WorldWideScience

Sample records for biological control pathogen

  1. BIOLOGICAL CONTROL OF WEEDS BY MEANS OF PLANT PATHOGENS

    OpenAIRE

    Marija Ravlić; Renata Baličević

    2014-01-01

    Biological control is the use of live beneficial organisms and products of their metabolism in the pests control. Plant pathogens can be used for weed control in three different ways: as classical, conservation and augmentative (inoculative and inundated) biological control. Inundated biological control involves the use of bioherbicides (mycoherbicides) or artificial breeding of pathogens and application in specific stages of crops and weeds. Biological control of weeds can be used where chem...

  2. BIOLOGICAL CONTROL OF WEEDS BY MEANS OF PLANT PATHOGENS

    Directory of Open Access Journals (Sweden)

    Marija Ravlić

    2014-06-01

    Full Text Available Biological control is the use of live beneficial organisms and products of their metabolism in the pests control. Plant pathogens can be used for weed control in three different ways: as classical, conservation and augmentative (inoculative and inundated biological control. Inundated biological control involves the use of bioherbicides (mycoherbicides or artificial breeding of pathogens and application in specific stages of crops and weeds. Biological control of weeds can be used where chemical herbicides are not allowed, if resistant weed species are present or in the integrated pest management against weeds with reduced herbicides doses and other non-chemical measures, but it has certain limitations and disadvantages.

  3. Microbiome studies in the biological control of plant pathogens

    Science.gov (United States)

    Biological control of plant pathogens, although it has been a successful alternative that has allowed to select microorganisms for the generation of bioproducts and to understand multiple biological mechanisms, cannot be considered as a strategy defined only from the selection of a range of cultiva...

  4. Trichoderma-plant-pathogen interactions: advances in genetics of biological control.

    Science.gov (United States)

    Mukherjee, Mala; Mukherjee, Prasun K; Horwitz, Benjamin A; Zachow, Christin; Berg, Gabriele; Zeilinger, Susanne

    2012-12-01

    Trichoderma spp. are widely used in agriculture as biofungicides. Induction of plant defense and mycoparasitism (killing of one fungus by another) are considered to be the most important mechanisms of Trichoderma-mediated biological control. Understanding these mechanisms at the molecular level would help in developing strains with superior biocontrol properties. In this article, we review our current understanding of the genetics of interactions of Trichoderma with plants and plant pathogens.

  5. Detection and treatment of chemical weapons and/or biological pathogens

    Science.gov (United States)

    Mariella Jr., Raymond P.

    2004-09-07

    A system for detection and treatment of chemical weapons and/or biological pathogens uses a detector system, an electrostatic precipitator or scrubber, a circulation system, and a control. The precipitator or scrubber is activated in response to a signal from the detector upon the detection of chemical weapons and/or biological pathogens.

  6. Insect pathogens as biological control agents: Back to the future.

    Science.gov (United States)

    Lacey, L A; Grzywacz, D; Shapiro-Ilan, D I; Frutos, R; Brownbridge, M; Goettel, M S

    2015-11-01

    The development and use of entomopathogens as classical, conservation and augmentative biological control agents have included a number of successes and some setbacks in the past 1years. In this forum paper we present current information on development, use and future directions of insect-specific viruses, bacteria, fungi and nematodes as components of integrated pest management strategies for control of arthropod pests of crops, forests, urban habitats, and insects of medical and veterinary importance. Insect pathogenic viruses are a fruitful source of microbial control agents (MCAs), particularly for the control of lepidopteran pests. Most research is focused on the baculoviruses, important pathogens of some globally important pests for which control has become difficult due to either pesticide resistance or pressure to reduce pesticide residues. Baculoviruses are accepted as safe, readily mass produced, highly pathogenic and easily formulated and applied control agents. New baculovirus products are appearing in many countries and gaining an increased market share. However, the absence of a practical in vitro mass production system, generally higher production costs, limited post application persistence, slow rate of kill and high host specificity currently contribute to restricted use in pest control. Overcoming these limitations are key research areas for which progress could open up use of insect viruses to much larger markets. A small number of entomopathogenic bacteria have been commercially developed for control of insect pests. These include several Bacillus thuringiensis sub-species, Lysinibacillus (Bacillus) sphaericus, Paenibacillus spp. and Serratia entomophila. B. thuringiensis sub-species kurstaki is the most widely used for control of pest insects of crops and forests, and B. thuringiensis sub-species israelensis and L. sphaericus are the primary pathogens used for control of medically important pests including dipteran vectors. These pathogens

  7. Biological Control of Plant Disease Caused by Bacteria

    Directory of Open Access Journals (Sweden)

    Triwidodo Arwiyanto

    2014-07-01

    Full Text Available Bacterial diseases in plants are difficult to control. The emphasis is on preventing the spread of the bacteria rather than curing the diseased plant. Integrated management measures for bacterial plant pathogens should be applied for successfull control. Biological control is one of the control measures viz. through the use of microorganisms to suppress the growth and development of bacterial plant pathogen and ultimately reduce the possibility of disease onset. The study of biological control of bacterial plant pathogen was just began compared with of fungal plant pathogen. The ecological nature of diverse bacterial plant pathogens has led scientists to apply different approach in the investigation of its biological control. The complex process of entrance to its host plant for certain soil-borne bacterial plant pathogens need special techniques and combination of more than one biological control agent. Problem and progress in controlling bacterial plant pathogens biologically will be discussed in more detail in the paper and some commercial products of biological control agents (biopesticides will be introduced.     Penyakit tumbuhan karena bakteri sulit dikendalikan. Penekanan pengendalian adalah pada pencegahan penyebaran bakteri patogen dan bukan pada penyembuhan tanaman yang sudah sakit. Untuk suksesnya pengendalian bakteri patogen tumbuhan diperlukan cara pengelolaan yang terpadu. Pengendalian secara biologi merupakan salah satu cara pengendalian dengan menggunakan mikroorganisme untuk menekan pertumbuhan dan perkembangan bakteri patogen tumbuhan dengan tujuan akhir menurunkan kemungkinan timbulnya penyakit. Sifat ekologi bakteri patogen tumbuhan yang berbeda-beda mengharuskan pendekatan yang berbeda pula dalam pengendaliannya secara biologi. Masalah dan perkembangan dalam pengendalian bakteri patogen tumbuhan secara biologi didiskusikan secara detail dalam makalah ini.

  8. Utilization of biological control agents for the management of postharvest pathogens of tomato

    International Nuclear Information System (INIS)

    Zafar, M.U.; Ansari, S.U.

    2016-01-01

    Twenty five isolates of Trichoderma, Bacillus and Pseudomonas spp. were obtained from rhizosphere of tomato growing fields using soil dilution technique on potato dextrose agar (PDA) and nutrient agar (NA) medium. Screening of these isolates were done against Geotrichum candidum, Trichothecium roseum and Rhizopus oryzae, causal agents of sour rot, pink mold rot and Rhizopus soft rot of tomato under the laboratory conditions. One promising isolate of each Trichoderma harzianum, Bacillus spp. and Pseudomonas fluorescens from the twenty five isolates were chosen and further evaluated as potential biological control agents (BCAs) against three important postharvest pathogens of tomato. Dual culture and spore concentration assay revealed that all three isolates inhibited radial growth of G. candidum, T. roseum and R. oryzae. Tomato fruits were inoculated with 25 micro L suspension of 10/sup 8/ cfu mL-1 for T. harzianum and 10/sup 8/cfu mL-1for each Bacillus sp. and P. fluorescens. Twenty four hours later the treated fruits were inoculated with 25 micro L of 105 conidia/mL of each of three postharvest pathogens. The results showed that P. fluorescens provided good control (78.1%) of G. candidum and (82.2%) R. oryzae, while, T. harzianum proved less effective to control all three pathogens. Bacillus spp. was only effective (88.4%) against T. roseum. Hence, our results depicted that Bacillus spp. and P. fluorescens proved to be a potential antagonist of T. roseum and R. oryzae however, all the tested BCAs were not consistent in their action against three postharvest pathogens of tomato. (author)

  9. Biological Control of Bacterial Wilt in South East Asia

    OpenAIRE

    Arwiyanto, Triwidodo

    2014-01-01

    Bacterial wilt disease caused by Ralstonia solanacearum destroys many crops of different plant families in South East Asia despite many researches about the disease, and the availability of developed control method in other parts of the world. There is no chemical available for the bacterial wilt pathogen and biological control is then chosen as an alternative to save the crops. Most of the biological control studies were based on antagonism between biological control agent and the pathogen. ...

  10. Entomopathogenic fungi as biological controllers: New insights into their virulence and pathogenicity

    Directory of Open Access Journals (Sweden)

    Shahid Ali Ahmad

    2012-01-01

    Full Text Available Entomopathogenic fungi vary considerably in their mode of action and virulence. Successful infection depends primarily on the adherence and penetration ability of a fungus to the host integuments. A variety of extracellular enzymes is produced during the degradation of insect integument. The attempts to control insects have changed over time from chemicals to natural control methods. This is why the development of natural methods of insect control or biopesticides, is preferred. By the use of fungal entomopathogens, insect pests can be controlled. There is no doubt that insects have been used for many years, but their effective use in the field remains elusive. However, their additional role in nature has also been discovered. Comparison of entomopathogens with conventional chemical pesticides depends on their efficiency and cost. In addition to efficiency, there are advantages in using microbial control agents, such as human safety and other non-target organisms; pesticide residues are minimized in food and biodiversity increased in managed ecosystems. In the present review the pathogenicity and virulence of entomopathogenic fungi and their role as biological control agents using biotechnology will be discussed.

  11. Management of plant pathogens and pests using microbial biological control agents. In: Trigiano, R.N. and Ownley, B.H., editors. Plant Pathology Concepts and Laboratory Exercises

    Science.gov (United States)

    All parts of plants face continual attack by plant pathogens and insects. Some insects are vectors of pathogens. Plant pests can be controlled by a variety of methods including application of pesticides but one of the most stainable and environmentally friendly approaches is biological control. Mic...

  12. Biological Control of Bacterial Wilt in South East Asia

    Directory of Open Access Journals (Sweden)

    Triwidodo Arwiyanto

    2014-12-01

    Full Text Available Bacterial wilt disease caused by Ralstonia solanacearum destroys many crops of different plant families in South East Asia despite many researches about the disease, and the availability of developed control method in other parts of the world. There is no chemical available for the bacterial wilt pathogen and biological control is then chosen as an alternative to save the crops. Most of the biological control studies were based on antagonism between biological control agent and the pathogen. The biological control agents were intended to reduce the initial inoculum of the pathogen. The effort to minimize the initial inoculum of the pathogen by baiting with the use of hypersensitive host-plant was only reliable when conducted in the greenhouse experiments. Various microorganisms have been searched as possible biological control agents, for instance avirulent form of the pathogen, soil or rhizosphere bacteria (Bacillus spp. and fluorescent pseudomonads, actinomycetes (Streptomyces spp., yeast (Pichia uillermondii, Candida ethanolica, and a consortium of microorganisms known as effective microorganisms (EM. None of these biological control agents has been used in field application and they need further investigation in order to effectively control bacterial wilt. Opportunities and challenges in developing biological control to combat bacterial wilt are discussed in the paper. Penyakit layu bakteri yang disebabkan oleh Ralstonia solanacearum menghancurkan banyak tanaman dalam famili yang berbeda di Asia Tenggara meskipun telah banyak penelitian tentang metode pengendaliannya. Penyakit ini sulit dikendalikan karena banyaknya variabilitas patogen dan belum tersedianya sumber ketahanan yang mapan. Di samping itu, sampai saat ini belum ada bahan kimia yang tersedia untuk patogen layu bakteri ini sehingga pengendalian biologi kemudian dipilih sebagai cara alternatif untuk menyelamatkan tanaman. Sebagian besar penelitian pengendalian biologi didasarkan

  13. Effcacy of different biological control agents against major postharvest pathogens of grapes under room temperature storage conditions

    Directory of Open Access Journals (Sweden)

    Ramu SENTHIL

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 Grapes were treated post harvest with a variety of biological agents to determine their effcacy in reducing yield loss. The agents Pseudomonas, Bacillus, Trichoderma and yeast isolates were individually screened against a number of postharvest pathogens including Aspergillus carbonarius, Penicillum expansum, and Fusarium moniliforme. B. subtilis strains EPC-8 and EPCO-16 showed high mycelial growth suppression of A. carbonarius and P. expansum  in vitro. The fungal antagonist Trichoderma viride strain (Tv Tvm was the most effective, inhibiting mycelial growth by 88.8 per cent. The biological control agents were tested in pre, post and combined inoculation studies against postharvest pathogens of grapes.  In the pre inoculation, B. subtilis (EPC-8 reduced the disease incidence of A. carbonarius causing rot, T. harzianum (Th Co was effective against P. expansum, and T. viride (Tv Tvm was effective against F. moniliforme. The same trend of effectiveness was also found in the post-inoculation and combined inoculation tests.

  14. The Tick Microbiome: Why Non-pathogenic Microorganisms Matter in Tick Biology and Pathogen Transmission

    Directory of Open Access Journals (Sweden)

    Sarah I. Bonnet

    2017-06-01

    Full Text Available Ticks are among the most important vectors of pathogens affecting humans and other animals worldwide. They do not only carry pathogens however, as a diverse group of commensal and symbiotic microorganisms are also present in ticks. Unlike pathogens, their biology and their effect on ticks remain largely unexplored, and are in fact often neglected. Nonetheless, they can confer multiple detrimental, neutral, or beneficial effects to their tick hosts, and can play various roles in fitness, nutritional adaptation, development, reproduction, defense against environmental stress, and immunity. Non-pathogenic microorganisms may also play a role in driving transmission of tick-borne pathogens (TBP, with many potential implications for both human and animal health. In addition, the genetic proximity of some pathogens to mutualistic symbionts hosted by ticks is evident when studying phylogenies of several bacterial genera. The best examples are found within members of the Rickettsia, Francisella, and Coxiella genera: while in medical and veterinary research these bacteria are traditionally recognized as highly virulent vertebrate pathogens, it is now clear to evolutionary ecologists that many (if not most Coxiella, Francisella, and Rickettsia bacteria are actually non-pathogenic microorganisms exhibiting alternative lifestyles as mutualistic ticks symbionts. Consequently, ticks represent a compelling yet challenging system in which to study microbiomes and microbial interactions, and to investigate the composition, functional, and ecological implications of bacterial communities. Ultimately, deciphering the relationships between tick microorganisms as well as tick symbiont interactions will garner invaluable information, which may aid in the future development of arthropod pest and vector-borne pathogen transmission control strategies.

  15. Pythium species and isolate diversity influence inhibition by the biological control agent Streptomyces lydicus

    Science.gov (United States)

    Disease control of soilborne pathogens by biological control agents has often been inconsistent under field conditions. One factor that may contribute to this inconsistency is the variability in response among pathogen populations and/or communities to the selected biological control agent. One hund...

  16. The Genome Biology of Effector Gene Evolution in Filamentous Plant Pathogens.

    Science.gov (United States)

    Sánchez-Vallet, Andrea; Fouché, Simone; Fudal, Isabelle; Hartmann, Fanny E; Soyer, Jessica L; Tellier, Aurélien; Croll, Daniel

    2018-05-16

    Filamentous pathogens, including fungi and oomycetes, pose major threats to global food security. Crop pathogens cause damage by secreting effectors that manipulate the host to the pathogen's advantage. Genes encoding such effectors are among the most rapidly evolving genes in pathogen genomes. Here, we review how the major characteristics of the emergence, function, and regulation of effector genes are tightly linked to the genomic compartments where these genes are located in pathogen genomes. The presence of repetitive elements in these compartments is associated with elevated rates of point mutations and sequence rearrangements with a major impact on effector diversification. The expression of many effectors converges on an epigenetic control mediated by the presence of repetitive elements. Population genomics analyses showed that rapidly evolving pathogens show high rates of turnover at effector loci and display a mosaic in effector presence-absence polymorphism among strains. We conclude that effective pathogen containment strategies require a thorough understanding of the effector genome biology and the pathogen's potential for rapid adaptation. Expected final online publication date for the Annual Review of Phytopathology Volume 56 is August 25, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

  17. [An example of research on biological control: Entomophthora fungi pathogenic for aphids].

    Science.gov (United States)

    Latgé, J P; Remaudière, G; Papierok, B

    1978-01-01

    The results obtained in 15 years of research on the Entomophthorales pathogen of aphids showed the importance of the action of these fungi in the regulation of natural aphid populations and their possible use in agriculture as a biological control agent. Recent ecological studies on natural populations of aphids established the seasonal variation of the different fungal species and the diverse degrees of specificity between the species or groups of species of aphid and the various species of Entomophthora. The study of populations dynamics of an aphid species on a cultivated plant permitted the determination of the way a certain number of biotic and abiotic factors, such as temperature, humidity, thresholds of the insect population and of the infecting fungus lead to an epizootic development. If the air propagation of the disease by conidia is understood for a long time, the role of the soil as a reservoir for the infecting fungus has been demonstrated recently. Under favourable climatic conditions, the use of industrially produced resistant resting spores would allow the regulation of aphid populations in nature.

  18. IRIDOID GLYCOSIDES FROM LINARIA GENISTIFOLIA (L. MILL. IN BIOLOGICAL CONTROL OF SOIL-BORNE FUNGAL PATHOGENS OF WHEAT AND SOME STRUCTURE CONSIDERATIONS

    Directory of Open Access Journals (Sweden)

    Natalia Mashcenko

    2015-06-01

    Full Text Available Biological activity of the iridoid glycosides extract from Linaria genistifolia (L. Mill. has been investigated, namely its influence on the resistance of the winter wheat Odesschi 51 plant to the caused by the Fusarium oxysporum and Helminthosporium avenae pathogenic fungi root rot. Our results indicate that summary iridoid glycosides from this plant, containing four major known compounds: 5-O-allosylantirrinoside, antirrinoside, linarioside and 6-β-hidroxiantirride, can be successfully employed in biological control of the afore-mentioned wheat pathogens: it stimulates wheat grains germination and embryonic root growth in conditions of fungal infection. 1H and 13C NMR characteristics of 5-O-allosylantirrinoside in Py-d5 are for the first time presented. Structures of two conformers of 5-O-allosylantirrinoside in D2O and Py-d5 solutions are proposed, based on the experimental NMR evidence and molecular modelling studies.

  19. Is the efficacy of biological control against plant diseases likely to be more durable than that of chemical pesticides?

    Directory of Open Access Journals (Sweden)

    Marc eBardin

    2015-07-01

    Full Text Available The durability of a control method for plant protection is defined as the persistence of its efficacy in space and time. It depends on (i the selection pressure exerted by it on populations of plant pathogens and (ii on the capacity of these pathogens to adapt to the control method. Erosion of effectiveness of conventional plant protection methods has been widely studied in the past. For example, apparition of resistance to chemical pesticides in plant pathogens or pests has been extensively documented. The durability of biological control has often been assumed to be higher than that of chemical control. Results concerning pest management in agricultural systems have shown that this assumption may not always be justified. Resistance of various pests to one or several toxins of Bacillus thuringensis and apparition of resistance of the codling moth Cydia pomonella to the Cydia pomonella granulovirus have, for example, been described. In contrast with the situation for pests, the durability of biological control of plant diseases has hardly been studied and no scientific reports proving the loss of efficiency of biological control agents against plant pathogens in practice has been published so far. Knowledge concerning the possible erosion of effectiveness of biological control is essential to ensure a durable efficacy of biological control agents on target plant pathogens. This knowledge will result in identifying risk factors that can foster the selection of strains of plant pathogens resistant to biological control agents. It will also result in identifying types of biological control agents with lower risk of efficacy loss i.e. modes of action of biological control agents that does not favor the selection of resistant isolates in natural populations of plant pathogens. An analysis of the scientific literature was then conducted to assess the potential for plant pathogens to become resistant to biological control agents.

  20. Biological Control Strategies for Mosquito Vectors of Arboviruses.

    Science.gov (United States)

    Huang, Yan-Jang S; Higgs, Stephen; Vanlandingham, Dana L

    2017-02-10

    Historically, biological control utilizes predatory species and pathogenic microorganisms to reduce the population of mosquitoes as disease vectors. This is particularly important for the control of mosquito-borne arboviruses, which normally do not have specific antiviral therapies available. Although development of resistance is likely, the advantages of biological control are that the resources used are typically biodegradable and ecologically friendly. Over the past decade, the advancement of molecular biology has enabled optimization by the manipulation of genetic materials associated with biological control agents. Two significant advancements are the discovery of cytoplasmic incompatibility induced by Wolbachia bacteria, which has enhanced replacement programs, and the introduction of dominant lethal genes into local mosquito populations through the release of genetically modified mosquitoes. As various arboviruses continue to be significant public health threats, biological control strategies have evolved to be more diverse and become critical tools to reduce the disease burden of arboviruses.

  1. Bacterial genome engineering and synthetic biology: combating pathogens.

    Science.gov (United States)

    Krishnamurthy, Malathy; Moore, Richard T; Rajamani, Sathish; Panchal, Rekha G

    2016-11-04

    The emergence and prevalence of multidrug resistant (MDR) pathogenic bacteria poses a serious threat to human and animal health globally. Nosocomial infections and common ailments such as pneumonia, wound, urinary tract, and bloodstream infections are becoming more challenging to treat due to the rapid spread of MDR pathogenic bacteria. According to recent reports by the World Health Organization (WHO) and Centers for Disease Control and Prevention (CDC), there is an unprecedented increase in the occurrence of MDR infections worldwide. The rise in these infections has generated an economic strain worldwide, prompting the WHO to endorse a global action plan to improve awareness and understanding of antimicrobial resistance. This health crisis necessitates an immediate action to target the underlying mechanisms of drug resistance in bacteria. The advent of new bacterial genome engineering and synthetic biology (SB) tools is providing promising diagnostic and treatment plans to monitor and treat widespread recalcitrant bacterial infections. Key advances in genetic engineering approaches can successfully aid in targeting and editing pathogenic bacterial genomes for understanding and mitigating drug resistance mechanisms. In this review, we discuss the application of specific genome engineering and SB methods such as recombineering, clustered regularly interspaced short palindromic repeats (CRISPR), and bacterial cell-cell signaling mechanisms for pathogen targeting. The utility of these tools in developing antibacterial strategies such as novel antibiotic production, phage therapy, diagnostics and vaccine production to name a few, are also highlighted. The prevalent use of antibiotics and the spread of MDR bacteria raise the prospect of a post-antibiotic era, which underscores the need for developing novel therapeutics to target MDR pathogens. The development of enabling SB technologies offers promising solutions to deliver safe and effective antibacterial therapies.

  2. Biological control of ticks

    Science.gov (United States)

    Samish, M.; Ginsberg, H.; Glazer, I.; Bowman, A.S.; Nuttall, P.

    2004-01-01

    Ticks have numerous natural enemies, but only a few species have been evaluated as tick biocontrol agents (BCAs). Some laboratory results suggest that several bacteria are pathogenic to ticks, but their mode of action and their potential value as biocontrol agents remain to be determined. The most promising entomopathogenic fungi appear to be Metarhizium anisopliae and Beauveria bassiana, strains of which are already commercially available for the control of some pests. Development of effective formulations is critical for tick management. Entomopathogenic nematodes that are pathogenic to ticks can potentially control ticks, but improved formulations and selection of novel nematode strains are needed. Parasitoid wasps of the genus Ixodiphagus do not typically control ticks under natural conditions, but inundative releases show potential value. Most predators of ticks are generalists, with a limited potential for tick management (one possible exception is oxpeckers in Africa). Biological control is likely to play a substantial role in future IPM programmes for ticks because of the diversity of taxa that show high potential as tick BCAs. Considerable research is required to select appropriate strains, develop them as BCAs, establish their effectiveness, and devise production strategies to bring them to practical use.

  3. Biological Control Strategies for Mosquito Vectors of Arboviruses

    Directory of Open Access Journals (Sweden)

    Yan-Jang S. Huang

    2017-02-01

    Full Text Available Historically, biological control utilizes predatory species and pathogenic microorganisms to reduce the population of mosquitoes as disease vectors. This is particularly important for the control of mosquito-borne arboviruses, which normally do not have specific antiviral therapies available. Although development of resistance is likely, the advantages of biological control are that the resources used are typically biodegradable and ecologically friendly. Over the past decade, the advancement of molecular biology has enabled optimization by the manipulation of genetic materials associated with biological control agents. Two significant advancements are the discovery of cytoplasmic incompatibility induced by Wolbachia bacteria, which has enhanced replacement programs, and the introduction of dominant lethal genes into local mosquito populations through the release of genetically modified mosquitoes. As various arboviruses continue to be significant public health threats, biological control strategies have evolved to be more diverse and become critical tools to reduce the disease burden of arboviruses.

  4. Non- chemical methods of seed treatment for control of seed- borne pathogens on vegetables

    NARCIS (Netherlands)

    Amein, T.; Wright, S.A.I.; Wickstrom, M.; Schmitt, A.; Koch, E.; Wolf, van der J.M.; Groot, S.P.C.; Werner, S.; Jahn, M.

    2006-01-01

    The aim of EU-project "Seed Treatments for Organic Vegetable Production" (STOVE) was to evaluate non-chemical methods for control of seed-borne pathogens in organic vegetable production. Physical (hot air, hot water and electron) and biologi-cal (microorganisms and different agents of natural

  5. Funding needed for assessments of weed biological control

    Science.gov (United States)

    John L. Maron; Dean E. Pearson; Stephen M. Hovick; Walter P. Carson

    2010-01-01

    Invasive non-native plants are a serious economic and ecological problem worldwide, and major efforts are therefore devoted to reducing weed abundance in agricultural and natural settings. Effective options for reducing invasive abundance and spread are few, although one common approach is biological control - the introduction of specialist herbivores or pathogens from...

  6. Evaluation of biological control of fusarium wilt in gerbera with Trichoderma asperellum

    OpenAIRE

    Daiani Brandler; Luan Junior Divensi; Rodrigo José Tonin; Thalita Pedrozo Pilla; Ines Rezendes; Paola Mendes Milanesi

    2017-01-01

    The increase in flower cultivation in recent years has been reflecting the higher incidence of soil pathogens that can cause serious problems. This study aimed to evaluate the biological control of Fusarium wilt in gerbera with Trichoderma asperellum. The evaluated treatments were: T1) Control, only sterile substrate; T2) Substrate + Fusarium oxysporum; T3) Substrate + Fusarium oxysporum + Trichoderma asperellum; and T4) Substrate + Trichoderma asperellum. For this, the pathogen was isolated ...

  7. Biological control of livestock pests: Pathogens

    Science.gov (United States)

    Interest in biological methods for livestock and poultry pest management is largely motivated by the development of resistance to most of the available synthetic pesticides by the major pests. There also has been a marked increase in organic systems, and those that promote animal welfare by reducing...

  8. Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control.

    Science.gov (United States)

    Churchill, Alice C L

    2011-05-01

    Banana (Musa spp.) is grown throughout the tropical and subtropical regions of the world. The fruits are a key staple food in many developing countries and a source of income for subsistence farmers. Bananas are also a major, multibillion-dollar export commodity for consumption primarily in developed countries, where few banana cultivars are grown. The fungal pathogen Mycosphaerella fijiensis causes black leaf streak disease (BLSD; aka black Sigatoka leaf spot) on the majority of edible banana cultivars grown worldwide. The fact that most of these cultivars are sterile and unsuitable for the breeding of resistant lines necessitates the extensive use of fungicides as the primary means of disease control. BLSD is a significant threat to the food security of resource-poor populations who cannot afford fungicides, and increases the environmental and health hazards where large-acreage monocultures of banana (Cavendish subgroup, AAA genome) are grown for export. Mycosphaerella fijiensis M. Morelet is a sexual, heterothallic fungus having Pseudocercospora fijiensis (M. Morelet) Deighton as the anamorph stage. It is a haploid, hemibiotrophic ascomycete within the class Dothideomycetes, order Capnodiales and family Mycosphaerellaceae. Its taxonomic placement is based on DNA phylogeny, morphological analyses and cultural characteristics. Mycosphaerella fijiensis is a leaf pathogen that causes reddish-brown streaks running parallel to the leaf veins, which aggregate to form larger, dark-brown to black compound streaks. These streaks eventually form fusiform or elliptical lesions that coalesce, form a water-soaked border with a yellow halo and, eventually, merge to cause extensive leaf necrosis. The disease does not kill the plants immediately, but weakens them by decreasing the photosynthetic capacity of leaves, causing a reduction in the quantity and quality of fruit, and inducing the premature ripening of fruit harvested from infected plants. Although Musa spp. are the

  9. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen

    NARCIS (Netherlands)

    Bolton, M.D.; Thomma, B.P.H.J.; Nelson, B.D.

    2006-01-01

    Sclerotinia sclerotiorum (Lib.) de Bary is a necrotrophic fungal pathogen causing disease in a wide range of plants. This review summarizes current knowledge of mechanisms employed by the fungus to parasitize its host with emphasis on biology, physiology and molecular aspects of pathogenicity. In

  10. Augmenting Plant Immune Responses and Biological Control by Microbial Determinants

    Directory of Open Access Journals (Sweden)

    Sang Moo Lee

    2015-09-01

    Full Text Available Plant have developed sophisticated defence mechanisms against microbial pathogens. The recent accumulated information allow us to understand the nature of plant immune responses followed by recognition of microbial factors/determinants through cutting-edge genomics and multi-omics techniques. However, the practical approaches to sustain plant health using enhancement of plant immunity is yet to be fully appreciated. Here, we overviewed the general concept and representative examples on the plant immunity. The fungal, bacterial, and viral determinants that was previously reported as the triggers of plant immune responses are introduced and described as the potential protocol of biological control. Specifically, the role of chitin, glucan, lipopolysaccharides/extracellular polysaccharides, microbe/pathogen-associated molecular pattern, antibiotics, mimic-phytohormones, N-acyl homoserine lactone, harpin, vitamins, and volatile organic compounds are considered. We hope that this review stimulates scientific community and farmers to broaden their knowledge on the microbial determinant-based biological control and to apply the technology on the integrated pest management program.

  11. Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests.

    Science.gov (United States)

    Cassells, Alan C

    2012-01-01

    The ability to establish and grow plant cell, organ, and tissue cultures has been widely exploited for basic and applied research, and for the commercial production of plants (micro-propagation). Regardless of whether the application is for research or commerce, it is essential that the cultures be established in vitro free of biological contamination and be maintained as aseptic cultures during manipulation, growth, and storage. The risks from microbial contamination are spurious experimental results due to the effects of latent contaminants or losses of valuable experimental or commercial cultures. Much of the emphasis in culture contamination management historically focussed on the elimination of phytopathogens and the maintenance of cultures free from laboratory contamination by environmental bacteria, fungi (collectively referred to as "vitro pathogens", i.e. pathogens or environmental micro-organisms which cause culture losses), and micro-arthropods ("vitro pests"). Microbial contamination of plant tissue cultures is due to the high nutrient availability in the almost universally used Murashige and Skoog (Physiol Plant 15:473-497, 1962) basal medium or variants of it. In recent years, it has been shown that many plants, especially perennials, are at least locally endophytically colonized intercellularly by bacteria. The latter, and intracellular pathogenic bacteria and viruses/viroids, may pass latently into culture and be spread horizontally and vertically in cultures. Growth of some potentially cultivable endophytes may be suppressed by the high salt and sugar content of the Murashige and Skoog basal medium and suboptimal temperatures for their growth in plant tissue growth rooms. The management of contamination in tissue culture involves three stages: disease screening (syn. disease indexing) of the stock plants with disease and endophyte elimination where detected; establishment and pathogen and contaminant screening of established initial cultures

  12. Biological control agents for suppression of post-harvest diseases of potatoes: strategies on discovery and development

    Science.gov (United States)

    As used in plant pathology, the term "biological control" or its short form “biocontrol” commonly refers to the decrease in the inoculum or the disease-producing activity of a pathogen accomplished through one or more organisms, including the host plant but excluding man. Biological control of plant...

  13. Biological control of fusarium wilt of tomato by antagonist fungi and ...

    African Journals Online (AJOL)

    Biological control of Fusarium oxysporum f. sp. lycopersici (FOL) causing wilt disease of tomato was studied in vitro as well as under pot conditions. Dual culture technique showed that Aspergillus niger, Penicillium citrinum, Penicillium sp. and Trichoderma harzianum inhibited the radial colony growth of the test pathogen.

  14. The Promise of Systems Biology Approaches for Revealing Host Pathogen Interactions in Malaria

    Directory of Open Access Journals (Sweden)

    Meghan Zuck

    2017-11-01

    Full Text Available Despite global eradication efforts over the past century, malaria remains a devastating public health burden, causing almost half a million deaths annually (WHO, 2016. A detailed understanding of the mechanisms that control malaria infection has been hindered by technical challenges of studying a complex parasite life cycle in multiple hosts. While many interventions targeting the parasite have been implemented, the complex biology of Plasmodium poses a major challenge, and must be addressed to enable eradication. New approaches for elucidating key host-parasite interactions, and predicting how the parasite will respond in a variety of biological settings, could dramatically enhance the efficacy and longevity of intervention strategies. The field of systems biology has developed methodologies and principles that are well poised to meet these challenges. In this review, we focus our attention on the Liver Stage of the Plasmodium lifecycle and issue a “call to arms” for using systems biology approaches to forge a new era in malaria research. These approaches will reveal insights into the complex interplay between host and pathogen, and could ultimately lead to novel intervention strategies that contribute to malaria eradication.

  15. [Screening strains for Trichoderma spp. for strong antagonism against ginseng root pathogens and study on their biological characters].

    Science.gov (United States)

    Zhao, A-Na; Ding, Wan-Long; Zhu, Dian-Long

    2006-10-01

    To screen the Trichodenna spp. for strong antagonist against ginseng root pathogens. The biological characters of ten Trichoderma strains were compared by culturing on different media. And their antagonistic activity against Phytophthora cactorum, Cylindrocarpon destructans and Rhizoctonia solani were measured on PDA. Tv04-2 and Th3080 showed a good growth on soil solution medium and PDA, and also showed high inhibitory efficacy to the three pathogens. The two Trichoderma strains showed different growth rate under light conditions and pH. Trichoderma strains were sensitive to most fungicides used in ginseng root disease controlling, however Tv04-2 was not sensitive to the fungicide Junchong Jueba.

  16. Integrated Biological Control

    International Nuclear Information System (INIS)

    JOHNSON, A.R.

    2002-01-01

    Biological control is any activity taken to prevent, limit, clean up, or remediate potential environmental, health and safety, or workplace quality impacts from plants, animals, or microorganisms. At Hanford the principal emphasis of biological control is to prevent the transport of radioactive contamination by biological vectors (plants, animals, or microorganisms), and where necessary, control and clean up resulting contamination. Other aspects of biological control at Hanford include industrial weed control (e.g.; tumbleweeds), noxious weed control (invasive, non-native plant species), and pest control (undesirable animals such as rodents and stinging insects; and microorganisms such as molds that adversely affect the quality of the workplace environment). Biological control activities may be either preventive (apriori) or in response to existing contamination spread (aposteriori). Surveillance activities, including ground, vegetation, flying insect, and other surveys, and apriori control actions, such as herbicide spraying and placing biological barriers, are important in preventing radioactive contamination spread. If surveillance discovers that biological vectors have spread radioactive contamination, aposteriori control measures, such as fixing contamination, followed by cleanup and removal of the contamination to an approved disposal location are typical response functions. In some cases remediation following the contamination cleanup and removal is necessary. Biological control activities for industrial weeds, noxious weeds and pests have similar modes of prevention and response

  17. Host–Pathogen Interactions

    NARCIS (Netherlands)

    Smits, M.A.; Schokker, D.J.

    2011-01-01

    The outcome of an infection is determined by numerous interactions between hosts and pathogens occurring at many different biological levels, ranging from molecule to population. To develop new control strategies for infectious diseases in livestock species, appropriate methodologies are needed

  18. Control fast or control smart: When should invading pathogens be controlled?

    Directory of Open Access Journals (Sweden)

    Robin N Thompson

    2018-02-01

    Full Text Available The intuitive response to an invading pathogen is to start disease management as rapidly as possible, since this would be expected to minimise the future impacts of disease. However, since more spread data become available as an outbreak unfolds, processes underpinning pathogen transmission can almost always be characterised more precisely later in epidemics. This allows the future progression of any outbreak to be forecast more accurately, and so enables control interventions to be targeted more precisely. There is also the chance that the outbreak might die out without any intervention whatsoever, making prophylactic control unnecessary. Optimal decision-making involves continuously balancing these potential benefits of waiting against the possible costs of further spread. We introduce a generic, extensible data-driven algorithm based on parameter estimation and outbreak simulation for making decisions in real-time concerning when and how to control an invading pathogen. The Control Smart Algorithm (CSA resolves the trade-off between the competing advantages of controlling as soon as possible and controlling later when more information has become available. We show-using a generic mathematical model representing the transmission of a pathogen of agricultural animals or plants through a population of farms or fields-how the CSA allows the timing and level of deployment of vaccination or chemical control to be optimised. In particular, the algorithm outperforms simpler strategies such as intervening when the outbreak size reaches a pre-specified threshold, or controlling when the outbreak has persisted for a threshold length of time. This remains the case even if the simpler methods are fully optimised in advance. Our work highlights the potential benefits of giving careful consideration to the question of when to start disease management during emerging outbreaks, and provides a concrete framework to allow policy-makers to make this decision.

  19. Control fast or control smart: When should invading pathogens be controlled?

    Science.gov (United States)

    Thompson, Robin N; Gilligan, Christopher A; Cunniffe, Nik J

    2018-02-01

    The intuitive response to an invading pathogen is to start disease management as rapidly as possible, since this would be expected to minimise the future impacts of disease. However, since more spread data become available as an outbreak unfolds, processes underpinning pathogen transmission can almost always be characterised more precisely later in epidemics. This allows the future progression of any outbreak to be forecast more accurately, and so enables control interventions to be targeted more precisely. There is also the chance that the outbreak might die out without any intervention whatsoever, making prophylactic control unnecessary. Optimal decision-making involves continuously balancing these potential benefits of waiting against the possible costs of further spread. We introduce a generic, extensible data-driven algorithm based on parameter estimation and outbreak simulation for making decisions in real-time concerning when and how to control an invading pathogen. The Control Smart Algorithm (CSA) resolves the trade-off between the competing advantages of controlling as soon as possible and controlling later when more information has become available. We show-using a generic mathematical model representing the transmission of a pathogen of agricultural animals or plants through a population of farms or fields-how the CSA allows the timing and level of deployment of vaccination or chemical control to be optimised. In particular, the algorithm outperforms simpler strategies such as intervening when the outbreak size reaches a pre-specified threshold, or controlling when the outbreak has persisted for a threshold length of time. This remains the case even if the simpler methods are fully optimised in advance. Our work highlights the potential benefits of giving careful consideration to the question of when to start disease management during emerging outbreaks, and provides a concrete framework to allow policy-makers to make this decision.

  20. Epigenetic control of effectors in plant pathogens

    Directory of Open Access Journals (Sweden)

    Mark eGijzen

    2014-11-01

    Full Text Available Plant pathogens display impressive versatility in adapting to host immune systems. Pathogen effector proteins facilitate disease but can become avirulence (Avr factors when the host acquires discrete recognition capabilities that trigger immunity. The mechanisms that lead to changes to pathogen Avr factors that enable escape from host immunity are diverse, and include epigenetic switches that allow for reuse or recycling of effectors. This perspective outlines possibilities of how epigenetic control of Avr effector gene expression may have arisen and persisted in plant pathogens, and how it presents special problems for diagnosis and detection of specific pathogen strains or pathotypes.

  1. Stepwise screening of microorganisms for commercial use in biological control of plant pathogenic fungi and bacteria. Biological Control

    NARCIS (Netherlands)

    Köhl, J.; Postma, J.; Nicot, P.; Ruocco, M.

    2011-01-01

    The development of new biocontrol products against plant diseases requires screening of high numbers of candidate antagonists. Antagonists for commercial use have to fulfill many different requirements. Besides being active against the specific targeted plant pathogens they must be safe and

  2. Evaluation of biological control of fusarium wilt in gerbera with Trichoderma asperellum

    Directory of Open Access Journals (Sweden)

    Daiani Brandler

    2017-09-01

    Full Text Available The increase in flower cultivation in recent years has been reflecting the higher incidence of soil pathogens that can cause serious problems. This study aimed to evaluate the biological control of Fusarium wilt in gerbera with Trichoderma asperellum. The evaluated treatments were: T1 Control, only sterile substrate; T2 Substrate + Fusarium oxysporum; T3 Substrate + Fusarium oxysporum + Trichoderma asperellum; and T4 Substrate + Trichoderma asperellum. For this, the pathogen was isolated from gerbera with disease symptoms and, subsequently, it was identified according to morphological characters. Furthermore, the degree of antagonism of T. asperellum against F. oxysporum was evaluated through the culture pairing test. For greenhouse evaluations, commercial autoclaved substrate was used and infested with corn grains infected by the pathogen. Morphological identification confirmed the pathogen species as Fusarium oxysporum. In the culture pairing test, it was found that T. asperellum did not present a high degree of antagonism. The plants cultivated on substrate infested by the pathogen had no visible symptoms of wilt, but the substrate infestation with the pathogen provided lower values of fresh and dry mass of shoots and roots. The treatment with T. asperellum obtained higher values of fresh and dry mass of both shoots and roots, and also more vigorous inflorescences in relation to the plants treated with the pathogen

  3. Costs and benefits of biological control of invasive alien plants: case studies from South Africa

    CSIR Research Space (South Africa)

    Van Wilgen, BW

    2004-01-01

    Full Text Available Invasive alien species can have significant negative environmental and economic impacts. Such species are often controlled biologically by means of introducing host-specific insects or pathogens that can reduce the species' invasive potential...

  4. [Principles of management in biological infections].

    Science.gov (United States)

    Płusa, Tadeusz

    2012-11-01

    The effectiveness of the management in respiratory infection is depending on the nature of the biological pathogen and the immune status of the patient. For this reason, providing assistance to victims the organ function support, similarly as defining the pathogen and targeted antibiotic therapy should be applied. Available diagnostic tests provide rapid ability to identify the pathogen and antibiotics are able to control infection. Lack of efficacy of treatment may indicate the diversity of the pathogen than previously known and raises suspicion of biological warfare pathogen.

  5. A Systems Biology Approach to Infectious Disease Research: Innovating the Pathogen-Host Research Paradigm

    Energy Technology Data Exchange (ETDEWEB)

    Aderem, Alan; Adkins, Joshua N.; Ansong, Charles; Galagan, James; Kaiser, Shari; Korth, Marcus J.; Law, G. L.; McDermott, Jason E.; Proll, Sean; Rosenberger, Carrie; Schoolnik, Gary; Katze, Michael G.

    2011-02-01

    The 20th century was marked by extraordinary advances in our understanding of microbes and infectious disease, but pandemics remain, food and water borne illnesses are frequent, multi-drug resistant microbes are on the rise, and the needed drugs and vaccines have not been developed. The scientific approaches of the past—including the intense focus on individual genes and proteins typical of molecular biology—have not been sufficient to address these challenges. The first decade of the 21st century has seen remarkable innovations in technology and computational methods. These new tools provide nearly comprehensive views of complex biological systems and can provide a correspondingly deeper understanding of pathogen-host interactions. To take full advantage of these innovations, the National Institute of Allergy and Infectious Diseases recently initiated the Systems Biology Program for Infectious Disease Research. As participants of the Systems Biology Program we think that the time is at hand to redefine the pathogen-host research paradigm.

  6. Molecular biology of Ganoderma pathogenicity and diagnosis in coconut seedlings.

    Science.gov (United States)

    Kandan, A; Radjacommare, R; Ramanathan, A; Raguchander, T; Balasubramanian, P; Samiyappan, R

    2009-01-01

    The pathogenicity of Ganoderma boninense was tested on coconut seedlings under greenhouse conditions and infection confirmed by using immunological and molecular diagnostic tools. Desiccation of older leaves and the emergence of sporophores were observed from pathogen-inoculated seedlings, whereas a control seedling does not show any pathogenic symptoms. Mature sporophores were formed within 10-13 weeks after inoculation. Polyclonal antibodies raised against mycelial proteins of Ganoderma were used for detection of Ganoderma in infected field palm and seedlings through indirect enzyme-linked immunosorbent assay technique. We adopted dot-immunobinding assay for the detection of Ganoderma from greenhouse and field samples. Under nucleic-acid-based diagnosis, G. boninense (167 bp) was detected from artificially inoculated seedlings and infected field palms by polymerase chain reaction. Apart from these, histopathological studies also support the Ganoderma pathogenicity in coconut seedlings. The pathogenicity test and combination of all the three diagnostic methods for Ganoderma could be highly reliable, rapid, sensitive and effective screening of resistance in planting material in the future.

  7. Biological control of Botrytis gray mould on tomato cultivated in greenhouse.

    Science.gov (United States)

    Fiume, F; Fiume, G

    2006-01-01

    Research was carried out to evaluate the effectiveness of the biological control of the Botrytis gray mould, caused by Botrytis cinerea Pers., one of the most important fungal diseases of the tomato (Lycopersicon esculentum Mill.). Biological control was performed by using Trichoderma harzianum Rifai, an antagonist that is a naturally occurring fungus found on some plants and in the soil worldwide. Trichoderma spp. are fungi diffused in nearly all agricultural soils and in other environments such as decaying wood. The object of this research is to find control strategies to reduce chemical treatments that cause damage to the environment and increase the pathogen resistance, applying the biological control by using T. harzianum against B. cinerea. A commercial product containing a natural isolate of T. harzianum is trichodex (Makhteshim Chemical Works, LTD). The research was performed in laboratory and in greenhouse. In laboratory, radial growth reduction of B. cinerea, in presence of T. harzianum, was calculated in relation to the growth of the pathogen control, by using a specific formula that measures the percentage of the inhibition of the radial mycelial growth. In greenhouse, starting from the tomato fruit setting, the research was carried out comparing, by a randomized complete block experiment design, replicated four times, the following treatments:1) untreated control; 2) pyrimethanil (400 g/L of a.i.), at 200 cc/hL of c.i. (pyrimidine fungicides); 3) trichodex at 100g/hL (1 kg/ha); 4) trichodex at 200 g/hL (2 kg/ha); 5) trichodex at 400 g/hL (4 kg/ha). Before fruit setting, the plots were all treated against Botrytis gray mould with iprodione 50% (100 g/hL), procymidone 50% (100 g/hL) and switch (Novartis plant protection) at 80 g/hL. In dual culture, the inhibition of B. cinerea radial mycelial growth was 76%. No inhibition halo was observed between B. cinerea and T. harzianum colonies but, after 3 days, the pathogen colony radius resulted no more than 1

  8. Suitability of Commercial Transport Media for Biological Pathogens under Nonideal Conditions

    Directory of Open Access Journals (Sweden)

    Kyle Hubbard

    2011-01-01

    Full Text Available There is extensive data to support the use of commercial transport media as a stabilizer for known clinical samples; however, there is little information to support their use outside of controlled conditions specified by the manufacturer. Furthermore, there is no data to determine the suitability of said media for biological pathogens, specifically those of interest to the US military. This study evaluates commercial off-the-shelf (COTS transport media based on sample recovery, viability, and quality of nucleic acids and peptides for nonpathogenic strains of Bacillus anthracis, Yersinia pestis, and Venezuelan equine encephalitis virus, in addition to ricin toxin. Samples were stored in COTS, PBST, or no media at various temperatures over an extended test period. The results demonstrate that COTS media, although sufficient for the preservation of nucleic acid and proteinaceous material, are not capable of maintaining an accurate representation of biothreat agents at the time of collection.

  9. Structure, Biology, and Therapeutic Application of Toxin-Antitoxin Systems in Pathogenic Bacteria.

    Science.gov (United States)

    Lee, Ki-Young; Lee, Bong-Jin

    2016-10-22

    Bacterial toxin-antitoxin (TA) systems have received increasing attention for their diverse identities, structures, and functional implications in cell cycle arrest and survival against environmental stresses such as nutrient deficiency, antibiotic treatments, and immune system attacks. In this review, we describe the biological functions and the auto-regulatory mechanisms of six different types of TA systems, among which the type II TA system has been most extensively studied. The functions of type II toxins include mRNA/tRNA cleavage, gyrase/ribosome poison, and protein phosphorylation, which can be neutralized by their cognate antitoxins. We mainly explore the similar but divergent structures of type II TA proteins from 12 important pathogenic bacteria, including various aspects of protein-protein interactions. Accumulating knowledge about the structure-function correlation of TA systems from pathogenic bacteria has facilitated a novel strategy to develop antibiotic drugs that target specific pathogens. These molecules could increase the intrinsic activity of the toxin by artificially interfering with the intermolecular network of the TA systems.

  10. Metabolic adaptation of a human pathogen during chronic infections - a systems biology approach

    DEFF Research Database (Denmark)

    Thøgersen, Juliane Charlotte

    modeling to uncover how human pathogens adapt to the human host. Pseudomonas aeruginosa infections in cystic fibrosis patients are used as a model system for under-­‐ standing these adaptation processes. The exploratory systems biology approach facilitates identification of important phenotypes...... by classical molecular biology approaches where genes and reactions typically are investigated in a one to one relationship. This thesis is an example of how mathematical approaches and modeling can facilitate new biologi-­‐ cal understanding and provide new surprising ideas to important biological processes....... and metabolic pathways that are necessary or related to establishment of chronic infections. Archetypal analysis showed to be successful in extracting relevant phenotypes from global gene expression da-­‐ ta. Furthermore, genome-­‐scale metabolic modeling showed to be useful in connecting the genotype...

  11. IPM potentials of microbial pathogens and diseases of mites

    NARCIS (Netherlands)

    van der Geest, L.P.S.; Ciancio, A.; Mukerji, K.G.

    2010-01-01

    An overview is given of diseases in mites, caused by infectious microorganisms. Many pathogens play an important role in the regulation of natural populations of mite populations and are for this reason subject of research on the feasibility to develop such pathogens to biological control agents.

  12. [Biosafety provision on handling pathogenic biological agents on the concept of biorisk assessment and management].

    Science.gov (United States)

    Dobrokhotskiĭ, O N; Kolombet, L V

    2010-01-01

    The paper shows it urgent to realize the concept of biological risk assessment and management on handling pathogenic biological agents (PBA). It gives a number of objective reasons that impede development of a methodology to assess laboratory biological risks. A concept of continuous improvement (a process approach) is proposed for use as a biorisk management tool for biosafety assurance when handling PBA. It is demonstrated that development of international cooperation urgently requires that national concepts and standards be harmonized with international regulatory documents on biosafety assurance on handling PBA.

  13. A host-specific biological control of grape crown gall by Agrobacterium vitis strain F2/5: its regulation and population dynamics.

    Science.gov (United States)

    Kaewnum, Supaporn; Zheng, Desen; Reid, Cheryl L; Johnson, Kameka L; Gee, Jodi C; Burr, Thomas J

    2013-05-01

    Nontumorigenic Agrobacterium vitis strain F2/5 is able to prevent crown gall caused by tumorigenic A. vitis on grape but not on other plant species such as tobacco. Mutations in a quorum-sensing transcription factor, aviR, and in caseinolytic protease (clp) component genes clpA and clpP1 resulted in reduced or loss of biological control. All mutants were complemented; however, restoration of biological control by complemented clpA and clpP1 mutants was dependent on the copy number of vector that was used as well as timing of application of the complemented mutants to grape wounds in relation to inoculation with pathogen. Mutations in other quorum-sensing and clp genes and in a gene associated with polyketide synthesis did not affect biological control. It was determined that, although F2/5 inhibits transformation by tumorigenic A. vitis strains on grape, it does not affect growth of the pathogen in wounded grape tissue over time.

  14. An Overview of the Control of Bacterial Pathogens in Cattle Manure

    Directory of Open Access Journals (Sweden)

    Christy E. Manyi-Loh

    2016-08-01

    Full Text Available Cattle manure harbors microbial constituents that make it a potential source of pollution in the environment and infections in humans. Knowledge of, and microbial assessment of, manure is crucial in a bid to prevent public health and environmental hazards through the development of better management practices and policies that should govern manure handling. Physical, chemical and biological methods to reduce pathogen population in manure do exist, but are faced with challenges such as cost, odor pollution, green house gas emission, etc. Consequently, anaerobic digestion of animal manure is currently one of the most widely used treatment method that can help to salvage the above-mentioned adverse effects and in addition, produces biogas that can serve as an alternative/complementary source of energy. However, this method has to be monitored closely as it could be fraught with challenges during operation, caused by the inherent characteristics of the manure. In addition, to further reduce bacterial pathogens to a significant level, anaerobic digestion can be combined with other methods such as thermal, aerobic and physical methods. In this paper, we review the bacterial composition of cattle manure as well as methods engaged in the control of pathogenic microbes present in manure and recommendations that need to be respected and implemented in order to prevent microbial contamination of the environment, animals and humans.

  15. Effectiveness of biological control of Phytophthora capsici in pepper by Trichoderma asperellum strain T34

    Directory of Open Access Journals (Sweden)

    Guillem SEGARRA

    2013-05-01

    Full Text Available Pepper (Capsicum annuum L., one of the most widely grown vegetables worldwide, is susceptible to root rot caused by Phytophthora capsici. Many biocides have recently been banned in Europe because of human health and environmental concerns. Integrated pest management is a European priority, where biological control together with other agronomic practices should replace pesticide management of plant diseases in the future. Application of different concentrations of the fungus Trichoderma asperellum strain T34 (the in T34 Biocontrol® on incidence of disease caused by P. capsici in pepper was studied. Different methods of application of the microbial control agent and inoculation of the pathogen were examined. T34 and etridiazole (Terrazole® were compared for their ability to suppress P. capsici. T34 reduced disease in most of the assayed situations (up to 71% disease reduction, while etridiazole was effective only when applied at the same time as the pathogen. The results obtained are discussed on the basis of the different modes of action of T34 and etridiazole. T34 is a useful biological alternative to chemicals for the control of P. capsici in pepper.

  16. Biological activity of Penaeus monodon GILT in shrimp pathogen protection

    Directory of Open Access Journals (Sweden)

    Aekkaraj Nualla-ong

    2017-04-01

    Full Text Available Gamma-interferon-inducible lysosomal thiol reductase (GILT contains a CXXC active site motif that possesses thiol reductase activity by catalyzing the disulfide bond reduction of exogenous antigens. Mutating the active site of human GILT to change the cysteine residues to serine residues eliminates this property. Our previous study reported that Penaeus monodon GILT (PmGILT contained a CXXS active site motif. Therefore, we assessed the enzymatic activity of PmGILT and demonstrated that it displayed identical thiol reductase activity at an acidic pH. In addition, the biological activity of PmGILT against shrimp pathogens, including white spot syndrome virus (WSSV and Gram-negative bacteria, was investigated. The neutralization of WSSV with PmGILT indicated the inhibition of WSSV invasion into shrimp hemocyte cells. Moreover, the relative percentage survival of shrimp injected with PmGILT-treated virus solution was 75%. Finally, the antimicrobial activity of PmGILT was confirmed by the growth inhibition of Vibrio harveyi. These results establish the role of PmGILT in the inhibition of the virulence of two major shrimp pathogens.

  17. Biological insect control using Metarhizium anisopliae: morphological, molecular, and ecological aspects

    Directory of Open Access Journals (Sweden)

    Patricia Vieira Tiago

    2014-04-01

    Full Text Available Microbial control of insects is based on the rational use of pathogens to maintain environmentally balanced pest population levels, and Metarhizium anisopliae has been the most studied and most utilized fungal species for that purpose. The natural genetic variability of entomopathogenic fungi is considered one of the principal advantages of microbial insect control. The inter- and intraspecific variability and the genetic diversity and population structures of Metarhizium and other entomopathogenic fungi have been examined using ITS-RFLP, ISSR, and ISSP molecular markers. The persistence of M. anisopliae in the soil and its possible effects on the structures of resident microbial communities must be considered when selecting isolates for biological insect control.

  18. Phenotypic charactheristics of fluorescent pseudomonss, biological control agent of lincat disease of temanggung tobacco

    Directory of Open Access Journals (Sweden)

    NINING NURUL AZIZAH

    2007-04-01

    Full Text Available Fluorescent pseudomonass isolated from local plants-rishosphere in temanggung controlled lincat disease of tobacco. This report describe phenotypic charactheristics of the bacteria in order to be used as a base for the development of the bacteria as a biological control agent of lincat disease. Phenotypic charactheristics of six isolates of fluorescent Pseudomonass which controlled lincat disease in the field were determined in the laboratory of Plant Bacteriology, Faculty of Agriculture, Gadjah Mada University. Plant pathogenicity tests were conducted by hypersensitive reaction into tobacco leaf and inoculation to tobacco plants. Antagonism test between fluorescent Pseudomonass and other candidate of biological control agents were also conducted. The results indicated that the bacteria were rod shape, Gram negative, positive reaction in catalase and oxidase tests. Nitrate reduce to nitrite, arginine was hydrolysed, fluorescent pigment were produced on King’s B medium, levan formation positive and all bacteria denitrifiy. The bacteria used urea, tween 80 and amylum were not hydrolised, poly--hydroxybutyrate was not accumulated in the cells. Negative reactions were observed for lysine decarboxylation, indol production, VP/MR reaction, and gelatn liquefation. Some compounds could be used as solely carbon sources. All isolates grew on the medium containing 2% NaCl. The best pH for growth was 6-7 and all isolates grew at 20-41C. Negative result were obtained for hypersensitive reaction and pathogenicity tests.

  19. Intervention strategies for control of foodborne pathogens

    Science.gov (United States)

    Juneja, Vijay K.

    2004-03-01

    The increasing numbers of illnesses associated with foodborne pathogens such as Listeria monocytogenes and Escherichia coli O157:H7, has renewed concerns about food safety because of consumer preferences for minimally processed foods that offer convenience in availability and preparation. Accordingly, the need for better control of foodborne pathogens has been paramount in recent years. Mechanical removal of microorganisms from food can be accomplished by centrifugation, filtration, trimming and washing. Cleaning and sanitation strategies can be used for minimizing the access of microorganisms in foods from various sources. Other strategies for control of foodborne pathogens include established physical microbiocidal treatments such as ionizing radiation and heating. Research has continued to demonstrate that food irradiation is a suitable process to control and possibly eliminate foodborne pathogens, for example Listeria monocytogenes and Escherichia coli O157:H7, from a number of raw and cooked meat and poultry products. Heat treatment is the most common method in use today for the inactivation of microorganisms. Microorganisms can also be destroyed by nonthermal treatments, such as application of high hydrostatic pressure, pulsed electric fields, oscillating magnetic fields or a combination of physical processes such as heat-irradiation, or heat-high hydrostatic pressure, etc. Each of the non-thermal technologies has specific applications in terms of the types of food that can be processed. Both conventional and newly developed physical treatments can be used in combination for controlling foodborne pathogens and enhancing the safety and shelf life of foods. Recent research has focused on combining traditional preservation factors with emerging intervention technologies. However, many key issues still need to be addressed for combination preservation factors or technologies to be useful in the food industry to meet public demands for foods with enhanced safety

  20. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2009-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  1. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2010-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  2. Biological control of strawberry soil-borne pathogens Macrophomina phaseolina and Fusarium solani, using Trichoderma asperellum and Bacillus spp.

    Directory of Open Access Journals (Sweden)

    Ana María PASTRANA

    2016-05-01

    Full Text Available In south-western Spain, Macrophomina phaseolina and Fusarium solani were found to be associated in strawberry plants with, respectively, charcoal rot, and crown and root rot symptoms. For management of both fungal diseases, the antagonistic effects of two commercial formulations, one based on Trichoderma asperellum T18 strain (Prodigy® and the other on Bacillus megaterium and B. laterosporus (Fusbact®, were evaluated in vitro and under controlled environment and field conditions. Two inoculation methods (root-dipping and soil application and two application times (pre- and post-pathogen inoculation, as preventive and curative treatments, respectively were assessed. Dual plate confrontation experiments demonstrated the antagonistic effects of T. asperellum and Bacillus spp. by inhibiting radial growth of M. phaseolina and F. solani by more than 36%. Preventive application of T. asperellum by root-dipping reduced the incidence of charcoal rot (up to 44% in a growth chamber and up to 65% under field conditions and also reduced disease progression, the percentage of crown necrosis, as well as the level of infection measured as ng of pathogen DNA g-1 plant by quantitative real-time PCR. This treatment was also the most effective for reduction of crown and root rot caused by F. solani (up to 100% in a greenhouse and up to 81% under field conditions. These results were nearly comparable with the control achieved using chemical fungicides. The Bacillus spp.-based formulation was also effective for control of charcoal rot and showed variable results for control of F. solani, depending on the growth conditions.

  3. Evolutionary biology of bacterial and fungal pathogens

    National Research Council Canada - National Science Library

    Baquero, F

    2008-01-01

    ... and Evolutionary Dynamics of Pathogens * 21 Keith A. Crandall and Marcos Pérez-Losada II. Evolutionary Genetics of Microbial Pathogens 4. Environmental and Social Influences on Infectious Disea...

  4. Synthetic biology expands chemical control of microorganisms.

    Science.gov (United States)

    Ford, Tyler J; Silver, Pamela A

    2015-10-01

    The tools of synthetic biology allow researchers to change the ways engineered organisms respond to chemical stimuli. Decades of basic biology research and new efforts in computational protein and RNA design have led to the development of small molecule sensors that can be used to alter organism function. These new functions leap beyond the natural propensities of the engineered organisms. They can range from simple fluorescence or growth reporting to pathogen killing, and can involve metabolic coordination among multiple cells or organisms. Herein, we discuss how synthetic biology alters microorganisms' responses to chemical stimuli resulting in the development of microbes as toxicity sensors, disease treatments, and chemical factories. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Fungal pathogens of Miconia calvescens (Melastomataceae) from Brazil, with reference to classical biological control.

    Science.gov (United States)

    Seixas, Claudine D S; Barreto, Robert W; Killgore, Eloise

    2007-01-01

    A survey of fungal pathogens of Miconia calvescens was carried out in Brazil aimed at finding potential classical biocontrol agents for management of this invasive alien weed in Hawaii. Coccodiella miconiae, Glomerella cingulata (= Colletotrichum gloeosporioides f. sp. miconiae) and the new species Guignardia miconiae and Korunomyces prostratus were found associated with foliar diseases and are described herein. Two previously undescribed spore stages of Coccodiella miconiae also were obtained allowing a complete description of this species. Pseudocercospora tamonae associated with leaf spots of other species of Miconia also was collected and also was proven to be pathogenic to M. calvescens.

  6. Biological Control of Diseases of Vegetables Grown Hydroponically in Thailand: Challenge and Opportunity.

    Science.gov (United States)

    Kanjanamaneesathian, Mana

    2015-01-01

    In Thailand, yield loss due to plant diseases in vegetables grown hydroponically is very high as a result of the growers` lack of knowledge for controlling diseases and their un- willingness to invest in setting-up the proper hydroponic system from the beginning. Severe root rot disease caused by Pythium spp. is frequent and can be anticipated in the hot climate in Thailand. This review focuses on the diseases in temperate lettuces which have been produced hydroponically and have been attacked by plant pathogens, particularly Pythium spp. Biological control of vegetable diseases grown hydroponically has been investigated in Thailand. Research is being carried out to identify effective strains of the antagonists, formulating the applicable products and delivering them appropriately to control the disease. Products of Bacillus subtilis, Chaetomium globosom and Trichoderma harzianum have been recommended for use to control diseases in vegetables grown hydroponically. Control efficacy of these products is varied as the biological products have been used by the growers in the paradigm of using chemical fungicide for disease control in hydroponic production system, overlooking the intrinsic characteristics of the biological control products. The recent patent, which minimizes the effects of sunlight and heat on the nutrient solution without the use of an external energy for cooling the nutrient, should be applied in producing hydroponic vegetables to mitigate poor plant growth and root rot disease outbreak in Thailand.

  7. The effect of biological and chemical control agents on the health status of the very early potato cultivar Rosara

    Directory of Open Access Journals (Sweden)

    Cwalina-Ambroziak Bożena

    2015-12-01

    Full Text Available The external appearance and quality of table potatoes are determined, among other factors, by the health status of the plants during the growing season. Chemical control methods are often combined with biocontrol agents to effectively fight potato pathogens. Potatoes of the very early cultivar Rosara were grown in experimental plots. The plots were located in Tomaszkowo (NE Poland, 2007-2009. The experiment involved the following treatments: 1 biological control − mycorrhizal Glomus spp. inoculum was applied to the roots, − tubers were dressed and plants were sprayed with Polyversum three times during the growing season, 2 chemical control - at two-week intervals, plants were sprayed with the following fungicides: Infinito 687.5 SC and Tanos 50 WG, Valbon 72 WG and Tanos 50 WG. In the control treatment, potato plants were not protected against pathogens. During the growing season, the severity of late blight and early blight was evaluated on a nine-point scale. The composition of fungal communities colonising potato stems was analysed. The fungistatic properties of the fungicides used in the field experiment were evaluated in an in vitro test. The symptoms of infections caused by Phytophthora infestans and Alternaria spp. were significantly reduced in the treatment which used the integrated chemical and biological control. The least diverse fungal community was isolated from fungicide-treated plants. In the in vitro test, fungicides at all analysed concentrations inhibited the linear mycelial growth of selected pathogens.

  8. OSHA Bloodborne Pathogens Standards Exposure Control Plan

    Science.gov (United States)

    Luhrs, Caro Elise; Teitelbaum, Rita

    1993-01-01

    The Hummer Associates Exposure Control Plan is designed to reduce significant occupational exposure to bloodborne pathogens and infectious materials for Hummer Associates health care personnel. Under universal precautions, all patients and all body fluids are considered potentially infectious for bloodborne pathogens. Medical personnel need not be at increased risk if universal precautions are correctly understood and followed. This program covers all employees who could reasonably anticipate contact with blood or other potentially infectious materials during the performance of their job responsibilities. Although HIV and hepatitis B are mentioned most often, this program applies to all bloodborne diseases. The two main components needed to implement this program are universal precautions and engineering/work practice controls. This program covers all employees who may have occupational exposure to blood or other potentially infectious materials. Other aspects of this program are discussed.

  9. Seed treatments to control seedborne fungal pathogens of vegetable crops.

    Science.gov (United States)

    Mancini, Valeria; Romanazzi, Gianfranco

    2014-06-01

    Vegetable crops are frequently infected by fungal pathogens, which can include seedborne fungi. In such cases, the pathogen is already present within or on the seed surface, and can thus cause seed rot and seedling damping-off. Treatment of vegetable seeds has been shown to prevent plant disease epidemics caused by seedborne fungal pathogens. Furthermore, seed treatments can be useful in reducing the amounts of pesticides required to manage a disease, because effective seed treatments can eliminate the need for foliar application of fungicides later in the season. Although the application of fungicides is almost always effective, their non-target environmental impact and the development of pathogen resistance have led to the search for alternative methods, especially in the past few years. Physical treatments that have already been used in the past and treatments with biopesticides, such as plant extracts, natural compounds and biocontrol agents, have proved to be effective in controlling seedborne pathogens. These have been applied alone or in combination, and they are widely used owing to their broad spectrum in terms of disease control and production yield. In this review, the effectiveness of different seed treatments against the main seedborne pathogens of some important vegetable crops is critically discussed. © 2013 Society of Chemical Industry.

  10. The role of hyperparasitism in microbial pathogen ecology and evolution.

    Science.gov (United States)

    Parratt, Steven R; Laine, Anna-Liisa

    2016-08-01

    Many micro-organisms employ a parasitic lifestyle and, through their antagonistic interactions with host populations, have major impacts on human, agricultural and natural ecosystems. Most pathogens are likely to host parasites of their own, that is, hyperparasites, but how nested chains of parasites impact on disease dynamics is grossly neglected in the ecological and evolutionary literature. In this minireview we argue that the diversity and dynamics of micro-hyperparasites are an important component of natural host-pathogen systems. We use the current literature from a handful of key systems to show that observed patterns of pathogen virulence and disease dynamics may well be influenced by hyperparasites. Exploring these factors will shed light on many aspects of microbial ecology and disease biology, including resistance-virulence evolution, apparent competition, epidemiology and ecosystem stability. Considering the importance of hyperparasites in natural populations will have applied consequences for the field of biological control and therapeutic science, where hyperparastism is employed as a control mechanism but not necessarily ecologically understood.

  11. Pathogen filtration to control plant disease outbreak in greenhouse production

    Science.gov (United States)

    Jeon, Sangho; Krasnow, Charles; Bhalsod, Gemini; Granke, Leah; Harlan, Blair; Hausbeck, Mary; Zhang, Wei

    2016-04-01

    Previous research has been extensively focused on understanding the fate and transport of human microbial pathogens in soil and water environments. However, little is known about the transport of plant pathogens, although these pathogens are often found in irrigation waters and could cause severe crop damage and economical loss. Water mold pathogens including Phytophthora spp. and Pythium spp. are infective to a wide range of vegetable and floriculture crops, and they are primarily harbored in soils and disseminated through water flow. It is challenging to control these pathogens because they often quickly develop resistance to many fungicides. Therefore, this multi-scale study aimed to investigate physical removal of plant pathogens from water by filtration, thus reducing the pathogen exposure risks to crops. In column-scale experiments, we studied controlling factors on the transport and retention of Phytophthora capsici zoospores in saturated columns packed with iron oxide coated-sand and uncoated-sand under varying solution chemistry. Biflagellate zoospores were less retained than encysted zoospores, and lower solution pH and greater iron oxide content increased the retention of encysted zoospores. These results provided insights on environmental dispersal of Phytophthora zoospores in natural soils as well as on developing cost-effective engineered filtration systems for pathogen removal. Using small-scale greenhouse filtration systems, we further investigated the performance of varying filter media (i.e., granular sand, iron oxide coated ceramic porous media, and activated carbon) in mitigating disease outbreaks of Phytophthora and Pythium for greenhouse-grown squash and poinsettia, respectively, in comparison with fungicide treatment. For squash, filtration by iron oxide coated media was more effective in reducing the Phytophthora infection, comparing to sand filtration and fungicide application. For poinsettia, sand filtration performed better in controlling

  12. Selection of endophytic fungi from comfrey (Symphytum officinale L.) for in vitro biological control of the phytopathogen Sclerotinia sclerotiorum (Lib.).

    Science.gov (United States)

    Rocha, Rafaeli; da Luz, Daniela Eleutério; Engels, Cibelle; Pileggi, Sônia Alvim Veiga; de Souza Jaccoud Filho, David; Matiello, Rodrigo Rodrigues; Pileggi, Marcos

    2009-01-01

    Biological control consists of using one organism to attack another that may cause economic damage to crops. Integrated Pest Management (IPM) is a very common strategy. The white mold produced by Sclerotinia sclerotiorum (Lib.) causes considerable damage to bean crops. This fungus is a soil inhabitant, the symptoms of which are characterized by water-soaked lesions covered by a white cottony fungal growth on the soil surface and/or the host plant. Possible biological control agents taken from plants are being investigated as phytopathogen inhibitors. These are endophytic microorganisms that inhabit the intercellular spaces of vegetal tissues and are often responsible for antimicrobial production. The objective of the present study was to select endophytic fungi isolated from comfrey (Symphytum officinale L.) leaves with in vitro antagonist potential against the phytopathogenic fungus S. sclerotiorum. Twelve isolates of endophytic fungi and a pathogenic strain of S. sclerotiorum were used in the challenge method. With the aid of this method, four endophytes with the best antagonistic activity against S. sclerotiorum were selected. Pathogen growth inhibition zones were considered indicative of antibiosis. The percentages of pathogenic mycelia growth were measured both with and without the antagonist, resulting in growth reductions of 46.7% to 50.0% for S. sclerotiorum. These analyses were performed by evaluating the endophytic/pathogenic mycelia growth in mm/day over an eight-day period of antagonistic tests.

  13. Multidrug-resistant opportunistic pathogens challenging veterinary infection control.

    Science.gov (United States)

    Walther, Birgit; Tedin, Karsten; Lübke-Becker, Antina

    2017-02-01

    Although the problems associated with healthcare-associated infections (HAI) and the emergence of zoonotic and multidrug-resistant pathogens in companion animal (dogs, cats and horses) medicine have been well-known for decades, current progress with respect to practical implementation of infection control programs in veterinary clinics has been limited. Clinical outbreak events reported for methicillin-resistant Staphylooccus aureus (MRSA) and Staphylococcus pseudintermedius (MRSP), extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and multidrug-resistant (MDR) Salmonella Serovars indicate the necessity of infection control strategies for protecting animal patients at risk as well as veterinary personnel. The close bond between humans and their companion animals provides opportunities for exchange of microorganisms, including MDR pathogens. This particular aspect of the "One Health" idea requires more representative surveillance efforts and infection control strategies with respect to animal-species specific characters. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Structure and Biological Activity of Pathogen-like Synthetic Nanomedicines

    Science.gov (United States)

    Lőrincz, Orsolya; Tőke, Enikő R.; Somogyi, Eszter; Horkay, Ferenc; Chandran, Preethi; Douglas, Jack F.; Szebeni, János; Lisziewicz, Julianna

    2011-01-01

    Here we characterize the structure, stability and intracellular mode-of-action of DermaVir nanomedicine that is under clinical development for the treatment of HIV/AIDS. This nanomedicine is comprised of pathogen-like pDNA/PEIm nanoparticles (NPs) having the structure and function resembling spherical viruses that naturally evolved to deliver nucleic acids to the cells. Atomic force microscopy demonstrated spherical 100–200nm NPs with a smooth polymer surface protecting the pDNA in the core. Optical-absorption determined both the NP structural stability and biological activity relevant to their ability to escape from the endosome and release the pDNA at the nucleus. Salt, pH and temperature influence the nanomedicine shelf-life and intracellular stability. This approach facilitates the development of diverse polyplex nanomedicines where the delivered pDNA-expressed antigens induce immune responses to kill infected cells. PMID:21839051

  15. Identification of Biocontrol Agents to Control the Fungal Pathogen, Geomyces destructans, in Bats

    Science.gov (United States)

    Braunstein, S.; Cheng, T.

    2013-12-01

    The fungal pathogen Geomyces destructans (Gd) causes the disease White-nose Syndrome (WNS) in bats and is estimated to have killed millions of bats since its emergence in North America in 2006. Gd is predicted to cause the local extinction of at least three bat species if rates of decline continue unabated. Given the devastating impacts of Gd to bat populations, identifying a viable method for controlling the pathogen is pertinent for conservation of affected bat species. Our work focuses on identifying naturally-occurring skin bacteria on bats that are antagonistic to Gd that could potentially be used as a biocontrol. We cultured bacteria from skin swabs taken from wild bats (Myotis lucifugus, Eptesicus fuscus, Myotis sodalis, Perimyotis subflavus). We conducted challenge experiments to identify bacterial strains that inhibited Gd growth. Bacteria that exhibited antifungal properties were identified using 16S and gyrB markers. Our methods identified several bacteria in the Pseudomonas fluorescens complex as potential biocontrol agents. Future work will continue to test the viability of these bacteria as biocontrol agents via experimental treatments with live captive bats. The failure of previous non-biocontrol methods highlights the importance of developing these bacteria as a biologically-friendly method for controlling Gd. A bat infected with Geomyces destructans. Photo by West Virginia Division of Natural Resources Bacterial culture from the swab of a bat's wings

  16. Conservation Physiology and Conservation Pathogens: White-Nose Syndrome and Integrative Biology for Host-Pathogen Systems.

    Science.gov (United States)

    Willis, Craig K R

    2015-10-01

    Conservation physiology aims to apply an understanding of physiological mechanisms to management of imperiled species, populations, or ecosystems. One challenge for physiologists hoping to apply their expertise to conservation is connecting the mechanisms we study, often in the laboratory, with the vital rates of populations in the wild. There is growing appreciation that infectious pathogens can threaten populations and species, and represent an important issue for conservation. Conservation physiology has much to offer in terms of addressing the threat posed to some host species by infectious pathogens. At the same time, the well-developed theoretical framework of disease ecology could provide a model to help advance the application of physiology to a range of other conservation issues. Here, I use white-nose syndrome (WNS) in hibernating North American bats as an example of a conservation problem for which integrative physiological research has been a critical part of research and management. The response to WNS highlights the importance of a well-developed theoretical framework for the application of conservation physiology to a particular threat. I review what is known about physiological mechanisms associated with mortality from WNS and emphasize the value of combining a strong theoretical background with integrative physiological studies in order to connect physiological mechanisms with population processes and thereby maximize the potential benefits of conservation physiology. © The Author 2015. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  17. Utilizing Bacillus to inhibit the growth and infection by sheath blight pathogen, Rhizoctoniasolani in rice

    Science.gov (United States)

    Margani, R.; Hadiwiyono; Widadi, S.

    2018-03-01

    Rhizoctonia solani Kuhn is a common pathogen of rice. The pathogen causes sheath blight of rice. The pathogen can cause loss in the production of rice up to 45%. So far, the disease however is still poorly taken care of by the farmers and researchers, so the control measures is nearly never practiced by the farmers in the fields. It due to the unavailability of effective control method of the disease. Therefore, development to control the disease is important. Bacillus is one of popular bacteria which is effective as biological control agent of a lot of pathogens in plants, but it has not been used for control sheath blight in rice yet. The current researches were aimed to study the potential of Bacillus collected from healthy rice as candidates of biological control agent of the disease. The results showed that some isolates showed indications to inhibit significantly the growth and infection of the pathogen. We obtained at least five isolates of Bacillus collected from leaves, sheath, and stem of healthy rice fields. All of the isolates could effectively inhibit the growth of R. solani in vitro on potato dextrose medium at range 30.33-58.00%, whereas in vivo B05 isolate was the most effective in inhibiting the infection of pathogen at 30.43%. It was not significantly different (P≥0.05) to application of hexaconazol with dosage of 2 ml L-1.

  18. Microbial antagonism as a potential solution for controlling selected root pathogens of crops

    Science.gov (United States)

    Cooper, Sarah; Agnew, Linda; Pereg, Lily

    2016-04-01

    Root pathogens of crops can cause large reduction in yield, however, there is a limited range of effective methods to control such pathogens. Soilborne pathogens that infect roots often need to survive in the rhizosphere, where there is high competition from other organisms. In such hot spots of microbial activity and growth, supported by root exudates, microbes have evolved antagonistic mechanisms that give them competitive advantages in winning the limited resources. Among these mechanisms is antibiosis, with production of some significant antifungal compounds including, antibiotics, volatile organic compounds, hydrogen cyanide and lytic enzymes. Some of these mechanisms may suppress disease through controlling the growth of root pathogens. In this project we isolated various fungi and bacteria that suppress the growth of cotton pathogens in vitro. The pathogen-suppressive microbes were isolated from cotton production soils that are under different management strategies, with and without the use of organic amendments. The potential of pathogen-suppressing microbes for controlling the black root rot disease, caused by the soilborne pathogen Thielaviopsis basicola, was confirmed using soil assays. We identified isolates with potential use as inoculant for cotton production in Australia. Having isolated a diverse group of antagonistic microbes enhances the probability that some would survive well in the soil and provide an alternative approach to address the problem of root disease affecting agricultural crops.

  19. Review of Pasteuria penetrans: Biology, Ecology, and Biological Control Potential.

    Science.gov (United States)

    Chen, Z X; Dickson, D W

    1998-09-01

    Pasteuria penetrans is a mycelial, endospore-forming, bacterial parasite that has shown great potential as a biological control agent of root-knot nematodes. Considerable progress has been made during the last 10 years in understanding its biology and importance as an agent capable of effectively suppressing root-knot nematodes in field soil. The objective of this review is to summarize the current knowledge of the biology, ecology, and biological control potential of P. penetrans and other Pasteuria members. Pasteuria spp. are distributed worldwide and have been reported from 323 nematode species belonging to 116 genera of free-living, predatory, plant-parasitic, and entomopathogenic nematodes. Artificial cultivation of P. penetrans has met with limited success; large-scale production of endospores depends on in vivo cultivation. Temperature affects endospore attachment, germination, pathogenesis, and completion of the life cycle in the nematode pseudocoelom. The biological control potential of Pasteuria spp. have been demonstrated on 20 crops; host nematodes include Belonolaimus longicaudatus, Heterodera spp., Meloidogyne spp., and Xiphinema diversicaudatum. Pasteuria penetrans plays an important role in some suppressive soils. The efficacy of the bacterium as a biological control agent has been examined. Approximately 100,000 endospores/g of soil provided immediate control of the peanut root-knot nematode, whereas 1,000 and 5,000 endospores/g of soil each amplified in the host nematode and became suppressive after 3 years.

  20. Potential for Combined Biocontrol Activity against Fungal Fish and Plant Pathogens by Bacterial Isolates from a Model Aquaponic System

    Directory of Open Access Journals (Sweden)

    Ivaylo Sirakov

    2016-11-01

    Full Text Available One of the main challenges in aquaponics is disease control. One possible solution for this is biological control with organisms exerting inhibitory effects on fish and plant pathogens. The aim of this study was to examine the potential of isolating microorganisms that exert an inhibitory effect on both plant and fish pathogens from an established aquaponic system. We obtained 924 isolates on selective King’s B agar and 101 isolates on MRS agar from different compartments of a model aquaponic system and tested them for antagonism against the plant pathogen Pythium ultimum and fish pathogen Saprolegnia parasitica. Overall, 42 isolates were able to inhibit both fungi. Although not yet tested in vivo, these findings open new options for the implementation of biological control of diseases in aquaponics, where plants and fish are cultivated in the same water recirculating system.

  1. Electronic Integrated Disease Surveillance System and Pathogen Asset Control System

    Directory of Open Access Journals (Sweden)

    Tom G. Wahl

    2012-06-01

    Full Text Available Electronic Integrated Disease Surveillance System (EIDSS has been used to strengthen and support monitoring and prevention of dangerous diseases within One Health concept by integrating veterinary and human surveillance, passive and active approaches, case-based records including disease-specific clinical data based on standardised case definitions and aggregated data, laboratory data including sample tracking linked to each case and event with test results and epidemiological investigations. Information was collected and shared in secure way by different means: through the distributed nodes which are continuously synchronised amongst each other, through the web service, through the handheld devices. Electronic Integrated Disease Surveillance System provided near real time information flow that has been then disseminated to the appropriate organisations in a timely manner. It has been used for comprehensive analysis and visualisation capabilities including real time mapping of case events as these unfold enhancing decision making. Electronic Integrated Disease Surveillance System facilitated countries to comply with the IHR 2005 requirements through a data transfer module reporting diseases electronically to the World Health Organisation (WHO data center as well as establish authorised data exchange with other electronic system using Open Architecture approach. Pathogen Asset Control System (PACS has been used for accounting, management and control of biological agent stocks. Information on samples and strains of any kind throughout their entire lifecycle has been tracked in a comprehensive and flexible solution PACS. Both systems have been used in a combination and individually. Electronic Integrated Disease Surveillance System and PACS are currently deployed in the Republics of Kazakhstan, Georgia and Azerbaijan as a part of the Cooperative Biological Engagement Program (CBEP sponsored by the US Defense Threat Reduction Agency (DTRA.

  2. Electronic integrated disease surveillance system and pathogen asset control system.

    Science.gov (United States)

    Wahl, Tom G; Burdakov, Aleksey V; Oukharov, Andrey O; Zhilokov, Azamat K

    2012-06-20

    Electronic Integrated Disease Surveillance System (EIDSS) has been used to strengthen and support monitoring and prevention of dangerous diseases within One Health concept by integrating veterinary and human surveillance, passive and active approaches, case-based records including disease-specific clinical data based on standardised case definitions and aggregated data, laboratory data including sample tracking linked to each case and event with test results and epidemiological investigations. Information was collected and shared in secure way by different means: through the distributed nodes which are continuously synchronised amongst each other, through the web service, through the handheld devices. Electronic Integrated Disease Surveillance System provided near real time information flow that has been then disseminated to the appropriate organisations in a timely manner. It has been used for comprehensive analysis and visualisation capabilities including real time mapping of case events as these unfold enhancing decision making. Electronic Integrated Disease Surveillance System facilitated countries to comply with the IHR 2005 requirements through a data transfer module reporting diseases electronically to the World Health Organisation (WHO) data center as well as establish authorised data exchange with other electronic system using Open Architecture approach. Pathogen Asset Control System (PACS) has been used for accounting, management and control of biological agent stocks. Information on samples and strains of any kind throughout their entire lifecycle has been tracked in a comprehensive and flexible solution PACS.Both systems have been used in a combination and individually. Electronic Integrated Disease Surveillance System and PACS are currently deployed in the Republics of Kazakhstan, Georgia and Azerbaijan as a part of the Cooperative Biological Engagement Program (CBEP) sponsored by the US Defense Threat Reduction Agency (DTRA).

  3. Biological control and sustainable food production

    NARCIS (Netherlands)

    Bale, J.S.; Lenteren, van J.C.; Bigler, F.

    2008-01-01

    The use of biological control for the management of pest insects pre-dates the modern pesticide era. The first major successes in biological control occurred with exotic pests controlled by natural enemy species collected from the country or area of origin of the pest (classical control).

  4. "Protected biological control"- Biological pest management in the greenhouse industry

    NARCIS (Netherlands)

    Pilkington, L.J.; Messelink, G.J.; Lenteren, van J.C.; Mottee, Le K.

    2010-01-01

    This paper briefly describes the foundations and characteristics of biological control in protected cropping and what drivers are behind adoption of this management system within this industry. Examining a brief history of biological control in greenhouses and what makes it a successful management

  5. Bacterial Genome Engineering and Synthetic Biology: Combating Pathogens

    Science.gov (United States)

    2016-11-04

    extremely high genome sequence similarity between non-pathogenic and pathogenic strains by targeting small sequence variations present in the...Microbiol 2011, 14(5):524-531. 46. Bikard D, Euler CW, Jiang W, Nussenzweig PM, Goldberg GW, Duportet X, Fischetti VA, Marraffini LA: Exploiting

  6. PCR-based identification of the pathogenic bacterium, Acaricomes phytoseiuli, in the biological control agent Phytoseiulus persimilis (Acari: Phytoseiidae)

    NARCIS (Netherlands)

    Gols, R.; Schütte, C.; Stouthamer, R.; Dicke, M.

    2007-01-01

    The predatory mite, Phytoseiulus persimilis is an important biological control agent of herbivorous spider mites. This species is also intensively used in the study of tritrophic effects of plant volatiles in interactions involving plants, herbivores, and their natural enemies. Recently, a novel

  7. Biological control of corky root in tomato.

    Science.gov (United States)

    Fiume, G; Fiume, F

    2008-01-01

    Corky root caused by Pyrenochaeta lycopersici (Schneider et Gerlach) is one of the most important soil borne fungal pathogens which develops in the soils, causing diseases in different crops. The research was carried out to evaluate the effectiveness of the biological control of corky root on tomato. Biological control was performed by using Trichoderma viride Pers. 18/17 SS, Streptomyces spp. AtB42 and Bacillus subtilis M51 PI. According to present and future regulations on the use of chemical fungicides and considering that treatments must avoids environmental pollution, the main object of this research was to find alternative strategies by using biocontrol agents against P. lycopersici that affect tomato plants. In laboratory, the effectiveness of T. viride 18/17 SS, Streptomyces spp. AtB42 and B. subtilis M51 PI to control P. lycopersici were studied. In greenhouse, the research was carried out comparing the following treatments: 1) untreated control; 2) T. viride 18/17 SS; 3) Streptomyces spp. AtB42; 4) B. subtilis M51 PI. Roots of plants of tomato H3028 Hazera were treated with the antagonist suspensions just prior of transplant. Treatments were repeated about 2 months after, with the same suspensions sprayed on the soil to the plant collar. In dual culture, the inhibition of P. lycopersici ranged up to 81.2% (caused from T. viride 18/17 SS), 75.6% (from Streptomyces spp. AtB42) and 66.8% (from B. subtilis M51 PI). In greenhouse trials, with regard to corky root symptoms, all treated plots showed signifycative differences compared to untreated. T. viride gave the better results followed by Streptomyces spp. and then by B. subtilis. The fungus antagonist showed good root surface competence such as demonstrated its persistence on the roots surface of the tomato plants whose roots were treated with T. viride 18/17 SS up to 2 months before.

  8. A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

    Science.gov (United States)

    Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

    2015-04-24

    disease that has become an important public health problem. Traditional serological methods are the gold standard for the detection of pathogenic strains of Leptospira. However, serological procedures are cumbersome, require more complex experimental techniques, and are based on a large number of international and domestic reference strains. Additionally, these experiments involve the immunization of animals with antigens from different serotypes to produce immune serum, and improper techniques may result in a rapid decrease in antibody titer, which would affect the final results. It is difficult to perform cumbersome detection procedures in a basic laboratory. Therefore, the use of conventional serological methods is limited, which significantly impacts daily leptospirosis epidemic surveillance, prevention, and control. Molecular biology methods, such as 16S rRNA and PCR-based methods, can be used to identify the pathogenic Leptospira. However, DNA extraction and gene sequencing methods are laborious and time consuming. Therefore, more rapid and reliable high-throughput identification methods are urgently needed for the clinical diagnosis of leptospirosis to improve epidemic control. Here, molecular fingerprinting technique was use to identify the pathogenicity. We constructed the reference spectra database and the super reference spectra of pathogenic and non-pathogenic Leptospira, which can rapidly identified Leptospira at the species level and the pathogenicity of these isolates can be simultaneously confirmed. Furthermore, the protein components of Leptospira pathogenicity were revealed. These findings thus provide a new way for Leptospira pathogenicity identification. Copyright © 2014. Published by Elsevier B.V.

  9. Exotic biological control agents

    NARCIS (Netherlands)

    Hajek, Ann E.; Hurley, Brett P.; Kenis, Marc; Garnas, Jeffrey R.; Bush, Samantha J.; Wingfield, Michael J.; Lenteren, van Joop C.; Cock, Matthew J.W.

    2016-01-01

    Biological control is a valuable and effective strategy for controlling arthropod pests and has been used extensively against invasive arthropods. As one approach for control of invasives, exotic natural enemies from the native range of a pest are introduced to areas where control is needed.

  10. Biological Control in Brazil: an overview

    OpenAIRE

    Parra,José Roberto Postali

    2014-01-01

    The use of Biological Control methods is on the increase, mainly as a result of the mobilization of human resources in entomology studies since the establishment of graduate programs in this country in the 1960s. This review approaches the retrospective of Biological Control in Brazil in recent decades, with an emphasis on the "culture of applying agrochemicals" adopted by Brazilian growers, which constrains progress in this area. Successful cases of Biological Control have been reported on i...

  11. The infection biology of Sphaerulina musiva: clues to understanding a forest pathogen.

    Directory of Open Access Journals (Sweden)

    Ruqian Qin

    Full Text Available Trees in the genus Populus and their interspecific hybrids are used across North America for fiber production and as a potential source of biofuel. Plantations of these species are severely impacted by a fungal pathogen, Sphaerulina musiva, the cause of leaf spot and stem canker. An inoculation protocol that does not rely on stem wounding to achieve infection was recently developed. Using this protocol two experiments were conducted to examine infection biology and disease development in the S. musiva-Populus interaction. In the first experiment non-wounded stems of one moderately resistant clone (NM6 and one susceptible clone (NC11505 were inoculated and examined by scanning electron microscopy at six different times (6 h, 12 h, 24 h, 72 h, 1 week, and 3 weeks post-inoculation. The images indicate that the pathogen appears to enter host tissue through small openings and lenticels and that there are no significant differences in the penetration rate between the moderately resistant (NM6 and susceptible (NC11505 clones at 12 h post-inoculation. In a second experiment a histological comparison of stem cankers for resistant clone DN74 and susceptible clone NC11505 were conducted at three time points (3 weeks, 5 weeks, and 7 weeks post-inoculation. Distinct differences in disease development were apparent between the resistant and susceptible clones at each time point, with the susceptible clone exhibiting a weak and delayed defense response. These results suggest, that following penetration, the pathogen may be able to interfere with the defense response in the susceptible host.

  12. Meat products: main pathogens and non-thermal control strategies

    Directory of Open Access Journals (Sweden)

    Norma Heredia

    2014-12-01

    Full Text Available Meat is a rich nutrient matrix that allows the proper environment for diverse microorganisms’ proliferation, deteriorative and pathogen. E. coli O157 and non-O157, Salmonella spp. and Listeria monocytogenes are among the pathogen ones. On other hand, the growing demand for “fresh-like” products with high sanitary, organoleptic and nutritional quality had drive the development of alternative technologies to traditional or thermal, to satisfy consumers’ demand. In the last decades new food preservation techniques with no effect on nutritional or organoleptic characteristics had been developed, maintaining or improving microbiological stability and quality. This work is review of the most common pathogen microorganisms in meat and meat products, and the emerging technologies like high hydrostatic pressure, radiation, intelligent and active packages, and the use of natutal compounds for their control.

  13. Biological stability of drinking water: controlling factors, methods and challenges

    Directory of Open Access Journals (Sweden)

    Emmanuelle ePrest

    2016-02-01

    Full Text Available Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g. development of opportunistic pathogens, aesthetic (e.g. deterioration of taste, odour, colour or operational (e.g. fouling or biocorrosion of pipes problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors such as (i type and concentration of available organic and inorganic nutrients, (ii type and concentration of residual disinfectant, (iii presence of predators such as protozoa and invertebrates, (iv environmental conditions such as water temperature, and (v spatial location of microorganisms (bulk water, sediment or biofilm. Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i existing knowledge on biological stability controlling factors and (ii how these factors are affected by drinking water production and distribution conditions. In addition, (iii the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discuss how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order to

  14. Biological Stability of Drinking Water: Controlling Factors, Methods, and Challenges

    Science.gov (United States)

    Prest, Emmanuelle I.; Hammes, Frederik; van Loosdrecht, Mark C. M.; Vrouwenvelder, Johannes S.

    2016-01-01

    Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g., development of opportunistic pathogens), aesthetic (e.g., deterioration of taste, odor, color) or operational (e.g., fouling or biocorrosion of pipes) problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors, such as (i) type and concentration of available organic and inorganic nutrients, (ii) type and concentration of residual disinfectant, (iii) presence of predators, such as protozoa and invertebrates, (iv) environmental conditions, such as water temperature, and (v) spatial location of microorganisms (bulk water, sediment, or biofilm). Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability) in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i) existing knowledge on biological stability controlling factors and (ii) how these factors are affected by drinking water production and distribution conditions. In addition, (iii) the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discussed, how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order

  15. Biological Stability of Drinking Water: Controlling Factors, Methods, and Challenges

    KAUST Repository

    Prest, Emmanuelle I.

    2016-02-01

    Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g., development of opportunistic pathogens), aesthetic (e.g., deterioration of taste, odor, color) or operational (e.g., fouling or biocorrosion of pipes) problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors, such as (i) type and concentration of available organic and inorganic nutrients, (ii) type and concentration of residual disinfectant, (iii) presence of predators, such as protozoa and invertebrates, (iv) environmental conditions, such as water temperature, and (v) spatial location of microorganisms (bulk water, sediment, or biofilm). Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability) in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i) existing knowledge on biological stability controlling factors and (ii) how these factors are affected by drinking water production and distribution conditions. In addition, (iii) the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discussed, how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order

  16. Effect of Producing Different Phenazines on Bacterial Fitness and Biological Control in Pseudomonas chlororaphis 30-84

    Directory of Open Access Journals (Sweden)

    Jun Myoung Yu

    2018-02-01

    Full Text Available Pseudomonas chlororaphis 30-84 is a biological control agent selected for its ability to suppress diseases caused by fungal pathogens. P. chlororaphis 30-84 produces three phenazines: phenazine-1-carboxylic acid (PCA, 2-hydroxy-phenazine-1-carboxylic acid (2OHPCA and a small amount of 2-hydroxy-phenazine (2OHPHZ, and these are required for fungal pathogen inhibition and wheat rhizosphere competence. The two, 2-hydroxy derivatives are produced from PCA via the activity of a phenazine-modifying enzyme encoded by phzO. In addition to the seven biosynthetic genes responsible for the production of PCA, many other Pseudomonas strains possess one or more modifying genes, which encode enzymes that act independently or together to convert PCA into other phenazine derivatives. In order to understand the fitness effects of producing different phenazines, we constructed isogenic derivatives of P. chlororaphis 30-84 that differed only in the type of phenazines produced. Altering the type of phenazines produced by P. chlororaphis 30-84 enhanced the spectrum of fungal pathogens inhibited and altered the degree of take-all disease suppression. These strains also differed in their ability to promote extracellular DNA release, which may contribute to the observed differences in the amount of biofilm produced. All derivatives were equally important for survival over repeated plant/harvest cycles, indicating that the type of phenazines produced is less important for persistence in the wheat rhizosphere than whether or not cells produce phenazines. These findings provide a better understanding of the effects of different phenazines on functions important for biological control activity with implications for applications that rely on introduced or native phenazine producing populations.

  17. Is Vector Control Sufficient to Limit Pathogen Spread in Vineyards?

    Science.gov (United States)

    Daugherty, M P; O'Neill, S; Byrne, F; Zeilinger, A

    2015-06-01

    Vector control is widely viewed as an integral part of disease management. Yet epidemiological theory suggests that the effectiveness of control programs at limiting pathogen spread depends on a variety of intrinsic and extrinsic aspects of a pathosystem. Moreover, control programs rarely evaluate whether reductions in vector density or activity translate into reduced disease prevalence. In areas of California invaded by the glassy-winged sharpshooter (Homalodisca vitripennis Germar), Pierce's disease management relies heavily on chemical control of this vector, primarily via systemic conventional insecticides (i.e., imidacloprid). But, data are lacking that attribute reduced vector pressure and pathogen spread to sharpshooter control. We surveyed 34 vineyards over successive years to assess the epidemiological value of within-vineyard chemical control. The results showed that imidacloprid reduced vector pressure without clear nontarget effects or secondary pest outbreaks. Effects on disease prevalence were more nuanced. Treatment history over the preceding 5 yr affected disease prevalence, with significantly more diseased vines in untreated compared with regularly or intermittently treated vineyards. Yet, the change in disease prevalence between years was low, with no significant effects of insecticide treatment or vector abundance. Collectively, the results suggest that within-vineyard applications of imidacloprid can reduce pathogen spread, but with benefits that may take multiple seasons to become apparent. The relatively modest effect of vector control on disease prevalence in this system may be attributable in part to the currently low regional sharpshooter population densities stemming from area-wide control, without which the need for within-vineyard vector control would be more pronounced. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Biological activity of the non-microbial fraction of kefir: antagonism against intestinal pathogens.

    Science.gov (United States)

    Iraporda, Carolina; Abatemarco Júnior, Mário; Neumann, Elisabeth; Nunes, Álvaro Cantini; Nicoli, Jacques R; Abraham, Analía G; Garrote, Graciela L

    2017-08-01

    Kefir is a fermented milk obtained by the activity of kefir grains which are composed of lactic and acetic acid bacteria, and yeasts. Many beneficial health effects have been associated with kefir consumption such as stimulation of the immune system and inhibition of pathogenic microorganisms. The biological activity of kefir may be attributed to the presence of a complex microbiota as well as the microbial metabolites that are released during fermentation. The aim of this work was to characterise the non-microbial fraction of kefir and to study its antagonism against Escherichia coli, Salmonella spp. and Bacillus cereus. During milk fermentation there was a production of organic acids, mainly lactic and acetic acid, with a consequent decrease in pH and lactose content. The non-microbial fraction of kefir added to nutrient broth at concentrations above 75% v/v induced a complete inhibition of pathogenic growth that could be ascribed to the presence of un-dissociated lactic acid. In vitro assays using an intestinal epithelial cell model indicated that pre-incubation of cells with the non-microbial fraction of kefir did not modify the association/invasion of Salmonella whereas pre-incubation of Salmonella with this fraction under conditions that did not affect their viability significantly decreased the pathogen's ability to invade epithelial cells. Lactate exerted a protective effect against Salmonella in a mouse model, demonstrating the relevance of metabolites present in the non-microbial fraction of kefir produced during milk fermentation.

  19. Epigenetics of host-pathogen interactions: the road ahead and the road behind.

    Directory of Open Access Journals (Sweden)

    Elena Gómez-Díaz

    Full Text Available A growing body of evidence points towards epigenetic mechanisms being responsible for a wide range of biological phenomena, from the plasticity of plant growth and development to the nutritional control of caste determination in honeybees and the etiology of human disease (e.g., cancer. With the (partial elucidation of the molecular basis of epigenetic variation and the heritability of certain of these changes, the field of evolutionary epigenetics is flourishing. Despite this, the role of epigenetics in shaping host-pathogen interactions has received comparatively little attention. Yet there is plenty of evidence supporting the implication of epigenetic mechanisms in the modulation of the biological interaction between hosts and pathogens. The phenotypic plasticity of many key parasite life-history traits appears to be under epigenetic control. Moreover, pathogen-induced effects in host phenotype may have transgenerational consequences, and the bases of these changes and their heritability probably have an epigenetic component. The significance of epigenetic modifications may, however, go beyond providing a mechanistic basis for host and pathogen plasticity. Epigenetic epidemiology has recently emerged as a promising area for future research on infectious diseases. In addition, the incorporation of epigenetic inheritance and epigenetic plasticity mechanisms to evolutionary models and empirical studies of host-pathogen interactions will provide new insights into the evolution and coevolution of these associations. Here, we review the evidence available for the role epigenetics on host-pathogen interactions, and the utility and versatility of the epigenetic technologies available that can be cross-applied to host-pathogen studies. We conclude with recommendations and directions for future research on the burgeoning field of epigenetics as applied to host-pathogen interactions.

  20. Biological control of the cucurbit powdery mildew pathogen Podosphaera xanthii by means of the epiphytic fungus Pseudozyma aphidis and parasitism as a mode of action

    Directory of Open Access Journals (Sweden)

    Aviva eGafni

    2015-03-01

    Full Text Available Epiphytic yeasts, which colonize plant surfaces, may possess activity that can be harnessed to help plants defend themselves against various pathogens. Due to their unique characteristics, epiphytic yeasts belonging to the genus Pseudozyma hold great potential for use as biocontrol agents. We identified a unique, biologically active isolate of the epiphytic yeast Pseudozyma aphidis that is capable of inhibiting Botrytis cinerea via a dual mode of action, namely induced resistance and antibiosis. Here, we show that strain L12 of P. aphidis can reduce the severity of powdery mildew caused by Podosphaera xanthii on cucumber plants with an efficacy of 75%. Confocal and scanning electron microscopy analyses demonstrated P. aphidis proliferation on infected tissue and its production of long hyphae that parasitize the powdery mildew hyphae and spores as an ectoparasite. We also show that crude extract of P. aphidis metabolites can inhibit P. xanthii spore germination in planta. Our results suggest that in addition to its antibiosis mode of action, P. aphidis may also act as an ectoparasite on P. xanthii. These results indicate that P. aphidis strain L12 has the potential to control powdery mildew.

  1. Biological control of the cucurbit powdery mildew pathogen Podosphaera xanthii by means of the epiphytic fungus Pseudozyma aphidis and parasitism as a mode of action.

    Science.gov (United States)

    Gafni, Aviva; Calderon, Claudia E; Harris, Raviv; Buxdorf, Kobi; Dafa-Berger, Avis; Zeilinger-Reichert, Einat; Levy, Maggie

    2015-01-01

    Epiphytic yeasts, which colonize plant surfaces, may possess activity that can be harnessed to help plants defend themselves against various pathogens. Due to their unique characteristics, epiphytic yeasts belonging to the genus Pseudozyma hold great potential for use as biocontrol agents. We identified a unique, biologically active isolate of the epiphytic yeast Pseudozyma aphidis that is capable of inhibiting Botrytis cinerea via a dual mode of action, namely induced resistance and antibiosis. Here, we show that strain L12 of P. aphidis can reduce the severity of powdery mildew caused by Podosphaera xanthii on cucumber plants with an efficacy of 75%. Confocal and scanning electron microscopy analyses demonstrated P. aphidis proliferation on infected tissue and its production of long hyphae that parasitize the powdery mildew hyphae and spores as an ectoparasite. We also show that crude extract of P. aphidis metabolites can inhibit P. xanthii spore germination in planta. Our results suggest that in addition to its antibiosis as mode of action, P. aphidis may also act as an ectoparasite on P. xanthii. These results indicate that P. aphidis strain L12 has the potential to control powdery mildew.

  2. Use of nuclear techniques in biological control

    International Nuclear Information System (INIS)

    Greany, Patrick D.; Carpenter, James E.

    2000-01-01

    As pointed out by Benbrook (1996), pest management is at a crossroads, and there is a great need for new, biointensive pest management strategies. Among these approaches, biological control is a keystone. However, because of increasing concerns about the introduction of exotic natural enemies of insect pests and weeds (Howarth 1991, Delfosse 1997), the overall thrust of biological control has moved toward augmentative biological control, involving releases of established natural enemy species (Knipling 1992). This in turn has created a need to develop more cost-effective mass rearing technologies for beneficial insects. Nuclear techniques could play an especially important role in augmentative biological control, not only in facilitating mass rearing, but in several other ways, as indicated below. Recognising the potential value for use of nuclear techniques in biological control, the Insect and Pest Control Section of the Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, sponsored a Consultants' Group Meeting on this subject in April 1997. The Group produced a document entitled Use of Nuclear Techniques in Biological Control: Managing Pests, Facilitating Trade and Protecting the Environment. The consultants included the authors of this paper as well as Ernest Delfosse (at that time, with the USDA-APHIS National Biological Control Institute), Garry Hill (Intl. Institute for Biological Control), Sinthya Penn (Beneficial Insectary), and Felipe Jeronimo (USDA-APHIS PPQ, Guatemala). The remarks presented in this paper reflect the thoughts presented by these consultants and other participants at the IAEA-sponsored meeting. Several potential uses for nuclear techniques were identified by the Consultants' Group, including: 1) improvements in rearing media (either artificial diets or natural hosts/prey), 2) provision of sterilised natural prey to be used as food during shipment, to ameliorate concerns relating to the

  3. Protein Disulfide Isomerase and Host-Pathogen Interaction

    Directory of Open Access Journals (Sweden)

    Beatriz S. Stolf

    2011-01-01

    Full Text Available Reactive oxygen species (ROS production by immunological cells is known to cause damage to pathogens. Increasing evidence accumulated in the last decade has shown, however, that ROS (and redox signals functionally regulate different cellular pathways in the host-pathogen interaction. These especially affect (i pathogen entry through protein redox switches and redox modification (i.e., intra- and interdisulfide and cysteine oxidation and (ii phagocytic ROS production via Nox family NADPH oxidase enzyme and the control of phagolysosome function with key implications for antigen processing. The protein disulfide isomerase (PDI family of redox chaperones is closely involved in both processes and is also implicated in protein unfolding and trafficking across the endoplasmic reticulum (ER and towards the cytosol, a thiol-based redox locus for antigen processing. Here, we summarise examples of the cellular association of host PDI with different pathogens and explore the possible roles of pathogen PDIs in infection. A better understanding of these complex regulatory steps will provide insightful information on the redox role and coevolutional biological process, and assist the development of more specific therapeutic strategies in pathogen-mediated infections.

  4. Recasting the theory of mosquito-borne pathogen transmission dynamics and control

    Science.gov (United States)

    Smith, David L.; Perkins, T. Alex; Reiner, Robert C.; Barker, Christopher M.; Niu, Tianchan; Chaves, Luis Fernando; Ellis, Alicia M.; George, Dylan B.; Le Menach, Arnaud; Pulliam, Juliet R. C.; Bisanzio, Donal; Buckee, Caroline; Chiyaka, Christinah; Cummings, Derek A. T.; Garcia, Andres J.; Gatton, Michelle L.; Gething, Peter W.; Hartley, David M.; Johnston, Geoffrey; Klein, Eili Y.; Michael, Edwin; Lloyd, Alun L.; Pigott, David M.; Reisen, William K.; Ruktanonchai, Nick; Singh, Brajendra K.; Stoller, Jeremy; Tatem, Andrew J.; Kitron, Uriel; Godfray, H. Charles J.; Cohen, Justin M.; Hay, Simon I.; Scott, Thomas W.

    2014-01-01

    Mosquito-borne diseases pose some of the greatest challenges in public health, especially in tropical and sub-tropical regions of the world. Efforts to control these diseases have been underpinned by a theoretical framework developed for malaria by Ross and Macdonald, including models, metrics for measuring transmission, and theory of control that identifies key vulnerabilities in the transmission cycle. That framework, especially Macdonald's formula for R0 and its entomological derivative, vectorial capacity, are now used to study dynamics and design interventions for many mosquito-borne diseases. A systematic review of 388 models published between 1970 and 2010 found that the vast majority adopted the Ross–Macdonald assumption of homogeneous transmission in a well-mixed population. Studies comparing models and data question these assumptions and point to the capacity to model heterogeneous, focal transmission as the most important but relatively unexplored component in current theory. Fine-scale heterogeneity causes transmission dynamics to be nonlinear, and poses problems for modeling, epidemiology and measurement. Novel mathematical approaches show how heterogeneity arises from the biology and the landscape on which the processes of mosquito biting and pathogen transmission unfold. Emerging theory focuses attention on the ecological and social context for mosquito blood feeding, the movement of both hosts and mosquitoes, and the relevant spatial scales for measuring transmission and for modeling dynamics and control. PMID:24591453

  5. Recasting the theory of mosquito-borne pathogen transmission dynamics and control.

    Science.gov (United States)

    Smith, David L; Perkins, T Alex; Reiner, Robert C; Barker, Christopher M; Niu, Tianchan; Chaves, Luis Fernando; Ellis, Alicia M; George, Dylan B; Le Menach, Arnaud; Pulliam, Juliet R C; Bisanzio, Donal; Buckee, Caroline; Chiyaka, Christinah; Cummings, Derek A T; Garcia, Andres J; Gatton, Michelle L; Gething, Peter W; Hartley, David M; Johnston, Geoffrey; Klein, Eili Y; Michael, Edwin; Lloyd, Alun L; Pigott, David M; Reisen, William K; Ruktanonchai, Nick; Singh, Brajendra K; Stoller, Jeremy; Tatem, Andrew J; Kitron, Uriel; Godfray, H Charles J; Cohen, Justin M; Hay, Simon I; Scott, Thomas W

    2014-04-01

    Mosquito-borne diseases pose some of the greatest challenges in public health, especially in tropical and sub-tropical regions of the world. Efforts to control these diseases have been underpinned by a theoretical framework developed for malaria by Ross and Macdonald, including models, metrics for measuring transmission, and theory of control that identifies key vulnerabilities in the transmission cycle. That framework, especially Macdonald's formula for R0 and its entomological derivative, vectorial capacity, are now used to study dynamics and design interventions for many mosquito-borne diseases. A systematic review of 388 models published between 1970 and 2010 found that the vast majority adopted the Ross-Macdonald assumption of homogeneous transmission in a well-mixed population. Studies comparing models and data question these assumptions and point to the capacity to model heterogeneous, focal transmission as the most important but relatively unexplored component in current theory. Fine-scale heterogeneity causes transmission dynamics to be nonlinear, and poses problems for modeling, epidemiology and measurement. Novel mathematical approaches show how heterogeneity arises from the biology and the landscape on which the processes of mosquito biting and pathogen transmission unfold. Emerging theory focuses attention on the ecological and social context for mosquito blood feeding, the movement of both hosts and mosquitoes, and the relevant spatial scales for measuring transmission and for modeling dynamics and control.

  6. Complexity, Analysis and Control of Singular Biological Systems

    CERN Document Server

    Zhang, Qingling; Zhang, Xue

    2012-01-01

    Complexity, Analysis and Control of Singular Biological Systems follows the control of real-world biological systems at both ecological and phyisological levels concentrating on the application of now-extensively-investigated singular system theory. Much effort has recently been dedicated to the modelling and analysis of developing bioeconomic systems and the text establishes singular examples of these, showing how proper control can help to maintain sustainable economic development of biological resources. The book begins from the essentials of singular systems theory and bifurcations before tackling  the use of various forms of control in singular biological systems using examples including predator-prey relationships and viral vaccination and quarantine control. Researchers and graduate students studying the control of complex biological systems are shown how a variety of methods can be brought to bear and practitioners working with the economics of biological systems and their control will also find the ...

  7. Aspergillus alliaceus, a new potential biological control of the root parasitic weed Orobanche.

    Science.gov (United States)

    Aybeke, Mehmet; Sen, Burhan; Okten, Suzan

    2014-07-01

    During extensive surveys in fields heavily infested by broomrape in the Trakya Region-Turkey, a different new fungus, Aspergillus alliaceus, was isolated from the infected broomrape. It is aimed to investigate whether or not it is really a pathogen for Orobanche. The fungi was exposed to a greenhouse environment in order to assess its pathogenicity and virulence against Orobanche cernua. In addition, infection tests on Orobanche seeds were also performed under laboratory conditions. The fungus was subjected using two different methods, exposure to a liquid culture with conidial solution and a sclerotial solid culture with fungal mycelia. Cytological studies were carried out at light, TEM and SEM levels. The results show that the sclerotial solid culture with fungal mycelia quickly caused necrosis and was more effective than the other type. It also greatly diminished attachments, tubercles, and caused the emergence of shoots and an increase in the total shoot number of Orobanche. In addition, both when the fungi was exposed to both soil and used to contaminate sunflower seeds, its pathogenicity was more effective. Consequently, it was determined that A. alliaceus was an effective potential biological control of broomrape throughout its life cycle from dormant seed to mature plant. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Advance in the biological handling of pathogen forming sclerocios

    International Nuclear Information System (INIS)

    Avila de Moreno, L.C.E.; Velandia Mosalve, J.

    1995-01-01

    Field rehearsals in the Center of Investigations Tibaitata allowed to determine that the mushrooms Trichoderma sp., Trichogramma search. Konigui No.1, Trichoderma search Konigui No.2 and Gliocladium sp. They have antagonistic effects against Rhizoctonia solani, that which showed in low percentages of tubers affected by R. solani, when the soil was treated with the mentioned mushrooms. In the control of Sclerotinia sclerotiorum, it was determined that Trichoderma barzianum should be applied in the moment in that it is presented more than 3 days of continuous humidity in the soil; lower these conditions 14.3 percent of plants it was only observed affected by the pathogen

  9. BIOMASS PRODUCTION AND FORMULATION OF Bacillus subtilis FOR BIOLOGICAL CONTROL

    Directory of Open Access Journals (Sweden)

    Amran Muis

    2016-10-01

    Full Text Available Bacillus subtilis is a widespread bacterium found in soil, water, and air. It controls the growth of certain harmful bacteria and fungi, presumably by competing for nutrients, growth sites on plants, and by directly colonizing and attaching to fungal pathogens. When applied to seeds, it colonizes the developing root system of the plants and continues to live on the root system and provides protection throughout the growing season. The study on biomass production and formulation of B. subtilis for biological control was conducted in the laboratory of Department of Plant Pathology, College of Agriculture, University of the Philippines Los Baños (UPLB-CA, College, Laguna from May to July 2005. The objective of the study was to determine the optimum pH and a good carbon source for biomass production of B. subtilis and to develop a seed treatment formulation of B. subtilis as biological control agent. Results showed that the optimum pH for growth of B. subtilis was pH 6 (1.85 x 109 cfu/ml. In laboratory tests for biomass production using cassava flour, corn flour, rice flour, and brown sugar as carbon sources, it grew best in brown sugar plus yeast extract medium (6.8 x 108 cfu ml-1 in sterile distilled water and 7.8 x 108 cfu ml-1 in coconut water. In test for bacterial biomass carriers, talc proved to be the best in terms of number of bacteria recovered from the seeds (3.98 x 105 cfu seed-1.

  10. Integration of Plant Defense Traits with Biological Control of Arthropod Pests: Challenges and Opportunities.

    Science.gov (United States)

    Peterson, Julie A; Ode, Paul J; Oliveira-Hofman, Camila; Harwood, James D

    2016-01-01

    Crop plants exhibit a wide diversity of defensive traits and strategies to protect themselves from damage by herbivorous pests and disease. These defensive traits may be naturally occurring or artificially selected through crop breeding, including introduction via genetic engineering. While these traits can have obvious and direct impacts on herbivorous pests, many have profound effects on higher trophic levels, including the natural enemies of herbivores. Multi-trophic effects of host plant resistance have the potential to influence, both positively and negatively, biological control. Plant defense traits can influence both the numerical and functional responses of natural enemies; these interactions can be semiochemically, plant toxin-, plant nutrient-, and/or physically mediated. Case studies involving predators, parasitoids, and pathogens of crop pests will be presented and discussed. These diverse groups of natural enemies may respond differently to crop plant traits based on their own unique biology and the ecological niches they fill. Genetically modified crop plants that have been engineered to express transgenic products affecting herbivorous pests are an additional consideration. For the most part, transgenic plant incorporated protectant (PIP) traits are compatible with biological control due to their selective toxicity to targeted pests and relatively low non-target impacts, although transgenic crops may have indirect effects on higher trophic levels and arthropod communities mediated by lower host or prey number and/or quality. Host plant resistance and biological control are two of the key pillars of integrated pest management; their potential interactions, whether they are synergistic, complementary, or disruptive, are key in understanding and achieving sustainable and effective pest management.

  11. Integration of plant defense traits with biological control of arthropod pests: challenges and opportunities

    Directory of Open Access Journals (Sweden)

    Julie A Peterson

    2016-11-01

    Full Text Available Crop plants exhibit a wide diversity of defensive traits and strategies to protect themselves from damage by herbivorous pests and disease. These defensive traits may be naturally occurring or artificially selected through crop breeding, including introduction via genetic engineering. While these traits can have obvious and direct impacts on herbivorous pests, many have profound effects on higher trophic levels, including the natural enemies of herbivores. Multi-trophic effects of host plant resistance have the potential to influence, both positively and negatively, biological control. Plant defense traits can influence both the numerical and functional responses of natural enemies; these interactions can be semiochemically-, plant toxin-, plant nutrient-, and/or physically-mediated. Case studies involving predators, parasitoids, and pathogens of crop pests will be presented and discussed. These diverse groups of natural enemies may respond differently to crop plant traits based on their own unique biology and the ecological niches they fill. Genetically modified crop plants that have been engineered to express transgenic products affecting herbivorous pests are an additional consideration. For the most part, transgenic plant incorporated protectant (PIP traits are compatible with biological control due to their selective toxicity to targeted pests and relatively low non-target impacts, although transgenic crops may have indirect effects on higher trophic levels and arthropod communities mediated by lower host or prey number and/or quality. Host plant resistance and biological control are two of the key pillars of integrated pest management; their potential interactions, whether they are synergistic, complementary, or disruptive, are key in understanding and achieving sustainable and effective pest management.

  12. Conserving and enhancing biological control of nematodes.

    Science.gov (United States)

    Timper, Patricia

    2014-06-01

    Conservation biological control is the modification of the environment or existing practices to protect and enhance antagonistic organisms to reduce damage from pests. This approach to biological control has received insufficient attention compared with inundative applications of microbial antagonists to control nematodes. This review provides examples of how production practices can enhance or diminish biological control of plant-parasitic nematodes and other soilborne pests. Antagonists of nematodes can be enhanced by providing supplementary food sources such as occurs when organic amendments are applied to soil. However, some organic amendments (e.g., manures and plants containing allelopathic compounds) can also be detrimental to nematode antagonists. Plant species and genotype can strongly influence the outcome of biological control. For instance, the susceptibility of the plant to the nematode can determine the effectiveness of control; good hosts will require greater levels of suppression than poor hosts. Plant genotype can also influence the degree of rhizosphere colonization and antibiotic production by antagonists, as well the expression of induced resistance by plants. Production practices such as crop rotation, fallow periods, tillage, and pesticide applications can directly disrupt populations of antagonistic organisms. These practices can also indirectly affect antagonists by reducing their primary nematode host. One of the challenges of conservation biological control is that practices intended to protect or enhance suppression of nematodes may not be effective in all field sites because they are dependent on indigenous antagonists. Ultimately, indicators will need to be identified, such as the presence of particular antagonists, which can guide decisions on where it is practical to use conservation biological control. Antagonists can also be applied to field sites in conjunction with conservation practices to improve the consistency, efficacy, and

  13. Potensi Jamur Patogen Tumbuhan sebagai Agen Pengendali Biologi Gulma Alang-alang

    OpenAIRE

    Nugroho, Bambang; Suryani, Titik; Hadisutrisno, Bambang

    1997-01-01

    Biological control is an important component of integrated pest management, including integrated pest management on weed. One of the important biological control agents is plant pathogenic fungi. The purpose of this research is to identify potential fungi to be developed as an agent of biological control on alang-alang (Imperata cylindrica L). A survey was conducted in highland and lowland areas which were seriously infested by alang-alang to know the disease intensity and its distribution...

  14. Biological Control of Fusarium Stalk Rot of Maize Using Bacillus spp

    Directory of Open Access Journals (Sweden)

    Joon-Hee Han

    2015-12-01

    Full Text Available Maize (Zea mays L. is an economically important crop in worldwide. While the consumption of the maize is steadily increasing, the yield is decreasing due to continuous mono-cultivation and infection of soil-borne fungal pathogens such as Fusarium species. Recently, stalk rot disease in maize, caused by F. subglutinans and F. temperatum has been reported in Korea. In this study, we isolated bacterial isolates in rhizosphere soil of maize and subsequently tested for antagonistic activities against F. subglutinans and F. temperatum. A total of 1,357 bacterial strains were isolated from rhizosphere. Among them three bacterial isolates (GC02, GC07, GC08 were selected, based on antagonistic effects against Fusarium species. The isolates GC02 and GC07 were most efficient in inhibiting the mycelium growth of the pathogens. The three isolates GC02, GC07 and GC08 were identified as Bacillus methylotrophicus, B. amyloliquefaciens and B. thuringiensis using 16S rRNA sequence analysis, respectively. GC02 and GC07 bacterial suspensions were able to suppress over 80% conidial germination of the pathogens. GC02, GC07 and GC08 were capable of producing large quantities of protease enzymes, whereas the isolates GC07 and GC08 produced cellulase enzymes. The isolates GC02 and GC07 were more efficient in phosphate solubilization and siderophore production than GC08. Analysis of disease suppression revealed that GC07 was most effective in suppressing the disease development of stalk rot. It was also found that B. methylotrophicus GC02 and B. amyloliquefaciens GC07 have an ability to inhibit the growth of other plant pathogenic fungi. This study indicated B. methylotrophicus GC02 and B. amyloliquefaciens GC07 has potential for being used for the development of a biological control agent.

  15. Fumigant dosages below maximum label rate control some soilborne pathogens

    Directory of Open Access Journals (Sweden)

    Shachaf Triky-Dotan

    2016-08-01

    Full Text Available The activity of commercial soil fumigants on some key soilborne pathogens was assessed in sandy loam soil under controlled conditions. Seven soil fumigants that are registered in California or are being or have been considered for registration were used in this study: dimethyl disulfide (DMDS mixed with chloropicrin (Pic (79% DMDS and 21% Pic, Tri-Con (50% methyl bromide and 50% Pic, Midas Gold (33% methyl iodide [MI] and 67% Pic, Midas Bronze (50% MI and 50% Pic, Midas (MI, active ingredient [a.i.] 97.8%, Pic (a.i. 99% trichloronitromethane and Pic-Clor 60 (57% Pic and 37% 1,3-dichloropropene [1–3,D]. Dose-response models were calculated for pathogen mortality after 24 hours of exposure to fumigants. Overall, the tested fumigants achieved good efficacy with dosages below the maximum label rate against the tested pathogens. In this study, Pythium ultimum and citrus nematode were sensitive to all the fumigants and Verticillium dahliae was resistant. For most fumigants, California regulations restrict application rates to less than the maximum (federal label rate, meaning that it is possible that the fumigants may not control major plant pathogens. This research provides information on the effectiveness of these alternatives at these lower application rates. The results from this study will help growers optimize application rates for registered fumigants (such as Pic and 1,3-D and will help accelerate the adoption of new fumigants (such as DMDS if they are registered in California.

  16. Factors controlling pathogen destruction during anaerobic digestion of biowastes

    International Nuclear Information System (INIS)

    Smith, S.R.; Lang, N.L.; Cheung, K.H.M.; Spanoudaki, K.

    2005-01-01

    Anaerobic digestion is the principal method of stabilising biosolids from urban wastewater treatment in the UK, and it also has application for the treatment of other types of biowaste. Increasing awareness of the potential risks to human and animal health from environmental sources of pathogens has focused attention on the efficacy of waste treatment processes at destroying pathogenic microorganisms in biowastes recycled to agricultural land. The degree of disinfection achieved by a particular anaerobic digester is influenced by a variety of interacting operational variables and conditions, which can often deviate from the ideal. Experimental investigations demonstrate that Escherichia coli and Salmonella spp. are not damaged by mesophilic temperatures, whereas rapid inactivation occurs by thermophilic digestion. A hydraulic, biokinetic and thermodynamic model of pathogen inactivation during anaerobic digestion showed that a 2 log 10 reduction in E. coli (the minimum removal required for agricultural use of conventionally treated biosolids) is likely to challenge most conventional mesophilic digesters, unless strict maintenance and management practices are adopted to minimise dead zones and by-pass flow. Efficient mixing and organic matter stabilisation are the main factors controlling the rate of inactivation under mesophilic conditions and not a direct effect of temperature per se on pathogenic organisms

  17. Biological Systems Thinking for Control Engineering Design

    Directory of Open Access Journals (Sweden)

    D. J. Murray-Smith

    2004-01-01

    Full Text Available Artificial neural networks and genetic algorithms are often quoted in discussions about the contribution of biological systems thinking to engineering design. This paper reviews work on the neuromuscular system, a field in which biological systems thinking could make specific contributions to the development and design of automatic control systems for mechatronics and robotics applications. The paper suggests some specific areas in which a better understanding of this biological control system could be expected to contribute to control engineering design methods in the future. Particular emphasis is given to the nonlinear nature of elements within the neuromuscular system and to processes of neural signal processing, sensing and system adaptivity. Aspects of the biological system that are of particular significance for engineering control systems include sensor fusion, sensor redundancy and parallelism, together with advanced forms of signal processing for adaptive and learning control

  18. Synthetic Biology to Engineer Bacteriophage Genomes.

    Science.gov (United States)

    Rita Costa, Ana; Milho, Catarina; Azeredo, Joana; Pires, Diana Priscila

    2018-01-01

    Recent advances in the synthetic biology field have enabled the development of new molecular biology techniques used to build specialized bacteriophages with new functionalities. Bacteriophages have been engineered towards a wide range of applications including pathogen control and detection, targeted drug delivery, or even assembly of new materials.In this chapter, two strategies that have been successfully used to genetically engineer bacteriophage genomes are addressed: a yeast-based platform and bacteriophage recombineering of electroporated DNA.

  19. Biological control of toxic cyanobacteria

    CSIR Research Space (South Africa)

    Ndlela, L

    2016-04-01

    Full Text Available harmful algal blooms and their impacts in over 30 countries. Biological control is a method of introducing natural enemies to control an organism and has been more successful using microorganisms....

  20. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  1. Screening the Medicines for Malaria Venture Pathogen Box across Multiple Pathogens Reclassifies Starting Points for Open-Source Drug Discovery.

    Science.gov (United States)

    Duffy, Sandra; Sykes, Melissa L; Jones, Amy J; Shelper, Todd B; Simpson, Moana; Lang, Rebecca; Poulsen, Sally-Ann; Sleebs, Brad E; Avery, Vicky M

    2017-09-01

    Open-access drug discovery provides a substantial resource for diseases primarily affecting the poor and disadvantaged. The open-access Pathogen Box collection is comprised of compounds with demonstrated biological activity against specific pathogenic organisms. The supply of this resource by the Medicines for Malaria Venture has the potential to provide new chemical starting points for a number of tropical and neglected diseases, through repurposing of these compounds for use in drug discovery campaigns for these additional pathogens. We tested the Pathogen Box against kinetoplastid parasites and malaria life cycle stages in vitro Consequently, chemical starting points for malaria, human African trypanosomiasis, Chagas disease, and leishmaniasis drug discovery efforts have been identified. Inclusive of this in vitro biological evaluation, outcomes from extensive literature reviews and database searches are provided. This information encompasses commercial availability, literature reference citations, other aliases and ChEMBL number with associated biological activity, where available. The release of this new data for the Pathogen Box collection into the public domain will aid the open-source model of drug discovery. Importantly, this will provide novel chemical starting points for drug discovery and target identification in tropical disease research. Copyright © 2017 Duffy et al.

  2. A new threat to bees? Entomopathogenic nematodes used in biological pest control cause rapid mortality in Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Alexandrea Dutka

    2015-11-01

    Full Text Available There is currently a great deal of concern about population declines in pollinating insects. Many potential threats have been identified which may adversely affect the behaviour and health of both honey bees and bumble bees: these include pesticide exposure, and parasites and pathogens. Whether biological pest control agents adversely affect bees has been much less well studied: it is generally assumed that biological agents are safer for wildlife than chemical pesticides. The aim of this study was to test whether entomopathogenic nematodes sold as biological pest control products could potentially have adverse effects on the bumble bee Bombus terrestris. One product was a broad spectrum pest control agent containing both Heterorhabditis sp. and Steinernema sp., the other product was specifically for weevil control and contained only Steinernema kraussei. Both nematode products caused ≥80% mortality within the 96 h test period when bees were exposed to soil containing entomopathogenic nematodes at the recommended field concentration of 50 nematodes per cm2 soil. Of particular concern is the fact that nematodes from the broad spectrum product could proliferate in the carcasses of dead bees, and therefore potentially infect a whole bee colony or spread to the wider environment.

  3. Predators indirectly control vector-borne disease: linking predator-prey and host-pathogen models.

    Science.gov (United States)

    Moore, Sean M; Borer, Elizabeth T; Hosseini, Parviez R

    2010-01-06

    Pathogens transmitted by arthropod vectors are common in human populations, agricultural systems and natural communities. Transmission of these vector-borne pathogens depends on the population dynamics of the vector species as well as its interactions with other species within the community. In particular, predation may be sufficient to control pathogen prevalence indirectly via the vector. To examine the indirect effect of predators on vectored-pathogen dynamics, we developed a theoretical model that integrates predator-prey and host-pathogen theory. We used this model to determine whether predation can prevent pathogen persistence or alter the stability of host-pathogen dynamics. We found that, in the absence of predation, pathogen prevalence in the host increases with vector fecundity, whereas predation on the vector causes pathogen prevalence to decline, or even become extinct, with increasing vector fecundity. We also found that predation on a vector may drastically slow the initial spread of a pathogen. The predator can increase host abundance indirectly by reducing or eliminating infection in the host population. These results highlight the importance of studying interactions that, within the greater community, may alter our predictions when studying disease dynamics. From an applied perspective, these results also suggest situations where an introduced predator or the natural enemies of a vector may slow the rate of spread of an emerging vector-borne pathogen.

  4. Insecticides and Biological Control

    Science.gov (United States)

    Furness, G. O.

    1972-01-01

    Use of insecticides has been questioned due to their harmful effects on edible items. Biological control of insects along with other effective practices for checking spread of parasites on crops are discussed. (PS)

  5. Will the Convention on Biological Diversity put an end to biological control?

    NARCIS (Netherlands)

    Lenteren, van J.C.; Cock, M.J.W.; Brodeur, J.; Barratt, B.I.P.; Bigler, F.; Bolckmans, K.; Haas, F.; Mason, P.G.; Parra, J.R.P.

    2011-01-01

    Will the Convention on Biological Diversity put an end to biological control? Under the Convention on Biological Diversity countries have sovereign rights over their genetic resources. Agreements governing the access to these resources and the sharing of the benefits arising from their use need to

  6. Vibriophages and Their Interactions with the Fish Pathogen Vibrio anguillarum

    DEFF Research Database (Denmark)

    Tan, Demeng; Gram, Lone; Middelboe, Mathias

    2014-01-01

    Vibrio anguillarum is an important pathogen in aquaculture, responsible for the disease vibriosis in many fish and invertebrate species. Disease control by antibiotics is a concern due to potential development and spread of antibiotic resistance. The use of bacteriophages to control the pathogen...... patterns of the individual host isolates, key phenotypic properties related to phage susceptibility are distributed worldwide and maintained in the global Vibrio community for decades. The phage susceptibility pattern of the isolates did not show any relation to the physiological relationships obtained...... from Biolog GN2 profiles, demonstrating that similar phage susceptibility patterns occur across broad phylogenetic and physiological differences in Vibrio strains. Subsequent culture experiments with two phages and two V. anguillarum hosts demonstrated an initial strong lytic potential of the phages...

  7. Recommendations for control of pathogens and infectious diseases in fish research facilities

    Science.gov (United States)

    Kent, M.L.; Feist, S.W.; Harper, C.; Hoogstraten-Miller, S.; Law, J.M.; Sanchez-Morgado, J. M.; Tanguay, R.L.; Sanders, G.E.; Spitsbergen, J.M.; Whipps, Christopher M.

    2009-01-01

    Concerns about infectious diseases in fish used for research have risen along with the dramatic increase in the use of fish as models in biomedical research. In addition to acute diseases causing severe morbidity and mortality, underlying chronic conditions that cause low-grade or subclinical infections may confound research results. Here we present recommendations and strategies to avoid or minimize the impacts of infectious agents in fishes maintained in the research setting. There are distinct differences in strategies for control of pathogens in fish used for research compared to fishes reared as pets or in aquaculture. Also, much can be learned from strategies and protocols for control of diseases in rodents used in research, but there are differences. This is due, in part, the unique aquatic environment that is modified by the source and quality of the water provided and the design of facilities. The process of control of pathogens and infectious diseases in fish research facilities is relatively new, and will be an evolving process over time. Nevertheless, the goal of documenting, detecting, and excluding pathogens in fish is just as important as in mammalian research models.

  8. Bacteriophages in the control of pathogenic vibrios

    DEFF Research Database (Denmark)

    Plaza, Nicolás; Castillo Bermúdez, Daniel Elías; Perez-Reytor, Diliana

    2018-01-01

    constitute a continuing threat for aquaculture. Moreover, the continuous use of antibiotics has been accompanied by an emergence of antibiotic resistance in Vibrio species, implying a necessity for efficient treatments. One promising alternative that emerges is the use of lytic bacteriophages; however......, there are some drawbacks that should be overcome to make phage therapy a widely accepted method. In this work, we discuss about the major pathogenic Vibrio species and the progress, benefits and disadvantages that have been detected during the experimental use of bacteriophages to their control....

  9. Controllability and observability of Boolean networks arising from biology

    Science.gov (United States)

    Li, Rui; Yang, Meng; Chu, Tianguang

    2015-02-01

    Boolean networks are currently receiving considerable attention as a computational scheme for system level analysis and modeling of biological systems. Studying control-related problems in Boolean networks may reveal new insights into the intrinsic control in complex biological systems and enable us to develop strategies for manipulating biological systems using exogenous inputs. This paper considers controllability and observability of Boolean biological networks. We propose a new approach, which draws from the rich theory of symbolic computation, to solve the problems. Consequently, simple necessary and sufficient conditions for reachability, controllability, and observability are obtained, and algorithmic tests for controllability and observability which are based on the Gröbner basis method are presented. As practical applications, we apply the proposed approach to several different biological systems, namely, the mammalian cell-cycle network, the T-cell activation network, the large granular lymphocyte survival signaling network, and the Drosophila segment polarity network, gaining novel insights into the control and/or monitoring of the specific biological systems.

  10. Control theory meets synthetic biology.

    Science.gov (United States)

    Del Vecchio, Domitilla; Dy, Aaron J; Qian, Yili

    2016-07-01

    The past several years have witnessed an increased presence of control theoretic concepts in synthetic biology. This review presents an organized summary of how these control design concepts have been applied to tackle a variety of problems faced when building synthetic biomolecular circuits in living cells. In particular, we describe success stories that demonstrate how simple or more elaborate control design methods can be used to make the behaviour of synthetic genetic circuits within a single cell or across a cell population more reliable, predictable and robust to perturbations. The description especially highlights technical challenges that uniquely arise from the need to implement control designs within a new hardware setting, along with implemented or proposed solutions. Some engineering solutions employing complex feedback control schemes are also described, which, however, still require a deeper theoretical analysis of stability, performance and robustness properties. Overall, this paper should help synthetic biologists become familiar with feedback control concepts as they can be used in their application area. At the same time, it should provide some domain knowledge to control theorists who wish to enter the rising and exciting field of synthetic biology. © 2016 The Author(s).

  11. Biological control of postharvest pathogens

    Science.gov (United States)

    Postharvest diseases of harvested commodities cause significant reductions in food availability and financial profits. Additionally, regulatory agencies are increasingly restricting or banning the postharvest use of synthetic chemical fungicides. This has increased the need to develop more ecofrie...

  12. Potensi Jamur Patogen Tumbuhan sebagai Agen Pengendali Biologi Gulma Alang-alang

    Directory of Open Access Journals (Sweden)

    Bambang Nugroho

    1997-09-01

    pathogenic fungi. The purpose of this research is to identify potential fungi to be developed as an agent of biological control on alang-alang (Imperata cylindrica L. A survey was conducted in highland and lowland areas which were seriously infested by alang-alang to know the disease intensity and its distribution. Sample of diseased leaves were taken for identification and pathogenecity testing. Four fungal diseases - leaf blight, rust and two kinds of leaf spot that are caused by Phoma sp, Puccinia rufipes Diet and two unidentified pathogens - were found. By inoculation trials it was proven that Phoma sp. is pathogenic to alang-alang. Considering that there are potential pathogenic fungi causing several diseases on alang-alang, it is possible to develop a method of controlling the grass by using pathogenic fungi.

  13. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2009-12-01

    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method.Methods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued .Results: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months.Conclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed. 

  14. Viral pathogen discovery

    Science.gov (United States)

    Chiu, Charles Y

    2015-01-01

    Viral pathogen discovery is of critical importance to clinical microbiology, infectious diseases, and public health. Genomic approaches for pathogen discovery, including consensus polymerase chain reaction (PCR), microarrays, and unbiased next-generation sequencing (NGS), have the capacity to comprehensively identify novel microbes present in clinical samples. Although numerous challenges remain to be addressed, including the bioinformatics analysis and interpretation of large datasets, these technologies have been successful in rapidly identifying emerging outbreak threats, screening vaccines and other biological products for microbial contamination, and discovering novel viruses associated with both acute and chronic illnesses. Downstream studies such as genome assembly, epidemiologic screening, and a culture system or animal model of infection are necessary to establish an association of a candidate pathogen with disease. PMID:23725672

  15. Environmental controls, oceanography and population dynamics of pathogens and harmful algal blooms: connecting sources to human exposure

    Directory of Open Access Journals (Sweden)

    Minnett Peter

    2008-11-01

    Full Text Available Abstract Coupled physical-biological models are capable of linking the complex interactions between environmental factors and physical hydrodynamics to simulate the growth, toxicity and transport of infectious pathogens and harmful algal blooms (HABs. Such simulations can be used to assess and predict the impact of pathogens and HABs on human health. Given the widespread and increasing reliance of coastal communities on aquatic systems for drinking water, seafood and recreation, such predictions are critical for making informed resource management decisions. Here we identify three challenges to making this connection between pathogens/HABs and human health: predicting concentrations and toxicity; identifying the spatial and temporal scales of population and ecosystem interactions; and applying the understanding of population dynamics of pathogens/HABs to management strategies. We elaborate on the need to meet each of these challenges, describe how modeling approaches can be used and discuss strategies for moving forward in addressing these challenges.

  16. Exploring the Possible Use of Information Barriers for future Biological Weapons Verification Regimes

    International Nuclear Information System (INIS)

    Luke, S.J.

    2011-01-01

    This report describes a path forward for implementing information barriers in a future generic biological arms-control verification regime. Information barriers have become a staple of discussion in the area of arms control verification approaches for nuclear weapons and components. Information barriers when used with a measurement system allow for the determination that an item has sensitive characteristics without releasing any of the sensitive information. Over the last 15 years the United States (with the Russian Federation) has led on the development of information barriers in the area of the verification of nuclear weapons and nuclear components. The work of the US and the Russian Federation has prompted other states (e.g., UK and Norway) to consider the merits of information barriers for possible verification regimes. In the context of a biological weapons control verification regime, the dual-use nature of the biotechnology will require protection of sensitive information while allowing for the verification of treaty commitments. A major question that has arisen is whether - in a biological weapons verification regime - the presence or absence of a weapon pathogen can be determined without revealing any information about possible sensitive or proprietary information contained in the genetic materials being declared under a verification regime. This study indicates that a verification regime could be constructed using a small number of pathogens that spans the range of known biological weapons agents. Since the number of possible pathogens is small it is possible and prudent to treat these pathogens as analogies to attributes in a nuclear verification regime. This study has determined that there may be some information that needs to be protected in a biological weapons control verification regime. To protect this information, the study concludes that the Lawrence Livermore Microbial Detection Array may be a suitable technology for the detection of the

  17. Exploring the Possible Use of Information Barriers for future Biological Weapons Verification Regimes

    Energy Technology Data Exchange (ETDEWEB)

    Luke, S J

    2011-12-20

    This report describes a path forward for implementing information barriers in a future generic biological arms-control verification regime. Information barriers have become a staple of discussion in the area of arms control verification approaches for nuclear weapons and components. Information barriers when used with a measurement system allow for the determination that an item has sensitive characteristics without releasing any of the sensitive information. Over the last 15 years the United States (with the Russian Federation) has led on the development of information barriers in the area of the verification of nuclear weapons and nuclear components. The work of the US and the Russian Federation has prompted other states (e.g., UK and Norway) to consider the merits of information barriers for possible verification regimes. In the context of a biological weapons control verification regime, the dual-use nature of the biotechnology will require protection of sensitive information while allowing for the verification of treaty commitments. A major question that has arisen is whether - in a biological weapons verification regime - the presence or absence of a weapon pathogen can be determined without revealing any information about possible sensitive or proprietary information contained in the genetic materials being declared under a verification regime. This study indicates that a verification regime could be constructed using a small number of pathogens that spans the range of known biological weapons agents. Since the number of possible pathogens is small it is possible and prudent to treat these pathogens as analogies to attributes in a nuclear verification regime. This study has determined that there may be some information that needs to be protected in a biological weapons control verification regime. To protect this information, the study concludes that the Lawrence Livermore Microbial Detection Array may be a suitable technology for the detection of the

  18. Card9 mediates susceptibility to intestinal pathogens through microbiota modulation and control of bacterial virulence.

    Science.gov (United States)

    Lamas, Bruno; Michel, Marie-Laure; Waldschmitt, Nadine; Pham, Hang-Phuong; Zacharioudaki, Vassiliki; Dupraz, Louise; Delacre, Myriam; Natividad, Jane M; Costa, Gregory Da; Planchais, Julien; Sovran, Bruno; Bridonneau, Chantal; Six, Adrien; Langella, Philippe; Richard, Mathias L; Chamaillard, Mathias; Sokol, Harry

    2017-08-08

    In association with innate and adaptive immunity, the microbiota controls the colonisation resistance against intestinal pathogens. Caspase recruitment domain 9 ( CARD9 ), a key innate immunity gene, is required to shape a normal gut microbiota. Card9 -/- mice are more susceptible to the enteric mouse pathogen Citrobacter rodentium that mimics human infections with enteropathogenic and enterohaemorrhagic Escherichia coli . Here, we examined how CARD9 controls C. rodentium infection susceptibility through microbiota-dependent and microbiota-independent mechanisms. C. rodentium infection was assessed in conventional and germ-free (GF) wild-type (WT) and Card9 -/- mice. To explore the impact of Card9 -/- microbiota in infection susceptibility, GF WT mice were colonised with WT (WT→GF) or Card9 -/- ( Card9 -/- →GF) microbiota before C. rodentium infection. Microbiota composition was determined by 16S rDNA gene sequencing. Inflammation severity was determined by histology score and lipocalin level. Microbiota-host immune system interactions were assessed by quantitative PCR analysis. CARD9 controls pathogen virulence in a microbiota-independent manner by supporting a specific humoral response. Higher susceptibility to C. rodentium -induced colitis was observed in Card9 -/- →GF mice. The microbiota of Card9 -/- mice failed to outcompete the monosaccharide-consuming C. rodentium , worsening the infection severity. A polysaccharide-enriched diet counteracted the ecological advantage of C. rodentium and the defective pathogen-specific antibody response in Card9 -/- mice. CARD9 modulates the susceptibility to intestinal infection by controlling the pathogen virulence in a microbiota-dependent and microbiota-independent manner. Genetic susceptibility to intestinal pathogens can be overridden by diet intervention that restores humoural immunity and a competing microbiota. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017

  19. Insight of Genus Corynebacterium: Ascertaining the Role of Pathogenic and Non-pathogenic Species.

    Science.gov (United States)

    Oliveira, Alberto; Oliveira, Leticia C; Aburjaile, Flavia; Benevides, Leandro; Tiwari, Sandeep; Jamal, Syed B; Silva, Arthur; Figueiredo, Henrique C P; Ghosh, Preetam; Portela, Ricardo W; De Carvalho Azevedo, Vasco A; Wattam, Alice R

    2017-01-01

    This review gathers recent information about genomic and transcriptomic studies in the Corynebacterium genus, exploring, for example, prediction of pathogenicity islands and stress response in different pathogenic and non-pathogenic species. In addition, is described several phylogeny studies to Corynebacterium , exploring since the identification of species until biological speciation in one species belonging to the genus Corynebacterium . Important concepts associated with virulence highlighting the role of Pld protein and Tox gene. The adhesion, characteristic of virulence factor, was described using the sortase mechanism that is associated to anchorage to the cell wall. In addition, survival inside the host cell and some diseases, were too addressed for pathogenic corynebacteria, while important biochemical pathways and biotechnological applications retain the focus of this review for non-pathogenic corynebacteria. Concluding, this review broadly explores characteristics in genus Corynebacterium showing to have strong relevance inside the medical, veterinary, and biotechnology field.

  20. Proteomics of Plant Pathogenic Fungi

    Directory of Open Access Journals (Sweden)

    Raquel González-Fernández

    2010-01-01

    Full Text Available Plant pathogenic fungi cause important yield losses in crops. In order to develop efficient and environmental friendly crop protection strategies, molecular studies of the fungal biological cycle, virulence factors, and interaction with its host are necessary. For that reason, several approaches have been performed using both classical genetic, cell biology, and biochemistry and the modern, holistic, and high-throughput, omic techniques. This work briefly overviews the tools available for studying Plant Pathogenic Fungi and is amply focused on MS-based Proteomics analysis, based on original papers published up to December 2009. At a methodological level, different steps in a proteomic workflow experiment are discussed. Separate sections are devoted to fungal descriptive (intracellular, subcellular, extracellular and differential expression proteomics and interactomics. From the work published we can conclude that Proteomics, in combination with other techniques, constitutes a powerful tool for providing important information about pathogenicity and virulence factors, thus opening up new possibilities for crop disease diagnosis and crop protection.

  1. Advancing vector biology research: a community survey for future directions, research applications and infrastructure requirements

    Science.gov (United States)

    Kohl, Alain; Pondeville, Emilie; Schnettler, Esther; Crisanti, Andrea; Supparo, Clelia; Christophides, George K.; Kersey, Paul J.; Maslen, Gareth L.; Takken, Willem; Koenraadt, Constantianus J. M.; Oliva, Clelia F.; Busquets, Núria; Abad, F. Xavier; Failloux, Anna-Bella; Levashina, Elena A.; Wilson, Anthony J.; Veronesi, Eva; Pichard, Maëlle; Arnaud Marsh, Sarah; Simard, Frédéric; Vernick, Kenneth D.

    2016-01-01

    Vector-borne pathogens impact public health, animal production, and animal welfare. Research on arthropod vectors such as mosquitoes, ticks, sandflies, and midges which transmit pathogens to humans and economically important animals is crucial for development of new control measures that target transmission by the vector. While insecticides are an important part of this arsenal, appearance of resistance mechanisms is increasingly common. Novel tools for genetic manipulation of vectors, use of Wolbachia endosymbiotic bacteria, and other biological control mechanisms to prevent pathogen transmission have led to promising new intervention strategies, adding to strong interest in vector biology and genetics as well as vector–pathogen interactions. Vector research is therefore at a crucial juncture, and strategic decisions on future research directions and research infrastructure investment should be informed by the research community. A survey initiated by the European Horizon 2020 INFRAVEC-2 consortium set out to canvass priorities in the vector biology research community and to determine key activities that are needed for researchers to efficiently study vectors, vector-pathogen interactions, as well as access the structures and services that allow such activities to be carried out. We summarize the most important findings of the survey which in particular reflect the priorities of researchers in European countries, and which will be of use to stakeholders that include researchers, government, and research organizations. PMID:27677378

  2. Dual effects of Metarhizium spp. and Clonostachys rosea against an insect and a seed-borne pathogen in wheat.

    Science.gov (United States)

    Keyser, Chad A; Jensen, Birgit; Meyling, Nicolai V

    2016-03-01

    Crops are often prone to both insect herbivory and disease, which necessitate multiple control measures. Ideally, an efficacious biological control agent must adequately control the target organism and not be inhibited by other biological control agents when applied simultaneously. Wheat seeds infected with the plant pathogen Fusarium culmorum were treated with Metarhizium brunneum or M. flavoviride and Clonostachys rosea individually and in combination, with the expectation to control both root-feeding insects and the pathogen. Emerging roots were evaluated for disease and then placed with Tenebrio molitor larvae, which were monitored for infection. Plant disease symptoms were nearly absent for seeds treated with C. rosea, both individually and in combination with Metarhizium spp. Furthermore, roots grown from seeds treated with Metarhizium spp. caused significant levels of fungal infection in larvae when used individually or combined with C. rosea. However, cotreated seeds showed reduced virulence towards T. molitor when compared with treatments using Metarhizium spp. only. This study clearly shows that seed treatments with both the entomopathogenic fungus M. brunneum and the mycoparasitic fungus C. rosea can protect plant roots from insects and disease. The dual-treatment approach to biological control presented here is consistent with the ideals of IPM strategies. © 2015 Society of Chemical Industry.

  3. Biological control component [Management of water hyacinth

    International Nuclear Information System (INIS)

    Harley, K.L.S.

    1981-01-01

    Both chemical and biological control have been used with limited success for the management of water hyacinth in Fiji. In some cases heavy application of chemicals have been successful in completely killing limited areas of water hyacinth, but have resulted in the destruction of biological agents introduced to control the water hyacinth and high contamination of natural water supplies. It is proposed that under the direction of Mr S R Singh, the Senior Research Scientist (Entomology) of the Koronivia Research Station, Suva, Fiji, a collaborative programme with Dr Harley of Australia on chemical and biological control of water hyacinth be initiated. This programme would be fundamentally short-term with the prime objective being an investigation of levels of insect population following varying levels of application of chemical sprays. By comparison with control areas, observations would be made of both chemical damage and insect damage within the limited time span of the period

  4. Effectiveness of a biological control agent Palexorista gilvoides in ...

    African Journals Online (AJOL)

    ACSS

    Effectiveness of a biological control agent Palexorista gilvoides in controlling Gonometa podorcarpi in conifer ... gilvoides as a potential biological control agent for G. podocarpi. Field and laboratory studies further established that P. .... version for windows (SPSS, 2002). Results. Gonometa podocarpi was present in.

  5. Hijacking of the host SCF ubiquitin ligase machinery by plant pathogens

    Directory of Open Access Journals (Sweden)

    Shimpei eMagori

    2011-11-01

    Full Text Available The SCF (SKP1-CUL1-F-box protein ubiquitin ligase complex mediates polyubiquitination of proteins targeted for degradation, thereby controlling a plethora of biological processes in eukaryotic cells. Although this ubiquitination machinery is found and functional only in eukaryotes, many non-eukaryotic pathogens also encode F-box proteins, the critical subunits of the SCF complex. Increasing evidence indicates that such non-eukaryotic F-box proteins play an essential role in subverting or exploiting the host ubiquitin/proteasome system for efficient pathogen infection. A recent bioinformatic analysis has identified more than 70 F-box proteins in 22 different bacterial species, suggesting that use of pathogen-encoded F-box effectors in the host cell may be a widespread infection strategy. In this review, we focus on plant pathogen-encoded F-box effectors, such as VirF of Agrobacterium tumefaciens, GALAs of Ralstonia solanacearum, and P0 of Poleroviruses, and discuss the molecular mechanism by which plant pathogens use these factors to manipulate the host cell for their own benefit.

  6. THE OCCURRENCE, GROWTH AND CONTROL OF PATHOGENS ...

    African Journals Online (AJOL)

    Fermented foods have many advantageous attributes such as improved nutritional value and safety against bacterial pathogens. These foods are also important for weaning purposes and hence play a role in protecting infants against foodborne diseases. However, pathogens have been isolated from some fermented foods ...

  7. Biological control agents elevate hantavirus by subsidizing deer mouse populations

    Science.gov (United States)

    Dean E. Pearson; Ragan M. Callaway

    2006-01-01

    Biological control of exotic invasive plants using exotic insects is practiced under the assumption that biological control agents are safe if they do not directly attack non-target species. We tested this assumption by evaluating the potential for two host-specific biological control agents (Urophora spp.), widely established in North America for spotted...

  8. Evolutionary Control of Infectious Disease: Prospects for Vectorborne and Waterborne Pathogens

    Directory of Open Access Journals (Sweden)

    Paul W Ewald

    1998-09-01

    Full Text Available Evolutionary theory may contribute to practical solutions for control of disease by identifying interventions that may cause pathogens to evolve to reduced virulence. Theory predicts, for example, that pathogens transmitted by water or arthropod vectors should evolve to relatively high levels of virulence because such pathogens can gain the evolutionary benefits of relatively high levels of host exploitation while paying little price from host illness. The entrance of Vibrio cholerae into South America in 1991 has generated a natural experiment that allows testing of this idea by determining whether geographic and temporal variations in toxigenicity correspond to variation in the potential for waterborne transmission. Preliminary studies show such correspondences: toxigenicity is negatively associated with access to uncontaminated water in Brazil; and in Chile, where the potential for waterborne transmission is particularly low, toxigenicity of strains declined between 1991 and 1998. In theory vector-proofing of houses should be similarly associated with benignity of vectorborne pathogens, such as the agents of dengue, malaria, and Chagas' disease. These preliminary studies draw attention to the need for definitive prospective experiments to determine whether interventions such as provisioning of uncontaminated water and vector-proofing of houses cause evolutionary reductions in virulence

  9. Genetic Variation and Biological Control of Fusarium graminearum Isolated from Wheat in Assiut-Egypt

    Directory of Open Access Journals (Sweden)

    Amer F. Mahmoud

    2016-04-01

    Full Text Available Fusarium graminearum Schwabe causes Fusarium head blight (FHB, a devastating disease that leads to extensive yield and quality loss of wheat and other cereal crops. Twelve isolates of F. graminearum were collected from naturally infected spikes of wheat from Assiut Egypt. These isolates were compared using SRAP. The results indicated distinct genetic groups exist within F. graminearum, and demonstrated that these groups have different biological properties, especially with respect to their pathogenicity on wheat. There were biologically significant differences between the groups; with group (B isolates being more aggressive towards wheat than groups (A and (C. Furthermore, Trichoderma harzianum (Rifai and Bacillus subtilis (Ehrenberg which isolated from wheat kernels were screened for antagonistic activity against F. graminearum. They significantly reduced the growth of F. graminearum colonies in culture. In order to gain insight into biological control effect in situ, highly antagonistic isolates of T. harzianum and B. subtilis were selected, based on their in vitro effectiveness, for greenhouse test. It was revealed that T. harzianum and B. subtilis significantly reduced FHB severity. The obtained results indicated that T. harzianum and B. subtilis are very effective biocontrol agents that offer potential benefit in FHB and should be harnessed for further biocontrol applications. The accurate analysis of genetic variation and studies of population structures have significant implications for understanding the genetic traits and disease control programs in wheat. This is the first known report of the distribution and genetic variation of F. graminearum on wheat spikes in Assiut Egypt.

  10. Isolasi Dan Identifikasi Pseudomonas Dari Tanah Kebun Biologi Wamena Dan Uji Awal Sebagai Agen Biokontrol Fusarium*[the Isolation and Identification of Pseudomonas From the Wamena Biological Gardens Soil and Its Preliminary Test as Biocontrol Agent on Fusari

    OpenAIRE

    Latupapua, HJD; Nurhidayat, N

    2003-01-01

    Pseudomonas bacteria plays essential role in soil ecology such as decomposer and biological control. The bacteria were isolated on selective media and identified from five soil samples taken within area of Wamena Biological Gardens.There are six species Pseudomonas were indentified based on morphological characters and biochemical reaction.P. striata was found to be common in soil of the area.No pathogen Pseudomonas was indentified in all soil samples. Preliminary study on biological control ...

  11. Illuminating the landscape of host–pathogen interactions with the bacterium Listeria monocytogenes

    Science.gov (United States)

    Cossart, Pascale

    2011-01-01

    Listeria monocytogenes has, in 25 y, become a model in infection biology. Through the analysis of both its saprophytic life and infectious process, new concepts in microbiology, cell biology, and pathogenesis have been discovered. This review will update our knowledge on this intracellular pathogen and highlight the most recent breakthroughs. Promising areas of investigation such as the increasingly recognized relevance for the infectious process, of RNA-mediated regulations in the bacterium, and the role of bacterially controlled posttranslational and epigenetic modifications in the host will also be discussed. PMID:22114192

  12. Molecular mechanisms of nematode-nematophagous microbe interactions: basis for biological control of plant-parasitic nematodes.

    Science.gov (United States)

    Li, Juan; Zou, Chenggang; Xu, Jianping; Ji, Xinglai; Niu, Xuemei; Yang, Jinkui; Huang, Xiaowei; Zhang, Ke-Qin

    2015-01-01

    Plant-parasitic nematodes cause significant damage to a broad range of vegetables and agricultural crops throughout the world. As the natural enemies of nematodes, nematophagous microorganisms offer a promising approach to control the nematode pests. Some of these microorganisms produce traps to capture and kill the worms from the outside. Others act as internal parasites to produce toxins and virulence factors to kill the nematodes from within. Understanding the molecular basis of microbe-nematode interactions provides crucial insights for developing effective biological control agents against plant-parasitic nematodes. Here, we review recent advances in our understanding of the interactions between nematodes and nematophagous microorganisms, with a focus on the molecular mechanisms by which nematophagous microorganisms infect nematodes and on the nematode defense against pathogenic attacks. We conclude by discussing several key areas for future research and development, including potential approaches to apply our recent understandings to develop effective biocontrol strategies.

  13. Status of biological control in vegetation management in forestry

    Science.gov (United States)

    George P. Markin; Donald E. Gardner

    1993-01-01

    Biological control traditionally depends upon importing the natural enemies of introduced weeds. Since vegetation management in forestry has primarily been aimed at protecting economic species of trees from competition from other native plants, biological control has been of little use in forestry. An alternative approach to controlling unwanted native plants,...

  14. Genome Assembly and Computational Analysis Pipelines for Bacterial Pathogens

    KAUST Repository

    Rangkuti, Farania Gama Ardhina

    2011-06-01

    Pathogens lie behind the deadliest pandemics in history. To date, AIDS pandemic has resulted in more than 25 million fatal cases, while tuberculosis and malaria annually claim more than 2 million lives. Comparative genomic analyses are needed to gain insights into the molecular mechanisms of pathogens, but the abundance of biological data dictates that such studies cannot be performed without the assistance of computational approaches. This explains the significant need for computational pipelines for genome assembly and analyses. The aim of this research is to develop such pipelines. This work utilizes various bioinformatics approaches to analyze the high-­throughput genomic sequence data that has been obtained from several strains of bacterial pathogens. A pipeline has been compiled for quality control for sequencing and assembly, and several protocols have been developed to detect contaminations. Visualization has been generated of genomic data in various formats, in addition to alignment, homology detection and sequence variant detection. We have also implemented a metaheuristic algorithm that significantly improves bacterial genome assemblies compared to other known methods. Experiments on Mycobacterium tuberculosis H37Rv data showed that our method resulted in improvement of N50 value of up to 9697% while consistently maintaining high accuracy, covering around 98% of the published reference genome. Other improvement efforts were also implemented, consisting of iterative local assemblies and iterative correction of contiguated bases. Our result expedites the genomic analysis of virulent genes up to single base pair resolution. It is also applicable to virtually every pathogenic microorganism, propelling further research in the control of and protection from pathogen-­associated diseases.

  15. Biological control of rice brown spot with native isolates of three Trichoderma species

    Directory of Open Access Journals (Sweden)

    Elham Khalili

    2012-03-01

    Full Text Available Brown spot caused by Bipolaris oryzae is an important rice disease in Southern coast of Caspian Sea, the major rice growing region in Iran. A total of 45 Trichoderma isolates were obtained from rice paddy fields in Golestan and Mazandaran provinces which belonged to Trichoderma harzianum, T. virens and T. atroviride species. Initially, they were screened against B. oryzae by antagonism tests including dual culture, volatile and nonvolatile metabolites and hyperparasitism. Results showed that Trichoderma isolates can significantly inhibit mycelium growth of pathogen in vitro by producing volatile and nonvolatile metabolites Light microscopic observations showed no evidence of mycoparasitic behaviour of the tested isolates of Trichoderma spp. such as coiling around the B. oryzae. According to in vitro experiments, Trichoderma isolates were selected in order to evaluate their efficacy in controlling brown spot in glasshouse using seed treatment and foliar spray methods. Concerning the glasshouse tests, two strains of T. harzianum significantly controlled the disease and one strain of T. atroviride increased the seedling growth. It is the first time that the biological control of rice brown spot and increase of seedling growth with Trichoderma species have been studied in Iran.

  16. A network approach to predict pathogenic genes for Fusarium graminearum.

    Science.gov (United States)

    Liu, Xiaoping; Tang, Wei-Hua; Zhao, Xing-Ming; Chen, Luonan

    2010-10-04

    Fusarium graminearum is the pathogenic agent of Fusarium head blight (FHB), which is a destructive disease on wheat and barley, thereby causing huge economic loss and health problems to human by contaminating foods. Identifying pathogenic genes can shed light on pathogenesis underlying the interaction between F. graminearum and its plant host. However, it is difficult to detect pathogenic genes for this destructive pathogen by time-consuming and expensive molecular biological experiments in lab. On the other hand, computational methods provide an alternative way to solve this problem. Since pathogenesis is a complicated procedure that involves complex regulations and interactions, the molecular interaction network of F. graminearum can give clues to potential pathogenic genes. Furthermore, the gene expression data of F. graminearum before and after its invasion into plant host can also provide useful information. In this paper, a novel systems biology approach is presented to predict pathogenic genes of F. graminearum based on molecular interaction network and gene expression data. With a small number of known pathogenic genes as seed genes, a subnetwork that consists of potential pathogenic genes is identified from the protein-protein interaction network (PPIN) of F. graminearum, where the genes in the subnetwork are further required to be differentially expressed before and after the invasion of the pathogenic fungus. Therefore, the candidate genes in the subnetwork are expected to be involved in the same biological processes as seed genes, which imply that they are potential pathogenic genes. The prediction results show that most of the pathogenic genes of F. graminearum are enriched in two important signal transduction pathways, including G protein coupled receptor pathway and MAPK signaling pathway, which are known related to pathogenesis in other fungi. In addition, several pathogenic genes predicted by our method are verified in other pathogenic fungi, which

  17. A network approach to predict pathogenic genes for Fusarium graminearum.

    Directory of Open Access Journals (Sweden)

    Xiaoping Liu

    Full Text Available Fusarium graminearum is the pathogenic agent of Fusarium head blight (FHB, which is a destructive disease on wheat and barley, thereby causing huge economic loss and health problems to human by contaminating foods. Identifying pathogenic genes can shed light on pathogenesis underlying the interaction between F. graminearum and its plant host. However, it is difficult to detect pathogenic genes for this destructive pathogen by time-consuming and expensive molecular biological experiments in lab. On the other hand, computational methods provide an alternative way to solve this problem. Since pathogenesis is a complicated procedure that involves complex regulations and interactions, the molecular interaction network of F. graminearum can give clues to potential pathogenic genes. Furthermore, the gene expression data of F. graminearum before and after its invasion into plant host can also provide useful information. In this paper, a novel systems biology approach is presented to predict pathogenic genes of F. graminearum based on molecular interaction network and gene expression data. With a small number of known pathogenic genes as seed genes, a subnetwork that consists of potential pathogenic genes is identified from the protein-protein interaction network (PPIN of F. graminearum, where the genes in the subnetwork are further required to be differentially expressed before and after the invasion of the pathogenic fungus. Therefore, the candidate genes in the subnetwork are expected to be involved in the same biological processes as seed genes, which imply that they are potential pathogenic genes. The prediction results show that most of the pathogenic genes of F. graminearum are enriched in two important signal transduction pathways, including G protein coupled receptor pathway and MAPK signaling pathway, which are known related to pathogenesis in other fungi. In addition, several pathogenic genes predicted by our method are verified in other

  18. A functional overview of conservation biological control

    DEFF Research Database (Denmark)

    Begg, Graham S; Cook, Samantha M; Dye, Richard

    2017-01-01

    Conservation biological control (CBC) is a sustainable approach to pest management that can contribute to a reduction in pesticide use as part of an Integrated Pest Management (IPM) strategy. CBC is based on the premise that countering habitat loss and environmental disturbance associated...... CBC prescriptions have proved elusive. To tackle this, we consolidate existing knowledge of CBC using a simple conceptual model that organises the functional elements of CBC into a common, unifying framework. We identify and integrate the key biological processes affecting natural enemies...... and their biological control function across local and regional scales, and consider the interactions, interdependencies and constraints that determine the outcome of CBC strategies. Conservation measures are often effective in supporting natural enemy populations but their success cannot be guaranteed; the greatest...

  19. Granular formulation of Fusarium oxysporum for biological control of faba bean and tomato Orobanche.

    Science.gov (United States)

    Nemat Alla, Mamdouh M; Shabana, Yasser M; Serag, Mamdouh M; Hassan, Nemat M; El-Hawary, Mohamed M

    2008-12-01

    Orobanche spp. represent a serious threat to a wide range of crops. They are difficult targets for herbicides, and biological control could provide a possible solution. This work therefore aimed to formulate mycoherbicides of Fusarium with adequate shelf life and virulence against Orobanche but safe to faba bean and tomato. Only two isolates of Fusarium oxysporum Schlecht. (Foxy I and Foxy II) obtained from diseased Orobanche shoots were found to be pathogenic to Orobanche crenata Forsk. and Orobanche ramosa L. Conidial suspension of both isolates significantly decreased germination, attachments and tubercles of Orobanche. Microconidia and chlamydospores of both isolates were formulated as mycoherbicides encapsulated in a wheat flour-kaolin matrix (four different formulations). All formulations greatly diminished Orobanche emerged shoots, total shoot number, shoot height, attachment of emerged shoots, the germinated seeds that succeeded in emerging above the soil surface and dry weight. Meanwhile, disease incidence and disease severity of emerged shoots were enhanced. The shelf life was adequate, particularly for coarse, freshly prepared, low-temperature-stored, microconidia-rich formulations. The induced growth reduction of Orobanche-infected host plants seemed to be nullified by formulations, particularly at the highest dose. These formulations seemed to destroy Orobanche but appeared harmless to host plants. Hence, they could be efficiently used as mycoherbicides for biological control of Orobanche in faba bean and tomato.

  20. Summary of taxa-specific research: 2. pathogens

    Science.gov (United States)

    Ned Klopfenstein; Brian Geils

    2009-01-01

    Damage caused by invasive forest pathogens is widely viewed as more severe, long-term, widespread, and difficult to restore than that caused by any other biological disturbance agent. In the last century, pathogens introduced into our native forests have threatened extinction of native tree species and critically degraded many different ecosystems across North America...

  1. Disease control by chemical and biological fungicides in cultivated mushrooms: button mushroom, oyster mushroom and shiitake

    Directory of Open Access Journals (Sweden)

    Ivana Potočnik

    2015-12-01

    Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.

  2. Systems biology elucidates common pathogenic mechanisms between nonalcoholic and alcoholic-fatty liver disease.

    Directory of Open Access Journals (Sweden)

    Silvia Sookoian

    Full Text Available The abnormal accumulation of fat in the liver is often related either to metabolic risk factors associated with metabolic syndrome in the absence of alcohol consumption (nonalcoholic fatty liver disease, NAFLD or to chronic alcohol consumption (alcoholic fatty liver disease, AFLD. Clinical and histological studies suggest that NAFLD and AFLD share pathogenic mechanisms. Nevertheless, current data are still inconclusive as to whether the underlying biological process and disease pathways of NAFLD and AFLD are alike. Our primary aim was to integrate omics and physiological data to answer the question of whether NAFLD and AFLD share molecular processes that lead to disease development. We also explored the extent to which insulin resistance (IR is a distinctive feature of NAFLD. To answer these questions, we used systems biology approaches, such as gene enrichment analysis, protein-protein interaction networks, and gene prioritization, based on multi-level data extracted by computational data mining. We observed that the leading disease pathways associated with NAFLD did not significantly differ from those of AFLD. However, systems biology revealed the importance of each molecular process behind each of the two diseases, and dissected distinctive molecular NAFLD and AFLD-signatures. Comparative co-analysis of NAFLD and AFLD clarified the participation of NAFLD, but not AFLD, in cardiovascular disease, and showed that insulin signaling is impaired in fatty liver regardless of the noxa, but the putative regulatory mechanisms associated with NAFLD seem to encompass a complex network of genes and proteins, plausible of epigenetic modifications. Gene prioritization showed a cancer-related functional map that suggests that the fatty transformation of the liver tissue is regardless of the cause, an emerging mechanism of ubiquitous oncogenic activation. In conclusion, similar underlying disease mechanisms lead to NAFLD and AFLD, but specific ones depict a

  3. Social and economic factors for the adoption of biological control of ...

    African Journals Online (AJOL)

    The results also showed that the decision on the application of biological control is determined by the educational level, income, mechanization level, extension activities, biological control awareness, social participation, attitude toward biological control and access to information sources which have significant influence.

  4. Control of the cassava mealybug in Africa: lessons from a biological ...

    African Journals Online (AJOL)

    Control of the cassava mealybug in Africa: lessons from a biological control project. ... Such studies are needed in order to attribute the observed effects to various causes and to advance the science of biological control. ( 4) It is concluded that biological control is the basis ofiPM but cannot usually be manipulated by the ...

  5. Processes for managing pathogens.

    Science.gov (United States)

    Godfree, Alan; Farrell, Joseph

    2005-01-01

    Wastewater contains human, animal, and plant pathogens capable of causing viral, bacterial, or parasitic infections. There are several routes whereby sewage pathogens may affect human health, including direct contact, contamination of food crops, zoonoses, and vectors. The range and numbers of pathogens in municipal wastewater vary with the level of endemic disease in the community, discharges from commercial activities, and seasonal factors. Regulations to control pathogen risk in the United States and Europe arising from land application of biosolids are based on the concept of multiple barriers to the prevention of transmission. The barriers are (i) treatment to reduce pathogen content and vector attraction, (ii) restrictions on crops grown on land to which biosolids have been applied, and (iii) minimum intervals following application and grazing or harvesting. Wastewater treatment reduces number of pathogens in the wastewater by concentrating them with the solids in the sludge. Although some treatment processes are designed specifically to inactivate pathogens, many are not, and the actual mechanisms of microbial inactivation are not fully understood for all processes. Vector attraction is reduced by stabilization (reduction of readily biodegradable material) and/or incorporation immediately following application. Concerns about health risks have renewed interest in the effects of treatment (on pathogens) and advanced treatment methods, and work performed in the United States suggests that Class A pathogen reduction can be achieved less expensively than previously thought. Effective pathogen risk management requires control to the complete chain of sludge treatment, biosolids handling and application, and post-application activities. This may be achieved by adherence to quality management systems based on hazard analysis critical control point (HACCP) principles.

  6. 9 CFR 381.94 - Contamination with Microorganisms; process control verification criteria and testing; pathogen...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Contamination with Microorganisms... § 381.94 Contamination with Microorganisms; process control verification criteria and testing; pathogen... maintaining process controls sufficient to prevent fecal contamination. FSIS shall take further action as...

  7. Emerging microbial biocontrol strategies for plant pathogens.

    Science.gov (United States)

    Syed Ab Rahman, Sharifah Farhana; Singh, Eugenie; Pieterse, Corné M J; Schenk, Peer M

    2018-02-01

    To address food security, agricultural yields must increase to match the growing human population in the near future. There is now a strong push to develop low-input and more sustainable agricultural practices that include alternatives to chemicals for controlling pests and diseases, a major factor of heavy losses in agricultural production. Based on the adverse effects of some chemicals on human health, the environment and living organisms, researchers are focusing on potential biological control microbes as viable alternatives for the management of pests and plant pathogens. There is a growing body of evidence that demonstrates the potential of leaf and root-associated microbiomes to increase plant efficiency and yield in cropping systems. It is important to understand the role of these microbes in promoting growth and controlling diseases, and their application as biofertilizers and biopesticides whose success in the field is still inconsistent. This review focusses on how biocontrol microbes modulate plant defense mechanisms, deploy biocontrol actions in plants and offer new strategies to control plant pathogens. Apart from simply applying individual biocontrol microbes, there are now efforts to improve, facilitate and maintain long-term plant colonization. In particular, great hopes are associated with the new approaches of using "plant-optimized microbiomes" (microbiome engineering) and establishing the genetic basis of beneficial plant-microbe interactions to enable breeding of "microbe-optimized crops". Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Biological control strategies of mycotoxigenic fungi and associated mycotoxins in Mediterranean basin crops

    Directory of Open Access Journals (Sweden)

    Dimitrios I. TSITSIGIANNIS

    2012-05-01

    Full Text Available Fungi that belong to the genera Aspergillus, Fusarium, and Penicillium pose serious phytopathological and mycotoxicological risks at pre-harvest and post-harvest stages, as well as in processed food products because they can produce several mycotoxins. Mycotoxins pose a serious problem for animal and human health and have a significant economic impact worldwide. The Mediterranean basin is a large geographical region with a temperate climate supporting the cultivation of a wealth of field and greenhouse crops with a high risk of mycotoxin contamination. The most important mycotoxins that occur in the Mediterranean basin are aflatoxins (B1, B2, G1 and G2 in dried fruits and nuts, ochratoxin A in grapes and raisins as well as trichothecenes and fumonisins in cereals. A variety of chemical, biological and physical strategies have been developed to control the mycotoxigenic pathogens; to minimize mycotoxin production at pre- or post-harvest level; to contribute to decontamination and/or detoxification of mycotoxins from contaminated foods and feeds; or to inhibit mycotoxin absorption in the gastrointestinal tract. Biological control using microbial antagonists either alone or as part of an integrated control strategy to reduce pesticide inputs, has emerged as a promising approach for control of mycotoxins in crops, both pre- and post-harvest. Several organisms including atoxigenic Aspergilli, yeasts, bacteria and fungi have been tested for their ability to reduce both fungal infection and mycotoxin contamination. For instance, atoxigenic fungal strains are being used widely to prevent pre-harvest aflatoxin contamination of crops such as peanuts, pistachios, maize, and cottonseed in several parts of the world including the Mediterranean area. Recent advancements in the use of biocontrol strategies have led to registration of commercial products with increased practical applications for the benefit of growers in several countries.

  9. Controlling highly pathogenic avian influenza outbreaks : An epidemiological and economic model analysis

    NARCIS (Netherlands)

    Backer, J. A.; van Roermund, H. J W; Fischer, Egil; van Asseldonk, M. A P M; Bergevoet, R. H M

    2015-01-01

    Outbreaks of highly pathogenic avian influenza (HPAI) can cause large losses for the poultry sector and for animal disease controlling authorities, as well as risks for animal and human welfare. In the current simulation approach epidemiological and economic models are combined to compare different

  10. Self-Organized Biological Dynamics and Nonlinear Control

    Science.gov (United States)

    Walleczek, Jan

    2006-04-01

    The frontiers and challenges of biodynamics research Jan Walleczek; Part I. Nonlinear Dynamics in Biology and Response to Stimuli: 1. External signals and internal oscillation dynamics - principal aspects and response of stimulated rhythmic processes Friedemann Kaiser; 2. Nonlinear dynamics in biochemical and biophysical systems: from enzyme kinetics to epilepsy Raima Larter, Robert Worth and Brent Speelman; 3. Fractal mechanisms in neural control: human heartbeat and gait dynamics in health and disease Chung-Kang Peng, Jeffrey M. Hausdorff and Ary L. Goldberger; 4. Self-organising dynamics in human coordination and perception Mingzhou Ding, Yanqing Chen, J. A. Scott Kelso and Betty Tuller; 5. Signal processing in biochemical reaction networks Adam P. Arkin; Part II. Nonlinear Sensitivity of Biological Systems to Electromagnetic Stimuli: 6. Electrical signal detection and noise in systems with long-range coherence Paul C. Gailey; 7. Oscillatory signals in migrating neutrophils: effects of time-varying chemical and electrical fields Howard R. Petty; 8. Enzyme kinetics and nonlinear biochemical amplification in response to static and oscillating magnetic fields Jan Walleczek and Clemens F. Eichwald; 9. Magnetic field sensitivity in the hippocampus Stefan Engström, Suzanne Bawin and W. Ross Adey; Part III. Stochastic Noise-Induced Dynamics and Transport in Biological Systems: 10. Stochastic resonance: looking forward Frank Moss; 11. Stochastic resonance and small-amplitude signal transduction in voltage-gated ion channels Sergey M. Bezrukov and Igor Vodyanoy; 12. Ratchets, rectifiers and demons: the constructive role of noise in free energy and signal transduction R. Dean Astumian; 13. Cellular transduction of periodic and stochastic energy signals by electroconformational coupling Tian Y. Tsong; Part IV. Nonlinear Control of Biological and Other Excitable Systems: 14. Controlling chaos in dynamical systems Kenneth Showalter; 15. Electromagnetic fields and biological

  11. Ultraviolet-Mediated Activation of Photo toxins from Peganum Harmala L. Seedlings to Control both Human-and Phyto-Pathogenic Microorganisms and Tumor Cells

    International Nuclear Information System (INIS)

    Kord, M.; Khafagi, I.; Dewedar, A.

    2003-01-01

    The medicinal plant Peganum harmala L. (zygophyllaceae) contains a number of Beta-carboline alkaloids, which are photosensitizers to bacteria, yeasts and eukaryotic cells in the presence of sunlight and artificial sources of long-wave UV radiation (365 nm). Ultraviolet irradiation of ten-day old aseptically germinated Peganum harmala inoculated on bacterial and yeast bioassay plates elicits strong phototoxic antimicrobials. Callus as well as crude methanol extracts of in vitro cultures were also investigated for the accumulation of photosensitizers. High performance liquid chromatographic analyses of irradiated and control tissues followed by fluorescent detection at 302 nm revealed the formation of serotonin (5-hydroxytryptamine) in irradiated tissues only. Eluted compounds detected at 330 nm revealed more than ten-fold accumulation of harmine, isoharmine and harmol in irradiated tissues. Moreover, several simple beta-carboline alkaloids were produced through irradiation with UV such as harmalanine and harmalacidine. UV-induced phototoxicity was proven against phyto pathogenic bacteria and human-pathogenic bacteria and yeasts. Photo-induced cytotoxicity was observed from two different toxicity bioassays, which are Artemia saline and potato discs tumor assay. The selective UV-dependent biological activities may imply a pharmacological potential of Peganum harmala in the control of infectious diseases and tumor tissues

  12. Use of Epidemiologic Models in the Control of Highly Pathogenic Avian Influenza

    NARCIS (Netherlands)

    Stegeman, J.A.; Bouma, A.; Jong, de M.C.M.

    2010-01-01

    In the past decades, mathematical models have become more and more accepted as a tool to develop surveillance programs and to evaluate the efficacy of intervention measures for the control of infectious diseases such as highly pathogenic avian influenza. Predictive models are used to simulate the

  13. Ross, macdonald, and a theory for the dynamics and control of mosquito-transmitted pathogens.

    Science.gov (United States)

    Smith, David L; Battle, Katherine E; Hay, Simon I; Barker, Christopher M; Scott, Thomas W; McKenzie, F Ellis

    2012-01-01

    Ronald Ross and George Macdonald are credited with developing a mathematical model of mosquito-borne pathogen transmission. A systematic historical review suggests that several mathematicians and scientists contributed to development of the Ross-Macdonald model over a period of 70 years. Ross developed two different mathematical models, Macdonald a third, and various "Ross-Macdonald" mathematical models exist. Ross-Macdonald models are best defined by a consensus set of assumptions. The mathematical model is just one part of a theory for the dynamics and control of mosquito-transmitted pathogens that also includes epidemiological and entomological concepts and metrics for measuring transmission. All the basic elements of the theory had fallen into place by the end of the Global Malaria Eradication Programme (GMEP, 1955-1969) with the concept of vectorial capacity, methods for measuring key components of transmission by mosquitoes, and a quantitative theory of vector control. The Ross-Macdonald theory has since played a central role in development of research on mosquito-borne pathogen transmission and the development of strategies for mosquito-borne disease prevention.

  14. Pathogenic characterization of lasiodplodia causing stem end rot of mango and its control using botanicals

    International Nuclear Information System (INIS)

    Ullah, S. F.; Hussain, Y.; Iram, S.

    2017-01-01

    Two widely cultivated mango fruit varieties White chounsa and Sindhri were collected from two major mango growing areas of Punjab and Sindh Provinces of Pakistan. This study was focused on pathological characterization of predominant postharvest diseases such as stem end rot of mango (Mangifera indica) caused by Lasiodiplodia theobromae, and evaluation of bio-control activity by different plant extracts. L. theobromae aggressiveness of isolates was tested by artificial inoculations under controlled conditions, all isolates proved pathogenic in varying degree of aggressiveness on (Sindhri and White chounsa) with reference to control. Calculated standard error mean varied in lesion area produced by pathogens 6-63cm/sup 2/ (Sindhri) and 60-170 cm/sup 2/ (White chounsa). Re-isolation of respective fungi verified the Koch's postulates. Plant extract of Datura stramonium, Aloe-vera, Eucalyptus camaldulensis, were used to control the radial growth of L. theobromae. Comparative analysis showed D. Stramonium and E. camaldulensis extracts most efficiently reduced the growth of Lasiodiplodia isolates, in comparison to Aloe-vera extract, restrict the 15-20% growth. All pathological results and treatments were significant at p<0.05 through ANOVA. This study emphasizes the behavior of pathogens which could be helpful in mango breeding to introduce resistance toward Lasiodiplodia and referred plants provide the best alternative of chemical fungicides. (author)

  15. Biological control of alien and invasive species in agriculture

    International Nuclear Information System (INIS)

    Calvitti, Maurizio; Moretti Riccardo; Lampazzi, Elena

    2015-01-01

    Agricultural production in Europe faces many challenges including limited availability of water, nitrogen input and fossil fuels. It is necessary, therefore, to identify methods of production and new technologies to increase the efficiency of the primary systems, guaranteeing amount of food, quality, safety and eco-sustainability . One of the most important aspects, though often undervalued in relation to the food chain, is the adversity of biological management of agricultural crops due to pests, pathogens or fitomizi with potential invasive already present in the territory or of recent origin alien. In this context, two main objectives should be implemented at the same time reduce production losses and protect the agro-ecosystem. To meet these expectations, as of January 1, 2015 all farms in the European Union countries are bound to the application of the Integrated Defense principles, as indicated by the Directive on the sustainable use of plant protection products (128/09 / EC) .In response to this and other new entomological emergencies plant health and medical-veterinary entomologist researchers of the Laboratory sustainable management of Agro-Ecosystems in ENEA, have directed their research towards the development of innovative systems for the sustainable control of invasive species of insects is in the agricultural sector that health. [it

  16. Effect of soil solarization on soil-borne pathogens

    International Nuclear Information System (INIS)

    Sobh, Hana

    1995-01-01

    Author.Soil solarization was conducted at three locations on the Lebanese coast. Maximum soil temperatures recorded were 53 and 48 celsius degrees at Jiyeh, 48.9, 46 and 43 celsius degrees at Naameh and 48, 45 and 43.5 celsius degrees at Khaldeh at 5, 15 and 25cm soil depths respectively. Mean soil temperatures recorded at 3pm were at Jiyeh 51.6, 47 and 46 celsius degrees compared to Naameh 47, 45 and 41 celsius degrees and Khaldeh 44, 42 and 41 celsius degrees at 5, 15 and 25 cm respectively. The mean temperature in solarized soils were 7.3 to 15 celsius degrees higher than those of the nonsolarized soils indicating a sustained increase of soil temperature in the solarized soils. The effect of soil solarization on artificially introduced fungal pathogens in the soil at Khaldeh, resulted in complete destruction of sclerotia of Sclerotinia spp. at three depths studied. However, with respect to the two other pathogens tested, solarization resulted in reduction of the viability of microsclerotia of Verticillium spp. by 99-79% and of Fusarium oxysporum f. sp. melonis inoculum by 88-54% at 5 and 15 cm respectively, but only by 45% and 14% reduction at 25 cm. This level of control is significant when it is compared to the percentage of control where the level of reduction of inoculum viability did not exceed 10% at any soil depth. As there were contradicting reports in the literature on nematodes, two field trials in greenhouses were conducted to study the possibility of integrating 2 methods for management on nematodes. Soil solarization alone or in combination with biological control of nematodes using Arthrobotrys spp. and Dactyl ella brocophaga to control the root-knot nematodes on two crops, tomato at Naameh and cucumber at Jiyeh were compared to Methyl Bromide treatment. It was evident that, even on a very susceptible crop like cucumber, the integration of biological control and soil solarization gave a good level of control similar to methyl bromide. Neither root

  17. Bioterrorism and Biological Warfare, from Past to the Present: A classic review

    Directory of Open Access Journals (Sweden)

    Majid Zare Bidaki

    2015-10-01

    Full Text Available Bioterrorism is defined as any terrorist action of intentional release or dissemination of highly pathogenic biological agents, including a variety of microorganisms or biological toxins. With the growing threat of terrorism, is necessary that the potential danger of various microorganisms – as a powerful tool of aggression and threat- to be taken seriously. This review tries to explain the concept of biological weapons and their historical development process with an emphasis on efforts to control the proliferation of these types of weapons over the last century. Potential impact of infectious diseases on people and armed forces was known from since 600 BC. Using the victims of the plague as a weapon in medieval warfare and spread of smallpox as a weapon during the war against the Indians when initially America was discovered, the development of biological weapons during the World War I, World War II and the Cold War, and even since the beginning of the third millennium, all show the strategic importance of pathogenic microorganisms as a deterrent power for the superiority of some governments and cults. Historical attempts to use infectious diseases as biological weapons reveal that the distinction between a natural outbreak of an infectious disease and that of a deliberate biological attack is very difficult. Abusing this characteristic of infectious diseases has made it possible for the purposes of superiority. International agreements to control the development of biological weapons, such as “the 1925 Geneva Protocol” and “the Convention on the Prohibition of the Development, Production and Stockpiling of Biological and Toxic Weapons” have not been able to control the development and using of biological warfare.  The current paper is a classic review (Overview article aiming at increasing the knowledge and awareness of people especially of health authorities and government officials.

  18. Entomopathogenic fungi as biological controllers: New insights into their virulence and pathogenicity

    OpenAIRE

    Shahid Ali Ahmad; Rao Qayyum Abdul; Bakhsh Allah; Husnain Tayyab

    2012-01-01

    Entomopathogenic fungi vary considerably in their mode of action and virulence. Successful infection depends primarily on the adherence and penetration ability of a fungus to the host integuments. A variety of extracellular enzymes is produced during the degradation of insect integument. The attempts to control insects have changed over time from chemicals to natural control methods. This is why the development of natural methods of insect control or biopesticides, is preferred. By the ...

  19. 75 FR 10645 - Low Pathogenic Avian Influenza; Voluntary Control Program and Payment of Indemnity

    Science.gov (United States)

    2010-03-09

    ... pathogenic avian influenza outbreaks, provides that consistency with humane euthanasia guidelines will be... markets. In the commenter's view, this action would not only provide for disease control but would benefit...

  20. Endoplasmic reticulum-dependent redox reactions control endoplasmic reticulum-associated degradation and pathogen entry.

    Science.gov (United States)

    Walczak, Christopher P; Bernardi, Kaleena M; Tsai, Billy

    2012-04-15

    Protein misfolding within the endoplasmic reticulum (ER) is managed by an ER quality control system that retro-translocates aberrant proteins into the cytosol for proteasomal destruction. This process, known as ER-associated degradation, utilizes the action of ER redox enzymes to accommodate the disulfide-bonded nature of misfolded proteins. Strikingly, various pathogenic viruses and toxins co-opt these redox components to reach the cytosol during entry. These redox factors thus regulate critical cellular homeostasis and host-pathogen interactions. Recent studies identify specific members of the protein disulfide isomerase (PDI) family, which use their chaperone and catalytic activities, in engaging both misfolded ER proteins and pathogens. The precise molecular mechanism by which a dedicated PDI family member disrupts the disulfide bonds in the misfolded ER proteins and pathogens, as well as how they act to unfold these substrates to promote their ER-to-cytosol membrane transport, remain poorly characterized. How PDI family members distinguish folded versus misfolded ER substrates remains enigmatic. What physical characteristics surrounding a substrate's disulfide bond instruct PDI that it is mispaired or native? For the pathogens, as their disulfide bonds normally serve a critical role in providing physical support, what conformational changes experienced in the host enable their disulfide bonds to be disrupted? A combination of more rigorous biochemical and high-resolution structural studies should begin to address these questions.

  1. Economic Benefit for Cuban Laurel Thrips Biological Control.

    Science.gov (United States)

    Shogren, C; Paine, T D

    2016-02-01

    The Cuban laurel thrips, Gynaikothrips ficorum Marchal (Thysanoptera: Phlaeothripidae), is a critical insect pest of Ficus microcarpa in California urban landscapes and production nurseries. Female thrips feed and oviposit on young Ficus leaves, causing the expanding leaves to fold or curl into a discolored leaf gall. There have been attempts to establish specialist predator natural enemies of the thrips, but no success has been reported. We resampled the same areas in 2013-2014 where we had released Montandoniola confusa (= morguesi) Streito and Matocq (Hemiptera: Anthocoridae) in southern California in 1995 but had been unable to recover individuals in 1997-1998. Thrips galls were significantly reduced in all three of the locations in the recent samples compared with the earlier samples. M. confusa was present in all locations and appears to be providing successful biological control. The value of the biological control, the difference between street trees in good foliage condition and trees with poor foliage, was $58,766,166. If thrips damage reduced the foliage to very poor condition, the value of biological control was $73,402,683. Total cost for the project was $61,830. The benefit accrued for every dollar spent on the biological control of the thrips ranged from $950, if the foliage was in poor condition, to $1,187, if the foliage was in very poor condition. The value of urban forest is often underappreciated. Economic analyses that clearly demonstrate the very substantial rates of return on investment in successful biological control in urban forests provide compelling arguments for supporting future efforts. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Biomimicry of volatile-based microbial control for managing emerging fungal pathogens.

    Science.gov (United States)

    Gabriel, K T; Joseph Sexton, D; Cornelison, C T

    2018-05-01

    Volatile organic compounds (VOCs) are known to be produced by a wide range of micro-organisms and for a number of purposes. Volatile-based microbial inhibition in environments such as soil is well-founded, with numerous antimicrobial VOCs having been identified. Inhibitory VOCs are of interest as microbial control agents, as low concentrations of gaseous VOCs can elicit significant antimicrobial effects. Volatile organic compounds are organic chemicals typically characterized as having low molecular weight, low solubility in water, and high vapour pressure. Consequently, VOCs readily evaporate to the gaseous phase at standard temperature and pressure. This contact-independent antagonism presents unique advantages over traditional, contact-dependent microbial control methods, including increased surface exposure and reduced environmental persistence. This approach has been the focus of our recent research, with positive results suggesting it may be particularly promising for the management of emerging fungal pathogens, such as the causative agents of white-nose syndrome of bats and snake fungal disease, which are difficult or impossible to treat using traditional approaches. Here, we review the history of volatile-based microbial control, discuss recent progress in formulations that mimic naturally antagonistic VOCs, outline the development of a novel treatment device, and highlight areas where further work is needed to successfully deploy VOCs against existing and emerging fungal pathogens. © 2017 The Society for Applied Microbiology.

  3. Identification of an Endophytic Antifungal Bacterial Strain Isolated from the Rubber Tree and Its Application in the Biological Control of Banana Fusarium Wilt.

    Directory of Open Access Journals (Sweden)

    Deguan Tan

    Full Text Available Banana Fusarium wilt (also known as Panama disease is one of the most disastrous plant diseases. Effective control methods are still under exploring. The endophytic bacterial strain ITBB B5-1 was isolated from the rubber tree, and identified as Serratia marcescens by morphological, biochemical, and phylogenetic analyses. This strain exhibited a high potential for biological control against the banana Fusarium disease. Visual agar plate assay showed that ITBB B5-1 restricted the mycelial growth of the pathogenic fungus Fusarium oxysporum f. sp. cubense race 4 (FOC4. Microscopic observation revealed that the cell wall of the FOC4 mycelium close to the co-cultured bacterium was partially decomposed, and the conidial formation was prohibited. The inhibition ratio of the culture fluid of ITBB B5-1 against the pathogenic fungus was 95.4% as estimated by tip culture assay. Chitinase and glucanase activity was detected in the culture fluid, and the highest activity was obtained at Day 2 and Day 3 of incubation for chitinase and glucanase, respectively. The filtrated cell-free culture fluid degraded the cell wall of FOC4 mycelium. These results indicated that chitinase and glucanase were involved in the antifungal mechanism of ITBB B5-1. The potted banana plants that were inoculated with ITBB B5-1 before infection with FOC4 showed 78.7% reduction in the disease severity index in the green house experiments. In the field trials, ITBB B5-1 showed a control effect of approximately 70.0% against the disease. Therefore, the endophytic bacterial strain ITBB B5-1 could be applied in the biological control of banana Fusarium wilt.

  4. [Bacillus thuringiensis: general aspects. An approach to its use in the biological control of lepidopteran insects behaving as agricultural pests].

    Science.gov (United States)

    Sauka, Diego H; Benintende, Graciela B

    2008-01-01

    Bacillus thuringiensis is the most widely applied biological pesticide used to control insects that affect agriculture and forestry and which transmit human and animal pathogens. During the past decades B. thuringiensis has been the subject of intensive research. These efforts have yielded considerable data about the relationships between the structure, mechanism of action, and genetics of their pesticidal crystal proteins. As a result, a coherent picture of these relationships has emerged. Other studies have focused on the ecological role of the B. thuringiensis crystal proteins and their performance in agricultural and other natural settings. With this knowledge as background and the help of biotechnological tools, researchers are now reporting promising results in the development of more useful toxins, recombinant bacteria, new formulations and transgenic plants that express pesticidal activity, in order to assure that these products are utilized with the best efficiency and benefit. This article is an attempt to integrate all these recent developments in the study of B. thuringiensis into a context of biological control of lepidopteran insect pest of agricultural importance.

  5. MODELING HOST-PATHOGEN INTERACTIONS: COMPUTATIONAL BIOLOGY AND BIOINFORMATICS FOR INFECTIOUS DISEASE RESEARCH (Session introduction)

    Energy Technology Data Exchange (ETDEWEB)

    McDermott, Jason E.; Braun, Pascal; Bonneau, Richard A.; Hyduke, Daniel R.

    2011-12-01

    Pathogenic infections are a major cause of both human disease and loss of crop yields and animal stocks and thus cause immense damage to the worldwide economy. The significance of infectious diseases is expected to increase in an ever more connected warming world, in which new viral, bacterial and fungal pathogens can find novel hosts and ecologic niches. At the same time, the complex and sophisticated mechanisms by which diverse pathogenic agents evade defense mechanisms and subvert their hosts networks to suit their lifestyle needs is still very incompletely understood especially from a systems perspective [1]. Thus, understanding host-pathogen interactions is both an important and a scientifically fascinating topic. Recently, technology has offered the opportunity to investigate host-pathogen interactions on a level of detail and scope that offers immense computational and analytical possibilities. Genome sequencing was pioneered on some of these pathogens, and the number of strains and variants of pathogens sequenced to date vastly outnumbers the number of host genomes available. At the same time, for both plant and human hosts more and more data on population level genomic variation becomes available and offers a rich field for analysis into the genetic interactions between host and pathogen.

  6. Bacillus cereus un patógeno importante en el control microbiológico de los alimentos / Bacillus cereus an important pathogen the microbiological control of food

    Directory of Open Access Journals (Sweden)

    Jennifer Sánchez

    2016-05-01

    Full Text Available Resumen Bacillus cereus es una bacteria genéticamente diversa que se encuentra comúnmente en el ambiente. Contamina los alimentos afectando la salud humana, al ingerir el microorganismo y/o sus toxinas, la emética o las enterotoxinas. En Colombia son escasos los reportes de intoxicación por B. cereus y se estima que hay un gran subregistro. Por lo anterior, se recomienda aumentar la vigilancia de este patógeno y realizar estudios sobre aspectos relevantes que permitan aplicar medidas de control para disminuir las intoxicaciones por B. cereus. El objetivo de esta revisión bibliográfica es presentar información actualizada sobre B. cereus, que incluye aspectos de su biología, taxonomía, toxinas, alimentos que contamina y metodologías para detectar, prevenir y controlar este microorganismo. La información presentada es de utilidad para el público en general, especialmente personas vinculadas al sector de alimentos, inocuidad alimentaria y control de procesos. / Abstract Bacillus cereus is a genetically diverse bacterium commonly found in the environment. It contaminates food, thus affecting human health upon ingestion of the microorganism and/or its toxins, the emetic or enterotoxins. In Colombia, reports of intoxication by B. cereus are scarce and under-registration is presumed. Because of this, it is recommended to increase surveillance of this pathogen and to develop studies on relevant aspects that allow the application of control measures to reduce intoxications by B. cereus. The aim of this review is to present current information on B. cereus, including aspects of its biology, taxonomy, toxins, food that it contaminates and methodologies for the detection, prevention and control of this microorganism. This information is useful for the general public, especially people involved with the food sector, food safety and process control.

  7. Biological control of Mycosphaerella fragariae in strawberry culture

    Directory of Open Access Journals (Sweden)

    Anderson Luis Heling

    2015-12-01

    Full Text Available The Mycosphaerella spot is one of the main foliar diseases of strawberry, degrating great leaf regions and reducing the photosynthetic area. Its control is mainly by the use of chemical fungicides, but, due the increasing demand for food free of pesticide, alternative control methods have been researched, such as biological control. This work aimed to evaluate the effect on strawberry plants, treated with the biological control agents Bacillus cereus, Saccharomyces boulardii and Saccharomyces cerevisiae, in the severity of Mycosphaerella fragariae, productivity and in the activity of β-1.3 glucanases, peroxidases and chitinases enzymes. It was verified that S. cerevisiae and B. cereus treatments were similar to fungicide for disease control. However, even reducing the severity of the disease, there was no increase in productivity, and the different control agents do not cause changes in the evaluated defense mechanisms.

  8. A Biomechanical Comparison of Proportional Electromyography Control to Biological Torque Control Using a Powered Hip Exoskeleton

    Directory of Open Access Journals (Sweden)

    Aaron J. Young

    2017-06-01

    Full Text Available BackgroundDespite a large increase in robotic exoskeleton research, there are few studies that have examined human performance with different control strategies on the same exoskeleton device. Direct comparison studies are needed to determine how users respond to different types of control. The purpose of this study was to compare user performance using a robotic hip exoskeleton with two different controllers: a controller that targeted a biological hip torque profile and a proportional myoelectric controller.MethodsWe tested both control approaches on 10 able-bodied subjects using a pneumatically powered hip exoskeleton. The state machine controller targeted a biological hip torque profile. The myoelectric controller used electromyography (EMG of lower limb muscles to produce a proportional control signal for the hip exoskeleton. Each subject performed two 30-min exoskeleton walking trials (1.0 m/s using each controller and a 10-min trial with the exoskeleton unpowered. During each trial, we measured subjects’ metabolic cost of walking, lower limb EMG profiles, and joint kinematics and kinetics (torques and powers using a force treadmill and motion capture.ResultsCompared to unassisted walking in the exoskeleton, myoelectric control significantly reduced metabolic cost by 13% (p = 0.005 and biological hip torque control reduced metabolic cost by 7% (p = 0.261. Subjects reduced muscle activity relative to the unpowered condition for a greater number of lower limb muscles using myoelectric control compared to the biological hip torque control. More subjects subjectively preferred the myoelectric controller to the biological hip torque control.ConclusionMyoelectric control had more advantages (metabolic cost and muscle activity reduction compared to a controller that targeted a biological torque profile for walking with a robotic hip exoskeleton. However, these results were obtained with a single exoskeleton device with specific

  9. A Biomechanical Comparison of Proportional Electromyography Control to Biological Torque Control Using a Powered Hip Exoskeleton.

    Science.gov (United States)

    Young, Aaron J; Gannon, Hannah; Ferris, Daniel P

    2017-01-01

    Despite a large increase in robotic exoskeleton research, there are few studies that have examined human performance with different control strategies on the same exoskeleton device. Direct comparison studies are needed to determine how users respond to different types of control. The purpose of this study was to compare user performance using a robotic hip exoskeleton with two different controllers: a controller that targeted a biological hip torque profile and a proportional myoelectric controller. We tested both control approaches on 10 able-bodied subjects using a pneumatically powered hip exoskeleton. The state machine controller targeted a biological hip torque profile. The myoelectric controller used electromyography (EMG) of lower limb muscles to produce a proportional control signal for the hip exoskeleton. Each subject performed two 30-min exoskeleton walking trials (1.0 m/s) using each controller and a 10-min trial with the exoskeleton unpowered. During each trial, we measured subjects' metabolic cost of walking, lower limb EMG profiles, and joint kinematics and kinetics (torques and powers) using a force treadmill and motion capture. Compared to unassisted walking in the exoskeleton, myoelectric control significantly reduced metabolic cost by 13% ( p  = 0.005) and biological hip torque control reduced metabolic cost by 7% ( p  = 0.261). Subjects reduced muscle activity relative to the unpowered condition for a greater number of lower limb muscles using myoelectric control compared to the biological hip torque control. More subjects subjectively preferred the myoelectric controller to the biological hip torque control. Myoelectric control had more advantages (metabolic cost and muscle activity reduction) compared to a controller that targeted a biological torque profile for walking with a robotic hip exoskeleton. However, these results were obtained with a single exoskeleton device with specific control configurations while level walking at a

  10. Evaluation of cellulose substrates treated with Metarhizium anisopliae (Metschnikoff Sorokin as a biological control agent against the termite Microcerotermes diversus Silvestri (Isoptera: Termitidae

    Directory of Open Access Journals (Sweden)

    Behzad Habibpour

    2011-08-01

    Full Text Available This article is the first report on the promising effect of an entomopathogenic fungus, Metarhizium anisopliae (Metschnikoff Sorokin to control populations of Microcerotermes diversus Silvestri. Biological control is an alternative to the long-term usage of chemical pesticides. M. anisopliae, the causal agent of green muscardine disease of insects, is an important fungus in biological control of insect pests. Bait systems can eliminate entire colonies of subterranean termites. Baiting reduces adverse environmental impacts caused by organochlorine and organophosphate pesticides in the control of termites and creates sustainable protection of buildings against their invasion. Treated-sawdust bait was applied by two methods: a combination of treated sawdust and untreated filter paper, and b combination of treated sawdust and untreated sawdust. When combinations of treated sawdust and untreated sawdust were used, LC50 and LC90 were 8.4×106 and 3.9×107 (spore/ml, respectively. With the use of improved bait formula and more virulent strains, we hope to achieve better control of termite colonies and enable pathogens to become a useful element in the Integrated Pest Management system.

  11. Use of an optical trap for study of host-pathogen interactions for dynamic live cell imaging.

    Science.gov (United States)

    Tam, Jenny M; Castro, Carlos E; Heath, Robert J W; Mansour, Michael K; Cardenas, Michael L; Xavier, Ramnik J; Lang, Matthew J; Vyas, Jatin M

    2011-07-28

    Dynamic live cell imaging allows direct visualization of real-time interactions between cells of the immune system(1, 2); however, the lack of spatial and temporal control between the phagocytic cell and microbe has rendered focused observations into the initial interactions of host response to pathogens difficult. Historically, intercellular contact events such as phagocytosis(3) have been imaged by mixing two cell types, and then continuously scanning the field-of-view to find serendipitous intercellular contacts at the appropriate stage of interaction. The stochastic nature of these events renders this process tedious, and it is difficult to observe early or fleeting events in cell-cell contact by this approach. This method requires finding cell pairs that are on the verge of contact, and observing them until they consummate their contact, or do not. To address these limitations, we use optical trapping as a non-invasive, non-destructive, but fast and effective method to position cells in culture. Optical traps, or optical tweezers, are increasingly utilized in biological research to capture and physically manipulate cells and other micron-sized particles in three dimensions(4). Radiation pressure was first observed and applied to optical tweezer systems in 1970(5, 6), and was first used to control biological specimens in 1987(7). Since then, optical tweezers have matured into a technology to probe a variety of biological phenomena(8-13). We describe a method(14) that advances live cell imaging by integrating an optical trap with spinning disk confocal microscopy with temperature and humidity control to provide exquisite spatial and temporal control of pathogenic organisms in a physiological environment to facilitate interactions with host cells, as determined by the operator. Live, pathogenic organisms like Candida albicans and Aspergillus fumigatus, which can cause potentially lethal, invasive infections in immunocompromised individuals(15, 16) (e.g. AIDS

  12. Economic value of biological control in integrated pest management of managed plant systems.

    Science.gov (United States)

    Naranjo, Steven E; Ellsworth, Peter C; Frisvold, George B

    2015-01-07

    Biological control is an underlying pillar of integrated pest management, yet little focus has been placed on assigning economic value to this key ecosystem service. Setting biological control on a firm economic foundation would help to broaden its utility and adoption for sustainable crop protection. Here we discuss approaches and methods available for valuation of biological control of arthropod pests by arthropod natural enemies and summarize economic evaluations in classical, augmentative, and conservation biological control. Emphasis is placed on valuation of conservation biological control, which has received little attention. We identify some of the challenges of and opportunities for applying economics to biological control to advance integrated pest management. Interaction among diverse scientists and stakeholders will be required to measure the direct and indirect costs and benefits of biological control that will allow farmers and others to internalize the benefits that incentivize and accelerate adoption for private and public good.

  13. Efficiency of using green algae as biological controllers against toxic ...

    African Journals Online (AJOL)

    Efficiency of using green algae as biological controllers against toxic algal taxa in cultured ... of two green algal species as biological control of the growth of toxic blue-green algae. ... African Journal of Aquatic Science 2014, 39(4): 443–450 ...

  14. Possibilities of avoidance and control of bacterial plant diseases when using pathogen-tested (certified) or - treated planting material

    NARCIS (Netherlands)

    Janse, J.; Wenneker, M.

    2002-01-01

    Testing of planting material for freedom from phytopathogenic bacteria is an important, although not exclusive, method for control of bacterial diseases of plants. Ideally, pathogen-free or pathogen-/disease-resistant planting material is desirable, but this situation is not always possible on a

  15. Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen

    International Nuclear Information System (INIS)

    Chitra, K.; Annadurai, G.

    2013-01-01

    In this present study the bio conjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were poly dispersed and the size of the silica nanoparticles was in the range of 114-164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 keV and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment of dye and carboxyl group onto the silica nanoparticles surface. The fluorescent silica nanoparticles showed highly efficient fluorescence and the fluorescent emission of silica nanoparticles occurred at 536 nm. The SEM image showed the aggregation of nanoparticles and bacteria. The growth of the pathogenic E. coli was controlled using silica nanoparticles; therefore silica nanoparticles could be used in food packaging material, biomedical material, and so forth. This work provides a rapid, simple, and accurate method for the detection of pathogen using fluorescent-based immunoassay.

  16. Biological characteristics and pathogenicity of a highly pathogenic Shewanella marisflavi infected sea cucumber (Apostichopus uaponicus)

    Science.gov (United States)

    Shewanella marisflavi isolate AP629 was characterized as a novel pathogen of sea cucumber. The LD50 values (14 days) in sea cucumber and swordtail fish were 3.89 × 106 and 4.85 × 104 CFU g-1 body weight, respectively. Studies on S. marisflavi had been conducted, including morphology, physiological a...

  17. The ability to cause infection in a pathogenic fungus uncovers a new biological feature of honey bee viruses.

    Science.gov (United States)

    Li, Zhiguo; Su, Songkun; Hamilton, Michele; Yan, Limin; Chen, Yanping

    2014-07-01

    We demonstrated that honey bee viruses including Deformed wing virus (DWV), Black queen cell virus (BQCV) and Israeli acute paralysis virus (IAPV) could infect and replicate in the fungal pathogen Ascosphaera apis that causes honey bee chalkbrood disease, revealing a novel biological feature of honey bee viruses. The phylogenetic analysis show that viruses of fungal and honey bee origins form two clusters in the phylogenetic trees distinctly and that host range of honey bee viruses is dynamic. Further studies are warranted to investigate the impact of the viruses on the fitness of their fungal host and phenotypic effects the virus-fungus combination has on honey bee hosts. Published by Elsevier Inc.

  18. Transcription control engineering and applications in synthetic biology

    Directory of Open Access Journals (Sweden)

    Michael D. Engstrom

    2017-09-01

    Full Text Available In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein, a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators (cis-factors were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators (trans-factors, giving examples of how cis- and trans-acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli, we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  19. Transcription control engineering and applications in synthetic biology.

    Science.gov (United States)

    Engstrom, Michael D; Pfleger, Brian F

    2017-09-01

    In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein), a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity) levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators ( cis -factors) were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators ( trans- factors), giving examples of how cis- and trans -acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli , we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  20. Modes of action for biological control of Botrytis cinerea by antagonistic bacteria

    Directory of Open Access Journals (Sweden)

    Rana HAIDAR

    2017-01-01

    Full Text Available The role of beneficial bacteria in biocontrol of plant diseases, particularly those caused by the necrotrophic fungus Botrytis cinerea, has been investigated by testing many bacteria under laboratory and field conditions. Bacteria may protect plants against B. cinerea by direct antagonistic interactions between biocontrol agents and this pathogen, as well as indirect effects through the induction of host resistance. This review focuses on various bacteria that act as biological control agents (BCAs of B. cinerea and their associated mechanisms. The modes of action (MoAs include: i synthesis of anti-fungal metabolites, such as antibiotics, cell wall-degrading enzymes and volatile organic compounds (VOCs; ii competition for nutrients and/or a niche; and iii induction of host resistance. The challenge for development of BCAs is to reduce the variability of efficiency and to prove persistence under a large range of conditions. We discuss the advantages and drawbacks of MoA for future applications of bacteria in the field and in post-harvest storage, as well as combination of different MoAs as a strategy to achieve a more regular efficacy.

  1. Arms Control: US and International efforts to ban biological weapons

    Energy Technology Data Exchange (ETDEWEB)

    1992-12-01

    The Bacteriological (Biological) and Toxin Weapons Convention, the treaty that bans the development, production, and stockpiling and acquisition of biological weapons was opened for signature in 1972 and came into force in 1975 after being ratified by 22 governments, including the depository nations of the USA, the United Kingdom, and the former Soviet Union. In support of the Convention, the USA later established export controls on items used to make biological weapons. Further, in accordance with the 1990 President`s Enhanced Proliferation Control Initiative, actions were taken to redefine and expand US export controls, as well as to encourage multilateral controls through the Australia Group. Thus far, the Convention has not been effective in stopping the development of biological weapons. The principal findings as to the reasons of the failures of the Convention are found to be: the Convention lacks universality, compliance measures are effective, advantage of verification may outweigh disadvantages. Recommendations for mitigating these failures are outlined in this report.

  2. Characterization and control of biological microrobots

    NARCIS (Netherlands)

    Khalil, I.S.M.; Pichel, Marc Philippe; Zondervan, L.; Abelmann, Leon; Misra, Sarthak; Desai, Jaydev P.; Dudek, Gregory; Khatib, Oussama; Kumar, Vijay

    2013-01-01

    This work addresses the characterization and control of Magnetotactic Bacterium (MTB) which can be considered as a biological microrobot. Magnetic dipole moment of the MTB and response to a field-with-alternating-direction are characterized. First, the magnetic dipole moment is characterized using

  3. Characterization and Control of Biological Microrobots

    NARCIS (Netherlands)

    Khalil, I.S.M.; Pichel, Marc Philippe; Pichel, M.P.; Zondervan, L.; Abelmann, Leon; Misra, Sarthak

    2012-01-01

    This work addresses the characterization and control of Magnetotactic Bacterium (MTB) which can be considered as a biological microrobot. Magnetic dipole moment of the MTB and response to a field-with-alternating-direction are characterized. First, the magnetic dipole moment is characterized using

  4. Persistence of Pathogenic and Non-Pathogenic Escherichia coli Strains in Various Tropical Agricultural Soils of India.

    Directory of Open Access Journals (Sweden)

    S Naganandhini

    Full Text Available The persistence of Shiga-like toxin producing E. coli (STEC strains in the agricultural soil creates serious threat to human health through fresh vegetables growing on them. However, the survival of STEC strains in Indian tropical soils is not yet understood thoroughly. Additionally how the survival of STEC strain in soil diverges with non-pathogenic and genetically modified E. coli strains is also not yet assessed. Hence in the present study, the survival pattern of STEC strain (O157-TNAU was compared with non-pathogenic (MTCC433 and genetically modified (DH5α strains on different tropical agricultural soils and on a vegetable growing medium, cocopeat under controlled condition. The survival pattern clearly discriminated DH5α from MTCC433 and O157-TNAU, which had shorter life (40 days than those compared (60 days. Similarly, among the soils assessed, the red laterite and tropical latosol supported longer survival of O157-TNAU and MTCC433 as compared to wetland and black cotton soils. In cocopeat, O157 recorded significantly longer survival than other two strains. The survival data were successfully analyzed using Double-Weibull model and the modeling parameters were correlated with soil physico-chemical and biological properties using principal component analysis (PCA. The PCA of all the three strains revealed that pH, microbial biomass carbon, dehydrogenase activity and available N and P contents of the soil decided the survival of E. coli strains in those soils and cocopeat. The present research work suggests that the survival of O157 differs in tropical Indian soils due to varied physico-chemical and biological properties and the survival is much shorter than those reported in temperate soils. As the survival pattern of non-pathogenic strain, MTCC433 is similar to O157-TNAU in tropical soils, the former can be used as safe model organism for open field studies.

  5. Biological control of Egyptian broomrape (Orobanche aegyptiaca using Fusarium spp.

    Directory of Open Access Journals (Sweden)

    I. Ghannam

    2007-08-01

    Full Text Available The broomrape (Orobanche spp. is an obligate holoparasitic weed that causes severe damage to many important vegetable crops. Many broomrape control strategies have been tested over the years. In this investigation, 125 Fusarium spp. isolates were recovered from diseased broomrape spikes collected from fields in agricultural areas near Hebron. The pathogenicity of isolates on broomrape was evaluated using an inoculum suspension containing mycelia and conidia. The most effective Fusarium isolates significantly increased the dead spikes of broomrape by 33.6–72.7% compared to the control; there was no obvious pathogenic effect on the tomato plants. Fusarium spp. isolates Fu 20, 25 and 119 were identified as F. solani, while Fu 30, 52, 59, 87 and 12-04 were F. oxysporum. In addition, the two previously known Fusarium strains, F. oxysporum strain EId (CNCM-I-1622 (Foxy and F. arthrosporioides strain E4a (CNCM-I-1621 (Farth were equally effective in controlling broomrape parasitizing tomato plants grown in pots, where the dead spikes of broomrape increased by 50.0 and 51.6%, respectively.

  6. Autophagy response: manipulating the mTOR-controlled machinery by amino acids and pathogens.

    Science.gov (United States)

    Fader, Claudio Marcelo; Aguilera, Milton Osmar; Colombo, María Isabel

    2015-10-01

    Macroautophagy is a self-degradative process that normally maintains cellular homeostasis via a lysosomal pathway. It is induced by different stress signals, including nutrients and growth factors' restriction as well as pathogen invasions. These stimuli are modulated by the serine/threonine protein kinase mammalian target of rapamycin (mTOR) which control not only autophagy but also protein translation and gene expression. This review focuses on the important role of mTOR as a master regulator of cell growth and the autophagy pathway. Here, we have discussed the role of intracellular amino acid availability and intracellular pH in the redistribution of autophagic structures, which may contribute to mammalian target of rapamycin complex 1 (mTORC1) activity regulation. We have also discussed that mTORC1 complex and components of the autophagy machinery are localized at the lysosomal surface, representing a fascinating mechanism to control the metabolism, cellular clearance and also to restrain invading intracellular pathogens.

  7. Pathogen Causing Disease of Diagnosis PCR Tecnology

    OpenAIRE

    SEVİNDİK, Emre; KIR, A. Çağrı; BAŞKEMER, Kadir; UZUN, Veysel

    2013-01-01

    Polimerase chain reaction (PCR) with which, the development of recombinant DNA tecnology, a technique commonly used in field of moleculer biology and genetic. Duplication of the target DNA is provided with this technique without the need for cloning. Some fungus species, bacteria, viruses constitutent an important group of pathogenicity in human, animals and plants. There are routinely applied types of PCR in the detection of pathogens infections diseases. These Nested- PCR, Real- Time PCR, M...

  8. Ecological niche of plant pathogens

    Directory of Open Access Journals (Sweden)

    Ecaterina Fodor

    2011-06-01

    Full Text Available Disease ecology is a new approach to the understanding of the spread and dynamics of pathogens in natural and man-made environments. Defining and describing the ecological niche of the pathogens is one of the major tasks for ecological theory, as well as for practitioners preoccupied with the control and forecasting of established and emerging diseases. Niche theory has been periodically revised, not including in an explicit way the pathogens. However, many progresses have been achieved in niche modeling of disease spread, but few attempts were made to construct a theoretical frame for the ecological niche of pathogens. The paper is a review of the knowledge accumulated during last decades in the niche theory of pathogens and proposes an ecological approach in research. It quest for new control methods in what concerns forest plant pathogens, with a special emphasis on fungi like organisms of the genus Phytophthora. Species of Phytophthora are the most successful plant pathogens of the moment, affecting forest and agricultural systems worldwide, many of them being invasive alien organisms in many ecosystems. The hyperspace of their ecological niche is defined by hosts, environment and human interference, as main axes. To select most important variables within the hyperspace, is important the understanding of the complex role of pathogens in the ecosystems as well as for control programs. Biotic relationships within ecosystem of host-pathogen couple are depicted by ecological network and specific metrics attached to this. The star shaped network is characterized by few high degree nodes, by short path lengths and relatively low connectivity, premises for a rapid disturbance spread. 

  9. Ecological niche of plant pathogens

    Directory of Open Access Journals (Sweden)

    Ecaterina Fodor

    2011-02-01

    Full Text Available Disease ecology is a new approach to the understanding of the spread and dynamics of pathogens in natural and man-made environments. Defining and describing the ecological niche of the pathogens is one of the major tasks for ecological theory, as well as for practitioners preoccupied with the control and forecasting of established and emerging diseases. Niche theory has been periodically revised, not including in an explicit way the pathogens. However, many progresses have been achieved in niche modeling of disease spread, but few attempts were made to construct a theoretical frame for the ecological niche of pathogens. The paper is a review of the knowledge accumulated during last decades in the niche theory of pathogens and proposes an ecological approach in research. It quest for new control methods in what concerns forest plant pathogens, with a special emphasis on fungi like organisms of the genus Phytophthora. Species of Phytophthora are the most successful plant pathogens of the moment, affecting forest and agricultural systems worldwide, many of them being invasive alien organisms in many ecosystems. The hyperspace of their ecological niche is defined by hosts, environment and human interference, as main axes. To select most important variables within the hyperspace, is important for the understanding of the complex role of pathogens in the ecosystems as well as for control programs. Biotic relationships within ecosystem of host-pathogen couple are depicted by ecological network and specific metrics attached to this. The star shaped network is characterized by few high degree nodes, by short path lengths and relatively low connectivity, premises for a rapid disturbance spread.

  10. Tramesan, a novel polysaccharide from Trametes versicolor. Structural characterization and biological effects.

    Directory of Open Access Journals (Sweden)

    Marzia Scarpari

    Full Text Available Mushrooms represent a formidable source of bioactive compounds. Some of these may be considered as biological response modifiers; these include compounds with a specific biological function: antibiotics (e.g. plectasin, immune system stimulator (e,g, lentinan, antitumor agents (e.g. krestin, PSK and hypolipidemic agents (e.g. lovastatin inter alia. In this study, we focused on the Chinese medicinal mushroom "yun zhi", Trametes versicolor, traditionally used for (cit. "replenish essence and qi (vital energy". Previous studies indicated the potential activity of extracts from culture filtrate of asexual mycelia of T. versicolor in controlling the growth and secondary metabolism (e.g. mycotoxins of plant pathogenic fungi. The quest of active principles produced by T. versicolor, allowed us characterising an exo-polysaccharide released in its culture filtrate and naming it Tramesan. Herein we evaluate the biological activity of Tramesan in different organisms: plants, mammals and plant pathogenic fungi. We suggest that the bioactivity of Tramesan relies mostly on its ability to act as pro antioxidant molecule regardless the biological system on which it was applied.

  11. The role of ionizing radiation in biological control of agricultural pests

    International Nuclear Information System (INIS)

    Mansour, M.

    2011-01-01

    Although the commercial biological control industry is growing, it still represents only a small portion of the international market of pest control sales (about 3%). This low ratio is due to several factors including high cost of production of biological control agents and technical and regulatory difficulties that complicate the shipping procedures and create trade barriers. This article summarizes the role of ionizing radiation in supporting the use of biological control agents in insect pest control and concentrates on its role in the production, transport, distribution, and release of parasites and predators and the advantages that ionizing radiation can offer, in comparison with traditional techniques. (author)

  12. PHIDIAS: a pathogen-host interaction data integration and analysis system

    OpenAIRE

    Xiang, Zuoshuang; Tian, Yuying; He, Yongqun

    2007-01-01

    The Pathogen-Host Interaction Data Integration and Analysis System (PHIDIAS) is a web-based database system that serves as a centralized source to search, compare, and analyze integrated genome sequences, conserved domains, and gene expression data related to pathogen-host interactions (PHIs) for pathogen species designated as high priority agents for public health and biological security. In addition, PHIDIAS allows submission, search and analysis of PHI genes and molecular networks curated ...

  13. Double impact of sterilizing pathogens: added value of increased life expectancy on pest control effectiveness.

    Science.gov (United States)

    Berec, Luděk; Maxin, Daniel

    2012-06-01

    Sterilizing pathogens are commonly assumed not to affect longevity of infected individuals, and if they do then negatively. Examples abound, however, of species in which the absence of reproduction actually increases life expectancy. This happens because by decreasing the energy outlay on reproduction individuals with lowered reproduction can live longer. Alternatively, fertile individuals are more susceptible to predators or parasitoids if the latter can capitalize on mating signals of the former. Here we develop and analyze an SI epidemiological model to explore whether and to what extent does such a life expectancy prolongation due to sterilizing pathogens affect host dynamics. In particular, we are interested in an added value of increased life expectancy on the possibility of successful pest control, that is, the effect of increased lifespan and hence increased potential of the infected individuals to spread the disease on pest control effectiveness. We show that although the parameter range in which we observe an effect of increased lifespan of the sterilized individuals is not large, the effect itself can be significant. In particular, the increase in pest control effectiveness can be very dramatic when disease transmission efficiency is close to birth rate, mortality rate of susceptibles is relatively high (i.e., the species is relatively short-lived), and sterilization efficiency is relatively high. Our results thus characterize pathogens that are promising candidates for an effective pest control and that might possibly be engineered if not occurring naturally.

  14. Biology of Leptoypha hospita (Hemiptera: Tingidae), a Potential Biological Control Agent of Chinese Privet

    Science.gov (United States)

    Yanzhuo Zhang; James L. Hanula; Scott Horn; Kristine Braman; Jianghua Sun

    2011-01-01

    The biology of Leptoypha hospita Drake et Poor (Hemiptera: Tingidae), a potential biological control agent from China for Chinese privet, Ligustrum sinense Lour., was studied in quarantine in the United States. Both nymphs and adults feed on Chinese privet mesophyll cells that lead to a bleached appearance of leaves and dieback of branch tips. L. hospita has five...

  15. 21 CFR 310.4 - Biologics; products subject to license control.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Biologics; products subject to license control... to license control. (a) If a drug has an approved license under section 351 of the Public Health.... (b) To obtain marketing approval for radioactive biological products for human use, as defined in...

  16. ESSENTIAL OILS OF CYMBOPOGON SP. IN THE CONTROL OF FOODBORNE PATHOGENIC BACTERIA

    Directory of Open Access Journals (Sweden)

    Danilo Florisvaldo BRUGNERA

    2011-08-01

    Full Text Available In this study, the agar well diffusion technique was used to determine the antibacterial activity of Cymbopogon nardus (citronella and Cymbopogon citratus (lemongrass essential oils, which were applied at different concentrations. The bacterial species used were the foodborne pathogens Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. Both essential oils presented antibacterial activity in most concentrations tested. The Minimum Inhibitory Concentrations (MICs founded were: 7.81μL/mL (S. aureus and 3.90μL/mL (E. coli and P. aeruginosa, for C. nardus essential oil; and 3.90μL/mL (S. aureus, E. coli and P. aeruginosa, for C. citratus essential oil. The essential oils used were shown as promising natural antibacterials for pathogenic bacteria control in the food industry.

  17. Quorum sensing and bacterial pathogenicity: From molecules to disease

    Directory of Open Access Journals (Sweden)

    Antariksh Deep

    2011-01-01

    Full Text Available Quorum sensing in prokaryotic biology refers to the ability of a bacterium to sense information from other cells in the population when they reach a critical concentration (i.e. a Quorum and communicate with them. The "language" used for this intercellular communication is based on small, self-generated signal molecules called as autoinducers. Quorum sensing is thought to afford pathogenic bacteria a mechanism to minimize host immune responses by delaying the production of tissue-damaging virulence factors until sufficient bacteria have amassed and are prepared to overwhelm host defense mechanisms and establish infection. Quorum sensing systems are studied in a large number of gram-negative bacterial species belonging to α, β, and γ subclasses of proteobacteria. Among the pathogenic bacteria, Pseudomonas aeruginosa is perhaps the best understood in terms of the virulence factors regulated and the role the Quorum sensing plays in pathogenicity. Presently, Quorum sensing is considered as a potential novel target for antimicrobial therapy to control multi/all drug-resistant infections. This paper reviews Quorum sensing in gram positive and gram negative bacteria and its role in biofilm formation.

  18. Biological effect of penetration controlled irradiation with ion beams

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Atsushi; Shimizu, Takashi; Kikuchi, Masahiro; Kobayashi, Yasuhiko; Watanabe, Hiroshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Yamashita, Takao

    1997-03-01

    To investigate the effect of local irradiation with ion beams on biological systems, technique for penetration controlled irradiation has been established. The range in a target was controlled by changing the distance from beam window in the atmosphere, and could be controlled linearly up to about 31 {mu}m in biological material. In addition, the effects of the penetration controlled irradiations with 1.5 MeV/u C and He ions were examined using tobacco pollen. The increased frequency of leaky pollen produced by ion beams suggests that the efficient pollen envelope damages would be induced at the range-end of ion beams. (author)

  19. An immuno-epidemiological model with threshold delay: a study of the effects of multiple exposures to a pathogen.

    Science.gov (United States)

    Qesmi, Redouane; Heffernan, Jane M; Wu, Jianhong

    2015-01-01

    An immuno-epidemiological model of pathogen transmission is developed. This model incorporates two main features: (i) the epidemiological model includes within-host pathogen dynamics for an infectious disease, (ii) the susceptible individuals to the infection experience a series of exposures via the pathogen before becoming infectious. It is shown that this model leads naturally to a system of differential delay equations of the threshold type and that these equations can be transformed, in a biologically natural way, to differential equations with state-dependent delay. An interesting dynamical behavior of the model is the bistability phenomena, when the basic reproductive ratio R0 is less than unity, which raises many new challenges to effective infection control.

  20. Exposure Control--OSHA's Bloodborne Pathogens Standard.

    Science.gov (United States)

    Granville, Mark F.

    1993-01-01

    Explains schools' responsibilities in complying with the Occupational Safety and Health Administration's (OSHA) Bloodborne Pathogens Standard. Describes exposure determination plan, protective equipment, housekeeping practices, labeling of waste, training employees, hepatitis B vaccinations, postexposure evaluation and medical follow-up, and…

  1. Understanding Federal regulations as guidelines for classical biological control programs

    Science.gov (United States)

    Michael E. Montgomery

    2011-01-01

    This chapter reviews the legislation and rules that provide the foundation for federal regulation of the introduction of natural enemies of insects as biological control agents. It also outlines the steps for complying with regulatory requirements, using biological control of Adelges tsugae Annand, the hemlock woolly adelgid (HWA), as an example. The...

  2. Synthetic biology: Novel approaches for microbiology.

    Science.gov (United States)

    Padilla-Vaca, Felipe; Anaya-Velázquez, Fernando; Franco, Bernardo

    2015-06-01

    In the past twenty years, molecular genetics has created powerful tools for genetic manipulation of living organisms. Whole genome sequencing has provided necessary information to assess knowledge on gene function and protein networks. In addition, new tools permit to modify organisms to perform desired tasks. Gene function analysis is speed up by novel approaches that couple both high throughput data generation and mining. Synthetic biology is an emerging field that uses tools for generating novel gene networks, whole genome synthesis and engineering. New applications in biotechnological, pharmaceutical and biomedical research are envisioned for synthetic biology. In recent years these new strategies have opened up the possibilities to study gene and genome editing, creation of novel tools for functional studies in virus, parasites and pathogenic bacteria. There is also the possibility to re-design organisms to generate vaccine subunits or produce new pharmaceuticals to combat multi-drug resistant pathogens. In this review we provide our opinion on the applicability of synthetic biology strategies for functional studies of pathogenic organisms and some applications such as genome editing and gene network studies to further comprehend virulence factors and determinants in pathogenic organisms. We also discuss what we consider important ethical issues for this field of molecular biology, especially for potential misuse of the new technologies. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

  3. Using biological control research in the classroom to promote scientific inquiry and literacy

    Science.gov (United States)

    Many scientists who research biological control also teach at universities or more informally through cooperative outreach. The purpose of this paper is to review biological control activities for the classroom in four refereed journals, The American Biology Teacher, Journal of Biological Education...

  4. PIML: the Pathogen Information Markup Language.

    Science.gov (United States)

    He, Yongqun; Vines, Richard R; Wattam, Alice R; Abramochkin, Georgiy V; Dickerman, Allan W; Eckart, J Dana; Sobral, Bruno W S

    2005-01-01

    A vast amount of information about human, animal and plant pathogens has been acquired, stored and displayed in varied formats through different resources, both electronically and otherwise. However, there is no community standard format for organizing this information or agreement on machine-readable format(s) for data exchange, thereby hampering interoperation efforts across information systems harboring such infectious disease data. The Pathogen Information Markup Language (PIML) is a free, open, XML-based format for representing pathogen information. XSLT-based visual presentations of valid PIML documents were developed and can be accessed through the PathInfo website or as part of the interoperable web services federation known as ToolBus/PathPort. Currently, detailed PIML documents are available for 21 pathogens deemed of high priority with regard to public health and national biological defense. A dynamic query system allows simple queries as well as comparisons among these pathogens. Continuing efforts are being taken to include other groups' supporting PIML and to develop more PIML documents. All the PIML-related information is accessible from http://www.vbi.vt.edu/pathport/pathinfo/

  5. Synthetic biology and regulatory networks: where metabolic systems biology meets control engineering.

    Science.gov (United States)

    He, Fei; Murabito, Ettore; Westerhoff, Hans V

    2016-04-01

    Metabolic pathways can be engineered to maximize the synthesis of various products of interest. With the advent of computational systems biology, this endeavour is usually carried out through in silico theoretical studies with the aim to guide and complement further in vitro and in vivo experimental efforts. Clearly, what counts is the result in vivo, not only in terms of maximal productivity but also robustness against environmental perturbations. Engineering an organism towards an increased production flux, however, often compromises that robustness. In this contribution, we review and investigate how various analytical approaches used in metabolic engineering and synthetic biology are related to concepts developed by systems and control engineering. While trade-offs between production optimality and cellular robustness have already been studied diagnostically and statically, the dynamics also matter. Integration of the dynamic design aspects of control engineering with the more diagnostic aspects of metabolic, hierarchical control and regulation analysis is leading to the new, conceptual and operational framework required for the design of robust and productive dynamic pathways. © 2016 The Author(s).

  6. Using Biological-Control Research in the Classroom to Promote Scientific Inquiry & Literacy

    Science.gov (United States)

    Richardson, Matthew L.; Richardson, Scott L.; Hall, David G.

    2012-01-01

    Scientists researching biological control should engage in education because translating research programs into classroom activities is a pathway to increase scientific literacy among students. Classroom activities focused on biological control target all levels of biological organization and can be cross-disciplinary by drawing from subject areas…

  7. Impact of climate trends on tick-borne pathogen transmission

    Directory of Open Access Journals (Sweden)

    Agustin eEstrada-Pena

    2012-03-01

    Full Text Available Recent advances in climate research together with a better understanding of tick-pathogen interactions, the distribution of ticks and the diagnosis of tick-borne pathogens raise questions about the impact of environmental factors on tick abundance and spread and the prevalence and transmission of tick-borne pathogens. While undoubtedly climate plays a role in the changes in distribution and seasonal abundance of ticks, it is always difficult to disentangle factors impacting on the abundance of tick hosts from those exerted by human habits. All together, climate, host abundance and social factors may explain the upsurge of epidemics transmitted by ticks to humans. Herein we focused on tick-borne pathogens that affect humans with pandemic potential. Borrelia burgdorferi s.l. (Lyme disease, Anaplasma phagocytophilum (human granulocytic anaplasmosis and tick-borne encephalitis virus (tick-borne encephalitis are transmitted by Ixodes spp. Crimean-Congo hemorrhagic fever virus (Crimean-Congo hemorrhagic fever is transmitted by Hyalomma spp. In this review, we discussed how vector tick species occupy the habitat as a function of different climatic factors, and how these factors impact on tick survival and seasonality. How molecular events at the tick-pathogen interface impact on pathogen transmission is also discussed. Results from statistically and biologically derived models are compared to show that while statistical models are able to outline basic information about tick distributions, biologically derived models are necessary to evaluate pathogen transmission rates and understand the effect of climatic variables and host abundance patterns on pathogen transmission. The results of these studies could be used to build early alert systems able to identify the main factors driving the subtle changes in tick distribution and seasonality and the prevalence of tick-borne pathogens.

  8. Tick-Pathogen Ensembles: Do Molecular Interactions Lead Ecological Innovation?

    Czech Academy of Sciences Publication Activity Database

    Cabezas Cruz, Alejandro; Estrada-Peňa, A.; Rego, Ryan O. M.; de la Fuente, J.

    2017-01-01

    Roč. 7, 13 March (2017), č. článku 74. ISSN 2235-2988 Institutional support: RVO:60077344 Keywords : tick-pathogen interactions * transcriptional reprogramming * epigenetics * ecological adaptation * Anaplasma phagocytophilum Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 4.300, year: 2016

  9. Isolation of microorganisms for biological control the moniliophthora roreri

    OpenAIRE

    suarez contreras, liliana yanet; Rangel Riaño, Alba Luz

    2014-01-01

    Moniliophlhora roreri is the causal agent of cocoa Moniliasis, which produces losses of up to 60% of the crop, as it affects only its commercial product, the cob. Biological control appears as an alternative management, using endophytic microorganisms. The reason because of this research came up was that it was aimed to isolate microorganisms with antagonist potential for biological control towards the phytopathogen M. roreri in Norte de Santander. This is done through isolation and identifica...

  10. Genetics of mechanisms controlling responses to two major pathogens in broiler and layer chickens

    DEFF Research Database (Denmark)

    Hamzic, Edin

    The objective of this thesis was to improve the understanding of molecular mechanisms controlling the response to two major pathogens, Eimeria maxima (coccidiosis) and infectious bronchitis virus (IBV), in broiler and layer chickens, respectively. Breeding for the improved response to the two...

  11. Complete genome sequence of Bacillus velezensis S3-1, a potential biological pesticide with plant pathogen inhibiting and plant promoting capabilities.

    Science.gov (United States)

    Jin, Qing; Jiang, Qiuyue; Zhao, Lei; Su, Cuizhu; Li, Songshuo; Si, Fangyi; Li, Shanshan; Zhou, Chenhao; Mu, Yonglin; Xiao, Ming

    2017-10-10

    Antagonistic soil microorganisms, which are non-toxic, harmless non-pollutants, can effectively reduce the density of pathogenic species by some ways. Bacillus velezensis strain S3-1 was isolated from the rhizosphere soil of cucumber, and was shown to inhibit plant pathogens, promote plant growth and efficiently colonize rhizosphere soils. The strain produced 13 kinds of lipopeptide antibiotics, belonging to the surfactin, iturin and fengycin families. Here, we presented the complete genome sequence of S3-1. The genome consists of one chromosome without plasmids and also contains the biosynthetic gene cluster that encodes difficidin, macrolactin, surfactin and fengycin. The genome contains 86 tRNA genes, 27 rRNA genes and 57 antibiotic-related genes. The complete genome sequence of B. velezensis S3-1 provides useful information to further detect the molecular mechanisms behind antifungal actions, and will facilitate its potential as a biological pesticide in the agricultural industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Food-borne pathogens

    International Nuclear Information System (INIS)

    Niemand, J.G.

    1985-01-01

    The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process

  13. The systems biology of host pathogen interactions.

    Directory of Open Access Journals (Sweden)

    Nikolai Petrovsky

    2013-06-01

    Full Text Available Infectious diseases constitute a major public health burden, particularly in developing countries. Amongst the pathogens afflicting humans, malaria, HIV, shigellosis and tuberculosis (TB cause a large number of deaths. Whilst antivirals, antibiotics and antiparasitic drugs have all helped to reduce the burden of disease, problems of drug resistance are increasingly common, presenting the need to come up with alternative approaches to disease prevention. Ideally, effective prophylactic vaccines would be developed against each of these infections, but unfortunately with the exception of TB, no vaccine is currently available against the other three infections. Baring a breakthrough, coming for example from the application of newer more potent adjuvants to vaccine candidates, new paradigms are needed to help tackle these infectious diseases.

  14. Biologically controlled minerals as potential indicators of life

    Science.gov (United States)

    Schwartz, D. E.; Mancinelli, R. L.; Kaneshiro, E.

    1991-01-01

    Minerals can be produced and deposited either by abiotic or biologic means. Regardless of their origin, mineral crystals reflect the environment conditions (e.g., temperature, pressure, chemical composition, and redox potential) present during crystal formation. Biologically-produced mineral crystals are grown or reworked under the control of their host organism and reflect an environment different from the abiotic environment. In addition, minerals of either biologic or abiotic origin have great longevities. For these reasons, biologically produced minerals have been proposed as biomarkers. Biomarkers are key morphological, chemical, and isotopic signatures of living systems that can be used to determine if life processes have occurred. Studies of biologically controlled minerals produced by the protist, Paramecium tetraurelia, were initiated since techniques have already been developed to culture them and isolate their crystalline material, and methods are already in place to analyze this material. Two direct crystalline phases were identified. One phase, whose chemical composition is high in Mg, was identified as struvite. The second phase, whose chemical composition is high in Ca, has not been previously found occurring naturally and may be considered a newly discovered material. Analyses are underway to determine the characteristics of these minerals in order to compare them with characteristics of these minerals in order to compare them with characteristics of minerals formed abiotically, but with the same chemical composition.

  15. Prevalence of bloodstream pathogens is higher in neonatal encephalopathy cases vs. controls using a novel panel of real-time PCR assays.

    Science.gov (United States)

    Tann, Cally J; Nkurunziza, Peter; Nakakeeto, Margaret; Oweka, James; Kurinczuk, Jennifer J; Were, Jackson; Nyombi, Natasha; Hughes, Peter; Willey, Barbara A; Elliott, Alison M; Robertson, Nicola J; Klein, Nigel; Harris, Kathryn A

    2014-01-01

    In neonatal encephalopathy (NE), infectious co-morbidity is difficult to diagnose accurately, but may increase the vulnerability of the developing brain to hypoxia-ischemia. We developed a novel panel of species-specific real-time PCR assays to identify bloodstream pathogens amongst newborns with and without NE in Uganda. Multiplex real-time PCR assays for important neonatal bloodstream pathogens (gram positive and gram negative bacteria, cytomegalovirus (CMV), herpes simplex virus(HSV) and P. falciparum) were performed on whole blood taken from 202 encephalopathic and 101 control infants. Automated blood culture (BACTEC) was performed for all cases and unwell controls. Prevalence of pathogenic bacterial species amongst infants with NE was 3.6%, 6.9% and 8.9%, with culture, PCR and both tests in combination, respectively. More encephalopathic infants than controls had pathogenic bacterial species detected (8.9%vs2.0%, p = 0.028) using culture and PCR in combination. PCR detected bacteremia in 11 culture negative encephalopathic infants (3 Group B Streptococcus, 1 Group A Streptococcus, 1 Staphylococcus aureus and 6 Enterobacteriacae). Coagulase negative staphylococcus, frequently detected by PCR amongst case and control infants, was considered a contaminant. Prevalence of CMV, HSV and malaria amongst cases was low (1.5%, 0.5% and 0.5%, respectively). This real-time PCR panel detected more bacteremia than culture alone and provides a novel tool for detection of neonatal bloodstream pathogens that may be applied across a range of clinical situations and settings. Significantly more encephalopathic infants than controls had pathogenic bacterial species detected suggesting that infection may be an important risk factor for NE in this setting.

  16. Prevalence of bloodstream pathogens is higher in neonatal encephalopathy cases vs. controls using a novel panel of real-time PCR assays.

    Directory of Open Access Journals (Sweden)

    Cally J Tann

    Full Text Available In neonatal encephalopathy (NE, infectious co-morbidity is difficult to diagnose accurately, but may increase the vulnerability of the developing brain to hypoxia-ischemia. We developed a novel panel of species-specific real-time PCR assays to identify bloodstream pathogens amongst newborns with and without NE in Uganda.Multiplex real-time PCR assays for important neonatal bloodstream pathogens (gram positive and gram negative bacteria, cytomegalovirus (CMV, herpes simplex virus(HSV and P. falciparum were performed on whole blood taken from 202 encephalopathic and 101 control infants. Automated blood culture (BACTEC was performed for all cases and unwell controls.Prevalence of pathogenic bacterial species amongst infants with NE was 3.6%, 6.9% and 8.9%, with culture, PCR and both tests in combination, respectively. More encephalopathic infants than controls had pathogenic bacterial species detected (8.9%vs2.0%, p = 0.028 using culture and PCR in combination. PCR detected bacteremia in 11 culture negative encephalopathic infants (3 Group B Streptococcus, 1 Group A Streptococcus, 1 Staphylococcus aureus and 6 Enterobacteriacae. Coagulase negative staphylococcus, frequently detected by PCR amongst case and control infants, was considered a contaminant. Prevalence of CMV, HSV and malaria amongst cases was low (1.5%, 0.5% and 0.5%, respectively.This real-time PCR panel detected more bacteremia than culture alone and provides a novel tool for detection of neonatal bloodstream pathogens that may be applied across a range of clinical situations and settings. Significantly more encephalopathic infants than controls had pathogenic bacterial species detected suggesting that infection may be an important risk factor for NE in this setting.

  17. Modulation of pathogen recognition by autophagy

    Directory of Open Access Journals (Sweden)

    Ji Eun eOh

    2012-03-01

    Full Text Available Autophagy is an ancient biological process for maintaining cellular homeostasis by degradation of long-lived cytosolic proteins and organelles. Recent studies demonstrated that autophagy is availed by immune cells to regulate innate immunity. On the one hand, cells exert direct effector function by degrading intracellular pathogens; on the other hand, autophagy modulates pathogen recognition and downstream signaling for innate immune responses. Pathogen recognition via pattern recognition receptors induces autophagy. The function of phagocytic cells is enhanced by recruitment of autophagy-related proteins. Moreover, autophagy acts as a delivery system for viral replication complexes to migrate to the endosomal compartments where virus sensing occurs. In another case, key molecules of the autophagic pathway have been found to negatively regulate immune signaling, thus preventing aberrant activation of cytokine production and consequent immune responses. In this review, we focus on the recent advances in the role of autophagy in pathogen recognition and modulation of innate immune responses.

  18. Biological Risks and Laboratory-Acquired Infections: A Reality That Cannot be Ignored in Health Biotechnology

    Science.gov (United States)

    Coelho, Ana Cláudia; García Díez, Juan

    2015-01-01

    Advances and research in biotechnology have applications over a wide range of areas, such as microbiology, medicine, the food industry, agriculture, genetically modified organisms, and nanotechnology, among others. However, research with pathogenic agents, such as virus, parasites, fungi, rickettsia, bacterial microorganisms, or genetic modified organisms, has generated concern because of their potential biological risk – not only for people, but also for the environment due to their unpredictable behavior. In addition, concern for biosafety is associated with the emergence of new diseases or re-emergence of diseases that were already under control. Biotechnology laboratories require biosafety measures designed to protect their staff, the population, and the environment, which may be exposed to hazardous organisms and materials. Laboratory staff training and education is essential, not only to acquire a good understanding about the direct handling of hazardous biological agents but also knowledge of the epidemiology, pathogenicity, and human susceptibility to the biological materials used in research. Biological risk can be reduced and controlled by the correct application of internationally recognized procedures such as proper microbiological techniques, proper containment apparatus, adequate facilities, protective barriers, and special training and education of laboratory workers. To avoid occupational infections, knowledge about standardized microbiological procedures and techniques and the use of containment devices, facilities, and protective barriers is necessary. Training and education about the epidemiology, pathogenicity, and biohazards of the microorganisms involved may prevent or decrease the risk. In this way, the scientific community may benefit from the lessons learned in the past to anticipate future problems. PMID:25973418

  19. Biological risks and laboratory-acquired infections. A reality that cannot be ignored in health biotechnology

    Directory of Open Access Journals (Sweden)

    Ana Cláudia Coelho

    2015-04-01

    Full Text Available Advances and research in biotechnology have applications over a wide range of areas such as microbiology, medicine, the food industry, agriculture, genetically modified organisms and nanotechnology, among others. However, research with pathogenic agents such as virus, parasites, fungi, rickettsia, bacterial microorganisms or genetic modified organisms has generated concern because of their potential biological risk - not only for people, but also for the environment due to their unpredictable behavior. In addition, concern for biosafety is associated with the emergence of new diseases or re-emergence of diseases that were already under control. Biotechnology laboratories require biosafety measures designed to protect their staff, the population and the environment, which may be exposed to hazardous organisms and materials. Laboratory staff training and education is essential, not only to acquire a good understanding about the direct handling of hazardous biological agents but also knowledge of the epidemiology, pathogenicity and human susceptibility to the biological materials used in research. Biological risk can be reduced and controlled by the correct application of internationally recognized procedures such as proper microbiological techniques, proper containment apparatus, adequate facilities, protective barriers and special training and education of laboratory workers. To avoid occupational infections, knowledge about standardized microbiological procedures and techniques and the use of containment devices, facilities and protective barriers is necessary. Training and education about the epidemiology, pathogenicity and biohazards of the microorganisms involved may prevent or decrease the risk. In this way, the scientific community may benefit from the lessons learned in the past to anticipate future problems.

  20. Use of Gamma Rays to Control of Internal Parasites and Pathogenic Bacteria in Silver side Fish (Bissaria)

    International Nuclear Information System (INIS)

    Shawki, H.A.; El-Hanafy, A.E.A.; Shagar, G.I.A.

    2014-01-01

    The usefulness of Gamma irradiation to control of internal parasites and pathogenic bacteria found in silver side fish (Atherina) (Bissaria) was investigated. The detected parasites and the prevalence were adult Trematode (37.5%); Cestodes (95%) and Nematode (22.5%) for control silver side fish. The counts of detected microorganisms, (Total bacterial count; Psychrophilic bacteria; Mold and yeast; E.coli and Staphyloccous aureus ) were 4.89 ; 2.30; 2.32; 2.31 and 2.04 log 10 cfu/g for control silver side fish, respectively. Applied irradiation doses reduce the infected rate by Trematode, Cestodes and Nematode, furthermore, gamma irradiation with different doses (0.5, 1, 2, 4 and 5 kGy) reduce the microorganisms count of silver side fish (Bissaria) samples and the rate of decrement increase with the dose increase. Total bacterial count was not detected by using dose 5 kGy while Psychrophilic bacteria were completely eliminated using dose 1 kGy. On the other hand mold and yeast; E.coli and Staph aureus in silver side fish samples were not detected after subjected to gamma irradiation with dose 4 kGy. The results suggest that the applied doses completely elimination different internal parasites and pathogenic bacteria found in silver side fish. Thus, it could be conclude that the irradiation dose of 4 kGy can be effectively applied to ensure the safety of internal parasites and pathogenic bacteria found in silver side fish (Atherina) (Bissaria) with regards to these harmful parasites and pathogenic bacteria

  1. Host plant-dependent phenotypic reversion of Ralstonia solanacearum from non-pathogenic to pathogenic forms via alterations in the phcA gene.

    Science.gov (United States)

    Poussier, Stéphane; Thoquet, Philippe; Trigalet-Demery, Danièle; Barthet, Séverine; Meyer, Damien; Arlat, Matthieu; Trigalet, André

    2003-08-01

    Ralstonia solanacearum is a plant pathogenic bacterium that undergoes a spontaneous phenotypic conversion (PC) from a wild-type pathogenic to a non-pathogenic form. PC is often associated with mutations in phcA, which is a key virulence regulatory gene. Until now, reversion to the wild-type pathogenic form has not been observed for PC variants and the biological significance of PC has been questioned. In this study, we characterized various alterations in phcA (eight IS element insertions, three tandem duplications, seven deletions and a base substitution) in 19 PC mutants from the model strain GMI1000. In five of these variants, reversion to the pathogenic form was observed in planta, while no reversion was ever noticed in vitro whatever culture media used. However, reversion was observed for a 64 bp tandem duplication in vitro in the presence of tomato root exudate. This is the first report showing a complete cycle of phenotypic conversion/reversion in a plant pathogenic bacterium.

  2. Human Milk Glycoproteins Protect Infants Against Human Pathogens

    Science.gov (United States)

    Liu, Bo

    2013-01-01

    Abstract Breastfeeding protects the neonate against pathogen infection. Major mechanisms of protection include human milk glycoconjugates functioning as soluble receptor mimetics that inhibit pathogen binding to the mucosal cell surface, prebiotic stimulation of gut colonization by favorable microbiota, immunomodulation, and as a substrate for bacterial fermentation products in the gut. Human milk proteins are predominantly glycosylated, and some biological functions of these human milk glycoproteins (HMGPs) have been reported. HMGPs range in size from 14 kDa to 2,000 kDa and include mucins, secretory immunoglobulin A, bile salt-stimulated lipase, lactoferrin, butyrophilin, lactadherin, leptin, and adiponectin. This review summarizes known biological roles of HMGPs that may contribute to the ability of human milk to protect neonates from disease. PMID:23697737

  3. Biological and epidemiological aspects of the quarantine pathogen Phytophthora ramorum

    Directory of Open Access Journals (Sweden)

    Beatrice Ginetti

    2015-12-01

    Full Text Available Phytophthora ramorum is a quarantine pathogen that causes leaf blight and shoot dieback of the crown, bark cankers and death on a number of both ornamental and forest trees, especially in North America and northern Europe, where it has produced severe outbreaks.In Italy it was first reported in 2002, on Rhodondendron yakushimanum in a Piedmont nursery; after that it seemed to have disappeared, only to re-emerge in 2013 when numerous isolates were detected on batches of Viburnum tinus plants growing in some nurseries in the Pistoia area (Tuscany, which is an important district in the trade of nursery plants world-wide. This work reports on a number of laboratory tests that were carried out on isolates from infected plant samples. The micromorphological and macromorphological characteristics of the pathogen growing on carrot agar (CA, corn meal agar (CMA, malt extract agar (MEA potato dextrose agar, and V8 agar with added PARPNH (see text were determined, as was the growth rate at 10º, 15º, 20º, 25°, 30º, 32º and 35ºC. Molecular analysis was employed to identify the isolates more precisely. Inoculation trials under the bark were also carried out to ascertain the isolate virulence and the Koch’s Postulates.The Plant Protection Service of the Tuscan Region (SFR, Servizio Fitosanitario Regionale was alerted as soon as the pathogen infection was detected and it took the prescribed steps to eradicate the infection in the field and prevent the recurrence of an epidemic.

  4. Augmentative biological control of arthropods in Latin America

    NARCIS (Netherlands)

    Lenteren, van J.C.; Bueno, V.H.P.

    2003-01-01

    Augmentative forms of biological control, where natural enemies are periodically introduced, are applied over large areas in various cropping systems in Latin America. About 25% of the world area under augmentative control is situated in this region. Well-known examples are the use of species of the

  5. 9 CFR 310.25 - Contamination with microorganisms; process control verification criteria and testing; pathogen...

    Science.gov (United States)

    2010-01-01

    ... criteria and testing; pathogen reduction standards. (a) Criteria for verifying process control; E. coli... 1 (E.coli) Establishments that slaughter more than one type of livestock or both livestock and... E. coli that is approved as an AOAC Official Method of the AOAC International (formerly the...

  6. Integrating large-scale data and RNA technology to protect crops from fungal pathogens

    Directory of Open Access Journals (Sweden)

    Ian Joseph Girard

    2016-05-01

    Full Text Available With a rapidly growing human population it is expected that plant science researchers and the agricultural community will need to increase food productivity using less arable land. This challenge is complicated by fungal pathogens and diseases, many of which can severely impact crop yield. Current measures to control fungal pathogens are either ineffective or have adverse effects on the agricultural enterprise. Thus, developing new strategies through research innovation to protect plants from pathogenic fungi is necessary to overcome these hurdles. RNA sequencing technologies are increasing our understanding of the underlying genes and gene regulatory networks mediating disease outcomes. The application of invigorating next generation sequencing strategies to study plant-pathogen interactions has and will provide unprecedented insight into the complex patterns of gene activity responsible for crop protection. However, questions remain about how biological processes in both the pathogen and the host are specified in space directly at the site of infection and over the infection period. The integration of cutting edge molecular and computational tools will provide plant scientists with the arsenal required to identify genes and molecules that play a role in plant protection. Large scale RNA sequence data can then be used to protect plants by targeting genes essential for pathogen viability in the production of stably transformed lines expressing RNA interference molecules, or through foliar applications of double stranded RNA.

  7. Occurrence and Prevalence of Insect Pathogens in Populations of the Codling Moth, Cydia pomonella L.: A Long-Term Diagnostic Survey

    Directory of Open Access Journals (Sweden)

    Regina G. Kleespies

    2013-08-01

    Full Text Available About 20,550 larvae, pupae and adults of the codling moth, Cydia pomonella L., were diagnosed for pathogens during long-term investigations (1955–2012 at the Institute for Biological Control in Darmstadt, Germany. The prevailing entomopathogens diagnosed in these studies were insect pathogenic fungi, especially Beauveria bassiana and Isaria farinosa, the microsporidium, Nosema carpocapsae, the Cydia pomonella granulovirus (CpGV, as well as mostly undetermined bacteria. While the CpGV was observed exclusively in larvae and pupae from laboratory colonies or from field experiments with this virus, entomopathogenic fungi were most frequently diagnosed in last instars in autumn and in diapausing larvae and pupae in spring. B. bassiana was identified as the major fungal pathogen, causing larval prevalences of 0.9% to 100% (mean, about 32%. During prognostic long-term studies in larvae and adults of C. pomonella, N. carpocapsae was diagnosed in codling moth populations from various locations in Germany. The mean prevalence generally ranged between 20% and 50%. Experiments revealed that the fecundity and fertility of microsporidia-infected female adults were significantly reduced compared to healthy ones. The results underpin the importance of naturally occurring microbial antagonists and represent a base for further ecological studies on developing new or additional biological and integrated control strategies.

  8. Non-proliferation issues in the field of biological technologies and dual-use materials

    International Nuclear Information System (INIS)

    Mamadaliev, S.M.; Troitskij, E.N.; Ibraev, R.

    2001-01-01

    In the paper the results of the DTRA 01-00-C-0030 'Strengthening of physical and biological protection' project at the Research Agricultural Institute (Kazakhstan) are discussed. The project was directed on the organization of a reliable physical integrity of dangerous pathogens, on the provision reliable protection around the periphery and outside security of the whole object as well as on the exclusion of possibility of pathogens expansion of dangerous infection material out the controlled working conditions. The central section of the protection is storehouse of microorganism culture

  9. Microgravity as a biological tool to examine host-pathogen interactions and to guide development of therapeutics and preventatives that target pathogenic bacteria.

    Science.gov (United States)

    Higginson, Ellen E; Galen, James E; Levine, Myron M; Tennant, Sharon M

    2016-11-01

    Space exploration programs have long been interested in the effects of spaceflight on biology. This research is important not only in its relevance to future deep space exploration, but also because it has allowed investigators to ask questions about how gravity impacts cell behavior here on Earth. In the 1980s, scientists designed and built the first rotating wall vessel, capable of mimicking the low shear environment found in space. This vessel has since been used to investigate growth of both microorganisms and human tissue cells in low shear modeled microgravity conditions. Bacterial behavior has been shown to be altered both in space and under simulated microgravity conditions. In some cases, bacteria appear attenuated, whereas in others virulence is enhanced. This has consequences not only for manned spaceflight, but poses larger questions about the ability of bacteria to sense the world around them. By using the microgravity environment as a tool, we can exploit this phenomenon in the search for new therapeutics and preventatives against pathogenic bacteria for use both in space and on Earth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Biologically-Inspired Control Architecture for Musical Performance Robots

    Directory of Open Access Journals (Sweden)

    Jorge Solis

    2014-10-01

    Full Text Available At Waseda University, since 1990, the authors have been developing anthropomorphic musical performance robots as a means for understanding human control, introducing novel ways of interaction between musical partners and robots, and proposing applications for humanoid robots. In this paper, the design of a biologically-inspired control architecture for both an anthropomorphic flutist robot and a saxophone playing robot are described. As for the flutist robot, the authors have focused on implementing an auditory feedback system to improve the calibration procedure for the robot in order to play all the notes correctly during a performance. In particular, the proposed auditory feedback system is composed of three main modules: an Expressive Music Generator, a Feed Forward Air Pressure Control System and a Pitch Evaluation System. As for the saxophone-playing robot, a pressure-pitch controller (based on the feedback error learning to improve the sound produced by the robot during a musical performance was proposed and implemented. In both cases studied, a set of experiments are described to verify the improvements achieved while considering biologically-inspired control approaches.

  11. Evaluation of Orius species for biological control of Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae)

    NARCIS (Netherlands)

    Tommasini, M.G.

    2003-01-01

    Key words: Thysanoptera, Frankliniella occidentalis, Heteroptera, Orius leavigatu, Orius majusculu, Orius niger, Orius insidiosus, Biology, Diapause, Biological control.The overall aim of this research was to develop a biological control programme for F. occidentalis through the selection of

  12. Extracellular peptidases of the cereal pathogen Fusarium graminearum.

    Directory of Open Access Journals (Sweden)

    Rohan George Thomas Lowe

    2015-11-01

    Full Text Available The plant pathogenic fungus Fusarium graminearum (Fgr creates economic and health risks in cereals agriculture. Fgr causes head blight (or scab of wheat and stalk rot of corn, reducing yield, degrading grain quality and polluting downstream food products with mycotoxins. Fungal plant pathogens must secrete proteases to access nutrition and to breakdown the structural protein component of the plant cell wall. Research into the proteolytic activity of Fgr is hindered by the complex nature of the suite of proteases secreted. We used a systems biology approach comprising genome analysis, transcriptomics and label-free quantitative proteomics to characterise the peptidases deployed by Fgr during growth. A combined analysis of published microarray transcriptome datasets revealed seven transcriptional groupings of peptidases based on in vitro growth, in planta growth, and sporulation behaviours. An orbitrap MS/MS proteomics technique defined the extracellular proteases secreted by Fusarium graminearum. A meta-classification based on sequence characters and transcriptional/translational activity in planta and in vitro provides a platform to develop control strategies that target Fgr peptidases.

  13. The rhizosphere microbial community in a multiple parallel mineralization system suppresses the pathogenic fungus Fusarium oxysporum

    Science.gov (United States)

    Fujiwara, Kazuki; Iida, Yuichiro; Iwai, Takashi; Aoyama, Chihiro; Inukai, Ryuya; Ando, Akinori; Ogawa, Jun; Ohnishi, Jun; Terami, Fumihiro; Takano, Masao; Shinohara, Makoto

    2013-01-01

    The rhizosphere microbial community in a hydroponics system with multiple parallel mineralization (MPM) can potentially suppress root-borne diseases. This study focused on revealing the biological nature of the suppression against Fusarium wilt disease, which is caused by the fungus Fusarium oxysporum, and describing the factors that may influence the fungal pathogen in the MPM system. We demonstrated that the rhizosphere microbiota that developed in the MPM system could suppress Fusarium wilt disease under in vitro and greenhouse conditions. The microbiological characteristics of the MPM system were able to control the population dynamics of F. oxysporum, but did not eradicate the fungal pathogen. The roles of the microbiological agents underlying the disease suppression and the magnitude of the disease suppression in the MPM system appear to depend on the microbial density. F. oxysporum that survived in the MPM system formed chlamydospores when exposed to the rhizosphere microbiota. These results suggest that the microbiota suppresses proliferation of F. oxysporum by controlling the pathogen's morphogenesis and by developing an ecosystem that permits coexistence with F. oxysporum. PMID:24311557

  14. Opportunities for biological weed control in Europe

    NARCIS (Netherlands)

    Scheepens, P.C.; Müller-Schärer, H.; Kempenaar, C.

    2001-01-01

    The development and application of biological weed control offer greatopportunities not only for farmers, nature conservationists and othervegetation managers but also for institutions and companies that wish tosell plant protection services and products, and for the general publicthat demands safe

  15. Biological control of dodder (Cuscuta campestris L. by fungi pathogens

    Directory of Open Access Journals (Sweden)

    F. Fallahpour

    2016-04-01

    Full Text Available Parasite weeds are the most important yield reducing factors, and among them dodder (Cuscuta campestris L. is an obligate parasite of many plant families. In order to find a suitable biocontrol agent for dodder a study was conducted based on a randomized complete design with four replications at research greenhouse of Faculty of Agriculture, Ferdowsi University of Mashhad, Iran during 2007-2009. Diseased dodders sampled from sugarbeet farms of Chenaran, Iran. After culturing and isolating exiting fungi from infected tissues of dodder, Fusarium sp., Alternaria sp. and Colletotrichum sp. were recognized. Inoculation of isolates was carried out with concenteration of 1×108 spores per ml sterile water at different growth stages of dodder in labratoary and greenhouse. Among different fungi, isolate of 323 of F. oxysporum showed an effective control on germination of dodder seeds and the highest level of plant pathogencity was before the contact of dodder with host and infection in older plants decreased. Infection of this isolate with crops such as sugarbeet (Beta vulgaris L., alfalfa (Medigago sativa L., basil (Ocimum basilicum L., wheat (Triticum aestivum L. and barley (Hordeum vulgare L. showed no symptoms.

  16. Potentially pathogenic amoeba-associated microorganisms in cooling towers and their control.

    Science.gov (United States)

    Pagnier, Isabelle; Merchat, Michèle; La Scola, Bernard

    2009-06-01

    Cooling towers provide a favorable environment for the proliferation of microorganisms. Cooling towers generate a biofilm and often aerosolize contaminated water, thereby increasing the risk of microorganism dissemination by human inhalation. This pathogen dissemination was first revealed by the epidemics of Legionnaires' disease that were directly related to the presence of cooling towers, and since then, the ecology of Legionella pneumophila has been well studied. Each country has specific standards regarding the acceptable amount of microorganisms in cooling tower systems. However, those standards typically only concern L. pneumophila, even though many other microorganisms can also be isolated from cooling towers, including protozoa, bacteria and viruses. Microbiological control of the cooling tower system can be principally achieved by chemical treatments and also by improving the system's construction. Several new treatments are being studied to improve the efficiency of disinfection. However, as most of these treatments continue to focus solely on L. pneumophila, reports of other types of pathogens continue to increase. Therefore, how their dissemination affects the human populous health should be addressed now.

  17. Pythium invasion of plant-based life support systems: biological control and sources

    Science.gov (United States)

    Jenkins, D. G.; Cook, K. L.; Garland, J. L.; Board, K. F.; Sager, J. C. (Principal Investigator)

    2000-01-01

    Invasion of plant-based life support systems by plant pathogens could cause plant disease and disruption of life support capability. Root rot caused by the fungus, Pythium, was observed during tests of prototype plant growth systems containing wheat at the Kennedy Space Center (KSC). We conducted experiments to determine if the presence of complex microbial communities in the plant root zone (rhizosphere) resisted invasion by the Pythium species isolated from the wheat root. Rhizosphere inocula of different complexity (as assayed by community-level physiological profile: CLPP) were developed using a dilution/extinction approach, followed by growth in hydroponic rhizosphere. Pythium growth on wheat roots and concomitant decreases in plant growth were inversely related to the complexity of the inocula during 20-day experiments in static hydroponic systems. Pythium was found on the seeds of several different wheat cultivars used in controlled environmental studies, but it is unclear if the seed-borne fungal strain(s) were identical to the pathogenic strain recovered from the KSC studies. Attempts to control pathogens and their effects in hydroponic life support systems should include early inoculation with complex microbial communities, which is consistent with ecological theory.

  18. Systems biology of fungal infection

    Directory of Open Access Journals (Sweden)

    Fabian eHorn

    2012-04-01

    Full Text Available Elucidation of pathogenicity mechanisms of the most important human pathogenic fungi, Aspergillus fumigatus and Candida albicans, has gained great interest in the light of the steadily increasing number of cases of invasive fungal infections.A key feature of these infections is the interaction of the different fungal morphotypes with epithelial and immune effector cells in the human host. Because of the high level of complexity, it is necessary to describe and understand invasive fungal infection by taking a systems biological approach, i.e., by a comprehensive quantitative analysis of the non-linear and selective interactions of a large number of functionally diverse, and frequently multifunctional, sets of elements, e.g., genes, proteins, metabolites, which produce coherent and emergent behaviours in time and space. The recent advances in systems biology will now make it possible to uncover the structure and dynamics of molecular and cellular cause-effect relationships within these pathogenic interactions.We review current efforts to integrate omics and image-based data of host-pathogen interactions into network and spatio-temporal models. The modelling will help to elucidate pathogenicity mechanisms and to identify diagnostic biomarkers and potential drug targets for therapy and could thus pave the way for novel intervention strategies based on novel antifungal drugs and cell therapy.

  19. Profiling the extended phenotype of plant pathogens: Challenges in Bacterial Molecular Plant Pathology.

    Science.gov (United States)

    Preston, Gail M

    2017-04-01

    One of the most fundamental questions in plant pathology is what determines whether a pathogen grows within a plant? This question is frequently studied in terms of the role of elicitors and pathogenicity factors in the triggering or overcoming of host defences. However, this focus fails to address the basic question of how the environment in host tissues acts to support or restrict pathogen growth. Efforts to understand this aspect of host-pathogen interactions are commonly confounded by several issues, including the complexity of the plant environment, the artificial nature of many experimental infection systems and the fact that the physiological properties of a pathogen growing in association with a plant can be very different from the properties of the pathogen in culture. It is also important to recognize that the phenotype and evolution of pathogen and host are inextricably linked through their interactions, such that the environment experienced by a pathogen within a host, and its phenotype within the host, is a product of both its interaction with its host and its evolutionary history, including its co-evolution with host plants. As the phenotypic properties of a pathogen within a host cannot be defined in isolation from the host, it may be appropriate to think of pathogens as having an 'extended phenotype' that is the product of their genotype, host interactions and population structure within the host environment. This article reflects on the challenge of defining and studying this extended phenotype, in relation to the questions posed below, and considers how knowledge of the phenotype of pathogens in the host environment could be used to improve disease control. What determines whether a pathogen grows within a plant? What aspects of pathogen biology should be considered in describing the extended phenotype of a pathogen within a host? How can we study the extended phenotype in ways that provide insights into the phenotypic properties of pathogens

  20. Macro to microfluidics system for biological environmental monitoring.

    Science.gov (United States)

    Delattre, Cyril; Allier, Cédric P; Fouillet, Yves; Jary, Dorothée; Bottausci, Frederic; Bouvier, Denis; Delapierre, Guillaume; Quinaud, Manuelle; Rival, Arnaud; Davoust, Laurent; Peponnet, Christine

    2012-01-01

    Biological environmental monitoring (BEM) is a growing field of research which challenges both microfluidics and system automation. The aim is to develop a transportable system with analysis throughput which satisfies the requirements: (i) fully autonomous, (ii) complete protocol integration from sample collection to final analysis, (iii) detection of diluted molecules or biological species in a large real life environmental sample volume, (iv) robustness and (v) flexibility and versatility. This paper discusses all these specifications in order to define an original fluidic architecture based on three connected modules, a sampling module, a sample preparation module and a detection module. The sample preparation module highly concentrates on the pathogens present in a few mL samples of complex and unknown solutions and purifies the pathogens' nucleic acids into a few μL of a controlled buffer. To do so, a two-step concentration protocol based on magnetic beads is automated in a reusable macro-to-micro fluidic system. The detection module is a PCR based miniaturized platform using digital microfluidics, where reactions are performed in 64 nL droplets handled by electrowetting on dielectric (EWOD) actuation. The design and manufacture of the two modules are reported as well as their respective performances. To demonstrate the integration of the complete protocol in the same system, first results of pathogen detection are shown. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Selection of Trichogramma for inundative biological control

    NARCIS (Netherlands)

    Pak, G.A.

    1988-01-01

    This thesis presents a study of the potential for biological control of lepidopterous pests on cabbage crops in the Netherlands, by means of inundative releases of the egg parasite Trichogramma (Hymenoptera, Trichogrammatidae). The objective of this study is to investigate the

  2. Incorporating biological control into IPM decision making

    Science.gov (United States)

    Of the many ways biological control can be incorporated into Integrated Pest Management (IPM) programs, natural enemy thresholds are arguably most easily adopted by stakeholders. Integration of natural enemy thresholds into IPM programs requires ecological and cost/benefit crop production data, thr...

  3. PHIDIAS: a pathogen-host interaction data integration and analysis system.

    Science.gov (United States)

    Xiang, Zuoshuang; Tian, Yuying; He, Yongqun

    2007-01-01

    The Pathogen-Host Interaction Data Integration and Analysis System (PHIDIAS) is a web-based database system that serves as a centralized source to search, compare, and analyze integrated genome sequences, conserved domains, and gene expression data related to pathogen-host interactions (PHIs) for pathogen species designated as high priority agents for public health and biological security. In addition, PHIDIAS allows submission, search and analysis of PHI genes and molecular networks curated from peer-reviewed literature. PHIDIAS is publicly available at http://www.phidias.us.

  4. The quantitative basis of the Arabidopsis innate immune system to endemic pathogens depends on pathogen genetics

    DEFF Research Database (Denmark)

    Corwin, Jason A; Copeland, Daniel; Feusier, Julie

    2016-01-01

    The most established model of the eukaryotic innate immune system is derived from examples of large effect monogenic quantitative resistance to pathogens. However, many host-pathogen interactions involve many genes of small to medium effect and exhibit quantitative resistance. We used the Arabido......The most established model of the eukaryotic innate immune system is derived from examples of large effect monogenic quantitative resistance to pathogens. However, many host-pathogen interactions involve many genes of small to medium effect and exhibit quantitative resistance. We used....... cinerea, we identified a total of 2,982 genes associated with quantitative resistance using lesion area and 3,354 genes associated with camalexin production as measures of the interaction. Most genes were associated with resistance to a specific Botrytis isolate, which demonstrates the influence...... genes associated with quantitative resistance. Using publically available co-expression data, we condensed the quantitative resistance associated genes into co-expressed gene networks. GO analysis of these networks implicated several biological processes commonly connected to disease resistance...

  5. An Integrated Biological Control System At Hanford

    International Nuclear Information System (INIS)

    Johnson, A.R.; Caudill, J.G.; Giddings, R.F.; Rodriguez, J.M.; Roos, R.C.; Wilde, J.W.

    2010-01-01

    In 1999 an integrated biological control system was instituted at the U.S. Department of Energy's Hanford Site. Successes and changes to the program needed to be communicated to a large and diverse mix of organizations and individuals. Efforts at communication are directed toward the following: Hanford Contractors (Liquid or Tank Waste, Solid Waste, Environmental Restoration, Science and Technology, Site Infrastructure), General Hanford Employees, and Hanford Advisory Board (Native American Tribes, Environmental Groups, Local Citizens, Washington State and Oregon State regulatory agencies). Communication was done through direct interface meetings, individual communication, where appropriate, and broadly sharing program reports. The objectives of the communication efforts was to have the program well coordinated with Hanford contractors, and to have the program understood well enough that all stakeholders would have confidence in the work performed by the program to reduce or elimate spread of radioactive contamination by biotic vectors. Communication of successes and changes to an integrated biological control system instituted in 1999 at the Department of Energy's Hanford Site have required regular interfaces with not only a diverse group of Hanford contractors (i.e., those responsible for liquid or tank waste, solid wastes, environmental restoration, science and technology, and site infrastructure), and general Hanford employees, but also with a consortium of designated stake holders organized as the Hanford Advisory Board (i.e., Native American tribes, various environmental groups, local citizens, Washington state and Oregon regulatory agencies, etc.). Direct interface meetings, individual communication where appropriate, and transparency of the biological control program were the methods and outcome of this effort.

  6. AN INTEGRATED BIOLOGICAL CONTROL SYSTEM AT HANFORD

    Energy Technology Data Exchange (ETDEWEB)

    JOHNSON AR; CAUDILL JG; GIDDINGS RF; RODRIGUEZ JM; ROOS RC; WILDE JW

    2010-02-11

    In 1999 an integrated biological control system was instituted at the U.S. Department of Energy's Hanford Site. Successes and changes to the program needed to be communicated to a large and diverse mix of organizations and individuals. Efforts at communication are directed toward the following: Hanford Contractors (Liquid or Tank Waste, Solid Waste, Environmental Restoration, Science and Technology, Site Infrastructure), General Hanford Employees, and Hanford Advisory Board (Native American Tribes, Environmental Groups, Local Citizens, Washington State and Oregon State regulatory agencies). Communication was done through direct interface meetings, individual communication, where appropriate, and broadly sharing program reports. The objectives of the communication efforts was to have the program well coordinated with Hanford contractors, and to have the program understood well enough that all stakeholders would have confidence in the work performed by the program to reduce or elimated spread of radioactive contamination by biotic vectors. Communication of successes and changes to an integrated biological control system instituted in 1999 at the Department of Energy's Hanford Site have required regular interfaces with not only a diverse group of Hanford contractors (i.e., those responsible for liquid or tank waste, solid wastes, environmental restoration, science and technology, and site infrastructure), and general Hanford employees, but also with a consortium of designated stake holders organized as the Hanford Advisory Board (i.e., Native American tribes, various environmental groups, local citizens, Washington state and Oregon regulatory agencies, etc.). Direct interface meetings, individual communication where appropriate, and transparency of the biological control program were the methods and outcome of this effort.

  7. Biological control of Meloidogyne incognita by Trichoderma ...

    African Journals Online (AJOL)

    Biological control against the root-knot nematode, Meloidogyne incognita was proven to occur in tomato, Solanum lycopersicom, soil-drenched with different isolates of Trichoderma harzianum and a commercial suspension of Serratia marcescens (Nemaless). The potential of such biocontrol agents to trigger plant defense ...

  8. Bioactive Metabolites from Pathogenic and Endophytic Fungi of Forest Trees.

    Science.gov (United States)

    Masi, Marco; Maddau, Lucia; Linaldeddu, Benedetto Teodoro; Scanu, Bruno; Evidente, Antonio; Cimmino, Alessio

    2018-01-01

    Fungi play an important role in terrestrial ecosystems interacting positively or negatively with plants. These interactions are complex and the outcomes are different depending on the fungal lifestyles, saprotrophic, mutualistic or pathogenic. Furthermore, fungi are well known for producing secondary metabolites, originating from different biosynthetic pathways, which possess biological properties of considerable biotechnological interest. Among the terrestrial ecosystems, temperate forests represent an enormous reservoir of fungal diversity. This review will highlight the goldmine of secondary metabolites produced by pathogenic and endophytic fungi of forest trees with focus on their biological activities. A structured search of bibliographic databases for peer-reviewed research literature was undertaken using a research discovery application providing access to a large and authoritative source of references. The papers selected were examined and the main results were reported and discussed. Two hundred forthy-one papers were included in the review, outlined a large number of secondary metabolites produced by pathogenic and endophiltic fungi and their biological activities, including phytotoxic, antifungal, antioomycetes, antibacterial, brine shrimp lethality, mosquito biting deterrence and larvicidal, cytotoxic, antiproliferative and many other bioactivities. The findings of this review confirm the importance of secondary metabolites produced by pathogenic and endophytic fungi from forest plants growing in temperate regions as an excellent prospects to discover compounds with new bioactivities and mode of actions. In addition, the potential of some metabolites as a source of new drugs and biopesticides is underlined. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  9. 75 FR 64984 - Availability of an Environmental Assessment for a Biological Control Agent for Hawkweeds

    Science.gov (United States)

    2010-10-21

    ... hawkweed gall wasp, Aulacidea subterminalis, into the continental United States as a biological control... United States for the biological control of hawkweeds (Hieracium pilosella, H. aurantiacum, H... control, and the use of biological control organisms. The use of herbicides, while effective, is limited...

  10. Determinant Variables, Enteric Pathogen Burden, Gut Function and Immune-related Inflammatory Biomarkers Associated With Childhood Malnutrition: A Prospective Case-Control Study in Northeastern Brazil.

    Science.gov (United States)

    Lima, Aldo A M; Leite, Álvaro M; Di Moura, Alessandra; Lima, Noélia L; Soares, Alberto M; Abreu, Cláudia B; Filho, José Quirino; Mota, Rosa M S; Lima, Ila F N; Havt, Alexandre; Medeiros, Pedro H Q S; Prata, Mara M G; Guedes, Marjorie M; Cavalcante, Paloma A; Veras, Herlice N; Santos, Ana K S; Moore, Sean R; Pinkerton, Relana C; Houpt, Eric R; Guerrant, Richard L

    2017-12-01

    Malnutrition results in serious consequences for growth and cognitive development in children. We studied select child and maternal biologic factors, socioeconomic factors, enteric pathogenic burden and gut function biomarkers in 402 children 6-24 months of age in Northeastern Brazil. In this prospective case-control study, not being fed colostrum [odds ratio (OR): 3.29, 95% confidence interval (CI): 1.73-6.26], maternal age ≥18 years (OR: 1.88, 95% CI: 1.10-3.22) and no electric fan (OR: 2.46, 95% CI: 1.22-4.96) or bicycle (OR: 1.80, 95% CI: 1.10-2.95) in the household were positively associated, and higher birth weight (OR: 0.27, 95% CI: 0.19-0.38), larger head circumference (OR: 0.74, 95% CI: 0.66-0.82) and shortness of breath in the last 2 weeks (OR: 0.49, 95% CI: 0.27-0.90) were negatively associated with malnutrition. Subclinical enteric pathogen infections were common, and enteroaggregative Escherichia coli infections were more prevalent in malnourished children (P = 0.045). Biomarkers such as the lactulose-mannitol test, myeloperoxidase, neopterin and calprotectin were highly elevated in both malnourished and nourished children. Nourished children had a better systemic immune response than the malnourished children, as detected by elevated serum amyloid A-1 and soluble cluster of differentiation protein 14 biomarkers (P malnutrition in children. There was a substantial subclinical enteric pathogen burden, particularly with enteroaggregative E. coli, in malnourished children.

  11. Biology of Paenibacillus larvae, a deadly pathogen of honey bee larvae.

    Science.gov (United States)

    Ebeling, Julia; Knispel, Henriette; Hertlein, Gillian; Fünfhaus, Anne; Genersch, Elke

    2016-09-01

    The gram-positive bacterium Paenibacillus larvae is the etiological agent of American Foulbrood of honey bees, a notifiable disease in many countries. Hence, P. larvae can be considered as an entomopathogen of considerable relevance in veterinary medicine. P. larvae is a highly specialized pathogen with only one established host, the honey bee larva. No other natural environment supporting germination and proliferation of P. larvae is known. Over the last decade, tremendous progress in the understanding of P. larvae and its interactions with honey bee larvae at a molecular level has been made. In this review, we will present the recent highlights and developments in P. larvae research and discuss the impact of some of the findings in a broader context to demonstrate what we can learn from studying "exotic" pathogens.

  12. BIOLOGICAL CONTROL - AS A MEANS TO CONTROL INSECT PESTS IN AZERBAIJAN

    Directory of Open Access Journals (Sweden)

    Z. M. Mamedov

    2013-01-01

    Full Text Available Two hundreds and twenty species parasites and predators of pests of various agricultures are revealed in Azerbaijan. The complex of entomophages of certain pests of agricultures is studied: 48 species of parasites and predators of Chloridea obsoleta 21 species of entomophages of Pectinophora malvella Hb., over 160 species of entomophages of pests of ozehards and vegetables, 34 species of entomophages of pests of forests. The hundreds species of entomophages and some entomophogenous microbes and antagonists are revealed. Biology and ecology of over 60 species of entomophages and useful microorganisims which are prospective as biological control agents are studied.

  13. Do biological-based strategies hold promise to biofouling control in MBRs?

    KAUST Repository

    Malaeb, Lilian

    2013-10-01

    Biofouling in membrane bioreactors (MBRs) remains a primary challenge for their wider application, despite the growing acceptance of MBRs worldwide. Research studies on membrane fouling are extensive in the literature, with more than 200 publications on MBR fouling in the last 3 years; yet, improvements in practice on biofouling control and management have been remarkably slow. Commonly applied cleaning methods are only partially effective and membrane replacement often becomes frequent. The reason for the slow advancement in successful control of biofouling is largely attributed to the complex interactions of involved biological compounds and the lack of representative-for-practice experimental approaches to evaluate potential effective control strategies. Biofouling is driven by microorganisms and their associated extra-cellular polymeric substances (EPS) and microbial products. Microorganisms and their products convene together to form matrices that are commonly treated as a black box in conventional control approaches. Biological-based antifouling strategies seem to be a promising constituent of an effective integrated control approach since they target the essence of biofouling problems. However, biological-based strategies are in their developmental phase and several questions should be addressed to set a roadmap for translating existing and new information into sustainable and effective control techniques. This paper investigates membrane biofouling in MBRs from the microbiological perspective to evaluate the potential of biological-based strategies in offering viable control alternatives. Limitations of available control methods highlight the importance of an integrated anti-fouling approach including biological strategies. Successful development of these strategies requires detailed characterization of microorganisms and EPS through the proper selection of analytical tools and assembly of results. Existing microbiological/EPS studies reveal a number of

  14. Electrochemical Methodologies for the Detection of Pathogens.

    Science.gov (United States)

    Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine

    2018-05-25

    Bacterial infections remain one of the principal causes of morbidity and mortality worldwide. The number of deaths due to infections is declining every year by only 1% with a forecast of 13 million deaths in 2050. Among the 1400 recognized human pathogens, the majority of infectious diseases is caused by just a few, about 20 pathogens only. While the development of vaccinations and novel antibacterial drugs and treatments are at the forefront of research, and strongly financially supported by policy makers, another manner to limit and control infectious outbreaks is targeting the development and implementation of early warning systems, which indicate qualitatively and quantitatively the presence of a pathogen. As toxin contaminated food and drink are a potential threat to human health and consequently have a significant socioeconomic impact worldwide, the detection of pathogenic bacteria remains not only a big scientific challenge but also a practical problem of enormous significance. Numerous analytical methods, including conventional culturing and staining techniques as well as molecular methods based on polymerase chain reaction amplification and immunological assays, have emerged over the years and are used to identify and quantify pathogenic agents. While being highly sensitive in most cases, these approaches are highly time, labor, and cost consuming, requiring trained personnel to perform the frequently complex assays. A great challenge in this field is therefore to develop rapid, sensitive, specific, and if possible miniaturized devices to validate the presence of pathogens in cost and time efficient manners. Electrochemical sensors are well accepted powerful tools for the detection of disease-related biomarkers and environmental and organic hazards. They have also found widespread interest in the last years for the detection of waterborne and foodborne pathogens due to their label free character and high sensitivity. This Review is focused on the current

  15. Biology, ecology and management of the invasive parthenium weed (Parthenium hysterophorus L.).

    Science.gov (United States)

    Adkins, Steve; Shabbir, Asad

    2014-07-01

    Parthenium weed (Parthenium hysterophorus L.) is one of the most aggressive invasive weeds, threatening natural ecosystems and agroecosystems in over 30 countries worldwide. Parthenium weed causes losses of crops and pastures, degrading the biodiversity of natural plant communities, causing human and animal health hazards and resulting in serious economic losses to people and their interests in many countries around the globe. Several of its biological and ecological attributes contribute towards its invasiveness. Various management approaches (namely cultural, mechanical, chemical and biological control) have been used to minimise losses caused by this weed, but most of these approaches are ineffective and uneconomical and/or have limitations. Although chemical control using herbicides and biological control utilising exotic insects and pathogens have been found to contribute to the management of the weed, the weed nevertheless remains a significant problem. An integrated management approach is proposed here for the effective management of parthenium weed on a sustainable basis. © 2014 Society of Chemical Industry.

  16. The isolation and identification of pathogenic fungi from Tessaratoma papillosa Drury (Hemiptera: Tessaratomidae).

    Science.gov (United States)

    Meng, Xiang; Hu, Junjie; Ouyang, Gecheng

    2017-01-01

    Litchi stink-bug, Tessaratoma papillosa Drury (Hemiptera: Tessaratomidae), is one of the most widespread and destructive pest species on Litchi chinensis Sonn and Dimocarpus longan Lour in Southern China. Inappropriate use of chemical pesticides has resulted in serious environmental problems and food pollution. Generating an improved Integrated Pest Management (IPM) strategy for litchi stink-bug in orchard farming requires development of an effective biological control agent. Entomopathogenic fungi are regarded as a vital ecological factor in the suppression of pest populations under field conditions. With few effective fungi and pathogenic strains available to control litchi stink-bug, exploration of natural resources for promising entomopathogenic fungi is warranted. In this study, two pathogenic fungi were isolated from cadavers of adult T. papillosa . They were identified as Paecilomyces lilacinus and Beauveria bassiana by morphological identification and rDNA-ITS homogeneous analysis. Infection of T. papillosa with B. bassiana and P. lilacinus occurred initially from the antennae, metameres, and inter-segmental membranes. Biological tests showed that the two entomopathogenic fungi induced high mortality in 2 nd and 5 th instar nymphs of T. papillosa . B. bassiana was highly virulent on 2 nd instar nymphs of T. papillosa , with values for cadaver rate, LC 50 and LT 50 of 88.89%, 1.92 × 10 7  conidia/mL and 4.34 days respectively. This study provides two valuable entomopathogenic fungi from T. papillosa . This finding suggests that the highly virulent P. lilacinus and B. bassiana play an important role in the biocontrol of T. papillosa in China. These pathogenic fungi had no pollution or residue risk, and could provide an alternative option for IPM of litchi stink-bug.

  17. The isolation and identification of pathogenic fungi from Tessaratoma papillosa Drury (Hemiptera: Tessaratomidae

    Directory of Open Access Journals (Sweden)

    Xiang Meng

    2017-10-01

    Full Text Available Background Litchi stink-bug, Tessaratoma papillosa Drury (Hemiptera: Tessaratomidae, is one of the most widespread and destructive pest species on Litchi chinensis Sonn and Dimocarpus longan Lour in Southern China. Inappropriate use of chemical pesticides has resulted in serious environmental problems and food pollution. Generating an improved Integrated Pest Management (IPM strategy for litchi stink-bug in orchard farming requires development of an effective biological control agent. Entomopathogenic fungi are regarded as a vital ecological factor in the suppression of pest populations under field conditions. With few effective fungi and pathogenic strains available to control litchi stink-bug, exploration of natural resources for promising entomopathogenic fungi is warranted. Methods & Results In this study, two pathogenic fungi were isolated from cadavers of adult T. papillosa. They were identified as Paecilomyces lilacinus and Beauveria bassiana by morphological identification and rDNA-ITS homogeneous analysis. Infection of T. papillosa with B. bassiana and P. lilacinus occurred initially from the antennae, metameres, and inter-segmental membranes. Biological tests showed that the two entomopathogenic fungi induced high mortality in 2nd and 5th instar nymphs of T. papillosa. B. bassiana was highly virulent on 2nd instar nymphs of T. papillosa, with values for cadaver rate, LC50 and LT50 of 88.89%, 1.92 × 107 conidia/mL and 4.34 days respectively. Discussion This study provides two valuable entomopathogenic fungi from T. papillosa. This finding suggests that the highly virulent P. lilacinus and B. bassiana play an important role in the biocontrol of T. papillosa in China. These pathogenic fungi had no pollution or residue risk, and could provide an alternative option for IPM of litchi stink-bug.

  18. Distribution of Plasmids in Distinct Leptospira Pathogenic Species.

    Science.gov (United States)

    Wang, Yanzhuo; Zhuang, Xuran; Zhong, Yi; Zhang, Cuicai; Zhang, Yan; Zeng, Lingbing; Zhu, Yongzhang; He, Ping; Dong, Ke; Pal, Utpal; Guo, Xiaokui; Qin, Jinhong

    2015-11-01

    Leptospirosis, caused by pathogenic Leptospira, is a worldwide zoonotic infection. The genus Leptospira includes at least 21 species clustered into three groups--pathogens, non-pathogens, and intermediates--based on 16S rRNA phylogeny. Research on Leptospira is difficult due to slow growth and poor transformability of the pathogens. Recent identification of extrachromosomal elements besides the two chromosomes in L. interrogans has provided new insight into genome complexity of the genus Leptospira. The large size, low copy number, and high similarity of the sequence of these extrachromosomal elements with the chromosomes present challenges in isolating and detecting them without careful genome assembly. In this study, two extrachromosomal elements were identified in L. borgpetersenii serovar Ballum strain 56604 through whole genome assembly combined with S1 nuclease digestion following pulsed-field gel electrophoresis (S1-PFGE) analysis. Further, extrachromosomal elements in additional 15 Chinese epidemic strains of Leptospira, comprising L. borgpetersenii, L. weilii, and L. interrogans, were successfully separated and identified, independent of genome sequence data. Southern blot hybridization with extrachromosomal element-specific probes, designated as lcp1, lcp2 and lcp3-rep, further confirmed their occurrences as extrachromosomal elements. In total, 24 plasmids were detected in 13 out of 15 tested strains, among which 11 can hybridize with the lcp1-rep probe and 11 with the lcp2-rep probe, whereas two can hybridize with the lcp3-rep probe. None of them are likely to be species-specific. Blastp search of the lcp1, lcp2, and lcp3-rep genes with a nonredundant protein database of Leptospira species genomes showed that their homologous sequences are widely distributed among clades of pathogens but not non-pathogens or intermediates. These results suggest that the plasmids are widely distributed in Leptospira species, and further elucidation of their biological

  19. Evaluation of bio-agent formulations to control Fusarium wilt of tomato

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... studied with emphasis on biological control using fungi or ... mechanisms such as antibiosis, competition, suppression, ... Fusarium wilt pathogen such as Trichoderma harzianum, .... sphere around soil and above plants.

  20. Highly pathogenic avian influenza.

    Science.gov (United States)

    Swayne, D E; Suarez, D L

    2000-08-01

    Highly pathogenic (HP) avian influenza (AI) (HPAI) is an extremely contagious, multi-organ systemic disease of poultry leading to high mortality, and caused by some H5 and H7 subtypes of type A influenza virus, family Orthomyxoviridae. However, most AI virus strains are mildly pathogenic (MP) and produce either subclinical infections or respiratory and/or reproductive diseases in a variety of domestic and wild bird species. Highly pathogenic avian influenza is a List A disease of the Office International des Epizooties, while MPAI is neither a List A nor List B disease. Eighteen outbreaks of HPAI have been documented since the identification of AI virus as the cause of fowl plague in 1955. Mildly pathogenic avian influenza viruses are maintained in wild aquatic bird reservoirs, occasionally crossing over to domestic poultry and causing outbreaks of mild disease. Highly pathogenic avian influenza viruses do not have a recognised wild bird reservoir, but can occasionally be isolated from wild birds during outbreaks in domestic poultry. Highly pathogenic avian influenza viruses have been documented to arise from MPAI viruses through mutations in the haemagglutinin surface protein. Prevention of exposure to the virus and eradication are the accepted methods for dealing with HPAI. Control programmes, which imply allowing a low incidence of infection, are not an acceptable method for managing HPAI, but have been used during some outbreaks of MPAI. The components of a strategy to deal with MPAI or HPAI include surveillance and diagnosis, biosecurity, education, quarantine and depopulation. Vaccination has been used in some control and eradication programmes for AI.

  1. Targeting of the hydrophobic metabolome by pathogens.

    Science.gov (United States)

    Helms, J Bernd; Kaloyanova, Dora V; Strating, Jeroen R P; van Hellemond, Jaap J; van der Schaar, Hilde M; Tielens, Aloysius G M; van Kuppeveld, Frank J M; Brouwers, Jos F

    2015-05-01

    The hydrophobic molecules of the metabolome - also named the lipidome - constitute a major part of the entire metabolome. Novel technologies show the existence of a staggering number of individual lipid species, the biological functions of which are, with the exception of only a few lipid species, unknown. Much can be learned from pathogens that have evolved to take advantage of the complexity of the lipidome to escape the immune system of the host organism and to allow their survival and replication. Different types of pathogens target different lipids as shown in interaction maps, allowing visualization of differences between different types of pathogens. Bacterial and viral pathogens target predominantly structural and signaling lipids to alter the cellular phenotype of the host cell. Fungal and parasitic pathogens have complex lipidomes themselves and target predominantly the release of polyunsaturated fatty acids from the host cell lipidome, resulting in the generation of eicosanoids by either the host cell or the pathogen. Thus, whereas viruses and bacteria induce predominantly alterations in lipid metabolites at the host cell level, eukaryotic pathogens focus on interference with lipid metabolites affecting systemic inflammatory reactions that are part of the immune system. A better understanding of the interplay between host-pathogen interactions will not only help elucidate the fundamental role of lipid species in cellular physiology, but will also aid in the generation of novel therapeutic drugs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Quality control of X-ray irradiator by biological markers

    International Nuclear Information System (INIS)

    Miura, Miwa; Lukmanul Hakkim, F.; Yoshida, Masahiro; Matsuda, Naoki; Morita, Naoko

    2011-01-01

    The exposure of animals or cultured cells to radiation is the essential and common step in experimental researches to elucidate biological effects of radiation. When an X-ray generator is used as a radiation source, physical parameters including dose, dose rate, and the energy spectrum of X-ray play crucial roles in biological outcome. Therefore, those parameters are the important points to be checked in quality control and to be carefully considered in advance to the irradiation to obtain the accurate and reproductive results. Here we measured radiation dose emitted from the X-ray irradiator for research purposes by using clonogenic survival of cultured mammalian cells as a biological marker in parallel with physical dosimetry. The results drawn from both methods exhibited good consistency in the dose distribution on the irradiation stage. Furthermore, the close relationship was observed between cell survival and the photon energy spectrum by using different filter components. These results suggest that biological dosimetry is applicable to quality control of X-ray irradiator in adjunct to physical dosimetry and that it possibly helps better understanding of the optimal irradiating condition by X-ray users in life-science field. (author)

  3. Stable States of Biological Organisms

    Science.gov (United States)

    Yukalov, V. I.; Sornette, D.; Yukalova, E. P.; Henry, J.-Y.; Cobb, J. P.

    2009-04-01

    A novel model of biological organisms is advanced, treating an organism as a self-consistent system subject to a pathogen flux. The principal novelty of the model is that it describes not some parts, but a biological organism as a whole. The organism is modeled by a five-dimensional dynamical system. The organism homeostasis is described by the evolution equations for five interacting components: healthy cells, ill cells, innate immune cells, specific immune cells, and pathogens. The stability analysis demonstrates that, in a wide domain of the parameter space, the system exhibits robust structural stability. There always exist four stable stationary solutions characterizing four qualitatively differing states of the organism: alive state, boundary state, critical state, and dead state.

  4. Thresholds for HLB vector control in infected commercial citrus and compatibility with biological control

    OpenAIRE

    Monzo, C.; Hendricks, K.; Roberts, P.; Stansly, P. A.

    2014-01-01

    Control of the HLB vector, Diaphorina citri Kuwayama, is considered a basic component for management this disease, even in a high HLB incidence scenario. Such control is mostly chemically oriented. However, over use of insecticides would increase costs and be incompatible with biological control. Establishment of economic thresholds for psyllid control under different price scenarios could optimize returns on investment.

  5. Managing conflict over biological control: the case of strawberry guava in Hawaii

    Science.gov (United States)

    Tracy Johnson

    2016-01-01

    Biological control researchers commonly avoid targets with potential for high conflict, but for certain highly damaging invaders with no viable management alternatives, it may be necessary to consider biological control even when it is likely to generate conflict. Discussed here is a case study, strawberry guava (Psidium cattleianum Sabine...

  6. Rearing and Release of Megamelus scutellaris Berg (Hemiptera: Delphacidae) for Biological Control of Water hyacinth in 2015

    Science.gov (United States)

    2017-06-01

    Hemiptera: Delphacidae) for Biological Control of Waterhyacinth in 2015 by Jan Freedman and Nathan Harms PURPOSE: Waterhyacinth biological control ... control agents. Three insects were released in the United States for biological control of waterhyacinth during the 1970s; two weevils, Neochetina...content) and competitive interactions with other biological control agents (e.g., Neochetina spp.), though their consideration in other biological

  7. Biological control by ( Coccinella algerica , Kovar 1977) against the ...

    African Journals Online (AJOL)

    Inputs from chemicals, particularly pesticides, to control crop pests have adverse effects on soil and the environment, among others. To reduce pest attacks, biological control with indigenous predators is the alternative and the cleanest, most environmentally friendly and ecologically balanced way. In order to achieve this ...

  8. Control of indigenous pathogenic bacteria in seafood

    DEFF Research Database (Denmark)

    Huss, Hans Henrik

    1997-01-01

    The pathogenic bacteria indigenous to the aquatic and general environment are listed. Their distribution in nature, prevalence in seafood and the possibilities for growth of these organisms in various types of products are outlined These data, combined with what is known regarding the epidemiology...

  9. Identifying Ant-Mirid Spatial Interactions to Improve Biological Control in Cacao-Based Agroforestry System.

    Science.gov (United States)

    Bagny Beilhe, Leïla; Piou, Cyril; Tadu, Zéphirin; Babin, Régis

    2018-06-06

    The use of ants for biological control of insect pests was the first reported case of conservation biological control. Direct and indirect community interactions between ants and pests lead to differential spatial pattern. We investigated spatial interactions between mirids, the major cocoa pest in West Africa and numerically dominant ant species, using bivariate point pattern analysis to identify potential biological control agents. We assume that potential biological control agents should display negative spatial interactions with mirids considering their niche overlap. The mirid/ant data were collected in complex cacao-based agroforestry systems sampled in three agroecological areas over a forest-savannah gradient in Cameroon. Three species, Crematogaster striatula Emery (Hymenoptera: Formicidae), Crematogaster clariventris Mayr (Hymenoptera: Formicidae), and Oecophylla longinoda Latreille (Hymenoptera: Formicidae) with high predator and aggressive behaviors were identified as dominant and showed negative spatial relationships with mirids. The weaver ant, O. longinoda was identified as the only potential biological control agent, considering its ubiquity in the plots, the similarity in niche requirements, and the spatial segregation with mirids resulting probably from exclusion mechanisms. Combining bivariate point pattern analysis to good knowledge of insect ecology was an effective method to identify a potentially good biological control agent.

  10. Irradiation control of pathogenic bacteria and their growth during storage time in cooled chicken

    International Nuclear Information System (INIS)

    Ha Yiming; Wang Feng; Fan Bei; Liu Shuliang; Ju Hua

    2009-01-01

    The growth of pathogenic bacteria during storage time and their D 10 values by irradiation in cooled chicken were evaluated. The total numbers of colony, E.coli 10003, Campylobacter jejuni33560 and CY04 of the D 10 values were 1.434 kGy, 0.408 kGy, 0.175 kGy, 0.2 kGy respectively in cooled chicken. The results show that total bacteria count in vacuum packaged cooled chicken sample is 5.66 lg(CFU/g) and 4.90 lg (CFU/g) after 3 kGy and 5 kGy irradiation. And in storage at 0∼4 degree C the storage shelf-life of irradiated vacuum packaged cooled chicken could extend to 21 d and 28 d. It can be deduced that pathogenic bacteria can be controlled effectively by irradiation. (authors)

  11. The rhizosphere microbial community in a multiple parallel mineralization system suppresses the pathogenic fungus Fusarium oxysporum.

    Science.gov (United States)

    Fujiwara, Kazuki; Iida, Yuichiro; Iwai, Takashi; Aoyama, Chihiro; Inukai, Ryuya; Ando, Akinori; Ogawa, Jun; Ohnishi, Jun; Terami, Fumihiro; Takano, Masao; Shinohara, Makoto

    2013-12-01

    The rhizosphere microbial community in a hydroponics system with multiple parallel mineralization (MPM) can potentially suppress root-borne diseases. This study focused on revealing the biological nature of the suppression against Fusarium wilt disease, which is caused by the fungus Fusarium oxysporum, and describing the factors that may influence the fungal pathogen in the MPM system. We demonstrated that the rhizosphere microbiota that developed in the MPM system could suppress Fusarium wilt disease under in vitro and greenhouse conditions. The microbiological characteristics of the MPM system were able to control the population dynamics of F. oxysporum, but did not eradicate the fungal pathogen. The roles of the microbiological agents underlying the disease suppression and the magnitude of the disease suppression in the MPM system appear to depend on the microbial density. F. oxysporum that survived in the MPM system formed chlamydospores when exposed to the rhizosphere microbiota. These results suggest that the microbiota suppresses proliferation of F. oxysporum by controlling the pathogen's morphogenesis and by developing an ecosystem that permits coexistence with F. oxysporum. © 2013 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  12. The role of strigolactones during plant interactions with the pathogenic fungus Fusarium oxysporum.

    Science.gov (United States)

    Foo, Eloise; Blake, Sara N; Fisher, Brendan J; Smith, Jason A; Reid, James B

    2016-06-01

    Strigolactones (SLs) do not influence spore germination or hyphal growth of Fusarium oxysporum. Mutant studies revealed no role for SLs but a role for ethylene signalling in defence against this pathogen in pea. Strigolactones (SLs) play important roles both inside the plant as a hormone and outside the plant as a rhizosphere signal in interactions with mycorrhizal fungi and parasitic weeds. What is less well understood is any potential role SLs may play in interactions with disease causing microbes such as pathogenic fungi. In this paper we investigate the influence of SLs on the hemibiotrophic pathogen Fusarium oxysporum f.sp. pisi both directly via their effects on fungal growth and inside the plant through the use of a mutant deficient in SL. Given that various stereoisomers of synthetic and naturally occuring SLs can display different biological activities, we used (+)-GR24, (-)-GR24 and the naturally occurring SL, (+)-strigol, as well as a racemic mixture of 5-deoxystrigol. As a positive control, we examined the influence of a plant mutant with altered ethylene signalling, ein2, on disease development. We found no evidence that SLs influence spore germination or hyphal growth of Fusarium oxysporum and that, while ethylene signalling influences pea susceptibility to this pathogen, SLs do not.

  13. Biological control of tortricids and aphids in strawberries

    DEFF Research Database (Denmark)

    Sigsgaard, Lene; Enkegaard, Annie; Eilenberg, Jørgen

    Cropping practice and biological control can contribute to reduced pesticide use in strawberries. Organic strawberries are less attacked by strawberry tortricid and buckwheat flower strips can augment its natural enemies. Against shallot aphid the two-spot ladybird is promising....

  14. Tissue-specific and pathogen-inducible expression of a fusion protein containing a Fusarium-specific antibody and a fungal chitinase protects wheat against Fusarium pathogens and mycotoxins.

    Science.gov (United States)

    Cheng, Wei; Li, He-Ping; Zhang, Jing-Bo; Du, Hong-Jie; Wei, Qi-Yong; Huang, Tao; Yang, Peng; Kong, Xian-Wei; Liao, Yu-Cai

    2015-06-01

    Fusarium head blight (FHB) in wheat and other small grain cereals is a globally devastating disease caused by toxigenic Fusarium pathogens. Controlling FHB is a challenge because germplasm that is naturally resistant against these pathogens is inadequate. Current control measures rely on fungicides. Here, an antibody fusion comprised of the Fusarium spp.-specific recombinant antibody gene CWP2 derived from chicken, and the endochitinase gene Ech42 from the biocontrol fungus Trichoderma atroviride was introduced into the elite wheat cultivar Zhengmai9023 by particle bombardment. Expression of this fusion gene was regulated by the lemma/palea-specific promoter Lem2 derived from barley; its expression was confirmed as lemma/palea-specific in transgenic wheat. Single-floret inoculation of independent transgenic wheat lines of the T3 to T6 generations revealed significant resistance (type II) to fungal spreading, and natural infection assays in the field showed significant resistance (type I) to initial infection. Gas chromatography-mass spectrometry analysis revealed marked reduction of mycotoxins in the grains of the transgenic wheat lines. Progenies of crosses between the transgenic lines and the FHB-susceptible cultivar Huamai13 also showed significantly enhanced FHB resistance. Quantitative real-time PCR analysis revealed that the tissue-specific expression of the antibody fusion was induced by salicylic acid drenching and induced to a greater extent by F. graminearum infection. Histochemical analysis showed substantial restriction of mycelial growth in the lemma tissues of the transgenic plants. Thus, the combined tissue-specific and pathogen-inducible expression of this Fusarium-specific antibody fusion can effectively protect wheat against Fusarium pathogens and reduce mycotoxin content in grain. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Molecular Diagnostics for Soilborne Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    E.J. Paplomatas

    2004-08-01

    Full Text Available Several classical approaches have been developed to detect and identify soil fungal inhabitants through the years. Selective media have been devised to exclude the large number of soil organisms and allow growth of target fungi. However the advent of molecular biology has offered a number of revolutionary insights into the detection and enumeration of soilborne fungal pathogens and also has started to provide information on the identification of unknown species from DNA sequences. This review paper focuses on the application of various molecular techniques in the detection, identification, characterization and quantification of soilborne fungal plant pathogens. This is based on information from the literature and is combined with personal research findings of the author.

  16. Randomized controlled clinical trial evaluating multiplex polymerase chain reaction for pathogen identification and therapy adaptation in critical care patients with pulmonary or abdominal sepsis.

    Science.gov (United States)

    Tafelski, Sascha; Nachtigall, Irit; Adam, Thomas; Bereswill, Stefan; Faust, Jana; Tamarkin, Andrey; Trefzer, Tanja; Deja, Maria; Idelevich, Evgeny A; Wernecke, Klaus-Dieter; Becker, Karsten; Spies, Claudia

    2015-06-01

    To determine whether a multiplex polymerase chain reaction (PCR)-based test could reduce the time required for initial pathogen identification in patients in an intensive care unit (ICU) setting. This double-blind, parallel-group randomized controlled trial** enrolled adults with suspected pulmonary or abdominal sepsis caused by an unknown pathogen. Both the intervention and control groups underwent the standard blood culture (BC) testing, but additional pathogen identification, based on the results of a LightCycler® SeptiFast PCR test, were provided in the intervention group. The study enrolled 37 patients in the control group and 41 in the intervention group. Baseline clinical and demographic characteristics were similar in both groups. The PCR-based test identified a pathogen in 10 out of 41 (24.4%) patients in the intervention group, with a mean duration from sampling to providing the information to the ICU of 15.9 h. In the control group, BC results were available after a significantly longer period (38.1 h). The LightCycler® SeptiFast PCR test demonstrated a significant reduction in the time required for initial pathogen identification, compared with standard BC. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  17. Biological control and invading freshwater snails. A case study.

    Science.gov (United States)

    Pointier, J P; Augustin, D

    1999-12-01

    Introductions of four species of freshwater snails occurred between 1972 and 1996 onto Guadeloupe Island. Two of them, Melanoides tuberculata and Marisa cornuarietis, were subsequently used as biological control agents against Biomphalaria glabrata, the snail intermediate host of intestinal schistosomiasis. In 1996, a general survey was carried out in 134 sites which had already been investigated in 1972. The total number of mollusc species had increased from 19 to 21. Site numbers housing B. glabrata and two other species had strongly declined. This decline may be mainly attributed to a competitive displacement by M. tuberculata and M. cornuarietis as illustrated by several biological control programmes. There were no changes in the remainder of the malacological fauna.

  18. Ecological theory as a foundation to control pathogenic invasion in aquaculture

    Science.gov (United States)

    De Schryver, Peter; Vadstein, Olav

    2014-01-01

    Detrimental host–pathogen interactions are a normal phenomenon in aquaculture animal production, and have been counteracted by prophylactic use of antibiotics. Especially, the youngest life stages of cultivated aquatic animals are susceptible to pathogen invasion, resulting in disease and mortality. To establish a more sustainable aquatic food production, there is a need for new microbial management strategies that focus on ‘join them' and not the traditional ‘beat them' approaches. We argue that ecological theory could serve as a foundation for developing sustainable microbial management methods that prevent pathogenic disease in larviculture. Management of the water microbiota in aquaculture systems according to ecological selection principles has been shown to decrease opportunistic pathogen pressure and to result in an improved performance of the cultured animals. We hypothesize that manipulation of the biodiversity of the gut microbiota can increase the host's resistance against pathogenic invasion and infection. However, substantial barriers need to be overcome before active management of the intestinal microbiota can effectively be applied in larviculture. PMID:24892581

  19. Biological control of banana black Sigatoka disease with Trichoderma

    OpenAIRE

    Poholl Adan Sagratzki Cavero; Rogério Eiji Hanada; Luadir Gasparotto; Rosalee Albuquerque Coelho Neto; Jorge Teodoro de Souza

    2015-01-01

    Black Sigatoka disease caused by Mycosphaerella fijiensis is the most severe banana disease worldwide. The pathogen is in an invasive phase in Brazil and is already present in most States of the country. The potential of 29 isolates of Trichoderma spp. was studied for the control of black Sigatoka disease under field conditions. Four isolates were able to significantly reduce disease severity and were further tested in a second field experiment. Isolate 2.047 showed the best results in both f...

  20. The Molecular Biology of Pestiviruses.

    Science.gov (United States)

    Tautz, Norbert; Tews, Birke Andrea; Meyers, Gregor

    2015-01-01

    Pestiviruses are among the economically most important pathogens of livestock. The biology of these viruses is characterized by unique and interesting features that are both crucial for their success as pathogens and challenging from a scientific point of view. Elucidation of these features at the molecular level has made striking progress during recent years. The analyses revealed that major aspects of pestivirus biology show significant similarity to the biology of human hepatitis C virus (HCV). The detailed molecular analyses conducted for pestiviruses and HCV supported and complemented each other during the last three decades resulting in elucidation of the functions of viral proteins and RNA elements in replication and virus-host interaction. For pestiviruses, the analyses also helped to shed light on the molecular basis of persistent infection, a special strategy these viruses have evolved to be maintained within their host population. The results of these investigations are summarized in this chapter. © 2015 Elsevier Inc. All rights reserved.

  1. Using consumption rate to assess potential predators for biological control of white perch

    Directory of Open Access Journals (Sweden)

    Gosch N.J.C.

    2011-08-01

    Full Text Available Control of undesirable fishes is important in aquatic systems, and using predation as a tool for biological control is an attractive option to fishery biologists. However, determining the appropriate predators for biological control is critical for success. The objective of this study was to evaluate the utility of consumption rate as an index to determine the most effective predators for biological control of an invasive fish. Consumption rate values were calculated for nine potential predators that prey on white perch Morone americana in Branched Oak and Pawnee reservoirs, Nebraska. The consumption rate index provided a unique and insightful means of determining the potential effectiveness of each predator species in controlling white perch. Cumulative frequency distributions facilitated interpretation by providing a graphical presentation of consumption rates by all individuals within each predator species. Largemouth bass Micropterus salmoides, walleye Sander vitreus and sauger S. canadensis were the most efficient white perch predators in both reservoirs; however, previous attempts to increase biomass of these predators have failed suggesting that successful biological control is unlikely using existing predator species in these Nebraska reservoirs.

  2. Application of bacteriophages in post-harvest control of human pathogenic and food spoiling bacteria.

    Science.gov (United States)

    Pérez Pulido, Rubén; Grande Burgos, Maria José; Gálvez, Antonio; Lucas López, Rosario

    2016-10-01

    Bacteriophages have attracted great attention for application in food biopreservation. Lytic bacteriophages specific for human pathogenic bacteria can be isolated from natural sources such as animal feces or industrial wastes where the target bacteria inhabit. Lytic bacteriophages have been tested in different food systems for inactivation of main food-borne pathogens including Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Salmonella enterica, Shigella spp., Campylobacter jejuni and Cronobacter sakazkii, and also for control of spoilage bacteria. Application of lytic bacteriophages could selectively control host populations of concern without interfering with the remaining food microbiota. Bacteriophages could also be applied for inactivation of bacteria attached to food contact surfaces or grown as biofilms. Bacteriophages may receive a generally recognized as safe status based on their lack of toxicity and other detrimental effects to human health. Phage preparations specific for L. monocytogenes, E. coli O157:H7 and S. enterica serotypes have been commercialized and approved for application in foods or as part of surface decontamination protocols. Phage endolysins have a broader host specificity compared to lytic bacteriophages. Cloned endolysins could be used as natural preservatives, singly or in combination with other antimicrobials such as bacteriocins.

  3. Mucosal immunity to pathogenic intestinal bacteria.

    Science.gov (United States)

    Perez-Lopez, Araceli; Behnsen, Judith; Nuccio, Sean-Paul; Raffatellu, Manuela

    2016-03-01

    The intestinal mucosa is a particularly dynamic environment in which the host constantly interacts with trillions of commensal microorganisms, known as the microbiota, and periodically interacts with pathogens of diverse nature. In this Review, we discuss how mucosal immunity is controlled in response to enteric bacterial pathogens, with a focus on the species that cause morbidity and mortality in humans. We explain how the microbiota can shape the immune response to pathogenic bacteria, and we detail innate and adaptive immune mechanisms that drive protective immunity against these pathogens. The vast diversity of the microbiota, pathogens and immune responses encountered in the intestines precludes discussion of all of the relevant players in this Review. Instead, we aim to provide a representative overview of how the intestinal immune system responds to pathogenic bacteria.

  4. The race between infection and immunity - how do pathogens set the pace?

    Energy Technology Data Exchange (ETDEWEB)

    Ribiero, Ruy M [Los Alamos National Laboratory

    2009-01-01

    Infection is often referred to as a race between pathogen and immune response. This metaphor suggests that slower growing pathogens should be more easily controlled. However, a growing body ofevidence shows that many chronic infections are caused by failure to control slow growing pathogens. The slow growth of pathogens appears to directly affect the kinetics of the immune response. Compared with the response to fast growing pathogens, the T cell response to slow pathogens is delayed in its initiation, lymphocyte expansion is slow and the response often fails to clear the pathogen, leading to chronic infection. Understanding the 'rules ofthe race' for slow growing pathogens has important implications for vaccine design and immune control of many chronic infections.

  5. Toll-Like Receptors 2 and 4 Cooperate in the Control of the Emerging Pathogen Brucella microti.

    Science.gov (United States)

    Arias, Maykel A; Santiago, Llipsy; Costas-Ramon, Santiago; Jaime-Sánchez, Paula; Freudenberg, Marina; Jiménez De Bagüés, Maria P; Pardo, Julián

    2016-01-01

    Toll-like receptors (TLRs) recognize pathogen-derived molecules and play a critical role during the host innate and adaptive immune response. Brucella spp. are intracellular gram-negative bacteria including several virulent species, which cause a chronic zoonotic infection in a wide range of mammalian hosts known as brucellosis. A new Brucella species, Brucella microti , was recently isolated from wild rodents and found to be highly pathogenic in mice. Using this species-specific model, it was previously found that CD8 + T cells are required to control this infection. In order to find out the role of TLR-mediated responses in the control of this pathogen, the course of infection of B. microti was analyzed over 3 weeks in wild-type (WT) and TLR knock out (KO) mice including TLR2 -/- , TLR4 -/- , TLR9 -/- , TLR2×4 -/- and TLR2×4×9 -/- . WT and single TLR2, TLR4 and TLR9 KO mice similarly control infection in liver and spleen. In contrast, bacterial clearance was delayed in TLR2×4 -/- and TLR2×4×9 -/- mice at 7 and 14 days post-infection. This defect correlated with impaired maturation and pro-inflammatory cytokine production in B. microti -infected dendritic cells from TLR2×4 -/- and TLR2×4×9 -/- mice. Finally, it was found that Tc cells from TLR2×4 -/- and TLR2×4×9 -/- mice showed reduced ability to inhibit growth of B. microti in macrophages, suggesting the involvement of TLR2 and 4 in the generation of specific Tc cells. Our findings indicate that TLR2 and TLR4 are required to control B. microti infection in mice and that this effect could be related to its participation in the maturation of dendritic cells and the generation of specific CD8 + Tc cells.

  6. THE USE OF PLANTS TO PROTECT PLANTS AND FOOD AGAINST FUNGAL PATHOGENS: A REVIEW.

    Science.gov (United States)

    Shuping, D S S; Eloff, J N

    2017-01-01

    Plant fungal pathogens play a crucial role in the profitability, quality and quantity of plant production. These phytopathogens are persistent in avoiding plant defences causing diseases and quality losses around the world that amount to billions of US dollars annually. To control the scourge of plant fungal diseases, farmers have used fungicides to manage the damage of plant pathogenic fungi. Drawbacks such as development of resistance and environmental toxicity associated with these chemicals have motivated researchers and cultivators to investigate other possibilities. Several databases were accessed to determine work done on protecting plants against plant fungal pathogens with plant extracts using search terms "plant fungal pathogen", "plant extracts" and "phytopathogens". Proposals are made on the best extractants and bioassay techniques to be used. In addition to chemical fungicides, biological agents have been used to deal with plant fungal diseases. There are many examples where plant extracts or plant derived compounds have been used as commercial deterrents of fungi on a large scale in agricultural and horticultural setups. One advantage of this approach is that plant extracts usually contain more than one antifungal compound. Consequently the development of resistance of pathogens may be lower if the different compounds affect a different metabolic process. Plants cultivated using plants extracts may also be marketed as organically produced. Many papers have been published on effective antimicrobial compounds present in plant extracts focusing on applications in human health. More research is required to develop suitable, sustainable, effective, cheaper botanical products that can be used to help overcome the scourge of plant fungal diseases. Scientists who have worked only on using plants to control human and animal fungal pathogens should consider the advantages of focusing on plant fungal pathogens. This approach could not only potentially increase

  7. Local and global control of ecological and biological networks

    OpenAIRE

    Alessandro Ferrarini

    2014-01-01

    Recently, I introduced a methodological framework so that ecological and biological networks can be controlled both from inside and outside by coupling network dynamics and evolutionary modelling. The endogenous control requires the network to be optimized at the beginning of its dynamics (by acting upon nodes, edges or both) so that it will then go inertially to the desired state. Instead, the exogenous control requires that exogenous controllers act upon the network at each time step. By th...

  8. The status of biological control and recommendations for improving uptake for the future

    NARCIS (Netherlands)

    Barratt, B.I.P.; Moran, V.C.; Bigler, F.; Lenteren, van J.C.

    2018-01-01

    Classical and augmentative biological control of insect pests and weeds has enjoyed a long history of successes. However, biocontrol practices have not been as universally accepted or optimally utilised as they could be. An International Organisation for Biological Control (IOBC) initiative brought

  9. The Plant Ribosome-Inactivating Proteins Play Important Roles in Defense against Pathogens and Insect Pest Attacks

    Directory of Open Access Journals (Sweden)

    Feng Zhu

    2018-02-01

    Full Text Available Ribosome-inactivating proteins (RIPs are toxic N-glycosidases that depurinate eukaryotic and prokaryotic rRNAs, thereby arresting protein synthesis during translation. RIPs are widely found in various plant species and within different tissues. It is demonstrated in vitro and in transgenic plants that RIPs have been connected to defense by antifungal, antibacterial, antiviral, and insecticidal activities. However, the mechanism of these effects is still not completely clear. There are a number of reviews of RIPs. However, there are no reviews on the biological functions of RIPs in defense against pathogens and insect pests. Therefore, in this report, we focused on the effect of RIPs from plants in defense against pathogens and insect pest attacks. First, we summarize the three different types of RIPs based on their physical properties. RIPs are generally distributed in plants. Then, we discuss the distribution of RIPs that are found in various plant species and in fungi, bacteria, algae, and animals. Various RIPs have shown unique bioactive properties including antibacterial, antifungal, antiviral, and insecticidal activity. Finally, we divided the discussion into the biological roles of RIPs in defense against bacteria, fungi, viruses, and insects. This review is focused on the role of plant RIPs in defense against bacteria, fungi, viruses, and insect attacks. The role of plant RIPs in defense against pathogens and insects is being comprehended currently. Future study utilizing transgenic technology approaches to study the mechanisms of RIPs will undoubtedly generate a better comprehending of the role of plant RIPs in defense against pathogens and insects. Discovering additional crosstalk mechanisms between RIPs and phytohormones or reactive oxygen species (ROS against pathogen and insect infections will be a significant subject in the field of biotic stress study. These studies are helpful in revealing significance of genetic control that can

  10. Biopesticides: An option for the biological pest control

    Directory of Open Access Journals (Sweden)

    Eusebio Nava Pérez

    2012-09-01

    Full Text Available The indiscriminate use of synthetic pesticides and the problems that its cause to human health, agriculture and the environment is comment, this paper also present general aspects about of biopesticides, and their uses in the biological pest control. By the nature these can be safely used in a sustainable agriculture. An example is the use of botanical pesticides whose active ingredient are the terpenes, alkaloids and phenolics, these have insecticide effects for many agriculture pests; also its are less expensive, are biodegradable and safe for humans and the environment, however havelittle residuality. Microbial pesticides are being introduced successfully to pests control in important crops such as; coffee, sugar cane, beans and corn. These products contain bacteria, fungi, viruses or nematodes. However, few entomopathogenic agents have been developed as effective biocontrol agents, one of them is the bacterium Bacillus thuringiensis (Berlinier for control of armyworm Spodoptera frugiperda (J.E Smith covering about 74% of the market,fungus 10% , viruses 5% and 11% others. Other upstanding case is the use of the fungus Beauveria bassiana (Balsamoagainst bean weevil Acanthoscelides obtectus (Say. Biopesticides have shown that when are used properly in the biological pest control its favor the practice of a sustainable agriculture, with less dependence of chemical insecticides.

  11. Potential for widespread application of biological control of stored-product pests

    DEFF Research Database (Denmark)

    Hansen, Lise Stengaard

    2007-01-01

    Biological control of stored product pests has substantial potential in Europe". This is essentially the conclusion of the activities of a European working group funded by the COST system, an intergovernmental networking system. Working group 4 of COST action 842 (2000-2005) focussed on biologica...... for these situations will contribute to ensuring that stored food products are protected from insect and mite pests using techniques that are safe for consumers, workers and the environment.......Biological control of stored product pests has substantial potential in Europe". This is essentially the conclusion of the activities of a European working group funded by the COST system, an intergovernmental networking system. Working group 4 of COST action 842 (2000-2005) focussed on biological...

  12. A systems biology approach to study systemic inflammation.

    Science.gov (United States)

    Chen, Bor-Sen; Wu, Chia-Chou

    2014-01-01

    Systemic inflammation needs a precise control on the sequence and magnitude of occurring events. The high throughput data on the host-pathogen interactions gives us an opportunity to have a glimpse on the systemic inflammation. In this article, a dynamic Candida albicans-zebrafish interactive infectious network is built as an example to demonstrate how systems biology approach can be used to study systematic inflammation. In particular, based on microarray data of C. albicans and zebrafish during infection, the hyphal growth, zebrafish, and host-pathogen intercellular PPI networks were combined to form an integrated infectious PPI network that helps us understand the systematic mechanisms underlying the pathogenicity of C. albicans and the immune response of the host. The signaling pathways for morphogenesis and hyphal growth of C. albicans were 2 significant interactions found in the intercellular PPI network. Two cellular networks were also developed corresponding to the different infection stages (adhesion and invasion), and then compared with each other to identify proteins to gain more insight into the pathogenic role of hyphal development in the C. albicans infection process. Important defense-related proteins in zebrafish were predicted using the same approach. This integrated network consisting of intercellular invasion and cellular defense processes during infection can improve medical therapies and facilitate development of new antifungal drugs.

  13. Complete genome sequence of Bacillus velezensis M75, a biocontrol agent against fungal plant pathogens, isolated from cotton waste.

    Science.gov (United States)

    Kim, Sang Yoon; Lee, Sang Yeob; Weon, Hang-Yeon; Sang, Mee Kyung; Song, Jaekyeong

    2017-01-10

    Bacillus species have been widely used as biological control agents in agricultural fields due to their ability to suppress plant pathogens. Bacillus velezensis M75 was isolated from cotton waste used for mushroom cultivation in Korea, and was found to be antagonistic to fungal plant pathogens. Here, we report the complete genome sequence of the M75 strain, which has a 4,007,450-bp single circular chromosome with 3921 genes and a G+C content of 46.60%. The genome contained operons encoding various non-ribosomal peptide synthetases and polyketide synthases, which are responsible for the biosynthesis of secondary metabolites. Our results will provide a better understanding of the genome of B. velezensis strains for their application as biocontrol agents against fungal plant pathogens in agricultural fields. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Natural biological control of pest mites in Brazilian sun coffee agroecosystems.

    Science.gov (United States)

    Teodoro, Adenir V; Sarmento, Renato A; Rêgo, Adriano S; da Graça S Maciel, Anilde

    2010-06-01

    Coffee is one of the leading commodities in tropical America. Although plantations are usually established under a canopy of trees in most producing countries in the region, Brazilian coffee is mostly produced under full sun conditions. Such simple, single-crop agroecosystems with intensive agrochemical inputs often suffer with pests like mites. Predatory mites of the family Phytoseiidae are the main natural enemies associated with pest mites in the field. However, these beneficial arthropods struggle to survive in intensive agroecosystems such as coffee monocultures due to unfavorable microclimatic conditions, widespread pesticide use, and lack of alternative food (pollen, nectar). Conservation biological control uses a range of management strategies to sustain and enhance populations of indigenous natural enemies such as predatory mites. We discuss here conservation biological control as a strategy to improve biological control of pest mites by native predatory mites in Brazilian coffee monocultures as well as some related patents.

  15. Control of biological hazards in cold smoked salmon production

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Embarek, Peter Karim Ben; Jeppesen, V.F.

    1995-01-01

    An outline of the common processing technology for cold smoked salmon in Denmark is presented. The safety hazards related to pathogenic bacteria, parasites and biogenic amines are discussed with special emphasis on hazards related to Clostridium botulinum and Listeria monocytogenes. Critical...... control points are identified for all hazards except growth of L. monocytogenes. For this reason a limitation of shelf life to three weeks at +5 degrees C far cold smoked vacuum-packed salmon having greater than or equal to 3% water phase salt is recommended...

  16. Research Regarding the Simultaneous Control of the Pathogens on Tomatoes Crops under High Plastic Tunnels

    Directory of Open Access Journals (Sweden)

    Gabriela ŞOVĂREL

    2017-05-01

    Full Text Available In Romania the most important pathogens on tomatoes crops are Alternaria porri f.sp. solani, Botrytis cinerea, Fulvia fulva, Phytophthora infestans and Erysiphe sp. During period of vegetation, the attack of mentioned pathogens are frequently overlapping. For simultaneously control of pathogenswere used some combination with different active substances (chlorothalonil 500g/l, iprodione 500 g/l, fenhexamid 500 g/l, thiophanate methyl 500g/l, metiram 80%, dimethomorph 9%, mancozeb 60%, difenoconazole 250 g/l , fenamidone 75g/l, propamocarb HCL 375 g/l. The best results for controlling Alternaria porri f.sp. solani, Botrytis cinerea and Fulvia fulva are metiram 80% 0.2% + thiophanate methyl 500g/l 0.14% with 93.5% efficacy. In the untreated check the degree of attack was 78.6% (44.3% A.solani, 7.0% B.cinerea and 27.3% F. Fulva. For controlling Phytophthora infestans, Erysiphe sp. and Fulvia fulva (fenamidone 75g/l + propamocarb HCL 375 g/l    0.2% +  difenoconazole 250 g/l 0.05% with 94.5% efficacy. In the untreated check the degree of attack is 81.2% (38.4% P. infestans, 27.4% Erysiphe sp. , 15.4% F. fulva.

  17. Daphnia magna shows reduced infection upon secondary exposure to a pathogen.

    Science.gov (United States)

    McTaggart, Seanna J; Wilson, Philip J; Little, Tom J

    2012-12-23

    Previous pathogen exposure is an important predictor of the probability of becoming infected. This is deeply understood for vertebrate hosts, and increasingly so for invertebrate hosts. Here, we test if an initial pathogen exposure changes the infection outcome to a secondary pathogen exposure in the natural host-pathogen system Daphnia magna and Pasteuria ramosa. Hosts were initially exposed to an infective pathogen strain, a non-infective pathogen strain or a control. The same hosts underwent a second exposure, this time to an infective pathogen strain, either immediately after the initial encounter or 48 h later. We observed that an initial encounter with a pathogen always conferred protection against infection compared with controls.

  18. Screening of Fungi for Biological Control of a Triatomine Vector of Chagas Disease: Temperature and Trypanosome Infection as Factors.

    Directory of Open Access Journals (Sweden)

    Aline R M Garcia

    2016-11-01

    Full Text Available Entomopathogenic fungi have been investigated as an alternative tool for controlling various insects, including triatomine vectors of the protozoan Trypanosoma cruzi, the etiological agent of Chagas disease. Here we tested the pathogenicity and virulence of ten isolates of the fungi Metarhizium spp. and Beauveria bassiana against Rhodnius prolixus and found all of the isolates to be virulent. We used two isolates (URPE-11 Metarhizium anisopliae and ENT-1 Beauveria bassiana for further screening based on their prolific sporulation in vitro (an important property of fungal biopesticides. We characterized their virulences in a dose-response experiment and then examined virulence across a range of temperatures (21, 23, 27 and 30°C. We found isolate ENT-1 to maintain higher levels of virulence over these temperatures than URPE-11. We therefore used B. bassiana ENT-1 in the final experiment in which we examined the survival of insects parasitized with T. cruzi and then infected with this fungus (once again over a range of temperatures. Contrary to our expectations, the survival of insects challenged with the pathogenic fungus was greater when they had previously been infected with the parasite T. cruzi than when they had not (independent of temperature. We discuss these results in terms of aspects of the biologies of the three organisms. In practical terms, we concluded that, while we have fungal isolates of potential interest for development as biopesticides against R. prolixus, we have identified what could be a critical problem for this biological tool: the parasite T. cruzi appears to confer a measure of resistance to the insect against the potential biopesticide agent so use of this fungus as a biopesticide could lead to selection for vector competence.

  19. Pathogenicity gene variations within the order Entomophthorales

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Lange, Lene

    Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms. In the ...... pathogenicity genes within genera Entomophthora and Pandora, using fungal genomic DNA originating from field-collected, infected insect host species of dipteran (flies, mosquitoes) or hemipteran (aphid) origin.......Fungi within the order Entomophthorales (subphylum Entomophthoromycotina) are obligate biotrophic pathogens of arthropods with a remarkable narrow host range. Infection takes place through the cuticle when conidia hit a susceptible host, facilitated by enzymatic and mechanical mechanisms......, conidia are produced and discharged when humidity gets high—usually during night. In an earlier secretome study of field-collected grain aphids (Sitobion avenae) infected with entomophthoralean fungi, a number of pathogenesis-related, secreted enzymes were discovered (Fungal Genetics and Biology 2011, vol...

  20. Biologically inspired control of humanoid robot arms robust and adaptive approaches

    CERN Document Server

    Spiers, Adam; Herrmann, Guido

    2016-01-01

    This book investigates a biologically inspired method of robot arm control, developed with the objective of synthesising human-like motion dynamically, using nonlinear, robust and adaptive control techniques in practical robot systems. The control method caters to a rising interest in humanoid robots and the need for appropriate control schemes to match these systems. Unlike the classic kinematic schemes used in industrial manipulators, the dynamic approaches proposed here promote human-like motion with better exploitation of the robot’s physical structure. This also benefits human-robot interaction. The control schemes proposed in this book are inspired by a wealth of human-motion literature that indicates the drivers of motion to be dynamic, model-based and optimal. Such considerations lend themselves nicely to achievement via nonlinear control techniques without the necessity for extensive and complex biological models. The operational-space method of robot control forms the basis of many of the techniqu...

  1. Strain improvement of fungal insecticides for controlling insect pests and vector-borne diseases.

    Science.gov (United States)

    Fang, Weiguo; Azimzadeh, Philippe; St Leger, Raymond J

    2012-06-01

    Insect pathogenic fungi play an important natural role in controlling insect pests. However, few have been successfully commercialized due to low virulence and sensitivity to abiotic stresses that produce inconsistent results in field applications. These limitations are inherent in most naturally occurring biological control agents but development of recombinant DNA techniques has made it possible to significantly improve the insecticidal efficacy of fungi and their tolerance to adverse conditions, including UV. These advances have been achieved by combining new knowledge derived from basic studies of the molecular biology of these pathogens, technical developments that enable very precise regulation of gene expression, and genes encoding insecticidal proteins from other organisms, particularly spiders and scorpions. Recent coverage of genomes is helping determine the identity, origin, and evolution of traits needed for diverse lifestyles and host switching. In future, such knowledge combined with the precision and malleability of molecular techniques will allow design of multiple pathogens with different strategies and host ranges to be used for different ecosystems, and that will avoid the possibility of the host developing resistance. With increasing public concern over the continued use of synthetic chemical insecticides, these new types of biological insecticides offer a range of environmental-friendly options for cost-effective control of insect pests. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Potential Biological and Climatic Factors That Influence the Incidence and Persistence of Highly Pathogenic H5N1 Avian Influenza Virus in Egypt

    Directory of Open Access Journals (Sweden)

    Ahmed H. Salaheldin

    2018-03-01

    Full Text Available Highly pathogenic H5N1 avian influenza virus (A/H5N1 of clade 2.2.1 is endemic in poultry in Egypt where the highest number of human infections worldwide was reported. During the last 12 years the Egyptian A/H5N1 evolved into several genotypes. In 2007-2014 vaccinated poultry suffered from antigenic drift variants of clade 2.2.1.1 and in 2014/2015 an unprecedented upsurge of A/H5N1 clade 2.2.1.2 occurred in poultry and humans. Factors contributing to the endemicity or re-emergence of A/H5N1 in poultry in Egypt remain unclear. Here, three potential factors were studied: climatic factors (temperature, relative humidity, and wind speed, biological fitness in vitro, and pathogenicity in domestic Pekin and Muscovy ducks. Statistical analyses using negative binomial regression models indicated that ambient temperature in winter months influenced the spread of A/H5N1 in different geographic areas analyzed in this study. In vitro, at 4 and 56°C 2.2.1.1 and recent 2.2.1.2 viruses were more stable than other viruses used in this study. Further, Pekin ducks were more resistant than Muscovy ducks and the viruses were excreted for up to 2 weeks post-infection assuming a strong role as a reservoir. Taken together, ambient temperature in winter months potentially contributes to increasing outbreaks in some regions in Egypt. Heat stability of clade 2.2.1.1 and recent 2.2.1.2 viruses probably favors their persistence at elevated temperatures. Importantly, asymptomatically infected Pekin ducks may play an important role in the spread of avian and human-like A/H5N1 in Egypt. Therefore, control measures including targeted surveillance and culling of silently infected Pekin ducks should be considered.

  3. Potential Biological and Climatic Factors That Influence the Incidence and Persistence of Highly Pathogenic H5N1 Avian Influenza Virus in Egypt

    Science.gov (United States)

    Salaheldin, Ahmed H.; Kasbohm, Elisa; El-Naggar, Heba; Ulrich, Reiner; Scheibner, David; Gischke, Marcel; Hassan, Mohamed K.; Arafa, Abdel-Satar A.; Hassan, Wafaa M.; Abd El-Hamid, Hatem S.; Hafez, Hafez M.; Veits, Jutta; Mettenleiter, Thomas C.; Abdelwhab, Elsayed M.

    2018-01-01

    Highly pathogenic H5N1 avian influenza virus (A/H5N1) of clade 2.2.1 is endemic in poultry in Egypt where the highest number of human infections worldwide was reported. During the last 12 years the Egyptian A/H5N1 evolved into several genotypes. In 2007-2014 vaccinated poultry suffered from antigenic drift variants of clade 2.2.1.1 and in 2014/2015 an unprecedented upsurge of A/H5N1 clade 2.2.1.2 occurred in poultry and humans. Factors contributing to the endemicity or re-emergence of A/H5N1 in poultry in Egypt remain unclear. Here, three potential factors were studied: climatic factors (temperature, relative humidity, and wind speed), biological fitness in vitro, and pathogenicity in domestic Pekin and Muscovy ducks. Statistical analyses using negative binomial regression models indicated that ambient temperature in winter months influenced the spread of A/H5N1 in different geographic areas analyzed in this study. In vitro, at 4 and 56°C 2.2.1.1 and recent 2.2.1.2 viruses were more stable than other viruses used in this study. Further, Pekin ducks were more resistant than Muscovy ducks and the viruses were excreted for up to 2 weeks post-infection assuming a strong role as a reservoir. Taken together, ambient temperature in winter months potentially contributes to increasing outbreaks in some regions in Egypt. Heat stability of clade 2.2.1.1 and recent 2.2.1.2 viruses probably favors their persistence at elevated temperatures. Importantly, asymptomatically infected Pekin ducks may play an important role in the spread of avian and human-like A/H5N1 in Egypt. Therefore, control measures including targeted surveillance and culling of silently infected Pekin ducks should be considered. PMID:29636730

  4. Onchocerciasis control: biological research is still needed

    Directory of Open Access Journals (Sweden)

    Boussinesq M.

    2008-09-01

    Full Text Available Achievements obtained by the onchocerciasis control programmes should not lead to a relaxation in the biological research on Onchocerca volvulus. Issues such as the Loa loa-related postivermectin serious adverse events, the uncertainties as to whether onchocerciasis can be eliminated by ivermectin treatments, and the possible emergence of ivermectin-resistant O. volvulus populations should be addressed proactively. Doxycycline, moxidectin and emodepside appear to be promising as alternative drugs against onchocerciasis but support to researches in immunology and genomics should also be increased to develop new control tools, including both vaccines and macrofilaricidal drugs.

  5. DNA mutations mediate microevolution between host-adapted forms of the pathogenic fungus Cryptococcus neoformans.

    Directory of Open Access Journals (Sweden)

    Denise A Magditch

    Full Text Available The disease cryptococcosis, caused by the fungus Cryptococcus neoformans, is acquired directly from environmental exposure rather than transmitted person-to-person. One explanation for the pathogenicity of this species is that interactions with environmental predators select for virulence. However, co-incubation of C. neoformans with amoeba can cause a "switch" from the normal yeast morphology to a pseudohyphal form, enabling fungi to survive exposure to amoeba, yet conversely reducing virulence in mammalian models of cryptococcosis. Like other human pathogenic fungi, C. neoformans is capable of microevolutionary changes that influence the biology of the organism and outcome of the host-pathogen interaction. A yeast-pseudohyphal phenotypic switch also happens under in vitro conditions. Here, we demonstrate that this morphological switch, rather than being under epigenetic control, is controlled by DNA mutation since all pseudohyphal strains bear mutations within genes encoding components of the RAM pathway. High rates of isolation of pseudohyphal strains can be explained by the physical size of RAM pathway genes and a hypermutator phenotype of the strain used in phenotypic switching studies. Reversion to wild type yeast morphology in vitro or within a mammalian host can occur through different mechanisms, with one being counter-acting mutations. Infection of mice with RAM mutants reveals several outcomes: clearance of the infection, asymptomatic maintenance of the strains, or reversion to wild type forms and progression of disease. These findings demonstrate a key role of mutation events in microevolution to modulate the ability of a fungal pathogen to cause disease.

  6. Biology and life history of Argopistes tsekooni (Coleoptera: Chrysomelidae) in China, a promising biological control agent of Chinese privet.

    Science.gov (United States)

    Y-Z Zhang; J. Sun; J.L. Hanula

    2009-01-01

    The biology and life history of Argopistes tsekooni Chen (Coleoptera: Chrysomelidae), a potential biological control agent of Chinese privet, Ligustrum sinense Lour., was studied under laboratory and outdoor conditions in Huangshan City of Anhui Province, China, in 2006. A. tsekooni larvae are leafminers that...

  7. Enhancing biological control of basal stem rot disease (Ganoderma boninense) in oil palm plantations.

    Science.gov (United States)

    Susanto, A; Sudharto, P S; Purba, R Y

    2005-01-01

    Basal Stem Rot (BSR) disease caused by Ganoderma boninense is the most destructive disease in oil palm, especially in Indonesia and Malaysia. The available control measures for BSR disease such as cultural practices and mechanical and chemical treatment have not proved satisfactory due to the fact that Ganoderma has various resting stages such as melanised mycelium, basidiospores and pseudosclerotia. Alternative control measures to overcome the Ganoderma problem are focused on the use of biological control agents and planting resistant material. Present studies conducted at Indonesian Oil Palm Research Institute (IOPRI) are focused on enhancing the use of biological control agents for Ganoderma. These activities include screening biological agents from the oil palm rhizosphere in order to evaluate their effectiveness as biological agents in glasshouse and field trials, testing their antagonistic activities in large scale experiments and eradicating potential disease inoculum with biological agents. Several promising biological agents have been isolated, mainly Trichoderma harzianum, T. viride, Gliocladium viride, Pseudomonas fluorescens, and Bacillus sp. A glasshouse and field trial for Ganoderma control indicated that treatment with T. harzianum and G. viride was superior to Bacillus sp. A large scale trial showed that the disease incidence was lower in a field treated with biological agents than in untreated fields. In a short term programme, research activities at IOPRI are currently focusing on selecting fungi that can completely degrade plant material in order to eradicate inoculum. Digging holes around the palm bole and adding empty fruit bunches have been investigated as ways to stimulate biological agents.

  8. Aquatic biology studies

    International Nuclear Information System (INIS)

    Anon.

    1976-01-01

    Aquatic biology studies focused on studying the hydrothermal effects of Par Pond reservoir on periphyton, plankton, zooplankton, macrophytes, human pathogens, and microbial activity; the variability between the artificial streams of the Flowing Streams Laboratory and Upper Three Runs Creek; and the bacterial production of methane in Savannah River Plant aquatic systems

  9. 75 FR 28232 - Availability of an Environmental Assessment for a Biological Control Agent for Hemlock Woolly...

    Science.gov (United States)

    2010-05-20

    ...] Availability of an Environmental Assessment for a Biological Control Agent for Hemlock Woolly Adelgid AGENCY..., into the continental United States for use as a biological control agent to reduce the severity of... biological control agent to reduce the severity of hemlock woolly adelgid (HWA) infestations. HWA, an...

  10. Incorporation of plant materials in the control of root pathogens in muskmelon

    Directory of Open Access Journals (Sweden)

    Andréa Mirne de Macêdo Dantas

    2013-12-01

    Full Text Available The effect of plant materials[Sunn Hemp (Crotalaria juncea, Castor Bean (Ricinus communis L., Cassava (Manihot esculenta Crantz and Neem (Azadirachta indica] and the times of incorporation of these materials in regards to the incidence of root rot in melon was evaluated in Ceará state, Brazil. The experiment was conducted in a commercial area with a history of root pathogens in cucurbitaceae. The randomized block design was used, in a 5 x 3 factorial arrangement with four repetitions. The treatments consisted of a combination of four plant materials (sunn hemp, castor beans, cassava and neem and a control with no soil incorporation of plant material and three times of incorporation (28, 21, and 14 days before the transplanting of the seedlings. Lower incidence of root rot was observed in practically all of the treatments where materials were incorporated at different times, with variation between the materials, corresponding with the time of incorporation, in relation to the soil without plant material. The pathogens isolated from the symptomatic muskmelon plants were Fusarium solani, Macrophomina phaseolina, Monosporascus cannonballus and Rhizoctonia solani, F. solani being encountered most frequently.

  11. Lawrence Livermore National Laboratory Workshop Characterization of Pathogenicity, Virulence and Host-Pathogen Interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krishnan, A

    2006-08-30

    The threats of bio-terrorism and newly emerging infectious diseases pose serious challenges to the national security infrastructure. Rapid detection and diagnosis of infectious disease in human populations, as well as characterizing pathogen biology, are critical for reducing the morbidity and mortality associated with such threats. One of the key challenges in managing an infectious disease outbreak, whether through natural causes or acts of overt terrorism, is detection early enough to initiate effective countermeasures. Much recent attention has been directed towards the utility of biomarkers or molecular signatures that result from the interaction of the pathogen with the host for improving our ability to diagnose and mitigate the impact of a developing infection during the time window when effective countermeasures can be instituted. Host responses may provide early signals in blood even from localized infections. Multiple innate and adaptive immune molecules, in combination with other biochemical markers, may provide disease-specific information and new targets for countermeasures. The presence of pathogen specific markers and an understanding of the molecular capabilities and adaptations of the pathogen when it interacts with its host may likewise assist in early detection and provide opportunities for targeting countermeasures. An important question that needs to be addressed is whether these molecular-based approaches will prove useful for early diagnosis, complement current methods of direct agent detection, and aid development and use of countermeasures. Lawrence Livermore National Laboratory (LLNL) will host a workshop to explore the utility of host- and pathogen-based molecular diagnostics, prioritize key research issues, and determine the critical steps needed to transition host-pathogen research to tools that can be applied towards a more effective national bio-defense strategy. The workshop will bring together leading researchers/scientists in the

  12. 77 FR 46373 - Availability of an Environmental Assessment for a Biological Control Agent for Hemlock Woolly...

    Science.gov (United States)

    2012-08-03

    ...] Availability of an Environmental Assessment for a Biological Control Agent for Hemlock Woolly Adelgid AGENCY... States for use as a biological control agent to reduce the severity of hemlock woolly adelgid... beetle from the western United States, into the eastern United States for use as a biological control...

  13. Pathogenic human viruses in coastal waters

    Science.gov (United States)

    Griffin, Dale W.; Donaldson, Kim A.; Paul, J.H.; Rose, Joan B.

    2003-01-01

    This review addresses both historical and recent investigations into viral contamination of marine waters. With the relatively recent emergence of molecular biology-based assays, a number of investigations have shown that pathogenic viruses are prevalent in marine waters being impacted by sewage. Research has shown that this group of fecal-oral viral pathogens (enteroviruses, hepatitis A viruses, Norwalk viruses, reoviruses, adenoviruses, rotaviruses, etc.) can cause a broad range of asymptomatic to severe gastrointestinal, respiratory, and eye, nose, ear, and skin infections in people exposed through recreational use of the water. The viruses and the nucleic acid signature survive for an extended period in the marine environment. One of the primary concerns of public health officials is the relationship between the presence of pathogens and the recreational risk to human health in polluted marine environments. While a number of studies have attempted to address this issue, the relationship is still poorly understood. A contributing factor to our lack of progress in the field has been the lack of sensitive methods to detect the broad range of both bacterial and viral pathogens. The application of new and advanced molecular methods will continue to contribute to our current state of knowledge in this emerging and

  14. 75 FR 69396 - Availability of an Environmental Assessment for a Biological Control Agent for Arundo donax

    Science.gov (United States)

    2010-11-12

    ... Biological Control Agent for Arundo donax AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION... alternatives to, the release of Arundo scale into the continental United States for use as a biological control... a biological control agent to reduce the severity of Arundo donax infestations. A. donax is a highly...

  15. Design control considerations for biologic-device combination products.

    Science.gov (United States)

    Anderson, Dave; Liu, Roger; Anand Subramony, J; Cammack, Jon

    2017-03-01

    Combination products are therapeutic and diagnostic medical products that combine drugs, devices, and/or biological products with one another. Historically, biologics development involved identifying efficacious doses administered to patients intravenously or perhaps by a syringe. Until fairly recently, there has been limited focus on developing an accompanying medical device, such as a prefilled syringe or auto-injector, to enable easy and more efficient delivery. For the last several years, and looking forward, where there may be little to distinguish biologics medicines with relatively similar efficacy profiles, the biotechnology market is beginning to differentiate products by patient-focused, biologic-device based combination products. As innovative as biologic-device combination products are, they can pose considerable development, regulatory, and commercialization challenges due to unique physicochemical properties and special clinical considerations (e.g., dosing volumes, frequency, co-medications, etc.) of the biologic medicine. A biologic-device combination product is a marriage between two partners with "cultural differences," so to speak. There are clear differences in the development, review, and commercialization processes of the biologic and the device. When these two cultures come together in a combination product, developers and reviewers must find ways to address the design controls and risk management processes of both the biologic and device, and knit them into a single entity with supporting product approval documentation. Moreover, digital medicine and connected health trends are pushing the boundaries of combination product development and regulations even further. Despite an admirable cooperation between industry and FDA in recent years, unique product configurations and design features have resulted in review challenges. These challenges have prompted agency reviewers to modernize consultation processes, while at the same time, promoting

  16. Isolation and expression of recombinant antibody fragments to the biological warfare pathogen Brucella melitensis.

    Science.gov (United States)

    Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George

    2003-05-01

    Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.

  17. The transcription factor Rbf1 is the master regulator for b-mating type controlled pathogenic development in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Kai Heimel

    Full Text Available In the phytopathogenic basidiomycete Ustilago maydis, sexual and pathogenic development are tightly connected and controlled by the heterodimeric bE/bW transcription factor complex encoded by the b-mating type locus. The formation of the active bE/bW heterodimer leads to the formation of filaments, induces a G2 cell cycle arrest, and triggers pathogenicity. Here, we identify a set of 345 bE/bW responsive genes which show altered expression during these developmental changes; several of these genes are associated with cell cycle coordination, morphogenesis and pathogenicity. 90% of the genes that show altered expression upon bE/bW-activation require the zinc finger transcription factor Rbf1, one of the few factors directly regulated by the bE/bW heterodimer. Rbf1 is a novel master regulator in a multilayered network of transcription factors that facilitates the complex regulatory traits of sexual and pathogenic development.

  18. Biological control of fusarium wilt of tomato by antagonist fungi and ...

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... Key words: Biological control, fusarium wilt, tomato, antagonist fungi, cyanobacteria. INTRODUCTION ... severely affected by wilt disease caused by F. oxysporum f. sp. ..... Changing options for the control of deciduous fruit.

  19. Roles of Forkhead-box Transcription Factors in Controlling Development, Pathogenicity, and Stress Response in Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Jaejin Park

    2014-06-01

    Full Text Available Although multiple transcription factors (TFs have been characterized via mutagenesis to understand their roles in controlling pathogenicity and infection-related development in Magnaporthe oryzae, the causal agent of rice blast, if and how forkhead-box (FOX TFs contribute to these processes remain to be characterized. Four putative FOX TF genes were identified in the genome of M. oryzae, and phylogenetic analysis suggested that two of them (MoFKH1 and MoHCM1 correspond to Ascomycota-specific members of the FOX TF family while the others (MoFOX1 and MoFOX2 are Pezizomycotina-specific members. Deletion of MoFKH1 (ΔMofkh1 resulted in reduced mycelial growth and conidial germination, abnormal septation and stress response, and reduced virulence. Similarly, ΔMohcm1 exhibited reduced mycelial growth and conidial germination. Conidia of ΔMofkh1 and ΔMohcm1 were more sensitive to one or both of the cell cycle inhibitors hydroxyurea and benomyl, suggesting their role in cell cycle control. On the other hand, loss of MoFOX1 (ΔMofox1 did not show any noticeable changes in development, pathogenicity, and stress response. Deletion of MoFOX2 was not successful even after repeated attempts. Taken together, these results suggested that MoFKH1 and Mo-HCM1 are important in fungal development and that MoFKH1 is further implicated in pathogenicity and stress response in M. oryzae.

  20. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Directory of Open Access Journals (Sweden)

    Sandra Pritzkow

    Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological

  1. Holarchical Systems and Emotional Holons : Biologically-Inspired System Designs for Control of Autonomous Aerial Vehicles

    Science.gov (United States)

    Ippolito, Corey; Plice, Laura; Pisanich, Greg

    2003-01-01

    The BEES (Bio-inspired Engineering for Exploration Systems) for Mars project at NASA Ames Research Center has the goal of developing bio-inspired flight control strategies to enable aerial explorers for Mars scientific investigations. This paper presents a summary of our ongoing research into biologically inspired system designs for control of unmanned autonomous aerial vehicle communities for Mars exploration. First, we present cooperative design considerations for robotic explorers based on the holarchical nature of biological systems and communities. Second, an outline of an architecture for cognitive decision making and control of individual robotic explorers is presented, modeled after the emotional nervous system of cognitive biological systems. Keywords: Holarchy, Biologically Inspired, Emotional UAV Flight Control

  2. Defense reactions of bean genotypes to bacterial pathogens in controlled conditions

    Science.gov (United States)

    Uysal, B.; Bastas, K. K.

    2018-03-01

    This study was focused on the role of antioxidant enzymes and total protein in imparting resistance against common bacterial blight caused by Xanthomonas axonopodis pv. phaseoli (Xap) and halo blight caused by Pseudomonas syringae pv. phaseolicola (Psp) in bean. Activities of Ascorbate peroxidase (APX), Catalase (CAT) and total protein were studied in resistant and susceptible bean genotypes. Five-day-old seedlings were inoculated with a bacterial suspension (108 CFU ml-1) and harvested at different time intervals (0, 12, 24 and 36 up to 72 h) under controlled growing conditions and assayed for antioxidant enzymes and total protein. Temporal increase of CAT, APX enzymes activities showed maximum activity at 12 h after both pathogens inoculation (hpi) in resistant cultivar, whereas in susceptible it increased at 72 h after both pathogens inoculation for CAT and 12, 24 h for APX enzymes. Maximum total protein activities were observed at 12 h and 24 h respectively after Xap, Psp inoculation (hpi) in resistant and maximum activities were observed at 24 h and 72 h respectively after Xap, Psp inoculation (hpi) in susceptible. Increase of antioxidant enzyme and total protein activities might be an important component in the defense strategy of resistance and susceptible bean genotypes against the bacterial infection. These findings suggest that disease protection is proportional to the amount of enhanced CAT, APX enzyme and total protein activity.

  3. Future research needs involving pathogens in groundwater

    Science.gov (United States)

    Bradford, Scott A.; Harvey, Ronald W.

    2017-01-01

    Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.

  4. Future research needs involving pathogens in groundwater

    Science.gov (United States)

    Bradford, Scott A.; Harvey, Ronald W.

    2017-06-01

    Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.

  5. Gamma irradiation inactivates honey bee fungal, microsporidian, and viral pathogens and parasites.

    Science.gov (United States)

    Simone-Finstrom, Michael; Aronstein, Kate; Goblirsch, Michael; Rinkevich, Frank; de Guzman, Lilia

    2018-03-01

    Managed honey bee (Apis mellifera) populations are currently facing unsustainable losses due to a variety of factors. Colonies are challenged with brood pathogens, such as the fungal agent of chalkbrood disease, the microsporidian gut parasite Nosema spp., and several viruses. These pathogens may be transmitted horizontally from worker to worker, vertically from queen to egg and via vectors like the parasitic mite, Varroa destructor. Despite the fact that these pathogens are widespread and often harbored in wax comb that is reused from year to year and transferred across beekeeping operations, few, if any, universal treatments exist for their control. In order to mitigate some of these biological threats to honey bees and to allow for more sustainable reuse of equipment, investigations into techniques for the sterilization of hive equipment and comb are of particular significance. Here, we investigated the potential of gamma irradiation for inactivation of the fungal pathogen Ascosphaera apis, the microsporidian Nosema ceranae and three honey bee viruses (Deformed wing virus [DWV], Black queen cell virus [BQCV], and Chronic bee paralysis virus [CBPV]), focusing on the infectivity of these pathogens post-irradiation. Results indicate that gamma irradiation can effectively inactivate A. apis, N. ceranae, and DWV. Partial inactivation was noted for BQCV and CBPV, but this did not reduce effects on mortality at the tested, relatively high doses. These findings highlight the importance of studying infection rate and symptom development post-treatment and not simply rate or quantity detected. These findings suggest that gamma irradiation may function as a broad treatment to help mitigate colony losses and the spread of pathogens through the exchange of comb across colonies, but raises the question why some viruses appear to be unaffected. These results provide the basis for subsequent studies on benefits of irradiation of used comb for colony health and productivity

  6. Transcriptional control of drug resistance, virulence and immune system evasion in pathogenic fungi: a cross-species comparison.

    Directory of Open Access Journals (Sweden)

    Pedro Pais

    2016-10-01

    Full Text Available Transcription factors are key players in the control of the activation or repression of gene expression programs in response to environmental stimuli. The study of regulatory networks taking place in fungal pathogens is a promising research topic that can help in the fight against these pathogens by targeting specific fungal pathways as a whole, instead of targeting more specific effectors of virulence or drug resistance. This review is focused on the analysis of regulatory networks playing a central role in the referred mechanisms in the human fungal pathogens Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Candida glabrata, Candida parapsilosis and Candida tropicalis. Current knowledge on the activity of the transcription factors characterized in each of these pathogenic fungal species will be addressed. Particular focus is given to their mechanisms of activation, regulatory targets and phenotypic outcome. The review further provides an evaluation on the conservation of transcriptional circuits among different fungal pathogens, highlighting the pathways that translate common or divergent traits among these species in what concerns their drug resistance, virulence and host immune evasion features. It becomes evident that the regulation of transcriptional networks is complex and presents significant variations among different fungal pathogens. Only the oxidative stress regulators Yap1 and Skn7 are conserved among all studied species; while some transcription factors, involved in nutrient homeostasis, pH adaptation, drug resistance and morphological switching are present in several, though not all species. Interestingly, in some cases not very homologous transcription factors display orthologous functions, whereas some homologous proteins have diverged in terms of their function in different species. A few cases of species specific transcription factors are also observed.

  7. Transcriptional Control of Drug Resistance, Virulence and Immune System Evasion in Pathogenic Fungi: A Cross-Species Comparison.

    Science.gov (United States)

    Pais, Pedro; Costa, Catarina; Cavalheiro, Mafalda; Romão, Daniela; Teixeira, Miguel C

    2016-01-01

    Transcription factors are key players in the control of the activation or repression of gene expression programs in response to environmental stimuli. The study of regulatory networks taking place in fungal pathogens is a promising research topic that can help in the fight against these pathogens by targeting specific fungal pathways as a whole, instead of targeting more specific effectors of virulence or drug resistance. This review is focused on the analysis of regulatory networks playing a central role in the referred mechanisms in the human fungal pathogens Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Candida glabrata, Candida parapsilosis , and Candida tropicalis . Current knowledge on the activity of the transcription factors characterized in each of these pathogenic fungal species will be addressed. Particular focus is given to their mechanisms of activation, regulatory targets and phenotypic outcome. The review further provides an evaluation on the conservation of transcriptional circuits among different fungal pathogens, highlighting the pathways that translate common or divergent traits among these species in what concerns their drug resistance, virulence and host immune evasion features. It becomes evident that the regulation of transcriptional networks is complex and presents significant variations among different fungal pathogens. Only the oxidative stress regulators Yap1 and Skn7 are conserved among all studied species; while some transcription factors, involved in nutrient homeostasis, pH adaptation, drug resistance and morphological switching are present in several, though not all species. Interestingly, in some cases not very homologous transcription factors display orthologous functions, whereas some homologous proteins have diverged in terms of their function in different species. A few cases of species specific transcription factors are also observed.

  8. Epigenetics and Why Biological Networks are More Controllable than Expected

    Science.gov (United States)

    Motter, Adilson

    2013-03-01

    A fundamental property of networks is that perturbations to one node can affect other nodes, potentially causing the entire system to change behavior or fail. In this talk, I will show that it is possible to exploit this same principle to control network behavior. This approach takes advantage of the nonlinear dynamics inherent to real networks, and allows bringing the system to a desired target state even when this state is not directly accessible or the linear counterpart is not controllable. Applications show that this framework permits both reprogramming a network to a desired task as well as rescuing networks from the brink of failure, which I will illustrate through various biological problems. I will also briefly review the progress our group has made over the past 5 years on related control of complex networks in non-biological domains.

  9. The Chernobyl accident: possible pathogenic mechanisms of origination of psychical and psychosomatic disadaptation

    International Nuclear Information System (INIS)

    Gelda, A.P

    1998-01-01

    The impact of the social-psychological and biological (low doze chronic irradiation, foods unbalance, local ecological hazards) factors increase a degree of pathogen influence on organism. It is known that chronic irradiation by low dozes promotes to an increase of sensitivity to damaging action other pathogenic factors. At the same time at the special functional condition (for example, stresses), radiosensitivity of organism and a number of non radiobiological agents in combined action with radiation enhances the radiobiological effect of irradiation. Predisposing factors have a certain significance. Taking into account a real social-psychological situation the problem of medico-biological consequences of the Chernobyl accident gets the special social-medical importance

  10. Asymmetric positive feedback loops reliably control biological responses.

    Science.gov (United States)

    Ratushny, Alexander V; Saleem, Ramsey A; Sitko, Katherine; Ramsey, Stephen A; Aitchison, John D

    2012-04-24

    Positive feedback is a common mechanism enabling biological systems to respond to stimuli in a switch-like manner. Such systems are often characterized by the requisite formation of a heterodimer where only one of the pair is subject to feedback. This ASymmetric Self-UpREgulation (ASSURE) motif is central to many biological systems, including cholesterol homeostasis (LXRα/RXRα), adipocyte differentiation (PPARγ/RXRα), development and differentiation (RAR/RXR), myogenesis (MyoD/E12) and cellular antiviral defense (IRF3/IRF7). To understand why this motif is so prevalent, we examined its properties in an evolutionarily conserved transcriptional regulatory network in yeast (Oaf1p/Pip2p). We demonstrate that the asymmetry in positive feedback confers a competitive advantage and allows the system to robustly increase its responsiveness while precisely tuning the response to a consistent level in the presence of varying stimuli. This study reveals evolutionary advantages for the ASSURE motif, and mechanisms for control, that are relevant to pharmacologic intervention and synthetic biology applications.

  11. Commercial Biological Control Agents Targeted Against Plant-Parasitic Root-knot Nematodes

    Directory of Open Access Journals (Sweden)

    Marie-Stéphane Tranier

    2014-12-01

    Full Text Available Root-knot nematodes are microscopic round worms, which cause severe agricultural losses. Their attacks affect the productivity by reducing the amount and the caliber of the fruits. Chemical control is widely used, but biological control appears to be a better solution, mainly using microorganisms to reduce the quantity of pests infecting crops. Biological control is developing gradually, and with time, more products are being marketed worldwide. They can be formulated with bacteria, viruses or with filamentous fungi, which can destroy and feed on phytoparasitic nematodes. To be used by the farmers, biopesticides must be legalized by the states, which has led to the establishment of a legal framework for their use, devised by various governmental organizations.

  12. Brevibacillus laterosporus, a Pathogen of Invertebrates and a Broad-Spectrum Antimicrobial Species

    Directory of Open Access Journals (Sweden)

    Luca Ruiu

    2013-09-01

    Full Text Available Brevibacillus laterosporus, a bacterium characterized by the production of a unique canoe-shaped lamellar body attached to one side of the spore, is a natural inhabitant of water, soil and insects. Its biopesticidal potential has been reported against insects in different orders including Coleoptera, Lepidoptera, Diptera and against nematodes and mollusks. In addition to its pathogenicity against invertebrates, different B. laterosporus strains show a broad-spectrum antimicrobial activity including activity against phytopathogenic bacteria and fungi. A wide variety of molecules, including proteins and antibiotics, have been associated with the observed pathogenicity and mode of action. Before being considered as a biological control agent against plant pathogens, the antifungal and antibacterial properties of certain B. laterosporus strains have found medical interest, associated with the production of antibiotics with therapeutic effects. The recent whole genome sequencing of this species revealed its potential to produce polyketides, nonribosomal peptides, and toxins. Another field of growing interest is the use of this bacterium for bioremediation of contaminated sites by exploiting its biodegradation properties. The aim of the present review is to gather and discuss all recent findings on this emerging entomopathogen, giving a wider picture of its complex and broad-spectrum biocontrol activity.

  13. From the root to the stem: interaction between the biocontrol root endophyte Pseudomonas fluorescens PICF7 and the pathogen Pseudomonas savastanoi NCPPB 3335 in olive knots

    Science.gov (United States)

    Maldonado-González, M Mercedes; Prieto, Pilar; Ramos, Cayo; Mercado-Blanco, Jesús

    2013-01-01

    Olive knot disease, caused by Pseudomonas savastanoi pv. savastanoi, is one of the most important biotic constraints for olive cultivation. Pseudomonas fluorescens PICF7, a natural colonizer of olive roots and effective biological control agent (BCA) against Verticillium wilt of olive, was examined as potential BCA against olive knot disease. Bioassays using in vitro-propagated olive plants were carried out to assess whether strain PICF7 controlled knot development either when co-inoculated with the pathogen in stems or when the BCA (in roots) and the pathogen (in stems) were spatially separated. Results showed that PICF7 was able to establish and persist in stem tissues upon artificial inoculation. While PICF7 was not able to suppress disease development, its presence transiently decreased pathogen population size, produced less necrotic tumours, and sharply altered the localization of the pathogen in the hyperplasic tissue, which may pose epidemiological consequences. Confocal laser scanning microscopy combined with fluorescent tagging of bacteria revealed that when PICF7 was absent the pathogen tended to be localized at the knot surface. However, presence of the BCA seemed to confine P. savastanoi at inner regions of the tumours. This approach has also enabled to prove that the pathogen can moved systemically beyond the hypertrophied tissue. PMID:23425069

  14. Protein-polymer nano-machines. Towards synthetic control of biological processes

    Directory of Open Access Journals (Sweden)

    Alexander Cameron

    2004-09-01

    Full Text Available Abstract The exploitation of nature's machinery at length scales below the dimensions of a cell is an exciting challenge for biologists, chemists and physicists, while advances in our understanding of these biological motifs are now providing an opportunity to develop real single molecule devices for technological applications. Single molecule studies are already well advanced and biological molecular motors are being used to guide the design of nano-scale machines. However, controlling the specific functions of these devices in biological systems under changing conditions is difficult. In this review we describe the principles underlying the development of a molecular motor with numerous potential applications in nanotechnology and the use of specific synthetic polymers as prototypic molecular switches for control of the motor function. The molecular motor is a derivative of a TypeI Restriction-Modification (R-M enzyme and the synthetic polymer is drawn from the class of materials that exhibit a temperature-dependent phase transition. The potential exploitation of single molecules as functional devices has been heralded as the dawn of new era in biotechnology and medicine. It is not surprising, therefore, that the efforts of numerous multidisciplinary teams 12. have been focused in attempts to develop these systems. as machines capable of functioning at the low sub-micron and nanometre length-scales 3. However, one of the obstacles for the practical application of single molecule devices is the lack of functional control methods in biological media, under changing conditions. In this review we describe the conceptual basis for a molecular motor (a derivative of a TypeI Restriction-Modification enzyme with numerous potential applications in nanotechnology and the use of specific synthetic polymers as prototypic molecular switches for controlling the motor function 4.

  15. Combinations of biocontrol agents for management of plant-parasitic nematodes and soilborne plant-pathogenic fungi.

    Science.gov (United States)

    Meyer, Susan L F; Roberts, Daniel P

    2002-03-01

    Numerous microbes are antagonistic to plant-parasitic nematodes and soilborne plant-pathogenic fungi, but few of these organisms are commercially available for management of these pathogens. Inconsistent performance of applied biocontrol agents has proven to be a primary obstacle to the development of successful commercial products. One of the strategies for overcoming inconsistent performance is to combine the disease-suppressive activity of two (or more) beneficial microbes in a biocontrol preparation. Such combinations have potential for more extensive colonization of the rhizosphere, more consistent expression of beneficial traits under a broad range of soil conditions, and antagonism to a larger number of plant pests or pathogens than strains applied individually. Conversely, microbes applied in combination also may have antagonistic interactions with each other. Increased, decreased, and unaltered suppression of the target pathogen or pest has been observed when biocontrol microbes have been applied in combination. Unfortunately, the ecological basis for increased or decreased suppression has not been determined in many cases and needs further consideration. The complexity of interactions involved in the application of multiple organisms for biological control has slowed progress toward development of successful formulations. However, this approach has potential for overcoming some of the efficacy problems that occur with application of individual biocontrol agents.

  16. Molecular mimicry modulates plant host responses to pathogens.

    Science.gov (United States)

    Ronald, Pamela; Joe, Anna

    2018-01-25

    Pathogens often secrete molecules that mimic those present in the plant host. Recent studies indicate that some of these molecules mimic plant hormones required for development and immunity. This Viewpoint reviews the literature on microbial molecules produced by plant pathogens that functionally mimic molecules present in the plant host. This article includes examples from nematodes, bacteria and fungi with emphasis on RaxX, a microbial protein produced by the bacterial pathogen Xanthomonas oryzae pv. oryzae. RaxX mimics a plant peptide hormone, PSY (plant peptide containing sulphated tyrosine). The rice immune receptor XA21 detects sulphated RaxX but not the endogenous peptide PSY. Studies of the RaxX/XA21 system have provided insight into both host and pathogen biology and offered a framework for future work directed at understanding how XA21 and the PSY receptor(s) can be differentially activated by RaxX and endogenous PSY peptides. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Species-specific chitin-binding module 18 expansion in the amphibian pathogen Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Abramyan, John; Stajich, Jason E

    2012-01-01

    Batrachochytrium dendrobatidis is the causative agent of chytridiomycosis, which is considered one of the driving forces behind the worldwide decline in populations of amphibians. As a member of the phylum Chytridiomycota, B. dendrobatidis has diverged significantly to emerge as the only pathogen of adult vertebrates. Such shifts in lifestyle are generally accompanied by various degrees of genomic modifications, yet neither its mode of pathogenicity nor any factors associated with it have ever been identified. Presented here is the identification and characterization of a unique expansion of the carbohydrate-binding module family 18 (CBM18), specific to B. dendrobatidis. CBM (chitin-binding module) expansions have been likened to the evolution of pathogenicity in a variety of fungus species, making this expanded group a prime candidate for the identification of potential pathogenicity factors. Furthermore, the CBM18 expansions are confined to three categories of genes, each having been previously implicated in host-pathogen interactions. These correlations highlight this specific domain expansion as a potential key player in the mode of pathogenicity in this unique fungus. The expansion of CBM18 in B. dendrobatidis is exceptional in its size and diversity compared to other pathogenic species of fungi, making this genomic feature unique in an evolutionary context as well as in pathogenicity. Amphibian populations are declining worldwide at an unprecedented rate. Although various factors are thought to contribute to this phenomenon, chytridiomycosis has been identified as one of the leading causes. This deadly fungal disease is cause by Batrachochytrium dendrobatidis, a chytrid fungus species unique in its pathogenicity and, furthermore, its specificity to amphibians. Despite more than two decades of research, the biology of this fungus species and its deadly interaction with amphibians had been notoriously difficult to unravel. Due to the alarming rate of worldwide

  18. Biological control of banana black Sigatoka disease with Trichoderma

    Directory of Open Access Journals (Sweden)

    Poholl Adan Sagratzki Cavero

    2015-06-01

    Full Text Available Black Sigatoka disease caused by Mycosphaerella fijiensis is the most severe banana disease worldwide. The pathogen is in an invasive phase in Brazil and is already present in most States of the country. The potential of 29 isolates of Trichoderma spp. was studied for the control of black Sigatoka disease under field conditions. Four isolates were able to significantly reduce disease severity and were further tested in a second field experiment. Isolate 2.047 showed the best results in both field experiments and was selected for fungicide sensitivity tests and mass production. This isolate was identified as Trichoderma atroviride by sequencing fragments of the ITS region of the rDNA and tef-1α of the RNA polymerase. Trichoderma atroviride was as effective as the fungicide Azoxystrobin, which is recommended for controlling black Sigatoka. This biocontrol agent has potential to control the disease and may be scaled-up for field applications on rice-based solid fermentation

  19. Distinct Mechanisms of Pathogenic DJ-1 Mutations in Mitochondrial Quality Control

    Directory of Open Access Journals (Sweden)

    Daniela Strobbe

    2018-03-01

    Full Text Available The deglycase and chaperone protein DJ-1 is pivotal for cellular oxidative stress responses and mitochondrial quality control. Mutations in PARK7, encoding DJ-1, are associated with early-onset familial Parkinson’s disease and lead to pathological oxidative stress and/or disrupted protein degradation by the proteasome. The aim of this study was to gain insights into the pathogenic mechanisms of selected DJ-1 missense mutations, by characterizing protein–protein interactions, core parameters of mitochondrial function, quality control regulation via autophagy, and cellular death following dopamine accumulation. We report that the DJ-1M26I mutant influences DJ-1 interactions with SUMO-1, in turn enhancing removal of mitochondria and conferring increased cellular susceptibility to dopamine toxicity. By contrast, the DJ-1D149A mutant does not influence mitophagy, but instead impairs Ca2+ dynamics and free radical homeostasis by disrupting DJ-1 interactions with a mitochondrial accessory protein known as DJ-1-binding protein (DJBP/EFCAB6. Thus, individual DJ-1 mutations have different effects on mitochondrial function and quality control, implying mutation-specific pathomechanisms converging on impaired mitochondrial homeostasis.

  20. The control of H5 or H7 mildly pathogenic avian influenza: a role for inactivated vaccine.

    Science.gov (United States)

    Halvorson, David A

    2002-02-01

    Biosecurity is the first line of defence in the prevention and control of mildly pathogenic avian influenza (MPAI). Its use has been highly successful in keeping avian influenza (AI) out of commercial poultry worldwide. However, sometimes AI becomes introduced into poultry populations and, when that occurs, biosecurity again is the primary means of controlling the disease. There is agreement that routine serological monitoring, disease reporting, isolation or quarantine of affected flocks, application of strict measures to prevent the contamination of and movement of people and equipment, and changing flock schedules are necessities for controlling AI. There is disagreement as to the disposition of MPAI-infected flocks: some advocate their destruction and others advocate controlled marketing. Sometimes biosecurity is not enough to stop the spread of MPAI. In general, influenza virus requires a dense population of susceptible hosts to maintain itself. When there is a large population of susceptible poultry in an area, use of an inactivated AI vaccine can contribute to AI control by reducing the susceptibility of the population. Does use of inactivated vaccine assist, complicate or interfere with AI control and eradication? Yes, it assists MPAI control (which may reduce the risk of highly pathogenic AI (HPAI)) but, unless steps are taken to prevent it, vaccination may interfere with sero-epidemiology in the case of an HPAI outbreak. Does lack of vaccine assist, complicate or interfere with AI control and eradication? Yes, it assists in identification of sero-positive (convalescent) flocks in a HPAI eradication program, but it interferes with MPAI control (which in turn may increase the risk of emergence of HPAI).A number of hypothetical concerns have been raised about the use of inactivated AI vaccines. Infection of vaccinated flocks, serology complications and spreading of virus by vaccine crews are some of the hypothetical concerns. The discussion of these concerns

  1. Microbial Inhibition of Fusarium Pathogens and Biological Modification of Trichothecenes in Cereal Grains

    Directory of Open Access Journals (Sweden)

    Urszula Wachowska

    2017-12-01

    Full Text Available Fungi of the genus Fusarium infect cereal crops during the growing season and cause head blight and other diseases. Their toxic secondary metabolites (mycotoxins contaminate grains. Several dozen toxic compounds produced by fungal pathogens have been identified to date. Type B trichothecenes—deoxynivalenol, its acetyl derivatives and nivalenol (produced mainly by F. graminearum and F. culmorum—are most commonly detected in cereal grains. “T-2 toxin” (produced by, among others, F. sporotrichioides belongs to type-A trichothecenes which are more toxic than other trichothecenes. Antagonistic bacteria and fungi can affect pathogens of the genus Fusarium via different modes of action: direct (mycoparasitism or hyperparasitism, mixed-path (antibiotic secretion, production of lytic enzymes and indirect (induction of host defense responses. Microbial modification of trichothecenes involves acetylation, deacetylation, oxidation, de-epoxidation, and epimerization, and it lowers the pathogenic potential of fungi of the genus Fusarium. Other modifing mechanisms described in the paper involve the physical adsorption of mycotoxins in bacterial cells and the conjugation of mycotoxins to glucose and other compounds in plant and fungal cells. The development of several patents supports the commercialization and wider application of microorganisms biodegrading mycotoxins in grains and, consequently, in feed additives.

  2. Rtt109-dependent histone H3 K56 acetylation and gene activity are essential for the biological control potential of Beauveria bassiana.

    Science.gov (United States)

    Cai, Qing; Wang, Juan-Juan; Shao, Wei; Ying, Sheng-Hua; Feng, Ming-Guang

    2018-04-27

    Rtt109 is a histone acetyltransferase that catalyzes histone H3K56 acetylation required for genomic stability, DNA damage repair and virulence-related gene activity in yeast-like human pathogens but remains functionally unknown in fungal insect pathogens. This study seeks to elucidate catalytic activity of Rtt109 orthologue and its possible role in sustaining biological control potential of Beauveria bassiana, a fungal entomopathogen. Deletion of rtt109 in B. bassiana abolished histone H3K56 acetylation and triggered histone H2A-S129 phosphorylation. Consequently, the deletion mutant showed increased sensitivities to the stresses of DNA damage, oxidation, cell wall perturbation, high osmolarity and heat shock during colony growth, severe conidiation defects under normal culture conditions, reduced conidial hydrophobicity, decreased conidial UV-B resistance, and attenuated virulence through normal cuticle infection. These phenotypic changes correlated well with reduced transcript levels of many genes, which encode the families of H2A-S129 dephosphorylation-related protein phosphotases, DNA damage-repairing factors, antioxidant enzymes, heat-shock proteins, key developmental activators, hydrophobins and cuticle-degrading Pr1 proteases respectively. Rtt109 can acetylate H3K56 and dephosphorylate H2A-S129 in direct and indirect manners respectively, and hence plays an essential role in sustaining genomic stability and global gene activity required for conidiation capacity, environmental fitness and pest-control potential in B. bassiana. This article is protected by copyright. All rights reserved.

  3. Diaphorina citri (Hemiptera: Liviidae) Vector Competence for the Citrus Greening Pathogen 'Candidatus Liberibacter Asiaticus'.

    Science.gov (United States)

    Tabachnick, Walter J

    2015-06-01

    Characterizing the vector competence of Diaphorina citri Kuwayama for 'Candidatus Liberibacter asiaticus,' the pathogen causing citrus greening, is essential for understanding the epidemiology of this disease that is threatening the U.S. citrus industry. Vector competence studies have been difficult because of the biology of D. citri, the inability to culture the pathogen, and the available diagnostic methods used to detect the bacteria in plant and insect tissues. The methods employed in many studies of D. citri vector competence may have overestimated amounts of live 'Ca. L. asiaticus' in both plant and insect tissues, and it is possible that the amounts of phloem ingested by psyllids may not contain sufficient detectable pathogen using current diagnostic methods. As a result of the difficulty in characterizing D. citri vector competence, the several daunting challenges for providing D. citri that are unable to inoculate 'Ca. L. asiaticus', as a novel method to control greening are discussed. Suggestions to overcome some of these challenges are provided. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Electrokinetically-controlled RNA-DNA hybridization assay for foodborne pathogens

    International Nuclear Information System (INIS)

    Weng, X.; Jiang, H.; Li, D.

    2012-01-01

    We have developed a microfluidic chip for use in an RNA-DNA hybridization assay for foodborne pathogens. Automatic sequential reagent dispensing and washing was realized with a programmable DC voltage sequencer. Signal detection was achieved with a miniaturized optical detection module. Salmonella and Listeria monocytogenes bacteria in different concentrations were quantitatively determined by this RNA-DNA hybridization assay in the microfluidic chip. The detection limit for the Salmonella and Listeria monocytogenes bacteria is 10 3 to 10 4 CFU mL -1 . The method excels by a significant reduction in the consumption of sample and reagent, and a short assay time. This automatic-operating microfluidic RNA-DNA hybridization assay is promising for on-site pathogen detection. (author)

  5. 75 FR 28233 - Availability of an Environmental Assessment for a Biological Control Agent for Asian Citrus Psyllid

    Science.gov (United States)

    2010-05-20

    ...] Availability of an Environmental Assessment for a Biological Control Agent for Asian Citrus Psyllid AGENCY... radiata, into the continental United States for use as a biological control agent to reduce the severity... of an alternative biological control agent, an encyrtid wasp, (Diaphorencyrtus aligarhensis). However...

  6. Understanding the behavior of foodborne pathogens in the food chain

    DEFF Research Database (Denmark)

    Rantsiou, Kalliopi; Mataragas, Marios; Jespersen, Lene

    2011-01-01

    In recent years and with the significant advancements in instrumentation for molecular biology methods, the focus of food microbiologists, dealing with pathogenic microorganisms in foods, is shifting. Scientists specifically aim at elucidating the effect that the food composition, as well...

  7. Surveillance of laboratory exposures to human pathogens and toxins: Canada 2016.

    Science.gov (United States)

    Bienek, A; Heisz, M; Su, M

    2017-11-02

    Canada recently enacted legislation to authorize the collection of data on laboratory incidents involving a biological agent. This is done by the Public Health Agency of Canada (PHAC) as part of a comprehensive national program that protects Canadians from the health and safety risks posed by human and terrestrial animal pathogens and toxins. To describe the first year of data on laboratory exposure incidents and/or laboratory-acquired infections in Canada since the Human Pathogens and Toxins Regulations came into effect. Incidents that occurred between January 1 and December 31, 2016 were self-reported by federally-regulated parties across Canada using a standardized form from the Laboratory Incident Notification Canada (LINC) surveillance system. Exposure incidents were described by sector, frequency of occurrence, timeliness of reporting, number of affected persons, human pathogens and toxins involved, causes and corrective actions taken. Microsoft Excel 2010 was used for basic descriptive analyses. In 2016, 46 exposure incidents were reported by holders of 835 active licences in Canada representing 1,352 physical areas approved for work involving a biological agent, for an overall incidence of 3.4%. The number of incidents was highest in the academic (n=16; 34.8%) and hospital (n=12; 26.1%) sectors, while the number of reported incidents was relatively low in the private industry sector. An average of four to five incidents occurred each month; the month of September presented as an outlier with 10 incidents. ​: A total of 100 people were exposed, with no reports of secondary exposure. Four incidents led to suspected (n=3) or confirmed (n=1) cases of laboratory-acquired infection. Most incidents involved pathogens classified at a risk group 2 level that were manipulated in a containment level 2 laboratory (91.3%). Over 22 different species of human pathogens and toxins were implicated, with bacteria the most frequent (34.8%), followed by viruses (26

  8. Evidence of Two Lyssavirus Phylogroups with Distinct Pathogenicity and Immunogenicity

    Science.gov (United States)

    Badrane, Hassan; Bahloul, Chokri; Perrin, Pierre; Tordo, Noël

    2001-01-01

    The genetic diversity of representative members of the Lyssavirus genus (rabies and rabies-related viruses) was evaluated using the gene encoding the transmembrane glycoprotein involved in the virus-host interaction, immunogenicity, and pathogenicity. Phylogenetic analysis distinguished seven genotypes, which could be divided into two major phylogroups having the highest bootstrap values. Phylogroup I comprises the worldwide genotype 1 (classic Rabies virus), the European bat lyssavirus (EBL) genotypes 5 (EBL1) and 6 (EBL2), the African genotype 4 (Duvenhage virus), and the Australian bat lyssavirus genotype 7. Phylogroup II comprises the divergent African genotypes 2 (Lagos bat virus) and 3 (Mokola virus). We studied immunogenic and pathogenic properties to investigate the biological significance of this phylogenetic grouping. Viruses from phylogroup I (Rabies virus and EBL1) were found to be pathogenic for mice when injected by the intracerebral or the intramuscular route, whereas viruses from phylogroup II (Mokola and Lagos bat viruses) were only pathogenic by the intracerebral route. We showed that the glycoprotein R333 residue essential for virulence was naturally replaced by a D333 in the phylogroup II viruses, likely resulting in their attenuated pathogenicity. Moreover, cross-neutralization distinguished the same phylogroups. Within each phylogroup, the amino acid sequence of the glycoprotein ectodomain was at least 74% identical, and antiglycoprotein virus-neutralizing antibodies displayed cross-neutralization. Between phylogroups, the identity was less than 64.5% and the cross-neutralization was absent, explaining why the classical rabies vaccines (phylogroup I) cannot protect against lyssaviruses from phylogroup II. Our tree-axial analysis divided lyssaviruses into two phylogroups that more closely reflect their biological characteristics than previous serotypes and genotypes. PMID:11238853

  9. The impact of the pathogen Rhizoctonia solani and its beneficial counterpart Bacillus amyloliquefaciens on the indigenous lettuce microbiome

    Directory of Open Access Journals (Sweden)

    Armin eErlacher

    2014-04-01

    Full Text Available Lettuce belongs to the most commonly raw eaten food worldwide and its microbiome plays an important role for both human and plant health. Yet, little is known about the impact of potentially occurring pathogens and beneficial inoculants of the indigenous microorganisms associated with lettuce. To address this question we studied the impact of the phytopathogenic fungus Rhizoctonia solani and the biological control agent Bacillus amyloliquefaciens FZB42 on the indigenous rhizosphere and phyllosphere community of greenhouse-grown lettuce at two plant stages. The rhizosphere and phyllosphere gammaproteobacterial microbiomes of lettuce plants showed clear differences in their overall and core microbiome composition as well as in corresponding diversity indices. The rhizosphere was dominated by Xanthomonadaceae (48% and Pseudomonadaceae (37% with Rhodanobacter, Pseudoxanthomonas, Dokdonella, Luteimonas, Steroidobacter, Thermomonas as core inhabitants, while the dominating taxa associated to phyllosphere were Pseudomonadaceae (54%, Moraxellaceae (16% and Enterobacteriaceae (25% with Alkanindiges, Pantoea and a group of Enterobacteriaceae unclassified at genus level. The preferential occurrence of enterics in the phyllosphere was the most significant difference between both habitats. Additional enhancement of enterics on the phyllosphere was observed in bottom rot diseased lettuce plants, while Acinetobacter and Alkanindiges were identified as indicators of healthy plants. Interestingly, the microbial diversity was enhanced by treatment with both the pathogen, and the co-inoculated biological control agent. The highest impact and bacterial diversity was found by Rhizoctonia inoculation, but FZB42 lowered the impact of Rhizoctonia on the microbiome. This study shows that the indigenous microbiome shifts as a consequence to pathogen attack but FZB42 can compensate these effects, which supports their role as biocontrol agent and suggests a novel mode of

  10. The biology of Colletotrichum acutatum

    Directory of Open Access Journals (Sweden)

    Diéguez-Uribeondo, Javier

    2004-06-01

    Full Text Available Colletotrichum acutatum is major pathogen of fruit crops, causing economically important losses of temperate, subtropical and tropical fruits worldwide. However, few studies have been carried out on key aspects of its biology. This is mainly because traditionally isolates of C. acutatum were often wrongly identified as C. gloeosporioides. Effective separation of the two species was not possible until the introduction of molecular tools for taxonomy. The life cycle of C. acutatum comprises a sexual and an asexual stage and much remains to be resolved regarding the genetics of sexuality and the effects of the sexual stage on population structure. Colletotrichum acutatum exhibits both infection strategies described for Colletotrichum species, i.e. intracellular hemibiotrophy and subcuticular-intramural necrotrophy, and may also undergo a period of quiescence in order to overcome resistance mechanisms in immature fruit such as pre-formed toxic compounds and phytoalexins, or due to the unsuitability of unripe fruit to fulfill the nutritional and energy requirements of the pathogen. Colletotrichum acutatum may overwinter as mycelium and/or appressoria in or on different parts of the host. Conidia are water-born and spread by rain episodes so infections are usually highest during the wettest periods of the growing season. Current management strategies for this fungus comprise the exploitation of cultivar resistance, cultural, chemical, and biological control methods, and preventive strategies such as disease-forecasting models. This review focuses on the current knowledge of biological aspects of C. acutatum and related Colletotrichum species and includes a discussion of the progress towards their control.Colletotrichum acutatum es uno de los principales hongos patógenos en agricultura y responsable de importantes pérdidas económicas en frutales en áreas tanto de climas templados como subtropicales y tropicales. Sin embargo, existen pocos estudios

  11. Pathogenicity of bloodstream and cerebrospinal fluid forms of ...

    African Journals Online (AJOL)

    kemrilib

    brain barrier and invade the central nervous system (CNS). However, it is not clear whether bloodstream forms (BSF) of T.b.rhodesiense differ in biological characteristics from ... carried out to compare the pathogenicity of CSF and BSF of T.b. rhodesiense parasites in ..... Swiss white of the same sex, the difference in survival ...

  12. Biological control of Fusarium moniliforme in maize.

    Science.gov (United States)

    Bacon, C W; Yates, I E; Hinton, D M; Meredith, F

    2001-05-01

    Fusarium moniliforme Sheldon, a biological species of the mating populations within the (italic)Gibberella fujikuroi species complex, i.e., population A [= G. moniliformis (Sheld.) Wineland], is an example of a facultative fungal endophyte. During the biotrophic endophytic association with maize, as well as during saprophytic growth, F. moniliforme produces the fumonisins. The fungus is transmitted vertically and horizontally to the next generation of plants via clonal infection of seeds and plant debris. Horizontal infection is the manner by which this fungus is spread contagiously and through which infection occurs from the outside that can be reduced by application of certain fungicides. The endophytic phase is vertically transmitted. This type infection is important because it is not controlled by seed applications of fungicides, and it remains the reservoir from which infection and toxin biosynthesis takes place in each generation of plants. Thus, vertical transmission of this fungus is just as important as horizontal transmission. A biological control system using an endophytic bacterium, Bacillus subtilis, has been developed that shows great promise for reducing mycotoxin accumulation during the endophytic (vertical transmission) growth phase. Because this bacterium occupies the identical ecological niche within the plant, it is considered an ecological homologue to F. moniliforme, and the inhibitory mechanism, regardless of the mode of action, operates on the competitive exclusion principle. In addition to this bacterium, an isolate of a species of the fungus Trichoderma shows promise in the postharvest control of the growth and toxin accumulation from F. moniliforme on corn in storage.

  13. A Role for Nonsense-Mediated mRNA Decay in Plants: Pathogen Responses Are Induced in Arabidopsis thaliana NMD Mutants

    Science.gov (United States)

    Rayson, Samantha; Arciga-Reyes, Luis; Wootton, Lucie; De Torres Zabala, Marta; Truman, William; Graham, Neil; Grant, Murray; Davies, Brendan

    2012-01-01

    Nonsense-mediated mRNA decay (NMD) is a conserved mechanism that targets aberrant mRNAs for destruction. NMD has also been found to regulate the expression of large numbers of genes in diverse organisms, although the biological role for this is unclear and few evolutionarily conserved targets have been identified. Expression analyses of three Arabidopsis thaliana lines deficient in NMD reveal that the vast majority of NMD-targeted transcripts are associated with response to pathogens. Congruently, NMD mutants, in which these transcripts are elevated, confer partial resistance to Pseudomonas syringae. These findings suggest a biological rationale for the regulation of gene expression by NMD in plants and suggest that manipulation of NMD could offer a new approach for crop protection. Amongst the few non-pathogen responsive NMD-targeted genes, one potential NMD targeted signal, the evolutionarily conserved upstream open reading frame (CuORF), was found to be hugely over-represented, raising the possibility that this feature could be used to target specific physiological mRNAs for control by NMD. PMID:22384098

  14. Contamination of water resources by pathogenic bacteria

    Science.gov (United States)

    2014-01-01

    Water-borne pathogen contamination in water resources and related diseases are a major water quality concern throughout the world. Increasing interest in controlling water-borne pathogens in water resources evidenced by a large number of recent publications clearly attests to the need for studies that synthesize knowledge from multiple fields covering comparative aspects of pathogen contamination, and unify them in a single place in order to present and address the problem as a whole. Providing a broader perceptive of pathogen contamination in freshwater (rivers, lakes, reservoirs, groundwater) and saline water (estuaries and coastal waters) resources, this review paper attempts to develop the first comprehensive single source of existing information on pathogen contamination in multiple types of water resources. In addition, a comprehensive discussion describes the challenges associated with using indicator organisms. Potential impacts of water resources development on pathogen contamination as well as challenges that lie ahead for addressing pathogen contamination are also discussed. PMID:25006540

  15. Control of Root Rot and Wilt Diseases of Roselle under Field Conditions

    Science.gov (United States)

    Hassan, Naglaa; Elsharkawy, Mohsen Mohamed; Shimizu, Masafumi

    2014-01-01

    Roselle (Hibiscus sabdariffa L.) is one of the most important medicinal crops in many parts of the world. In this study, the effects of microelements, antioxidants, and bioagents on Fusarium oxysporum, F. solani, and Macrophomina phaseolina, the causal pathogens of root rot and wilt diseases in roselle, were examined under field conditions. Preliminary studies were carried out in vitro in order to select the most effective members to be used in field control trials. Our results showed that microelements (copper and manganese), antioxidants (salicylic acid, ascorbic acid, and EDTA), a fungicide (Dithane M45) and biological control agents (Trichoderma harzianum and Bacillus subtilis) were significantly reduced the linear growth of the causal pathogens. Additionally, application of the previous microelements, antioxidants, a fungicide and biological control agents significantly reduced disease incidence of root rot and wilt diseases under field conditions. Copper, salicylic acid, and T. harzianum showed the best results in this respect. In conclusion, microelements, antioxidants, and biocontrol agents could be used as alternative strategies to fungicides for controlling root rot and wilt diseases in roselle. PMID:25606010

  16. Bacterial size matters: Multiple mechanisms controlling septum cleavage and diplococcus formation are critical for the virulence of the opportunistic pathogen Enterococcus faecalis

    Science.gov (United States)

    Salamaga, Bartłomiej; Prajsnar, Tomasz K.; Willemse, Joost; Bewley, Martin A.; Chau, Françoise

    2017-01-01

    Enterococcus faecalis is an opportunistic pathogen frequently isolated in clinical settings. This organism is intrinsically resistant to several clinically relevant antibiotics and can transfer resistance to other pathogens. Although E. faecalis has emerged as a major nosocomial pathogen, the mechanisms underlying the virulence of this organism remain elusive. We studied the regulation of daughter cell separation during growth and explored the impact of this process on pathogenesis. We demonstrate that the activity of the AtlA peptidoglycan hydrolase, an enzyme dedicated to septum cleavage, is controlled by several mechanisms, including glycosylation and recognition of the peptidoglycan substrate. We show that the long cell chains of E. faecalis mutants are more susceptible to phagocytosis and are no longer able to cause lethality in the zebrafish model of infection. Altogether, this work indicates that control of cell separation during division underpins the pathogenesis of E. faecalis infections and represents a novel enterococcal virulence factor. We propose that inhibition of septum cleavage during division represents an attractive therapeutic strategy to control infections. PMID:28742152

  17. Bacterial size matters: Multiple mechanisms controlling septum cleavage and diplococcus formation are critical for the virulence of the opportunistic pathogen Enterococcus faecalis.

    Directory of Open Access Journals (Sweden)

    Bartłomiej Salamaga

    2017-07-01

    Full Text Available Enterococcus faecalis is an opportunistic pathogen frequently isolated in clinical settings. This organism is intrinsically resistant to several clinically relevant antibiotics and can transfer resistance to other pathogens. Although E. faecalis has emerged as a major nosocomial pathogen, the mechanisms underlying the virulence of this organism remain elusive. We studied the regulation of daughter cell separation during growth and explored the impact of this process on pathogenesis. We demonstrate that the activity of the AtlA peptidoglycan hydrolase, an enzyme dedicated to septum cleavage, is controlled by several mechanisms, including glycosylation and recognition of the peptidoglycan substrate. We show that the long cell chains of E. faecalis mutants are more susceptible to phagocytosis and are no longer able to cause lethality in the zebrafish model of infection. Altogether, this work indicates that control of cell separation during division underpins the pathogenesis of E. faecalis infections and represents a novel enterococcal virulence factor. We propose that inhibition of septum cleavage during division represents an attractive therapeutic strategy to control infections.

  18. Compatible biological and chemical control systems for Rhizoctonia solani in potato

    NARCIS (Netherlands)

    Boogert, van den P.H.J.F.; Luttikholt, A.J.G.

    2004-01-01

    A series of chemical and biological control agents were tested for compatibility with the Rhizoctonia-specific biocontrol fungus Verticillium biguttatum aimed at designing novel control strategies for black scurf (Rhizoctonia solani) and other tuber diseases in potato. The efficacy of chemicals,

  19. Biological control of necrotrophic plant pathogenic fungi: Tomato ...

    African Journals Online (AJOL)

    Egyptian Journal of Biotechnology. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 25 (2007) >. Log in or Register to get access to full text downloads.

  20. Biological Control of Aquatic Plants with Pathogenic Fungi

    Science.gov (United States)

    1981-01-01

    methods have not been entirely satisfactory because of cost, overall ineffectiveness, or environmental pollution . The energy problem as it relates to...canal system near Cocoa, Florida, and in Palm Beach and Broward counties. With the exception of the Palm Beach and Broward areas, all the waterways in...Marvel’ 11 Phaseolus limensis MacF.* Butter Bean, ’Henderson’ 0 NT P. limensis* Lima Bean, ’Fordhook’ 5 3 d P. limensis* Lima Bean, ’Thorogreen’ 100

  1. Biological control in agro-systems by means of the handling of entomophagous insects

    International Nuclear Information System (INIS)

    Nicholls, Clara Ines; Altieri, Miguel A

    1998-01-01

    From several decades ago the importance of natural enemies of the noxious organisms has been recognized. Unfortunately the introduction of the biological control has not had the desired dimension. The indiscriminate use of biocides products has altered the biodiversity of the agro-ecosystem. The parasitoids and predators have suffered the noxious effects of the plaguicides. These natural enemies of the plagues play a momentous paper in the regulation of noxious insects population. The predators of the insecta class register in diverse orders and the abundance of species is impressive. But the knowledge of their importance is only partial. In many countries the kindness of these organisms has not been specified and does not protect them. In the case of parasitoids something similar occurs. It is say that their biotic diversity is incalculable but very few species are exploited. In these two groups rest the classic biological control projects. The successes in projects of biological control are recognized and they are enlarging in several countries but more impulse is required. Due to demands of a sustainable agricultural production it should support the biological control of plagues. In this document general looks on the topic are expounded

  2. Small non-coding RNAs: new insights in modulation of host immune response by intracellular bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Waqas Ahmed

    2016-10-01

    Full Text Available Pathogenic bacteria possess intricate regulatory networks that temporally control the production of virulence factors, and enable the bacteria to survive and proliferate within host cell. Small non-coding RNAs (sRNAs have been identified as important regulators of gene expression in diverse biological contexts. Recent research has shown bacterial sRNAs involved in growth and development, cell proliferation, differentiation, metabolism, cell signaling and immune response through regulating protein–protein interactions or via their ability to base pair with RNA and DNA. In this review, we provide a brief overview of mechanism of action employed by immune-related sRNAs, their known functions in immunity, and how they can be integrated into regulatory circuits that govern virulence, which will facilitates to understand pathogenesis and the development of novel, more effective therapeutic approaches to treat infections caused by intracellular bacterial pathogens.

  3. How the study of Listeria monocytogenes has led to new concepts in biology.

    Science.gov (United States)

    Rolhion, Nathalie; Cossart, Pascale

    2017-06-01

    The opportunistic intracellular bacterial pathogen Listeria monocytogenes has in 30 years emerged as an exceptional bacterial model system in infection biology. Research on this bacterium has provided considerable insight into how pathogenic bacteria adapt to mammalian hosts, invade eukaryotic cells, move intracellularly, interfere with host cell functions and disseminate within tissues. It also contributed to unveil features of normal host cell pathways and unsuspected functions of previously known cellular proteins. This review provides an updated overview of our knowledge on this pathogen. In many examples, findings on L. monocytogenes provided the basis for new concepts in bacterial regulation, cell biology and infection processes.

  4. Plastic potential: how the phenotypes and adaptations of pathogens are influenced by microbial interactions within plants.

    Science.gov (United States)

    O'Keeffe, Kayleigh R; Carbone, Ignazio; Jones, Corbin D; Mitchell, Charles E

    2017-08-01

    Predicting the effects of plant-associated microbes on emergence, spread, and evolution of plant pathogens demands an understanding of how pathogens respond to these microbes at two levels of biological organization: that of an individual pathogen and that of a pathogen population across multiple individual plants. We first examine the plastic responses of individual plant pathogens to microbes within a shared host, as seen through changes in pathogen growth and multiplication. We then explore the limited understanding of how within-plant microbial interactions affect pathogen populations and discuss the need to incorporate population-level observations with population genomic techniques. Finally, we suggest that integrating across levels will further our understanding of the ecological and evolutionary impacts of within-plant microbial interactions on pathogens. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Total synthesis and biological investigation of (-)-promysalin.

    Science.gov (United States)

    Steele, Andrew D; Knouse, Kyle W; Keohane, Colleen E; Wuest, William M

    2015-06-17

    Compounds that specifically target pathogenic bacteria are greatly needed, and identifying the method by which they act would provide new avenues of treatment. Herein we report the concise, high-yielding total synthesis (eight steps, 35% yield) of promysalin, a natural product that displays antivirulence phenotypes against pathogenic bacteria. Guided by bioinformatics, four diastereomers were synthesized, and the relative and absolute stereochemistries were confirmed by spectral and biological analysis. Finally, we show for the first time that promysalin displays two antivirulence phenotypes: the dispersion of mature biofilms and the inhibition of pyoverdine production, hinting at a unique pathogenic-specific mechanism of action.

  6. Do pathogens become more virulent as they spread? Evidence from the amphibian declines in Central America.

    Science.gov (United States)

    Phillips, Ben L; Puschendorf, Robert

    2013-09-07

    The virulence of a pathogen can vary strongly through time. While cyclical variation in virulence is regularly observed, directional shifts in virulence are less commonly observed and are typically associated with decreasing virulence of biological control agents through coevolution. It is increasingly appreciated, however, that spatial effects can lead to evolutionary trajectories that differ from standard expectations. One such possibility is that, as a pathogen spreads through a naive host population, its virulence increases on the invasion front. In Central America, there is compelling evidence for the recent spread of pathogenic Batrachochytrium dendrobatidis (Bd) and for its strong impact on amphibian populations. Here, we re-examine data on Bd prevalence and amphibian population decline across 13 sites from southern Mexico through Central America, and show that, in the initial phases of the Bd invasion, amphibian population decline lagged approximately 9 years behind the arrival of the pathogen, but that this lag diminished markedly over time. In total, our analysis suggests an increase in Bd virulence as it spread southwards, a pattern consistent with rapid evolution of increased virulence on Bd's invading front. The impact of Bd on amphibians might therefore be driven by rapid evolution in addition to more proximate environmental drivers.

  7. Nematodes for the biological control of the woodwasp, Sirex noctilio

    Science.gov (United States)

    Robin A. Bedding

    2007-01-01

    The tylenchid nematode Beddingia (Deladenus) siricidicola (Bedding) is by far the most important control agent of Sirex noctilio F., a major pest of pine plantations. It sterilizes female sirex, is density dependent, can achieve nearly 100 percent parasitism and, as a result of its complicated biology can be readily manipulated for sirex control. Bedding and Iede (2005...

  8. Isolation and characterization of Enterobacteriaceae species infesting post-harvest strawberries and their biological control using bacteriophages.

    Science.gov (United States)

    Kurtböke, D Ipek; Palk, A; Marker, A; Neuman, C; Moss, L; Streeter, K; Katouli, M

    2016-10-01

    Strawberry is a significantly consumed fruit worldwide, mostly without being subjected to disinfection processes. During the harvest and transfer from farm to consumers as well as where organic farming practises have been employed, the surface of the fruit may become contaminated by pathogenic bacteria. Post-harvest strawberry fruits in punnets available for public consumption were thus screened for the presence of enteric bacteria in the Sunshine Coast region of Queensland, Australia. Some of the tested samples (13 %) were found to carry such bacteria and even in greater numbers if organic amendments were used (69 %). The bacteria were found to belong in the genera of Escherichia, Enterobacter, Raoultella, Klebsiella, Pantoea, Shigella, Citrobacter and Cronobacter within the family Enterobacteriaceae. Some of the isolates were found to adhere to Caco-2 cells representing human gut epithelium as well as carrying virulence and toxin genes. Resistance mostly against sulphafurazole, cefoxitin, ampicillin and nitrofurantoin was found among 14 different antimicrobial agents tested including 100 % resistance to cefoxitin and ampicillin in the genus Pantoea. In the second phase of the study, bacteriophages were isolated against the isolates and were subsequently applied to post-harvest fruits. A significant (P ≤ 0.001) reduction in the number of enteric bacteria was observed when a high-titre polyvalent bacteriophage suspension (×10(12) PFU/mL) was applied to the fruit surface. Bacteriophages also decreased the adhesion of the Escherichia coli isolates to Caco-2 cells. Findings might indicate that biological control using bacteriophages might be of significant value for the industry targeting to reduce pathogenic loads of bacteria on the fruit.

  9. Biology and pathogenesis of Acanthamoeba

    Directory of Open Access Journals (Sweden)

    Siddiqui Ruqaiyyah

    2012-01-01

    Full Text Available Abstract Acanthamoeba is a free-living protist pathogen, capable of causing a blinding keratitis and fatal granulomatous encephalitis. The factors that contribute to Acanthamoeba infections include parasite biology, genetic diversity, environmental spread and host susceptibility, and are highlighted together with potential therapeutic and preventative measures. The use of Acanthamoeba in the study of cellular differentiation mechanisms, motility and phagocytosis, bacterial pathogenesis and evolutionary processes makes it an attractive model organism. There is a significant emphasis on Acanthamoeba as a Trojan horse of other microbes including viral, bacterial, protists and yeast pathogens.

  10. Evaluation of impedance on biological Tissues using automatic control measurement system

    Energy Technology Data Exchange (ETDEWEB)

    Kil, Sang Hyeong; Shin, Dong Hoon; Lee, Seong Mo [Pusan National University, Yangsan (Korea, Republic of); Lee, Moo Seok; Kim, Sang Sik [Pusan National University, Busan (Korea, Republic of); Kim, Gun FDo; Lee, Jong Kyu [Pukyung National University, Busan (Korea, Republic of)

    2015-08-15

    Each biological tissue has endemic electrical characteristics owing to various differences such as those in cellular arrangement or organization form. The endemic electrical characteristics change when any biological change occurs. This work is a preliminary study surveying the changes in the electrical characteristics of biological tissue caused by radiation exposure. For protection against radiation hazards, therefore the electrical characteristics of living tissue were evaluated after development of the automatic control measurement system using LabVIEW. No alteration of biological tissues was observed before and after measurement of the electrical characteristics, and the biological tissues exhibited similar patterns. Through repeated measurements using the impedance/gain-phase analyzer, the coefficient of variation was determined as within 10%. The reproducibility impedance phase difference in electrical characteristics of the biological tissue did not change, and the tissue had resistance. The absolute value of impedance decreased constantly in proportion to the frequency. It has become possible to understand the electrical characteristics of biological tissues through the measurements made possible by the use of the developed.

  11. Evaluation of impedance on biological Tissues using automatic control measurement system

    International Nuclear Information System (INIS)

    Kil, Sang Hyeong; Shin, Dong Hoon; Lee, Seong Mo; Lee, Moo Seok; Kim, Sang Sik; Kim, Gun FDo; Lee, Jong Kyu

    2015-01-01

    Each biological tissue has endemic electrical characteristics owing to various differences such as those in cellular arrangement or organization form. The endemic electrical characteristics change when any biological change occurs. This work is a preliminary study surveying the changes in the electrical characteristics of biological tissue caused by radiation exposure. For protection against radiation hazards, therefore the electrical characteristics of living tissue were evaluated after development of the automatic control measurement system using LabVIEW. No alteration of biological tissues was observed before and after measurement of the electrical characteristics, and the biological tissues exhibited similar patterns. Through repeated measurements using the impedance/gain-phase analyzer, the coefficient of variation was determined as within 10%. The reproducibility impedance phase difference in electrical characteristics of the biological tissue did not change, and the tissue had resistance. The absolute value of impedance decreased constantly in proportion to the frequency. It has become possible to understand the electrical characteristics of biological tissues through the measurements made possible by the use of the developed.

  12. Survival after pathogen exposure in group-living insects: don't forget the stress of social isolation!

    Science.gov (United States)

    Kohlmeier, P; Holländer, K; Meunier, J

    2016-09-01

    A major cost of group-living is its inherent risk of pathogen infection. To limit this risk, many group-living animals have developed the capability to prophylactically boost their immune system in the presence of group members and/or to mount collective defences against pathogens. These two phenomena, called density-dependent prophylaxis and social immunity, respectively, are often used to explain why, in group-living species, individuals survive better in groups than in isolation. However, this survival difference may also reflect an alternative and often overlooked process: a cost of social isolation on individuals' capability to fight against infections. Here, we disentangled the effects of density-dependent prophylaxis, social immunity and stress of social isolation on the survival after pathogen exposure in group-living adults of the European earwig Forficula auricularia. By manipulating the presence of group members both before and after pathogen exposure, we demonstrated that the cost of being isolated after infection, but not the benefits of social immunity or density-dependent prophylaxis, explained the survival of females. Specifically, females kept constantly in groups or constantly isolated had higher survival rates than females that were first in groups and then isolated after infection. Our results also showed that this cost of social isolation was absent in males and that social isolation did not reduce the survival of noninfected individuals. Overall, this study gives a new perspective on the role of pathogens in social evolution, as it suggests that an apparently nonadaptive, personal immune process may promote the maintenance of group-living under pathogenic environments. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

  13. Pseudomnas syringae – a Pathogen of Fruit Trees in Serbia

    Directory of Open Access Journals (Sweden)

    Veljko Gavrilović

    2009-01-01

    Full Text Available Data about symptomatology, pathogenicity and bacteriological characteristics of Pseudomonas syringae, and PCR methods for fast and reliable detection of the pathogen are given in this paper. P. syringae has been experimentaly proved as a pathogen of pear, apple, apricot, plum cherry, and raspberry, and pathogen strains have also been isolated from necrotic peach buds. Two pathogen varieties, syringae and morsprunorum, were found in our research in Serbia, the former being dominant on fruit trees.The most reliable method for detection of this bacteria is PCR, using BOX and REP primers. This method has also revealed significant differences among the strains originating from fruit trees in Serbia. Thus, it was proved that the population of P. syringae in Serbia is heterogeneous, which is very important for future epidemiologocal studies. Control of this pathogen includes mechanical, cultural and chemical measures, but integrated approach is very important for sustainable control.

  14. The impact of plant-pathogen studies on medicinal drug discovery

    NARCIS (Netherlands)

    Ottmann, C.; Hoorn, van der R.A.L.; Kaiser, M.

    2012-01-01

    The pharmaceutical industry is reliant on a constant supply of new chemical entities and molecular targets for disease intervention. In this tutorial review, we want to illustrate that basic research studies on the biological function of natural products involved in plant–pathogen interactions can

  15. The biological control as a strategy to support nontraditional agricultural exports in Peru: An empirical analysis

    Directory of Open Access Journals (Sweden)

    Franklin Duarte Cueva

    2012-12-01

    Full Text Available The study is oriented to explore the general characteristics of agriculture, the biological control as a pest control mechanism and agro export industry. In this context, we try to promote the use of biological control as a strategy to support nontraditional exports related to products such as asparagus and fresh avocados grown in the La Libertad Department (Peru, through an agronomic and management approach. Biological control is the basis of integrated pest management (IPM and contributes to the conservation of agricultural ecosystems allowing to export companies reduce costs, fulfill international phytosanitary measures and supports the preservation of the environment and health. Thus, the Peruvian agro export companies could build a sustainable competitive advantage and seek a positioning as socially responsible firms. We analyze variables such as crop statistics, comparative costs between biological control and chemical control, main destination markets for asparagus and fresh avocados, international standards, among others.

  16. Disinfection and removal of human pathogenic bacteria in arctic waste stabilization ponds

    DEFF Research Database (Denmark)

    Huang, Yannan; Hansen, Lisbeth Truelstrup; Ragush, Colin M.

    2017-01-01

    Wastewater stabilization ponds (WSPs) are commonly used to treat municipal wastewater in Arctic Canada. The biological treatment in the WSPs is strongly influenced by climatic conditions. Currently, there is limited information about the removal of fecal and pathogenic bacteria during the short...... cool summer treatment season. With relevance to public health, the objectives of this paper were to determine if treatment in arctic WSPs resulted in the disinfection (i.e., removal of fecal indicator bacteria, Escherichia coli) and removal of selected human bacterial pathogens from the treated...... treatment of the wastewater with a 2–3 Log removal of generic indicator E. coli. The bacterial pathogens Salmonella spp., pathogenic E. coli, and Listeria monocytogenes, but not Campylobacter spp. and Helicobacter pylori, were detected in the untreated and treated wastewater, indicating that human...

  17. Isolation, Characterization and Biological Properties of Membrane Vesicles Produced by the Swine Pathogen Streptococcus suis.

    Directory of Open Access Journals (Sweden)

    Bruno Haas

    Full Text Available Streptococcus suis, more particularly serotype 2, is a major swine pathogen and an emerging zoonotic agent worldwide that mainly causes meningitis, septicemia, endocarditis, and pneumonia. Although several potential virulence factors produced by S. suis have been identified in the last decade, the pathogenesis of S. suis infections is still not fully understood. In the present study, we showed that S. suis produces membrane vesicles (MVs that range in diameter from 13 to 130 nm and that appear to be coated by capsular material. A proteomic analysis of the MVs revealed that they contain 46 proteins, 9 of which are considered as proven or suspected virulence factors. Biological assays confirmed that S. suis MVs possess active subtilisin-like protease (SspA and DNase (SsnA. S. suis MVs degraded neutrophil extracellular traps, a property that may contribute to the ability of the bacterium to escape the host defense response. MVs also activated the nuclear factor-kappa B (NF-κB signaling pathway in both monocytes and macrophages, inducing the secretion of pro-inflammatory cytokines, which may in turn contribute to increase the permeability of the blood brain barrier. The present study brought evidence that S. suis MVs may play a role as a virulence factor in the pathogenesis of S. suis infections, and given their composition be an excellent candidate for vaccine development.

  18. Pathogenicity of Nosema sp. (Microsporidia in the diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae.

    Directory of Open Access Journals (Sweden)

    Nadia Kermani

    Full Text Available Biological control using pathogenic microsporidia could be an alternative to chemical control of the diamondback moth (DBM Plutella xylostella (Lepidoptera: Plutellidae. The microsporidium Nosema bombycis (NB is one of the numerous pathogens that can be used in the Integrated Pest Management (IPM of DBM. However, its pathogenicity or effectiveness can be influenced by various factors, particularly temperature. This study was therefore conducted to investigate the effect of temperature on NB infection of DBM larvae. Second-instar larvae at different doses (spore concentration: 0, 1×10²,1×10³,1×10⁴, and 1×10⁵ at 15°, 20°, 25°, 30° and 35°C and a relative humidity(RH of 65% and light dark cycle (L:D of 12∶12. Larval mortality was recorded at 24 h intervals until the larvae had either died or pupated. The results showed that the spore concentration had a significant negative effect on larval survival at all temperatures, although this effect was more pronounced (92% at 35°C compared with that at 20 and 30°C (≃50% and 25°C (26%. Histological observations showed that Nosema preferentially infected the adipose tissue and epithelial cells of the midgut, resulting in marked vacuolization of the cytoplasm. These findings suggest that Nosema damaged the midgut epithelial cells. Our results suggest that Nosema had a direct adverse effect on DBM, and could be utilized as an important biopesticide alternative to chemical insecticides in IPM.

  19. biological and biochemical effects of biocides and gamma radiation on pathogen attacked some horticulture crops

    International Nuclear Information System (INIS)

    Helal, I.M.M.

    2006-01-01

    the present investigation was aimed to study the possibility of formulation of some essential oils having antimicrobial activity to be used as biocides. the results of this study showed that fennel, peppermint and caraway oils were the most inhibitory effective oils against some post harvest pathogens. the used oils. were formulated as biocides using different emulsifiers with the addition of different types of fixed oils . the prepared biocides were effective for controlling the growth of the studied microorganisms in vitro and in vivo on the host plant products. also , the interaction of biocides and different doses of gamma radiation were effective for extending the shelf life of potato tubers and orange fruits during storage at room temperature for periods of 150 and 75 days, respectively. biochemical changes in potato tubers and orange fruits as a result of treatments were studied

  20. Screening of chitinolytic actinomycetes for biological control of Sclerotium rolfsii stem rot disease of chilli

    Directory of Open Access Journals (Sweden)

    Pranee Pattanapipitpaisal

    2012-09-01

    Full Text Available Two hundred and eighty three strains were isolated from rhizoshere-associated soils, from Ubon Ratchathani andSrisaket province, using Enrichment Media for isolation of Chitinase-producing Actinomycetes agar (EMCA agar. All strainswere screened for chitinolytic activity and sixty eight strains gave significant clear zone on EMCA agar plates. The selectedchitinolytic strains were assayed for in vitro antagonism against Sclerotium rolfsii using cornmeal agar (CMA agar assayprocedure and the result showed that thirteen isolates have remarkable inhibiting the growth of the fungus and the top fiveantagonistic actinomycetes were PACCH 277, PACCH129, PACCH225, PACCH24 and PACCH246, respectively. The resultindicated that these actinomycetes produce chitinase which catalyze the degradation of chitin, resulting in inhibition of S.rolfsii growth. Their abilities to control the disease development were tested for in vivo biocontrol assay on chilli seedlings.Two out of thirteen candidate, PACCH24 and PACCH225, antagonists reduced the disease development at 90%. It wassuggested that the ability to inhibit the growth of pathogen in vitro was not related to the disease reduction in vivo. Thestrain PACCH24 was further identified as Streptomyces hygroscopicus according to morphological characteristic, cell walland cellular sugar analysis and 16S rDNA sequencing. The study implies a novel chitinolytic actinomycete which could bedeveloped to be a biological agent which would be included as a complement with organic fertilizers in order to control stemrot disease and promote growth of chilli.

  1. Arthropods vector grapevine trunk disease pathogens.

    Science.gov (United States)

    Moyo, P; Allsopp, E; Roets, F; Mostert, L; Halleen, F

    2014-10-01

    Arthropod-mediated dispersal of pathogens is known in many cropping systems but has never been demonstrated for grapevine trunk disease pathogens. Arthropods from vineyards were screened for the presence of pathogens associated with Petri disease and esca using cultural and molecular techniques. The ability of the most abundant pathogen-carrying species to inoculate healthy grapevine vascular tissues was also determined. Millipedes and ants were allowed to associate with a DsRed- Express-transformed Phaeomoniella chlamydospora, after which they were exposed to freshly pruned healthy grapevines under controlled conditions and wounds were monitored for subsequent infection. In addition, the possibility of millipede excreta, commonly found on pruning wounds in the field, to act as inoculum source was determined. A diverse arthropod fauna was associated with declining grapevines and many of these carried trunk disease pathogens. However, spiders, the ant Crematogaster peringueyi, and the millipede Ommattoiulus moreleti were the most abundant pathogen carriers. The ant and millipede species fed on pruning wound sap and effectively transmitted trunk disease pathogens. Millipede excreta contained viable spores of Phaeomoniella chlamydospora and may serve as an inoculum source. Numerous arthropods, including beneficial predators, are potential vectors of grapevine trunk disease pathogens. Our results highlight the need for an integrated approach, including targeted management of ants and millipedes at the time of pruning, to limit the spread of grapevine trunk diseases.

  2. Pathogens' toolbox to manipulate human complement.

    Science.gov (United States)

    Fernández, Francisco J; Gómez, Sara; Vega, M Cristina

    2017-12-14

    The surveillance and pathogen fighting functions of the complement system have evolved to protect mammals from life-threatening infections. In turn, pathogens have developed complex molecular mechanisms to subvert, divert and evade the effector functions of the complement. The study of complement immunoevasion by pathogens sheds light on their infection drivers, knowledge that is essential to implement therapies. At the same time, complement evasion also acts as a discovery ground that reveals important aspects of how complement works under physiological conditions. In recent years, complex interrelationships between infection insults and the onset of autoimmune and complement dysregulation diseases have led to propose that encounters with pathogens can act as triggering factors for disease. The correct management of these diseases involves the recognition of their triggering factors and the development and administration of complement-associated molecular therapies. Even more recently, unsuspected proteins from pathogens have been shown to possess moonlighting functions as virulence factors, raising the possibility that behind the first line of virulence factors there be many more pathogen proteins playing secondary, helping and supporting roles for the pathogen to successfully establish infections. In an era where antibiotics have a progressively reduced effect on the management and control of infectious diseases worldwide, knowledge on the mechanisms of pathogenic invasion and evasion look more necessary and pressing than ever. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Greenhouse evaluation of Bacillus subtilis AP-01 and Trichoderma harzianum AP-001 in controlling tobacco diseases.

    Science.gov (United States)

    Maketon, Monchan; Apisitsantikul, Jirasak; Siriraweekul, Chatchai

    2008-04-01

    Two biological control agents, Bacillus subtilis AP-01 (Larminar(™)) and Trichoderma harzianum AP-001 (Trisan(™)) alone or/in combination were investigated in controlling three tobacco diseases, including bacterial wilt (Ralstonia solanacearum), damping-off (Pythium aphanidermatum), and frogeye leaf spot (Cercospora nicotiana). Tests were performed in greenhouse by soil sterilization prior to inoculation of the pathogens. Bacterial-wilt and damping off pathogens were drenched first and followed with the biological control agents and for comparison purposes, two chemical fungicides. But for frogeye leaf spot, which is an airborne fungus, a spraying procedure for every treatment including a chemical fungicide was applied instead of drenching. Results showed that neither B. subtilis AP-01 nor T harzianum AP-001 alone could control the bacterial wilt, but when combined, their controlling capabilities were as effective as a chemical treatment. These results were also similar for damping-off disease when used in combination. In addition, the combined B. subtilis AP-01 and T. harzianum AP-001 resulted in a good frogeye leaf spot control, which was not significantly different from the chemical treatment.

  4. Adaptive value of sex in microbial pathogens.

    Science.gov (United States)

    Michod, Richard E; Bernstein, Harris; Nedelcu, Aurora M

    2008-05-01

    Explaining the adaptive value of sex is one of the great outstanding problems in biology. The challenge comes from the difficulty in identifying the benefits provided by sex, which must outweigh the substantial costs of sex. Here, we consider the adaptive value of sex in viruses, bacteria and fungi, and particularly the information available on the adaptive role of sex in pathogenic microorganisms. Our general theme is that the varied aspects of sex in pathogens illustrate the varied issues surrounding the evolution of sex generally. These include, the benefits of sex (in the short- and long-term), as well as the costs of sex (both to the host and to the pathogen). For the benefits of sex (that is, its adaptive value), we consider three hypotheses: (i) sex provides for effective and efficient recombinational repair of DNA damages, (ii) sex provides DNA for food, and (iii) sex produces variation and reduces genetic associations among alleles under selection. Although the evolution of sex in microbial pathogens illustrates these general issues, our paper is not a general review of theories for the evolution of sex in all organisms. Rather, we focus on the adaptive value of sex in microbial pathogens and conclude that in terms of short-term benefits, the DNA repair hypothesis has the most support and is the most generally applicable hypothesis in this group. In particular, recombinational repair of DNA damages may substantially benefit pathogens when challenged by the oxidative defenses of the host. However, in the long-term, sex may help get rid of mutations, increase the rate of adaptation of the population, and, in pathogens, may infrequently create new infective strains. An additional general issue about sex illustrated by pathogens is that some of the most interesting consequences of sex are not necessarily the reasons for which sex evolved. For example, antibiotic resistance may be transferred by bacterial sex, but this transfer is probably not the reason sex

  5. Influenza interaction with cocirculating pathogens and its impact on surveillance, pathogenesis, and epidemic profile: A key role for mathematical modelling.

    Directory of Open Access Journals (Sweden)

    Lulla Opatowski

    2018-02-01

    Full Text Available Evidence is mounting that influenza virus interacts with other pathogens colonising or infecting the human respiratory tract. Taking into account interactions with other pathogens may be critical to determining the real influenza burden and the full impact of public health policies targeting influenza. This is particularly true for mathematical modelling studies, which have become critical in public health decision-making. Yet models usually focus on influenza virus acquisition and infection alone, thereby making broad oversimplifications of pathogen ecology. Herein, we report evidence of influenza virus interactions with bacteria and viruses and systematically review the modelling studies that have incorporated interactions. Despite the many studies examining possible associations between influenza and Streptococcus pneumoniae, Staphylococcus aureus, Haemophilus influenzae, Neisseria meningitidis, respiratory syncytial virus (RSV, human rhinoviruses, human parainfluenza viruses, etc., very few mathematical models have integrated other pathogens alongside influenza. The notable exception is the pneumococcus-influenza interaction, for which several recent modelling studies demonstrate the power of dynamic modelling as an approach to test biological hypotheses on interaction mechanisms and estimate the strength of those interactions. We explore how different interference mechanisms may lead to unexpected incidence trends and possible misinterpretation, and we illustrate the impact of interactions on public health surveillance using simple transmission models. We demonstrate that the development of multipathogen models is essential to assessing the true public health burden of influenza and that it is needed to help improve planning and evaluation of control measures. Finally, we identify the public health, surveillance, modelling, and biological challenges and propose avenues of research for the coming years.

  6. Enterococcus infection biology: lessons from invertebrate host models.

    Science.gov (United States)

    Yuen, Grace J; Ausubel, Frederick M

    2014-03-01

    The enterococci are commensals of the gastrointestinal tract of many metazoans, from insects to humans. While they normally do not cause disease in the intestine, they can become pathogenic when they infect sites outside of the gut. Recently, the enterococci have become important nosocomial pathogens, with the majority of human enterococcal infections caused by two species, Enterococcus faecalis and Enterococcus faecium. Studies using invertebrate infection models have revealed insights into the biology of enterococcal infections, as well as general principles underlying host innate immune defense. This review highlights recent findings on Enterococcus infection biology from two invertebrate infection models, the greater wax moth Galleria mellonella and the free-living bacteriovorous nematode Caenorhabditis elegans.

  7. Effectiveness of electron beam irradiation in the control of some soilborne pathogens

    International Nuclear Information System (INIS)

    Orlikowski, L.B.; Ptaszek, M.; Migdal, W.; Gryczka, U.

    2011-01-01

    Electron beam (EB) irradiation was tested against Botrytis cinerea, Pythium ultimum and Phytophthora citricola the most dangerous pathogens causing stem and root rot of seedlings, cuttings and older plants. In the laboratory trials cultures of 3 species were irradiated with doses 0 (control), 1.5, 3.0, 4.5 and 6.0 kGy whereas peat was treated with 10, 15 and 25 kGy. P. citricola was the most sensitive species for irradiation. In greenhouse trials 15 kGy irradiation of peat protected chrysanthemum cuttings against B. cinerea and P. ultimum as well as rhododendron young plants against P. citricola. Irradiation of peat did not influence the growth and development of the tested plants. (authors)

  8. Controlled polymer synthesis--from biomimicry towards synthetic biology.

    Science.gov (United States)

    Pasparakis, George; Krasnogor, Natalio; Cronin, Leroy; Davis, Benjamin G; Alexander, Cameron

    2010-01-01

    The controlled assembly of synthetic polymer structures is now possible with an unprecedented range of functional groups and molecular architectures. In this critical review we consider how the ability to create artificial materials over lengthscales ranging from a few nm to several microns is generating systems that not only begin to mimic those in nature but also may lead to exciting applications in synthetic biology (139 references).

  9. Emerging Preservation Techniques for Controlling Spoilage and Pathogenic Microorganisms in Fruit Juices

    Science.gov (United States)

    Aneja, Kamal Rai; Dhiman, Romika; Aggarwal, Neeraj Kumar; Aneja, Ashish

    2014-01-01

    Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed. PMID:25332721

  10. Emerging Preservation Techniques for Controlling Spoilage and Pathogenic Microorganisms in Fruit Juices

    Directory of Open Access Journals (Sweden)

    Kamal Rai Aneja

    2014-01-01

    Full Text Available Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed.

  11. Emerging preservation techniques for controlling spoilage and pathogenic microorganisms in fruit juices.

    Science.gov (United States)

    Aneja, Kamal Rai; Dhiman, Romika; Aggarwal, Neeraj Kumar; Aneja, Ashish

    2014-01-01

    Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed.

  12. Regulatory T cells and immunity to pathogens.

    Science.gov (United States)

    Rouse, Barry T; Suvas, Susmit

    2007-09-01

    Immune responses to pathogens are modulated by one or more types of cells that perform a regulatory function. Some cells with this function, such as CD4+ Foxp3+ natural regulatory T cells (nTreg), pre-exist prior to infections whereas others may be induced as a consequence of infection (adaptive Treg). With pathogens that have a complex pathogenesis, multiple types of regulatory cells could influence the outcome. One major property of Treg is to help minimize collateral tissue damage that can occur during immune reactions to a chronic infection. The consequence is less damage to the host but in such situations the pathogen is likely to establish persistence. In some cases, a fine balance is established between Treg responses, effector components of immunity and the pathogen. Treg responses to pathogens may also act to hamper the efficacy of immune control. This review discusses these issues as well as the likely mechanisms by which various pathogens can signal the participation of Treg during infection.

  13. Modelling approach for biological control of insect pest by releasing infected pest

    International Nuclear Information System (INIS)

    Tan Yuanshun; Chen Lansun

    2009-01-01

    Models of biological control have a long history of theoretical development that have focused on the interactions between a predator and a prey. Here we have extended the classical epidemic model to include a continuous and impulsive pest control strategies by releasing the infected pests bred in laboratory. For the continuous model, the results imply that the susceptible pest goes to extinct if the threshold condition R 0 0 > 1, the positive equilibrium of continuous model is globally asymptotically stable. Similarly, the threshold condition which guarantees the global stability of the susceptible pest-eradication periodic solution is obtained for the model with impulsive control strategy. Consequently, based on the results obtained in this paper, the control strategies which maintain the pests below an acceptably low level are discussed by controlling the release rate and impulsive period. Finally, the biological implications of the results and the efficiency of two control strategies are also discussed

  14. Streptococcus dysgalactiae subsp. dysgalactiae isolated from milk of the bovine udder as emerging pathogens: In vitro and in vivo infection of human cells and zebrafish as biological models.

    Science.gov (United States)

    Alves-Barroco, Cinthia; Roma-Rodrigues, Catarina; Raposo, Luís R; Brás, Catarina; Diniz, Mário; Caço, João; Costa, Pedro M; Santos-Sanches, Ilda; Fernandes, Alexandra R

    2018-03-25

    Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) is a major cause of bovine mastitis and has been regarded as an animal-restricted pathogen, although rare infections have been described in humans. Previous studies revealed the presence of virulence genes encoded by phages of the human pathogen Group A Streptococcus pyogenes (GAS) in SDSD isolated from the milk of bovine udder with mastitis. The isolates SDSD VSD5 and VSD13 could adhere and internalize human primary keratinocyte cells, suggesting a possible human infection potential of bovine isolates. In this work, the in vitro and in vivo potential of SDSD to internalize/adhere human cells of the respiratory track and zebrafish as biological models was evaluated. Our results showed that, in vitro, bovine SDSD strains could interact and internalize human respiratory cell lines and that this internalization was dependent on an active transport mechanism and that, in vivo, SDSD are able to cause invasive infections producing zebrafish morbidity and mortality. The infectious potential of these isolates showed to be isolate-specific and appeared to be independent of the presence or absence of GAS phage-encoded virulence genes. Although the infection ability of the bovine SDSD strains was not as strong as the human pathogenic S. pyogenes in the zebrafish model, results suggested that these SDSD isolates are able to interact with human cells and infect zebrafish, a vertebrate infectious model, emerging as pathogens with zoonotic capability. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  15. The inception and evolution of a unique masters program in cancer biology, prevention and control.

    Science.gov (United States)

    Cousin, Carolyn; Blancato, Jan

    2010-09-01

    The University of the District of Columbia (UDC) and the Lombardi Comprehensive Cancer Center (LCCC), Georgetown University Medical Center established a Masters Degree Program in Cancer Biology, Prevention and Control at UDC that is jointly administered and taught by UDC and LCCC faculty. The goal of the Masters Degree Program is to educate students as master-level cancer professionals capable of conducting research and service in cancer biology, prevention, and control or to further advance the education of students to pursue doctoral studies. The Program's unique nature is reflected in its philosophy "the best cancer prevention and control researchers are those with a sound understanding of cancer biology". This program is a full-time, 2-year, 36-credit degree in which students take half of their coursework at UDC and half of their coursework at LCCC. During the second year, students are required to conduct research either at LCCC or UDC. Unlike most cancer biology programs, this unique Program emphasizes both cancer biology and cancer outreach training.

  16. The Multitrophic Plant-Herbivore-Parasitoid-Pathogen System

    DEFF Research Database (Denmark)

    Bruni, Luis Emilio

    2011-01-01

    . The models for multitrophic interactions and above and below ground interactions furnish a picture based on material exchanges, i.e., trophic webs, between the participating taxa. On the other hand, in most disciplines of biology there is an incipient trend that considers biology as a science of “sensing......”, that is, biologists in different sub-disciplines are assigning increasing importance to the informational processes in living systems and are paying more attention to the “context” (e.g., from quorum sensing to info-chemicals to signal transduction in general). There is a new and exciting epistemological...... in many different empirical studies of what we could call the “multitrophic plant–herbivore–parasitoid–pathogen system”....

  17. The Biology of Neisseria Adhesins

    Directory of Open Access Journals (Sweden)

    Miao-Chiu Hung

    2013-07-01

    Full Text Available Members of the genus Neisseria include pathogens causing important human diseases such as meningitis, septicaemia, gonorrhoea and pelvic inflammatory disease syndrome. Neisseriae are found on the exposed epithelia of the upper respiratory tract and the urogenital tract. Colonisation of these exposed epithelia is dependent on a repertoire of diverse bacterial molecules, extending not only from the surface of the bacteria but also found within the outer membrane. During invasive disease, pathogenic Neisseriae also interact with immune effector cells, vascular endothelia and the meninges. Neisseria adhesion involves the interplay of these multiple surface factors and in this review we discuss the structure and function of these important molecules and the nature of the host cell receptors and mechanisms involved in their recognition. We also describe the current status for recently identified Neisseria adhesins. Understanding the biology of Neisseria adhesins has an impact not only on the development of new vaccines but also in revealing fundamental knowledge about human biology.

  18. Screening of wheat endophytes as biological control agents against Fusarium head blight using two different in vitro tests.

    Science.gov (United States)

    Comby, Morgane; Gacoin, Marie; Robineau, Mathilde; Rabenoelina, Fanja; Ptas, Sébastien; Dupont, Joëlle; Profizi, Camille; Baillieul, Fabienne

    2017-09-01

    In order to find biological control agents (BCAs) for the management of Fusarium head blight (FHB), a major disease on wheat crops worldwide, 86 microorganisms isolated from inner tissues of wheat plants were discriminated for their ability to inhibit the growth of Fusarium graminearum and Fusarium culmorum by in vitro dual culture assays. A group of 22 strains appeared very effective to inhibit F. graminearum (inhibition of 30-51%) and they were also globally effective in controlling F. culmorum (inhibition of 15-53%). Further evaluation of a subselection of strains by screening on detached spikelets in vitro confirmed three species, namely Phoma glomerata, Aureobasidium proteae and Sarocladium kiliense, that have not yet been reported for their efficacy against Fusarium spp., indicating that looking for BCAs toward FHB among wheat endophytes proved to be promising. The efficacy of some strains turned out different between both in vitro screening approaches, raising the importance of finding the most appropriate screening approach for the search of BCAs. This study pointed out the interest of the test on detached wheat spikelets that provided information about a potential pathogenicity, the growth capacity and efficacy of the endophyte strains on the targeted plant, before testing them on whole plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. 77 FR 46373 - Field Release of Aphelinus glycinis for the Biological Control of the Soybean Aphid in the...

    Science.gov (United States)

    2012-08-03

    ... Inspection Service [Docket No APHIS-2012-0061] Field Release of Aphelinus glycinis for the Biological Control... for the biological control of the soybean aphid, Aphis glycines, in the continental United States. We... glycinis for the Biological Control of the Soybean Aphid in the Continental United States'' (March 2012...

  20. Interrelationships of food safety and plant pathology: the life cycle of human pathogens on plants.

    Science.gov (United States)

    Barak, Jeri D; Schroeder, Brenda K

    2012-01-01

    Bacterial food-borne pathogens use plants as vectors between animal hosts, all the while following the life cycle script of plant-associated bacteria. Similar to phytobacteria, Salmonella, pathogenic Escherichia coli, and cross-domain pathogens have a foothold in agricultural production areas. The commonality of environmental contamination translates to contact with plants. Because of the chronic absence of kill steps against human pathogens for fresh produce, arrival on plants leads to persistence and the risk of human illness. Significant research progress is revealing mechanisms used by human pathogens to colonize plants and important biological interactions between and among bacteria in planta. These findings articulate the difficulty of eliminating or reducing the pathogen from plants. The plant itself may be an untapped key to clean produce. This review highlights the life of human pathogens outside an animal host, focusing on the role of plants, and illustrates areas that are ripe for future investigation.

  1. Biological Terrorism: US Policies to Reduce Global Biothreats

    Science.gov (United States)

    2008-09-01

    program for pro- jects that advance BEP objectives. Global Cooperation to develop bio- safety and pathogen security stan- dards that are consistent with...security. The Organization for Economic Cooperation and Development ( OECD ) has recently developed voluntary biosecurity guidelines for implementation...Abbreviations AG Australia Group BEP Biosecurity Engagement Program BSL Biosafety level BWC Biological Weapons Convention BWC-ISU Biological Weapons

  2. [Evolution of pathogenic micro-organisms as a challenge for medicine].

    Science.gov (United States)

    Vaara, Martti

    2009-01-01

    Successful parasitic micro-organisms are able to adapt to the circumstances of the host's organ system, and it is usually not expedient for them to kill their host. Under selection pressure, the evolution of micro-organisms is vastly quicker that that of man. The selection pressure brought about by rapid ecological changes and alterations associated with human action provides for the development of new, dangerous pathogens and transformation of familiar pathogens to become more dangerous. Progress in molecular biology has thus far not yielded as many new tools for the treatment of infectious diseases as the hopes were in the early 2000's.

  3. Exosome function: from tumor immunology to pathogen biology.

    Science.gov (United States)

    Schorey, Jeffrey S; Bhatnagar, Sanchita

    2008-06-01

    Exosomes are the newest family member of 'bioactive vesicles' that function to promote intercellular communication. Exosomes are derived from the fusion of multivesicular bodies with the plasma membrane and extracellular release of the intraluminal vesicles. Recent studies have focused on the biogenesis and composition of exosomes as well as regulation of exosome release. Exosomes have been shown to be released by cells of hematopoietic and non-hematopoietic origin, yet their function remains enigmatic. Much of the prior work has focused on exosomes as a source of tumor antigens and in presentation of tumor antigens to T cells. However, new studies have shown that exosomes might also promote cell-to-cell spread of infectious agents. Moreover, exosomes isolated from cells infected with various intracellular pathogens, including Mycobacterium tuberculosis and Toxoplasma gondii, have been shown to contain microbial components and can promote antigen presentation and macrophage activation, suggesting that exosomes may function in immune surveillance. In this review, we summarize our understanding of exosome biogenesis but focus primarily on new insights into exosome function. We also discuss their possible use as disease biomarkers and vaccine candidates.

  4. Protein prenylation: a new mode of host-pathogen interaction.

    Science.gov (United States)

    Amaya, Moushimi; Baranova, Ancha; van Hoek, Monique L

    2011-12-09

    Post translational modifications are required for proteins to be fully functional. The three step process, prenylation, leads to farnesylation or geranylgeranylation, which increase the hydrophobicity of the prenylated protein for efficient anchoring into plasma membranes and/or organellar membranes. Prenylated proteins function in a number of signaling and regulatory pathways that are responsible for basic cell operations. Well characterized prenylated proteins include Ras, Rac and Rho. Recently, pathogenic prokaryotic proteins, such as SifA and AnkB, have been shown to be prenylated by eukaryotic host cell machinery, but their functions remain elusive. The identification of other bacterial proteins undergoing this type of host-directed post-translational modification shows promise in elucidating host-pathogen interactions to develop new therapeutics. This review incorporates new advances in the study of protein prenylation into a broader aspect of biology with a focus on host-pathogen interaction. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Enhanced resistance in Theobroma cacao against oomycete and fungal pathogens by secretion of phosphatidylinositol-3-phosphate-binding proteins.

    Science.gov (United States)

    Helliwell, Emily E; Vega-Arreguín, Julio; Shi, Zi; Bailey, Bryan; Xiao, Shunyuan; Maximova, Siela N; Tyler, Brett M; Guiltinan, Mark J

    2016-03-01

    The internalization of some oomycete and fungal pathogen effectors into host plant cells has been reported to be blocked by proteins that bind to the effectors' cell entry receptor, phosphatidylinositol-3-phosphate (PI3P). This finding suggested a novel strategy for disease control by engineering plants to secrete PI3P-binding proteins. In this study, we tested this strategy using the chocolate tree Theobroma cacao. Transient expression and secretion of four different PI3P-binding proteins in detached leaves of T. cacao greatly reduced infection by two oomycete pathogens, Phytophthora tropicalis and Phytophthora palmivora, which cause black pod disease. Lesion size and pathogen growth were reduced by up to 85%. Resistance was not conferred by proteins lacking a secretory leader, by proteins with mutations in their PI3P-binding site, or by a secreted PI4P-binding protein. Stably transformed, transgenic T. cacao plants expressing two different PI3P-binding proteins showed substantially enhanced resistance to both P. tropicalis and P. palmivora, as well as to the fungal pathogen Colletotrichum theobromicola. These results demonstrate that secretion of PI3P-binding proteins is an effective way to increase disease resistance in T. cacao, and potentially in other plants, against a broad spectrum of pathogens. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Methylene Diphosphonate Chemical and Biological control of MDP complex

    International Nuclear Information System (INIS)

    Aungurarat, Angkanan; Ngamprayad, Tippanan

    2000-01-01

    Technetium-9 9m MDP easy prepared from MDP kits which different sources such as OAP (In house), SIGMA. The resulting Tc 9 9m -MDP preparations were controlled in chemical and biological tests to compare the different results in these cases: radiochemical purity, the quantity of starting material and biodistribution result

  7. [Physicians' knowledge in Israel on the biology and control of head lice].

    Science.gov (United States)

    Mumcuoglu, Kosta Y; Mumcuoglu, Michael; Danilevich, Maria; Gilead, Leon

    2008-10-01

    Health providers such as physicians, nurses and pharmacists should be knowledgeable about the biology of head lice and the ways to control them effectively, in order to reduce the proportion of children infested with head lice. To evaluate the knowledge of physicians in Israel on the biology and epidemiology of lice, as well as their experience with infested individuals and their preferences for diagnosis, prophylaxis and control. An anonymous questionnaire with 37 questions was used. The first 20 questions addressed the general knowledge of physicians on lice biology and control, while the remaining 17 questions were related to their personal experience with lice and louse treatment. Out of 273 physicians interviewed 66.8% had good knowledge of lice, while the remaining 33.2% had some knowledge on lice. The difference between the groups of physicians with medium and good knowledge on lice was borderline significant (P=0.0722), with the dermatologists borderline significantly less knowledgeable than the rest (P=0.0765). Significant differences were found between those physicians with 4-6 or 11-20 years of professional experience and the remaining groups (twice Pbiology and control was higher than male physicians (39.4% and 29.4%, respectively), the differences were borderline significant (P=0.09). Pediatricians and dermatologists examined significantly more children than family physicians and general practitioners (P control of head louse infestations.

  8. Immune responses of Helicoverpa armigera to different kinds of pathogens

    Directory of Open Access Journals (Sweden)

    Zhao Xiao-Fan

    2010-03-01

    Full Text Available Abstract Background Insects react against pathogens through innate immunity. The cotton bollworm Helicoverpa armigera (H. armigera is an important defoliator and an extremely destructive pest insect of many crops. The elucidation of the mechanism of the immune response of H. armigera to various pathogens can provide a theoretical basis for new approaches to biologically control this pest. Results Four kinds of pathogens Bacillus thuringiensis, Klebsiella pneumoniae, Candida albicans, and Autographa californica multiple nucleocapsid nucleopolyhedrovirus harbored green fluorescence protein and polyhedron (AcMNPV-GFP were used to challenge the insect. The cellular and humoral immune responses to the pathogens were analyzed in the challenged H. armigera. The results show that in the five kinds of haemocytes, only granulocytes phagocytized the Gram-negative and Gram-positive bacteria and fungi. All haemocytes can be infected by AcMNPV. Fourteen immune-related genes including pattern recognition receptors (PRRs such as peptidoglycan recognition proteins (HaPGRP and HaPGRP C and Gram-Negative Bacteria-Binding Protein (HaGNBP, and antimicrobial peptides (AMPs such as cecropin-1, 2 and 3 (HaCec-1, 2 and 3, lysozyme (HaLys, attacin (HaAtt, gallerimycin-like (HaGall, gloverin-like (HaGlo, moricin-like (HaMor, cobatoxin-like (HaCob, galiomicin-like (HaGali, and immune inducible protein (HaIip appeared in different expression profiles to different pathogen infections. The transcripts of 13 immune related genes (except HaPGRPC are obviously up-regulated by Gram-positive bacteria. HaCec-1 and 3, HaMor, HaAtt, HaLys, HaIip, HaPGRP and HaGNBP are greatly up-regulated after fungal infection. HaGNBP, HaCec-2, HaGall, HaGlo, HaMor, HaCob, HaGali obviously increased in Gram-negative bacterial infection. Only five genes, HaGNBP, HaCec-1, HaGali, HaGlo, and HaLys, are weakly up-regulated after viral infection. The AMP transcripts had higher expression levels than the

  9. An improved method of DNA extraction from plants for pathogen ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.

  10. Biological control of Orobanche aegyptiaca by Fusarium oxysporum F. sp. Orobanchein northwest Iran.

    Science.gov (United States)

    Saremi, H; Okhovvat, S M

    2008-01-01

    Broomrape (Orobanche aegyptiaca) is one of the most serious weed pathogen on many plants all over the world, especially in northwest Iran. It causes damage on some plants particularly on tomato, cucumber and other dicotyledonous crops in zanjan province. Broomrape as weed, caused reductions in crop yield, adversely affected crop quality, and resulted in loss of cultivated land due to reduced crop alternatives. Since there were no any chemical methods and other proper technique to control this plant parasite we tried to find a good mechanism for its management in the fields. Our study showed there was a specific species, Fusarium oxysporum f. sp. orobonche that had infected Broomrapes naturally in the field. In point of fact the species was isolated from naturally infected Broomrape in studied Locations. Our surveys showed F. oxysporum f. sp. orobanche caused disease on orobanche spp. in different agricultural fields. Although there were other fungal species which can nearly manage the orobanche but it can be fungal pathogen to other plants. However the best fungal isolate can be F. oxysporum f. sp. orobanche since it may not be pathogen for other plants.

  11. 76 FR 3076 - Availability of an Environmental Assessment for a Biological Control Agent for Air Potato

    Science.gov (United States)

    2011-01-19

    ...] Availability of an Environmental Assessment for a Biological Control Agent for Air Potato AGENCY: Animal and... environmental assessment (EA) relative to the control of air potato (Dioscorea bulbifera). The EA considers the... States for use as a biological control agent to reduce the severity of air potato infestations. We are...

  12. Systems Biology-Based Platforms to Accelerate Research of Emerging Infectious Diseases.

    Science.gov (United States)

    Oh, Soo Jin; Choi, Young Ki; Shin, Ok Sarah

    2018-03-01

    Emerging infectious diseases (EIDs) pose a major threat to public health and security. Given the dynamic nature and significant impact of EIDs, the most effective way to prevent and protect against them is to develop vaccines in advance. Systems biology approaches provide an integrative way to understand the complex immune response to pathogens. They can lead to a greater understanding of EID pathogenesis and facilitate the evaluation of newly developed vaccine-induced immunity in a timely manner. In recent years, advances in high throughput technologies have enabled researchers to successfully apply systems biology methods to analyze immune responses to a variety of pathogens and vaccines. Despite recent advances, computational and biological challenges impede wider application of systems biology approaches. This review highlights recent advances in the fields of systems immunology and vaccinology, and presents ways that systems biology-based platforms can be applied to accelerate a deeper understanding of the molecular mechanisms of immunity against EIDs. © Copyright: Yonsei University College of Medicine 2018.

  13. Synthetic biology and biosecurity: challenging the "myths".

    OpenAIRE

    Jefferson, C; Lentzos, F; Marris, C

    2014-01-01

    15.10.14 KB. Ok to add published version to spiral, OA paper under cc by Synthetic biology, a field that aims to make biology easier to engineer, is routinely described as leading to an increase in the dual-use threat, i.e., the potential for the same scientific research to be used for peaceful purposes or misused for warfare or terrorism. Fears have been expressed that the de-skilling of biology, combined with online access to the genomic DNA sequences of pathogenic organisms an...

  14. Effectiveness of sanitizing products on controlling selected pathogen surrogates on retail deli slicers.

    Science.gov (United States)

    Yeater, Michael C; Kirsch, Katie R; Taylor, T Matthew; Mitchell, Jeff; Osburn, Wesley N

    2015-04-01

    The objectives of this study were (i) to assess the efficacy of quaternary ammonium chloride-based wet foam (WF) and dry foam (DF) sanitizer systems (600 ppm) for reducing Listeria innocua (a nonpathogenic surrogate of Listeria monocytogenes) or a 100.0 μg/ml rifampin-resistant Salmonella Typhimurium LT2 (a nonpathogenic surrogate of Salmonella enterica serovar Typhimurium) on niche and transfer point areas of an unwashed retail deli slicer as compared with traditional chlorine (Cl(-)) treatment (200 ppm) and (ii) to compare sanitizer surface contact times (10 and 15 min) for pathogen surrogate control. Turkey frankfurter slurries inoculated with L. innocua or Salmonella Typhimurium were used to inoculate seven high-risk sites on a commercial slicer. After 30 min of bacterial attachment, slicers were dry wiped to remove excess food matter, followed by a randomly assigned sanitizer treatment. Surviving pathogen surrogate cells were enumerated on modified Oxford's agar not containing antimicrobic supplement (L. innocua) or on tryptic soy agar supplemented with 100 μg/ml rifampin (Salmonella Typhimurium LT2). Replicate-specific L. innocua and Salmonella Typhimurium reductions were calculated as log CFU per square centimeter of control minus log CFU per square centimeter of enumerated survivors for each site. For both organisms, all sanitizer treatments differed from each other, with Cl(-) producing the least reduction and WF the greatest reduction. A significant (P < 0.05) site-by-treatment interaction was observed. The results of the study indicate that quaternary ammonium chloride sanitizers (600 ppm) applied by both WF and DF were more effective at reducing L. innocua and Salmonella Typhimurium than a traditional Cl sanitizer (200 ppm) on unwashed slicer surfaces.

  15. Radiochemical and biological control of metaiodobenzyl-guanidine (MIBG) labeled with 131I

    International Nuclear Information System (INIS)

    Barboza, M.R.F.F. de; Muramoto, E.; Colturato, M.T.; Silva Valente Goncalves, R. da; Pereira, N.P.S. de; Almeida, M.A.T.M. de; Silva, C.P.G. da.

    1988-07-01

    This study shows the standardization of the radiochemical control of MIBG - 131 I in eletrophoretic system and also the biological control in Wistar rat for a period of time, not longer than 60 minutes after tracer administration. (author) [pt

  16. Landscape epidemiology and control of pathogens with cryptic and long-distance dispersal: sudden oak death in northern Californian forests.

    Directory of Open Access Journals (Sweden)

    João A N Filipe

    2012-01-01

    Full Text Available Exotic pathogens and pests threaten ecosystem service, biodiversity, and crop security globally. If an invasive agent can disperse asymptomatically over long distances, multiple spatial and temporal scales interplay, making identification of effective strategies to regulate, monitor, and control disease extremely difficult. The management of outbreaks is also challenged by limited data on the actual area infested and the dynamics of spatial spread, due to financial, technological, or social constraints. We examine principles of landscape epidemiology important in designing policy to prevent or slow invasion by such organisms, and use Phytophthora ramorum, the cause of sudden oak death, to illustrate how shortfalls in their understanding can render management applications inappropriate. This pathogen has invaded forests in coastal California, USA, and an isolated but fast-growing epidemic focus in northern California (Humboldt County has the potential for extensive spread. The risk of spread is enhanced by the pathogen's generalist nature and survival. Additionally, the extent of cryptic infection is unknown due to limited surveying resources and access to private land. Here, we use an epidemiological model for transmission in heterogeneous landscapes and Bayesian Markov-chain-Monte-Carlo inference to estimate dispersal and life-cycle parameters of P. ramorum and forecast the distribution of infection and speed of the epidemic front in Humboldt County. We assess the viability of management options for containing the pathogen's northern spread and local impacts. Implementing a stand-alone host-free "barrier" had limited efficacy due to long-distance dispersal, but combining curative with preventive treatments ahead of the front reduced local damage and contained spread. While the large size of this focus makes effective control expensive, early synchronous treatment in newly-identified disease foci should be more cost-effective. We show how the

  17. Conservation biological control and enemy diversity on a landscape scale

    NARCIS (Netherlands)

    Tscharntke, T.; Bommarco, R.; Clough, Y.; Crist, T.O.; Kleijn, D.; Rand, T.A.; Tylianakis, J.M.; Nouhuys, S.; Vidal, S.

    2007-01-01

    Conservation biological control in agroecosystems requires a landscape management perspective, because most arthropod species experience their habitat at spatial scales beyond the plot level, and there is spillover of natural enemies across the crop–noncrop interface. The species pool in the

  18. Biology, etiology, and control of virus diseases of banana and plantain.

    Science.gov (United States)

    Kumar, P Lava; Selvarajan, Ramasamy; Iskra-Caruana, Marie-Line; Chabannes, Matthieu; Hanna, Rachid

    2015-01-01

    Banana and plantain (Musa spp.), produced in 10.3 million ha in the tropics, are among the world's top 10 food crops. They are vegetatively propagated using suckers or tissue culture plants and grown almost as perennial plantations. These are prone to the accumulation of pests and pathogens, especially viruses which contribute to yield reduction and are also barriers to the international exchange of germplasm. The most economically important viruses of banana and plantain are Banana bunchy top virus (BBTV), a complex of banana streak viruses (BSVs) and Banana bract mosaic virus (BBrMV). BBTV is known to cause the most serious economic losses in the "Old World," contributing to a yield reduction of up to 100% and responsible for a dramatic reduction in cropping area. The BSVs exist as episomal and endogenous forms are known to be worldwide in distribution. In India and the Philippines, BBrMV is known to be economically important but recently the virus was discovered in Colombia and Costa Rica, thus signaling its spread into the "New World." Banana and plantain are also known to be susceptible to five other viruses of minor significance, such as Abaca mosaic virus, Abaca bunchy top virus, Banana mild mosaic virus, Banana virus X, and Cucumber mosaic virus. Studies over the past 100 years have contributed to important knowledge on disease biology, distribution, and spread. Research during the last 25 years have led to a better understanding of the virus-vector-host interactions, virus diversity, disease etiology, and epidemiology. In addition, new diagnostic tools were developed which were used for surveillance and the certification of planting material. Due to a lack of durable host resistance in the Musa spp., phytosanitary measures and the use of virus-free planting material are the major methods of virus control. The state of knowledge on BBTV, BBrMV, and BSVs, and other minor viruses, disease spread, and control are summarized in this review. © 2015 Elsevier Inc

  19. VarR controls colonization and virulence in the marine macroalgal pathogen Nautella italica R11

    Directory of Open Access Journals (Sweden)

    Melissa eGardiner

    2015-10-01

    Full Text Available There is increasing evidence to suggest that macroalgae (seaweeds are susceptible to infectious disease. However, to date, little is known about the mechanisms that facilitate the colonization and virulence of microbial seaweed pathogens. One well-described example of a seaweed disease is the bleaching of the red alga Delisea pulchra, which can be caused by the bacterium Nautella italica R11, a member of the Roseobacter clade. This pathogen contains a unique luxR-type gene, varR, which we hypothesize controls its colonization and virulence. We show here that a varR knock-out strain is deficient in its ability to cause disease in D. pulchra and is defective in biofilm formation and attachment to a common algal polysaccharide. Moreover complementation of the varR gene in trans can restore these functions to the wild type levels. Proteomic analysis of bacterial cells in planktonic and biofilm growth highlight the potential importance of nitrogen scavenging, mobilization of energy reserves, and stress resistance in the biofilm lifestyle of N. italica R11. Moreover, we show that VarR regulates the expression of a specific subset of biofilm-associated proteins. Taken together these data suggest that VarR controls colonization and persistence of N. italica R11 on the surface of a macroalgal host and that it is an important regulator of virulence.

  20. Modeling the intracellular pathogen-immune interaction with cure rate

    Science.gov (United States)

    Dubey, Balram; Dubey, Preeti; Dubey, Uma S.

    2016-09-01

    Many common and emergent infectious diseases like Influenza, SARS, Hepatitis, Ebola etc. are caused by viral pathogens. These infections can be controlled or prevented by understanding the dynamics of pathogen-immune interaction in vivo. In this paper, interaction of pathogens with uninfected and infected cells in presence or absence of immune response are considered in four different cases. In the first case, the model considers the saturated nonlinear infection rate and linear cure rate without absorption of pathogens into uninfected cells and without immune response. The next model considers the effect of absorption of pathogens into uninfected cells while all other terms are same as in the first case. The third model incorporates innate immune response, humoral immune response and Cytotoxic T lymphocytes (CTL) mediated immune response with cure rate and without absorption of pathogens into uninfected cells. The last model is an extension of the third model in which the effect of absorption of pathogens into uninfected cells has been considered. Positivity and boundedness of solutions are established to ensure the well-posedness of the problem. It has been found that all the four models have two equilibria, namely, pathogen-free equilibrium point and pathogen-present equilibrium point. In each case, stability analysis of each equilibrium point is investigated. Pathogen-free equilibrium is globally asymptotically stable when basic reproduction number is less or equal to unity. This implies that control or prevention of infection is independent of initial concentration of uninfected cells, infected cells, pathogens and immune responses in the body. The proposed models show that introduction of immune response and cure rate strongly affects the stability behavior of the system. Further, on computing basic reproduction number, it has been found to be minimum for the fourth model vis-a-vis other models. The analytical findings of each model have been exemplified by

  1. The niche reduction approach: an opportunity for optimal control of infectious diseases in low-income countries?

    Science.gov (United States)

    Roche, Benjamin; Broutin, Hélène; Choisy, Marc; Godreuil, Sylvain; de Magny, Guillaume Constantin; Chevaleyre, Yann; Zucker, Jean-Daniel; Breban, Romulus; Cazelles, Bernard; Simard, Frédéric

    2014-07-25

    During the last century, WHO led public health interventions that resulted in spectacular achievements such as the worldwide eradication of smallpox and the elimination of malaria from the Western world. However, besides major successes achieved worldwide in infectious diseases control, most elimination/control programs remain frustrating in many tropical countries where specific biological and socio-economical features prevented implementation of disease control over broad spatial and temporal scales. Emblematic examples include malaria, yellow fever, measles and HIV. There is consequently an urgent need to develop affordable and sustainable disease control strategies that can target the core of infectious diseases transmission in highly endemic areas. Meanwhile, although most pathogens appear so difficult to eradicate, it is surprising to realize that human activities are major drivers of the current high rate of extinction among upper organisms through alteration of their ecology and evolution, i.e., their "niche". During the last decades, the accumulation of ecological and evolutionary studies focused on infectious diseases has shown that the niche of a pathogen holds more dimensions than just the immune system targeted by vaccination and treatment. Indeed, it is situated at various intra- and inter- host levels involved on very different spatial and temporal scales. After developing a precise definition of the niche of a pathogen, we detail how major advances in the field of ecology and evolutionary biology of infectious diseases can enlighten the planning and implementation of infectious diseases control in tropical countries with challenging economic constraints. We develop how the approach could translate into applied cases, explore its expected benefits and constraints, and we conclude on the necessity of such approach for pathogen control in low-income countries.

  2. Genomic and evolutionary comparisons of diazotrophic and pathogenic bacteria of the order Rhizobiales

    Directory of Open Access Journals (Sweden)

    Vasconcelos Ana

    2010-02-01

    Full Text Available Abstract Background Species belonging to the Rhizobiales are intriguing and extensively researched for including both bacteria with the ability to fix nitrogen when in symbiosis with leguminous plants and pathogenic bacteria to animals and plants. Similarities between the strategies adopted by pathogenic and symbiotic Rhizobiales have been described, as well as high variability related to events of horizontal gene transfer. Although it is well known that chromosomal rearrangements, mutations and horizontal gene transfer influence the dynamics of bacterial genomes, in Rhizobiales, the scenario that determine pathogenic or symbiotic lifestyle are not clear and there are very few studies of comparative genomic between these classes of prokaryotic microorganisms trying to delineate the evolutionary characterization of symbiosis and pathogenesis. Results Non-symbiotic nitrogen-fixing bacteria and bacteria involved in bioremediation closer to symbionts and pathogens in study may assist in the origin and ancestry genes and the gene flow occurring in Rhizobiales. The genomic comparisons of 19 species of Rhizobiales, including nitrogen-fixing, bioremediators and pathogens resulted in 33 common clusters to biological nitrogen fixation and pathogenesis, 15 clusters exclusive to all nitrogen-fixing bacteria and bacteria involved in bioremediation, 13 clusters found in only some nitrogen-fixing and bioremediation bacteria, 01 cluster exclusive to some symbionts, and 01 cluster found only in some pathogens analyzed. In BBH performed to all strains studied, 77 common genes were obtained, 17 of which were related to biological nitrogen fixation and pathogenesis. Phylogenetic reconstructions for Fix, Nif, Nod, Vir, and Trb showed possible horizontal gene transfer events, grouping species of different phenotypes. Conclusions The presence of symbiotic and virulence genes in both pathogens and symbionts does not seem to be the only determinant factor for lifestyle

  3. Genomic and evolutionary comparisons of diazotrophic and pathogenic bacteria of the order Rhizobiales.

    Science.gov (United States)

    Carvalho, Fabíola M; Souza, Rangel C; Barcellos, Fernando G; Hungria, Mariangela; Vasconcelos, Ana Tereza R

    2010-02-08

    Species belonging to the Rhizobiales are intriguing and extensively researched for including both bacteria with the ability to fix nitrogen when in symbiosis with leguminous plants and pathogenic bacteria to animals and plants. Similarities between the strategies adopted by pathogenic and symbiotic Rhizobiales have been described, as well as high variability related to events of horizontal gene transfer. Although it is well known that chromosomal rearrangements, mutations and horizontal gene transfer influence the dynamics of bacterial genomes, in Rhizobiales, the scenario that determine pathogenic or symbiotic lifestyle are not clear and there are very few studies of comparative genomic between these classes of prokaryotic microorganisms trying to delineate the evolutionary characterization of symbiosis and pathogenesis. Non-symbiotic nitrogen-fixing bacteria and bacteria involved in bioremediation closer to symbionts and pathogens in study may assist in the origin and ancestry genes and the gene flow occurring in Rhizobiales. The genomic comparisons of 19 species of Rhizobiales, including nitrogen-fixing, bioremediators and pathogens resulted in 33 common clusters to biological nitrogen fixation and pathogenesis, 15 clusters exclusive to all nitrogen-fixing bacteria and bacteria involved in bioremediation, 13 clusters found in only some nitrogen-fixing and bioremediation bacteria, 01 cluster exclusive to some symbionts, and 01 cluster found only in some pathogens analyzed. In BBH performed to all strains studied, 77 common genes were obtained, 17 of which were related to biological nitrogen fixation and pathogenesis. Phylogenetic reconstructions for Fix, Nif, Nod, Vir, and Trb showed possible horizontal gene transfer events, grouping species of different phenotypes. The presence of symbiotic and virulence genes in both pathogens and symbionts does not seem to be the only determinant factor for lifestyle evolution in these microorganisms, although they may act in

  4. Adaptive Fuzzy-Lyapunov Controller Using Biologically Inspired Swarm Intelligence

    Directory of Open Access Journals (Sweden)

    Alejandro Carrasco Elizalde

    2008-01-01

    Full Text Available The collective behaviour of swarms produces smarter actions than those achieved by a single individual. Colonies of ants, flocks of birds and fish schools are examples of swarms interacting with their environment to achieve a common goal. This cooperative biological intelligence is the inspiration for an adaptive fuzzy controller developed in this paper. Swarm intelligence is used to adjust the parameters of the membership functions used in the adaptive fuzzy controller. The rules of the controller are designed using a computing-with-words approach called Fuzzy-Lyapunov synthesis to improve the stability and robustness of an adaptive fuzzy controller. Computing-with-words provides a powerful tool to manipulate numbers and symbols, like words in a natural language.

  5. Biological control of fruit flies (Diptera: Tephritidae) through parasitoid augmentative releases: Current status

    International Nuclear Information System (INIS)

    Montoya, Pablo; Liedo, Pablo

    2000-01-01

    Fruit flies are among the main pests affecting the world fruit industry (Aluja 1993). Bait sprays have traditionally been used successfully to control them; however, the side effects on the environment and health hazards commonly associated with pesticides, have resulted in strong public opposition to the use of bait sprays. This is particularly so when sprays are applied in urban areas or in coffee plantations where, although Medflies are present, they do not pose a danger to crops. Alternative methods that are effective and environmental friendly to suppress fruit fly populations are highly desirable. Biological control, the use of natural enemies to suppress pest populations, represents such an alternative. Some of the most successful cases of biological control are the control of Iceria purchasi Maskell (Homoptera: Margarodidae) by Rodolia cardinalis Mulsant (Coleoptera: Coccinellidae) in California (De Bach 1968, van den Bosch et al. 1982), and the control of Aleurocanthus woglumi Ashby (Homoptera: Aleyrodidae) mainly by Encarsia (=Prospaltella) opulenta Silv. (Hymenoptera: Aphelinidae) in Mexico (Jimenez 1961, 1971), both using the classical approach. However, this approach has been limited to certain conditions of environmental stability and biodiversity which are only found in a few ecosystems. Other factors, such as types of pests, the economic threshold and product quality requirements represent additional limitations. The best option in many cases could be augmentative biological control, which could overcome some of the deficiencies of the classical approach (Sivinski 1996). According to Knipling (1992) and Barclay (1987), augmentative biological control can be considered as a formal alternative for suppressing pest populations and even for use in eradication programmes, after integration with the sterile insect technique (SIT). In this approach, mass production of natural enemies is required and this production has to be cost effective

  6. Exploring rhizosphere bacteria of Eichhornia crassipes for metal tolerance and biological activity

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Gomez, S.; Ribeiro, M.; Deshpande, S.A.; Singh, K.S.; DeSouza, L.

    Cl3, They were further screened for antibiotic sensitivity and biological activity according to Kirby-Bauer disc diffusion method The MTB under metal stress condition showed significant biological activity against clinical pathogens, fouling...

  7. Food-borne pathogens. Is there a remedy

    Energy Technology Data Exchange (ETDEWEB)

    Niemand, J G

    1985-03-01

    The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process.

  8. Gene Drive for Mosquito Control: Where Did It Come from and Where Are We Headed?

    Science.gov (United States)

    Macias, Vanessa M; Ohm, Johanna R; Rasgon, Jason L

    2017-09-02

    Mosquito-borne pathogens place an enormous burden on human health. The existing toolkit is insufficient to support ongoing vector-control efforts towards meeting disease elimination and eradication goals. The perspective that genetic approaches can potentially add a significant set of tools toward mosquito control is not new, but the recent improvements in site-specific gene editing with CRISPR/Cas9 systems have enhanced our ability to both study mosquito biology using reverse genetics and produce genetics-based tools. Cas9-mediated gene-editing is an efficient and adaptable platform for gene drive strategies, which have advantages over innundative release strategies for introgressing desirable suppression and pathogen-blocking genotypes into wild mosquito populations; until recently, an effective gene drive has been largely out of reach. Many considerations will inform the effective use of new genetic tools, including gene drives. Here we review the lengthy history of genetic advances in mosquito biology and discuss both the impact of efficient site-specific gene editing on vector biology and the resulting potential to deploy new genetic tools for the abatement of mosquito-borne disease.

  9. Babaco (Vasconcellea heilbornii var. pentagona Badillo. Major plant pathogens and control strategies

    Directory of Open Access Journals (Sweden)

    Angel Rolando Robles-Carrión

    2016-04-01

    Full Text Available This work was carried out with the aim of documenting the importance of Babaco for the Andean region, its main plant pathogens, and possible control strategies and integrated management, emphasizing the MVB. Was performed a systematic review of scientific papers published in prestigious journals and thesis diplomas, masters and doctorates from various universities. As a criterion for inclusion-exclusion studies were taken into account in the genus Vasconcellea. Ecuador has 15 of the 21 described species, of which more than half are located in the province of Loja. Vascular Wilt Babaco (MVB is caused by a complex of Fusarium fungi that interact with the plant. There are no integrated management strategies for Vascular Wilt Babaco scientifically proven.

  10. Hard ticks and their bacterial endosymbionts (or would be pathogens)

    Czech Academy of Sciences Publication Activity Database

    Ahantarig, A.; Trinachartvanit, W.; Baimai, V.; Grubhoffer, Libor

    2013-01-01

    Roč. 58, č. 5 (2013), s. 419-428 ISSN 0015-5632 Institutional support: RVO:60077344 Keywords : Ixodes ricinus * Candidatus Midichloria mitochondrii * Francisella-like endosymbionts * vector Ambylomma americanum * fever group Rickettsiae * Dermacentor and ersoni * spotted fever * borne pathogens Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.145, year: 2013

  11. Whole-genome sequencing of Bacillus subtilis XF-1 reveals mechanisms for biological control and multiple beneficial properties in plants.

    Science.gov (United States)

    Guo, Shengye; Li, Xingyu; He, Pengfei; Ho, Honhing; Wu, Yixin; He, Yueqiu

    2015-06-01

    Bacillus subtilis XF-1 is a gram-positive, plant-associated bacterium that stimulates plant growth and produces secondary metabolites that suppress soil-borne plant pathogens. In particular, it is especially highly efficient at controlling the clubroot disease of cruciferous crops. Its 4,061,186-bp genome contains an estimated 3853 protein-coding sequences and the 1155 genes of XF-1 are present in most genome-sequenced Bacillus strains: 3757 genes in B. subtilis 168, and 1164 in B. amyloliquefaciens FZB42. Analysis using the Cluster of Orthologous Groups database of proteins shows that 60 genes control bacterial mobility, 221 genes are related to cell wall and membrane biosynthesis, and more than 112 are genes associated with secondary metabolites. In addition, the genes contributed to the strain's plant colonization, bio-control and stimulation of plant growth. Sequencing of the genome is a fundamental step for developing a desired strain to serve as an efficient biological control agent and plant growth stimulator. Similar to other members of the taxon, XF-1 has a genome that contains giant gene clusters for the non-ribosomal synthesis of antifungal lipopeptides (surfactin and fengycin), the polyketides (macrolactin and bacillaene), the siderophore bacillibactin, and the dipeptide bacilysin. There are two synthesis pathways for volatile growth-promoting compounds. The expression of biosynthesized antibiotic peptides in XF-1 was revealed by matrix-assisted laser desorption/ionization-time of flight mass spectrometry.

  12. Biocontrol interventions for inactivation of foodborne pathogens on produce

    Science.gov (United States)

    Post-harvest interventions for control of foodborne pathogens on minimally processed foods are crucial for food safety. Biocontrol interventions have the primary objective of developing novel antagonists in combinations with physical and chemical interventions to inactivate pathogenic microbes. Ther...

  13. Tropism and pathogenicity of rickettsiae

    Directory of Open Access Journals (Sweden)

    Tsuneo eUchiyama

    2012-06-01

    Full Text Available Rickettsiae are obligate intracellular parasitic bacteria that cause febrile exanthematous illnesses such as Rocky Mountain spotted fever, Mediterranean spotted fever, epidemic and murine typhus, etc. Although the vector ranges of each Rickettsia species are rather restricted; i.e., ticks belonging to Arachnida and lice and fleas belonging to Insecta usually act as vectors for spotted fever group and typhus group rickettsiae, respectively, it would be interesting to elucidate the mechanisms controlling the vector tropism of rickettsiae. This review discusses the factors determining the vector tropism of rickettsiae. In brief, the vector tropism of rickettsiae species is basically consistent with their tropism towards cultured tick and insect cells. The mechanisms responsible for rickettsiae pathogenicity are also described. Recently, genomic analyses of rickettsiae have revealed that they possess several genes that are homologous to those affecting the pathogenicity of other bacteria. Analyses comparing the genomes of pathogenic and nonpathogenic strains of rickettsiae have detected many factors that are related to rickettsial pathogenicity. It is also known that a reduction in the rickettsial genome has occurred during the course of its evolution. Interestingly, Rickettsia species with small genomes, such as Rickettsia prowazekii, are more pathogenic to humans than those with larger genomes. This review also examines the growth kinetics of pathogenic and nonpathogenic species of spotted fever group rickettsiae in mammalian cells. The growth of nonpathogenic species is restricted in these cells, which is mediated, at least in part, by autophagy. The superinfection of nonpathogenic rickettsiae-infected cells with pathogenic rickettsiae results in an elevated yield of the nonpathogenic rickettsiae and the growth of the pathogenic rickettsiae. Autophagy is restricted in these cells. These results are discussed in this review.

  14. Stakeholder perceptions: Biological control of Russian olive (Elaeagnus angustifolia)

    Science.gov (United States)

    Sharlene E. Sing; Kevin J. Delaney

    2016-01-01

    An online survey was distributed through email lists provided by various stakeholder groups on behalf of the International Consortium for Biological Control of Russian Olive in spring of 2012. A total of 392 respondents replied from 24 U.S. states and 1 Canadian province. Questions posed in the survey were designed to identify and categorize 1) stakeholders by...

  15. Deep Characterization of the Microbiomes of Calophya spp. (Hemiptera: Calophyidae) Gall-Inducing Psyllids Reveals the Absence of Plant Pathogenic Bacteria and Three Dominant Endosymbionts.

    Science.gov (United States)

    Overholt, Will A; Diaz, Rodrigo; Rosskopf, Erin; Green, Stefan J; Overholt, William A

    2015-01-01

    Bacteria associated with sap-feeding insect herbivores include not only symbionts that may increase their hosts' fitness but also harmful plant pathogens. Calophya spp. gall-inducing psyllids (Hemiptera: Calophyidae) are being investigated for their potential as biological control agents of the noxious weed, Brazilian peppertree (Schinus terebinthifolia), in Florida. Although there are no examples of plant pathogen transmission by members of the family Calophyidae, several insects in the superfamily Psylloidea are known to transmit pathogenic bacteria in the genera Candidatus Liberibacter and Candidatus Phytoplasma. To determine whether Calophya spp. harbor potentially harmful plant pathogenic bacteria, we sequenced small subunit (SSU) ribosomal RNA (rRNA) gene amplicons generated from individuals from four Calophya spp. populations: All microbial SSU gene sequences fell into the bacterial domain, with 98-99% belonging to the Proteobacteria. The Calophya microbiomes contained a relatively simple community, with 49-79 operational taxonomic units (OTUs; 97%) detected, and only 5-8 OTUs with greater than 1% abundance. Candidatus Carsonella showed the highest relative abundance, with OTUs from this candidate genus representing between 51-65% of all recovered sequences. The next most abundant clade observed was an unclassified Enterobacteriacae group closely related to bacteria from the genera Buchnera and Blochmannia that ranged from 20-31% in relative abundance. Wolbachia populations were the third most abundant group and represented 7-27% of the diversity in microbial OTUs. No SSU rRNA gene sequences from putative pathogenic bacteria from the genera Ca. Liberibacter or Ca. Phytoplasma were detected in the microbiomes of the four Calophya populations. The probability that infected psyllids were present in our colonies, but were not sampled, was extremley low (1.39 x 10(-10)). As far as we are aware, our study is the first to characterize the microbiome of a candidate

  16. Deep Characterization of the Microbiomes of Calophya spp. (Hemiptera: Calophyidae Gall-Inducing Psyllids Reveals the Absence of Plant Pathogenic Bacteria and Three Dominant Endosymbionts.

    Directory of Open Access Journals (Sweden)

    Will A Overholt

    Full Text Available Bacteria associated with sap-feeding insect herbivores include not only symbionts that may increase their hosts' fitness but also harmful plant pathogens. Calophya spp. gall-inducing psyllids (Hemiptera: Calophyidae are being investigated for their potential as biological control agents of the noxious weed, Brazilian peppertree (Schinus terebinthifolia, in Florida. Although there are no examples of plant pathogen transmission by members of the family Calophyidae, several insects in the superfamily Psylloidea are known to transmit pathogenic bacteria in the genera Candidatus Liberibacter and Candidatus Phytoplasma. To determine whether Calophya spp. harbor potentially harmful plant pathogenic bacteria, we sequenced small subunit (SSU ribosomal RNA (rRNA gene amplicons generated from individuals from four Calophya spp. populations: All microbial SSU gene sequences fell into the bacterial domain, with 98-99% belonging to the Proteobacteria. The Calophya microbiomes contained a relatively simple community, with 49-79 operational taxonomic units (OTUs; 97% detected, and only 5-8 OTUs with greater than 1% abundance. Candidatus Carsonella showed the highest relative abundance, with OTUs from this candidate genus representing between 51-65% of all recovered sequences. The next most abundant clade observed was an unclassified Enterobacteriacae group closely related to bacteria from the genera Buchnera and Blochmannia that ranged from 20-31% in relative abundance. Wolbachia populations were the third most abundant group and represented 7-27% of the diversity in microbial OTUs. No SSU rRNA gene sequences from putative pathogenic bacteria from the genera Ca. Liberibacter or Ca. Phytoplasma were detected in the microbiomes of the four Calophya populations. The probability that infected psyllids were present in our colonies, but were not sampled, was extremley low (1.39 x 10(-10. As far as we are aware, our study is the first to characterize the microbiome of

  17. Protecting workers from pathogens. Employers must act now to comply with OSHA's new standard on bloodborne pathogens.

    Science.gov (United States)

    White, C L

    1992-04-01

    A new standard set forth by the Occupational Safety and Health Administration (OSHA) requires healthcare employers to implement sweeping new controls in areas such as record keeping, engineering, hazard prevention, and work practice. Through the bloodborne pathogen standard, which went into effect on March 6, OSHA acknowledges that healthcare workers face significant health risks as a result of occupational exposure to blood and other infectious materials. Although most prudent healthcare providers already adhere to the Centers for Disease Control's universal precautions, the OSHA regulations include several additional mandatory measures that are more specific and stringent. The additional measures include the development of an exposure control plan, procedures for responding to an employee's exposure to bloodborne pathogens, the implementation of certain engineering and work practice controls to eliminate or minimize on-the-job exposure risks, and the provision of personal protective equipment and information and training programs. OSHA estimates that the greatest cost component of implementing procedures to bring a facility into compliance is attributable to the purchase of personal protective equipment. Although the costs of compliance are substantial, OSHA has estimated that these costs represent less than 1 percent of the healthcare industry's annual revenues. Violation of the bloodborne pathogen standard may result in penalties of up to $70,000, depending on the severity of the infraction. Criminal penalties are also possible for willful violations that result in worker death.

  18. Landscape epidemiology and control of pathogens with cryptic and long-distance dispersal: Sudden oak death in northern Californian forests

    Science.gov (United States)

    Joao A. N. Filipe; Richard C. Cobb; Ross K. Meentemeyer; Christopher A. Lee; Yana S. Valachovic; Alex R. Cook; David M. Rizzo; Christopher A. Gilligan

    2012-01-01

    Exotic pathogens and pests threaten ecosystem service, biodiversity, and crop security globally. If an invasive agent can disperse asymptomatically over long distances, multiple spatial and temporal scales interplay, making identification of effective strategies to regulate, monitor, and control disease extremely difficult. The management of outbreaks is also...

  19. Improving the cost-effectiveness, trade and safety of biological control for agricultural insect pests using nuclear techniques

    Science.gov (United States)

    If appropriately applied, biological control offers one of the most promising, environmentally sound, and sustainable control tactics for arthropod pests and weeds for application as part of an integrated pest management (IPM) approach. Public support for biological control as one of the preferred m...

  20. AN INVESTIGATION ON PATHOGENIC VIBRIOS DISTRIBUTION IN DOMESTIC WASTEWATER

    OpenAIRE

    A. Almasi

    2005-01-01

    Municipal wastewater is one of the most important pollution sources for water supply resources. Identification and enumeration of pathogenic agents particularly pathogenic Vibrios are beneficial for controlling and prevention planning of the infectious diseases. This research was carried out to identify the distribution of the recognized pathogenic Vibrios with emphasizing on identification of Vibrio cholera in the wastewater of Kermanshah city western Iran in 2002. The method of study was cr...

  1. Using biological networks to improve our understanding of infectious diseases

    Directory of Open Access Journals (Sweden)

    Nicola J. Mulder

    2014-08-01

    Full Text Available Infectious diseases are the leading cause of death, particularly in developing countries. Although many drugs are available for treating the most common infectious diseases, in many cases the mechanism of action of these drugs or even their targets in the pathogen remain unknown. In addition, the key factors or processes in pathogens that facilitate infection and disease progression are often not well understood. Since proteins do not work in isolation, understanding biological systems requires a better understanding of the interconnectivity between proteins in different pathways and processes, which includes both physical and other functional interactions. Such biological networks can be generated within organisms or between organisms sharing a common environment using experimental data and computational predictions. Though different data sources provide different levels of accuracy, confidence in interactions can be measured using interaction scores. Connections between interacting proteins in biological networks can be represented as graphs and edges, and thus studied using existing algorithms and tools from graph theory. There are many different applications of biological networks, and here we discuss three such applications, specifically applied to the infectious disease tuberculosis, with its causative agent Mycobacterium tuberculosis and host, Homo sapiens. The applications include the use of the networks for function prediction, comparison of networks for evolutionary studies, and the generation and use of host–pathogen interaction networks.

  2. Fate of pathogens and micro-pollutants during organic wastes and by-products anaerobic digestion - a review; Etat des connaissances sur le devenir des germes pathogenes et des micropolluants au cours de la methanisation des dechets et sous-produits organiques

    Energy Technology Data Exchange (ETDEWEB)

    Couturier, Ch; Galtier, L

    1998-09-01

    Based on 300 scientific papers, the following bibliographical research deals with the fate of micro-pollutants (pathogens, heavy metals, organic pollutants) during anaerobic digestion. Different biological and chemical mechanisms allow organic compounds elimination, except from some Polycyclic Aromatic Hydrocarbons (PAHs) and heavy metals which are fixed to the solid biomass, permitting water contamination risks attenuation. Unlike mesophilic digestion, thermophilic digestion is a 'sanitation' process regarding pathogens elimination. However, mesophilic digestion offers an important reliability compared with competitive or complementary processes. In particular, energy recovery from anaerobic digestion allows temperature control and makes easier further sanitation heat treatments. In general, anaerobic digestion represents a tool which can be included in an organic waste treatment line assuming waste selection and good agricultural practices. Otherwise, sanitation problem is still badly handled by waste operators and constructors which have been consulted. Research orientations seem especially interesting in improving knowledge of real industrial processes performances. (author)

  3. Indoor biological pollution

    International Nuclear Information System (INIS)

    Bressa, G.

    2000-01-01

    Inside buildings - besides the umpteen toxic substances emanating from materials and appliances used daily for the most assorted activities - there are may be a number of different pathogenic micro-organisms able to cause diseases and respiratory system infections. Indoor pollution caused by biological agents may be due not only to living microorganisms, but also to dead ones or to the produce of their metabolism as well as to allergens. The most efficient precautionary measure against biological agents is to ventilate the rooms one lives in. In case of air-conditioning, it's good rule to keep air pipes dry and clean, renewing filters at regular intervals in order to avoid fungi and bacteria from settling in [it

  4. Common Occupational Health Problems In Disease Control In Nigeria

    African Journals Online (AJOL)

    This article reviews some common occupational health problems among health workers due to exposure to hazardous or pathogenic biological, chemical and physical agents in the line of duty. Highlighted biological agents are pathogenic viruses, bacteria etc; chemical agents are laboratory reagents, mercury and ...

  5. Enhancing the role of veterinary vaccines reducing zoonotic diseases of humans: Linking systems biology with vaccine development

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Leslie G.; Khare, Sangeeta; Lawhon, Sara D.; Rossetti, Carlos A.; Lewin, Harris A.; Lipton, Mary S.; Turse, Joshua E.; Wylie, Dennis C.; Bai, Yu; Drake, Kenneth L.

    2011-09-22

    The aim of research on infectious diseases is their prevention, and brucellosis and salmonellosis as such are classic examples of worldwide zoonoses for application of a systems biology approach for enhanced rational vaccine development. When used optimally, vaccines prevent disease manifestations, reduce transmission of disease, decrease the need for pharmaceutical intervention, and improve the health and welfare of animals, as well as indirectly protecting against zoonotic diseases of people. Advances in the last decade or so using comprehensive systems biology approaches linking genomics, proteomics, bioinformatics, and biotechnology with immunology, pathogenesis and vaccine formulation and delivery are expected to enable enhanced approaches to vaccine development. The goal of this paper is to evaluate the role of computational systems biology analysis of host:pathogen interactions (the interactome) as a tool for enhanced rational design of vaccines. Systems biology is bringing a new, more robust approach to veterinary vaccine design based upon a deeper understanding of the host pathogen interactions and its impact on the host's molecular network of the immune system. A computational systems biology method was utilized to create interactome models of the host responses to Brucella melitensis (BMEL), Mycobacterium avium paratuberculosis (MAP), Salmonella enterica Typhimurium (STM), and a Salmonella mutant (isogenic *sipA, sopABDE2) and linked to the basis for rational development of vaccines for brucellosis and salmonellosis as reviewed by Adams et al. and Ficht et al. [1,2]. A bovine ligated ileal loop biological model was established to capture the host gene expression response at multiple time points post infection. New methods based on Dynamic Bayesian Network (DBN) machine learning were employed to conduct a comparative pathogenicity analysis of 219 signaling and metabolic pathways and 1620 gene ontology (GO) categories that defined the host

  6. The effect of initial density and parasitoid intergenerational survival rate on classical biological control

    International Nuclear Information System (INIS)

    Xiao Yanni; Tang Sanyi

    2008-01-01

    Models of biological control have a long history of theoretical development that have focused on the interaction of a parasitoid and its host. The host-parasitoid systems have identified several important and general factors affecting the long-term dynamics of interacting populations. However, much less is known about how the initial densities of host-parasitoid populations affect the biological control as well as the stability of host-parasitoid systems. To do this, the classical Nicholson-Bailey model with host self-regulation and parasitoid intergenerational survival rate is used to uncover the effect of initial densities on the successful biological control. The results indicate that the simplest Nicholson-Bailey model has various coexistence with a wide range of parameters, including boundary attractors where the parasitoid population is absent and interior attractors where host-parasitoid coexists. The final stable states of host-parasitoid populations depend on their initial densities as well as their ratios, and those results are confirmed by basins of attraction of initial densities. The results also indicate that the parasitoid intergenerational survival rate increases the stability of the host-parasitoid systems. Therefore, the present research can help us to further understand the dynamical behavior of host-parasitoid interactions, to improve the classical biological control and to make management decisions

  7. Candidate predators for biological control of the poultry red mite Dermanyssus gallinae

    NARCIS (Netherlands)

    Lesna, I.; Wolfs, P.; Faraji, F.; Roy, L.; Komdeur, J.; Sabelis, M.W.

    2009-01-01

    The poultry red mite, Dermanyssus gallinae, is currently a significant pest in the poultry industry in Europe. Biological control by the introduction of predatory mites is one of the various options for controlling poultry red mites. Here, we present the first results of an attempt to identify

  8. Candidate predators for biological control of the poultry red mite Dermanyssus gallinae

    NARCIS (Netherlands)

    Lesna, Izabela; Wolfs, Peter; Faraji, Farid; Roy, Lise; Komdeur, Jan; Sabelis, Maurice W.

    The poultry red mite, Dermanyssus gallinae, is currently a significant pest in the poultry industry in Europe. Biological control by the introduction of predatory mites is one of the various options for controlling poultry red mites. Here, we present the first results of an attempt to identify

  9. Evaluation of the potential of Trichoderma viride in the control of fungal pathogens of Roselle (Hibiscus sabdariffa L.) in vitro.

    Science.gov (United States)

    Eslaminejad Parizi, T; Ansaria, Mehdi; Elaminejad, Tahereh

    2012-04-01

    The potential of Trichoderma viride as a bio-control agent was evaluated in vitro against Roselle pathogens i.e. Phoma exigua, Fusarium nygamai and Rhizoctonia solani[1] using the dual culture technique. Volatile and non-volatile inhibitors of Trichoderma were also evaluated for this purpose. T. viride[2] was shown to have a marked inhibitory effect on the tested pathogens in vitro. Maximum inhibition occurred against P. exigua, with 71.76% reduction in mycelial radial growth. The three pathogens, P. exigua, F. nygamai and R. solani were also found to be susceptible to the volatile inhibitors produced by T. viride, giving rise to growth inhibition of about 68% in each case. When T. viride non-volatile metabolites were tested against the pathogens, maximum inhibition occurred against R. solani (73.95% mycelial growth inhibition), followed by P. exigua (37.17% inhibition). The inhibitory effect of the non-volatile metabolites on F. nygamai was, however, minimal. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Parasites and pathogens of ticks ( Rhipicephalus species Acari ...

    African Journals Online (AJOL)

    The interaction of ticks with its environment as well as its natural hosts predisposes it to acquiring pathogens that could pose animal and human health risks. Identifying these pathogens could alert dog owners and others to reassess the predisposing factors and ensure control. The aim of the study was to identify the species ...

  11. Biologically inspired control and modeling of (biorobotic systems and some applications of fractional calculus in mechanics

    Directory of Open Access Journals (Sweden)

    Lazarević Mihailo P.

    2013-01-01

    Full Text Available In this paper, the applications of biologically inspired modeling and control of (biomechanical (nonredundant mechanisms are presented, as well as newly obtained results of author in mechanics which are based on using fractional calculus. First, it is proposed to use biological analog-synergy due to existence of invariant features in the execution of functional motion. Second, the model of (biomechanical system may be obtained using another biological concept called distributed positioning (DP, which is based on the inertial properties and actuation of joints of considered mechanical system. In addition, it is proposed to use other biological principles such as: principle of minimum interaction, which takes a main role in hierarchical structure of control and self-adjusting principle (introduce local positive/negative feedback on control with great amplifying, which allows efficiently realization of control based on iterative natural learning. Also, new, recently obtained results of the author in the fields of stability, electroviscoelasticity, and control theory are presented which are based on using fractional calculus (FC. [Projekat Ministarstva nauke Republike Srbije, br. 35006

  12. Disease burden of foodborne pathogens in the Netherlands, 2009

    NARCIS (Netherlands)

    Havelaar, A.H.|info:eu-repo/dai/nl/072306122; Haagsma, J.A.; Mangen, M.J.J.; Kemmeren, J.M.; Verhoef, L.; Vijgen, S.M.; Wilson, M; Friesema, I.H.; Kortbeek, L.M.; van Duynhoven, Y.T.; van Pelt, W.

    2012-01-01

    To inform risk management decisions on control, prevention and surveillance of foodborne disease, the disease burden of foodborne pathogens is estimated using Disability Adjusted Life Years as a summary metric of public health. Fourteen pathogens that can be transmitted by food are included in the

  13. Comparative proteomic analysis of pathogenic and non-pathogenic strains from the swine pathogen Mycoplasma hyopneumoniae

    Directory of Open Access Journals (Sweden)

    Klein Cátia S

    2009-12-01

    Full Text Available Abstract Background Mycoplasma hyopneumoniae is a highly infectious swine pathogen and is the causative agent of enzootic pneumonia (EP. Following the previous report of a proteomic survey of the pathogenic 7448 strain of swine pathogen, Mycoplasma hyopneumoniae, we performed comparative protein profiling of three M. hyopneumoniae strains, namely the non-pathogenic J strain and the two pathogenic strains 7448 and 7422. Results In 2DE comparisons, we were able to identify differences in expression levels for 67 proteins, including the overexpression of some cytoadherence-related proteins only in the pathogenic strains. 2DE immunoblot analyses allowed the identification of differential proteolytic cleavage patterns of the P97 adhesin in the three strains. For more comprehensive protein profiling, an LC-MS/MS strategy was used. Overall, 35% of the M. hyopneumoniae genome coding capacity was covered. Partially overlapping profiles of identified proteins were observed in the strains with 81 proteins identified only in one strain and 54 proteins identified in two strains. Abundance analysis of proteins detected in more than one strain demonstrates the relative overexpression of 64 proteins, including the P97 adhesin in the pathogenic strains. Conclusions Our results indicate the physiological differences between the non-pathogenic strain, with its non-infective proliferate lifestyle, and the pathogenic strains, with its constitutive expression of adhesins, which would render the bacterium competent for adhesion and infection prior to host contact.

  14. Do biological-based strategies hold promise to biofouling control in MBRs?

    KAUST Repository

    Malaeb, Lilian; Le-Clech, Pierre; Vrouwenvelder, Johannes S.; Ayoub, George M.; Saikaly, Pascal

    2013-01-01

    . The reason for the slow advancement in successful control of biofouling is largely attributed to the complex interactions of involved biological compounds and the lack of representative-for-practice experimental approaches to evaluate potential effective

  15. Assessing the status of biological control as a management tool for suppression of invasive alien plants in South Africa

    OpenAIRE

    Zachariades, Costas; Paterson, Iain D.; Strathie, Lorraine W.; Hill, Martin P.; van Wilgen, Brian W.

    2017-01-01

    Background: Biological control of invasive alien plants (IAPs) using introduced natural enemies contributes significantly to sustained, cost-effective management of natural resources in South Africa. The status of, and prospects for, biological control is therefore integral to National Status Reports (NSRs) on Biological Invasions, the first of which is due in 2017. Objectives: Our aim was to evaluate the status of, and prospects for, biological control of IAPs in South Africa. We discuss...

  16. Systems integration of biodefense omics data for analysis of pathogen-host interactions and identification of potential targets.

    Directory of Open Access Journals (Sweden)

    Peter B McGarvey

    2009-09-01

    Full Text Available The NIAID (National Institute for Allergy and Infectious Diseases Biodefense Proteomics program aims to identify targets for potential vaccines, therapeutics, and diagnostics for agents of concern in bioterrorism, including bacterial, parasitic, and viral pathogens. The program includes seven Proteomics Research Centers, generating diverse types of pathogen-host data, including mass spectrometry, microarray transcriptional profiles, protein interactions, protein structures and biological reagents. The Biodefense Resource Center (www.proteomicsresource.org has developed a bioinformatics framework, employing a protein-centric approach to integrate and support mining and analysis of the large and heterogeneous data. Underlying this approach is a data warehouse with comprehensive protein + gene identifier and name mappings and annotations extracted from over 100 molecular databases. Value-added annotations are provided for key proteins from experimental findings using controlled vocabulary. The availability of pathogen and host omics data in an integrated framework allows global analysis of the data and comparisons across different experiments and organisms, as illustrated in several case studies presented here. (1 The identification of a hypothetical protein with differential gene and protein expressions in two host systems (mouse macrophage and human HeLa cells infected by different bacterial (Bacillus anthracis and Salmonella typhimurium and viral (orthopox pathogens suggesting that this protein can be prioritized for additional analysis and functional characterization. (2 The analysis of a vaccinia-human protein interaction network supplemented with protein accumulation levels led to the identification of human Keratin, type II cytoskeletal 4 protein as a potential therapeutic target. (3 Comparison of complete genomes from pathogenic variants coupled with experimental information on complete proteomes allowed the identification and

  17. Regulatory Proteolysis in Arabidopsis-Pathogen Interactions.

    Science.gov (United States)

    Pogány, Miklós; Dankó, Tamás; Kámán-Tóth, Evelin; Schwarczinger, Ildikó; Bozsó, Zoltán

    2015-09-24

    Approximately two and a half percent of protein coding genes in Arabidopsis encode enzymes with known or putative proteolytic activity. Proteases possess not only common housekeeping functions by recycling nonfunctional proteins. By irreversibly cleaving other proteins, they regulate crucial developmental processes and control responses to environmental changes. Regulatory proteolysis is also indispensable in interactions between plants and their microbial pathogens. Proteolytic cleavage is simultaneously used both by plant cells, to recognize and inactivate invading pathogens, and by microbes, to overcome the immune system of the plant and successfully colonize host cells. In this review, we present available results on the group of proteases in the model plant Arabidopsis thaliana whose functions in microbial pathogenesis were confirmed. Pathogen-derived proteolytic factors are also discussed when they are involved in the cleavage of host metabolites. Considering the wealth of review papers available in the field of the ubiquitin-26S proteasome system results on the ubiquitin cascade are not presented. Arabidopsis and its pathogens are conferred with abundant sets of proteases. This review compiles a list of those that are apparently involved in an interaction between the plant and its pathogens, also presenting their molecular partners when available.

  18. Biological control agent for mosquito larvae: Review on the killifish ...

    African Journals Online (AJOL)

    This review attempts to give an account on the recent advances on the killifish Aphanius dispar dispar as a biological control agent for mosquito larvae. Thirty six (36) articles of literature (scientific papers, technical and workshop reports) on this subject covering the period between 1980 and 2009 were reviewed.

  19. Targeting the C-type lectins-mediated host-pathogen interactions with dextran.

    Science.gov (United States)

    Pustylnikov, Sergey; Sagar, Divya; Jain, Pooja; Khan, Zafar K

    2014-01-01

    Dextran, the α-1,6-linked glucose polymer widely used in biology and medicine, promises new applications. Linear dextran applied as a blood plasma substitute demonstrates a high rate of biocompatibility. Dextran is present in foods, drugs, and vaccines and in most cases is applied as a biologically inert substance. In this review we analyze dextran's cellular uptake principles, receptor specificity and, therefore, its ability to interfere with pathogen-lectin interactions: a promising basis for new antimicrobial strategies. Dextran-binding receptors in humans include the DC-SIGN (dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin) family receptors: DC-SIGN (CD209) and L-SIGN (the liver and lymphatic endothelium homologue of DC-SIGN), the mannose receptor (CD206), and langerin. These receptors take part in the uptake of pathogens by dendritic cells and macrophages and may also participate in the modulation of immune responses, mostly shown to be beneficial for pathogens per se rather than host(s). It is logical to predict that owing to receptor-specific interactions, dextran or its derivatives can interfere with these immune responses and improve infection outcome. Recent data support this hypothesis. We consider dextran a promising molecule for the development of lectin-glycan interaction-blocking molecules (such as DC-SIGN inhibitors) that could be applied in the treatment of diseases including tuberculosis, influenza, hepatitis B and C, human immunodeficiency virus infection and AIDS, etc. Dextran derivatives indeed change the pathology of infections dependent on DC-SIGN and mannose receptors. Complete knowledge of specific dextran-lectin interactions may also be important for development of future dextran applications in biological research and medicine.

  20. Insect-plant-pathogen interactions as shaped by future climate: effects on biology, distribution, and implications for agriculture.

    Science.gov (United States)

    Trębicki, Piotr; Dáder, Beatriz; Vassiliadis, Simone; Fereres, Alberto

    2017-12-01

    Carbon dioxide (CO 2 ) is the main anthropogenic gas which has drastically increased since the industrial revolution, and current concentrations are projected to double by the end of this century. As a consequence, elevated CO 2 is expected to alter the earths' climate, increase global temperatures and change weather patterns. This is likely to have both direct and indirect impacts on plants, insect pests, plant pathogens and their distribution, and is therefore problematic for the security of future food production. This review summarizes the latest findings and highlights current knowledge gaps regarding the influence of climate change on insect, plant and pathogen interactions with an emphasis on agriculture and food production. Direct effects of climate change, including increased CO 2 concentration, temperature, patterns of rainfall and severe weather events that impact insects (namely vectors of plant pathogens) are discussed. Elevated CO 2 and temperature, together with plant pathogen infection, can considerably change plant biochemistry and therefore plant defense responses. This can have substantial consequences on insect fecundity, feeding rates, survival, population size, and dispersal. Generally, changes in host plant quality due to elevated CO 2 (e.g., carbon to nitrogen ratios in C3 plants) negatively affect insect pests. However, compensatory feeding, increased population size and distribution have also been reported for some agricultural insect pests. This underlines the importance of additional research on more targeted, individual insect-plant scenarios at specific locations to fully understand the impact of a changing climate on insect-plant-pathogen interactions. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  1. Reevaluation of the value of autoparasitoids in biological control.

    Directory of Open Access Journals (Sweden)

    Lian-Sheng Zang

    Full Text Available Autoparasitoids with the capacity of consuming primary parasitoids that share the same hosts to produce males are analogous to intraguild predators. The use of autoparasitoids in biological control programs is a controversial matter because there is little evidence to support the view that autoparasitoids do not disrupt and at times may promote suppression of insect pests in combination with primary parasitoids. We found that Encarsia sophia, a facultative autoparasitoid, preferred to use heterospecific hosts as secondary hosts for producing males. The autoparasitoids mated with males originated from heterospecifics may parasitize more hosts than those mated with males from conspecifics. Provided with an adequate number of males, the autoparasitoids killed more hosts than En. formosa, a commonly used parasitoid for biological control of whiteflies. This study supports the view that autoparasitoids in combination with primary parasitoids do not disrupt pest management and may enhance such programs. The demonstrated preference of an autoparasitoid for heterospecifics and improved performance of males from heterospecifics observed in this study suggests these criteria should be considered in strategies that endeavor to mass-produce and utilize autoparasitoids in the future.

  2. Biology and Water Pollution Control.

    Science.gov (United States)

    Warren, Charles E.

    Within this text, the reader is attuned to the role biology can and should play in combating the alarming increase in water pollution. Both the urgency of the problem and the biological techniques that are being developed to cope with the water pollution crisis are scrutinized; what is and is not known about the problem is explained; past,…

  3. Biologically Inspired Modular Neural Control for a Leg-Wheel Hybrid Robot

    DEFF Research Database (Denmark)

    Manoonpong, Poramate; Wörgötter, Florentin; Laksanacharoen, Pudit

    2014-01-01

    In this article we present modular neural control for a leg-wheel hybrid robot consisting of three legs with omnidirectional wheels. This neural control has four main modules having their functional origin in biological neural systems. A minimal recurrent control (MRC) module is for sensory signal...... processing and state memorization. Its outputs drive two front wheels while the rear wheel is controlled through a velocity regulating network (VRN) module. In parallel, a neural oscillator network module serves as a central pattern generator (CPG) controls leg movements for sidestepping. Stepping directions...... or they can serve as useful modules for other module-based neural control applications....

  4. Production of cross-kingdom oxylipins by pathogenic fungi: An update on their role in development and pathogenicity.

    Science.gov (United States)

    Fischer, Gregory J; Keller, Nancy P

    2016-03-01

    Oxylipins are a class of molecules derived from the incorporation of oxygen into polyunsaturated fatty acid substrates through the action of oxygenases. While extensively investigated in the context of mammalian immune responses, over the last decade it has become apparent that oxylipins are a common means of communication among and between plants, animals, and fungi to control development and alter host-microbe interactions. In fungi, some oxylipins are derived nonenzymatically while others are produced by lipoxygenases, cyclooxygenases, and monooxygenases with homology to plant and human enzymes. Recent investigations of numerous plant and human fungal pathogens have revealed oxylipins to be involved in the establishment and progression of disease. This review highlights oxylipin production by pathogenic fungi and their role in fungal development and pathogen/host interactions.

  5. Studies on bacterial flora and biological control agent of Cydia ...

    African Journals Online (AJOL)

    In the present study, in order to find a more effective and safe biological control agent against Cydia pomonella, we investigated the bacterial flora and tested them for insecticidal effects on this insect. According to morphological, physiological and biochemical tests, bacterial flora were identified as Proteus rettgeri (Cp1), ...

  6. The perception of corn farmers about biological control of Caradrina ...

    African Journals Online (AJOL)

    The purpose of this study was to analyze the perception of corn farmers about biological control of Caradrina by Braconid in Dezful Township, Khouzestan Province, Iran. The method used in this study was correlative descriptive and causal relation. A random sample of Dezful township corn farmers of Khouzestan Province, ...

  7. Sources and basic threats of biological safety

    International Nuclear Information System (INIS)

    Nazarova, O.D.

    2010-01-01

    Full text: Biological safety of any state is connected with development of its public protection against biological weapons and opportunity to prevent bio terrorist attacks. That's why in modern social-economic and geo-political conditions, the problem of biological safety strengthening become significant, which is connected with migration process globalization, development of bio-technology and dramatically increased risk of pathogenic germ infections proliferation, which can be used as biological weapon. Despite of undertaken efforts by world community on full prohibition of biological weapon, its proliferation in the world still takes place. Biology revolution during second and third millennium lead to development not only biotechnology but new achievements in medicine, agriculture and other fields of economy, but also created scientific and research preconditions for development of advanced biological means of mass destruction, that make it more attractive for achieving superiority and assigned targets: low developments costs, opportunity to create it by one small laboratory with two-three high qualified specialists bio technologists; tremendous impact effect: one substance gram can contain from one till one hundreds quintillions (10"1"8 - 10"2"0) active pathogen molecules and in case if they belong to amplificated RNA and DNA, each molecule getting to organism, will multiply and contaminate environment (the last one is its principal difference from chemical weapon); bypass of organism immunological barriers and specific vaccinations; unusual clinic finding, hard diagnosis; weakness of traditional medications and treatment methods; lack of material destruction; opportunity of tight-lipped developments; opportunity of tight-lipped application; opportunity of delayed effect; opportunity of selective influence on specific population (by use of genetic, climatic and cultural specifications of race, nations and nationalities). Above mentioned specifications create

  8. Evaluation of biologic occupational risk control practices: quality indicators development and validation.

    Science.gov (United States)

    Takahashi, Renata Ferreira; Gryschek, Anna Luíza F P L; Izumi Nichiata, Lúcia Yasuko; Lacerda, Rúbia Aparecida; Ciosak, Suely Itsuko; Gir, Elucir; Padoveze, Maria Clara

    2010-05-01

    There is growing demand for the adoption of qualification systems for health care practices. This study is aimed at describing the development and validation of indicators for evaluation of biologic occupational risk control programs. The study involved 3 stages: (1) setting up a research team, (2) development of indicators, and (3) validation of the indicators by a team of specialists recruited to validate each attribute of the developed indicators. The content validation method was used for the validation, and a psychometric scale was developed for the specialists' assessment. A consensus technique was used, and every attribute that obtained a Content Validity Index of at least 0.75 was approved. Eight indicators were developed for the evaluation of the biologic occupational risk prevention program, with emphasis on accidents caused by sharp instruments and occupational tuberculosis prevention. The indicators included evaluation of the structure, process, and results at the prevention and biologic risk control levels. The majority of indicators achieved a favorable consensus regarding all validated attributes. The developed indicators were considered validated, and the method used for construction and validation proved to be effective. Copyright (c) 2010 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

  9. Wrecked regulation of intrinsically disordered proteins in diseases: Pathogenicity of deregulated regulators

    Directory of Open Access Journals (Sweden)

    Vladimir N. Uversky

    2014-07-01

    Full Text Available Biologically active proteins without stable tertiary structure are common in all known proteomes. Functions of these intrinsically disordered proteins (IDPs are typically related to regulation, signaling and control. Cellular levels of these important regulators are tightly regulated by a variety mechanisms ranging from firmly controlled expression to precisely targeted degradation. Functions of IDPs are controlled by binding to specific partners, alternative splicing, and posttranslational modifications among other means. In the norm, right amounts of precisely activated IDPs have to be present in right time at right places. Wrecked regulation brings havoc to the ordered world of disordered proteins, leading to protein misfolding, misidentification, and missignaling that give rise to numerous human diseases, such as cancer, cardiovascular disease, neurodegenerative diseases, and diabetes. Among factors inducing pathogenic transformations of IDPs are various cellular mechanisms, such as chromosomal translocations, damaged splicing, altered expression, frustrated posttranslational modifications, aberrant proteolytic degradation, and defective trafficking. This review presents some of the aspects of deregulated regulation of IDPs leading to human diseases.

  10. Microfluidic devices for sample preparation and rapid detection of foodborne pathogens.

    Science.gov (United States)

    Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy; Ngo, Tien Anh; Chidambara, Vinayaka Aaydha; Than, Linh Quyen; Bang, Dang Duong; Wolff, Anders

    2018-03-10

    Rapid detection of foodborne pathogens at an early stage is imperative for preventing the outbreak of foodborne diseases, known as serious threats to human health. Conventional bacterial culturing methods for foodborne pathogen detection are time consuming, laborious, and with poor pathogen diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices for online monitoring of pathogens with high accuracy and sensitivity in a time-saving and cost effective manner. Lab on chip is a blooming area in diagnosis, which exploits different mechanical and biological techniques to detect very low concentrations of pathogens in food samples. This is achieved through streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods and food production line. Copyright © 2018. Published by Elsevier Inc.

  11. Fecundity compensation and tolerance to a sterilizing pathogen in Daphnia.

    Science.gov (United States)

    Vale, P F; Little, T J

    2012-09-01

    Hosts are armed with several lines of defence in the battle against parasites: they may prevent the establishment of infection, reduce parasite growth once infected or persevere through mechanisms that reduce the damage caused by infection, called tolerance. Studies on tolerance in animals have focused on mortality, and sterility tolerance has not been investigated experimentally. Here, we tested for genetic variation in the multiple steps of defence when the invertebrate Daphnia magna is infected with the sterilizing bacterial pathogen Pasteuria ramosa: anti-infection resistance, anti-growth resistance and the ability to tolerate sterilization once infected. When exposed to nine doses of a genetically diverse pathogen inoculum, six host genotypes varied in their average susceptibility to infection and in their parasite loads once infected. How host fecundity changed with increasing parasite loads did not vary between genotypes, indicating that there was no genetic variation for this measure of fecundity tolerance. However, genotypes differed in their level of fecundity compensation under infection, and we discuss how, by increasing host fitness without targeting parasite densities, fecundity compensation is consistent with the functional definition of tolerance. Such infection-induced life-history shifts are not traditionally considered to be part of the immune response, but may crucially reduce harm (in terms of fitness loss) caused by disease, and are a distinct source of selection on pathogens. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  12. The role and control of sludge age in biological nutrient removal activated sludge systems.

    Science.gov (United States)

    Ekama, G A

    2010-01-01

    The sludge age is the most fundamental and important parameter in the design, operation and control of biological nutrient removal (BNR) activated sludge (AS) systems. Generally, the better the effluent and waste sludge quality required from the system, the longer the sludge age, the larger the biological reactor and the more wastewater characteristics need to be known. Controlling the reactor concentration does not control sludge age, only the mass of sludge in the system. When nitrification is a requirement, sludge age control becomes a requirement and the secondary settling tanks can no longer serve the dual purpose of clarifier and waste activated sludge thickeners. The easiest and most practical way to control sludge age is with hydraulic control by wasting a defined proportion of the reactor volume daily. In AS plants with reactor concentration control, nitrification fails first. With hydraulic control of sludge age, nitrification will not fail, rather the plant fails by shedding solids over the secondary settling tank effluent weirs.

  13. High hydrostatic pressure and biology: a brief history.

    Science.gov (United States)

    Demazeau, Gérard; Rivalain, Nolwennig

    2011-03-01

    Pressure as a thermodynamical parameter was successively introduced in physics, hydrometallurgy, geochemistry, and biology. In all cases, the main objective was to recreate a natural phenomenon (gas or liquid compressibility, synthesis or crystal growth of minerals, survival of deep sea microorganisms…). The introduction of high hydrostatic pressure (HHP) in Biology was an important scientific feature over the last hundred years. This paper describes the different steps that have led to the spreading of pressure in biology and the opening of new frontiers either in basic and applied researches due to the specific characteristics of the pressure parameter. Because of the low energy conveyed by this parameter, leading to the preservation of most organoleptic properties of foods, and its ability to inactivate many pathogens, the use of HHP began to spread at the end of the twentieth century into the food industry, in particular for the development of pathogen inactivation processes. Today, even if this field is still the first application domain for HHP, more and more research works have shown that this parameter could be of great interest in health and medicine sciences.

  14. Differential physiological responses of dalmatian toadflax, Linaria dalmatica L. Miller, to injury from two insect biological control agents: Implications for decision-making in biological control

    Science.gov (United States)

    Robert K. D. Peterson; Sharlene E. Sing; David K. Weaver

    2005-01-01

    Successful biological control of invasive weeds with specialist herbivorous insects is predicated on the assumption that the injury stresses the weeds sufficiently to cause reductions in individual fitness. Because plant gas exchange directly impacts growth and fitness, characterizing how injury affects these primary processes may provide a key indicator of...

  15. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  16. Fate of pathogens and micro-pollutants during organic wastes and by-products anaerobic digestion - a review; Etat des connaissances sur le devenir des germes pathogenes et des micropolluants au cours de la methanisation des dechets et sous-produits organiques

    Energy Technology Data Exchange (ETDEWEB)

    Couturier, Ch.; Galtier, L.

    1998-09-01

    Based on 300 scientific papers, the following bibliographical research deals with the fate of micro-pollutants (pathogens, heavy metals, organic pollutants) during anaerobic digestion. Different biological and chemical mechanisms allow organic compounds elimination, except from some Polycyclic Aromatic Hydrocarbons (PAHs) and heavy metals which are fixed to the solid biomass, permitting water contamination risks attenuation. Unlike mesophilic digestion, thermophilic digestion is a 'sanitation' process regarding pathogens elimination. However, mesophilic digestion offers an important reliability compared with competitive or complementary processes. In particular, energy recovery from anaerobic digestion allows temperature control and makes easier further sanitation heat treatments. In general, anaerobic digestion represents a tool which can be included in an organic waste treatment line assuming waste selection and good agricultural practices. Otherwise, sanitation problem is still badly handled by waste operators and constructors which have been consulted. Research orientations seem especially interesting in improving knowledge of real industrial processes performances. (author)

  17. Comparative genomic analysis of multiple strains of two unusual plant pathogens: Pseudomonas corrugata and Pseudomonas mediterranea

    Directory of Open Access Journals (Sweden)

    Emmanouil A Trantas

    2015-08-01

    Full Text Available The non-fluorescent pseudomonads, Pseudomonas corrugata (Pcor and P. mediterranea (Pmed, are closely related species that cause pith necrosis, a disease of tomato that causes severe crop losses. However, they also show strong antagonistic effects against economically important pathogens, demonstrating their potential for utilization as biological control agents. In addition, their metabolic versatility makes them attractive for the production of commercial biomolecules and bioremediation. An extensive comparative genomics study is required to dissect the mechanisms that Pcor and Pmed employ to cause disease, prevent disease caused by other pathogens, and to mine their genomes for commercially significant chemical pathways. Here, we present the draft genomes of nine Pcor and Pmed strains from different geographical locations. This analysis covered significant genetic heterogeneity and allowed in-depth genomic comparison. All examined strains were able to trigger symptoms in tomato plants but not all induced a hypersensitive-like response in Nicotiana benthamiana. Genome-mining revealed the absence of a type III secretion system and of known type III effectors from all examined Pcor and Pmed strains. The lack of a type III secretion system appears to be unique among the plant pathogenic pseudomonads. Several gene clusters coding for type VI secretion system were detected in all genomes.

  18. Functional Redundancy and Ecological Innovation Shape the Circulation of Tick-Transmitted Pathogens

    Directory of Open Access Journals (Sweden)

    Agustín Estrada-Peña

    2017-05-01

    Full Text Available Ticks are vectors of pathogens affecting human and animal health worldwide. Nevertheless, the ecological and evolutionary interactions between ticks, hosts, and pathogens are largely unknown. Here, we integrated a framework to evaluate the associations of the tick Ixodes ricinus with its hosts and environmental niches that impact pathogen circulation. The analysis of tick-hosts association suggested that mammals and lizards were the ancestral hosts of this tick species, and that a leap to Aves occurred around 120 M years ago. The signature of the environmental variables over the host's phylogeny revealed the existence of two clades of vertebrates diverging along a temperature and vegetation split. This is a robust proof that the tick probably experienced a colonization of new niches by adapting to a large set of new hosts, Aves. Interestingly, the colonization of Aves as hosts did not increase significantly the ecological niche of I. ricinus, but remarkably Aves are super-spreaders of pathogens. The disparate contribution of Aves to the tick-host-pathogen networks revealed that I. ricinus evolved to maximize habitat overlap with some hosts that are super-spreaders of pathogens. These results supported the hypothesis that large host networks are not a requirement of tick survival but pathogen circulation. The biological cost of tick adaptation to non-optimal environmental conditions might be balanced by molecular mechanisms triggered by the pathogens that we have only begun to understand.

  19. Foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Thomas Bintsis

    2017-06-01

    Full Text Available Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy. The characteristics of the most common pathogenic bacteria (Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium perfringens, Cronobacter sakazakii, Esherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Staphylococccus aureus, Vibrio spp. and Yersinia enterocolitica, viruses (Hepatitis A and Noroviruses and parasites (Cyclospora cayetanensis, Toxoplasma gondii and Trichinella spiralis, together with some important outbreaks, are reviewed. Food safety management systems based on to classical hazard-based approach has been proved to be inefficient, and risk-based food safety approach is now suggested from leading researchers and organizations. In this context, a food safety management system should be designed in a way to estimate the risks to human health from food consumption and to identify, select and implement mitigation strategies in order to control and reduce these risks. In addition, the application of suitable food safety education programs for all involved people in the production and consumption of foods is suggested.

  20. Plant Responses to Pathogen Attack: Small RNAs in Focus.

    Science.gov (United States)

    Islam, Waqar; Noman, Ali; Qasim, Muhammad; Wang, Liande

    2018-02-08

    Small RNAs (sRNA) are a significant group of gene expression regulators for multiple biological processes in eukaryotes. In plants, many sRNA silencing pathways produce extensive array of sRNAs with specialized roles. The evidence on record advocates for the functions of sRNAs during plant microbe interactions. Host sRNAs are reckoned as mandatory elements of plant defense. sRNAs involved in plant defense processes via different pathways include both short interfering RNA (siRNA) and microRNA (miRNA) that actively regulate immunity in response to pathogenic attack via tackling pathogen-associated molecular patterns (PAMPs) and other effectors. In response to pathogen attack, plants protect themselves with the help of sRNA-dependent immune systems. That sRNA-mediated plant defense responses play a role during infections is an established fact. However, the regulations of several sRNAs still need extensive research. In this review, we discussed the topical advancements and findings relevant to pathogen attack and plant defense mediated by sRNAs. We attempted to point out diverse sRNAs as key defenders in plant systems. It is hoped that sRNAs would be exploited as a mainstream player to achieve food security by tackling different plant diseases.