin-to-charge converters that depend on their crystalline order.

  1. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    Science.gov (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  2. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  3. Ascending-ramp biphasic waveform has a lower defibrillation threshold and releases less troponin I than a truncated exponential biphasic waveform.

    Science.gov (United States)

    Huang, Jian; Walcott, Gregory P; Ruse, Richard B; Bohanan, Scott J; Killingsworth, Cheryl R; Ideker, Raymond E

    2012-09-11

    We tested the hypothesis that the shape of the shock waveform affects not only the defibrillation threshold but also the amount of cardiac damage. Defibrillation thresholds were determined for 11 waveforms-3 ascending-ramp waveforms, 3 descending-ramp waveforms, 3 rectilinear first-phase biphasic waveforms, a Gurvich waveform, and a truncated exponential biphasic waveform-in 6 pigs with electrodes in the right ventricular apex and superior vena cava. The ascending, descending, and rectilinear waveforms had 4-, 8-, and 16-millisecond first phases and a 3.5-millisecond rectilinear second phase that was half the voltage of the first phase. The exponential biphasic waveform had a 60% first-phase and a 50% second-phase tilt. In a second study, we attempted to defibrillate after 10 seconds of ventricular fibrillation with a single ≈30-J shock (6 pigs successfully defibrillated with 8-millisecond ascending, 8-millisecond rectilinear, and truncated exponential biphasic waveforms). Troponin I blood levels were determined before and 2 to 10 hours after the shock. The lowest-energy defibrillation threshold was for the 8-milliseconds ascending ramp (14.6±7.3 J [mean±SD]), which was significantly less than for the truncated exponential (19.6±6.3 J). Six hours after shock, troponin I was significantly less for the ascending-ramp waveform (0.80±0.54 ng/mL) than for the truncated exponential (1.92±0.47 ng/mL) or the rectilinear waveform (1.17±0.45 ng/mL). The ascending ramp has a significantly lower defibrillation threshold and at ≈30 J causes 58% less troponin I release than the truncated exponential biphasic shock. Therefore, the shock waveform affects both the defibrillation threshold and the amount of cardiac damage.

  4. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  5. Dependences of the geometrical parameters of cell community on stimulation voltage and frequency in chick embryonic cardiomyocytes

    Science.gov (United States)

    Fujii, Koki; Nomura, Fumimasa; Kaneko, Tomoyuki

    2018-03-01

    To investigate the optimal conditions for electrical stimulation, communities of lined-up chick embryonic cardiomyocytes were evaluated in terms of their threshold voltage for pacing (PVMin) and the half-maximum paced frequency (PF50), with a focus on the following factors: (1) the orientation of the major axis of cell communities to the electric field (EF) direction as the external factor; (2) the number of cells in a cell community, the length of the cell community, and the mean length of cells comprising the community as the internal factors. Firstly, PVMin decreased with increasing length of the cell network oriented parallel to the EF. PVMin was approximately 0.041 ± 0.025 V/mm when the community was sufficiently long. On the other hand, PVMin in the orthogonal orientation was constant at 1.7 ± 0.047 V/mm with no dependence on the length of the cell network. Secondly, we found that PF50 increased with increasing length of the cell network or the number of cells in the network; the PF50 values were 2.03 ± 0.05 and 3.39 ± 0.05 Hz when the respective cell network lengths were 100 µm (n = 43) and more than 300 µm (n = 6) and the cells were oriented parallel to the EF. These findings indicate that it is important to suppress ventricular fibrillation with minimal efficient stimulation by considering the EF direction with respect to the orientation of cardiomyocytes. Furthermore, expanded cells showed the loss of ability to respond to stimulation at higher frequencies. Cardiomyocytes combined with seeded fibroblasts as a cell network at a low density are a possible model of a ventricular remodeling heart.

  6. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  8. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Irreversible magnetic-field dependence of ferromagnetic resonance and inverse spin Hall effect voltage in CoFeB/Pt bilayer

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang-Il [Department of Materials Science and Engineering, Korea University, Seoul, 136-713 (Korea, Republic of); Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Seo, Min-Su [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Choi, Yeon Suk, E-mail: ychoi@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Park, Seung-Young, E-mail: parksy@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of)

    2017-01-01

    Magnetic field (H) sweeping direction dependences of the mixed voltage V{sub mix} induced by the inverse-spin Hall effect(ISHE) and spin-rectified effect (SRE) in a CoFeB (5 nm)/Pt (10 nm) bilayer structure are investigated using the ferromagnetic resonance in the TE mode cavities and coplanar waveguide methods. Conventionally, the magnitude of ISHE voltage V{sub ISH} (symmetric) excluding the SRE (antisymmetric component) was unavoidably separated from the fitting curve of V{sub mix} (a sum of a symmetric and an antisymmetric part) for one direction of H-source. By studying the ratio of the two voltage parts with the bi-directional H sweeping, the optimized V{sub ISH} (no SRE condition) value which also include a well-defined spin Hall angle can be obtained via the linear response relation of ISHE and SRE components. - Highlights: • Hysteretic behavior of ferromagnetic resonance spectra in the CoFeB/Pt sample. • Hysteretic behavior of inverse-spin Hall effect voltage in the CoFeB/Pt sample. • Proportion of inverse spin-Hall effect voltage can be determined by the cavity mode. • The hysteretic behavior arise from the unsaturated magnetization limit. • The well-defined spin Hall angle which consider a hysteresis can be obtained.

  10. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  11. Biphasic calcium phosphate–casein bone graft fortified with Cassia

    Indian Academy of Sciences (India)

    Biphasic calcium phosphate; bone graft; Cassia occidentalis; simulated body fluid; SaOS-2 cell line. ... The study investigates the efficacy of CO extract incorporated biphasic calcium phosphate as an osteoinductive material. ... Current Issue

  12. Discrimination Voltage and Overdrive Bias Dependent Performance Evaluation of Passively Quenched SiC Single-Photon-Counting Avalanche Photodiodes

    International Nuclear Information System (INIS)

    Liu Fei; Yang Sen; Zhou Dong; Lu Hai; Zhang Rong; Zheng You-Dou

    2015-01-01

    In many critical civil and emerging military applications, low-level UV detection, sometimes at single photon level, is highly desired. In this work, a mesa-type 4H-SiC UV avalanche photodiode (APD) is designed and fabricated, which exhibits low leakage current and high avalanche gain. When studied by using a passive quenching circuit, the APD exhibits self-quenching characteristics due to its high differential resistance in the avalanche region. The single photon detection efficiency and dark count rate of the APD are evaluated as functions of discrimination voltage and over-drive voltage. The optimized operation conditions of the single photon counting APD are discussed. (paper)

  13. Mediated water electrolysis in biphasic systems.

    Science.gov (United States)

    Scanlon, Micheál D; Peljo, Pekka; Rivier, Lucie; Vrubel, Heron; Girault, Hubert H

    2017-08-30

    The concept of efficient electrolysis by linking photoelectrochemical biphasic H 2 evolution and water oxidation processes in the cathodic and anodic compartments of an H-cell, respectively, is introduced. Overpotentials at the cathode and anode are minimised by incorporating light-driven elements into both biphasic reactions. The concepts viability is demonstrated by electrochemical H 2 production from water splitting utilising a polarised water-organic interface in the cathodic compartment of a prototype H-cell. At the cathode the reduction of decamethylferrocenium cations ([Cp 2 *Fe (III) ] + ) to neutral decamethylferrocene (Cp 2 *Fe (II) ) in 1,2-dichloroethane (DCE) solvent takes place at the solid electrode/oil interface. This electron transfer process induces the ion transfer of a proton across the immiscible water/oil interface to maintain electroneutrality in the oil phase. The oil-solubilised proton immediately reacts with Cp 2 *Fe (II) to form the corresponding hydride species, [Cp 2 *Fe (IV) (H)] + . Subsequently, [Cp 2 *Fe (IV) (H)] + spontaneously undergoes a chemical reaction in the oil phase to evolve hydrogen gas (H 2 ) and regenerate [Cp 2 *Fe (III) ] + , whereupon this catalytic Electrochemical, Chemical, Chemical (ECC') cycle is repeated. During biphasic electrolysis, the stability and recyclability of the [Cp 2 *Fe (III) ] + /Cp 2 *Fe (II) redox couple were confirmed by chronoamperometric measurements and, furthermore, the steady-state concentration of [Cp 2 *Fe (III) ] + monitored in situ by UV/vis spectroscopy. Post-biphasic electrolysis, the presence of H 2 in the headspace of the cathodic compartment was established by sampling with gas chromatography. The rate of the biphasic hydrogen evolution reaction (HER) was enhanced by redox electrocatalysis in the presence of floating catalytic molybdenum carbide (Mo 2 C) microparticles at the immiscible water/oil interface. The use of a superhydrophobic organic electrolyte salt was critical to

  14. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  15. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  16. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  17. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  18. Metal separations using aqueous biphasic partitioning systems

    International Nuclear Information System (INIS)

    Chaiko, D.J.; Zaslavsky, B.; Rollins, A.N.; Vojta, Y.; Gartelmann, J.; Mego, W.

    1996-01-01

    Aqueous biphasic extraction (ABE) processes offer the potential for low-cost, highly selective separations. This countercurrent extraction technique involves selective partitioning of either dissolved solutes or ultrafine particulates between two immiscible aqueous phases. The extraction systems that the authors have studied are generated by combining an aqueous salt solution with an aqueous polymer solution. They have examined a wide range of applications for ABE, including the treatment of solid and liquid nuclear wastes, decontamination of soils, and processing of mineral ores. They have also conducted fundamental studies of solution microstructure using small angle neutron scattering (SANS). In this report they review the physicochemical fundamentals of aqueous biphase formation and discuss the development and scaleup of ABE processes for environmental remediation

  19. The recombination correction and the dependence of the response of plane parallel chambers on the polarizing voltage in pulsed electron and photon beams

    International Nuclear Information System (INIS)

    Roos, M.; Derikum, K.

    2000-01-01

    Based on an experimental investigation of the recombination effect in plane parallel chambers, a relation is deduced that allows the correction to be calculated from the electrode spacing and from the dose per pulse. It is shown that the uncertainties caused by the application of the Boag formula for volume recombination (recommended in the International Code of Practice TRS-381) amount to not more than about 0.1% for conventional beams. Calculated recombinations are compared with experimental results concerning the dependence of the response of various commercial plane parallel chambers on the polarizing voltage. Since it cannot be excluded that particular chambers collect a non-negligible amount of charge from regions outside the designated collecting volume or that the effective polarizing voltage is reduced by poor contacts, it seems advisable to experimentally check the chambers before use and before application of the analytical relations. (author)

  20. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  1. Modeling on oxide dependent 2DEG sheet charge density and threshold voltage in AlGaN/GaN MOSHEMT

    Science.gov (United States)

    Panda, J.; Jena, K.; Swain, R.; Lenka, T. R.

    2016-04-01

    We have developed a physics based analytical model for the calculation of threshold voltage, two dimensional electron gas (2DEG) density and surface potential for AlGaN/GaN metal oxide semiconductor high electron mobility transistors (MOSHEMT). The developed model includes important parameters like polarization charge density at oxide/AlGaN and AlGaN/GaN interfaces, interfacial defect oxide charges and donor charges at the surface of the AlGaN barrier. The effects of two different gate oxides (Al2O3 and HfO2) are compared for the performance evaluation of the proposed MOSHEMT. The MOSHEMTs with Al2O3 dielectric have an advantage of significant increase in 2DEG up to 1.2 × 1013 cm-2 with an increase in oxide thickness up to 10 nm as compared to HfO2 dielectric MOSHEMT. The surface potential for HfO2 based device decreases from 2 to -1.6 eV within 10 nm of oxide thickness whereas for the Al2O3 based device a sharp transition of surface potential occurs from 2.8 to -8.3 eV. The variation in oxide thickness and gate metal work function of the proposed MOSHEMT shifts the threshold voltage from negative to positive realizing the enhanced mode operation. Further to validate the model, the device is simulated in Silvaco Technology Computer Aided Design (TCAD) showing good agreement with the proposed model results. The accuracy of the developed calculations of the proposed model can be used to develop a complete physics based 2DEG sheet charge density and threshold voltage model for GaN MOSHEMT devices for performance analysis.

  2. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  3. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad; Ali, Rashid Ayesha

    2013-01-01

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  4. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad

    2013-09-03

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  5. Achieving consistent image quality and overall radiation dose reduction for coronary CT angiography with body mass index-dependent tube voltage and tube current selection

    International Nuclear Information System (INIS)

    Wang, G.; Gao, J.; Zhao, S.; Sun, X.; Chen, X.; Cui, X.

    2014-01-01

    Aim: To develop a quantitative body mass index (BMI)-dependent tube voltage and tube current selection method for obtaining consistent image quality and overall dose reduction in computed tomography coronary angiography (CTCA). Methods and materials: The images of 190 consecutive patients (group A) who underwent CTCA with fixed protocols (100 kV/193 mAs for 100 patients with a BMI of <27 and 120 kV/175 mAs for 90 patients with a BMI of >27) were retrospectively analysed and reconstructed with an adaptive statistical iterative reconstruction (ASIR) algorithm at 50% blending. Image noise was measured and the relationship to BMI was studied to establish BMI-dependent tube current for obtaining CTCA images with user-specified image noise. One hundred additional cardiac patients (group B) were examined using prospective triggering with the BMI-dependent tube voltage/current. CTCA image-quality score, image noise, and effective dose from groups B and C (subgroup of A of 100 patients examined with prospective triggering only) were obtained and compared. Results: There was a linear relationship between image noise and BMI in group A. Using a BMI-dependent tube current in group B, an average CTCA image noise of 27.7 HU (target 28 HU) and 31.7 HU (target 33 HU) was obtained for the subgroups of patients with BMIs of >27 and of <27, respectively, and was independent of patient BMI. There was no difference between image-quality scores between groups B and C (4.52 versus 4.60, p > 0.05). The average effective dose for group B (2.56 mSv) was 42% lower than group C (4.38 mSv; p < 0.01). Conclusion: BMI-dependent tube voltage/current selection in CTCA provides an individualized protocol that generates consistent image quality and helps to reduce overall patient radiation dose. - Highlights: • BMI-dependent kVp and mA selection method may be established in CCTA. • BMI-dependent kVp and mA enables consistent CCTA image quality. • Overall dose reduction of 40% can

  6. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  7. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  8. Three dimensional biphasic calcium phosphate nanocomposites for load bearing bioactive bone grafts

    Energy Technology Data Exchange (ETDEWEB)

    Garai, Subhadra, E-mail: subha@nmlindia.org; Sinha, Arvind

    2016-02-01

    Mimicking matrix mediated bio-mineralization process, three dimensional blocks of biphasic calcium phosphate (BCP, hydroxyapatite (HA) and β-tricalcium phosphate (TCP)) nanocomposites, having three different stoichiometries have been synthesized for possible application as load bearing synthetic bone graft or scaffolds. Biphasic blocks with three weight ratios of 20:80, 25:75 and 30:70 of HA and TCP respectively have been synthesized. Detailed structural and chemical characterization of the samples revealed a strong dependence of porosity and mechanical properties on the stoichiometry of biphasic blocks. Effect of physiological medium on the microstructure and mechanical properties of the three different blocks has also been studied. Bioactivity of the BCP block, exhibiting highest compressive strength in air as well as in physiological medium, has been evaluated through adhesion, proliferation and differentiation of mesenchymal stem cells using different markers. - Highlights: • Developed a process for the synthesis of load bearing 3d- biphasic nanocomposites. • Synthesized nanocomposites exhibited in vitro osteoconductivity and osteoinductivity for bone marrow mesenchymal cells. • Developed process is a matrix mediated biomimetic one.

  9. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  10. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  11. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  12. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

    Science.gov (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

    2011-04-18

    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  13. Temperature Dependency and Alpha Response of Semi-Insulating GaAs Schottky Radiation Detector at Low Bias Voltage

    International Nuclear Information System (INIS)

    Kang, Sang Mook; Ha, Jang Ho; Park, Se Hwan; Kim, Han Soo; Kim, Yong Kyun

    2009-01-01

    The last decade has seen a growing interest in semiconductor radiation detectors operated at room or nearly room temperature. Great efforts have been invested in the development of radiation detectors based on semi-insulating (SI) GaAs. The main reasons are as follows: (i) high resistance against radiation damage; (ii) it possesses a good energy resolution, which relates to its active volume; (iii) such a detector also exhibits fast signal rise times, which results from a high mobility and drift velocity of charge carriers; (iv) its large band gap energy allows a SI GaAs detector to operate at room temperature. Other important features are a good technology base and low production and operating costs. An alpha particle monitoring method for the detection of Pu-238 and U-235 is becoming important in homeland security. Alpha measurement in a vacuum is known to provide a good resolution sufficient to separate an isotope abundance in nuclear materials. However, in order to apply it to a high radiation field like a spent fuel treatment facility, a nuclear material loading and unloading process in a vacuum is one of the great disadvantages. Therefore, the main technical issue is to develop a detector for alpha detection at air condition and low power operation for integration type device. In this study we fabricated GaAs Schottky detector by using semi-insulating (SI) wafer and measured current-voltage characteristic curve and alpha response with 5.5 MeV Am-241 source

  14. Bias voltage dependence of molecular orientation of dialkyl ketone and fatty acid alkyl ester at the liquid–graphite interface

    Energy Technology Data Exchange (ETDEWEB)

    Hibino, Masahiro, E-mail: hibino@mmm.muroran-it.ac.jp [Department of Applied Sciences, Muroran Institute of Technology, 27-1 Mizumoto-cho, Muroran 050-8585 (Japan); Tsuchiya, Hiroshi [Department of Applied Physics, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan)

    2014-10-30

    Graphical abstract: - Highlights: • Self-assembled monolayers (SAMs) of 18-pentatriacontanone (as ketone) and stearyl stearate (as ester) were formed on a graphite surface at the liquid–solid interface. • Orientations of the molecules in SAMs on the substrate were studied by scanning tunneling microscopy. • A perpendicular carbon skeleton-plane orientation with the CO pointing up on the surface is favorable for a substrate with negative charge and vice versa. - Abstract: Molecular orientations of self-assembled 18-pentatriacontanone (as ketone) and stearyl stearate (as ester) monolayers adsorbed on a graphite surface were studied by scanning tunneling microscopy (STM) at the liquid–solid interface. At a positive sample bias, the central areas of the dialkyl ketone and fatty acid alkyl ester molecules in the STM images appeared as two bright regions on both sides of a dim spot and a bright region on one side of a dim spot, whereas at a negative sample bias, the areas appeared dim. This contrast variation indicates that a perpendicular carbon skeleton-plane orientation with the CO pointing down on the surface is favorable for a substrate with positive charge and vice versa because of the greater electronegativity of the oxygen atom. Upon the bias voltage reversal, the delay time for the STM image contrast change in the region was observed on a time scale of minutes. The difference between the delay time lengths for the direction of bias polarity change indicates that the perpendicular configuration with CO pointing up is more stable than that with CO pointing down. These results indicate that the use of an electric field along a direction vertical to the monolayer on the substrate provides control over the orientations of the molecules between two stable states at the liquid–solid interface.

  15. Biphasic regulation of development of the high-affinity saxitoxin receptor by innervation in rat skeletal muscle

    International Nuclear Information System (INIS)

    Sherman, S.J.; Catterall, W.A.

    1982-01-01

    Specific binding of 3 H-saxitoxin (STX) was used to quantitate the density of voltage-sensitive sodium channels in developing rat skeletal muscle. In adult triceps surae, a single class of sites with a KD . 2.9 nM and a density of 21 fmol/mg wet wt was detected. The density of these high-affinity sites increased from 2.0 fmol/mg wet wt to the adult value in linear fashion during days 2-25 after birth. Denervation of the triceps surae at day 11 or 17 reduced final saxitoxin receptor site density to 10.4 or 9.2 fmol/mg wet wt, respectively, without changing KD. Denervation of the triceps surae at day 5 did not alter the subsequent development of saxitoxin receptor sites during days 5-9 and accelerated the increase of saxitoxin receptor sites during days 9-13. After day 13, saxitoxin receptor development abruptly ceased and the density of saxitoxin receptor sites declined to 11 fmol/wg wet wt. These results show that the regulation of high-affinity saxitoxin receptor site density by innervation is biphasic. During the first phase, which is independent of continuing innervation, the saxitoxin receptor density increases to 47-57% of the adult level. After day 11, the second phase of development, which is dependent on continuing innervation, gives rise to the adult density of saxitoxin receptors

  16. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  17. Bias-voltage dependence of perpendicular spin-transfer torque in asymmetric MgO-based magnetic tunnel junctions

    KAUST Repository

    Oh, Se Chung; Park, Seung Young; Manchon, Aurelien; Chshiev, Mairbek; Han, Jae Ho; Lee, Hyun Woo; Lee, Jang Eun; Nam, Kyung Tae; Jo, Younghun; Kong, Yo Chan; Dieny, Bernard; Lee, Kyung Jin

    2009-01-01

    Spin-transfer torque (STT) allows the electrical control of magnetic states in nanostructures. The STT in magnetic tunnel junctions (MTJs) is of particular importance owing to its potential for device applications. It has been demonstrated that the MTJ has a sizable perpendicular STT (, field-like torque), which substantially affects STT-driven magnetization dynamics. In contrast to symmetric MTJs where the bias dependence of is quadratic, it is theoretically predicted that the symmetry breaking of the system causes an extra linear bias dependence. Here, we report experimental results that are consistent with the predicted linear bias dependence in asymmetric MTJs. The linear contribution is quite significant and its sign changes from positive to negative as the asymmetry is modified. This result opens a way to design the bias dependence of the field-like term, which is useful for device applications by allowing, in particular, the suppression of the abnormal switching-back phenomena. © 2009 Macmillan Publishers Limited. All rights reserved.

  18. Bias-voltage dependence of perpendicular spin-transfer torque in asymmetric MgO-based magnetic tunnel junctions

    KAUST Repository

    Oh, Se Chung

    2009-10-25

    Spin-transfer torque (STT) allows the electrical control of magnetic states in nanostructures. The STT in magnetic tunnel junctions (MTJs) is of particular importance owing to its potential for device applications. It has been demonstrated that the MTJ has a sizable perpendicular STT (, field-like torque), which substantially affects STT-driven magnetization dynamics. In contrast to symmetric MTJs where the bias dependence of is quadratic, it is theoretically predicted that the symmetry breaking of the system causes an extra linear bias dependence. Here, we report experimental results that are consistent with the predicted linear bias dependence in asymmetric MTJs. The linear contribution is quite significant and its sign changes from positive to negative as the asymmetry is modified. This result opens a way to design the bias dependence of the field-like term, which is useful for device applications by allowing, in particular, the suppression of the abnormal switching-back phenomena. © 2009 Macmillan Publishers Limited. All rights reserved.

  19. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  20. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  1. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Investigation of the transport properties of metals in the biphase region

    International Nuclear Information System (INIS)

    Oreshkin, V. I.; Rousskikh, A. G.; Chaikovsky, S. A.; Oreshkin, E. V.

    2010-01-01

    Results of experiments on electrical wire explosion are presented and processes of stratum formation and decay are analyzed in this paper. A procedure of calculating the transport coefficients from the rate of stratum damping is described. It is demonstrated that values of the transport coefficients for metals are not an unambiguous function of the material state in the biphase region for characteristic times of ∼10 -7 s but depend on the process prehistory.

  3. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  4. Low-temperature VRH conduction through complex materials in the presence of a temperature-dependent voltage threshold: A semi-classical percolative approach

    International Nuclear Information System (INIS)

    Sen, A.K.; Bhattacharya, S.

    2006-12-01

    In this paper, we study the variation of low temperature (T) dc conductance, G(T), of a semi-classical percolative Random Resistor cum Tunneling-bond Network (RRTN), in the presence of a linearly temperature-dependent microscopic voltage threshold, υ g (T). This model (proposed by our group in the early 90's) considers a phenomenological semi-classical tunneling (or, hopping through a barrier) process. Just as in our previous constant-υ g case, we find in the present study also that the variable range hopping (VRH) exponent γ varies continuously with the ohmic concentration p in a non-monotonic fashion. In addition, we observe a new shoulder-like behaviour of G(T) in the intermediate temperature range, below the conductance maximum. (author)

  5. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  6. Obtaining of ceramics biphasic dense and porous

    International Nuclear Information System (INIS)

    Pallone, E.M.J.A.; Rigo, E.C.S.; Fraga, A.F.

    2010-01-01

    Among the bioceramic hydroxyapatite (HAP) and beta-tricalcium phosphate (beta-TCP) are materials commonly used in biomedical field. Their combined properties result in a material with absorbable and at the same time with bioactive surface. Called biphasic ceramics such materials respond more quickly when exposed to physiological environment. In this work, powders of HAP/beta-TCP were obtained by chemical precipitation. After obtaining the post-phase was added at a ratio of 0, 15% and 30w% aqueous solutions of corn starch in order to obtain porous bodies. After mixing the resulting solutions were dried, resigned in tablet form and sintered at 1300 deg C. The initial powder was characterized by X-ray diffraction with Rietveld refinement to quantify the phases present. Bodies-of-evidence has been characterized by calculating the bulk density, X-ray diffraction (XRD), scanning electron microscopy and diametral compression. (author)

  7. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  8. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  9. Large time-dependent coercivity and resistivity modification under sustained voltage application in a Pt/Co/AlOx/Pt junction.

    NARCIS (Netherlands)

    Brink, van den A.; van der Heijden, M.A.J.; Swagten, H.J.M.; Koopmans, B.

    2015-01-01

    The coercivity and resistivity of a Pt/Co/AlOx/Pt junction are measured under sustained voltage application. High bias voltages of either polarity are determined to cause a strongly enhanced, reversible coercivity modification compared to low voltages. Time-resolved measurements show a logarithmic

  10. Investigation of p-n-junctions in n-InP based on voltage dependence of differential capacity

    International Nuclear Information System (INIS)

    Agaev, Ja.; Atabaev, Kh.; Gazakov, O.; Sadykov, K.B.

    1976-01-01

    The barrier capacity of alloyed p-n transitions on n-InP crystals grown by the crystallization method has been investigated. The transitions have been obtained by fusing In + 3 - 10% Zn. Step-by-step distribution of the impurity concentration in the space charge layer takes place in the alloyed diodes under investigation. The coefficient characterizing the impurity distribution in the space charge layer has been determined. The well-expressed dependence of I/C 2 =f/u) observed both at a room temperature and at the temperature of liquid nitrogen indicates that the density of ground carriers in the p-n regions are constant at a definite distance from the p-n transition. The main parameters of p-n transitions have been determined

  11. Production of Phytotoxic Metabolite Using Biphasic Fermentation System from Strain C1136 of Lasiodiplodia pseudotheobromae, a Potential Bioherbicidal Agent

    Directory of Open Access Journals (Sweden)

    Charles Oluwaseun ADETUNJI

    2017-09-01

    Full Text Available Formulation of effective and environmental friendly bioherbicides depends on the type of fermentation medium used for the production of phytotoxic metabolites. The effect of biomass, colony forming unit and the phytotoxic metabolite produced from the biphasic fermentation was carried out, while the phytotoxic metabolite was tested in vivo and in-vitro on Echinochola crus-galli and dicotyledonous Chromolaena odorata. The mutant strain of Lasiodiplodia pseudotheobromae C1136 (Lp90 produced the highest amount of conidia and the largest necrotic area on the two tested weeds when compared to its wild strain in the different biphasic media combinations. The study revealed that the biphasic system containing PDB + rice produced the highest bioherbicidal activities. Therefore, the phytotoxic metabolites from strain C1136 are suggested for large scale production of bioherbicides for the management of weeds in conventional farming to improve yield and enhance food security.

  12. Design and development of a low-cost biphasic charge-balanced functional electric stimulator and its clinical validation.

    Science.gov (United States)

    Shendkar, Chandrashekhar; Lenka, Prasanna K; Biswas, Abhishek; Kumar, Ratnesh; Mahadevappa, Manjunatha

    2015-10-01

    Functional electric stimulators that produce near-ideal, charge-balanced biphasic stimulation waveforms with interphase delay are considered safer and more efficacious than conventional stimulators. An indigenously designed, low-cost, portable FES device named InStim is developed. It features a charge-balanced biphasic single channel. The authors present the complete design, mathematical analysis of the circuit and the clinical evaluation of the device. The developed circuit was tested on stroke patients affected by foot drop problems. It was tested both under laboratory conditions and in clinical settings. The key building blocks of this circuit are low dropout regulators, a DC-DC voltage booster and a single high-power current source OP-Amp with current-limiting capabilities. This allows the device to deliver high-voltage, constant current, biphasic pulses without the use of a bulky step-up transformer. The advantages of the proposed design over the currently existing devices include improved safety features (zero DC current, current-limiting mechanism and safe pulses), waveform morphology that causes less muscle fatigue, cost-effectiveness and compact power-efficient circuit design with minimal components. The device is also capable of producing appropriate ankle dorsiflexion in patients having foot drop problems of various Medical Research Council scale grades.

  13. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  14. Selective formation of biphasic thin films of metal–organic frameworks by potential-controlled cathodic electrodeposition

    OpenAIRE

    Li, Minyuan Miller; Dinca, Mircea

    2013-01-01

    Cathodic electrodeposition lends itself to the formation of biphasic metal–organic framework thin films at room temperature from single deposition baths using potential bias as the main user input. Depending on the applied potential, we selectively deposit two different phases as either bulk mixtures or bilayer films.

  15. Modeling and predictions of biphasic mechanosensitive cell migration altered by cell-intrinsic properties and matrix confinement.

    Science.gov (United States)

    Pathak, Amit

    2018-04-12

    Motile cells sense the stiffness of their extracellular matrix (ECM) through adhesions and respond by modulating the generated forces, which in turn lead to varying mechanosensitive migration phenotypes. Through modeling and experiments, cell migration speed is known to vary with matrix stiffness in a biphasic manner, with optimal motility at an intermediate stiffness. Here, we present a two-dimensional cell model defined by nodes and elements, integrated with subcellular modeling components corresponding to mechanotransductive adhesion formation, force generation, protrusions and node displacement. On 2D matrices, our calculations reproduce the classic biphasic dependence of migration speed on matrix stiffness and predict that cell types with higher force-generating ability do not slow down on very stiff matrices, thus disabling the biphasic response. We also predict that cell types defined by lower number of total receptors require stiffer matrices for optimal motility, which also limits the biphasic response. For a cell type with robust biphasic migration on 2D surface, simulations in channel-like confined environments of varying width and height predict faster migration in more confined matrices. Simulations performed in shallower channels predict that the biphasic mechanosensitive cell migration response is more robust on 2D micro-patterns as compared to the channel-like 3D confinement. Thus, variations in the dimensionality of matrix confinement alters the way migratory cells sense and respond to the matrix stiffness. Our calculations reveal new phenotypes of stiffness- and topography-sensitive cell migration that critically depend on both cell-intrinsic and matrix properties. These predictions may inform our understanding of various mechanosensitive modes of cell motility that could enable tumor invasion through topographically heterogeneous microenvironments. © 2018 IOP Publishing Ltd.

  16. * Fabrication and Characterization of Biphasic Silk Fibroin Scaffolds for Tendon/Ligament-to-Bone Tissue Engineering.

    Science.gov (United States)

    Font Tellado, Sònia; Bonani, Walter; Balmayor, Elizabeth R; Foehr, Peter; Motta, Antonella; Migliaresi, Claudio; van Griensven, Martijn

    2017-08-01

    Tissue engineering is an attractive strategy for tendon/ligament-to-bone interface repair. The structure and extracellular matrix composition of the interface are complex and allow for a gradual mechanical stress transfer between tendons/ligaments and bone. Thus, scaffolds mimicking the structural features of the native interface may be able to better support functional tissue regeneration. In this study, we fabricated biphasic silk fibroin scaffolds designed to mimic the gradient in collagen molecule alignment present at the interface. The scaffolds had two different pore alignments: anisotropic at the tendon/ligament side and isotropic at the bone side. Total porosity ranged from 50% to 80% and the majority of pores (80-90%) were ligament, enthesis, and cartilage markers significantly changed depending on pore alignment in each region of the scaffolds. In conclusion, the biphasic scaffolds fabricated in this study show promising features for tendon/ligament-to-bone tissue engineering.

  17. Biphasic oxidation of oxy-hemoglobin in bloodstains.

    Directory of Open Access Journals (Sweden)

    Rolf H Bremmer

    Full Text Available BACKGROUND: In forensic science, age determination of bloodstains can be crucial in reconstructing crimes. Upon exiting the body, bloodstains transit from bright red to dark brown, which is attributed to oxidation of oxy-hemoglobin (HbO(2 to met-hemoglobin (met-Hb and hemichrome (HC. The fractions of HbO(2, met-Hb and HC in a bloodstain can be used for age determination of bloodstains. In this study, we further analyze the conversion of HbO(2 to met-Hb and HC, and determine the effect of temperature and humidity on the conversion rates. METHODOLOGY: The fractions of HbO(2, met-Hb and HC in a bloodstain, as determined by quantitative analysis of optical reflectance spectra (450-800 nm, were measured as function of age, temperature and humidity. Additionally, Optical Coherence Tomography around 1300 nm was used to confirm quantitative spectral analysis approach. CONCLUSIONS: The oxidation rate of HbO(2 in bloodstains is biphasic. At first, the oxidation of HbO(2 is rapid, but slows down after a few hours. These oxidation rates are strongly temperature dependent. However, the oxidation of HbO(2 seems to be independent of humidity, whereas the transition of met-Hb into HC strongly depends on humidity. Knowledge of these decay rates is indispensable for translating laboratory results into forensic practice, and to enable bloodstain age determination on the crime scene.

  18. Temperature dependent current-voltage characteristics of Au/n-Si Schottky barrier diodes and the effect of transition metal oxides as an interface layer

    Science.gov (United States)

    Mahato, Somnath; Puigdollers, Joaquim

    2018-02-01

    Temperature dependent current-voltage (I‒V) characteristics of Au/n-type silicon (n-Si) Schottky barrier diodes have been investigated. Three transition metal oxides (TMO) are used as an interface layer between gold and silicon. The basic Schottky diode parameters such as ideality factor (n), barrier height (ϕb 0) and series resistance (Rs) are calculated and successfully explained by the thermionic emission (TE) theory. It has been found that ideality factor decreased and barrier height increased with increased of temperature. The conventional Richardson plot of ln(I0/T2) vs. 1000/T is determined the activation energy (Ea) and Richardson constant (A*). Whereas value of 'A*' is much smaller than the known theoretical value of n-type Si. The temperature dependent I-V characteristics obtained the mean value of barrier height (ϕb 0 bar) and standard deviation (σs) from the linear plot of ϕap vs. 1000/T. From the modified Richardson plot of ln(I0/T2) ˗ (qσ)2/2(kT)2 vs. 1000/T gives Richardson constant and homogeneous barrier height of Schottky diodes. Main observation in this present work is the barrier height and ideality factor shows a considerable change but the series resistance value exhibits negligible change due to TMO as an interface layer.

  19. A phenomenological model of the electrically stimulated auditory nerve fiber: temporal and biphasic response properties

    Directory of Open Access Journals (Sweden)

    Colin eHorne

    2016-02-01

    Full Text Available We present a phenomenological model of electrically stimulated auditory nerve fibers (ANFs. The model reproduces the probabilistic and temporal properties of the ANF response to both monophasic and biphasic stimuli, in isolation. The main contribution of the model lies in its ability to reproduce statistics of the ANF response (mean latency, jitter, and firing probability under both monophasic and cathodic-anodic biphasic stimulation, without changing the model’s parameters. The response statistics of the model depend on stimulus level and duration of the stimulating pulse, reproducing trends observed in the ANF. In the case of biphasic stimulation, the model reproduces the effects of pseudomonophasic pulse shapes and also the dependence on the interphase gap (IPG of the stimulus pulse, an effect that is quantitatively reproduced. The model is fitted to ANF data using a procedure that uniquely determines each model parameter. It is thus possible to rapidly parameterize a large population of neurons to reproduce a given set of response statistic distributions.Our work extends the stochastic leaky integrate and fire (SLIF neuron, a well-studied phenomenological model of the electrically stimulated neuron. We extend the SLIF neuron so as to produce a realistic latency distribution by delaying the moment of spiking. During this delay, spiking may be abolished by anodic current. By this means, the probability of the model neuron responding to a stimulus is reduced when a trailing phase of opposite polarity is introduced. By introducing a minimum wait period that must elapse before a spike may be emitted, the model is able to reproduce the differences in the threshold level observed in the ANF for monophasic and biphasic stimuli. Thus, the ANF response to a large variety of pulse shapes are reproduced correctly by this model.

  20. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  1. Biphasically Modulating the Activity of Carboxypeptidase G2 with Ultrasound

    Directory of Open Access Journals (Sweden)

    Wanying Ma

    2017-07-01

    Full Text Available Background/Aims: Carboxypeptidase G2 (CPG2 has been used for cancer prodrug therapy to realize the targeted release of active drugs, but there yet lacks a means to modulate the CPG2 activity. Here ultrasound was used to modulate the CPG2 activity. Methods: The activity of insonated CPG2 was determined, and then underlying biochemical (i.e., monomer, dimer and conformation and ultrasonic (i.e., heat and cavitation mechanisms were explored. Results: Ultrasound (1.0 MHz increased or decreased the enzymatic activity; the activity decreased as zero- or first-order kinetics, depending on the intensity. L1 (10 W/cm2 for 200 s improved the activity via increasing the specific activity. L2 or L3 (20 W/cm2 for 1200 or 3000 s decreased the activity via disassembling the dimer, degrading the monomer, inducing glycosylation, transforming conformation and decreasing the specific activity. An increase or a slight decrease of activity attributable to 10 W/cm2 was reversible, but the activity decrease due to 20 W/cm2 was irreversible. The enzymatic modulation was realized via cavitation. Conclusion: Ultrasound can biphasically modulate the CPG2 activity, and can be employed in the CPG2-prodrug therapy to adjust the release and moles of active drugs.

  2. Transport characteristics of Pd Schottky barrier diodes on epitaxial n-GaSb as determined from temperature dependent current–voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Venter, A., E-mail: andre.venter@nmmu.ac.za [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Murape, D.M.; Botha, J.R. [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Auret, F.D. [Department of Physics, University of the Pretoria, Lynnwood Road, Pretoria 0002 (South Africa)

    2015-01-01

    The temperature dependent transport characteristics of Pd/n-GaSb:Te Schottky contacts with low and saturating reverse current are investigated by means of current–voltage measurements between 80 K and 320 K. The apparent barrier height and ideality factor increase with a decrease in temperature. Neither thermionic nor thermionic field emission can explain the low temperature characteristics of these diodes. Instead, evidence is presented for barrier inhomogeneity across the metal/semiconductor contact. A plot of the barrier height, ϕ{sub b} vs. 1/2kT revealed a double Gaussian distribution for the barrier height with ϕ{sub b,mean} assuming values of 0.59 eV ± 0.07 (80–140 K) and 0.25 eV ± 0.12 (140–320 K) respectively. - Highlights: • Transport characteristics of Pd/epitaxial n-GaSb:Te SBDs are studied by means of I-V-T measurements. • SBDs have remarkably low and saturating reverse current – of the lowest ever reported for GaSb. • Transport behaviour is explained by considering electronic states present on the GaSb surface. • Evidence is presented for barrier inhomogeneity across the metal-semiconductor contact.

  3. Transport characteristics of Pd Schottky barrier diodes on epitaxial n-GaSb as determined from temperature dependent current–voltage measurements

    International Nuclear Information System (INIS)

    Venter, A.; Murape, D.M.; Botha, J.R.; Auret, F.D.

    2015-01-01

    The temperature dependent transport characteristics of Pd/n-GaSb:Te Schottky contacts with low and saturating reverse current are investigated by means of current–voltage measurements between 80 K and 320 K. The apparent barrier height and ideality factor increase with a decrease in temperature. Neither thermionic nor thermionic field emission can explain the low temperature characteristics of these diodes. Instead, evidence is presented for barrier inhomogeneity across the metal/semiconductor contact. A plot of the barrier height, ϕ b vs. 1/2kT revealed a double Gaussian distribution for the barrier height with ϕ b,mean assuming values of 0.59 eV ± 0.07 (80–140 K) and 0.25 eV ± 0.12 (140–320 K) respectively. - Highlights: • Transport characteristics of Pd/epitaxial n-GaSb:Te SBDs are studied by means of I-V-T measurements. • SBDs have remarkably low and saturating reverse current – of the lowest ever reported for GaSb. • Transport behaviour is explained by considering electronic states present on the GaSb surface. • Evidence is presented for barrier inhomogeneity across the metal-semiconductor contact

  4. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  6. Stoichiometric implications of a biphasic life cycle.

    Science.gov (United States)

    Tiegs, Scott D; Berven, Keith A; Carmack, Douglas J; Capps, Krista A

    2016-03-01

    Animals mediate flows of elements and energy in ecosystems through processes such as nutrient sequestration in body tissues, and mineralization through excretion. For taxa with biphasic life cycles, the dramatic shifts in anatomy and physiology that occur during ontogeny are expected to be accompanied by changes in body and excreta stoichiometry, but remain little-explored, especially in vertebrates. Here we tested stoichiometric hypotheses related to the bodies and excreta of the wood frog (Lithobates sylvaticus) across life stages and during larval development. Per-capita rates of nitrogen (N) and phosphorus (P) excretion varied widely during larval ontogeny, followed unimodal patterns, and peaked midway through development (Taylor-Kollros stages XV and XII, respectively). Larval mass did not increase steadily during development but peaked at stage XVII and declined until the termination of the experiment at stage XXII. Mass-specific N and P excretion rates of the larvae decreased exponentially during development. When coupled with population-biomass estimates, population-level excretion rates were greatest at stages VIII-X. Percent carbon (C), N, and C:N of body tissue showed weak trends across major life stages; body P and C:P, however, increased sixfold during development from egg to adult. Our results demonstrate that intraspecific ontogenic changes in nutrient contents of excretion and body tissues can be significant, and that N and P are not always excreted proportionally throughout life cycles. These results highlight the dynamic roles that species play in ecosystems, and how the morphological and physiological changes that accompany ontogeny can influence ecosystem-level processes.

  7. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  8. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  9. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  10. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  11. Progress on the biphase turbine at Cerro Prieto

    Energy Technology Data Exchange (ETDEWEB)

    Cerini, D.; Hays, L.; Studhalter, W. [Douglas Energy Company, Placentia, CA (United States)

    1997-12-31

    The status of a Biphase turbine power plant being installed at the Cerro Prieto geothermal field is presented. The major modules for the power plant are completed except for a back pressure steam turbine. The power plant will be started in April 1997 with the Biphase turbine alone followed by the addition of the steam turbine module two months later. The current power plant performance level is 2780 kWe due to a decline in the well. An increase in power output to 4060 kWe by adding the flow from another well is planned. The addition of five Biphase power plants with a total power output of 21.2 megawatts is described.

  12. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  13. Biphasic Malignant Pleural Mesothelioma Masquerading as a Primary Skeletal Tumor

    Directory of Open Access Journals (Sweden)

    James Benjamin Gleason

    2016-01-01

    Full Text Available Biphasic malignant pleural mesothelioma is a rare malignant tumor, usually presenting as a pleural-based mass in a patient with history of chronic asbestos exposure. We herein report a case of a 41-year-old man who presented with chest pain and had a chest computed tomography (CT scan suggestive of a primary skeletal tumor originating from the ribs (chondrosarcoma or osteosarcoma, with no history of asbestos exposure. CT-guided core needle biopsies were diagnosed as malignant sarcomatoid mesothelioma. Surgical resection and chest wall reconstruction were performed, confirming the diagnosis and revealing a secondary histologic component (epithelioid, supporting the diagnosis of biphasic malignant mesothelioma.

  14. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  15. Biphasic Rapamycin Effects in Lymphoma and Carcinoma Treatment.

    Science.gov (United States)

    Liu, Yang; Pandeswara, Srilakshmi; Dao, Vinh; Padrón, Álvaro; Drerup, Justin M; Lao, Shunhua; Liu, Aijie; Hurez, Vincent; Curiel, Tyler J

    2017-01-15

    mTOR drives tumor growth but also supports T-cell function, rendering the applications of mTOR inhibitors complex especially in T-cell malignancies. Here, we studied the effects of the mTOR inhibitor rapamycin in mouse EL4 T-cell lymphoma. Typical pharmacologic rapamycin (1-8 mg/kg) significantly reduced tumor burden via direct suppression of tumor cell proliferation and improved survival in EL4 challenge independent of antitumor immunity. Denileukin diftitox (DD)-mediated depletion of regulatory T cells significantly slowed EL4 growth in vivo in a T-cell-dependent fashion. However, typical rapamycin inhibited T-cell activation and tumor infiltration in vivo and failed to boost DD treatment effects. Low-dose (LD) rapamycin (75 μg/kg) increased potentially beneficial CD44hiCD62L + CD8 + central memory T cells in EL4 challenge, but without clinical benefit. LD rapamycin significantly enhanced DD treatment efficacy, but DD plus LD rapamycin treatment effects were independent of antitumor immunity. Instead, rapamycin upregulated EL4 IL2 receptor in vitro and in vivo, facilitating direct DD tumor cell killing. LD rapamycin augmented DD efficacy against B16 melanoma and a human B-cell lymphoma, but not against human Jurkat T-cell lymphoma or ID8agg ovarian cancer cells. Treatment effects correlated with IL2R expression, but mechanisms in some tumors were not fully defined. Overall, our data define a distinct, biphasic mechanisms of action of mTOR inhibition at doses that are clinically exploitable, including in T-cell lymphomas. Cancer Res; 77(2); 520-31. ©2016 AACR. ©2016 American Association for Cancer Research.

  16. Imaging responses of on-site CsI and Gd2O2S flat-panel detectors: Dependence on the tube voltage

    Science.gov (United States)

    Jeon, Hosang; Chung, Myung Jin; Youn, Seungman; Nam, Jiho; Lee, Jayoung; Park, Dahl; Kim, Wontaek; Ki, Yongkan; Kim, Ho Kyung

    2015-07-01

    One of the emerging issues in radiography is low-dose imaging to minimize patient's exposure. The scintillating materials employed in most indirect flat-panel detectors show a drastic change of X-ray photon absorption efficiency around their K-edge energies that consequently affects image quality. Using various tube voltages, we investigated the imaging performance of most popular scintillators: cesium iodide (CsI) and gadolinium oxysulfide (Gd2O2S). The integrated detective quantum efficiencies (iDQE) of four detectors installed in the same hospital were evaluated according to the standardized procedure IEC 62220-1 at tube voltages of 40 - 120 kVp. The iDQE values of the Gd2O2S detectors were normalized by those of CsI detectors to exclude the effects of image postprocessing. The contrast-to-noise ratios (CNR) were also evaluated by using an anthropomorphic chest phantom. The iDQE of the CsI detector outperformed that of the Gd2O2S detector over all tube voltages. Moreover, we noted that the iDQE of the Gd2O2S detectors quickly rolled off with decreasing tube voltage under 70 kVp. The CNRs of the two scintillators were similar at 120 kVp. At 60 kVp, however, the CNR of Gd2O2S was about half that of CsI. Compared to the Gd2O2S detectors, variations in the DQE performance of the CsI detectors were relatively immune to variations in the applied tube voltages. Therefore, we claim that Gd2O2S detectors are inappropriate for use in low-tube-voltage imaging (e.g., extremities and pediatrics) with low patient exposure.

  17. High-field quench behavior and dependence of hot spot temperature on quench detection voltage threshold in a Bi2Sr2CaCu2Ox coil

    International Nuclear Information System (INIS)

    Shen, Tengming; Ye, Liyang; Turrioni, Daniele; Li, Pei

    2015-01-01

    Small insert solenoids have been built using a multifilamentary Ag/Bi 2 Sr 2 CaCu 2 O x round wire insulated with a mullite sleeve (∼100 μm in thickness) and characterized in background fields to explore the quench behaviors and limits of Bi 2 Sr 2 CaCu 2 O x superconducting magnets, with an emphasis on assessing the impact of slow normal zone propagation on quench detection. Using heaters of various lengths to initiate a small normal zone, a coil was quenched safely more than 70 times without degradation, with the maximum coil temperature reaching 280 K. Coils withstood a resistive voltage of tens of mV for seconds without quenching, showing the high stability of these coils and suggesting that the quench detection voltage should be greater than 50 mV in order not to falsely trigger protection. The hot spot temperature for the resistive voltage of the normal zone to reach 100 mV increased from ∼40–∼80 K while increasing the operating wire current density J o from 89 A mm −2 to 354 A mm −2 , whereas for the voltage to reach 1 V, it increased from ∼60–∼140 K. This shows the increasing negative impact of slow normal zone propagation on quench detection with increasing J o and the need to limit the quench detection voltage to <1 V. These measurements, coupled with an analytical quench model, were used to assess the impact of the maximum allowable detection voltage and temperature upon quench detection on the quench protection, assuming a limit of the hot spot temperature to <300 K. (paper)

  18. Deep eutectic solvents as performance additives in biphasic reactions

    NARCIS (Netherlands)

    Lan, Dongming; Wang, Xuping; Zhou, Pengfei; Hollmann, F.; Wang, Yonghua

    2017-01-01

    Deep eutectic solvents act as surfactants in biphasic (hydrophobic/aqueous) reaction mixtures enabling higher interfacial surface areas at lower mechanical stress as compared to simple emulsions. Exploiting this effect the rate of a chemoenzymatic epoxidation reaction was increased more than

  19. In vitro study on biomineralization of biphasic calcium phosphate ...

    Indian Academy of Sciences (India)

    In this study, we report the preparation of a bone graft material, having cylindrical shape, containing biphasic calcium phosphate (BCP), gelatin (G), chitosan (C) and Terminalia chebula (TC) extract. TC extract was used as a crosslinker that gives stability to bone graft when it is placed in SBF. The graft was stable in the SBF ...

  20. Biphasic Clinical Course Among Kenyan Children With Cerebral ...

    African Journals Online (AJOL)

    Background Cerebral malaria is the most severe neurological complication of Falciparum malaria. It is associated with a significant risk of death and neurological sequelae. A biphasic clinical picture is associated with an even greater risk of neurological sequelae. Objective To examine the incidence and clinical ...

  1. Production of Phytotoxic Metabolite Using Biphasic Fermentation System from Strain C1136 of Lasiodiplodia pseudotheobromae, a Potential Bioherbicidal Agent

    OpenAIRE

    Charles Oluwaseun ADETUNJI; Julius Kola OLOKE; Gandham PRASAD; Moses ABALAKA; Emenike Onyebum IROKANULO

    2017-01-01

    Formulation of effective and environmental friendly bioherbicides depends on the type of fermentation medium used for the production of phytotoxic metabolites. The effect of biomass, colony forming unit and the phytotoxic metabolite produced from the biphasic fermentation was carried out, while the phytotoxic metabolite was tested in vivo and in-vitro on Echinochola crus-galli and dicotyledonous Chromolaena odorata. The mutant strain of Lasiodiplodia pseudotheobromae C1136 (Lp90) produced th...

  2. Kinetics of Ca2+- and ATP-dependent, voltage-controlled anion conductance in the plasma membrane of mesophyll cells of Pisum sativum

    NARCIS (Netherlands)

    Elzenga, J.T.M.; van Volkenburgh, E.

    Whole-cell patch-clamp techniques were used to measure anion currents through the plasma membrane of protoplasts of mesophyll cells of expanding pea (Pisum sativum L.) leaves. Voltage-induced changes of the currents could be modelled with single exponential activation and deactivation kinetics. The

  3. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  4. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  5. Comment on 'Temperature dependence of the current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions'

    Energy Technology Data Exchange (ETDEWEB)

    Pipinys, P; Rimeika, A [Department of Physics, Vilnius Pedagogical University, Studentu 39, LT-08106 Vilnius (Lithuania)], E-mail: ftfdekanas@vpu.lt

    2008-02-27

    Current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions, measured in the temperature range 140-280 K by Kaya et al (2007 J. Phys.: Condens. Matter 19 406205), are reinterpreted in the framework of phonon-assisted tunnelling theory, as a free-charge-carrier generation mechanism in the strong electrical field. It is shown that phonon-assisted tunnelling more adequately describes the peculiarities of the variation of I-V data with temperature in PANI polymers. (comment)

  6. Angular dependence of Si3N4 etch rates and the etch selectivity of SiO2 to Si3N4 at different bias voltages in a high-density C4F8 plasma

    International Nuclear Information System (INIS)

    Lee, Jin-Kwan; Lee, Gyeo-Re; Min, Jae-Ho; Moon, Sang Heup

    2007-01-01

    The dependence of Si 3 N 4 etch rates and the etch selectivity of SiO 2 to Si 3 N 4 on ion-incident angles was studied for different bias voltages in a high-density C 4 F 8 plasma. A Faraday cage and specially designed substrate holders were used to accurately control the angles of incident ions on the substrate surface. The normalized etch yield (NEY), defined as the etch yield obtained at a given ion-incident angle normalized to that obtained on a horizontal surface, was unaffected by the bias voltage in Si 3 N 4 etching, but it increased with the bias voltage in SiO 2 etching in the range of -100 to -300 V. The NEY changed showing a maximum with an increase in the ion-incident angle in the etching of both substrates. In the Si 3 N 4 etching, a maximum NEY of 1.7 was obtained at 70 deg. in the above bias voltage range. However, an increase in the NEY at high ion-incident angles was smaller for SiO 2 than for Si 3 N 4 and, consequently, the etch selectivity of SiO 2 to Si 3 N 4 decreased with an increase in the ion-incident angle. The etch selectivity decreased to a smaller extent at high bias voltage because the NEY of SiO 2 had increased. The characteristic changes in the NEY for different substrates could be correlated with the thickness of a steady-state fluorocarbon (CF x ) film formed on the substrates

  7. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  8. Review of biphasic insulin aspart in the treatment of type 1 and 2 diabetes

    Directory of Open Access Journals (Sweden)

    Nazia Raja-Khan

    2008-01-01

    Full Text Available Nazia Raja-Khan, Sarah S Warehime, Robert A GabbayDivision of Endocrinology, Diabetes, and Metabolism, Penn State Institute for Diabetes and Obesity, Pennsylvania State University College of Medicine, Hershey, Pennsylvania, USABackground: Insulin is an effective treatment for achieving glycemic control and preventing complications in patients with diabetes. In order to make insulin therapy more acceptable to patients, newer formulations of insulin have been developed, such as biphasic insulins. Biphasic insulins conveniently provide both prandial and basal insulin in a single injection. One of the most well-studied biphasic insulins is biphasic insulin aspart 70/30.Objective: Our goal was to review the current literature on the safety and efficacy of biphasic insulin aspart in type 1 and type 2 diabetes.Methods: A MEDLINE search was conducted using the terms “biphasic insulin aspart” to identify clinical studies and reviews.Results: Biphasic insulin aspart more effectively reduces post-prandial glucose compared to other biphasic insulins and basal insulins. Compared to biphasic insulin aspart, fasting glucose levels are lower with NPH, similar with glargine, and similar or lower with biphasic human insulin. Treat-to-target trials have shown that a goal HbA1c below 6.5 or 7% can be achieved with biphasic insulin aspart. The risk of hypoglycemia is similar to or less than that seen with other biphasic insulins or NPH insulin.Conclusion: Biphasic insulin aspart 70/30 is a safe and effective treatment option for patients with diabetes.Keywords: biphasic insulin aspart, insulin, diabetes

  9. Voltage regulating circuit

    NARCIS (Netherlands)

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  10. Preparation and Characterization of Apatitic Biphasic Calcium Phosphate

    International Nuclear Information System (INIS)

    Thin Thin Nwe; Kyaw Naing; Khin Mar Tun; Nyunt Wynn

    2005-09-01

    The apatitic biphasic calcium phosphate (ABcp) consisting of hydroxyapatite (HA) and -tricalcium phosphate ( -Tcp) has been prepared by precipitation technique using slaked lime and orthophosphoric acid. The X-ray diffraction analysis of the product I (hydroxyapatite) revealed that ABcp was partially crystalline state. However, on heating at 800 C for 8 hrs, XRD pattern indicated a perfectly crystalline form of ABcp. This observation was supported by FT-IR measurement. The change in morphology regarding in the functional nature was infered by the shift in the FT-IR frequency. The optimization of the apatitic biphasic calcium phosphate was done by the variation of disodium hydrogen phosphate concentration, setting time, hardening time as well as compressive strength. The perpared cement may be used as an artificial substitution bone

  11. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Science.gov (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

    2008-06-25

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  12. Biphasic synaptic Ca influx arising from compartmentalized electrical signals in dendritic spines.

    Directory of Open Access Journals (Sweden)

    Brenda L Bloodgood

    2009-09-01

    Full Text Available Excitatory synapses on mammalian principal neurons are typically formed onto dendritic spines, which consist of a bulbous head separated from the parent dendrite by a thin neck. Although activation of voltage-gated channels in the spine and stimulus-evoked constriction of the spine neck can influence synaptic signals, the contribution of electrical filtering by the spine neck to basal synaptic transmission is largely unknown. Here we use spine and dendrite calcium (Ca imaging combined with 2-photon laser photolysis of caged glutamate to assess the impact of electrical filtering imposed by the spine morphology on synaptic Ca transients. We find that in apical spines of CA1 hippocampal neurons, the spine neck creates a barrier to the propagation of current, which causes a voltage drop and results in spatially inhomogeneous activation of voltage-gated Ca channels (VGCCs on a micron length scale. Furthermore, AMPA and NMDA-type glutamate receptors (AMPARs and NMDARs, respectively that are colocalized on individual spine heads interact to produce two kinetically and mechanistically distinct phases of synaptically evoked Ca influx. Rapid depolarization of the spine triggers a brief and large Ca current whose amplitude is regulated in a graded manner by the number of open AMPARs and whose duration is terminated by the opening of small conductance Ca-activated potassium (SK channels. A slower phase of Ca influx is independent of AMPAR opening and is determined by the number of open NMDARs and the post-stimulus potential in the spine. Biphasic synaptic Ca influx only occurs when AMPARs and NMDARs are coactive within an individual spine. These results demonstrate that the morphology of dendritic spines endows associated synapses with specialized modes of signaling and permits the graded and independent control of multiple phases of synaptic Ca influx.

  13. Actinide recovery using aqueous biphasic extraction: Initial developmental studies

    International Nuclear Information System (INIS)

    Chaiko, D.J.; Mensah-Biney, R.; Mertz, C.J.; Rollins, A.N.

    1992-08-01

    Aqueous biphasic extraction systems are being developed to treat radioactive wastes. The separation technique involves the selective partitioning of either solutes or colloid-size particles between two scible aqueous phases. Wet grinding of plutonium residues to an average particle size of one micron will be used to liberate the plutonium from the bulk of the particle matrix. The goal is to produce a plutonium concentrate that will integrate with existing and developing chemical recovery processes. Ideally, the process would produce a nonTRU waste stream. Coupling physical beneficiation with chemical processing will result in a substantial reduction in the volume of mixed wastes generated from dissolution recovery processes. As part of this program, we will also explore applications of aqueous biphasic extraction that include the separation and recovery of dissolved species such as metal ions and water-soluble organics. The expertise and data generated in this work will form the basis for developing more cost-effective processes for handling waste streams from environmental restoration and waste management activities within the DOE community. This report summarizes the experimental results obtained during the first year of this effort. Experimental efforts were focused on elucidating the surface and solution chemistry variables which govern partitioning behavior of plutonium and silica in aqueous biphasic extraction systems. Additional efforts were directed toward the development of wet grinding methods for producing ultrafine particles with diameters of one micron or less

  14. Actinide recovery using aqueous biphasic extraction: Initial developmental studies

    Energy Technology Data Exchange (ETDEWEB)

    Chaiko, D.J.; Mensah-Biney, R.; Mertz, C.J.; Rollins, A.N.

    1992-08-01

    Aqueous biphasic extraction systems are being developed to treat radioactive wastes. The separation technique involves the selective partitioning of either solutes or colloid-size particles between two scible aqueous phases. Wet grinding of plutonium residues to an average particle size of one micron will be used to liberate the plutonium from the bulk of the particle matrix. The goal is to produce a plutonium concentrate that will integrate with existing and developing chemical recovery processes. Ideally, the process would produce a nonTRU waste stream. Coupling physical beneficiation with chemical processing will result in a substantial reduction in the volume of mixed wastes generated from dissolution recovery processes. As part of this program, we will also explore applications of aqueous biphasic extraction that include the separation and recovery of dissolved species such as metal ions and water-soluble organics. The expertise and data generated in this work will form the basis for developing more cost-effective processes for handling waste streams from environmental restoration and waste management activities within the DOE community. This report summarizes the experimental results obtained during the first year of this effort. Experimental efforts were focused on elucidating the surface and solution chemistry variables which govern partitioning behavior of plutonium and silica in aqueous biphasic extraction systems. Additional efforts were directed toward the development of wet grinding methods for producing ultrafine particles with diameters of one micron or less.

  15. Threshold voltage variation depending on single grain boundary and stored charges in an adjacent cell for vertical silicon–oxide–nitride–oxide–silicon NAND flash memory

    Science.gov (United States)

    Oh, Hyeongwan; Kim, Jiwon; Baek, Rock-Hyun; Lee, Jeong-Soo

    2018-04-01

    The effects of single grain boundary (SGB) position and stored electron charges in an adjacent cell in silicon–oxide–nitride–oxide–silicon (SONOS) structures on the variations of threshold voltage (V th) were investigated using technology computer-aided design (TCAD) simulation. As the bit line voltage increases, the SGB position causing the maximum V th variation was shifted from the center to the source side in the channel, owing to the drain-induced grain barrier lowering effect. When the SGB is located in the spacer region, the potential interaction from both the SGB and the stored electron charges in the adjacent cell becomes significant and thus resulting in larger V th variation. In contrast, when the SGB is located at the center of the channel, the peak position of potential barrier is shifted to the center, so that the influence of the adjacent cell is diminished. As the gate length is scaled down to 20 nm, the influence of stored charges in adjacent cells becomes significant, resulting in larger V th variations.

  16. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  17. Voltage linearity modulation and polarity dependent conduction in metal-insulator-metal capacitors with atomic-layer-deposited Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} nano-stacks

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Bao; Liu, Wen-Jun; Wei, Lei; Zhang, David Wei; Jiang, Anquan; Ding, Shi-Jin, E-mail: sjding@fudan.edu.cn [State Key Laboratory of ASIC and System, School of Microelectronics, Fudan University, Shanghai 200433 (China)

    2015-07-07

    Excellent voltage linearity of metal-insulator-metal (MIM) capacitors is highly required for next generation radio frequency integration circuits. In this work, employing atomic layer deposition technique, we demonstrated how the voltage linearity of MIM capacitors was modulated by adding different thickness of SiO{sub 2} layer to the nano-stack of Al{sub 2}O{sub 3}/ZrO{sub 2}. It was found that the quadratic voltage coefficient of capacitance (α) can be effectively reduced from 1279 to −75 ppm/V{sup 2} with increasing the thickness of SiO{sub 2} from zero to 4 nm, which is more powerful than increasing the thickness of ZrO{sub 2} in the Al{sub 2}O{sub 3}/ZrO{sub 2} stack. This is attributed to counteraction between the positive α for Al{sub 2}O{sub 3}/ZrO{sub 2} and the negative one for SiO{sub 2} in the MIM capacitors with Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} stacks. Interestingly, voltage-polarity dependent conduction behaviors in the MIM capacitors were observed. For electron bottom-injection, the addition of SiO{sub 2} obviously suppressed the leakage current; however, it abnormally increased the leakage current for electron top-injection. These are ascribed to the co-existence of shallow and deep traps in ZrO{sub 2}, and the former is in favor of the field-assisted tunnelling conduction and the latter contributes to the trap-assisted tunnelling process. The above findings will be beneficial to device design and process optimization for high performance MIM capacitors.

  18. Temperature dependent quasi-static capacitance-voltage characterization of SiO2/β-Ga2O3 interface on different crystal orientations

    Science.gov (United States)

    Zeng, Ke; Singisetti, Uttam

    2017-09-01

    The interface trap density (Dit) of the SiO2/β-Ga2O3 interface in ( 2 ¯ 01), (010), and (001) orientations is obtained by the Hi-Lo method with the low frequency capacitance measured using the Quasi-Static Capacitance-Voltage (QSCV) technique. QSCV measurements are carried out at higher temperatures to increase the measured energy range of Dit in the bandgap. At room temperature, higher Dit is observed near the band edge for all three orientations. The measurement at higher temperatures led to an annealing effect that reduced the Dit value for all samples. Comparison with the conductance method and frequency dispersion of the capacitance suggests that the traps at the band edge are slow traps which respond to low frequency signals.

  19. Thickness dependence of the poling and current-voltage characteristics of paint films made up of lead zirconate titanate ceramic powder and epoxy resin

    Science.gov (United States)

    Egusa, Shigenori; Iwasawa, Naozumi

    1995-11-01

    A specially prepared paint made up of lead zirconate titanate (PZT) ceramic powder and epoxy resin was coated on an aluminum plate and was cured at room temperature, thus forming the paint film of 25-300 μm thickness with a PZT volume fraction of 53%. The paint film was then poled at room temperature, and the poling behavior was determined by measuring the piezoelectric activity as a function of poling field. The poling behavior shows that the piezoelectric activity obtained at a given poling field increases with an increase in the film thickness from 25 to 300 μm. The current-voltage characteristic of the paint film, on the other hand, shows that the increase in the film thickness leads not only to an increase in the magnitude of the current density at a given electric field but also to an increase in the critical electric field at which the transition from the ohmic to space-charge-limited conduction takes place. This fact indicates that the amount of the space charge of electrons injected into the paint film decreases as the film thickness increases. Furthermore, comparison of the current-voltage characteristic of the paint film with that of a pure epoxy film reveals that the space charge is accumulated largely at the interface between the PZT and epoxy phases in the paint film. On the basis of this finding, a model is developed for the poling behavior of the paint film by taking into account a possible effect of the space-charge accumulation and a broad distribution of the electric field in the PZT phase. This model is shown to give an excellent fit to the experimental data of the piezoelectric activity obtained here as a function of poling field and film thickness.

  20. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Science.gov (United States)

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  1. Analysis of bias voltage dependent spectral response in Ga0.51In0.49P/Ga0.99In0.01As/Ge triple junction solar cell

    International Nuclear Information System (INIS)

    Sogabe, Tomah; Ogura, Akio; Okada, Yoshitaka

    2014-01-01

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V bias ) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V bias for Ga 0.51 In 0.49 P/Ga 0.99 In 0.01 As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V bias measurements. The profile of SR−V bias curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell

  2. Analysis of bias voltage dependent spectral response in Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Sogabe, Tomah, E-mail: Sogabe@mbe.rcast.u-tokyo.ac.jp; Ogura, Akio; Okada, Yoshitaka [Research Center for Advanced Science and Technology (RCAST), The University of Tokyo 4-6-1 Komaba, Meguro-ku, Tokyo 153-8504 (Japan)

    2014-02-21

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V{sub bias}) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V{sub bias} for Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V{sub bias} measurements. The profile of SR−V{sub bias} curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell.

  3. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  4. Analysis of temperature-dependant current–voltage characteristics and extraction of series resistance in Pd/ZnO Schottky barrier diodes

    Energy Technology Data Exchange (ETDEWEB)

    Mayimele, M A, E-mail: meehleketo@gmail.com; Rensburg, J P van. Janse; Auret, F D; Diale, M

    2016-01-01

    We report on the analysis of current voltage (I–V) measurements performed on Pd/ZnO Schottky barrier diodes (SBDs) in the 80–320 K temperature range. Assuming thermionic emission (TE) theory, the forward bias I–V characteristics were analysed to extract Pd/ZnO Schottky diode parameters. Comparing Cheung’s method in the extraction of the series resistance with Ohm’s law, it was observed that at lower temperatures (T<180 K) the series resistance decreased with increasing temperature, the absolute minimum was reached near 180 K and increases linearly with temperature at high temperatures (T>200 K). The barrier height and the ideality factor decreased and increased, respectively, with decrease in temperature, attributed to the existence of barrier height inhomogeneity. Such inhomogeneity was explained based on TE with the assumption of Gaussian distribution of barrier heights with a mean barrier height of 0.99 eV and a standard deviation of 0.02 eV. A mean barrier height of 0.11 eV and Richardson constant value of 37 A cm{sup −2} K{sup −2} were determined from the modified Richardson plot that considers the Gaussian distribution of barrier heights.

  5. The quaternary lidocaine derivative, QX-314, exerts biphasic effects on transient receptor potential vanilloid subtype 1 channels in vitro

    DEFF Research Database (Denmark)

    Rivera-Acevedo, Ricardo E; Pless, Stephan Alexander; Ahern, Christopher A

    2011-01-01

    concentrations (less than 1 mM), QX-314 potently inhibited capsaicin-evoked TRPV1 currents with an IC₅₀ of 8.0 ± 0.6 μM. CONCLUSIONS: The results of this study show that the quaternary lidocaine derivative QX-314 exerts biphasic effects on TRPV1 channels, inhibiting capsaicin-evoked TRPV1 currents at lower...... channels. METHODS: The authors conducted an in vitro laboratory study in which they expressed TRPV1 and TRPV4 channels in Xenopus laevis oocytes and recorded cation currents with the two-electrode voltage clamp method. They used confocal microscopy for Ca²⁺ imaging in TRPV1 transient transfected tsA201...

  6. A new kinetic biphasic approach applied to biodiesel process intensification

    Energy Technology Data Exchange (ETDEWEB)

    Russo, V.; Tesser, R.; Di Serio, M.; Santacesaria, E. [Naples Univ. (Italy). Dept. of Chemistry

    2012-07-01

    Many different papers have been published on the kinetics of the transesterification of vegetable oil with methanol, in the presence of alkaline catalysts to produce biodiesel. All the proposed approaches are based on the assumption of a pseudo-monophasic system. The consequence of these approaches is that some experimental aspects cannot be described. For the reaction performed in batch conditions, for example, the monophasic approach is not able to reproduce the different plateau obtained by using different amount of catalyst or the induction time observed at low stirring rates. Moreover, it has been observed by operating in continuous reactors that micromixing has a dramatic effect on the reaction rate. At this purpose, we have recently observed that is possible to obtain a complete conversion to biodiesel in less than 10 seconds of reaction time. This observation is confirmed also by other authors using different types of reactors like: static mixers, micro-reactors, oscillatory flow reactors, cavitational reactors, microwave reactors or centrifugal contactors. In this work we will show that a recently proposed biphasic kinetic approach is able to describe all the aspects before mentioned that cannot be described by the monophasic kinetic model. In particular, we will show that the biphasic kinetic model can describe both the induction time observed in the batch reactors, at low stirring rate, and the very high conversions obtainable in a micro-channel reactor. The adopted biphasic kinetic model is based on a reliable reaction mechanism that will be validated by the experimental evidences reported in this work. (orig.)

  7. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  8. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  9. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  10. Cell–material interactions on biphasic polyurethane matrix

    Science.gov (United States)

    Dicesare, Patrick; Fox, Wade M.; Hill, Michael J.; Krishnan, G. Rajesh; Yang, Shuying; Sarkar, Debanjan

    2013-01-01

    Cell–matrix interaction is a key regulator for controlling stem cell fate in regenerative tissue engineering. These interactions are induced and controlled by the nanoscale features of extracellular matrix and are mimicked on synthetic matrices to control cell structure and functions. Recent studies have shown that nanostructured matrices can modulate stem cell behavior and exert specific role in tissue regeneration. In this study, we have demonstrated that nanostructured phase morphology of synthetic matrix can control adhesion, proliferation, organization and migration of human mesenchymal stem cells (MSCs). Nanostructured biodegradable polyurethanes (PU) with segmental composition exhibit biphasic morphology at nanoscale dimensions and can control cellular features of MSCs. Biodegradable PU with polyester soft segment and hard segment composed of aliphatic diisocyanates and dipeptide chain extender were designed to examine the effect polyurethane phase morphology. By altering the polyurethane composition, morphological architecture of PU was modulated and its effect was examined on MSC. Results show that MSCs can sense the nanoscale morphology of biphasic polyurethane matrix to exhibit distinct cellular features and, thus, signifies the relevance of matrix phase morphology. The role of nanostructured phases of a synthetic matrix in controlling cell–matrix interaction provides important insights for regulation of cell behavior on synthetic matrix and, therefore, is an important tool for engineering tissue regeneration. PMID:23255285

  11. A New Biphasic Dicalcium Silicate Bone Cement Implant

    Directory of Open Access Journals (Sweden)

    Fausto Zuleta

    2017-07-01

    Full Text Available This study aimed to investigate the processing parameters and biocompatibility of a novel biphasic dicalcium silicate (C2S cement. Biphasic α´L + β-C2Sss was synthesized by solid-state processing, and was used as a raw material to prepare the cement. In vitro bioactivity and biocompatibility studies were assessed by soaking the cement samples in simulated body fluid (SBF and human adipose stem cell cultures. Two critical-sized defects of 6 mm Ø were created in 15 NZ tibias. A porous cement made of the high temperature forms of C2S, with a low phosphorous substitution level, was produced. An apatite-like layer covered the cement’s surface after soaking in SBF. The cell attachment test showed that α´L + β-C2Sss supported cells sticking and spreading after 24 h of culture. The cement paste (55.86 ± 0.23 obtained higher bone-to-implant contact (BIC percentage values (better quality, closer contact in the histomorphometric analysis, and defect closure was significant compared to the control group (plastic. The residual material volume of the porous cement was 35.42 ± 2.08% of the initial value. The highest BIC and bone formation percentages were obtained on day 60. These results suggest that the cement paste is advantageous for initial bone regeneration.

  12. Membrane Potential-dependent Uptake of 18F-triphenylphosphonium - A New Voltage Sensor as an Imaging Agent for Detecting Burn-induced Apoptosis

    Science.gov (United States)

    Zhao, Gaofeng; Yu, Yong-Ming; Shoup, Timothy M.; Elmaleh, David R.; Bonab, Ali A.; Tompkins, Ronald G.; Fischman, Alan J.

    2014-01-01

    Background Mitochondrial dysfunction has been closely related to many pathological processes, such as cellular apoptosis. Alterations in organelle membrane potential are associated with mitochondrial dysfunction. A fluorine -18 labeled phosphonium compound: 18F-triphenylphosphonium (18F-TPP) was prepared to determine its potential use as a mitochondria-targeting radiopharmaceutical to evaluate cellular apoptosis. Methods Studies were conducted in both ex vivo cell lines and in vivo using a burned animal model. Uptake of 18F-TPP was assessed in PC-3 cells by gamma counting under the following conditions: graded levels of extra-cellular potassium concentrations, incubation with carbonyl cyanide m-chlorophenylhydrazone (CCCP) and staurosporine. Apoptosis was studied in a burn animal model using TUNEL staining and simultaneous assessment of 18F-TPP uptake by biodistribution. Results We found that stepwise membrane depolarization by potassium (K) resulted in a linear decrease in 18F-TPP uptake, with a slope of 0.62+/−0.08 and a correlation coefficient of 0.936+/−0.11. Gradually increased concentrations of CCCP lead to decreased uptakes of 18F-TPP. Staurosporine significantly decreased the uptake of 18F-TPP in PC-3 cells from 14.2+/−3.8% to 5.6+/−1.3% (P<0.001). Burn induced significant apoptosis (sham: 4.4 +/−1.8% vs. burn: 24.6+/− 6.7 %; p<0.005) and a reduced uptake of tracer in the spleens of burn injured animals as compared to sham burn controls (burn: 1.13+/−0.24% vs. sham: 3.28+/−0.67%; p<0.005). Biodistribution studies demonstrated that burn induced significant reduction in 18F-TPP uptake in spleen, heart, lung, and liver, which were associated with significantly increased apoptosis. Conclusions 18F-TPP is a promising new voltage sensor for detecting mitochondrial dysfunction and apoptosis in various tissues. PMID:24582214

  13. High voltage systems

    International Nuclear Information System (INIS)

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  14. Analysis of a biphase-based servo format for hard-disk drives

    NARCIS (Netherlands)

    Makinwa, K.A.A.; Bergmans, J.W.M.; Voorman, J.O.

    2000-01-01

    Biphase modulation in an embedded-servo format for hard-disk drives is investigated. It is shown that for biphase, at the low linear densities typical of servo information, near-maximum-likelihood performance can be attained by a simple bit detector consisting of a full-response linear equalizer and

  15. Seizure characteristics of epilepsy in childhood after acute encephalopathy with biphasic seizures and late reduced diffusion.

    Science.gov (United States)

    Ito, Yuji; Natsume, Jun; Kidokoro, Hiroyuki; Ishihara, Naoko; Azuma, Yoshiteru; Tsuji, Takeshi; Okumura, Akihisa; Kubota, Tetsuo; Ando, Naoki; Saitoh, Shinji; Miura, Kiyokuni; Negoro, Tamiko; Watanabe, Kazuyoshi; Kojima, Seiji

    2015-08-01

    The aim of this study was to clarify characteristics of post-encephalopathic epilepsy (PEE) in children after acute encephalopathy with biphasic seizures and late reduced diffusion (AESD), paying particular attention to precise diagnosis of seizure types. Among 262 children with acute encephalopathy/encephalitis registered in a database of the Tokai Pediatric Neurology Society between 2005 and 2012, 44 were diagnosed with AESD according to the clinical course and magnetic resonance imaging (MRI) findings and were included in this study. Medical records were reviewed to investigate clinical data, MRI findings, neurologic outcomes, and presence or absence of PEE. Seizure types of PEE were determined by both clinical observation by pediatric neurologists and ictal video-electroencephalography (EEG) recordings. Of the 44 patients after AESD, 10 (23%) had PEE. The period between the onset of encephalopathy and PEE ranged from 2 to 39 months (median 8.5 months). Cognitive impairment was more severe in patients with PEE than in those without. Biphasic seizures and status epilepticus during the acute phase of encephalopathy did not influence the risk of PEE. The most common seizure type of PEE on clinical observation was focal seizures (n = 5), followed by epileptic spasms (n = 4), myoclonic seizures (n = 3), and tonic seizures (n = 2). In six patients with PEE, seizures were induced by sudden unexpected sounds. Seizure types confirmed by ictal video-EEG recordings were epileptic spasms and focal seizures with frontal onset, and all focal seizures were startle seizures induced by sudden acoustic stimulation. Intractable daily seizures remain in six patients with PEE. We demonstrate seizure characteristics of PEE in children after AESD. Epileptic spasms and startle focal seizures are common seizure types. The specific seizure types may be determined by the pattern of diffuse subcortical white matter injury in AESD and age-dependent reorganization of the brain

  16. Generic Model-Based Tailor-Made Design and Analysis of Biphasic Reaction Systems

    DEFF Research Database (Denmark)

    Anantpinijwatna, Amata

    systems have a broad range of application, such as the manufacture of petroleum based chemicals, pharmaceuticals, and agro-bio products. Major considerations in the design and analysis of biphasic reaction systems are physical and chemical equilibria, kinetic mechanisms, and reaction rates. The primary...... contribution of this thesis is the development of a systematic modelling framework for the biphasic reaction system. The developed framework consists of three modules describing phase equilibria, reactions and mass transfer, and material balances of such processes. Correlative and predictive thermodynamic......Biphasic reaction systems are composed of immiscible aqueous and organic liquid phases where reactants, products, and catalysts are partitioned. These biphasic conditions point to novel synthesis paths, higher yields, and faster reactions, as well as facilitate product separation. The biphasic...

  17. Voltage regulator for generator

    Energy Technology Data Exchange (ETDEWEB)

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  18. Two-stage unified stretched-exponential model for time-dependence of threshold voltage shift under positive-bias-stresses in amorphous indium-gallium-zinc oxide thin-film transistors

    Science.gov (United States)

    Jeong, Chan-Yong; Kim, Hee-Joong; Hong, Sae-Young; Song, Sang-Hun; Kwon, Hyuck-In

    2017-08-01

    In this study, we show that the two-stage unified stretched-exponential model can more exactly describe the time-dependence of threshold voltage shift (ΔV TH) under long-term positive-bias-stresses compared to the traditional stretched-exponential model in amorphous indium-gallium-zinc oxide (a-IGZO) thin-film transistors (TFTs). ΔV TH is mainly dominated by electron trapping at short stress times, and the contribution of trap state generation becomes significant with an increase in the stress time. The two-stage unified stretched-exponential model can provide useful information not only for evaluating the long-term electrical stability and lifetime of the a-IGZO TFT but also for understanding the stress-induced degradation mechanism in a-IGZO TFTs.

  19. Automatic voltage imbalance detector

    Science.gov (United States)

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  20. Voltage and partial pressure dependent defect chemistry in (La,Sr)FeO3-δ thin films investigated by chemical capacitance measurements.

    Science.gov (United States)

    Schmid, Alexander; Rupp, Ghislain M; Fleig, Jürgen

    2018-05-03

    La0.6Sr0.4FeO3-δ (LSF) thin films of different thickness were prepared by pulsed laser deposition on yttria stabilized zirconia (YSZ) and characterized by using three electrode impedance spectroscopy. Electrochemical film capacitance was analyzed in relation to oxygen partial pressure (0.25 mbar to 1 bar), DC polarization (0 m to -600 m) and temperature (500 to 650 °C). For most measurement parameters, the chemical bulk capacitance dominates the overall capacitive properties and the corresponding defect chemical state depends solely on the oxygen chemical potential inside the film, independent of atmospheric oxygen pressure and DC polarization. Thus, defect chemical properties (defect concentrations and defect formation enthalpies) could be deduced from such measurements. Comparison with LSF defect chemical bulk data from the literature showed good agreement for vacancy formation energies but suggested larger electronic defect concentrations in the films. From thickness-dependent measurements at lower oxygen chemical potentials, an additional capacitive contribution could be identified and attributed to the LSF|YSZ interface. Deviations from simple chemical capacitance models at high pressures are most probably due to defect interactions.

  1. Voltage and partial pressure dependent defect chemistry in (La,Sr)FeO3–δ thin films investigated by chemical capacitance measurements

    Science.gov (United States)

    Rupp, Ghislain M.; Fleig, Jürgen

    2018-01-01

    La0.6Sr0.4FeO3–δ (LSF) thin films of different thickness were prepared by pulsed laser deposition on yttria stabilized zirconia (YSZ) and characterized by using three electrode impedance spectroscopy. Electrochemical film capacitance was analyzed in relation to oxygen partial pressure (0.25 mbar to 1 bar), DC polarization (0 m to –600 m) and temperature (500 to 650 °C). For most measurement parameters, the chemical bulk capacitance dominates the overall capacitive properties and the corresponding defect chemical state depends solely on the oxygen chemical potential inside the film, independent of atmospheric oxygen pressure and DC polarization. Thus, defect chemical properties (defect concentrations and defect formation enthalpies) could be deduced from such measurements. Comparison with LSF defect chemical bulk data from the literature showed good agreement for vacancy formation energies but suggested larger electronic defect concentrations in the films. From thickness-dependent measurements at lower oxygen chemical potentials, an additional capacitive contribution could be identified and attributed to the LSF|YSZ interface. Deviations from simple chemical capacitance models at high pressures are most probably due to defect interactions. PMID:29671421

  2. Voltage stability in low voltage microgrids in aspects of active and reactive power demand

    Directory of Open Access Journals (Sweden)

    Parol Mirosław

    2016-03-01

    Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

  3. Voltage Unbalance Compensation with Smart Three-phase Loads

    DEFF Research Database (Denmark)

    Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

    2016-01-01

    unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

  4. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  5. Biphasic 201thallium scintgraphy after dipyridamole in mitral valve diseases

    International Nuclear Information System (INIS)

    Schmoliner, R.; Dudczak, R.; Kronik, G.; Moesslacher, H.; Kletter, K.; Frischauf, H.

    1980-01-01

    The results of biphasic 201 thallium scintigraphy after dipyridamole i.v. could neither prove nor exclude the presence of small focal lesions in the myocardium of 17 patients with mitral valve diseases. The frequent finding of a decrease in activity in the anterolateral myocardium is probably due to a relative increase in activity in the region of the inferior wall with superimposed areas of the papillary muscle and right ventricular myocardium. If the right ventricle is visualized in stress- or redistribution images, an increase in mean pulmonary artery pressure can be accepted. According to Cohen's criteria, a grade 2 or 3 virtually proves the existence of pulmonary hypertension, a grade 1 makes this finding rather probable. The possibility of pulmonary hypertension can not be excluded if the right ventricular myocardium is not visualized. (orig.) [de

  6. Biphasic growth of orbital volume in Chinese children.

    Science.gov (United States)

    Wei, Nan; Bi, Hua; Zhang, Bin; Li, Xue; Sun, Fengyuan; Qian, Xuehan

    2017-09-01

    The aim of this study was to map out the developmental curve of the orbital volume of Chinese children aged 1-15 years. CT scanning was performed on 109 children and the orbital volume, interlateral orbital rim distance (IORD), and extent of exophthalmos were measured on the CT images and plotted against age. The development of the orbit structure followed a biphasic pattern. The first growth phase was before 3 years and the second growth phase was between 7 years and 12 years of age. The growth speed in the first phase was about 3 times that of the second one (first vs second phase: 2.28 cm 3 /year vs 0.67 cm 3 /year for orbital volume, 5.01 mm/year vs 1.57 mm/year for IORD, 1.29 mm/year vs 0.42 mm/year for the exophthalmos). During development, there was no significant difference between the left and right orbits. There was no significant difference between boys and girls before 12 years of age. However, after 12 years of age, boys had significantly larger orbital volumes (22.16±2.28 cm 3 /year vs 18.57±1.16 cm 3 /year, pChinese children, the development of orbital volume follows a biphasic pattern and a sex difference becomes significant after the age of 12 years. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  7. A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

    Directory of Open Access Journals (Sweden)

    M. R. Aghamohammadi

    2011-06-01

    Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

  8. Paired associative stimulation targeting the tibialis anterior muscle using either mono or biphasic transcranial magnetic stimulation

    DEFF Research Database (Denmark)

    Mrachacz-Kersting, Natalie; Stevenson, Andrew James Thomas

    2017-01-01

    Paired associative stimulation (PAS) protocols induce plastic changes within the motor cortex. The objectives of this study were to investigate PAS effects targeting the tibialis anterior (TA) muscle using a biphasic transcranial magnetic stimulation (TMS) pulse form and, to determine whether...... a reduced intensity of this pulse would lead to significant changes as has been reported for hand muscles using a monophasic TMS pulse. Three interventions were investigated: (1) suprathreshold PAbi-PAS (n = 11); (2) suprathreshold PAmono-PAS (n = 11) where PAS was applied using a biphasic or monophasic......% for subthreshold PAbi-PAS. PAS using a biphasic pulse form at subthreshold intensities induces similar effects to conventional PAS....

  9. Distinct moieties underlie biphasic H+ gating of connexin43 channels, producing a pH optimum for intercellular communication

    Science.gov (United States)

    Garciarena, Carolina D.; Malik, Akif; Swietach, Pawel; Moreno, Alonso P.; Vaughan-Jones, Richard D.

    2018-01-01

    Most mammalian cells can intercommunicate via connexin-assembled, gap-junctional channels. To regulate signal transmission, connexin (Cx) channel permeability must respond dynamically to physiological and pathophysiological stimuli. One key stimulus is intracellular pH (pHi), which is modulated by a tissue’s metabolic and perfusion status. Our understanding of the molecular mechanism of H+ gating of Cx43 channels—the major isoform in the heart and brain—is incomplete. To interrogate the effects of acidic and alkaline pHi on Cx43 channels, we combined voltage-clamp electrophysiology with pHi imaging and photolytic H+ uncaging, performed over a range of pHi values. We demonstrate that Cx43 channels expressed in HeLa or N2a cell pairs are gated biphasically by pHi via a process that consists of activation by H+ ions at alkaline pHi and inhibition at more acidic pHi. For Cx43 channel–mediated solute/ion transmission, the ensemble of these effects produces a pHi optimum, near resting pHi. By using Cx43 mutants, we demonstrate that alkaline gating involves cysteine residues of the C terminus and is independent of motifs previously implicated in acidic gating. Thus, we present a molecular mechanism by which cytoplasmic acid–base chemistry fine tunes intercellular communication and establishes conditions for the optimal transmission of solutes and signals in tissues, such as the heart and brain.—Garciarena, C. D., Malik, A., Swietach, P., Moreno, A. P., Vaughan-Jones, R. D. Distinct moieties underlie biphasic H+ gating of connexin43 channels, producing a pH optimum for intercellular communication. PMID:29183963

  10. Bi-phasic regulation of glycogen content in astrocytes via Cav-1/PTEN/PI3K/AKT/GSK-3β pathway by fluoxetine.

    Science.gov (United States)

    Bai, Qiufang; Song, Dan; Gu, Li; Verkhratsky, Alexei; Peng, Liang

    2017-04-01

    Here, we present the data indicating that chronic treatment with fluoxetine regulates Cav-1/PTEN/PI3K/AKT/GSK-3β signalling pathway and glycogen content in primary cultures of astrocytes with bi-phasic concentration dependence. At lower concentrations, fluoxetine downregulates gene expression of Cav-1, decreases membrane content of PTEN, increases activity of PI3K/AKT, and elevates GSK-3β phosphorylation thus suppressing its activity. At higher concentrations, fluoxetine acts in an inverse fashion. As expected, fluoxetine at lower concentrations increased while at higher concentrations decreased glycogen content in astrocytes. Our findings indicate that bi-phasic regulation of glycogen content via Cav-1/PTEN/PI3K/AKT/GSK-3β pathway by fluoxetine may be responsible for both therapeutic and side effects of the drug.

  11. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  12. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  13. Microstructure and phase evolution during the dealloying of bi-phase Al–Ag alloy

    International Nuclear Information System (INIS)

    Song, T.T.; Gao, Y.L.; Zhang, Z.H.; Zhai, Q.J.

    2013-01-01

    Highlights: ► Selective leaching of α-Al(Ag) and Ag 2 Al occurs simultaneously during dealloying. ► Diffusion of Al and vacancy controlled mechanism dominate the etching of Ag 2 Al. ► The coarsening of ligaments in NPS follows a time dependence of d ∝t 2/5 . - Abstract: The chemical dealloying of bi-phase Al-35Ag alloy has been investigated within the parting limit. The dealloying of α-Al(Ag) and Ag 2 Al commenced simultaneously, and all α-Al(Ag) and part of Ag 2 Al were dealloyed, leaving residual Ag 2 Al to be dealloyed afterwards. The dealloying of the residual Ag 2 Al is associated with vacancy controlled mechanism and diffusion of Al atoms. It is revealed that the diffusions of the Al and Ag atoms during dealloying are significant. The Ag skeletons formed at the initial stage, and became coarsened gradually with a time dependence of d ∝t 2/5 , illustrating the vital role of diffusion of Ag atoms.

  14. Stray voltage mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  15. High voltage engineering

    CERN Document Server

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  16. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  17. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Directory of Open Access Journals (Sweden)

    Alicia Lundby

    2008-06-01

    Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  18. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  19. Biphasic influence of dexamethasone exposure on embryonic vertebrate skeleton development

    International Nuclear Information System (INIS)

    Cheng, Xin; Chen, Jian-long; Ma, Zheng-lai; Zhang, Zhao-long; Lv, Shun; Mai, Dong-mei; Liu, Jia-jia; Chuai, Manli; Lee, Kenneth Ka Ho; Wan, Chao; Yang, Xuesong

    2014-01-01

    in mesenchymal cell mass treated by low concentration of Dex. Mmp-13 expression was obviously up-regulated by Dex in both mesenchymal cells and primary chondrocyte cultures. And Col10a1 expression was also increased by Dex exposure in chondrocyte. In summary, we have revealed that different concentrations of Dex exposure during early gestation could exert a biphasic effect on vertebrate skeletal development. - Highlights: • Chick embryos occurred shortening of the long bone following Dex exposure. • Dex suppressed chondrocytes proliferation and promoted apoptosis. • Dex exposure decreased ALP production and up-regulated Runx-2 and Mmp-13. • Dex exhibited biphasic effects on chondrogenic proliferation and nodule formation. • The hypertrophy and ossification were accelerated by Dex both in vivo and in vitro

  20. Biphasic influence of dexamethasone exposure on embryonic vertebrate skeleton development

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Xin; Chen, Jian-long; Ma, Zheng-lai; Zhang, Zhao-long; Lv, Shun; Mai, Dong-mei; Liu, Jia-jia [Department of Histology and Embryology, Key Laboratory for Regenerative Medicine of the Ministry of Education, School of Medicine, Jinan University, Guangzhou 510632 (China); Chuai, Manli [Division of Cell and Developmental Biology, University of Dundee, Dundee DD1 5EH (United Kingdom); Lee, Kenneth Ka Ho; Wan, Chao [Stem Cell and Regeneration Thematic Research Programme, School of Biomedical Sciences, Chinese University of Hong Kong, Shatin (Hong Kong); Yang, Xuesong, E-mail: yang_xuesong@126.com [Department of Histology and Embryology, Key Laboratory for Regenerative Medicine of the Ministry of Education, School of Medicine, Jinan University, Guangzhou 510632 (China); Institute of Fetal-Preterm Labor Medicine, Jinan University, Guangzhou 510632 (China)

    2014-11-15

    increased in mesenchymal cell mass treated by low concentration of Dex. Mmp-13 expression was obviously up-regulated by Dex in both mesenchymal cells and primary chondrocyte cultures. And Col10a1 expression was also increased by Dex exposure in chondrocyte. In summary, we have revealed that different concentrations of Dex exposure during early gestation could exert a biphasic effect on vertebrate skeletal development. - Highlights: • Chick embryos occurred shortening of the long bone following Dex exposure. • Dex suppressed chondrocytes proliferation and promoted apoptosis. • Dex exposure decreased ALP production and up-regulated Runx-2 and Mmp-13. • Dex exhibited biphasic effects on chondrogenic proliferation and nodule formation. • The hypertrophy and ossification were accelerated by Dex both in vivo and in vitro.

  1. The Phosphodiesterase 4 Inhibitor Prevents Antigen-induced Biphasic Nasal Obstruction in Brown Norway Rats

    Directory of Open Access Journals (Sweden)

    Hirokazu Kawasaki

    2005-01-01

    Conclusions: The present study provides a simple model of allergic biphasic nasal obstruction in BN rats, and also suggests that the PDE4 inhibitor may alleviate nasal obstruction in patients with allergic rhinitis.

  2. Generation of useful energy from process fluids using the biphase turbine

    Science.gov (United States)

    Helgeson, N. L.

    1981-01-01

    The six largest energy consuming industries in the United States were surveyed to determine the energy savings that could result from applying the Biphase turbine to industrial process streams. A national potential energy savings of 58 million barrels of oil per year (technical market) was identified. This energy is recoverable from flashing gas liquid process streams and is separate and distinct from exhaust gas waste heat recovery. The industries surveyed in this program were the petroleum chemical, primary metals, paper and pulp, stone-clay-glass, and food. It was required to determine the applicability of the Biphase turbine to flashing operations connected with process streams, to determine the energy changes associated with these flashes if carried out in a Biphase turbine, and to determine the suitability (technical and economical feasibility) of applying the Biphase turbine to these processes.

  3. Biphasic cuirass ventilation is better than bag-valve mask ventilation for resuscitation following organophosphate poisoning

    Directory of Open Access Journals (Sweden)

    Ilan Gur

    2015-01-01

    Conclusions: The noninvasive, easy-to-operate Biphasic Cuirass Ventilation device was effective in reducing OP-induced mortality and might be advantageous in an organophosphate mass casualty event. This finding should be validated in further investigations.

  4. Sodium lauryl sulfate impedes drug release from zinc-crosslinked alginate beads: switching from enteric coating release into biphasic profiles.

    Science.gov (United States)

    Taha, Mutasem O; Nasser, Wissam; Ardakani, Adel; Alkhatib, Hatim S

    2008-02-28

    The aim of this research is to investigate the effects of sodium lauryl sulfate (SLS) on ionotropically cross-linked alginate beads. Different levels of SLS were mixed with sodium alginate and chlorpheniramine maleate (as loaded model drug). The resulting viscous solutions were dropped onto aqueous solutions of zinc or calcium ions for ionotropic curing. The generated beads were assessed by their drug releasing profiles, infrared and differential scanning colorimetery (DSC) traits. SLS was found to exert profound concentration-dependent impacts on the characteristics of zinc-crosslinked alginate beads such that moderate modifications in the levels of SLS switched drug release from enteric coating-like behavior to a biphasic release modifiable to sustained-release by the addition of minute amounts of xanthan gum. Calcium cross-linking failed to reproduce the same behavior, probably due to the mainly ionic nature of calcium-carboxylate bonds compared to the coordinate character of their zinc-carboxylate counterparts. Apparently, moderate levels of SLS repel water penetration into the beads, and therefore minimize chlorpheniramine release. However, higher SLS levels seem to discourage polymeric cross-linking and therefore allow biphasic drug release.

  5. Effect of Ganoderma lucidum on pollen-induced biphasic nasal blockage in a guinea pig model of allergic rhinitis.

    Science.gov (United States)

    Mizutani, Nobuaki; Nabe, Takeshi; Shimazu, Masaji; Yoshino, Shin; Kohno, Shigekatsu

    2012-03-01

    Ganoderma lucidum (GL), an oriental medical mushroom, has been used in Asia for the prevention and treatment of a variety of diseases. However, the effect of GL on allergic rhinitis has not been well defined. The current study describes the inhibitory effect of GL on the biphasic nasal blockage and nasal hyperresponsiveness induced by repeated antigen challenge in a guinea pig model of allergic rhinitis. Intranasally sensitized guinea pigs were repeatedly challenged by inhalation of Japanese cedar pollen once every week. Ganoderma lucidum was orally administered once daily for 8 weeks from the time before the first challenge. The treatment with GL dose-dependently inhibited the early and late phase nasal blockage at the fifth to ninth antigen challenges. Furthermore, nasal hyperresponsiveness to intranasally applied leukotriene D₄ on 2 days after the eighth antigen challenge was also inhibited by the treatment with GL. However, Cry j 1-specific IgE antibody production was not affected by the treatment. In conclusion, we demonstrated that the pollen-induced biphasic nasal blockage and nasal hyperresponsiveness were suppressed by the daily treatment with GL in the guinea pig model of allergic rhinitis. These results suggest that GL may be a useful therapeutic drug for treating patients with allergic rhinitis. Copyright © 2011 John Wiley & Sons, Ltd.

  6. Amplification of a bi-phase shift-key modulated signal by a mm-wave FEL

    International Nuclear Information System (INIS)

    Prosnitz, D.; Scharlemann, E.T.; Sheaffer, M.K.

    1991-10-01

    Bi-phase shift keying (BPSK) is a modulation scheme used in communications and radar in which the phase of a transmitted rf signal is switched in a coded pattern between discrete values differing by π radians. The transmitted information rate (in communications) or resolution (in imaging radar) depends on the rate at which the transmitted signal can be modulated. Modulation rates of greater than 1 GHz are generally desired. Although the instantaneous gain bandwidth of a mm-wave FEL amplifier can be much greater than 10 GHz, slippage may limit the BPSK modulation rate that can be amplified. Qualitative slippage arguments would limit the modulation rate to relatively low values; nevertheless, simulations with a time-dependent FEL code (GINGER) indicate that rates of 2 GHz or more are amplified without much loss in modulation integrity. In this paper we describe the effects of slippage in the simulations and discuss the limits of simple arguments

  7. Comparison between FEBio and Abaqus for biphasic contact problems.

    Science.gov (United States)

    Meng, Qingen; Jin, Zhongmin; Fisher, John; Wilcox, Ruth

    2013-09-01

    Articular cartilage plays an important role in the function of diarthrodial joints. Computational methods have been used to study the biphasic mechanics of cartilage, and Abaqus has been one of the most widely used commercial software packages for this purpose. A newly developed open-source finite element solver, FEBio, has been developed specifically for biomechanical applications. The aim of this study was to undertake a direct comparison between FEBio and Abaqus for some practical contact problems involving cartilage. Three model types, representing a porous flat-ended indentation test, a spherical-ended indentation test, and a conceptual natural joint contact model, were compared. In addition, a parameter sensitivity study was also performed for the spherical-ended indentation test to investigate the effects of changes in the input material properties on the model outputs, using both FEBio and Abaqus. Excellent agreement was found between FEBio and Abaqus for all of the model types and across the range of material properties that were investigated.

  8. Biphasic interactions between a cationic dendrimer and actin.

    Science.gov (United States)

    Ruenraroengsak, Pakatip; Florence, Alexander T

    2010-12-01

    Gene delivery systems face the problem not only of the route toward the cell and tissues in question, but also of the molecularly crowded environment of both the cytoplasm and the nucleus itself. One of the physical barriers in the cytoplasm for diffusing nanoparticles is an actin network. Here, we describe the finding that a self-fluorescent sixth generation cationic dendrimer (6 nm in diameter) interacts reversibly and possibly electrostatically with actin filaments in vitro. Not only does this interaction slow the diffusion of the dendrimer but it also affects actin polymerization in a biphasic manner. At low concentrations the dendrimer behaves like a G-binding actin protein, retarding actin polymerization, whereas at high concentrations the dendrimer acts as a nucleating protein accelerating the polymerization. Thus in vivo the diffusion of a dendrimer carrier such as this has both physical and chemical elements: by decreasing polymerization it might accelerate its own transport, and by enhancing actin polymerization retard it. This finding suggests that such a dendrimer may have a role as an anticancer agent through its inhibitory effect on actin polymerization.

  9. Aqueous biphasic systems involving alkylsulfate-based ionic liquids

    Energy Technology Data Exchange (ETDEWEB)

    Deive, Francisco J. [Instituto de Tecnologia Quimica e Biologica, UNL, Av. Republica, Apartado 127, 2780-901 Oeiras (Portugal); Department of Chemical Engineering, University of Vigo, P.O. Box 36310, Vigo (Spain); Rodriguez, Ana [Department of Chemical Engineering, University of Vigo, P.O. Box 36310, Vigo (Spain); Marrucho, Isabel M., E-mail: imarrucho@itqb.unl.pt [Instituto de Tecnologia Quimica e Biologica, UNL, Av. Republica, Apartado 127, 2780-901 Oeiras (Portugal); Rebelo, Luis P.N. [Instituto de Tecnologia Quimica e Biologica, UNL, Av. Republica, Apartado 127, 2780-901 Oeiras (Portugal)

    2011-11-15

    Highlights: > K{sub 3}PO{sub 4}, K{sub 2}CO{sub 3}, Na{sub 2}CO{sub 3}, and (NH{sub 4}){sub 2}SO{sub 4} act as phase promoter in aqueous solutions of ILs. > Remarkable influence of alkyl-chain length on solubility curves of alkylsulfate-based ILs. > Merchuck correlation was used for describing these systems. > {Delta}S{sub hyd} and Hofmeister series were used to discuss the different salting out effects. - Abstract: The specific effects of K{sub 3}PO{sub 4}, K{sub 2}CO{sub 3}, Na{sub 2}CO{sub 3}, and (NH{sub 4}){sub 2}SO{sub 4}, as high charge-density inorganic salts and thus inducers of the formation of aqueous biphasic systems (ABS) containing several ethyl-methylimidazolium alkylsulfate ionic liquids, C{sub 2}MIM C{sub n}SO{sub 4} (n = 2, 4, 6, or 8), have been assessed at T = 298.15 K. The results are analyzed in the light of the Hofmeister series. The influence of different alkyl chain lengths in the anion, together with the ability of the selected inorganic salts to induce the formation of ABS, is discussed. Phase diagrams have been determined through turbidimetry, including tie lines assignments from mass phase ratios according to the lever - arm rule. The Merchuck equation was satisfactorily used to correlate the solubility curve.

  10. A biphasic model for bleeding in soft tissue

    Science.gov (United States)

    Chang, Yi-Jui; Chong, Kwitae; Eldredge, Jeff D.; Teran, Joseph; Benharash, Peyman; Dutson, Erik

    2017-11-01

    The modeling of blood passing through soft tissues in the body is important for medical applications. The current study aims to capture the effect of tissue swelling and the transport of blood under bleeding or hemorrhaging conditions. The soft tissue is considered as a non-static poro-hyperelastic material with liquid-filled voids. A biphasic formulation effectively, a generalization of Darcy's law-is utilized, treating the phases as occupying fractions of the same volume. The interaction between phases is captured through a Stokes-like friction force on their relative velocities and a pressure that penalizes deviations from volume fractions summing to unity. The soft tissue is modeled as a hyperelastic material with a typical J-shaped stress-strain curve, while blood is considered as a Newtonian fluid. The method of Smoothed Particle Hydrodynamics is used to discretize the conservation equations based on the ease of treating free surfaces in the liquid. Simulations of swelling under acute hemorrhage and of draining under gravity and compression will be demonstrated. Ongoing progress in modeling of organ tissues under injuries and surgical conditions will be discussed.

  11. A FAST study of quasi-static structure ("Inverted-V") potential drops and their latitudinal dependence in the premidnight sector and ramifications for the current-voltage relationship

    Science.gov (United States)

    Dombeck, J.; Cattell, C.; McFadden, J.

    2013-09-01

    Utilizing FAST satellite electron measurements, we present the first reported investigation of the dependency on latitude of quasi-static structure ("inverted-V") potential drop magnitude (Φ). A trend of lower Φ at lower latitudes in the premidnight sector on field lines with dark foot points was observed. This trend is supported both statistically and in individual satellite crossings. The existence of two distinct peaks in occurrence probability for Φ was also observed: one between ~2 kV and 10 kV and the other at somewhat less than 1 kV. The relative occurrence of structures with Φ in the higher (>2 kV) peak is significantly reduced with decreasing latitude. This partially accounts for the statistical trend of lower potential drop magnitudes at lower latitudes. The two Φ occurrence frequency peaks correspond to two different regimes (one with eΦ/kTe ~ or > 1 and one with eΦ/kTe current-voltage relation where source electron density rather than Φ is most directly controlled by the field-aligned current density. These observations and their ramifications represent a significant step forward in the understanding of field-aligned currents, auroral acceleration, and magnetospheric-ionospheric coupling.

  12. Dependence of open-circuit voltage of SnO2-nSi solar cells; SnO2-nSi taiyo denchi no sanka ondo menhoi izonsei

    Energy Technology Data Exchange (ETDEWEB)

    Shinoda, S; Shimizu, A; Yano, K; Kasuga, M [Yamanashi University, Yamanashi (Japan). Faculty of Engineering

    1997-11-25

    Although metal(or semiconductor)-semiconductor solar cells, SnO2-nSi solar cell for example, are superior in cost and efficiency, its barrier height and open-circuit voltage V(oc) are lower than those of p-n junctions. To improve these defects, study was made on the dependence of V(oc) on oxidation temperature and surface orientation using various solar cells prepared from (100)Si and (111)Si under various oxidation conditions. As a result, the density of surface states increases with a decrease in oxidation temperature of Si substrates, resulting in an increase in diode factor and V(oc). In this case, since oxide films are extremely thin and contribution of non-terminated bonds is large in the initial oxidation stage, the quantity of dangling bonds is larger in (100) plane than (111) plane, resulting in an increase in diode factor and V(oc). Since the surface energy level (the degree of electrons dominated by acceptor-like surface state from this level to the top of a valence band) of (100) Si is lower than that of (111) Si, the effective barrier height and V(oc) increase. 28 refs., 6 figs., 2 tabs.

  13. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  14. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  15. A promising tritium breeding material: Nanostructured 2Li2TiO3-Li4SiO4 biphasic ceramic pebbles

    Science.gov (United States)

    Dang, Chen; Yang, Mao; Gong, Yichao; Feng, Lan; Wang, Hailiang; Shi, Yanli; Shi, Qiwu; Qi, Jianqi; Lu, Tiecheng

    2018-03-01

    As an advanced tritium breeder material for the fusion reactor blanket of the International Thermonuclear Experimental Reactor (ITER), Li2TiO3-Li4SiO4 biphasic ceramic has attracted widely attention due to its merits. In this paper, the uniform precursor powders were prepared by hydrothermal method, and nanostructured 2Li2TiO3-Li4SiO4 biphasic ceramic pebbles were fabricated by an indirect wet method at the first time. In addition, the composition dependence (x/y) of their microstructure characteristics and mechanical properties were investigated. The results indicated that the crush load of biphasic ceramic pebbles was better than that of single phase ceramic pebbles under identical conditions. The 2Li2TiO3-Li4SiO4 ceramic pebbles have good morphology, small grain size (90 nm), satisfactory crush load (37.8 N) and relative density (81.8 %T.D.), which could be a promising breeding material in the future fusion reactor.

  16. Forging And Milling Contribution On Residual Stresses For A Textured Biphasic Titanium Alloy

    International Nuclear Information System (INIS)

    Deleuze, C.; Fabre, A.; Barrallier, L.; Molinas, O.

    2011-01-01

    Ti-10V-2Fe-3Al is a biphasic titanium alloy (α+β) used in aeronautical applications for its mechanical properties, such as its yield strength of 1200 MPa and it weighs 40% less than steel. This alloy is particularly useful for vital parts with complex geometry, because of its high forging capability. In order to predict the capability for fatigue lifetime, the designers need to know the residual stresses. X-Ray diffraction is the main experimental technique used to determine residual stresses on the surface. In this case, stress levels are primarily influenced by the complex forging and milling process. On this alloy in particular, it may be difficult to characterize stress due to modification of the microstructure close to the surface. Results obtained by x-ray analysis depend on the correct definition of the shape of the diffraction peaks. The more precisely defined the position of the peak, the more accurately the stresses are evaluated. This paper presents a method to detect if residual stresses can be characterized by x-ray diffraction. The characterization of hardness seems to be a relevant technique to quickly analyze the capability of x-ray diffraction to determine residual stresses.

  17. Biphasic threat to femoral head perfusion in abduction: arterial hypoperfusion and venous congestion

    Energy Technology Data Exchange (ETDEWEB)

    Yousefzadeh, David K. [Comer Children' s Hospital, Department of Radiology, Chicago, IL (United States); University of Chicago, Department of Radiology, Chicago, IL (United States); Jaramillo, Diego [Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); Johnson, Neil [Cincinnati Children' s Hospital, Department of Radiology, Cincinnati, OH (United States); Doerger, Kirk [Radiology Associates of Northern Kentucky, Crestview Hills, KY (United States); Sullivan, Christopher [University of Chicago, Department of Surgery, Chicago, IL (United States)

    2010-09-15

    Hip abduction can cause avascular necrosis (AVN) of the femoral head in infants. To compare the US perfusion pattern of femoral head cartilage in neutral position with that in different degrees and duration of abduction, testing the venous congestion theory of post-abduction ischemia. In 20 neonates, the Doppler flow characteristics of the posterosuperior (PS) branch of the femoral head cartilage feeding vessels were evaluated in neutral and at 30 , 45 , and 60 abduction. In three neonates the leg was held in 45-degree abduction and flow was assessed at 5, 10, and 15 min. Male/female ratio was 11/9 with a mean age of 1.86 {+-} 0.7 weeks. The peak systolic velocities (PSV) declined in all three degrees of abduction. After 15 min of 45-degree abduction, the mean PSV declined and showed an absent or reversed diastolic component and undetectable venous return. No perfusion was detected at 60-degree abduction. Abduction-induced femoral head ischemia is biphasic and degree- and duration-dependent. In phase I there is arterial hypoperfusion and in phase II there is venous congestion. A new pathogeneses for femoral head ischemia is offered. (orig.)

  18. Biphasic effect of alcohol intake on the development of fatty liver disease.

    Science.gov (United States)

    Takahashi, Hirokazu; Ono, Masafumi; Hyogo, Hideyuki; Tsuji, Chika; Kitajima, Yoichiro; Ono, Naofumi; Eguchi, Takahisa; Fujimoto, Kazuma; Chayama, Kazuaki; Saibara, Toshiji; Anzai, Keizo; Eguchi, Yuichiro

    2015-11-01

    Fatty liver is an important clinical feature not only in alcoholic and non-alcoholic fatty liver diseases, but in other chronic liver diseases as well. Our aim was to elucidate the effect and relationship between habitual alcohol intake and obesity in the development of fatty liver disease. We enrolled 8,029 subjects undergoing abdominal ultrasonography with general medical examinations, and analyzed the factors associated with fatty liver based on daily alcohol intake, body mass index (BMI), and waist circumference. For fatty liver, BMI, waist circumference, total cholesterol, triglycerides, and fasting plasma glucose were significant and independent risk factors. Heavy alcohol intake (50 g/day) was a significant risk factor for fatty liver in women (odds ratio [OR], 3.35). Analysis based on the presence or absence of obesity revealed that moderate alcohol intake was a significant negative risk factor for fatty liver in both male and female obese (BMI ≥25 kg/m(2)) subjects (OR, 0.74 for non-obese and 0.39 for obese patients, respectively). Heavy alcohol intake was also a significant negative risk factor in obese males (0.62). In contrast, heavy alcohol intake was a risk factor in non-obese males (OR, 1.29) and in all females (OR, 2.22 for non-obese and 6.6 for obese patients, respectively). The influence of alcohol intake on fatty liver differed depending on the level of alcohol consumption, gender, and the presence of obesity, and showed biphasic effects.

  19. Design and evaluation of lornoxicam bilayered tablets for biphasic release

    Directory of Open Access Journals (Sweden)

    Songa Ambedkar Sunil

    2012-12-01

    Full Text Available The objective of the present investigation was to develop bilayered tablets of lornoxicam to achieve biphasic release pattern. A bilayered tablet, consisting of an immediate and controlled release layer, was prepared by direct compression technique. The controlled release effect was achieved by using various hydrophilic natural, semi synthetic and synthetic controlled release polymers such as xanthan gum, hydroxypropyl methylcellulose (HPMC and polyethylene oxide (PEO to modulate the release of the drug. The in vitro drug release profiles showed the biphasic release behavior in which the immediate release (IR layer containing the lornoxicam was released within 15 minutes, whereas the controlled release (CR layer controlled the drug release for up to 24 h. All the bilayered tablets formulated have followed the zero order release with non-Fickian diffusion controlled release mechanism after the initial burst release. FTIR studies revealed that there was no interaction between the drug and polymers used in the study. Statistical analysis (ANOVA showed no significant difference in the cumulative amount of drug release after 15 min, but significant difference (p O objetivo do presente trabalho foi desenvolver comprimidos bicamada de lornoxicam para atingir padrão de liberação bifásica. Preparou-se, por compressão direta, comprimido bicamada, consistindo de uma camada de liberação imediata e uma de liberação controlada. A liberação controlada foi obtida pelo uso de vários polímeros naturais hidrofílicos, semi-sintéticos e sintéticos, tais como goma xantana, hidroxipropilmetil celulose (HPMC e óxido de polietileno (PEO para modular a liberação do fármaco. Os perfis de liberação in vitro mostraram comportamento bifásico em que a camada de liberação imediata (IR contendo lornoxicam foi liberada em 15 minutos, enquanto a camada de liberação controlada (CR liberou o fármaco em mais de 24 horas, Todos os comprimidos bicamada

  20. Novel Measurements of Aerosol Particle Interfaces Using Biphasic Microfluidics

    Science.gov (United States)

    Metcalf, A. R.; Dutcher, C. S.

    2014-12-01

    Secondary organic aerosol (SOA) particles are nearly ubiquitous in the atmosphere and yet there remains large uncertainties in their formation processes and ambient properties. These particles are complex microenvironments, which can contain multiple interfaces due to internal aqueous-organic phase partitioning and to the external liquid-vapor surface. These aerosol interfaces can profoundly affect the fate of condensable organic compounds emitted into the atmosphere by altering the way in which organic vapors interact with the ambient aerosol. Aerosol interfaces affect particle internal structure, species uptake, equilibrium partitioning, activation to cloud condensation or ice nuclei, and optical properties. For example, organic thin films can shield the core of the aerosol from the ambient environment, which may disrupt equilibrium partitioning and mass transfer. To improve our ability to accurately predict the fate of SOA in the atmosphere, we must improve our knowledge of aerosol interfaces and their interactions with the ambient environment. Few technologies exist to accurately probe aerosol interfaces at atmospherically-relevant conditions. In this talk, a novel method using biphasic microscale flows will be introduced for generating, trapping, and perturbing complex interfaces at atmospherically relevant conditions. These microfluidic experiments utilize high-speed imaging to monitor interfacial phenomena at the microscale and are performed with phase contrast and fluorescence microscopy on a temperature-controlled inverted microscope stage. From these experiments, interfacial thermodynamic properties such as surface tension, rheological properties such as interfacial moduli, and kinetic properties such as mass transfer coefficients can be measured or inferred. Chemical compositions of the liquid phases studied here span a range of viscosities and include electrolyte and water soluble organic acid species often observed in the atmosphere, such as mixtures

  1. Core-shell nanoreactors for efficient aqueous biphasic catalysis.

    Science.gov (United States)

    Zhang, Xuewei; Cardozo, Andrés F; Chen, Si; Zhang, Wenjing; Julcour, Carine; Lansalot, Muriel; Blanco, Jean-François; Gayet, Florence; Delmas, Henri; Charleux, Bernadette; Manoury, Eric; D'Agosto, Franck; Poli, Rinaldo

    2014-11-17

    Water-borne phosphine-functionalized core-cross-linked micelles (CCM) consisting of a hydrophobic core and a hydrophilic shell were obtained as stable latexes by reversible addition-fragmentation chain transfer (RAFT) in water in a one-pot, three-step process. Initial homogeneous aqueous-phase copolymerization of methacrylic acid (MAA) and poly(ethylene oxide) methyl ether methacrylate (PEOMA) is followed by copolymerization of styrene (S) and 4-diphenylphosphinostyrene (DPPS), yielding P(MAA-co-PEOMA)-b-P(S-co-DPPS) amphiphilic block copolymer micelles (M) by polymerization-induced self-assembly (PISA), and final micellar cross-linking with a mixture of S and diethylene glycol dimethacrylate. The CCM were characterized by dynamic light scattering and NMR spectroscopy to evaluate size, dispersity, stability, and the swelling ability of various organic substrates. Coordination of [Rh(acac)(CO)2 ] (acac=acetylacetonate) to the core-confined phosphine groups was rapid and quantitative. The CCM and M latexes were then used, in combination with [Rh(acac)(CO)2 ], to catalyze the aqueous biphasic hydroformylation of 1-octene, in which they showed high activity, recyclability, protection of the activated Rh center by the polymer scaffold, and low Rh leaching. The CCM latex gave slightly lower catalytic activity but significantly less Rh leaching than the M latex. A control experiment conducted in the presence of the sulfoxantphos ligand pointed to the action of the CCM as catalytic nanoreactors with substrate and product transport into and out of the polymer core, rather than as a surfactant in interfacial catalysis. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  3. Charge carrier transport in Cu(In,Ga)Se2 thin-film solar-cells studied by electron beam induced current and temperature and illumination dependent current voltage analysis

    International Nuclear Information System (INIS)

    Nichterwitz, Melanie

    2012-01-01

    This work contributes to the understanding of generation dependent charge-carrier transport properties in Cu(In,Ga)Se 2 (CIGSe)/ CdS/ ZnO solar cells and a consistent model for the electronic band diagram of the heterojunction region of the device is developed. Cross section electron-beam induced current (EBIC) and temperature and illumination dependent current voltage (IV) measurements are performed on CIGSe solar cells with varying absorber layer compositions and CdS thickness. For a better understanding of possibilities and limitations of EBIC measurements applied on CIGSe solar cells, detailed numerical simulations of cross section EBIC profiles for varying electron beam and solar cell parameters are performed and compared to profiles obtained from an analytical description. Especially the effects of high injection conditions are considered. Even though the collection function of the solar cell is not independent of the generation function of the electron beam, the local electron diffusion length in CIGSe can still be extracted. Grain specific values ranging from (480±70) nm to (2.3±0.2) μm are determined for a CuInSe 2 absorber layer and a value of (2.8±0.3) μm for CIGSe with a Ga-content of 0.3. There are several models discussed in literature to explain generation dependent charge carrier transport, all assuming a high acceptor density either located in the CIGSe layer close to the CIGSe/CdS interface (p + layer), within the CdS layer or at the CdS/ZnO interface. In all models, a change in charge carrier collection properties is caused by a generation dependent occupation probability of the acceptor type defect state and the resulting potential distribution throughout the device. Numerical simulations of EBIC and IV data are performed with parameters according to these models. The model that explains the experimental data best is that of a p + layer at the CIGSe/CdS interface and acceptor type defect states at the CdS/ZnO interface. The p + layer leads

  4. High voltage engineering fundamentals

    CERN Document Server

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  5. The metal-ion-dependent adhesion site in the Von Willebrand factor-A domain of α2δ subunits is key to trafficking voltage-gated Ca2+ channels

    Science.gov (United States)

    Cantí, C.; Nieto-Rostro, M.; Foucault, I.; Heblich, F.; Wratten, J.; Richards, M. W.; Hendrich, J.; Douglas, L.; Page, K. M.; Davies, A.; Dolphin, A. C.

    2005-01-01

    All auxiliary α2δ subunits of voltage-gated Ca2+ (CaV) channels contain an extracellular Von Willebrand factor-A (VWA) domain that, in α2δ-1 and -2, has a perfect metal-ion-dependent adhesion site (MIDAS). Modeling of the α2δ-2 VWA domain shows it to be highly likely to bind a divalent cation. Mutating the three key MIDAS residues responsible for divalent cation binding resulted in a MIDAS mutant α2δ-2 subunit that was still processed and trafficked normally when it was expressed alone. However, unlike WT α2δ-2, the MIDAS mutant α2δ-2 subunit did not enhance and, in some cases, further diminished CaV1.2, -2.1, and -2.2 currents coexpressed with β1b by using either Ba2+ or Na+ as a permeant ion. Furthermore, expression of the MIDAS mutant α2δ-2 reduced surface expression and strongly increased the perinuclear retention of CaVα1 subunits at the earliest time at which expression was observed in both Cos-7 and NG108–15 cells. Despite the presence of endogenous α2δ subunits, heterologous expression of α2δ-2 in differentiated NG108–15 cells further enhanced the endogenous high-threshold Ca2+ currents, whereas this enhancement was prevented by the MIDAS mutations. Our results indicate that α2δ subunits normally interact with the CaVα1 subunit early in their maturation, before the appearance of functional plasma membrane channels, and an intact MIDAS motif in the α2δ subunit is required to promote trafficking of the α1 subunit to the plasma membrane by an integrin-like switch. This finding provides evidence for a primary role of a VWA domain in intracellular trafficking of a multimeric complex, in contrast to the more usual roles in binding extracellular ligands in other exofacial VWA domains. PMID:16061813

  6. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Low-voltage gyrotrons

    International Nuclear Information System (INIS)

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  8. Low voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  9. Low voltage electron beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  10. Evaluation of the finite element software ABAQUS for biomechanical modelling of biphasic tissues.

    Science.gov (United States)

    Wu, J Z; Herzog, W; Epstein, M

    1998-02-01

    The biphasic cartilage model proposed by Mow et al. (1980) has proven successful to capture the essential mechanical features of articular cartilage. In order to analyse the joint contact mechanics in real, anatomical joints, the cartilage model needs to be implemented into a suitable finite element code to approximate the irregular surface geometries of such joints. However, systematic and extensive evaluation of the capacity of commercial software for modelling the contact mechanics with biphasic cartilage layers has not been made. This research was aimed at evaluating the commercial finite element software ABAQUS for analysing biphasic soft tissues. The solutions obtained using ABAQUS were compared with those obtained using other finite element models and analytical solutions for three numerical tests: an unconfined indentation test, a test with the contact of a spherical cartilage surface with a rigid plate, and an axi-symmetric joint contact test. It was concluded that the biphasic cartilage model can be implemented into the commercial finite element software ABAQUS to analyse practical joint contact problems with biphasic articular cartilage layers.

  11. Equivalence between short-time biphasic and incompressible elastic material responses.

    Science.gov (United States)

    Ateshian, Gerard A; Ellis, Benjamin J; Weiss, Jeffrey A

    2007-06-01

    Porous-permeable tissues have often been modeled using porous media theories such as the biphasic theory. This study examines the equivalence of the short-time biphasic and incompressible elastic responses for arbitrary deformations and constitutive relations from first principles. This equivalence is illustrated in problems of unconfined compression of a disk, and of articular contact under finite deformation, using two different constitutive relations for the solid matrix of cartilage, one of which accounts for the large disparity observed between the tensile and compressive moduli in this tissue. Demonstrating this equivalence under general conditions provides a rationale for using available finite element codes for incompressible elastic materials as a practical substitute for biphasic analyses, so long as only the short-time biphasic response is sought. In practice, an incompressible elastic analysis is representative of a biphasic analysis over the short-term response deltatelasticity tensor, and K is the hydraulic permeability tensor of the solid matrix. Certain notes of caution are provided with regard to implementation issues, particularly when finite element formulations of incompressible elasticity employ an uncoupled strain energy function consisting of additive deviatoric and volumetric components.

  12. Dissolved nutrients and atrazine removal by column-scale monophasic and biphasic rain garden model systems.

    Science.gov (United States)

    Yang, Hanbae; McCoy, Edward L; Grewal, Parwinder S; Dick, Warren A

    2010-08-01

    Rain gardens are bioretention systems that have the potential to reduce peak runoff flow and improve water quality in a natural and aesthetically pleasing manner. We compared hydraulic performance and removal efficiencies of nutrients and atrazine in a monophasic rain garden design versus a biphasic design at a column-scale using simulated runoff. The biphasic rain garden was designed to increase retention time and removal efficiency of runoff pollutants by creating a sequence of water saturated to unsaturated conditions. We also evaluated the effect of C substrate availability on pollutant removal efficiency in the biphasic rain garden. Five simulated runoff events with various concentrations of runoff pollutants (i.e. nitrate, phosphate, and atrazine) were applied to the monophasic and biphasic rain gardens once every 5d. Hydraulic performance was consistent over the five simulated runoff events. Peak flow was reduced by approximately 56% for the monophasic design and 80% for the biphasic design. Both rain garden systems showed excellent removal efficiency of phosphate (89-100%) and atrazine (84-100%). However, significantly (prain garden (29-39%). Addition of C substrate in the form of glucose increased removal efficiency of nitrate significantly (prain gardens. (c) 2010 Elsevier Ltd. All rights reserved.

  13. Multi-objective optimization of distributed generation with voltage ...

    African Journals Online (AJOL)

    DR OKE

    1*Department of Electrical Engineering, Kamla Nehru Institute of Technology Sultanpurr, ... of DG in distribution systems for different voltage dependent load models and .... The evaluation of the objective function depends only on location, size ...

  14. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  15. Pretreatment of Eucalyptus in biphasic system for furfural production and accelerated enzymatic hydrolysis.

    Science.gov (United States)

    Zhang, Xiudong; Bai, Yuanyuan; Cao, Xuefei; Sun, Runcang

    2017-08-01

    Herein, an efficient biphasic pretreatment process was developed to improve the production of furfural (FF) and glucose from Eucalyptus. The influence of formic acid and NaCl on FF production from xylose in water and various biphasic systems was investigated. Results showed that the addition of formic acid and NaCl significantly promoted the FF yield, and the biphasic system of MIBK (methyl isobutyl ketone)/water exhibited the best performance for FF production. Then the Eucalyptus was pretreated in the MIBK/water system, and a maximum FF yield of 82.0% was achieved at 180°C for 60min. Surface of the pretreated Eucalyptus became relatively rough and loose, and its crystallinity index increased obviously due to the removal of hemicelluloses and lignin. The pretreated Eucalyptus samples showed much higher enzymatic hydrolysis rates (26.2-70.7%) than the raw Eucalyptus (14.5%). Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Metabolomics reveals metabolic targets and biphasic responses in breast cancer cells treated by curcumin alone and in association with docetaxel.

    Directory of Open Access Journals (Sweden)

    Mathilde Bayet-Robert

    Full Text Available BACKGROUND: Curcumin (CUR has deserved extensive research due to its anti-inflammatory properties, of interest in human diseases including cancer. However, pleiotropic even paradoxical responses of tumor cells have been reported, and the mechanisms of action of CUR remain uncompletely elucidated. METHODOLOGY/PRINCIPAL FINDINGS: (1H-NMR spectroscopy-based metabolomics was applied to get novel insight into responses of MCF7 and MDA-MB-231 breast cancer cells to CUR alone, and MCF7 cells to CUR in cotreatment with docetaxel (DTX. In both cell types, a major target of CUR was glutathione metabolism. Total glutathione (GSx increased at low dose CUR (≤ 10 mg.l(-1-28 µM- (up to +121% in MCF7 cells, P<0.01, and +138% in MDA-MB-231 cells, P<0.01, but decreased at high dose (≥ 25 mg.l(-1 -70 µM- (-49%, in MCF7 cells, P<0.02, and -56% in MDA-MB-231 cells, P<0.025. At high dose, in both cell types, GSx-related metabolites decreased, including homocystein, creatine and taurine (-60 to -80%, all, P<0.05. Together with glutathione-S-transferase actvity, data established that GSx biosynthesis was upregulated at low dose, and GSx consumption activated at high dose. Another major target, in both cell types, was lipid metabolism involving, at high doses, accumulation of polyunsaturated and total free fatty acids (between ×4.5 and ×11, P<0.025, and decrease of glycerophospho-ethanolamine and -choline (about -60%, P<0.025. Multivariate statistical analyses showed a metabolic transition, even a biphasic behavior of some metabolites including GSx, between low and high doses. In addition, CUR at 10 mg.l(-1 in cotreatment with DTX induced modifications in glutathione metabolism, lipid metabolism, and glucose utilization. Some of these changes were biphasic depending on the duration of exposure to CUR. CONCLUSIONS/SIGNIFICANCE: Metabolomics reveals major metabolic targets of CUR in breast cancer cells, and biphasic responses that challenge the widely accepted

  17. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  18. The standard biphasic-contrast examination of the stomach and duodenum

    International Nuclear Information System (INIS)

    Op den Orth, J.O.

    1979-01-01

    A standard examination has been developed, called biphasic, because it combines the advantages of positive-contrast and double-contrast techniques. The theoretical background and technique of this examination are described and the basic interpretation of double-contrast studies stated. General remarks on the results and on the complementary role of radiological examination and endoscopy are included. A quantitative study of standard biphasic-contrast examinations in patients over a period of 3 years is presented. Finally a radiological atlas of common lesions of the stomach and duodenum is given. (C.F.)

  19. Biphasic decay of the Ca transient results from increased sarcoplasmic reticulum Ca leak

    Science.gov (United States)

    Sankaranarayanan, Rajiv; Li, Yatong; Greensmith, David J.; Eisner, David A.

    2016-01-01

    Key points Ca leak from the sarcoplasmic reticulum through the ryanodine receptor (RyR) reduces the amplitude of the Ca transient and slows its rate of decay.In the presence of β‐adrenergic stimulation, RyR‐mediated Ca leak produces a biphasic decay of the Ca transient with a fast early phase and a slow late phase.Two forms of Ca leak have been studied, Ca‐sensitising (induced by caffeine) and non‐sensitising (induced by ryanodine) and both induce biphasic decay of the Ca transient.Only Ca‐sensitising leak can be reversed by traditional RyR inhibitors such as tetracaine.Ca leak can also induce Ca waves. At low levels of leak, waves occur. As leak is increased, first biphasic decay and then slowed monophasic decay is seen. The level of leak has major effects on the shape of the Ca transient. Abstract In heart failure, a reduction in Ca transient amplitude and contractile dysfunction can by caused by Ca leak through the sarcoplasmic reticulum (SR) Ca channel (ryanodine receptor, RyR) and/or decreased activity of the SR Ca ATPase (SERCA). We have characterised the effects of two forms of Ca leak (Ca‐sensitising and non‐sensitising) on calcium cycling and compared with those of SERCA inhibition. We measured [Ca2+]i with fluo‐3 in voltage‐clamped rat ventricular myocytes. Increasing SR leak with either caffeine (to sensitise the RyR to Ca activation) or ryanodine (non‐sensitising) had similar effects to SERCA inhibition: decreased systolic [Ca2+]i, increased diastolic [Ca2+]i and slowed decay. However, in the presence of isoproterenol, leak produced a biphasic decay of the Ca transient in the majority of cells while SERCA inhibition produced monophasic decay. Tetracaine reversed the effects of caffeine but not of ryanodine. When caffeine (1 mmol l−1) was added to a cell which displayed Ca waves, the wave frequency initially increased before waves disappeared and biphasic decay developed. Eventually (at higher caffeine concentrations), the

  20. Intermediate state trapping of a voltage sensor

    DEFF Research Database (Denmark)

    Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca

    2012-01-01

    Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...

  1. Wind Power Plant Voltage Stability Evaluation: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Muljadi, E.; Zhang, Y. C.

    2014-09-01

    Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

  2. Synthesis, characterization and in vitro behavior of nanostructured diopside/biphasic calcium phosphate scaffolds

    Energy Technology Data Exchange (ETDEWEB)

    Ramezani, Samira; Emadi, Rahmatollah; Kharaziha, Mahshid [Department of Materials Engineering, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of); Tavangarian, Fariborz, E-mail: f_tavangarian@yahoo.com [Mechanical Engineering Program, School of Science, Engineering and Technology, Penn State Harrisburg, Middletown, PA 17057 (United States)

    2017-01-15

    A significant challenge in bone tissue engineering is the development of 3D constructs serving as scaffolds to fill bone defects, support osteoblasts, and promote bone regeneration. In this paper, highly porous (∼79%) nanostructured diopside/biphasic calcium phosphate (BCP) scaffolds with interconnected porosity were developed using various diopside contents via space holder method. X-ray diffraction (XRD), transmission electron microscopy (TEM) and scanning electron microscopy (SEM) techniques were utilized to evaluate different samples. Furthermore, the effects of scaffold composition on mechanical properties, bioactivity, biodegradability, and cytotoxicity were studied as well. The results showed that the produced scaffolds had an average pore size and density of 200–340 μm and 2.5 ± 0.3–1.8 ± 0.3 gr/cm{sup 3}, respectively, depending on the diopside content. Besides, increasing the diopside content of scaffolds from 0 to 15 wt% enhanced the bioactivity, biodegradability, and compressive strength from 1.2 ± 0.2 to 3.2 ± 0.3 MPa, respectively. In addition, MTT assay also confirmed that the BCP15 scaffold (containing 15 wt% diopside) significantly promoted cell viability and cell adhesion compared to BCP0 scaffold. Overall, our study suggests that nanostructured diopside/BCP scaffolds with improved biological and mechanical properties could potentially be used for bone tissue engineering application. - Highlights: • Highly porous (∼79%) scaffolds were synthesized by space holder method. • Adding diopside nanopowder reduced the average pore size of the scaffolds. • Diopside increased the compressive strength of the scaffolds by three-times. • Nanostructured diopside/BCP scaffolds significantly promoted cell viability. • The nanostructured composite scaffold of BCP15 is cell-friendly.

  3. Response of stem cells from different origins to biphasic calcium phosphate bioceramics.

    Science.gov (United States)

    Lobo, Sonja E; Glickman, Robert; da Silva, Wagner N; Arinzeh, Treena L; Kerkis, Irina

    2015-08-01

    Biphasic calcium phosphate (BCP) bioceramics have been successfully applied in a broad variety of presentation forms and with different ratios of hydroxyapatite (HA) and β-tricalcium phosphate (β-TCP). BCPs have been loaded with stem cells from different origins for bone tissue engineering purposes, but evidence of stem cell behavior on different compositions (various HA/β-TCP ratios) and physical features of BCPs is limited. We compared the adhesion, proliferation, viability and osteogenic potential of human mesenchymal stem cells (MSCs) on granular BCPs with equal HA/β-TCP ratio of diverse particle sizes and on porous blocks which had different chemical compositions. In addition, the osteogenic differentiation of MSCs was compared to adipose-derived (ADSC) and dental pulp (DPSC) stem cells, as well as to pre-osteoblasts on a particulate BCP. MSCs growing on granular BCPs demonstrated increased number as compared to MSCs growing on blocks. Cells proliferated to a greater extent on small granular BCPs, while large granular BCPs and blocks promoted cell differentiation. Surprisingly, the expression of genes involved in osteogenesis was upregulated in MSCs on bioceramics in basal medium which indicates that BCPs may have osteoinductive potential. This was confirmed with the upregulation of osteochondrogenic markers, at different time points, when stem cells from various tissues were grown on the BCP. This study demonstrates that BCPs, depending on their physical features and chemical composition, modulate stem cell behavior, and that stem cells from different origins are inherently distinct in their gene expression profile and can be triggered toward osteochondrogenic fate by BCPs.

  4. Direct 3D powder printing of biphasic calcium phosphate scaffolds for substitution of complex bone defects

    International Nuclear Information System (INIS)

    Castilho, Miguel; Pires, Inês; Moseke, Claus; Ewald, Andrea; Gbureck, Uwe; Groll, Jürgen; Teßmar, Jörg; Vorndran, Elke

    2014-01-01

    The 3D printing technique based on cement powders is an excellent method for the fabrication of individual and complex bone substitutes even in the case of large defects. The outstanding bone remodeling capacity of biphasic calcium phosphates (BCPs) containing hydroxyapatite (HA) as well as tricalcium phosphate (TCP) in varying ratios makes the adaption of powder systems resulting in BCP materials to this fabrication technique a desirable aim. This study presents the synthesis and characterization of a novel powder system for the 3D printing process, intended for the production of complexly shaped BCP scaffolds by a hydraulic setting reaction of calcium carbonate and TCP with phosphoric acid. The HA/TCP ratio in the specimens could be tailored by the calcium/phosphate ratio of the starting powder. The scaffolds could be fabricated with a dimensional accuracy of >96.5% and a minimal macro pore size of 300 µm. Independent of the phase composition the printed specimens showed a microporosity of approximately 68%, while the compressive strength strongly depended on the chemical composition and increased with rising TCP content in the scaffolds to a maximum of 1.81 MPa. Post-treatment of the scaffolds with a polylactic-co-glycolic acid-solution enhanced the mechanical properties by a factor of 8. In vitro studies showed that all BCP scaffolds were cytocompatible and enhanced the cell viability as well as the cell proliferation, as compared with pure TCP. Cell proliferation is even better on BCP when compared to HA and cell viability is in a similar range on these materials. (paper)

  5. Digital voltage discriminator

    International Nuclear Information System (INIS)

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  6. High-voltage picoamperemeter

    Energy Technology Data Exchange (ETDEWEB)

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  7. Geomagnetism and Induced Voltage

    Science.gov (United States)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  8. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  9. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.

  10. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

  11. CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.

    Directory of Open Access Journals (Sweden)

    Samuel eGoodchild

    2012-06-01

    Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.

  12. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

  13. The harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter.

    OpenAIRE

    ПАНЧЕНКО, В В

    2015-01-01

    The author investigates a rectifier unit constructed on the basis of cascade connection of the main non-controlled m-pulse rectifier and PWM voltage booster converter. The research presents the analysis of the harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter on completely controlled keys. The dependence of the relative harmonic amplitude on the commutation corner is defined. The estimation of a rectifier unit electromagnetic compatibility wit...

  14. Effect of nasal continuous and biphasic positive airway pressure on lung volume in preterm infants

    NARCIS (Netherlands)

    Miedema, Martijn; van der Burg, Pauline S.; Beuger, Sabine; de Jongh, Frans H.; Frerichs, Inez; van Kaam, Anton H.

    2013-01-01

    To monitor regional changes in end-expiratory lung volume (EELV), tidal volumes, and their ventilation distribution during different levels of nasal continuous positive airway pressure (nCPAP) and nasal biphasic positive airway pressure (BiPAP) in stable preterm infants. By using electrical

  15. A New Type of Biphasic Calcium Phosphate Cement as a Gentamicin Carrier for Osteomyelitis

    Directory of Open Access Journals (Sweden)

    Wen-Yu Su

    2013-01-01

    Full Text Available Osteomyelitis therapy is a long-term and inconvenient procedure for a patient. Antibiotic-loaded bone cements are both a complementary and alternative treatment option to intravenous antibiotic therapy for the treatment of osteomyelitis. In the current study, the biphasic calcium phosphate cement (CPC, called α-TCP/HAP (α-tricalcium phosphate/hydroxyapatite biphasic cement, was prepared as an antibiotics carrier for osteomyelitis. The developed biphasic cement with a microstructure of α-TCP surrounding the HAP has a fast setting time which will fulfill the clinical demand. The X-ray diffraction and Fourier transform infrared spectrometry analyses showed the final phase to be HAP, the basic bone mineral, after setting for a period of time. Scanning electron microscopy revealed a porous structure with particle sizes of a few micrometers. The addition of gentamicin in α-TCP/HAP would delay the transition of α-TCP but would not change the final-phase HAP. The gentamicin-loaded α-TCP/HAP supplies high doses of the antibiotic during the initial 24 hours when they are soaked in phosphate buffer solution (PBS. Thereafter, a slower drug release is produced, supplying minimum inhibitory concentration until the end of the experiment (30 days. Studies of growth inhibition of Staphylococcus aureus and Pseudomonas aeruginosa in culture indicated that gentamicin released after 30 days from α-TCP/HAP biphasic cement retained antibacterial activity.

  16. A randomized trial comparing monophasic and biphasic waveform shocks for external cardioversion of atrial fibrillation

    NARCIS (Netherlands)

    Koster, Rudolph W.; Dorian, Paul; Chapman, Fred W.; Schmitt, Paul W.; O'Grady, Sharon G.; Walker, Robert G.

    2004-01-01

    Background We compared efficacy of and pain felt after biphasic truncated exponential (BTE) and monophasic damped sine (MDS) shocks in patients undergoing external cardioversion of atrial fibrillation (AF). Methods Patients with AF were randomized to BTE or MDS waveform cardioversion. Successive

  17. Occurrence of amylose-lipid complexes in teff and maize starch biphasic pastes

    CSIR Research Space (South Africa)

    Wokadala, OC

    2012-09-01

    Full Text Available The occurrence of amylose–lipid complexes was determined in maize and teff starch biphasic pastes i.e. peak viscosity pastes at short and prolonged pasting times. Maize and teff starches were pasted for 11.5 and 130 min with or without added stearic...

  18. A re-examination of the biphasic theory of skeletal muscle growth.

    Science.gov (United States)

    Levine, A S; Hegarty, P V

    1977-01-01

    Because of the importance of fibre diameter measurements it was decided to re-evaluate the biphasic theory of skeletal muscle growth and development. This theory proposes an initial memophasic distribution of muscle fibres which changes to a biphasic distribution during development. The theory is based on observations made on certain muscles in mice, where two distinct populations of fibre diameters (20 and 40 micronm) contribute to the biphasic distribution. In the present investigation corss sections of frozen biceps brachii of mice in rigor mortis were examined. The rigor state was used to avoid complications produced by thaw-rigor contraction. The diameters of the outermost and innermost fibres were found to be significantly different. However, if the outer and inner fibres were combined to form one group, no significant difference between this group and other random groups was found. The distributions of all groups were monophasic. The diameters of isolated fibres from mice and rats also displayed a monophasic distribution. This evidence leads to the conclusion that the biphasic theory of muscle growth is untenable. Some of the variables which may occur in fibre size and shape are discussed. Images Fig. 1 PMID:858691

  19. Biphasic single-reactor process for dehydration of xylose and hydrogenation of produced furfural

    NARCIS (Netherlands)

    Ordomskiy, V.; Schouten, J.C.; Schaaf, van der J.; Nijhuis, T.A.

    2013-01-01

    The processes of xylose dehydration and the consecutive furfural hydrogenation have been combined in a single biphasic reactor. The dehydration was studied over Amberlyst-15 and the hydrogenation over a hydrophobic Ru/C catalyst. 1-Butanol, 2-methyltetrahydrofuran and cyclohexane were used as

  20. Hydroxyapatite/polylactide biphasic combination scaffold loaded with dexamethasone for bone regeneration.

    Science.gov (United States)

    Son, Jun-Sik; Kim, Su-Gwan; Oh, Ji-Su; Appleford, Mark; Oh, Sunho; Ong, Joo L; Lee, Kyu-Bok

    2011-12-15

    This study presents a novel design of a ceramic/polymer biphasic combination scaffold that mimics natural bone structures and is used as a bone graft substitute. To mimic the natural bone structures, the outside cortical-like shells were composed of porous hydroxyapatite (HA) with a hollow interior using a polymeric template-coating technique; the inner trabecular-like core consisted of porous poly(D,L-lactic acid) (PLA) that was loaded with dexamethasone (DEX) and was directly produced using a particle leaching/gas forming technique to create the inner diameter of the HA scaffold. It was observed that the HA and PLA parts of the fabricated HA/PLA biphasic scaffold contained open and interconnected pore structures, and the boundary between both parts was tightly connected without any gaps. It was found that the structure of the combination scaffold was analogous to that of natural bone based on micro-computed tomography analysis. Additionally, the dense, uniform apatite layer was formed on the surface of the HA/PLA biphasic scaffold through a biomimetic process, and DEX was successfully released from the PLA of the biphasic scaffold over a 1-month period. This release caused human embryonic palatal mesenchyme cells to proliferate, differentiate, produce ECM, and form tissue in vitro. Therefore, it was concluded that this functionally graded scaffold is similar to natural bone and represents a potential bone-substitute material. Copyright © 2011 Wiley Periodicals, Inc.

  1. Alpha alumina synthesis by laser treatment of bi-phasic nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Aktas, Cenk, E-mail: cenk.aktas@inm-gmbh.de [Leibniz Institute for New Materials, D2 2 Campus, 66123 Saarbrücken (Germany); Lee, Juseok; Míro, Marina Martinez [Leibniz Institute for New Materials, D2 2 Campus, 66123 Saarbrücken (Germany); Barnoush, Afrooz [Norwegian University of Science and Technology, Trondheim (Norway); Saarland University, D2 2 Campus, 66123 Saarbrücken (Germany); Veith, Michael [Leibniz Institute for New Materials, D2 2 Campus, 66123 Saarbrücken (Germany)

    2013-08-01

    Al/Al{sub 2}O{sub 3} bi-phasic nanowires (Al-core/Al{sub 2}O{sub 3} shell) are prepared by chemical vapor deposition (CVD) using single source precursor (SSP) approach. Such bi-phasic nanostructures were heat-treated using an argon laser operating at visible wavelengths. Al core seems to act as an active binder, which might decrease the inhomogeneous heating and thermal gradients. Nanoindentation method is used to estimate the hardness of the laser treated surfaces. Hardness values and pop-in behaviour in loading-curve indicate a formation of α-Al{sub 2}O{sub 3} with very low defect density. It is believed that Al/Al{sub 2}O{sub 3} bi-phasic layers exhibit a dynamic change by transforming into alumina after the laser irradiation and this leads to alteration of the optical absorption especially in the visible wavelength region. Following the full transformation to alumina, the surface reflects back the laser light which hinders inhomogeneous and excessive heating. In this context, laser treatment of Al/Al{sub 2}O{sub 3} bi-phasic nanowires provides a controlled sintering process which can open up various applications in different fields.

  2. Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

    Science.gov (United States)

    Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-07-15

    A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

    Science.gov (United States)

    Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-01-01

    A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

  4. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain

    Directory of Open Access Journals (Sweden)

    Yukiko eMishina

    2014-09-01

    Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  5. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.

    Science.gov (United States)

    Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas

    2014-01-01

    Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  6. Voltage Quench Dynamics of a Kondo System.

    Science.gov (United States)

    Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel

    2016-01-22

    We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.

  7. Influence of Voltage on Main Characteristics of Electric Lighting Lamps

    Directory of Open Access Journals (Sweden)

    V. B. Kozlovskaya

    2009-01-01

    Full Text Available An analysis and systemization of data on influence of voltage value on main lighting engineering, electric and economic characteristics of incandescent lamps, gaseous-discharge lamps of low and high pressure have been made in the paper.Analytical and graphical dependences have been obtained that ensure to evaluate quantitative changes of corresponding lamp characteristics at voltage deviation from nominal value.

  8. Mechanism of voltage-gated channel formation in lipid membranes.

    Science.gov (United States)

    Guidelli, Rolando; Becucci, Lucia

    2016-04-01

    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  10. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  11. High Voltage Seismic Generator

    Science.gov (United States)

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  12. Increased voltage photovoltaic cell

    Science.gov (United States)

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  13. Non steady-state descriptions of drug permeation through stratum corneum. I. The biphasic brick-and-mortar model.

    Science.gov (United States)

    Heisig, M; Lieckfeldt, R; Wittum, G; Mazurkevich, G; Lee, G

    1996-03-01

    The diffusion equation should be solved for the non-steady-state problem of drug diffusion within a two-dimensional, biphasic stratum corneum membrane having homogeneous lipid and corneocyte phases. A numerical method was developed for a brick-and-mortar SC-geometry, enabling an explicit solution for time-dependent drug concentration within both phases. The lag time and permeability were calculated. It is shown how the barrier property of this model membrane depends on relative phase permeability, corneocyte alignment, and corneocyte-lipid partition coefficient. Additionally, the time-dependent drug concentration profiles within the membrane can be observed during the lag and steady-state phases. The model SC-membrane predicts, from purely morphological principles, lag times and permeabilities that are in good agreement with experimental values. The long lag times and very small permeabilities reported for human SC can only be predicted for a highly-staggered corneocyte geometry and corneocytes that are 1000 times less permeable than the lipid phase. Although the former conclusion is reasonable, the latter is questionable. The elongated, flattened corneocyte shape renders lag time and permeability insensitive to large changes in their alignment within the SC. Corneocyte/lipid partitioning is found to be fundamentally different to SC/donor partitioning, since increasing drug lipophilicity always reduces both lag time and permeability.

  14. B-Raf and CRHR1 internalization mediate biphasic ERK1/2 activation by CRH in hippocampal HT22 Cells.

    Science.gov (United States)

    Bonfiglio, Juan J; Inda, Carolina; Senin, Sergio; Maccarrone, Giuseppina; Refojo, Damián; Giacomini, Damiana; Turck, Christoph W; Holsboer, Florian; Arzt, Eduardo; Silberstein, Susana

    2013-03-01

    CRH is a key regulator of neuroendocrine, autonomic, and behavioral response to stress. CRH-stimulated CRH receptor 1 (CRHR1) activates ERK1/2 depending on intracellular context. In a previous work, we demonstrated that CRH activates ERK1/2 in limbic areas of the mouse brain (hippocampus and basolateral amygdala). ERK1/2 is an essential mediator of hippocampal physiological processes including emotional behavior, synaptic plasticity, learning, and memory. To elucidate the molecular mechanisms by which CRH activates ERK1/2 in hippocampal neurons, we used the mouse hippocampal cell line HT22. We document for the first time that ERK1/2 activation in response to CRH is biphasic, involving a first cAMP- and B-Raf-dependent early phase and a second phase that critically depends on CRHR1 internalization and β-arrestin2. By means of mass-spectrometry-based screening, we identified B-Raf-associated proteins that coimmunoprecipitate with endogenous B-Raf after CRHR1 activation. Using molecular and pharmacological tools, the functional impact of selected B-Raf partners in CRH-dependent ERK1/2 activation was dissected. These results indicate that 14-3-3 proteins, protein kinase A, and Rap1, are essential for early CRH-induced ERK1/2 activation, whereas dynamin and vimentin are required for the CRHR1 internalization-dependent phase. Both phases of ERK1/2 activation depend on calcium influx and are affected by calcium/calmodulin-dependent protein kinase II inactivation. Thus, this report describes the dynamics and biphasic nature of ERK1/2 activation downstream neuronal CRHR1 and identifies several new critical components of the CRHR1 signaling machinery that selectively controls the early and late phases of ERK1/2 activation, thus providing new potential therapeutic targets for stress-related disorders.

  15. Suppressing voltage transients in high voltage power supplies

    International Nuclear Information System (INIS)

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  16. PLZT light transmittance memory driven with an asymmetric voltage pulse

    International Nuclear Information System (INIS)

    Inoue, Kazuhiko; Morita, Takeshi

    2010-01-01

    PLZT is a ferroelectric electro-optic material, which has been operated with a constant voltage supply to keep a certain optical property. In this study, we propose an optical transmittance memory effect by controlling the domain conditions. The keypoint is to use an asymmetric voltage pulse. In the positive direction, a sufficiently-large voltage is applied to align the polarization directions. After this operation, a relatively small light transmittance is memorized even after removing the electric field. On the other hand, in the negative direction, the amplitude of the voltage is adjusted to the coercive electric field. In this condition, the domain structure is almost the same as the depolarization state. With this voltage supply, the maximum light transmittance can be kept after removing the electric field. Using these voltage operations, the PLZT can obtain two light transmittance states depending on the domain structure. This memory effect should be useful for innovative optical scanners or shutters in the future.

  17. Benchmarking of Voltage Sag Generators

    DEFF Research Database (Denmark)

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  18. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  19. Induced Voltage in an Open Wire

    Science.gov (United States)

    Morawetz, K.; Gilbert, M.; Trupp, A.

    2017-07-01

    A puzzle arising from Faraday's law has been considered and solved concerning the question which voltage will be induced in an open wire with a time-varying homogeneous magnetic field. In contrast to closed wires where the voltage is determined by the time variance of the magnetic field and the enclosed area, in an open wire we have to integrate the electric field along the wire. It is found that the longitudinal electric field with respect to the wave vector contributes with 1/3 and the transverse field with 2/3 to the induced voltage. In order to find the electric fields the sources of the magnetic fields are necessary to know. The representation of a spatially homogeneous and time-varying magnetic field implies unavoidably a certain symmetry point or symmetry line which depend on the geometry of the source. As a consequence the induced voltage of an open wire is found to be the area covered with respect to this symmetry line or point perpendicular to the magnetic field. This in turn allows to find the symmetry points of a magnetic field source by measuring the voltage of an open wire placed with different angles in the magnetic field. We present exactly solvable models of the Maxwell equations for a symmetry point and for a symmetry line, respectively. The results are applicable to open circuit problems like corrosion and for astrophysical applications.

  20. Voltage breakdown on niobium and copper surfaces

    International Nuclear Information System (INIS)

    Werner, G.R.; Padamsee, H.; Betzwieser, J.C.; Liu, Y.G.; Rubin, K.H.R.; Shipman, J.E.; Ying, L.T.

    2003-01-01

    Experiments have shown that voltage breakdown in superconducting niobium RF cavities is in many ways similar to voltage breakdown on niobium cathodes in DC voltage gaps; most striking are the distinctive starburst patterns and craters that mark the site of voltage breakdown in both superconducting cavities and DC vacuum gaps. Therefore, we can learn much about RF breakdown from simpler, faster DC experiments. We have direct evidence, in the form of before'' and ''after'' pictures, that breakdown events caused by high surface electric fields occur with high probability at contaminant particles on surfaces. Although the pre-breakdown behavior (field emission) seems to depend mostly on the contaminant particles present and little on the substrate, the breakdown event itself is greatly affected by the substrate-niobium, heavily oxidized niobium, electropolished copper, and diamond-machined copper cathodes lead to different kinds of breakdown events. By studying DC voltage breakdown we hope to learn more details about the processes involved in the transition from field emission to catastrophic arcing and the cratering of the surface; as well as learning how to prevent breakdown, we would like to learn how to cause breakdown, which could be important when ''processing'' cavities to reduce field emission. (author)

  1. Transient voltage sharing in series-coupled high voltage switches

    Directory of Open Access Journals (Sweden)

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  2. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    DEFF Research Database (Denmark)

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  3. Sensing voltage across lipid membranes

    Science.gov (United States)

    Swartz, Kenton J.

    2009-01-01

    The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

  4. Biphasic Estradiol-induced AKT Phosphorylation Is Modulated by PTEN via MAP Kinase in HepG2 Cells

    Science.gov (United States)

    Marino, Maria; Acconcia, Filippo; Trentalance, Anna

    2003-01-01

    We reported previously in HepG2 cells that estradiol induces cell cycle progression throughout the G1–S transition by the parallel stimulation of both PKC-α and ERK signaling molecules. The analysis of the cyclin D1 gene expression showed that only the MAP kinase pathway was involved. Here, the presence of rapid/nongenomic, estradiol-regulated, PI3K/AKT signal transduction pathway, its modulation by the levels of the tumor suppressor PTEN, its cross-talk with the ERK pathway, and its involvement in DNA synthesis and cyclin D1 gene promoter activity have all been studied in HepG2 cells. 17β-Estradiol induced the rapid and biphasic phosphorylation of AKT. These phosphorylations were independent of each other, being the first wave of activation independent of the estrogen receptor (ER), whereas the second was dependent on ER. Both activations were dependent on PI3K activity; furthermore, the ERK pathway modulated AKT phosphorylation by acting on the PTEN levels. The results showed that the PI3K pathway, as well as ER, were strongly involved in both G1–S progression and cyclin D1 promoter activity by acting on its proximal region (-254 base pairs). These data indicate that in HepG2 cells, different rapid/nongenomic estradiol-induced signal transduction pathways modulate the multiple steps of G1–S phase transition. PMID:12808053

  5. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    Directory of Open Access Journals (Sweden)

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  6. Tailoring the structure of biphasic calcium phosphate via synthesis procedure

    Science.gov (United States)

    Mansour, S. F.; El-dek, S. I.; Ahmed, M. K.

    2017-12-01

    Nano calcium phosphate ceramics (CaPC) were synthesized using simple co-precipitation method at different preparation conditions. The selected Ca/P ratio with a variation of pH value lead to formation of dicalcium phosphate dihydrate (DCPD) at pH 5 and 6 while, hydroxyapatite (HAP) nano particles were formed at pH 9 and 12 at room temperature. The crystallite size was in the range of 15-55 nm depending on the obtained crystalline phase. The study displayed variation of decomposition depending on the annealing temperature. The significant note is the different transformation trend of each phase depending on the starting pH value. The HRTEM illustrated that the DCPD phase was formed as fibers with diameter around 4-6 nm, while HAP was formed in rod shape. The aspect ratio decreased from 6.6 at pH 9 to 4 at pH 12 which refer to the great influence of pH value on the morphology of calcium phosphates.

  7. Anti-prelog reduction of prochiral carbonyl compounds by Oenococcus oeni in a biphasic system.

    Science.gov (United States)

    Hu, Jian; Xu, Yan

    2006-07-01

    An aqueous-organic biphasic system was established and used with whole cells of Oenococcus oeni to reduce 2-octanone to (R)-2-octanol. The conversion reached 99% when the Tris/borate buffer was increased from 50 mM to 300 mM in the aqueous phase. In addition, the conversion increased as the log P value of the organic solvent changed from 0.5 to 6.6. Under optimized conditions, the conversion of (R)-2-octanol reached 99% from 0.5 M 2-octanone with an optical purity of 99% e.e. The biphasic system allows the anti-Prelog reduction of aliphatic and aromatic ketones to furnish (R)-configurated alcohols in high optical purity as well.

  8. RF magnetron-sputtered coatings deposited from biphasic calcium phosphate targets for biomedical implant applications

    Directory of Open Access Journals (Sweden)

    K.A. Prosolov

    2017-09-01

    Full Text Available Bioactive calcium phosphate coatings were deposited by radio-frequency magnetron sputtering from biphasic targets of hydroxyapatite and tricalcium phosphate, sintered at different mass % ratios. According to Raman scattering and X-ray diffraction data, the deposited hydroxyapatite coatings have a disordered structure. High-temperature treatment of the coatings in air leads to a transformation of the quasi-amorphous structure into a crystalline one. A correlation has been observed between the increase in the Ca content in the coatings and a subsequent decrease in Ca in the biphasic targets after a series of deposition processes. It was proposed that the addition of tricalcium phosphate to the targets would led to a finer coating's surface topography with the average size of 78 nm for the structural elements.

  9. Hepatitis C virus core protein expression leads to biphasic regulation of the p21 cdk inhibitor and modulation of hepatocyte cell cycle

    International Nuclear Information System (INIS)

    Nguyen, Hau; Mudryj, Maria; Guadalupe, Moraima; Dandekar, Satya

    2003-01-01

    Hepatitis C virus (HCV) Core protein is implicated in viral pathogenesis by the modulation of hepatocyte gene expression and function. To determine the effect of Core protein on the cell-cycle control of hepatocytes, a HepG2 cell line containing a Flag-tagged Core under the control of an inducible promoter was generated. Initial Core protein expression included the presence of unprocessed (191 aa) and processed (173 aa) forms of the Core proteins with the processed form becoming dominant later. Expression of the 191 aa form of Core protein corresponded to an increase in the expression of the p21, a decrease in cdk2-dependent kinase activity, and a decrease in the percentage of cells in S-phase along with an accumulation of cells in the G 0 /G 1 phase of the cell cycle. As the processed form accumulated, the p21 levels started to decline, suggesting that Core protein regulates p21 expression in a biphasic manner. These findings implicate Core protein in potentially modulating hepatocyte cell cycle differentially in the early stages of infection through biphasic regulation of p21 cdk kinase inhibitor

  10. Involvement of α-, γ- and δ-Tocopherol Isomers from Pumpkin (Cucurbita pepo L. Seed Oil or Oil Mixtures in the Biphasic DPPH˙ Disappearance Kinetics

    Directory of Open Access Journals (Sweden)

    Dalibor Broznić

    2016-01-01

    Full Text Available The antioxidant activity of three types of pumpkin seed oil or oil mixtures (cold-pressed, produced from roasted seed paste and salad produced in the northern part of Croatia and the kinetics of their behaviour as free radical scavengers were investigated using DPPH˙. In addition, the involvement of oil tocopherol isomers (α-, γ- and δ- in different steps of DPPH˙ disappearance and their impact on the rate of reaction were analysed. The kinetics of DPPH˙ disappearance is a two-step process. In the first step, rapid disappearance of DPPH˙ occurs during the first 11 min of the reaction, depending on the oil type, followed by a slower decline in the second step. To describe DPPH˙ disappearance kinetics, six mathematical models (mono- and biphasic were tested. Our findings showed that γ- and δ-tocopherols affected DPPH˙ disappearance during the first step, and α-tocopherol in the second step of the reaction. Moreover, α-tocopherol demonstrated 30 times higher antioxidant activity than γ- and δ-tocopherols. The results indicated the biphasic double-exponential behaviour of DPPH˙ disappearance in oil samples, due to the complexity of reactions that involve different tocopherol isomers and proceed through different chemical pathways.

  11. Involvement of α-, γ- and δ-Tocopherol Isomers from
Pumpkin (Cucurbita pepo L.) Seed Oil or Oil Mixtures in
the Biphasic DPPH˙ Disappearance Kinetics

    Science.gov (United States)

    Broznić, Dalibor; Milin, Čedomila

    2016-01-01

    Summary The antioxidant activity of three types of pumpkin seed oil or oil mixtures (cold- -pressed, produced from roasted seed paste and salad) produced in the northern part of Croatia and the kinetics of their behaviour as free radical scavengers were investigated using DPPH˙. In addition, the involvement of oil tocopherol isomers (α-, γ- and δ-) in different steps of DPPH˙ disappearance and their impact on the rate of reaction were analysed. The kinetics of DPPH˙ disappearance is a two-step process. In the first step, rapid disappearance of DPPH˙ occurs during the first 11 min of the reaction, depending on the oil type, followed by a slower decline in the second step. To describe DPPH˙ disappearance kinetics, six mathematical models (mono- and biphasic) were tested. Our findings showed that γ- and δ-tocopherols affected DPPH˙ disappearance during the first step, and α-tocopherol in the second step of the reaction. Moreover, α-tocopherol demonstrated 30 times higher antioxidant activity than γ- and δ-tocopherols. The results indicated the biphasic double-exponential behaviour of DPPH˙ disappearance in oil samples, due to the complexity of reactions that involve different tocopherol isomers and proceed through different chemical pathways. PMID:27904410

  12. Involvement of α-, γ- and δ-Tocopherol Isomers from
Pumpkin (Cucurbita pepo L.) Seed Oil or Oil Mixtures in
the Biphasic DPPH˙ Disappearance Kinetics.

    Science.gov (United States)

    Broznić, Dalibor; Jurešić, Gordana Čanadi; Milin, Čedomila

    2016-06-01

    The antioxidant activity of three types of pumpkin seed oil or oil mixtures (cold- -pressed, produced from roasted seed paste and salad) produced in the northern part of Croatia and the kinetics of their behaviour as free radical scavengers were investigated using DPPH˙. In addition, the involvement of oil tocopherol isomers (α-, γ- and δ-) in different steps of DPPH˙ disappearance and their impact on the rate of reaction were analysed. The kinetics of DPPH˙ disappearance is a two-step process. In the first step, rapid disappearance of DPPH˙ occurs during the first 11 min of the reaction, depending on the oil type, followed by a slower decline in the second step. To describe DPPH˙ disappearance kinetics, six mathematical models (mono- and biphasic) were tested. Our findings showed that γ- and δ-tocopherols affected DPPH˙ disappearance during the first step, and α-tocopherol in the second step of the reaction. Moreover, α-tocopherol demonstrated 30 times higher antioxidant activity than γ- and δ-tocopherols. The results indicated the biphasic double-exponential behaviour of DPPH˙ disappearance in oil samples, due to the complexity of reactions that involve different tocopherol isomers and proceed through different chemical pathways.

  13. Efficacy and safety of biphasic insulin aspart and biphasic insulin lispro mix in patients with type 2 diabetes: A review of the literature

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2016-01-01

    Full Text Available Type 2 diabetes (T2D represents an escalating burden worldwide, particularly in China and India. Compared with Caucasians, Asian people with diabetes have lower body mass index, increased visceral adiposity, and postprandial glucose (PPG/insulin resistance. Since postprandial hyperglycemia contributes significantly to total glycemic burden and is associated with heightened cardiovascular risk, targeting PPG early in T2D is paramount. Premixed insulin regimens are widely used in Asia due to their convenience and effectiveness. Data from randomized controlled trials and observational studies comparing efficacy and safety of biphasic insulin aspart 30 (BIAsp 30 with biphasic insulin lispro mix (LM 25/50 and versus other insulin therapies or oral antidiabetic drugs (OADs in T2D demonstrated that BIAsp 30 and LM 25/50 were associated with similar or greater improvements in glycemic control versus comparator regimens, such as basal–bolus insulin, in insulin-naÏve, and prior insulin users. Studies directly comparing BIAsp 30 and LM 25 provided conflicting glycemic control results. Safety data generally showed increased hypoglycemia and weight gain with premixed insulins versus basal–bolus insulin or OADs. However, large observational trials documented improvements in glycated hemoglobin, PPG, and hypoglycemia with BIAsp 30 in multi-ethnic patient populations. In summary, this literature review demonstrates that premixed insulin regimens are an appropriate and effective treatment choice in T2D.

  14. Development of Modified-Release Tablets of Zolpidem Tartrate by Biphasic Quick/Slow Delivery System

    OpenAIRE

    Mahapatra, Anjan Kumar; Sameeraja, N. H.; Murthy, P. N.

    2014-01-01

    Zolpidem tartrate is a non-benzodiazepine analogue of imidazopyridine of sedative and hypnotic category. It has a short half-life with usual dosage regimen being 5 mg, two times a day, or 10 mg, once daily. The duration of action is considered too short in certain circumstances. Thus, it is desirable to lengthen the duration of action. The formulation design was implemented by preparing extended-release tablets of zolpidem tartrate using the biphasic delivery system technology, where sodium s...

  15. Characterization and in vitro evaluation of biphasic α-tricalcium phosphate/β-tricalcium phosphate cement

    Energy Technology Data Exchange (ETDEWEB)

    Arahira, Takaaki; Maruta, Michito, E-mail: maruta@college.fdcnet.ac.jp; Matsuya, Shigeki

    2017-05-01

    Biphasic calcium phosphate consisting of hydroxyapatite (HA) and β-tricalcium phosphate(β-TCP) is an excellent bone substitute with controllable bioresorbability. Fabrication of biphasic calcium phosphate with self-setting ability is expected to enhance its potential application as bone substitute. In this study, mixtures of α-TCP and β-TCP with various compositions were prepared through α-β phase transition of α-TCP powder at 1000 °C for various periods. These powders were mixed with 0.25 M Na{sub 2}HPO{sub 4} at a P/L ratio of 2, and then hardened at 37 °C at 100% RH for up to 24 h. Material properties of biphasic HA/β-TCP cement with different α-TCP/β-TCP composition were characterized. These cements were also evaluated with respect to cell response in vitro using MC3T3-E1 cell lines. In conclusion, mechanical and biological properties of HA/β-TCP cement could be controlled by changing the heat treatment time of α-TCP powder at 1000 °C. In vitro results indicated that cell proliferation and ALP activity increased with increase β-TCP content. - Highlights: • We could fabricate biphasic HA/β-TCP cements using heat treated α-TCP powder. • It is easy to control the ratio of α-TCP to β-TCP changing the heat treatment time up to 48 h. • Both cell number and ALP activity increased with increase in β-TCP content. • In vitro results showed that β-TCP has superior cell affinity to HA.

  16. Preparation of highly infective Leishmania promastigotes by cultivation on SNB-9 biphasic medium

    Czech Academy of Sciences Publication Activity Database

    Grekov, Igor; Svobodová, M.; Nohýnková, E.; Lipoldová, Marie

    2011-01-01

    Roč. 87, č. 3 (2011), s. 273-277 ISSN 0167-7012 R&D Projects: GA MŠk(CZ) LC06009; GA ČR GA310/08/1697 Institutional research plan: CEZ:AV0Z50520514 Keywords : Leishmania * SNB-9 * biphasic culture medium * parasite infectivity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.086, year: 2011

  17. A simulation study of the reaction of human heart to biphasic electrical shocks

    Directory of Open Access Journals (Sweden)

    Seemann Gunnar

    2004-06-01

    Full Text Available Abstract Background This article presents a study, which examines the effects of biphasic electrical shocks on human ventricular tissue. The effects of this type of shock are not yet fully understood. Animal experiments showed the superiority of biphasic shocks over monophasic ones in defibrillation. A mathematical computer simulation can increase the knowledge of human heart behavior. Methods The research presented in this article was done with different models representing a three-dimensional wedge of ventricular myocardium. The electrophysiology was described with Priebe-Beuckelmann model. The realistic fiber twist, which is specific to human myocardium was included. Planar electrodes were placed at the ends of the longest side of the virtual cardiac wedge, in a bath medium. They were sources of electrical shocks, which varied in magnitude from 0.1 to 5 V. In a second arrangement ring electrodes were placed directly on myocardium for getting a better view on secondary electrical sources. The electrical reaction of the tissue was generated with a bidomain model. Results The reaction of the tissue to the electrical shock was specific to the initial imposed characteristics. Depolarization appeared in the first 5 ms in different locations. A further study of the cardiac tissue behavior revealed, which features influence the response of the considered muscle. It was shown that the time needed by the tissue to be totally depolarized is much shorter when a biphasic shock is applied. Each simulation ended only after complete repolarization was achieved. This created the possibility of gathering information from all states corresponding to one cycle of the cardiac rhythm. Conclusions The differences between the reaction of the homogeneous tissue and a tissue, which contains cleavage planes, reveals important aspects of superiority of biphasic pulses. ...

  18. Work Stress and Alcohol Use: Developing and Testing a Biphasic Self-Medication Model

    OpenAIRE

    Frone, Michael R.

    2016-01-01

    This study developed and tested a moderated-mediation model of work stress and alcohol use, based on the biphasic (stimulant and sedative) effects of alcohol and the self-medication and stress-vulnerability models of alcohol use. The model proposes that exposure to work stressors can increase both negative affect and work fatigue, and that these two sources of strain can subsequently motivate the use of alcohol. However, the relations of negative affect and work fatigue to a...

  19. Use of Respiratory Support in the Biphase Ventilation Airway Mode in the Newborn

    OpenAIRE

    S. N. Koval; A. Ye. Kulagin

    2006-01-01

    Biphasic positive airway pressure (BIPAP) (also known as DuoPAP, BiLevel, BiVent, PCV+, SPAP) is a mode of ventilation with cycling variations between two continuous positive airway pressure levels. It is a mixture of pressure controlled ventilation and spontaneous breathing, which is unrestricted in each phase of the respiratory cycle. The volume displacement caused by the difference between Phigh and Plow airway pressure level. The phase time ratio (PTR — the BIPAP frequency) is calculated ...

  20. A case of mumps-related acute encephalopathy with biphasic seizures and late reduced diffusion.

    Science.gov (United States)

    Hazama, Kyoko; Shiihara, Takashi; Tsukagoshi, Hiroyuki; Hasegawa, Shunji; Dowa, Yuri; Watanabe, Mio

    2017-10-01

    Mumps is a common childhood viral disease characterized by fever and swelling of the parotid gland. The prognosis is generally good, although some complications, such as encephalitis (0.1%), exist. Acute encephalopathy with biphasic seizures and late reduced diffusion is the most common type of acute encephalopathy. However, this type of encephalopathy has not been reported in association with mumps infection. A previously healthy 3-year-old Japanese boy had a brief convulsion after fever for 3days, and then had conscious disturbance and parotitis. After several days, he had a second brief convulsion and was admitted. Increased serum amylase levels and presence of anti-mumps immunoglobulin M antibody confirmed mumps parotitis. The patient had another brief seizure later the day of admission. He did not have status or cluster seizures, although the biphasic nature of his seizures, conscious disturbance between the seizures, no pleocytosis in cerebrospinal fluid, and brain magnetic resonance images were consistent with acute encephalopathy with biphasic seizures and late reduced diffusion. In Japan, the mumps vaccine is not administered as a part of routine immunizations. It thus has low coverage (30-40%), and as a result, mumps infections are still common. However, this is the first case of mumps-related acute encephalopathy with biphasic seizures and late reduced diffusion. This case may be representative of only a minority of patients with mumps-associated central nervous system involvement. Nevertheless, this diagnostic possibility may be considered. In order to prevent mumps-related complications, routine mumps vaccination might be warranted. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  1. Molecular mechanism of voltage sensing in voltage-gated proton channels

    Science.gov (United States)

    Rebolledo, Santiago; Perez, Marta E.

    2013-01-01

    Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

  2. Radiation effects on residual voltage of polyethylene films

    International Nuclear Information System (INIS)

    Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.

    1986-01-01

    It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)

  3. CO2 Absorption by Biphasic Solvents: Comparison with Lower Phase Alone

    International Nuclear Information System (INIS)

    Xu, Zhicheng; Wang, Shujuan; Qi, Guojie; Liu, Jinzhao; Zhao, Bo; Chen, Changhe

    2014-01-01

    The mixtures of 2 M 1,4-butanediamine (BDA) and 4 M 2-(diethylamino)-ethanol (DEEA) have been found to be promising biphasic solvents. This work identifies the composition of the lower phase using a DX-120 Ion Chromatograph (IC) and a Metrohm 809 Titrando auto titrator. The cyclic capacities, cyclic loadings and reaction products of the biphasic solvent are compared with those of the aqueous solution with the same amine concentration as the lower phase of the biphasic solvent at the rich loading ((2B4D) L ) using a fast screening facility and a JNM ECA-600 Nuclear Magnetic Resonance spectrometer (NMR). Their absorption rates at different loadings are also investigated using a Wetted Wall Column (WWC). The results show that the cyclic capacity and cyclic loading of (2B4D) L are almost the same as those of 2B4D. The absorption rate of (2B4D) L is higher than 2B4D at all the 3 tested loadings, except for the fresh solutions at CO 2 pressure lower than 10 kPa. NMR results show that the reaction products of (2B4D) L had more BDA bi-carbamate, less BDA and less BDA carbamate than 2B4D. The CO 2 reaction products of (2B4D) L had twice as much carbonate/bicarbonate as with 2B4D and less BDA carbamate. (authors)

  4. Paired Associative Stimulation Targeting the Tibialis Anterior Muscle using either Mono or Biphasic Transcranial Magnetic Stimulation

    Directory of Open Access Journals (Sweden)

    Natalie Mrachacz-Kersting

    2017-04-01

    Full Text Available Paired associative stimulation (PAS protocols induce plastic changes within the motor cortex. The objectives of this study were to investigate PAS effects targeting the tibialis anterior (TA muscle using a biphasic transcranial magnetic stimulation (TMS pulse form and, to determine whether a reduced intensity of this pulse would lead to significant changes as has been reported for hand muscles using a monophasic TMS pulse. Three interventions were investigated: (1 suprathreshold PAbi-PAS (n = 11; (2 suprathreshold PAmono-PAS (n = 11 where PAS was applied using a biphasic or monophasic pulse form at 120% resting motor threshold (RMT; (3 subthreshold PAbi-PAS (n = 10 where PAS was applied as for (1 at 95% active motor threshold (AMT. The peak-to-peak motor evoked potentials (MEPs were quantified prior to, immediately following, and 30 min after the cessation of the intervention. TA MEP size increased significantly for all interventions immediately post (61% for suprathreshold PAbi-PAS, 83% for suprathreshold PAmono-PAS, 55% for subthreshold PAbi-PAS and 30 min after the cessation of the intervention (123% for suprathreshold PAbi-PAS, 105% for suprathreshold PAmono-PAS, 80% for subthreshold PAbi-PAS. PAS using a biphasic pulse form at subthreshold intensities induces similar effects to conventional PAS.

  5. Comparison of the lysis-centrifugation and agitated biphasic blood culture systems for detection of fungemia.

    Science.gov (United States)

    Murray, P R

    1991-01-01

    Although the detection of fungemia has been improved by the use of vented or biphasic blood culture bottles, the best recovery and earliest detection have been reported in the Isolator lysis-centrifugation system. It was recently demonstrated that improved detection of both bacteria and fungi was accomplished by mechanically agitating blood culture bottles for the first 24 h of incubation. In this study the detection of fungemia by use of the Isolator system was compared with that of an agitated biphasic system. A total of 182 fungi were isolated from blood specimens inoculated into both culture systems. No difference in the overall recovery of fungi or individual species of yeasts was observed between the two systems. However, all seven isolates of Histoplasma capsulatum were recovered in the Isolator system only. The time required to detect fungemia with each of the two systems was also compared. No statistically significant difference was observed. From the data collected during this 18-month study, it can be concluded that the overall recovery and time of detection of yeasts are equivalent in the lysis-centrifugation system and the agitated biphasic blood culture system. The lysis-centrifugation system is still superior for the detection of filamentous fungi such as H. capsulatum. PMID:1993772

  6. Predictive feedback can account for biphasic responses in the lateral geniculate nucleus.

    Directory of Open Access Journals (Sweden)

    Janneke F M Jehee

    2009-05-01

    Full Text Available Biphasic neural response properties, where the optimal stimulus for driving a neural response changes from one stimulus pattern to the opposite stimulus pattern over short periods of time, have been described in several visual areas, including lateral geniculate nucleus (LGN, primary visual cortex (V1, and middle temporal area (MT. We describe a hierarchical model of predictive coding and simulations that capture these temporal variations in neuronal response properties. We focus on the LGN-V1 circuit and find that after training on natural images the model exhibits the brain's LGN-V1 connectivity structure, in which the structure of V1 receptive fields is linked to the spatial alignment and properties of center-surround cells in the LGN. In addition, the spatio-temporal response profile of LGN model neurons is biphasic in structure, resembling the biphasic response structure of neurons in cat LGN. Moreover, the model displays a specific pattern of influence of feedback, where LGN receptive fields that are aligned over a simple cell receptive field zone of the same polarity decrease their responses while neurons of opposite polarity increase their responses with feedback. This phase-reversed pattern of influence was recently observed in neurophysiology. These results corroborate the idea that predictive feedback is a general coding strategy in the brain.

  7. Voltage current characteristics of type III superconductors

    International Nuclear Information System (INIS)

    Dorofejev, G.L.; Imenitov, A.B.; Klimenko, E.Y.

    1980-01-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb 3 Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T. (author)

  8. Voltage current characteristics of type III superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Dorofeiev, G L; Imenitov, A B; Klimenko, E Y [Gosudarstvennyi Komitet po Ispol' zovaniyu Atomnoi Ehnergii SSSR, Moscow. Inst. Atomnoi Ehnergii

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb/sub 3/Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T.

  9. Low-High and High-Low Biphasic Injection Forms in Computed Tomography Examinations of the Upper Abdomen

    International Nuclear Information System (INIS)

    Marti-Bonmati, L.; Arana, E.; Tobarra, E.; Sierra, C.

    2006-01-01

    Purpose: To analyze the influence of different biphasic and monophasic injection rate protocols in abdominal computed tomography (CT). Material and Methods: A randomized, consecutive, parallel group study was designed and conducted in 60 patients studied with the same CT helical protocol. Patients were randomly distributed into three groups: (A) monophasic (120 ml at 2.5 ml/s); (B) low-high biphasic (120 ml, first 60 ml at a rate of 2 ml/s, the other 60 ml at 2.5 ml/s); and (C) high-low biphasic (120 ml, first 60 ml at a rate of 2.5 ml/s, the other 60 ml at 2 ml/s). All patients were injected with 300 mg I/ml non-ionic contrast media at a fixed delay time of 55 s. Contrast enhancement efficacy was evaluated by attenuation coefficient measurements. Results: Although non-significant, monophasic protocol enhancements were higher than biphasic protocol enhancements in all measurements except aortic bifurcation (p = 0.003). At this level, biphasic protocols obtained an increased mean enhancement from 7.6% to 2.5% compared to monophasic protocols. Conclusion: Monophasic contrast agent injection in helical CT of the upper abdomen produces a higher enhancement of parenchymal and venous structures. No significant difference was observed between low-high and high-low biphasic protocols

  10. High voltage isolation transformer

    Science.gov (United States)

    Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

    1985-01-01

    A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

  11. Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers

    Directory of Open Access Journals (Sweden)

    J. Koton

    2011-04-01

    Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.

  12. The biphasic effect of extracellular glucose concentration on carbachol-induced fluid secretion from mouse submandibular glands.

    Science.gov (United States)

    Terachi, Momomi; Hirono, Chikara; Kitagawa, Michinori; Sugita, Makoto

    2018-06-01

    Cholinergic agonists evoke elevations of the cytoplasmic free-calcium concentration ([Ca 2+ ] i ) to stimulate fluid secretion in salivary glands. Salivary flow rates are significantly reduced in diabetic patients. However, it remains elusive how salivary secretion is impaired in diabetes. Here, we used an ex vivo submandibular gland perfusion technique to characterize the dependency of salivary flow rates on extracellular glucose concentration and activities of glucose transporters expressed in the glands. The cholinergic agonist carbachol (CCh) induced sustained fluid secretion, the rates of which were modulated by the extracellular glucose concentration in a biphasic manner. Both lowering the extracellular glucose concentration to less than 2.5 mM and elevating it to higher than 5 mM resulted in decreased CCh-induced fluid secretion. The CCh-induced salivary flow was suppressed by phlorizin, an inhibitor of the sodium-glucose cotransporter 1 (SGLT1) located basolaterally in submandibular acinar cells, which is altered at the protein expression level in diabetic animal models. Our data suggest that SGLT1-mediated glucose uptake in acinar cells is required to maintain the fluid secretion by sustaining Cl - secretion in real-time. High extracellular glucose levels may suppress the CCh-induced secretion of salivary fluid by altering the activities of ion channels and transporters downstream of [Ca 2+ ] i signals. © 2018 Eur J Oral Sci.

  13. Biphasic effects of FGF2 on odontoblast differentiation involve changes in the BMP and Wnt signaling pathways.

    Science.gov (United States)

    Sagomonyants, Karen; Mina, Mina

    2014-08-01

    Odontoblast differentiation during physiological and reparative dentinogenesis is dependent upon multiple signaling molecules, including fibroblast growth factors (FGFs), bone morphogenetic proteins (BMPs) and Wingless/Integrated (Wnt) ligands. Recent studies in our laboratory showed that continuous exposure of primary dental pulp cultures to FGF2 exerted biphasic effects on the expression of markers of dentinogenesis. In the present study, we examined the possible involvement of the BMP and Wnt signaling pathways in mediating the effects of FGF2 on dental pulp cells. Our results showed that stimulatory effects of FGF2 on dentinogenesis during the proliferation phase of growth were associated with increased expression of the components of the BMP (Bmp2, Dlx5, Msx2, Osx) and Wnt (Wnt10a, Wisp2) pathways, and decreased expression of an inhibitor of the Wnt signaling, Nkd2. Further addition of FGF2 during the differentiation/mineralization phase of growth resulted in decreased expression of components of the BMP signaling (Bmp2, Runx2, Osx) and increased expression of inhibitors of the Wnt signaling (Nkd2, Dkk3). This suggests that both BMP and Wnt pathways may be involved in mediating the effects of FGF2 on dental pulp cells.

  14. Biphasic regulation of intracellular calcium by gemfibrozil contributes to inhibiting L6 myoblast differentiation: implications for clinical myotoxicity.

    Science.gov (United States)

    Liu, Aiming; Yang, Julin; Gonzalez, Frank J; Cheng, Gary Q; Dai, Renke

    2011-02-18

    Gemfibrozil is the most myotoxic fibrate drug commonly used for dyslipidemia, but the mechanism is poorly understood. The current study revealed that gemfibrozil inhibits myoblast differentiation through the regulation of intracellular calcium ([Ca(2+)]i) as revealed in L6 myoblasts by use of laser scan confocal microscopy and flow cytometry using Fluo-4 AM as a probe. Gemfibrozil at 20-400 μM, could regulate [Ca(2+)]i in L6 cells in a biphasic manner, and sustained reduction was observed when the concentration reached 200 μM. Inhibition of L6 differentiation by gemfibrozil was concentration-dependent with maximal effect noted between 200 and 400 μM, as indicated by creatine kinase activities and the differentiation index, respectively. In differentiating L6 myoblasts, gemfibrozil at concentrations below 400 μM led to no significant signs of apoptosis or cytotoxicity, whereas differentiation, inhibited by 200 μM gemfibrozil, was only partially recovered. A good correlation was noted between gemfibrozil concentrations that regulate [Ca(2+)]i and inhibit L6 myoblasts differentiation, and both are within the range of total serum concentrations found in the clinic. These data suggest a potential pharmacodynamic effect of gemfibrozil on myogenesis as a warning sign, in addition to the complex pharmacokinetic interactions. It is also noteworthy that mobilization of [Ca(2+)]i by gemfibrozil may trigger complex biological responses besides myocyte differentiation. Information revealed in this study explores the mechanism of gemfibrozil-induced myotoxicity through the regulation of intracellular calcium.

  15. Engineering amount of cell-cell contact demonstrates biphasic proliferative regulation through RhoA and the actin cytoskeleton

    International Nuclear Information System (INIS)

    Gray, Darren S.; Liu, Wendy F.; Shen, Colette J.; Bhadriraju, Kiran; Nelson, Celeste M.; Chen, Christopher S.

    2008-01-01

    Endothelial cell-cell contact via VE-cadherin plays an important role in regulating numerous cell functions, including proliferation. However, using different experimental approaches to manipulate cell-cell contact, investigators have observed both inhibition and stimulation of proliferation depending on the adhesive context. In this study, we used micropatterned wells combined with active positioning of cells by dielectrophoresis in order to investigate whether the number of contacting neighbors affected the proliferative response. Varying cell-cell contact resulted in a biphasic effect on proliferation; one contacting neighbor increased proliferation, while two or more neighboring cells partially inhibited this increase. We also observed that cell-cell contact increased the formation of actin stress fibers, and that expression of dominant negative RhoA (RhoN19) blocked the contact-mediated increase in stress fibers and proliferation. Furthermore, examination of heterotypic pairs of untreated cells in contact with RhoN19-expressing cells revealed that intracellular, but not intercellular, tension is required for the contact-mediated stimulation of proliferation. Moreover, engagement of VE-cadherin with cadherin-coated beads was sufficient to stimulate proliferation in the absence of actual cell-cell contact. In all, these results demonstrate that cell-cell contact signals through VE-cadherin, RhoA, and intracellular tension in the actin cytoskeleton to regulate proliferation

  16. Temporary over voltages in the high voltage networks

    International Nuclear Information System (INIS)

    Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

    2001-01-01

    The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

  17. Biphasic poly-dispersions modelling with applications in nuclear safety

    International Nuclear Information System (INIS)

    Gimenez, Marcelo

    2005-01-01

    Many technological, scientific and environmental areas require of the understanding of multiple-phase, polydisperse systems.Particularly, in nuclear safety area, under hypothetical severe accident conditions, the fission products are released as gases and airborne particles.In the present thesis a contribution to the modeling of confined polydisperse systems (aerosols and liquid-gas) is presented. A family of one and two dimensional models was developed, describing the impact of the particles size on the aerosol evolution, taking into account the transport mechanisms by the carrying media, settling, lift, thermophoresis, diffusion, coagulation and condensation, considering the spatial dependence. The aerosol general dynamic balance equation -no-linear integral-differential equation-, is treated by means of the Moments Method, imposing a prescribed volume size distribution, and obtaining a model based in the first few moments.This yields to a relatively simple convection-diffusion set of coupled equations, that describes the evolution of the parameters that characterize the size distribution, with a low computational cost that allows to deal the heterogeneities of the spatial distribution of the aerosol.A complementary model, based also on the Moments Method, is developed to perform sensitivity analysis due to uncertainties in the constitutive equations and in the input parameters.The Perturbative Method, Differential-formalism, is used to develop a set of sensitivity equations, which are useful for designing experiments and theoretical studies.The model results are compared with exact solutions and numerical and experimental data extracted from the open literature.Various physical phenomena involved in different simulated case are analysed in detail.Particularly, the study is oriented to the analysis of the concentration gradients and the validation of the aerosol well-mixed hypothesis, typically used in present numerical codes.Deviations were observed from the

  18. Operation and Performance of a Biphase Turbine Power Plant at the Cerro Prieto Geothermal Field (Final Report)

    Energy Technology Data Exchange (ETDEWEB)

    Hays, Lance G. [Douglas Energy Company, Placentia, CA (United States)

    2000-09-01

    A full scale, wellhead Biphase turbine was manufactured and installed with the balance of plant at Well 103 of the Cerro Prieto geothermal resource in Baja, California. The Biphase turbine was first synchronized with the electrical grid of Comision Federal de Electricidad on August 20, 1997. The Biphase power plant was operated from that time until May 23, 2000, a period of 2 years and 9 months. A total of 77,549 kWh were delivered to the grid. The power plant was subsequently placed in a standby condition pending replacement of the rotor with a newly designed, higher power rotor and replacement of the bearings and seals. The maximum measured power output of the Biphase turbine, 808 kWe at 640 psig wellhead pressure, agreed closely with the predicted output, 840 kWe. When combined with the backpressure steam turbine the total output power from that flow would be increased by 40% above the power derived only from the flow by the present flash steam plant. The design relations used to predict performance and design the turbine were verified by these tests. The performance and durability of the Biphase turbine support the conclusion of the Economics and Application Report previously published, (Appendix A). The newly designed rotor (the Dual Pressure Rotor) was analyzed for the above power condition. The Dual Pressure Rotor would increase the power output to 2064 kWe by incorporating two pressure letdown stages in the Biphase rotor, eliminating the requirement for a backpressure steam turbine. The power plant availability was low due to deposition of solids from the well on the Biphase rotor and balance of plant problems. A great deal of plant down time resulted from the requirement to develop methods to handle the solids and from testing the apparatus in the Biphase turbine. Finally an online, washing method using the high pressure two-phase flow was developed which completely eliminated the solids problem. The availability of the Biphase turbine itself was 100

  19. Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)

    2016-03-07

    We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

  20. Study protocol: the effect of whole body vibration on acute unilateral unstable lateral ankle sprain- a biphasic randomized controlled trial.

    Science.gov (United States)

    Baumbach, Sebastian Felix; Fasser, Mariette; Polzer, Hans; Sieb, Michael; Regauer, Markus; Mutschler, Wolf; Schieker, Matthias; Blauth, Michael

    2013-01-14

    Ankle sprains often result in ankle instability, which is most likely caused by damage to passive structures and neuromuscular impairment. Whole body vibration (WBV) is a neuromuscular training method improving those impaired neurologic parameters. The aim of this study is to compare the current gold standard functional treatment to functional treatment plus WBV in patients with acute unilateral unstable inversion ankle sprains. 60 patients, aged 18-40 years, presenting with an isolated, unilateral, acute unstable inversion ankle sprain will be included in this bicentric, biphasic, randomized controlled trial. Samples will be randomized by envelope drawing. All patients will be allowed early mobilization and pain-dependent weight bearing, limited functional immobilization by orthosis, PRICE, NSARDs as well as home and supervised physiotherapy. Supervised physical therapy will take place twice a week, for 30 minutes for a period of 6 weeks, following a standardized intervention protocol. During supervised physical therapy, the intervention group will perform exercises similar to those of the control group, on a side-alternating sinusoidal vibration platform. Two time-dependent primary outcome parameters will be assessed: short-term outcome after six weeks will be postural control quantified by the sway index; mid-term outcome after one year will be assessed by subjective instability, defined by the presence of giving-way attacks. Secondary outcome parameters include: return to pre-injury level of activities, residual pain, recurrence, objective instability, energy/coordination, Foot and Ankle Disability Index and EQ 5D. This is the first trial investigating the effects of WBV in patients with acute soft tissue injury. Inversion ankle sprains often result in ankle instability, which is most likely due to damage of neurological structures. Due to its unique, frequency dependent, influence on various neuromuscular parameters, WBV is a promising treatment method for

  1. Study protocol: the effect of whole body vibration on acute unilateral unstable lateral ankle sprain- a biphasic randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Baumbach Sebastian Felix

    2013-01-01

    Full Text Available Abstract Background Ankle sprains often result in ankle instability, which is most likely caused by damage to passive structures and neuromuscular impairment. Whole body vibration (WBV is a neuromuscular training method improving those impaired neurologic parameters. The aim of this study is to compare the current gold standard functional treatment to functional treatment plus WBV in patients with acute unilateral unstable inversion ankle sprains. Methods/Design 60 patients, aged 18–40 years, presenting with an isolated, unilateral, acute unstable inversion ankle sprain will be included in this bicentric, biphasic, randomized controlled trial. Samples will be randomized by envelope drawing. All patients will be allowed early mobilization and pain-dependent weight bearing, limited functional immobilization by orthosis, PRICE, NSARDs as well as home and supervised physiotherapy. Supervised physical therapy will take place twice a week, for 30 minutes for a period of 6 weeks, following a standardized intervention protocol. During supervised physical therapy, the intervention group will perform exercises similar to those of the control group, on a side-alternating sinusoidal vibration platform. Two time-dependent primary outcome parameters will be assessed: short-term outcome after six weeks will be postural control quantified by the sway index; mid-term outcome after one year will be assessed by subjective instability, defined by the presence of giving-way attacks. Secondary outcome parameters include: return to pre-injury level of activities, residual pain, recurrence, objective instability, energy/coordination, Foot and Ankle Disability Index and EQ 5D. Discussion This is the first trial investigating the effects of WBV in patients with acute soft tissue injury. Inversion ankle sprains often result in ankle instability, which is most likely due to damage of neurological structures. Due to its unique, frequency dependent, influence on various

  2. Biphasic papillary renal cell carcinoma is a rare morphological variant with frequent multifocality: a study of 28 cases.

    Science.gov (United States)

    Trpkov, Kiril; Athanazio, Daniel; Magi-Galluzzi, Cristina; Yilmaz, Helene; Clouston, David; Agaimy, Abbas; Williamson, Sean R; Brimo, Fadi; Lopez, Jose I; Ulamec, Monika; Rioux-Leclercq, Nathalie; Kassem, Maysoun; Gupta, Nilesh; Hartmann, Arndt; Leroy, Xavier; Bashir, Samir Al; Yilmaz, Asli; Hes, Ondřej

    2018-04-01

    To further characterise biphasic squamoid renal cell carcinoma (RCC), a recently proposed variant of papillary RCC. We identified 28 tumours from multiple institutions. They typically showed two cell populations-larger cells with eosinophilic cytoplasm and higher-grade nuclei, surrounded by smaller, amphophilic cells with scanty cytoplasm. The dual morphology was variable (median 72.5% of tumour, range 5-100%); emperipolesis was found in all cases. The male/female ratio was 2:1, and the median age was 55 years (range 39-86 years). The median tumour size was 20 mm (range 9-65 mm). Pathological stage pT1a was found in 21 cases, pT1b in three, and pT3a and pT3b in one each (two not available). Multifocality was found in 32%: multifocal biphasic RCC in one case, biphasic + papillary RCC in two cases, biphasic + clear cell RCC in three cases, biphasic + low-grade urothelial carcinoma of the renal pelvis in one case, and biphasic + Birt-Hogg-Dubé syndrome in one case. Positive immunostains included: PAX8, cytokeratin (CK) 7, α-methylacyl-CoA racemase, epithelial membrane antigen, and vimentin. Cyclin D1 was expressed only in the larger cells. The Ki67 index was higher in the larger cells (median 5% versus ≤1%). Negative stains included: carbonic anhydrase 9, CD117, GATA-3, WT1, CK5/6, and CK20; CD10 and 34βE12 were variably expressed. Gains of chromosomes 7 and 17 were found in two evaluated cases. Follow-up was available for 23 patients (median 24 months, range 1-244 months): 19 were alive without disease, one was alive with recurrence, and one had died of disease (two had died of other causes). Biphasic papillary RCC is a rare variant of papillary RCC, and is often multifocal. © 2017 John Wiley & Sons Ltd.

  3. Switching from biphasic human insulin to biphasic insulin aspart 30 in type 2 diabetes: results from the ASEAN subgroup of the A₁chieve study.

    Science.gov (United States)

    Hussein, Zanariah; Lim-Abrahan, Mary Anne; Jain, Anand B; Goh, Su Yen; Soewondo, Pradana

    2013-04-01

    To evaluate the safety and effectiveness of biphasic insulin aspart 30 (BIAsp 30) in ASEAN type 2 diabetes (T2D) patients switched from biphasic human insulin (BHI) in the non-interventional 24-week A₁chieve study. Indonesian, Malaysian, Filipino and Singaporean patients switched from BHI to BIAsp 30 at their physicians' discretion were included. The incidence of serious adverse drug reactions (SADRs), including major hypoglycaemia was the primary endpoint. Changes in hypoglycaemia, glycated haemoglobin A1c (HbA1c), fasting plasma glucose (FPG), postprandial plasma glucose (PPPG), lipids, body weight and systolic blood pressure were also evaluated. Quality of life (QoL) was measured using the EQ-5D questionnaire. For the 465 patients included (mean ± SD age: 56 ± 10.3 years, diabetes duration: 9.7 ± 7.1 years, baseline HbA1c: 9.4 ± 1.8%), the mean pre-study BHI dose was 0.62 ± 0.28 IU/kg and 63.4% were dosing BHI twice daily (bid). The mean baseline BIAsp 30 dose was 0.65 ± 0.27 U/kg, titrated up to 0.71 ± 0.28 U/kg over 24 weeks, and most patients continued bid dosing. No SADRs or major hypoglycaemic episodes were reported. The proportion of patients reporting overall hypoglycaemia decreased significantly from 10.8% at baseline to 3.4% at Week 24 (p ASEAN subgroup poorly controlled on BHI. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  4. Computer controlled high voltage system

    Energy Technology Data Exchange (ETDEWEB)

    Kunov, B; Georgiev, G; Dimitrov, L [and others

    1996-12-31

    A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

  5. A Voltage Quality Detection Method

    DEFF Research Database (Denmark)

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  6. Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter

    Directory of Open Access Journals (Sweden)

    Padalko D.A.

    2017-12-01

    Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.

  7. Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

    Science.gov (United States)

    Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

    2018-05-07

    Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

  8. Voltage-gated calcium flux mediates Escherichia coli mechanosensation.

    Science.gov (United States)

    Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M

    2017-08-29

    Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.

  9. Equilibrium fluctuation relations for voltage coupling in membrane proteins.

    Science.gov (United States)

    Kim, Ilsoo; Warshel, Arieh

    2015-11-01

    A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

  10. Transient voltage oscillations in coils

    International Nuclear Information System (INIS)

    Chowdhuri, P.

    1985-01-01

    Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated

  11. Grafting voltage and pharmacological sensitivity in potassium channels.

    Science.gov (United States)

    Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

    2016-08-01

    A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

  12. Thermal voltage noise in layered superconductors

    International Nuclear Information System (INIS)

    Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.

    1995-01-01

    Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields

  13. Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks

    Science.gov (United States)

    Teverovsky, Alexander

    2016-01-01

    Time dependence of absorption voltages (Vabs) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on Vabs, cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on Vabs, are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks. Index Terms: Ceramic capacitor, insulation resistance, dielectric absorption, cracking.

  14. New method for determining avalanche breakdown voltage of silicon photomultipliers

    International Nuclear Information System (INIS)

    Chirikov-Zorin, I.

    2017-01-01

    The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

  15. Voltage quantization by ballistic vortices in two-dimensional superconductors

    International Nuclear Information System (INIS)

    Orlando, T.P.; Delin, K.A.

    1991-01-01

    The voltage generated by moving ballistic vortices with a mass m ν in a two-dimensional superconducting ring is quantized, and this quantization depends on the amount of charge enclosed by the ring. The quantization of the voltage is the dual to flux quantization in a superconductor, and is a manifestation of the Aharonov-Casher effect. The quantization is obtained by applying the Bohr-Sommerfeld criterion to the canonical momentum of the ballistic vortices. The results of this quantization condition can also be used to understand the persistent voltage predicted by van Wees for an array of Josephson junctions

  16. Voltage fluctuations in granular superconductors in the perpendicular configuration

    International Nuclear Information System (INIS)

    Gerashchenko, O V

    2003-01-01

    The spectral density of voltage fluctuations in granular YBa 2 Cu 3 O 7-δ superconductors in the perpendicular configuration has been studied in the flux flow mode. It has been found that, in this case, the 1/f-voltage noise observed depends weakly on temperature and is associated with motion of a magnetic flux in the superconductor. A comparison of the data obtained with the results of previous measurements in parallel configuration has shown that voltage noise is produced by a single common source, which is presumably associated with self-organization of the critical state in granular superconductors

  17. Learning new meanings for known words: Biphasic effects of prior knowledge

    Science.gov (United States)

    Fang, Xiaoping; Perfetti, Charles; Stafura, Joseph

    2017-01-01

    In acquiring word meanings, learners are often confronted by a single word form that is mapped to two or more meanings. For example, long after how to roller-“skate”, one may learn that “skate” is also a kind of fish. Such learning of new meanings for familiar words involves two potentially contrasting processes, relative to new form-new meaning learning: 1) Form-based familiarity may facilitate learning a new meaning, and 2) meaning-based interference may inhibit learning a new meaning. We examined these two processes by having native English speakers learn new, unrelated meanings for familiar (high frequency) and less familiar (low frequency) English words, as well as for unfamiliar (novel or pseudo-) words. Tracking learning with cued-recall tasks at several points during learning revealed a biphasic pattern: higher learning rates and greater learning efficiency for familiar words relative to novel words early in learning and a reversal of this pattern later in learning. Following learning, interference from original meanings for familiar words was detected in a semantic relatedness judgment task. Additionally, lexical access to familiar words with new meanings became faster compared to their exposure controls, but no such effect occurred for less familiar words. Overall, the results suggest a biphasic pattern of facilitating and interfering processes: Familiar word forms facilitate learning earlier, while interference from original meanings becomes more influential later. This biphasic pattern reflects the co-activation of new and old meanings during learning, a process that may play a role in lexicalization of new meanings. PMID:29399593

  18. Intervertebral Disc Tissue Engineering with Natural Extracellular Matrix-Derived Biphasic Composite Scaffolds.

    Directory of Open Access Journals (Sweden)

    Baoshan Xu

    Full Text Available Tissue engineering has provided an alternative therapeutic possibility for degenerative disc diseases. However, we lack an ideal scaffold for IVD tissue engineering. The goal of this study is to fabricate a novel biomimetic biphasic scaffold for IVD tissue engineering and evaluate the feasibility of developing tissue-engineered IVD in vitro and in vivo. In present study we developed a novel integrated biphasic IVD scaffold using a simple freeze-drying and cross-linking technique of pig bone matrix gelatin (BMG for the outer annulus fibrosus (AF phase and pig acellular cartilage ECM (ACECM for the inner nucleus pulposus (NP phase. Histology and SEM results indicated no residual cells remaining in the scaffold that featured an interconnected porous microstructure (pore size of AF and NP phase 401.4 ± 13.1 μm and 231.6 ± 57.2 μm, respectively. PKH26-labeled AF and NP cells were seeded into the scaffold and cultured in vitro. SEM confirmed that seeded cells could anchor onto the scaffold. Live/dead staining showed that live cells (green fluorescence were distributed in the scaffold, with no dead cells (red fluorescence being found. The cell-scaffold constructs were implanted subcutaneously into nude mice and cultured for 6 weeks in vivo. IVD-like tissue formed in nude mice as confirmed by histology. Cells in hybrid constructs originated from PKH26-labeled cells, as confirmed by in vivo fluorescence imaging system. In conclusion, the study demonstrates the feasibility of developing a tissue-engineered IVD in vivo with a BMG- and ACECM-derived integrated AF-NP biphasic scaffold. As well, PKH26 fluorescent labeling with in vivo fluorescent imaging can be used to track cells and analyse cell--scaffold constructs in vivo.

  19. Application of aqueous biphasic systems as strategy to purify tannase from Aspergillus tamarii URM 7115.

    Science.gov (United States)

    de Sena, Amanda Reges; Barros Oliveira, Flávio Manoel; Campos Leite, Tonny Cley; Evaristo da Silva Nascimento, Talita Camila; Moreira, Keila Aparecida; de Assis, Sandra Aparecida

    2017-10-21

    The aims of the current study are to assess the influence of polyethylene glycol (PEG) concentration, molar mass, pH, and citrate concentrations on aqueous biphasic systems based on 2 4 factorial designs, as well as to check their capacity to purify tannase secreted by Aspergillus tamarii URM 7115. Tannase was produced through submerged fermentation at 26°C for 67 h in Czapeck-Dox modified broth and added with yeast extract and tannic acid. The factorial design was followed to assess the influence of PEG molar mass (M PEG 600; 4,000 and 8,000 g/ mol), and PEG (C PEG 20.0; 22.0 and 24.0% w/w) and citrate concentrations (C CIT 15.0, 17.5, and 20.0%, w/w), as well as of pH (6.0, 7.0, and 8.0) on the response variables; moreover, partition coefficient (K), yield (Y), and purification factor (PF) were analyzed. The most suitable parameters to purify tannase secreted by A. tamarii URM 7115 through a biphasic system were 600 (g/mol) M PEG , 24% (w/w) C PEG , 15% (w/w) C CIT at pH 6.0 and they resulted in 6.33 enzyme partition, 131.25% yield, 19.80 purification factor and 195.08 selectivity. Tannase secreted by A. tamarii URM 7115 purified through aqueous biphasic systems composed of PEG/citrate can be used for industrial purposes, since it presents suitable purification factor and yield.

  20. Fabrication and tritium release property of Li2TiO3-Li4SiO4 biphasic ceramics

    Science.gov (United States)

    Yang, Mao; Ran, Guangming; Wang, Hailiang; Dang, Chen; Huang, Zhangyi; Chen, Xiaojun; Lu, Tiecheng; Xiao, Chengjian

    2018-05-01

    Li2TiO3-Li4SiO4 biphasic ceramic pebbles have been developed as an advanced tritium breeder due to the potential to combine the advantages of both Li2TiO3 and Li4SiO4. Wet method was developed for the pebble fabrication and Li2TiO3-Li4SiO4 biphasic ceramic pebbles were successfully prepared by wet method using the powders synthesized by hydrothermal method. The tritium release properties of the Li2TiO3-Li4SiO4 biphasic ceramic pebbles were evaluated. The biphasic pebbles exhibited good tritium release property at low temperatures and the tritium release temperature was around 470 °C. Because of the isotope exchange reaction between H2 and tritium, the addition of 0.1%H2 to purge gas He could significantly enhance the tritium gas release and the fraction of molecular form of tritium increased from 28% to 55%. The results indicate that the Li2TiO3-Li4SiO4 biphasic ceramic pebbles fabricated by wet method exhibit good tritium release property and hold promising potential as advanced breeder pebbles.

  1. Lipase in biphasic alginate beads as a biocatalyst for esterification of butyric acid and butanol in aqueous media.

    Science.gov (United States)

    Ng, Choong Hey; Yang, Kun-Lin

    2016-01-01

    Esterification of organic acids and alcohols in aqueous media is very inefficient due to thermodynamic constraints. However, fermentation processes used to produce organic acids and alcohols are often conducted in aqueous media. To produce esters in aqueous media, biphasic alginate beads with immobilized lipase are developed for in situ esterification of butanol and butyric acid. The biphasic beads contain a solid matrix of calcium alginate and hexadecane together with 5 mg/mL of lipase as the biocatalyst. Hexadecane in the biphasic beads serves as an organic phase to facilitate the esterification reaction. Under optimized conditions, the beads are able to catalyze the production of 0.16 mmol of butyl butyrate from 0.5 mmol of butyric acid and 1.5 mmol of butanol. In contrast, when monophasic beads (without hexadecane) are used, only trace amount of butyl butyrate is produced. One main application of biphasic beads is in simultaneous fermentation and esterification (SFE) because the organic phase inside the beads is very stable and does not leach out into the culture medium. SFE is successfully conducted with an esterification yield of 6.32% using biphasic beads containing iso-octane even though the solvent is proven toxic to the butanol-producing Clostridium spp. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Imaging Voltage in Genetically Defined Neuronal Subpopulations with a Cre Recombinase-Targeted Hybrid Voltage Sensor.

    Science.gov (United States)

    Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B

    2017-09-20

    Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In

  3. Electrochemical assessment of water|ionic liquid biphasic systems towards cesium extraction from nuclear waste

    OpenAIRE

    Stockmann, T. Jane; Zhang, Jing; Montgomery, Anne-Marie; Ding, Zhifeng

    2014-01-01

    A room temperature ionic liquid (IL) composed of a quaternary alkylphosphonium (trihexyltetradecylphosphonium, P66614(+)) and tetrakis(pentafluorophenyl) borate anion (TB) was employed within a water| P66614TB (w|P66614TB or w|IL) biphasic system to evaluate cesium ion extraction in comparison to that with a traditional water|organic solvent (w|o) combination. Cs-137 is a major contributor to the radioactivity of spent nuclear fuel as it leaves the reactor, and its extraction efficiency is th...

  4. New biphasic monocomponent composite material obtained by the partial oxypropylation of bacterial cellulose

    International Nuclear Information System (INIS)

    Rosa, Joyce Rover; Silva, Ingrid S.V. da; Pasquini, Daniel; Santos, Daniele B. dos; Barud, Hernane S.; Ribeiro, Sidney J.L.

    2011-01-01

    This study aimed to partial oxypropylation of bacterial cellulose (CB), as well as the characterization of pure CB, oxypropylated CB (CBO) and oxypropylated CB after Soxhlet extraction with hexane (CBOE). The oxypropylation reaction was carried out by propylene oxide polymerization, catalyzed by KOH, in the presence of CB The CB samples, before and after modification, were subjected to analysis of scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR), X-ray diffraction, differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). It was possible verify that the partial transformation of bacterial cellulose by inserting a layer of thermoplastic polymer on its surface occurred efficiently, obtaining a biphasic monocomponent composite material. (author)

  5. LOFT voltage insertion calibaration program

    International Nuclear Information System (INIS)

    Tillitt, D.N.; Miyasaki, F.S.

    1975-08-01

    The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

  6. Power-MOSFET Voltage Regulator

    Science.gov (United States)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  7. High-Voltage, Multiphasic, Nanosecond Pulses to Modulate Cellular Responses.

    Science.gov (United States)

    Ryan, Hollie A; Hirakawa, Shinji; Yang, Enbo; Zhou, Chunrong; Xiao, Shu

    2018-04-01

    Nanosecond electric pulses are an effective power source in plasma medicine and biological stimulation, in which biophysical responses are governed by peak power and not energy. While uniphasic nanosecond pulse generators are widely available, the recent discovery that biological effects can be uniquely modulated by reversing the polarity of nanosecond duration pulses calls for the development of a multimodal pulse generator. This paper describes a method to generate nanosecond multiphasic pulses for biomedical use, and specifically demonstrates its ability to cancel or enhance cell swelling and blebbing. The generator consists of a series of the fundamental module, which includes a capacitor and a MOSFET switch. A positive or a negative phase pulse module can be produced based on how the switch is connected. Stacking the modules in series can increase the voltage up to 5 kV. Multiple stacks in parallel can create multiphase outputs. As each stack is independently controlled and charged, multiphasic pulses can be created to produce flexible and versatile pulse waveforms. The circuit topology can be used for high-frequency uniphasic or biphasic nanosecond burst pulse production, creating numerous opportunities for the generator in electroporation applications, tissue ablation, wound healing, and nonthermal plasma generation.

  8. Moderately nonlinear diffuse-charge dynamics under an ac voltage.

    Science.gov (United States)

    Stout, Robert F; Khair, Aditya S

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  9. Moderately nonlinear diffuse-charge dynamics under an ac voltage

    Science.gov (United States)

    Stout, Robert F.; Khair, Aditya S.

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  10. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  11. Invariance of the magnetic behavior and AMI in ferromagnetic biphase films with distinct non-magnetic metallic spacers

    Energy Technology Data Exchange (ETDEWEB)

    Silva, E.F. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59078-900 Natal, RN (Brazil); Departamento de Física, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil); Gamino, M. [Departamento de Física, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil); Instituto de Física, Universidade Federal do Rio Grande de Sul, 91501-970 Porto Alegre, RS (Brazil); Andrade, A.M.H. de [Instituto de Física, Universidade Federal do Rio Grande de Sul, 91501-970 Porto Alegre, RS (Brazil); Vázquez, M. [Instituto de Ciencia de Materiales de Madrid, CSIC, 28049 Madrid (Spain); Correa, M.A. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59078-900 Natal, RN (Brazil); Bohn, F., E-mail: felipebohn@fisica.ufrn.br [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59078-900 Natal, RN (Brazil)

    2017-02-01

    We investigate the quasi-static magnetic, magnetotransport, and dynamic magnetic properties in ferromagnetic biphase films with distinct non-magnetic metallic spacer layers. We observe that the nature of the non-magnetic metallic spacer material does not have significant influence on the overall biphase magnetic behavior, and, consequently, on the magnetotransport and dynamic magnetic responses. We focus on the magnetoimpedance effect and verify that the films present asymmetric magnetoimpedance effect. Moreover, we explore the possibility of tuning the linear region of the magnetoimpedance curves around zero magnetic field by varying the probe current frequency in order to achieve higher sensitivity values. The invariance of the magnetic behavior and the asymmetric magnetoimpedance effect in ferromagnetic biphase films with distinct non-magnetic metallic spacers place them as promising candidates for probe element and open possibilities to the development of lower-cost high sensitivity linear magnetic field sensor devices.

  12. Modular High Voltage Power Supply

    Energy Technology Data Exchange (ETDEWEB)

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  13. Reliability criteria for voltage stability

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Carson W; Silverstein, Brian L [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.

  14. High voltage distributions in RPCs

    International Nuclear Information System (INIS)

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  15. A Physicochemically Optimized and Neuroconductive Biphasic Nerve Guidance Conduit for Peripheral Nerve Repair.

    Science.gov (United States)

    Ryan, Alan J; Lackington, William A; Hibbitts, Alan J; Matheson, Austyn; Alekseeva, Tijna; Stejskalova, Anna; Roche, Phoebe; O'Brien, Fergal J

    2017-12-01

    Clinically available hollow nerve guidance conduits (NGCs) have had limited success in treating large peripheral nerve injuries. This study aims to develop a biphasic NGC combining a physicochemically optimized collagen outer conduit to bridge the transected nerve, and a neuroconductive hyaluronic acid-based luminal filler to support regeneration. The outer conduit is mechanically optimized by manipulating crosslinking and collagen density, allowing the engineering of a high wall permeability to mitigate the risk of neuroma formation, while also maintaining physiologically relevant stiffness and enzymatic degradation tuned to coincide with regeneration rates. Freeze-drying is used to seamlessly integrate the luminal filler into the conduit, creating a longitudinally aligned pore microarchitecture. The luminal stiffness is modulated to support Schwann cells, with laminin incorporation further enhancing bioactivity by improving cell attachment and metabolic activity. Additionally, this biphasic NGC is shown to support neurogenesis and gliogenesis of neural progenitor cells and axonal outgrowth from dorsal root ganglia. These findings highlight the paradigm that a successful NGC requires the concerted optimization of both a mechanical support phase capable of bridging a nerve defect and a neuroconductive phase with an architecture capable of supporting both Schwann cells and neurons in order to achieve functional regenerative outcome. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Biopolymer-stabilized Pt nanoparticles colloid: a highly active and recyclable catalyst for biphasic catalysis

    International Nuclear Information System (INIS)

    Wang, Yujia; Shen, Yueyue; Qiu, Yunfei; Zhang, Ting; Liao, Yang; Zhao, Shilin; Ma, Jun; Mao, Hui

    2016-01-01

    Noble metal nanoparticles are promising candidates to replace conventional bulk counterparts owing to their high activity and selectivity. To enable catalyst recovery, noble metal nanoparticles are often supported onto solid matrices to prepare heterogeneous catalyst. Although recycle of noble metal nanoparticles is realized by heterogenization, a loss of activity is usually encountered. In the present investigation, Pt nanoparticles with tunable particle size (1.85–2.80 nm) were facilely prepared by using polyphenols as amphiphilic stabilizers. The as-prepared Pt nanoparticles colloid solution could be used as highly active catalyst in aqueous–organic biphasic catalysis. The phenolic hydroxyls of polyphenols could constrain Pt nanoparticles in aqueous phase, and simultaneously, the aromatic scaffold of polyphenols ensured effective interactions between substrates and Pt nanoparticles. As a consequence, the obtained polyphenols-stabilized Pt nanoparticles exhibited high activity and cycling stability in biphasic hydrogenation of a series of unsaturated compounds. Compared with conventional heterogeneous Pt-C and Pt-Al 2 O 3 catalysts, polyphenols-stabilized Pt nanoparticles showed obvious advantage both in activity and cycling stability.

  17. Aqueous biphasic extraction of uranium and thorium from contaminated soils. Final report

    International Nuclear Information System (INIS)

    Chaiko, D.J.; Gartelmann, J.; Henriksen, J.L.; Krause, T.R.; Deepak; Vojta, Y.; Thuillet, E.; Mertz, C.J.

    1995-07-01

    The aqueous biphasic extraction (ABE) process for soil decontamination involves the selective partitioning of solutes and fine particulates between two immiscible aqueous phases. The biphase system is generated by the appropriate combination of a water-soluble polymer (e.g., polyethlene glycol) with an inorganic salt (e.g., sodium carbonate). Selective partitioning results in 99 to 99.5% of the soil being recovered in the cleaned-soil fraction, while only 0.5 to 1% is recovered in the contaminant concentrate. The ABE process is best suited to the recovery of ultrafine, refractory material from the silt and clay fractions of soils. During continuous countercurrent extraction tests with soil samples from the Fernald Environmental Management Project site (Fernald, OH), particulate thorium was extracted and concentrated between 6- and 16-fold, while the uranium concentration was reduced from about 500 mg/kg to about 77 mg/kg. Carbonate leaching alone was able to reduce the uranium concentration only to 146 mg/kg. Preliminary estimates for treatment costs are approximately $160 per ton of dry soil. A detailed flowsheet of the ABE process is provided

  18. Acute exercise induces biphasic increase in respiratory mRNA in skeletal muscle

    International Nuclear Information System (INIS)

    Ikeda, Shin-ichi; Kizaki, Takako; Haga, Shukoh; Ohno, Hideki; Takemasa, Tohru

    2008-01-01

    Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) promotes the expression of oxidative enzymes in skeletal muscle. We hypothesized that activation of the p38 MAPK (mitogen-activated protein kinase) in response to exercise was associated with exercise-induced PGC-1α and respiratory enzymes expression and aimed to demonstrate this under the physiological level. We subjected mice to a single bout of treadmill running and found that the exercise induced a biphasic increase in the expression of respiratory enzymes mRNA. The second phase of the increase was accompanied by an increase in PGC-1α protein, but the other was not. Administration of SB203580 (SB), an inhibitor of p38 MAPK, suppressed the increase in PGC-1α expression and respiratory enzymes mRNA in both phases. These data suggest that p38 MAPK is associated with the exercise-induced expression of PGC-1α and biphasic increase in respiratory enzyme mRNAs in mouse skeletal muscle under physiological conditions

  19. Synthesis of biphasic calcium phosphate containing nanostructured films by micro arc oxidation on magnesium alloy

    Energy Technology Data Exchange (ETDEWEB)

    Seyfoori, A., E-mail: klm.1985@yahoo.com [School of Metallurgy and Materials Engineering, Iran University of Science and Technology, 16846-13114 Tehran (Iran, Islamic Republic of); National Cell Bank, Pasteur Institute of Iran, 13164 Tehran (Iran, Islamic Republic of); Mirdamadi, Sh.; Seyedraoufi, Z.S.; Khavandi, A. [School of Metallurgy and Materials Engineering, Iran University of Science and Technology, 16846-13114 Tehran (Iran, Islamic Republic of); Aliofkhazraei, M. [Department of Materials Engineering, Faculty of Engineering, Tarbiat Modares University, 14115-143 Tehran (Iran, Islamic Republic of)

    2013-10-01

    The present research reports the synthesis of an innovative nanostructured composite film containing biphasic calcium phosphate (BCP) by the micro arc oxidation (MAO) method on AZ31 magnesium alloy. Nanometric structure of the used hydroxyapatite powder and the coatings were characterized by means of transmission and field-emission scanning electron microscope, respectively. Electrochemical behaviors of the pure MAO and nanocomposite films were also evaluated by electrochemical impedance spectroscopy and potentiodynamic polarization tests in simulated body fluid (SBF) environment. The results showed higher corrosion resistance of nanocomposite film compared to pure MAO coating, which was related to the blocking feature of the nanoparticles from the diffusing of the corrosive medium through the substrate. In addition, by immersing the specimens in simulated body fluid, greater apatite forming ability of the nanocomposite coating was proved. - Highlights: • Synthesis of innovative biphasic calcium phosphate containing nanostructured films via micro arc oxidation. • Nanocomposite film has lower degradation rate than pure MAO film. • Greater apatite forming ability for nanocomposite coating compared with pure MAO film is obtained.

  20. Biphasic products of dicalcium phosphate-rich cement with injectability and nondispersibility

    International Nuclear Information System (INIS)

    Ko, Chia-Ling; Chen, Jian-Chih; Hung, Chun-Cheng; Wang, Jen-Chyan; Tien, Yin-Chun; Chen, Wen-Cheng

    2014-01-01

    In this study, a calcium phosphate cement was developed using tetracalcium phosphate and surface-modified dicalcium phosphate anhydrous (DCPA). This developed injectable bone graft substitute can be molded to the shape of the bone cavity and set in situ through the piping system that has an adequate mechanical strength, non-dispersibility, and biocompatibility. The materials were based on the modified DCPA compositions of calcium phosphate cement (CPC), where the phase ratio of the surface-modified DCPA is higher than that of the conventional CPC for forming dicalcium phosphate (DCP)-rich cement. The composition and morphology of several calcium phosphate cement specimens during setting were analyzed via X-ray diffractometry and transmission electron microscopy coupled with an energy dispersive spectroscopy system. The compressive strength of DCP-rich CPCs was greater than 30 MPa after 24 h of immersion in vitro. The reaction of the CPCs produced steady final biphasic products of DCPs with apatite. The composites of calcium phosphate cements derived from tetracalcium phosphate mixed with surface-modified DCPA exhibited excellent mechanical properties, injectability, and interlocking forces between particles, and they also featured nondispersive behavior when immersed in a physiological solution. - Highlights: • Bone cement precursor with nanocrystals is characterized. • DCP-rich CPCs with nanocrystals exhibited biphasic product phases. • Nanocrystals in cement significantly affected the interlocking ability. • Nanocrystals in cement exhibited higher strength and anti-dispersion. • DCP-rich CPCs increase the potential of bioresorption after reaction

  1. Synthesis of biphasic calcium phosphate containing nanostructured films by micro arc oxidation on magnesium alloy

    International Nuclear Information System (INIS)

    Seyfoori, A.; Mirdamadi, Sh.; Seyedraoufi, Z.S.; Khavandi, A.; Aliofkhazraei, M.

    2013-01-01

    The present research reports the synthesis of an innovative nanostructured composite film containing biphasic calcium phosphate (BCP) by the micro arc oxidation (MAO) method on AZ31 magnesium alloy. Nanometric structure of the used hydroxyapatite powder and the coatings were characterized by means of transmission and field-emission scanning electron microscope, respectively. Electrochemical behaviors of the pure MAO and nanocomposite films were also evaluated by electrochemical impedance spectroscopy and potentiodynamic polarization tests in simulated body fluid (SBF) environment. The results showed higher corrosion resistance of nanocomposite film compared to pure MAO coating, which was related to the blocking feature of the nanoparticles from the diffusing of the corrosive medium through the substrate. In addition, by immersing the specimens in simulated body fluid, greater apatite forming ability of the nanocomposite coating was proved. - Highlights: • Synthesis of innovative biphasic calcium phosphate containing nanostructured films via micro arc oxidation. • Nanocomposite film has lower degradation rate than pure MAO film. • Greater apatite forming ability for nanocomposite coating compared with pure MAO film is obtained

  2. Non-conventional solvents in liquid phase microextraction and aqueous biphasic systems.

    Science.gov (United States)

    An, Jiwoo; Trujillo-Rodríguez, María J; Pino, Verónica; Anderson, Jared L

    2017-06-02

    The development of rapid, convenient, and high throughput sample preparation approaches such as liquid phase microextraction techniques have been continuously developed over the last decade. More recently, significant attention has been given to the replacement of conventional organic solvents used in liquid phase microextraction techniques in order to reduce toxic waste and to improve selectivity and/or extraction efficiency. With these objectives, non-conventional solvents have been explored in liquid phase microextraction and aqueous biphasic systems. The utilized non-conventional solvents include ionic liquids, magnetic ionic liquids, and deep eutectic solvents. They have been widely used as extraction solvents or additives in various liquid phase microextraction modes including dispersive liquid-liquid microextraction, single-drop microextraction, hollow fiber-liquid phase microextraction, as well as in aqueous biphasic systems. This review provides an overview into the use of non-conventional solvents in these microextraction techniques in the past 5 years (2012-2016). Analytical applications of the techniques are also discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Biphasic electrical currents stimulation promotes both proliferation and differentiation of fetal neural stem cells.

    Directory of Open Access Journals (Sweden)

    Keun-A Chang

    2011-04-01

    Full Text Available The use of non-chemical methods to differentiate stem cells has attracted researchers from multiple disciplines, including the engineering and the biomedical fields. No doubt, growth factor based methods are still the most dominant of achieving some level of proliferation and differentiation control--however, chemical based methods are still limited by the quality, source, and amount of the utilized reagents. Well-defined non-chemical methods to differentiate stem cells allow stem cell scientists to control stem cell biology by precisely administering the pre-defined parameters, whether they are structural cues, substrate stiffness, or in the form of current flow. We have developed a culture system that allows normal stem cell growth and the option of applying continuous and defined levels of electric current to alter the cell biology of growing cells. This biphasic current stimulator chip employing ITO electrodes generates both positive and negative currents in the same culture chamber without affecting surface chemistry. We found that biphasic electrical currents (BECs significantly increased the proliferation of fetal neural stem cells (NSCs. Furthermore, BECs also promoted the differentiation of fetal NSCs into neuronal cells, as assessed using immunocytochemistry. Our results clearly show that BECs promote both the proliferation and neuronal differentiation of fetal NSCs. It may apply to the development of strategies that employ NSCs in the treatment of various neurodegenerative diseases, such as Alzheimer's and Parkinson's diseases.

  4. Is there an Optimal Shape of the Defibrillation Shock: Constant Current vs. Pulsed Biphasic Waveforms

    Directory of Open Access Journals (Sweden)

    Ivan Dotsinsky

    2013-04-01

    Full Text Available Three waveforms for transthoracic defibrillation are assessed and compared: the Pulsed Biphasic Waveform (PBW, the Rectilinear Biphasic Waveform (RBW, and the "lossless" constant current (LLCC pulses. Two indices are introduced: 1 kf = W/W0 - the ratio between the delivered energy W and the energy W0 of a rectangular pulse with the same duration and electric charge; 2 ηC = W/WC0 - the level of utilizing the initially loaded capacitor energy WC0. The envisioned comparative study shows that ηC index is favorable for both PBW and LLCC, while kf of both RBW and LLCC demonstrates advantage over the PBW in the range of small inter-electrode thoracic impedances below 80 Ω. Some design considerations are also discussed. The attractive LLCC concept needs large and heavy inductive coil to support the constant current amplitude, besides it is capable to induce strong electromagnetic influences due to the complex current control. The RBW technology controls the delivery of current through a series of internal resistors which are, however, a source of high heat losses. The PBW implements controlled duty cycle of high-frequency chopped pulses to adapt the energy delivery in respect of the patient impedance measured at the beginning of the shock. PBW technology makes use of small capacitors which allows the construction of light weight and small-size portable devices for transthoracic defibrillation.

  5. MDCT urography: experience with a bi-phasic excretory phase examination protocol

    International Nuclear Information System (INIS)

    Meindl, Thomas; Coppenrath, Eva; Degenhart, Christoph; Reiser, Maximilian F.; Mueller-Lisse, Ullrich G.; Mueller-Lisse, Ulrike L.

    2007-01-01

    The benefit of multidetector computed tomographic urography (MDCTU) for visualising early and late excretory phase (EP) upper urinary tract (UUT) opacification has been studied. UUT opacification was retrospectively evaluated in 45 bi-phasic four-row MDCTU examinations. The UUT was divided into intrarenal collecting system (IRCS), proximal, middle and distal ureter. Two independent readers rated opacification: 1, none; 2, partial; 3, complete. Numbers of segments and percentages of UUTs at each score were calculated for each EP and two EPs combined. Results of a single EP and of combined EPs were compared by Wilcoxon matched-pairs signed-ranks. IRCS and proximal ureter were at least partially opacified in each EP in >95%. The middle ureter was at least partially opacified in the early and late EP in 85% and 93%, respectively. The distal ureter was opacified in 65% (49/75) in the early EP and in 78% (59/75) in the late EP. Combining two EPs, non-opacified distal segments decreased to 9% (7/75). Significant improvement between a single EP and combining two EPs were found for the middle and distal ureter (P < 0.03). Bi-phasic MDCTU substantially improved opacification of the middle and distal ureter. IRCS and proximal ureter are reliably opacified with one EP. (orig.)

  6. Biopolymer-stabilized Pt nanoparticles colloid: a highly active and recyclable catalyst for biphasic catalysis

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yujia; Shen, Yueyue; Qiu, Yunfei; Zhang, Ting; Liao, Yang; Zhao, Shilin; Ma, Jun, E-mail: 1044208419@qq.com; Mao, Hui, E-mail: rejoice222@163.com [Sichuan Normal University, College of Chemistry and Materials Science (China)

    2016-10-15

    Noble metal nanoparticles are promising candidates to replace conventional bulk counterparts owing to their high activity and selectivity. To enable catalyst recovery, noble metal nanoparticles are often supported onto solid matrices to prepare heterogeneous catalyst. Although recycle of noble metal nanoparticles is realized by heterogenization, a loss of activity is usually encountered. In the present investigation, Pt nanoparticles with tunable particle size (1.85–2.80 nm) were facilely prepared by using polyphenols as amphiphilic stabilizers. The as-prepared Pt nanoparticles colloid solution could be used as highly active catalyst in aqueous–organic biphasic catalysis. The phenolic hydroxyls of polyphenols could constrain Pt nanoparticles in aqueous phase, and simultaneously, the aromatic scaffold of polyphenols ensured effective interactions between substrates and Pt nanoparticles. As a consequence, the obtained polyphenols-stabilized Pt nanoparticles exhibited high activity and cycling stability in biphasic hydrogenation of a series of unsaturated compounds. Compared with conventional heterogeneous Pt-C and Pt-Al{sub 2}O{sub 3} catalysts, polyphenols-stabilized Pt nanoparticles showed obvious advantage both in activity and cycling stability.

  7. Fabrication of nano structural biphasic materials from phosphogypsum waste and their in vitro applications

    Energy Technology Data Exchange (ETDEWEB)

    Mohamed, Khaled R., E-mail: Kh_rezk966@yahoo.com [Biomaterials Department, National Research Centre, Dokki, Cairo (Egypt); Mousa, Sahar M. [Chemistry Department, Science and Art College, King Abdulaziz University, Rabigh Campus, P.O. Box 344, 21911 Rabigh (Saudi Arabia); Inorganic Chemistry Department, National Research Centre, Dokki, P.O. Box 12622, 11787 Cairo (Egypt); El Bassyouni, Gehan T. [Biomaterials Department, National Research Centre, Dokki, Cairo (Egypt); Medical Physics Department, College of Medicine, Taif University (Saudi Arabia)

    2014-02-01

    Graphical abstract: (a) Schema of the process, (b) TEM of nano particles of biphasic materials and (c) SEM of post-immersion. - Highlights: • Ratio of HA and β-TCP phases were controlled by thermal treatment. • HA partially decomposed into β-TCP with other bioactive phases. • Calcined HA at 900 °C is the best for the bioactivity behavior. - Abstract: In this study, a novel process of preparing biphasic calcium phosphate (BCP) is proposed. Also its bioactivity for the utilization of the prepared BCP as a biomaterial is studied. A mixture of calcium hydroxyapatite (HAP) and tricalcium phosphate (β-TCP) could be obtained by thermal treatment of HAP which was previously prepared from phosphogypsum (PG) waste. The chemical and phase composition, morphology and particle size of prepared samples was characterized by X-ray diffraction (XRD), Infrared spectroscopy (IR), Scanning electron microscopy (SEM) and Transmission electron microscopy (TEM). The bioactivity was investigated by soaking of the calcined samples in simulated body fluid (SBF). Results confirmed that the calcination temperatures played an important role in the formation of calcium phosphate (CP) materials. XRD results indicated that HAP was partially decomposed into β-TCP. The in vitro data confirmed that the calcined HAP forming BCP besides other phases such as pyrophosphate and silica are bioactive materials. Therefore, BCP will be used as good biomaterials for medical applications.

  8. Efficient One-Pot Synthesis of 5-Chloromethylfurfural (CMF from Carbohydrates in Mild Biphasic Systems

    Directory of Open Access Journals (Sweden)

    Dimitris S. Argyropoulos

    2013-07-01

    Full Text Available 5-Halomethylfurfurals can be considered as platform chemicals of high reactivity making them useful for the preparation of a variety of important compounds. In this study, a one-pot route for the conversion of carbohydrates into 5-chloromethylfurfural (CMF in a simple and efficient (HCl-H3PO4/CHCl3 biphasic system has been investigated. Monosaccharides such as D-fructose, D-glucose and sorbose, disaccharides such as sucrose and cellobiose and polysaccharides such as cellulose were successfully converted into CMF in satisfactory yields under mild conditions. Our data shows that when using D-fructose the optimum yield of CMF was about 47%. This understanding allowed us to extent our work to biomaterials, such as wood powder and wood pulps with yields of CMF obtained being comparable to those seen with some of the enumerated mono and disaccharides. Overall, the proposed (HCl-H3PO4/CHCl3 optimized biphasic system provides a simple, mild, and cost-effective means to prepare CMF from renewable resources.

  9. Injectable TEMPO-oxidized nanofibrillated cellulose/biphasic calcium phosphate hydrogel for bone regeneration.

    Science.gov (United States)

    Safwat, Engie; Hassan, Mohammad L; Saniour, Sayed; Zaki, Dalia Yehia; Eldeftar, Mervat; Saba, Dalia; Zazou, Mohamed

    2018-05-01

    Nanofibrillated cellulose, obtained from rice straw agricultural wastes was used as a substrate for the preparation of a new injectable and mineralized hydrogel for bone regeneration. Tetramethyl pyridine oxyl (TEMPO) oxidized nanofibrillated cellulose, was mineralized through the incorporation of a prepared and characterized biphasic calcium phosphate at a fixed ratio of 50 wt%. The TEMPO-oxidized rice straw nanofibrillated cellulose was characterized using transmission electron microscopy, Fourier transform infrared, and carboxylic content determination. The injectability and viscosity of the prepared hydrogel were evaluated using universal testing machine and rheometer testing, respectively. Cytotoxicity and alkaline phosphatase level tests on osteoblast like-cells for in vitro assessment of the biocompatibility were investigated. Results revealed that the isolated rice straw nanofibrillated cellulose is a nanocomposite of the cellulose nanofibers and silica nanoparticles. Rheological properties of the tested materials are suitable for use as injectable material and of nontoxic effect on osteoblast-like cells, as revealed by the positive alkaline phosphate assay. However, nanofibrillated cellulose/ biphasic calcium phosphate hydrogel showed higher cytotoxicity and lower bioactivity test results when compared to that of nanofibrillated cellulose.

  10. Biphasic pulses enhance bleomycin efficacy in a spontaneous canine genital tumor model of chemoresistance: Sticker sarcoma

    Directory of Open Access Journals (Sweden)

    Citro Gennaro

    2008-11-01

    Full Text Available Abstract Sticker's sarcoma (also known as transmissible venereal tumor is a horizontally transmitted neoplasm of the dog, that is passed with coitus. It is a locally aggressive tumor with a low tendency to metastatic spread. The most common locations are the genitals, the nose, the perianal area. Standard treatment consists with chemotherapy with vincristine, however other therapies such as, cryotherapy, immunotherapy or, in selected cases, radiation therapy, have been reported. In this article we describe the outcome of a small cohort of canine patients, with chemotherapy resistant transmissible venereal tumor (TVT, treated with bleomycin selectively driven by trains of biphasic pulses (electrochemotherapy. Three canine patients, with refractory TVT, entered the study and received two sessions of ECT under sedation. The pets had local injection of bleomycin at the concentration of 1.5 mg/ml and five minutes after the chemotherapy, trains of 8 biphasic electric pulses lasting 50 + 50 μs each, with 1 ms interpulse intervals, were delivered by means of modified caliper or, for difficult districts, through paired needle electrode. All the patients responded to the treatment and are still in remission at different times. Electrochemotherapy appears as a safe and efficacious modality for the treatment of TVT and warrants further investigations.

  11. Online Epileptic Seizure Prediction Using Wavelet-Based Bi-Phase Correlation of Electrical Signals Tomography.

    Science.gov (United States)

    Vahabi, Zahra; Amirfattahi, Rasoul; Shayegh, Farzaneh; Ghassemi, Fahimeh

    2015-09-01

    Considerable efforts have been made in order to predict seizures. Among these methods, the ones that quantify synchronization between brain areas, are the most important methods. However, to date, a practically acceptable result has not been reported. In this paper, we use a synchronization measurement method that is derived according to the ability of bi-spectrum in determining the nonlinear properties of a system. In this method, first, temporal variation of the bi-spectrum of different channels of electro cardiography (ECoG) signals are obtained via an extended wavelet-based time-frequency analysis method; then, to compare different channels, the bi-phase correlation measure is introduced. Since, in this way, the temporal variation of the amount of nonlinear coupling between brain regions, which have not been considered yet, are taken into account, results are more reliable than the conventional phase-synchronization measures. It is shown that, for 21 patients of FSPEEG database, bi-phase correlation can discriminate the pre-ictal and ictal states, with very low false positive rates (FPRs) (average: 0.078/h) and high sensitivity (100%). However, the proposed seizure predictor still cannot significantly overcome the random predictor for all patients.

  12. Isoattenuating insulinomas at biphasic contrast-enhanced CT: frequency, clinicopathologic features and perfusion characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Liang; Xue, Hua-dan; Sun, Hao; Wang, Xuan; He, Yong-lan; Jin, Zheng-yu [Peking Union Medical College Hospital, Department of Radiology, Beijing (China); Zhao, Yu-pei [Peking Union Medical College Hospital, Department of General Surgery, Beijing (China)

    2016-10-15

    We aimed to determine the frequency of isoattenuating insulinomas, to investigate their clinicopathological features and to assess their regional pancreatic perfusion characteristics. Institutional review board approval was obtained, and patient informed consent was waived. From July 2010 to June 2014, 170 patients (66 male, 104 female) with endogenous hyperinsulinemic hypoglycemia underwent biphasic contrast-enhanced CT before surgery, and 129 of those patients also received preoperative whole-pancreas CT perfusion. A total of 181 tumours were proved histopathologically after surgery. Enhancement pattern and regional pancreatic perfusion characteristics were analyzed. Clinical features, tumour size and pathological grading were investigated. The frequency of isoattenuating tumours was 24.9 %. Tumour size and WHO grading was not significantly different between isoattenuating and hyperattenuating tumours. Tumour-free regions had identical blood flow (BF) regardless of their location (p = 0.35). Isoattenuating tumour-harbouring regions had lower BF compared with hyperattenuating tumour-harbouring regions; both showed higher BF compared with tumour-free neighbourhood regions (all p < 0.01). For patients with isoattenuating tumours, the overall hospital stay was longer (p < 0.01). A substantial subset of insulinomas were isoattenuating on biphasic CT. CT perfusion showed higher BF in tumour-harbouring regions compared to tumour-free regions, providing a clue for tumour regionalization. (orig.)

  13. Biphasic effect of citral, a flavoring and scenting agent, on spatial learning and memory in rats.

    Science.gov (United States)

    Yang, Zheqiong; Xi, Jinlei; Li, Jihong; Qu, Wen

    2009-10-01

    Although some central effects of citral have been reported, cognitive effects on spatial memory have not been investigated. The evidence showed that citral can regulate the synthesis of retinoic acid (RA), which exerts a vital function in the development and maintenance of spatial memory. In this study, we applied Morris water maze to test the effect of citral on animals' spatial learning and memory. To elucidate the mechanism of this effect, we also measured the retinoic acid concentration in rats' hippocampus by high performance liquid chromatography (HPLC). Our data implied biphasic effects of citral. The low dose (0.1 mg/kg) of citral improved the spatial learning capability, and enhanced the spatial reference memory of rats, whereas the high dose (1.0 mg/kg) was like to produce the opposite effects. Meanwhile, the low dose of citral increased the hippocampal retinoic acid concentration, while the high dose decreased it. Due to the quick elimination and non-bioaccumulation in the body, effects of citral on spatial memory in this study seemed to be indirect actions. The change in hippocampal retinoic acid concentration induced by different doses of citral might be responsible for the biphasic effect of citral on spatial learning and memory.

  14. A matter of quantum voltages

    Energy Technology Data Exchange (ETDEWEB)

    Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2014-11-14

    Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.

  15. The effect of activation rate on left atrial bipolar voltage in patients with paroxysmal atrial fibrillation.

    Science.gov (United States)

    Williams, Steven E; Linton, Nick; O'Neill, Louisa; Harrison, James; Whitaker, John; Mukherjee, Rahul; Rinaldi, Christopher A; Gill, Jaswinder; Niederer, Steven; Wright, Matthew; O'Neill, Mark

    2017-09-01

    Bipolar voltage is used during electroanatomic mapping to define abnormal myocardium, but the effect of activation rate on bipolar voltage is not known. We hypothesized that bipolar voltage may change in response to activation rate. By examining corresponding unipolar signals we sought to determine the mechanisms of such changes. LA extrastimulus mapping was performed during CS pacing in 10 patients undergoing first time paroxysmal atrial fibrillation ablation. Bipolar and unipolar electrograms were recorded using a PentaRay catheter (4-4-4 spacing) and indifferent IVC electrode, respectively. An S1S2 pacing protocol was delivered with extrastimulus coupling interval reducing from 350 to 200 milliseconds. At each recording site (119 ± 37 per LA), bipolar peak-to-peak voltage, unipolar peak to peak voltage and activation delay between unipole pairs was measured. Four patterns of bipolar voltage/extrastimulus coupling interval curves were seen: voltage attenuation with plateau voltage >1 mV (48 ± 15%) or voltage unaffected by coupling interval with plateau voltage >1 mV (17 ± 10%) or voltage attenuation were associated with significantly greater unipolar voltage attenuation at low (25 ± 28 mV/s vs. 9 ± 11 mV/s) and high (23 ± 29 mV/s vs. 6 ± 12 mV/s) plateau voltage sites (P voltage attenuation (P = 0.026). Bipolar electrogram voltage is dependent on activation rate at a significant proportion of sites. Changes in unipolar voltage and timing underlie these effects. These observations have important implications for use of voltage mapping to delineate abnormal atrial substrate. © 2017 The Authors. Journal of Cardiovascular Electrophysiology published by Wiley Periodicals, Inc.

  16. A thermoelectric voltage effect in polyethylene oxide

    International Nuclear Information System (INIS)

    Martin, Bjoern; Wagner, Achim; Kliem, Herbert

    2003-01-01

    The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depends on the energy-barrier heights in the multi-well potential

  17. A prospective, randomised and blinded comparison of first shock success of monophasic and biphasic waveforms in out-of-hospital cardiac arrest

    NARCIS (Netherlands)

    van Alem, Anouk P.; Chapman, Fred W.; Lank, Paula; Hart, Augustinus A. M.; Koster, Rudolph W.

    2003-01-01

    Background: Evidence suggests that biphasic waveforms are more effective than monophasic waveforms for defibrillation in out-of-hospital cardiac arrest (OHCA), yet their performance has only been compared in un-blinded studies. Methods and results: We compared the success of biphasic truncated

  18. Voltage current characteristics of type III superconductors

    Science.gov (United States)

    Dorofejev, G. L.; Imenitov, A. B.; Klimenko, E. Yu.

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogenious monofilament and multifilament Nb-Ti, Nb-Zr, Nb 3Sn wires were investigated in different ranges of magnetic field, temperature and current. The longitudinal electric field for homogenious wires may be described by E=J ρnexp- T c/T 0+ T/T 0+ B/B 0+ J/J 0, where To, Bo, Jo are the increasing parameters, which depend weakly on B and T, of the electric field. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (ie the surface corresponding to a certain conventional effective resistivity in T, B, J - space) and a description of any increasing parameter that depends on B and T.

  19. MPPT algorithm for voltage controlled PV inverters

    DEFF Research Database (Denmark)

    Kerekes, Tamas; Teodorescu, Remus; Liserre, Marco

    2008-01-01

    This paper presents a novel concept for an MPPT that can be used in case of a voltage controlled grid connected PV inverters. In case of single-phase systems, the 100 Hz ripple in the AC power is also present on the DC side. Depending on the DC link capacitor, this power fluctuation can be used t...... to track the MPP of the PV array, using the information that at MPP the power oscillations are very small. In this way the algorithm can detect the fact that the current working point is at the MPP, for the current atmospheric conditions....

  20. Study of hMSC proliferation and differentiation on Mg and Mg–Sr containing biphasic β-tricalcium phosphate and amorphous calcium phosphate ceramics

    International Nuclear Information System (INIS)

    Singh, Satish S.; Roy, Abhijit; Lee, Boeun; Kumta, Prashant N.

    2016-01-01

    Biphasic mixtures of either Mg"2"+ or combined Mg"2"+ and Sr"2"+ cation substituted β-tricalcium phosphate (β-TCP) and amorphous calcium phosphate (ACP) were prepared using a low temperature chemical phosphatizing and hydrolysis reaction approach. Scaffolds prepared using the cation substituted calcium phosphates were capable of supporting similar levels of human mesenchymal stem cell proliferation in comparison to commercially available β-TCP. The concentrations of Mg"2"+, Sr"2"+, and PO_4"3"− released from these scaffolds were also within the ranges desired from previous reports to support both hMSC proliferation and osteogenic differentiation. Interestingly, hMSCs cultured directly on scaffolds prepared with only Mg"2"+ substituted β-TCP were capable of supporting statistically significantly increased alkaline phosphatase activity, osteopontin, and osteoprotegerin expression in comparison to all compositions containing both Mg"2"+ and Sr"2"+, and commercially available β-TCP. hMSCs cultured in the presence of scaffold extracts also exhibited similar trends in the expression of osteogenic markers as was observed during direct culture. Therefore, it was concluded that the enhanced differentiation observed was due to the release of bioactive ions rather than the surface microstructure. The role of these ions on transforming growth factor-β and bone morphogenic protein signaling was also evaluated using a PCR array. It was concluded that the release of these ions may support enhanced differentiation through SMAD dependent TGF-β and BMP signaling. - Highlights: • Synthesis of Mg and Mg-Sr containing biphasic beta tricalcium phosphate ceramics • Magnesium substitution influences ALP activity compared to strontium content. • Solution extract plays a more dominant role on hMSC differentiation. • Direct and indirect Mg and Mg-Sr TCP culture show similar OPG and OPN expression.

  1. Study of hMSC proliferation and differentiation on Mg and Mg–Sr containing biphasic β-tricalcium phosphate and amorphous calcium phosphate ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Satish S., E-mail: sss42@pitt.edu [Department of Chemical & Petroleum Engineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Roy, Abhijit, E-mail: abr20@pitt.edu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Lee, Boeun [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Kumta, Prashant N., E-mail: pkumta@pitt.edu [Department of Chemical & Petroleum Engineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Center for Craniofacial Regeneration, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Department of Mechanical Engineering and Materials Science, University of Pittsburgh, PA 15261 (United States)

    2016-07-01

    Biphasic mixtures of either Mg{sup 2+} or combined Mg{sup 2+} and Sr{sup 2+} cation substituted β-tricalcium phosphate (β-TCP) and amorphous calcium phosphate (ACP) were prepared using a low temperature chemical phosphatizing and hydrolysis reaction approach. Scaffolds prepared using the cation substituted calcium phosphates were capable of supporting similar levels of human mesenchymal stem cell proliferation in comparison to commercially available β-TCP. The concentrations of Mg{sup 2+}, Sr{sup 2+}, and PO{sub 4}{sup 3−} released from these scaffolds were also within the ranges desired from previous reports to support both hMSC proliferation and osteogenic differentiation. Interestingly, hMSCs cultured directly on scaffolds prepared with only Mg{sup 2+} substituted β-TCP were capable of supporting statistically significantly increased alkaline phosphatase activity, osteopontin, and osteoprotegerin expression in comparison to all compositions containing both Mg{sup 2+} and Sr{sup 2+}, and commercially available β-TCP. hMSCs cultured in the presence of scaffold extracts also exhibited similar trends in the expression of osteogenic markers as was observed during direct culture. Therefore, it was concluded that the enhanced differentiation observed was due to the release of bioactive ions rather than the surface microstructure. The role of these ions on transforming growth factor-β and bone morphogenic protein signaling was also evaluated using a PCR array. It was concluded that the release of these ions may support enhanced differentiation through SMAD dependent TGF-β and BMP signaling. - Highlights: • Synthesis of Mg and Mg-Sr containing biphasic beta tricalcium phosphate ceramics • Magnesium substitution influences ALP activity compared to strontium content. • Solution extract plays a more dominant role on hMSC differentiation. • Direct and indirect Mg and Mg-Sr TCP culture show similar OPG and OPN expression.

  2. Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

    Science.gov (United States)

    Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

    2012-07-01

    Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

  3. Mechanisms and rules of anion partition into ionic liquids: phenolate ions in ionic liquid/water biphasic systems.

    Science.gov (United States)

    Katsuta, Shoichi; Nakamura, Ko-ichi; Kudo, Yoshihiro; Takeda, Yasuyuki

    2012-01-19

    It is important to understand the mechanisms and general rules of ion partitioning in hydrophobic ionic liquid (IL)/water biphasic systems in order to predict the extractability of an ionic species with various ILs. In this study, we have investigated the partition of picrate ion (target anion, T(-)) from aqueous sodium picrate solutions into several ILs and the accompanying changes in aqueous concentrations of the IL component cation (C(+)) and anion (A(-)) at 298.2 K. The main ILs examined are 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)amide, 1-butyl-3-methylimidazolium hexafluorophosphate, and 1-methyl-3-octylimidazolium bis(trifluoromethanesulfonyl)amide. The aqueous concentrations of C(+) and A(-) decreased and increased, respectively, with the extraction of T(-) into the IL phase. From the standpoint of equilibrium, the partition behavior of T(-) can be explained both by the anion exchange with A(-) in the IL phase and by the ion pair extraction with C(+) in the aqueous phase. The aqueous concentrations of C(+) and A(-) are governed by the solubility product of the IL (K(sp)). The distribution ratio of T(-) is expressed as a function of Δ[T(-)](W), namely, the difference between the initial and equilibrium concentrations of T(-) in the aqueous phase; the distribution ratio of T(-) is nearly constant when Δ[T(-)](W) < K(sp)(1/2), but decreases with increasing Δ[T(-)](W) in the larger Δ[T(-)](W) region. The equilibrium constants of the ion pair extraction and the ion exchange extraction have been determined for picrate and other phenolate ions whose partition data were previously reported. The dependences of the extraction constants and extractability on the kinds of IL component ions can be quantitatively explained on the basis of the variations of K(sp).

  4. Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

    Science.gov (United States)

    Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

    2011-11-30

    We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

  5. Mitigation of voltage sags in the distribution system with dynamic voltage restorer

    International Nuclear Information System (INIS)

    Viglas, D.; Belan, A.

    2012-01-01

    Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

  6. Comparison of low-energy versus high-energy biphasic defibrillation shocks following prolonged ventricular fibrillation.

    Science.gov (United States)

    Walcott, Gregory P; Melnick, Sharon B; Killingsworth, Cheryl R; Ideker, Raymond E

    2010-01-01

    Since the initial development of the defibrillator, there has been concern that, while delivery of a large electric shock would stop fibrillation, it would also cause damage to the heart. This concern has been raised again with the development of the biphasic defibrillator. To compare defibrillation efficacy, postshock cardiac function, and troponin I levels following 150-J and 360-J shocks. Nineteen swine were anesthetized with isoflurane and instrumented with pressure catheters in the left ventricle, aorta, and right atrium. The animals were fibrillated for 6 minutes, followed by defibrillation with either low-energy (n = 8) or high-energy (n = 11) shocks. After defibrillation, chest compressions were initiated and continued until return of spontaneous circulation (ROSC). Epinephrine, 0.01 mg/kg every 3 minutes, was given for arterial blood pressure < 50 mmHg. Hemodynamic parameters were recorded for four hours. Transthoracic echocardiography was performed and troponin I levels were measured at baseline and four hours following ventricular fibrillation (VF). Survival rates at four hours were not different between the two groups (low-energy, 5 of 8; high-energy, 7 of 11). Results for arterial blood pressure, positive dP/dt (first derivative of pressure measured over time, a measure of left ventricular contractility), and negative dP/dt at the time of lowest arterial blood pressure (ABP) following ROSC were not different between the two groups (p = not significant [NS]), but were lower than at baseline. All hemodynamic measures returned to baseline by four hours. Ejection fractions, stroke volumes, and cardiac outputs were not different between the two groups at four hours. Troponin I levels at four hours were not different between the two groups (12 +/- 11 ng/mL versus 21 +/- 26 ng/mL, p = NS) but were higher at four hours than at baseline (19 +/- 19 ng/mL versus 0.8 +/- 0.5 ng/mL, p < 0.05, groups combined). Biphasic 360-J shocks do not cause more cardiac damage

  7. Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

    OpenAIRE

    Okuma, Takanori; Yasuura, Hiroto

    2001-01-01

    This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

  8. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    OpenAIRE

    Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

    2014-01-01

    For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  9. A Biphasic Calcium Sulphate/Hydroxyapatite Carrier Containing Bone Morphogenic Protein-2 and Zoledronic Acid Generates Bone

    DEFF Research Database (Denmark)

    Raina, Deepak Bushan; Isaksson, Hanna; Hettwer, Werner

    2016-01-01

    -the-shelf osteoinductive bone substitutes that can replace bone grafts are required. We tested the carrier properties of a biphasic, calcium sulphate and hydroxyapatite ceramic material, containing a combination of recombinant human bone morphogenic protein-2 (rhBMP-2) to induce bone, and zoledronic acid (ZA) to delay...

  10. Induction of bone formation by smart biphasic hydroxyapatite tricalcium phosphate biomimetic matrices in the non-human primate Papio ursinus

    CSIR Research Space (South Africa)

    Ripamonti, U

    2008-01-01

    Full Text Available Long-term studies in the non-human primate Chacma baboon Papio ursinus were set to investigate the induction of bone formation by biphasic hydroxyapatite/β-tricalcium phosphate (HA/β-TCP) biomimetic matrices. HA/β-TCP biomimetic matrices in a pre...

  11. INVESTIGATION OF AQUEOUS BIPHASIC SYSTEMS FOR THE SEPARATIONS OF LIGNINS FROM CELLULOSE IN THE PAPER PULPING PROCESS. (R826732)

    Science.gov (United States)

    In efforts to apply a polymer-based aqueous biphasic system (ABS) extraction to the paper pulping process, the study of the distribution of various lignin and cellulosic fractions in ABS and the effects of temperature on system composition and solute partitioning have been inv...

  12. Chiral separation of α-cyclohexylmandelic acid enantiomers by high-speed counter-current chromatography with biphasic recognition

    Science.gov (United States)

    Tong, Shengqiang

    2010-01-01

    This work concentrates on a novel chiral separation technology named biphasic recognition applied to resolution of α-cyclohexylmandelic acid enantiomers by high-speed counter-current chromatography (HSCCC). The biphasic chiral recognition HSCCC was performed by adding lipophilic (−)-2-ethylhexyl tartrate in the organic stationary phase and hydrophilic hydroxypropyl-β-cyclodextrin in the aqueous mobile phase, which preferentially recognized the (−)-enantiomer and (+)-enantiomer, respectively. The two-phase solvent system composed of n-hexane-methyl tert-butyl ether-water (9:1:10, v/v/v) with the above chiral selectors was selected according to the partition coefficient and separation factor of the target enantiomers. Various parameters involved in the chiral separation were investigated, namely the types of the chiral selector (CS); the concentration of each chiral selector; pH of the mobile phase; and the separation temperature. The mechanism involved in this biphasic recognition chiral separation by HSCCC was discussed. Langmuirian isotherm was employed to estimate the loading limits for each chiral selector. The overall experimental results show that the HSCCC separation of enantiomer based on biphasic recognition is much more efficient than the traditional monophasic recognition chiral separation, since it utilizes the cooperation of both lipophilic and hydrophilic chiral selectors. PMID:20303497

  13. Efficient asymmetric hydrolysis of styrene oxide catalyzed by Mung bean epoxide hydrolases in ionic liquid-based biphasic systems.

    Science.gov (United States)

    Chen, Wen-Jing; Lou, Wen-Yong; Zong, Min-Hua

    2012-07-01

    The asymmetric hydrolysis of styrene oxide to (R)-1-phenyl-1,2-ethanediol using Mung bean epoxide hydrolases was, for the first time, successfully conducted in an ionic liquid (IL)-containing biphasic system. Compared to aqueous monophasic system, IL-based biphasic systems could not only dissolve the substrate, but also effectively inhibit the non-enzymatic hydrolysis, and therefore markedly improve the reaction efficiency. Of all the tested ILs, the best results were observed in the biphasic system containing C(4)MIM·PF(6), which exhibited good biocompatibility with the enzyme and was an excellent solvent for the substrate. In the C(4)MIM·PF(6)/buffer biphasic system, it was found that the optimal volume ratio of IL to buffer, reaction temperature, buffer pH and substrate concentration were 1/6, 35°C, 6.5 and 100 mM, respectively, under which the initial reaction rate, the yield and the product e.e. were 18.4 mM/h, 49.4% and 97.0%. The biocatalytic process was shown to be feasible on a 500-mL preparative scale. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

    Science.gov (United States)

    Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

    2017-10-01

    Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

  15. Cavity Voltage Phase Modulation MD

    CERN Document Server

    Mastoridis, Themistoklis; Molendijk, John; Timko, Helga; CERN. Geneva. ATS Department

    2016-01-01

    The LHC RF/LLRF system is currently configured for extremely stable RF voltage to minimize transient beam loading effects. The present scheme cannot be extended beyond nominal beam current since the demanded power would exceed the peak klystron power and lead to saturation. A new scheme has therefore been proposed: for beam currents above nominal (and possibly earlier), the cavity phase modulation by the beam will not be corrected (transient beam loading), but the strong RF feedback and One-Turn Delay feedback will still be active for loop and beam stability in physics. To achieve this, the voltage set point will be adapted for each bunch. The goal of this MD was to test a new algorithm that would adjust the voltage set point to achieve the cavity phase modulation that would minimize klystron forward power.

  16. First high-voltage measurements using Ca{sup +} ions at the ALIVE experiment

    Energy Technology Data Exchange (ETDEWEB)

    König, K., E-mail: kkoenig@ikp.tu-darmstadt.de [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Geppert, Ch. [Universität Mainz, Institut für Kernchemie (Germany); Krämer, J.; Maaß, B. [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Otten, E. W. [Universität Mainz, Institut für Physik (Germany); Ratajczyk, T.; Nörtershäuser, W. [Technische Universität Darmstadt, Institut für Kernphysik (Germany)

    2017-11-15

    Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.

  17. A common pathway for charge transport through voltage-sensing domains.

    Science.gov (United States)

    Chanda, Baron; Bezanilla, Francisco

    2008-02-07

    Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.

  18. A Simplified Whole-Organ CT Perfusion Technique with Biphasic Acquisition: Preliminary Investigation of Accuracy and Protocol Feasibility in Kidneys.

    Science.gov (United States)

    Yuan, XiaoDong; Zhang, Jing; Quan, ChangBin; Tian, Yuan; Li, Hong; Ao, GuoKun

    2016-04-01

    To determine the feasibility and accuracy of a protocol for calculating whole-organ renal perfusion (renal blood flow [RBF]) and regional perfusion on the basis of biphasic computed tomography (CT), with concurrent dynamic contrast material-enhanced (DCE) CT perfusion serving as the reference standard. This prospective study was approved by the institutional review board, and written informed consent was obtained from all patients. Biphasic CT of the kidneys, including precontrast and arterial phase imaging, was integrated with a first-pass dynamic volume CT protocol and performed and analyzed in 23 patients suspected of having renal artery stenosis. The perfusion value derived from biphasic CT was calculated as CT number enhancement divided by the area under the arterial input function and compared with the DCE CT perfusion data by using the paired t test, correlation analysis, and Bland-Altman plots. Correlation analysis was made between the RBF and the extent of renal artery stenosis. All postprocessing was independently performed by two observers and then averaged as the final result. Mean ± standard deviation biphasic and DCE CT perfusion data for RBF were 425.62 mL/min ± 124.74 and 419.81 mL/min ± 121.13, respectively (P = .53), and for regional perfusion they were 271.15 mL/min per 100 mL ± 82.21 and 266.33 mL/min per 100 mL ± 74.40, respectively (P = .31). Good correlation and agreement were shown between biphasic and DCE CT perfusion for RBF (r = 0.93; ±10% variation from mean perfusion data [P < .001]) and for regional perfusion (r = 0.90; ±13% variation from mean perfusion data [P < .001]). The extent of renal artery stenosis was negatively correlated with RBF with biphasic CT perfusion (r = -0.81, P = .012). Biphasic CT perfusion is clinically feasible and provides perfusion data comparable to DCE CT perfusion data at both global and regional levels in the kidney. Online supplemental material is available for this article.

  19. Design of shielded voltage divider for impulse voltage measurement

    International Nuclear Information System (INIS)

    Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.

    1976-01-01

    The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)

  20. Unbalanced Voltage Compensation in Low Voltage Residential AC Grids

    DEFF Research Database (Denmark)

    Trintis, Ionut; Douglass, Philip; Munk-Nielsen, Stig

    2016-01-01

    This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling...

  1. Numerical analysis on the effect of voltage change on removing condensed water inside the GDL of a PEM fuel cell

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Nam Woo [Fuel Cell Technology Development Team, Eco-Technology Center, Hyundai-Kia Motors, Yongin (Korea, Republic of); Kim, Young Sang; Kim, Min Soo [Dept. of Mechanical and Aerospace Engineering, Seoul National University, Seoul (Korea, Republic of); Kim, Min Sung [School of Energy Systems Engineering, Chung-Ang University, Seoul (Korea, Republic of)

    2016-09-15

    Decreasing the voltage of a fuel cell through hydrogen mixing or using low-air stoichiometry ratio is beneficial to remove condensed water inside GDL under flooding condition. In this study, the effect of voltage level of a fuel cell on water distribution in GDL under flooding condition was numerically analyzed. Water content in GDL was dependent on the voltage level of a fuel cell, that is, the water content was low when the cell voltage was maintained low. The effect of voltage change under flooding condition was also simulated. The flow rate of condensed water inside GDL considerably increased immediately after decreasing the cell voltage. The oxygen concentration in the catalyst layer was increased by decreasing the voltage of the fuel cell. Consequently, the cell voltage was recovered. Therefore, decreasing cell voltage under flooding condition can facilitate removal of condensed water in GDL.

  2. The high voltage homopolar generator

    Science.gov (United States)

    Price, J. H.; Gully, J. H.; Driga, M. D.

    1986-11-01

    System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.

  3. A biphasic oxidation of alcohols to aldehydes and ketones using a simplified packed-bed microreactor

    Directory of Open Access Journals (Sweden)

    Andrew Bogdan

    2009-04-01

    Full Text Available We demonstrate the preparation and characterization of a simplified packed-bed microreactor using an immobilized TEMPO catalyst shown to oxidize primary and secondary alcohols via the biphasic Anelli-Montanari protocol. Oxidations occurred in high yields with great stability over time. We observed that plugs of aqueous oxidant and organic alcohol entered the reactor as plugs but merged into an emulsion on the packed-bed. The emulsion coalesced into larger plugs upon exiting the reactor, leaving the organic product separate from the aqueous by-products. Furthermore, the microreactor oxidized a wide range of alcohols and remained active in excess of 100 trials without showing any loss of catalytic activity.

  4. Obtaining of ceramics biphasic dense and porous; Obtencao de ceramicas bifasicas densas e porosas

    Energy Technology Data Exchange (ETDEWEB)

    Pallone, E.M.J.A.; Rigo, E.C.S., E-mail: eliria@usp.b [Universidade de Sao Paulo (FZEA/USP), Pirassununga, SP (Brazil). Dept. de Ciencias Basicas; Silva, K.L. [Universidade Estadual de Campinas (FEM/UNICAMP), SP (Brazil). Faculdade de Engenharia Mecanica; Rezende, M.E. [Universidade Sao Francisco, Itatiba, SP (Brazil); Fraga, A.F. [Universidade Federal de Sao Carlos (DEMa/UFSCar), SP (Brazil). Dept. de Engenharia de Materiais; Marques, R.F.C. [Universidade Federal de Alfenas (UNIFAL), Pocos de Caldas, MG (Brazil)

    2010-07-01

    Among the bioceramic hydroxyapatite (HAP) and beta-tricalcium phosphate (beta-TCP) are materials commonly used in biomedical field. Their combined properties result in a material with absorbable and at the same time with bioactive surface. Called biphasic ceramics such materials respond more quickly when exposed to physiological environment. In this work, powders of HAP/beta-TCP were obtained by chemical precipitation. After obtaining the post-phase was added at a ratio of 0, 15% and 30w% aqueous solutions of corn starch in order to obtain porous bodies. After mixing the resulting solutions were dried, resigned in tablet form and sintered at 1300 deg C. The initial powder was characterized by X-ray diffraction with Rietveld refinement to quantify the phases present. Bodies-of-evidence has been characterized by calculating the bulk density, X-ray diffraction (XRD), scanning electron microscopy and diametral compression. (author)

  5. Pickering interfacial catalysis for biphasic systems: from emulsion design to green reactions.

    Science.gov (United States)

    Pera-Titus, Marc; Leclercq, Loïc; Clacens, Jean-Marc; De Campo, Floryan; Nardello-Rataj, Véronique

    2015-02-09

    Pickering emulsions are surfactant-free dispersions of two immiscible fluids that are kinetically stabilized by colloidal particles. For ecological reasons, these systems have undergone a resurgence of interest to mitigate the use of synthetic surfactants and solvents. Moreover, the use of colloidal particles as stabilizers provides emulsions with original properties compared to surfactant-stabilized emulsions, microemulsions, and micellar systems. Despite these specific advantages, the application of Pickering emulsions to catalysis has been rarely explored. This Minireview describes very recent examples of hybrid and composite amphiphilic materials for the design of interfacial catalysts in Pickering emulsions with special emphasis on their assets and challenges for industrially relevant biphasic reactions in fine chemistry, biofuel upgrading, and depollution. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Alendronate-Eluting Biphasic Calcium Phosphate (BCP Scaffolds Stimulate Osteogenic Differentiation

    Directory of Open Access Journals (Sweden)

    Sung Eun Kim

    2015-01-01

    Full Text Available Biphasic calcium phosphate (BCP scaffolds have been widely used in orthopedic and dental fields as osteoconductive bone substitutes. However, BCP scaffolds are not satisfactory for the stimulation of osteogenic differentiation and maturation. To enhance osteogenic differentiation, we prepared alendronate- (ALN- eluting BCP scaffolds. The coating of ALN on BCP scaffolds was confirmed by scanning electron microscopy (FE-SEM, energy-dispersive X-ray spectroscopy (EDS, and attenuated total reflectance-Fourier transform infrared spectroscopy (ATR-FTIR. An in vitro release study showed that release of ALN from ALN-eluting BCP scaffolds was sustained for up to 28 days. In vitro results revealed that MG-63 cells grown on ALN-eluting BCP scaffolds exhibited increased ALP activity and calcium deposition and upregulated gene expression of Runx2, ALP, OCN, and OPN compared with the BCP scaffold alone. Therefore, this study suggests that ALN-eluting BCP scaffolds have the potential to effectively stimulate osteogenic differentiation.

  7. Spindle-cell squamous carcinoma of the esophagus: a tumor with biphasic morphology

    International Nuclear Information System (INIS)

    Agha, F.P.; Keren, D.F.

    1985-01-01

    Spindle-cell squamous carcinoma of the esophagus is a rare malignant tumor. It is characterized by a large bulky mass in the middle third of the esophagus with a lobulated surface and local expansion of the esophagus. This lesion may be pedunculated and cause relatively little obstruction despite its bulk. The current view, based on ultrastructure and immunohistochemical evidence, has confirmed that the sarcomatous component of the squamous cell carcinoma originates from mesenchymal metaplasia of squamous cells. On the basis of this evidence and clinical behavior, it seems appropriate to consider carcinosarcoma and pseudosarcoma as equivalents and as variants of squamous cell carcinoma. Four patients with spindle-cell squamous carcinoma, an unusual subset of squamous carcinoma, are described, and the salient radiographic and pathologic features of this disorder's distinctive biphasic morphology are discussed

  8. Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP.

    Science.gov (United States)

    Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

    2010-11-01

    A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.

  9. Recording membrane potential changes through photoacoustic voltage sensitive dye

    DEFF Research Database (Denmark)

    Zhang, Haichong K.; Kang, Jeeun; Yan, Ping

    2017-01-01

    Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo...... systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching...... the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize...

  10. Resilient architecture design for voltage variation

    CERN Document Server

    Reddi, Vijay Janapa

    2013-01-01

    Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

  11. Characterization of liver metastases: the efficacy of biphasic magnetic resonance imaging with ferucarbotran-enhancement

    International Nuclear Information System (INIS)

    Hong, H.S.; Byun, J.H.; Won, H.J.; Kim, K.W.; Lee, S.S.; Lee, M.G.; Yun, S.C.

    2010-01-01

    Aim: To retrospectively evaluate the efficacy of biphasic magnetic resonance imaging (MRI) of the liver with ferucarbotran-enhancement for the characterization of hepatic metastases. Materials and methods: Thirty-six patients underwent MRI of the liver with separate acquisition of double-contrast enhancement consisting of gadolinium and ferucarbotran. A total of 106 focal hepatic lesions (51 metastases, 31 cysts, 23 haemangiomas, and one eosinophilic abscess) were included. Two sets of MRI were analysed: (1) ferucarbotran set: ferucarbotran-enhanced T1-weighted (T1W) dynamic imaging combined with ferucarbotran-enhanced T2*-weighted (T2*W) delayed imaging and (2) double set: gadolinium-enhanced T1W dynamic imaging combined with ferucarbotran-enhanced T2*W delayed imaging. The diagnostic accuracy of the two sets was evaluated using alternative free-response receiver operating characteristic curve analysis. Sensitivity and specificity were compared using the McNemar test. The enhancement pattern of focal hepatic lesions was analysed on gadolinium and ferucarbotran-enhanced T1W dynamic imaging. Results: There was no significant difference in the accuracy of characterizing hepatic metastases between the two sets. Sensitivity and specificity were not significantly different between the sets (p > 0.05). Peripheral rim enhancement was exhibited in 57% of metastatic lesions on ferucarbotran-enhanced T1W dynamic imaging. The majority (96%) of hepatic haemangiomas demonstrated typical peripheral nodular enhancement with progression on ferucarbotran-enhanced T1W dynamic imaging and were easily differentiated from metastases. Conclusion: Biphasic MRI of the liver with ferucarbotran-enhancement alone provided comparable diagnostic efficacy to double-contrast MRI for the characterization of hepatic metastases.

  12. Progranulin haploinsufficiency causes biphasic social dominance abnormalities in the tube test.

    Science.gov (United States)

    Arrant, A E; Filiano, A J; Warmus, B A; Hall, A M; Roberson, E D

    2016-07-01

    Loss-of-function mutations in progranulin (GRN) are a major autosomal dominant cause of frontotemporal dementia (FTD), a neurodegenerative disorder in which social behavior is disrupted. Progranulin-insufficient mice, both Grn(+/-) and Grn(-/-) , are used as models of FTD due to GRN mutations, with Grn(+/-) mice mimicking the progranulin haploinsufficiency of FTD patients with GRN mutations. Grn(+/-) mice have increased social dominance in the tube test at 6 months of age, although this phenotype has not been reported in Grn(-/-) mice. In this study, we investigated how the tube test phenotype of progranulin-insufficient mice changes with age, determined its robustness under several testing conditions, and explored the associated cellular mechanisms. We observed biphasic social dominance abnormalities in Grn(+/-) mice: at 6-8 months, Grn(+/-) mice were more dominant than wild-type littermates, while after 9 months of age, Grn(+/-) mice were less dominant. In contrast, Grn(-/-) mice did not exhibit abnormal social dominance, suggesting that progranulin haploinsufficiency has distinct effects from complete progranulin deficiency. The biphasic tube test phenotype of Grn(+/-) mice was associated with abnormal cellular signaling and neuronal morphology in the amygdala and prefrontal cortex. At 6-9 months, Grn(+/-) mice exhibited increased mTORC2/Akt signaling in the amygdala and enhanced dendritic arbors in the basomedial amygdala, and at 9-16 months Grn(+/-) mice exhibited diminished basal dendritic arbors in the prelimbic cortex. These data show a progressive change in tube test dominance in Grn(+/-) mice and highlight potential underlying mechanisms by which progranulin insufficiency may disrupt social behavior. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  13. Regulation of the demographic structure in isomorphic biphasic life cycles at the spatial fine scale.

    Directory of Open Access Journals (Sweden)

    Vasco Manuel Nobre de Carvalho da Silva Vieira

    Full Text Available Isomorphic biphasic algal life cycles often occur in the environment at ploidy abundance ratios (Haploid:Diploid different from 1. Its spatial variability occurs within populations related to intertidal height and hydrodynamic stress, possibly reflecting the niche partitioning driven by their diverging adaptation to the environment argued necessary for their prevalence (evolutionary stability. Demographic models based in matrix algebra were developed to investigate which vital rates may efficiently generate an H:D variability at a fine spatial resolution. It was also taken into account time variation and type of life strategy. Ploidy dissimilarities in fecundity rates set an H:D spatial structure miss-fitting the ploidy fitness ratio. The same happened with ploidy dissimilarities in ramet growth whenever reproductive output dominated the population demography. Only through ploidy dissimilarities in looping rates (stasis, breakage and clonal growth did the life cycle respond to a spatially heterogeneous environment efficiently creating a niche partition. Marginal locations were more sensitive than central locations. Related results have been obtained experimentally and numerically for widely different life cycles from the plant and animal kingdoms. Spore dispersal smoothed the effects of ploidy dissimilarities in fertility and enhanced the effects of ploidy dissimilarities looping rates. Ploidy dissimilarities in spore dispersal could also create the necessary niche partition, both over the space and time dimensions, even in spatial homogeneous environments and without the need for conditional differentiation of the ramets. Fine scale spatial variability may be the key for the prevalence of isomorphic biphasic life cycles, which has been neglected so far.

  14. Use of Respiratory Support in the Biphase Ventilation Airway Mode in the Newborn

    Directory of Open Access Journals (Sweden)

    S. N. Koval

    2006-01-01

    Full Text Available Biphasic positive airway pressure (BIPAP (also known as DuoPAP, BiLevel, BiVent, PCV+, SPAP is a mode of ventilation with cycling variations between two continuous positive airway pressure levels. It is a mixture of pressure controlled ventilation and spontaneous breathing, which is unrestricted in each phase of the respiratory cycle. The volume displacement caused by the difference between Phigh and Plow airway pressure level. The phase time ratio (PTR — the BIPAP frequency is calculated as the ratio between the durations of the two pressure phases, a PTR greater than 1:1 is called APRV (airway pressure release ventilation. In patients with ARDS maintained spontaneous breathing with BIPAP resulted in lower venous admixture and better arterial blood oxygenation as compared with A/C. Only a few studies with BIPAP have been performed in newborn and infants until now. We studied the use of BIPAP in newborn (body mass > 3kg and randomised 40 patients with respiratory failure for ventilation with BIPAP (n=20 or conventional mechanical ventilatory support (assist-control A/C — synchronised intermittent mandatory ventilation (SIMV (n=20. The Pediatric Risk of Mortality score (PRISM were collected for each patient. Fentanyl, diazepam, GABA were used as sedatives and adjusted in accordance with the Cook scale. We compared ventilatory parameters, information pertaining to pulmonary function and oxygen delivery, cardiac output, additional descriptors of organ system functions, duration and complications of ventilation and number and dosages of sedatives administered. All the patients that we intended to ventilate with BIPAP were successfully ventilated, we can conclude that biphasic ventilatory support suitable mode of ventilation for newborn with a decreased need of analgetics and sedatives than A/C. Finally, BIPAP is an a effective safe, and easy to use for personal mode of mechanical ventilatory support in newborn. 

  15. Influence of microstructure on low cycle fatigue in some single phase and biphasic stainless steels

    Energy Technology Data Exchange (ETDEWEB)

    Stolarz, J. [Ecole Nationale Superieure des Mines, Centre SMS, URA CNRS 1884, Saint-Etienne (France)

    2004-07-01

    This overview deals with the effects of microstructural parameters in different single phase and biphasic stainless steels on short crack behaviour and on fatigue life in the low cycle regime. The effect of the grain size is investigated in a single phase austenitic stainless steel. Under plastic strain control, the fatigue life increases when the grain size decreases. The results are discussed by analysing the distributions of crack depths as a function of the grain size. The second type of material is a metastable austenitic steel which partially transforms into martensite during LCF at temperatures between -50 C and +120 C. The grain size of the initially single phase austenitic microstructure has a combined influence on the volume fraction of martensite produced during fatigue and on the fatigue life. In this case, the grain size effect is still considerable but totally indirect because all fatigue cracks grow exclusively in the martensite. The cyclic behaviour analysis in biphasic alloys in which two phases undergo plastic deformation during LCF is considerably more complex because the conventional concept of microstructural barriers cannot be applied. The possible damage patterns in a pair of grains with different mechanical properties are discussed on the example of a solution treated and aged superduplex austenitic-ferritic stainless steel (SDSS). The hardening of one phase (ferrite) through ageing at 475 C changes the cyclic behaviour of the initial ''quasi single phase'' microstructure. Consequently, the fatigue life under plastic strain control decreases compared with the solution treated SDSS. The discussion is focussed on LCF damage mechanisms at the microstructure size scale with a particular accent put on the propagation of short cracks in the bulk. All the microstructures exhibit some common features with respect to the behaviour of short cracks. In particular a strong effect of microstructural barriers in the bulk and the

  16. Assessing composition and structure of soft biphasic media from Kelvin-Voigt fractional derivative model parameters

    Science.gov (United States)

    Zhang, Hongmei; Wang, Yue; Fatemi, Mostafa; Insana, Michael F.

    2017-03-01

    Kelvin-Voigt fractional derivative (KVFD) model parameters have been used to describe viscoelastic properties of soft tissues. However, translating model parameters into a concise set of intrinsic mechanical properties related to tissue composition and structure remains challenging. This paper begins by exploring these relationships using a biphasic emulsion materials with known composition. Mechanical properties are measured by analyzing data from two indentation techniques—ramp-stress relaxation and load-unload hysteresis tests. Material composition is predictably correlated with viscoelastic model parameters. Model parameters estimated from the tests reveal that elastic modulus E 0 closely approximates the shear modulus for pure gelatin. Fractional-order parameter α and time constant τ vary monotonically with the volume fraction of the material’s fluid component. α characterizes medium fluidity and the rate of energy dissipation, and τ is a viscous time constant. Numerical simulations suggest that the viscous coefficient η is proportional to the energy lost during quasi-static force-displacement cycles, E A . The slope of E A versus η is determined by α and the applied indentation ramp time T r. Experimental measurements from phantom and ex vivo liver data show close agreement with theoretical predictions of the η -{{E}A} relation. The relative error is less than 20% for emulsions 22% for liver. We find that KVFD model parameters form a concise features space for biphasic medium characterization that described time-varying mechanical properties. The experimental work was carried out at the Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA. Methodological development, including numerical simulation and all data analysis, were carried out at the school of Life Science and Technology, Xi’an JiaoTong University, 710049, China.

  17. New technetium-99m generator technologies utilizing polyethylene glycol-based aqueous biphasic systems

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, R.D.; Bond, A.H.; Zhang, Jianhua [Northern Illinois Univ., De Kalb, IL (United States). Dept. of Chemistry; Horwitz, P. [Argonne National Lab., IL (United States)

    1995-12-31

    Two new schemes for TcO{sub 4}{sup {minus}}/MoO{sub 4}{sup 2{minus}} separations from OH{sup {minus}} and MoO{sub 4}{sup 2{minus}} media using polyethylene glycol (PEG)-based aqueous biphasic systems (ABS) have been developed. The two most important salt solutions in current {sup 99m}Tc-generator technologies, OH{sup {minus}} and MoO{sub 4}{sup 2{minus}}, also salt out PEG to form ABS. In liquid/liquid PEG- ABS, pertechnetate can be separated from molybdate with separation factors as high as 10,000. Stripping is accomplished by reduction of the TcO{sub 4}{sup {minus}} and back extraction into a salt solution. the strip solution can be the salt of an imaging agent (e.g., Na{sub 4}HEDPA) and thus may, under the appropriate conditions, be injected directly into the human body. {sup 99m}TcO{sub 4}{sup {minus}} can also be concentrated from a dilute load solution of {sup 99}MoO{sub 4}{sup 2{minus}} in NaOH using an aqueous biphasic extraction chromatographic technique (ABEC). A rinse with K{sub 2}CO{sub 3} assures that all {sup 99}MoO{sub 4}{sup 2{minus}} is removed from the column and this is confirmed by a rapid drop in {sup 99}Mo activity by the fourth free column volume (fcv) of rinse. The {sup 99m}TcO{sub 4}{sup {minus}} is then eluted with water. This chromatographic separation affords 94% of the {sup 99m}TcO{sub 4}{sup {minus}} activity in 5 fcv, with the y spectrum showing less than 2 {times} 10{sup {minus}4} of the original {sup 99}Mo activity.

  18. Sensing charges of the Ciona intestinalis voltage-sensing phosphatase.

    Science.gov (United States)

    Villalba-Galea, Carlos A; Frezza, Ludivine; Sandtner, Walter; Bezanilla, Francisco

    2013-11-01

    Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing.

  19. Developing Fast Fluorescent Protein Voltage Sensors by Optimizing FRET Interactions.

    Directory of Open Access Journals (Sweden)

    Uhna Sung

    Full Text Available FRET (Förster Resonance Energy Transfer-based protein voltage sensors can be useful for monitoring neuronal activity in vivo because the ratio of signals between the donor and acceptor pair reduces common sources of noise such as heart beat artifacts. We improved the performance of FRET based genetically encoded Fluorescent Protein (FP voltage sensors by optimizing the location of donor and acceptor FPs flanking the voltage sensitive domain of the Ciona intestinalis voltage sensitive phosphatase. First, we created 39 different "Nabi1" constructs by positioning the donor FP, UKG, at 8 different locations downstream of the voltage-sensing domain and the acceptor FP, mKO, at 6 positions upstream. Several of these combinations resulted in large voltage dependent signals and relatively fast kinetics. Nabi1 probes responded with signal size up to 11% ΔF/F for a 100 mV depolarization and fast response time constants both for signal activation (~2 ms and signal decay (~3 ms. We improved expression in neuronal cells by replacing the mKO and UKG FRET pair with Clover (donor FP and mRuby2 (acceptor FP to create Nabi2 probes. Nabi2 probes also had large signals and relatively fast time constants in HEK293 cells. In primary neuronal culture, a Nabi2 probe was able to differentiate individual action potentials at 45 Hz.

  20. The local domain wall position in ferromagnetic thin wires: simultaneous measurement of re