WorldWideScience

Sample records for biological control pathogen

  1. BIOLOGICAL CONTROL OF WEEDS BY MEANS OF PLANT PATHOGENS

    Directory of Open Access Journals (Sweden)

    Marija Ravlić

    2014-06-01

    Full Text Available Biological control is the use of live beneficial organisms and products of their metabolism in the pests control. Plant pathogens can be used for weed control in three different ways: as classical, conservation and augmentative (inoculative and inundated biological control. Inundated biological control involves the use of bioherbicides (mycoherbicides or artificial breeding of pathogens and application in specific stages of crops and weeds. Biological control of weeds can be used where chemical herbicides are not allowed, if resistant weed species are present or in the integrated pest management against weeds with reduced herbicides doses and other non-chemical measures, but it has certain limitations and disadvantages.

  2. Pathogen refuge: a key to understanding biological control.

    Science.gov (United States)

    Johnson, Kenneth B

    2010-01-01

    Pathogen refuge is the idea that some potentially infectious pathogen propagules are not susceptible to the influence of an antagonistic microbial agent. The existence of a refuge can be attributable to one or more factors, including temporal, spatial, structural, and probabilistic, or to the pathogen's evolved ability to acquire antagonist-free space prior to ingress into a plant host. Within a specific pathosystem, refuge size can be estimated in experiments by measuring the proportion of pathogen propagules that remain infective as a function of the amount of antagonist introduced to the system. Refuge size is influenced by qualities of specific antagonists and by environment but less so by the quantity of antagonist. Consequently, most efforts to improve and optimize biological control are in essence efforts to reduce refuge size. Antagonist mixtures, optimal timing of antagonist introductions, integrated biological and chemical control, environmental optimization, and the utilization of disarmed pathogens as antagonists are strategies with potential to minimize a pathogen refuge.

  3. Biological control of livestock pests: Pathogens

    Science.gov (United States)

    Interest in biological methods for livestock and poultry pest management is largely motivated by the development of resistance to most of the available synthetic pesticides by the major pests. There also has been a marked increase in organic systems, and those that promote animal welfare by reducing...

  4. Identification of Bacillus Strains for Biological Control of Catfish Pathogens

    Science.gov (United States)

    Ran, Chao; Carrias, Abel; Williams, Malachi A.; Capps, Nancy; Dan, Bui C. T.; Newton, Joseph C.; Kloepper, Joseph W.; Ooi, Ei L.; Browdy, Craig L.; Terhune, Jeffery S.; Liles, Mark R.

    2012-01-01

    Bacillus strains isolated from soil or channel catfish intestine were screened for their antagonism against Edwardsiella ictaluri and Aeromonas hydrophila, the causative agents of enteric septicemia of catfish (ESC) and motile aeromonad septicaemia (MAS), respectively. Twenty one strains were selected and their antagonistic activity against other aquatic pathogens was also tested. Each of the top 21 strains expressed antagonistic activity against multiple aquatic bacterial pathogens including Edwardsiella tarda, Streptococcus iniae, Yersinia ruckeri, Flavobacterium columnare, and/or the oomycete Saprolegnia ferax. Survival of the 21 Bacillus strains in the intestine of catfish was determined as Bacillus CFU/g of intestinal tissue of catfish after feeding Bacillus spore-supplemented feed for seven days followed by normal feed for three days. Five Bacillus strains that showed good antimicrobial activity and intestinal survival were incorporated into feed in spore form at a dose of 8×107 CFU/g and fed to channel catfish for 14 days before they were challenged by E. ictaluri in replicate. Two Bacillus subtilis strains conferred significant benefit in reducing catfish mortality (PBacillus strains also showed protective effects against E. ictaluri in striped catfish. Safety of the four strains exhibiting the strongest biological control in vivo was also investigated in terms of whether the strains contain plasmids or express resistance to clinically important antibiotics. The Bacillus strains identified from this study have good potential to mediate disease control as probiotic feed additives for catfish aquaculture. PMID:23029244

  5. Identification of Bacillus strains for biological control of catfish pathogens.

    Science.gov (United States)

    Ran, Chao; Carrias, Abel; Williams, Malachi A; Capps, Nancy; Dan, Bui C T; Newton, Joseph C; Kloepper, Joseph W; Ooi, Ei L; Browdy, Craig L; Terhune, Jeffery S; Liles, Mark R

    2012-01-01

    Bacillus strains isolated from soil or channel catfish intestine were screened for their antagonism against Edwardsiella ictaluri and Aeromonas hydrophila, the causative agents of enteric septicemia of catfish (ESC) and motile aeromonad septicaemia (MAS), respectively. Twenty one strains were selected and their antagonistic activity against other aquatic pathogens was also tested. Each of the top 21 strains expressed antagonistic activity against multiple aquatic bacterial pathogens including Edwardsiella tarda, Streptococcus iniae, Yersinia ruckeri, Flavobacterium columnare, and/or the oomycete Saprolegnia ferax. Survival of the 21 Bacillus strains in the intestine of catfish was determined as Bacillus CFU/g of intestinal tissue of catfish after feeding Bacillus spore-supplemented feed for seven days followed by normal feed for three days. Five Bacillus strains that showed good antimicrobial activity and intestinal survival were incorporated into feed in spore form at a dose of 8×10(7) CFU/g and fed to channel catfish for 14 days before they were challenged by E. ictaluri in replicate. Two Bacillus subtilis strains conferred significant benefit in reducing catfish mortality (PBacillus strains also showed protective effects against E. ictaluri in striped catfish. Safety of the four strains exhibiting the strongest biological control in vivo was also investigated in terms of whether the strains contain plasmids or express resistance to clinically important antibiotics. The Bacillus strains identified from this study have good potential to mediate disease control as probiotic feed additives for catfish aquaculture.

  6. Insect pathogens as biological control agents: Back to the future.

    Science.gov (United States)

    Lacey, L A; Grzywacz, D; Shapiro-Ilan, D I; Frutos, R; Brownbridge, M; Goettel, M S

    2015-11-01

    The development and use of entomopathogens as classical, conservation and augmentative biological control agents have included a number of successes and some setbacks in the past 1years. In this forum paper we present current information on development, use and future directions of insect-specific viruses, bacteria, fungi and nematodes as components of integrated pest management strategies for control of arthropod pests of crops, forests, urban habitats, and insects of medical and veterinary importance. Insect pathogenic viruses are a fruitful source of microbial control agents (MCAs), particularly for the control of lepidopteran pests. Most research is focused on the baculoviruses, important pathogens of some globally important pests for which control has become difficult due to either pesticide resistance or pressure to reduce pesticide residues. Baculoviruses are accepted as safe, readily mass produced, highly pathogenic and easily formulated and applied control agents. New baculovirus products are appearing in many countries and gaining an increased market share. However, the absence of a practical in vitro mass production system, generally higher production costs, limited post application persistence, slow rate of kill and high host specificity currently contribute to restricted use in pest control. Overcoming these limitations are key research areas for which progress could open up use of insect viruses to much larger markets. A small number of entomopathogenic bacteria have been commercially developed for control of insect pests. These include several Bacillus thuringiensis sub-species, Lysinibacillus (Bacillus) sphaericus, Paenibacillus spp. and Serratia entomophila. B. thuringiensis sub-species kurstaki is the most widely used for control of pest insects of crops and forests, and B. thuringiensis sub-species israelensis and L. sphaericus are the primary pathogens used for control of medically important pests including dipteran vectors. These pathogens

  7. A theoretical framework for biological control of soil-borne plant pathogens: Identifying effective strategies.

    Science.gov (United States)

    Cunniffe, Nik J; Gilligan, Christopher A

    2011-06-07

    We develop and analyse a flexible compartmental model of the interaction between a plant host, a soil-borne pathogen and a microbial antagonist, for use in optimising biological control. By extracting invasion and persistence thresholds of host, pathogen and biological control agent, performing an equilibrium analysis, and numerical investigation of sensitivity to parameters and initial conditions, we determine criteria for successful biological control. We identify conditions for biological control (i) to prevent a pathogen entering a system, (ii) to eradicate a pathogen that is already present and, if that is not possible, (iii) to reduce the density of the pathogen. Control depends upon the epidemiology of the pathogen and how efficiently the antagonist can colonise particular habitats (i.e. healthy tissue, infected tissue and/or soil-borne inoculum). A sharp transition between totally effective control (i.e. eradication of the pathogen) and totally ineffective control can follow slight changes in biologically interpretable parameters or to the initial amounts of pathogen and biological control agent present. Effective biological control requires careful matching of antagonists to pathosystems. For preventative/eradicative control, antagonists must colonise susceptible hosts. However, for reduction in disease prevalence, the range of habitat is less important than the antagonist's bulking-up efficiency. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Potential of Fungal Pathogens for Biological Control of Water Hyacinth

    African Journals Online (AJOL)

    ... fungal pathogens associated with water hyacinth. Several potential pathogen isolates including Alternaria eichhorniae, Cercospora sp. and Acremonium zonatum were identified. Isolates of Cercospora sp. and A. eichhorniae were evaluated for their effectiveness on water hyacinth plants in the screen bouse. The disease ...

  9. The possible usage of mycoviruses in biological control against tree pathogenic fungi

    Directory of Open Access Journals (Sweden)

    Ayşe Gülden Aday Kaya

    2015-01-01

    Full Text Available Mycoviruses in many organism including plant pathogenic fungi. They are mostly spread intracellularly via asexual and sexual reproduction of the fungi and cause some changes on them. Although many mycoviruses have no clear effect on their hosts, there are also many reports that they cause some phenotypic chances. Especially, they have effect on plant pathogenic fungi by increasing or decreasing their virulence. When they reduce the virulence of the host like in Chestnut canker sample, it is possible to use them in biological control. In this review, mycoviruses detected on some important fungal pathogens of forest trees both in our country and world were introduced and the studies carried out were summarized.

  10. Entomopathogenic fungi as biological controllers: New insights into their virulence and pathogenicity

    Directory of Open Access Journals (Sweden)

    Shahid Ali Ahmad

    2012-01-01

    Full Text Available Entomopathogenic fungi vary considerably in their mode of action and virulence. Successful infection depends primarily on the adherence and penetration ability of a fungus to the host integuments. A variety of extracellular enzymes is produced during the degradation of insect integument. The attempts to control insects have changed over time from chemicals to natural control methods. This is why the development of natural methods of insect control or biopesticides, is preferred. By the use of fungal entomopathogens, insect pests can be controlled. There is no doubt that insects have been used for many years, but their effective use in the field remains elusive. However, their additional role in nature has also been discovered. Comparison of entomopathogens with conventional chemical pesticides depends on their efficiency and cost. In addition to efficiency, there are advantages in using microbial control agents, such as human safety and other non-target organisms; pesticide residues are minimized in food and biodiversity increased in managed ecosystems. In the present review the pathogenicity and virulence of entomopathogenic fungi and their role as biological control agents using biotechnology will be discussed.

  11. Stepwise screening of microorganisms for commercial use in biological control of plant pathogenic fungi and bacteria. Biological Control

    NARCIS (Netherlands)

    Köhl, J.; Postma, J.; Nicot, P.; Ruocco, M.

    2011-01-01

    The development of new biocontrol products against plant diseases requires screening of high numbers of candidate antagonists. Antagonists for commercial use have to fulfill many different requirements. Besides being active against the specific targeted plant pathogens they must be safe and

  12. Management of plant pathogens and pests using microbial biological control agents. In: Trigiano, R.N. and Ownley, B.H., editors. Plant Pathology Concepts and Laboratory Exercises

    Science.gov (United States)

    All parts of plants face continual attack by plant pathogens and insects. Some insects are vectors of pathogens. Plant pests can be controlled by a variety of methods including application of pesticides but one of the most stainable and environmentally friendly approaches is biological control. Mic...

  13. Candida albicans - Biology, molecular characterization, pathogenicity, and advances in diagnosis and control - An update.

    Science.gov (United States)

    Dadar, Maryam; Tiwari, Ruchi; Karthik, Kumaragurubaran; Chakraborty, Sandip; Shahali, Youcef; Dhama, Kuldeep

    2018-04-01

    Candida albicans is an emerging multidrug-resistant fungal pathogen representing an important source of invasive disease in humans and generating high healthcare costs worldwide. This fungus is frequently found in different anatomical sites of healthy persons and could induce systemic and superficial infections under optimal environmental conditions. Invasive candidiasis (IC) is an important nosocomial infection with high morbidity and mortality rates in hospitalized children. It represents a major source of prolonged infections in intensive care unit (ICU), particularly in immunosuppressed or elderly patients. Clinical diagnosis of candidiasis could be difficult because of the lack of specific symptoms and clinical signs. Although C. albicans is the most frequently isolated Candida species in IC, non-albicans Candida (NAC) species are also commonly detected. Multilocus enzyme electrophoresis (MLEE), fragment length polymorphism (RFLP), electrophoretic karyotyping (EK), and random amplified polymorphic DNA (RAPD), multilocus sequence typing (MLST) are known as an efficient technique used for molecular typing of Candida species. The efficacy of antifungal treatment against candidiasis has been evaluated and discussed in the context of large epidemiological studies. The present review highlights the etiology, epidemiology, molecular typing, commensalism and virulence factors, along with the appropriate prevention and control strategies regarding this widespread pathogen. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Evaluation of a New Biological Control Pathogen for Management of Eurasian Watermilfoil

    Science.gov (United States)

    2013-06-01

    ness of a potential fungal pathogen in managing the nuisance submersed plant Eurasian watermilfoil. INTRODUCTION: Myriophyllum spicatum L. (Eurasian...to be grown three weeks rather than the usual two. Toxin production may be a factor in plant disease development (Agrios 2005). Myrothecium roridum...spicatum, by a fungal pathogen and a herbicide. J. Aquat. Plant Manage. 26:12-17. Taneja, N. K., S. Raj, and P. K. Seth. 1990. Existence of

  15. Effcacy of different biological control agents against major postharvest pathogens of grapes under room temperature storage conditions

    Directory of Open Access Journals (Sweden)

    Ramu SENTHIL

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 Grapes were treated post harvest with a variety of biological agents to determine their effcacy in reducing yield loss. The agents Pseudomonas, Bacillus, Trichoderma and yeast isolates were individually screened against a number of postharvest pathogens including Aspergillus carbonarius, Penicillum expansum, and Fusarium moniliforme. B. subtilis strains EPC-8 and EPCO-16 showed high mycelial growth suppression of A. carbonarius and P. expansum  in vitro. The fungal antagonist Trichoderma viride strain (Tv Tvm was the most effective, inhibiting mycelial growth by 88.8 per cent. The biological control agents were tested in pre, post and combined inoculation studies against postharvest pathogens of grapes.  In the pre inoculation, B. subtilis (EPC-8 reduced the disease incidence of A. carbonarius causing rot, T. harzianum (Th Co was effective against P. expansum, and T. viride (Tv Tvm was effective against F. moniliforme. The same trend of effectiveness was also found in the post-inoculation and combined inoculation tests.

  16. Isolation and characterization of soil Streptomyces species as potential biological control agents against fungal plant pathogens.

    Science.gov (United States)

    Evangelista-Martínez, Zahaed

    2014-05-01

    The use of antagonist microorganisms against fungal plant pathogens is an attractive and ecologically alternative to the use of chemical pesticides. Streptomyces are beneficial soil bacteria and potential candidates for biocontrol agents. This study reports the isolation, characterization and antagonist activity of soil streptomycetes from the Los Petenes Biosphere Reserve, a Natural protected area in Campeche, Mexico. The results showed morphological, physiological and biochemical characterization of six actinomycetes and their inhibitory activity against Curvularia sp., Aspergillus niger, Helminthosporium sp. and Fusarium sp. One isolate, identified as Streptomyces sp. CACIS-1.16CA showed the potential to inhibit additional pathogens as Alternaria sp., Phytophthora capsici, Colletotrichum sp. and Rhizoctonia sp. with percentages ranging from 47 to 90 %. This study identified a streptomycete strain with a broad antagonist activity that could be used for biocontrol of plant pathogenic fungi.

  17. Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control.

    Science.gov (United States)

    Churchill, Alice C L

    2011-05-01

    Banana (Musa spp.) is grown throughout the tropical and subtropical regions of the world. The fruits are a key staple food in many developing countries and a source of income for subsistence farmers. Bananas are also a major, multibillion-dollar export commodity for consumption primarily in developed countries, where few banana cultivars are grown. The fungal pathogen Mycosphaerella fijiensis causes black leaf streak disease (BLSD; aka black Sigatoka leaf spot) on the majority of edible banana cultivars grown worldwide. The fact that most of these cultivars are sterile and unsuitable for the breeding of resistant lines necessitates the extensive use of fungicides as the primary means of disease control. BLSD is a significant threat to the food security of resource-poor populations who cannot afford fungicides, and increases the environmental and health hazards where large-acreage monocultures of banana (Cavendish subgroup, AAA genome) are grown for export. Mycosphaerella fijiensis M. Morelet is a sexual, heterothallic fungus having Pseudocercospora fijiensis (M. Morelet) Deighton as the anamorph stage. It is a haploid, hemibiotrophic ascomycete within the class Dothideomycetes, order Capnodiales and family Mycosphaerellaceae. Its taxonomic placement is based on DNA phylogeny, morphological analyses and cultural characteristics. Mycosphaerella fijiensis is a leaf pathogen that causes reddish-brown streaks running parallel to the leaf veins, which aggregate to form larger, dark-brown to black compound streaks. These streaks eventually form fusiform or elliptical lesions that coalesce, form a water-soaked border with a yellow halo and, eventually, merge to cause extensive leaf necrosis. The disease does not kill the plants immediately, but weakens them by decreasing the photosynthetic capacity of leaves, causing a reduction in the quantity and quality of fruit, and inducing the premature ripening of fruit harvested from infected plants. Although Musa spp. are the

  18. Fungal pathogens of Miconia calvescens (Melastomataceae) from Brazil, with reference to classical biological control.

    Science.gov (United States)

    Seixas, Claudine D S; Barreto, Robert W; Killgore, Eloise

    2007-01-01

    A survey of fungal pathogens of Miconia calvescens was carried out in Brazil aimed at finding potential classical biocontrol agents for management of this invasive alien weed in Hawaii. Coccodiella miconiae, Glomerella cingulata (= Colletotrichum gloeosporioides f. sp. miconiae) and the new species Guignardia miconiae and Korunomyces prostratus were found associated with foliar diseases and are described herein. Two previously undescribed spore stages of Coccodiella miconiae also were obtained allowing a complete description of this species. Pseudocercospora tamonae associated with leaf spots of other species of Miconia also was collected and also was proven to be pathogenic to M. calvescens.

  19. Aflatoxins and food pathogens: impact of biologically active aflatoxins and their control strategies.

    Science.gov (United States)

    Umesha, Sharanaiah; Manukumar, Honnayakanahalli Marichenne Gowda; Chandrasekhar, Bhadvelu; Shivakumara, Prahlad; Shiva Kumar, Jayanna; Raghava, Sri; Avinash, Prakasha; Shirin, Marahel; Bharathi, Tumkur R; Rajini, Sollepura B; Nandhini, Murali; Vinaya Rani, Govinda Gowda; Shobha, Mohankumar; Prakash, Harishchandra S

    2017-04-01

    Globally disease outbreaks as a result of the consumption of contaminated food and feedstuffs are a regular primary problem. The foremost elements contributing to contamination are microorganisms, particularly fungi, which produce low-molecular weight secondary metabolites, with demonstrated toxic properties that are referred to as mycotoxins. Aflatoxins contaminate agricultural commodities and may cause sickness or fatality in humans and animals. Moreover, poor conditions of storage and a deficiency in regulatory measures in food quality control aggravate the main issue. For that reason, mycotoxin-related illness of nutrition represents a major health hazard for local populations. Government policies should make regulations aiming to avoid the entry of aflatoxins into food stuffs. For consumer safety, control and management strategies should be developed and implemented by regulatory authorities. There is the need for attention from farmers, scientists, government and collaborative minds throughout the country to ensure aflatoxin-free food. The present review is informative not only for health-conscious consumers, but also for relevant authorities with respect to paving the way for future research aiming to fill the existing gaps in our knowledge with regard to mycotoxins and food security. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  20. Effcacy of different biological control agents against major postharvest pathogens of grapes under room temperature storage conditions

    OpenAIRE

    Ramu SENTHIL; Kuppusamy PRABAKAR; Lingan RAJENDRAN; Gandhi KARTHIKEYAN

    2011-01-01

    Grapes were treated post harvest with a variety of biological agents to determine their effcacy in reducing yield loss. The agents Pseudomonas, Bacillus, Trichoderma and yeast isolates were individually screened against a number of postharvest pathogens including Aspergillus carbonarius, Penicillum expansum, and Fusarium moniliforme. B. subtilis strains EPC-8 and EPCO-16 showed high mycelial growth suppression of A. carbonarius and P. expansum  in vitro. The fungal antagonist Trichoder...

  1. STUDY OF MICROBIAL DIVERSITY OF FUNGAL COMMUNITIES FROM RHIZOSPHERE AND PHYLOSPHERE OF STRAWBERRY TREATED WITH CHEMICAL AND BIOLOGICAL AGENTS FOR THE CONTROL OF PATHOGENS

    OpenAIRE

    Gabi-Mirela Matei; S. Matei

    2011-01-01

    The negative impact of long term utilization of pesticides on yields quality, as well as on the human health made scientific community to seek new ways, less expensive and environmental friendly for protecting cultivated plants against pathogens. Biological control agents of microbial origin represented by living selected strains or their metabolites are more and more frequently utilized for protecting horticultural plants intensely consumed by European population, such as strawberry. A green...

  2. IRIDOID GLYCOSIDES FROM LINARIA GENISTIFOLIA (L. MILL. IN BIOLOGICAL CONTROL OF SOIL-BORNE FUNGAL PATHOGENS OF WHEAT AND SOME STRUCTURE CONSIDERATIONS

    Directory of Open Access Journals (Sweden)

    Natalia Mashcenko

    2015-06-01

    Full Text Available Biological activity of the iridoid glycosides extract from Linaria genistifolia (L. Mill. has been investigated, namely its influence on the resistance of the winter wheat Odesschi 51 plant to the caused by the Fusarium oxysporum and Helminthosporium avenae pathogenic fungi root rot. Our results indicate that summary iridoid glycosides from this plant, containing four major known compounds: 5-O-allosylantirrinoside, antirrinoside, linarioside and 6-β-hidroxiantirride, can be successfully employed in biological control of the afore-mentioned wheat pathogens: it stimulates wheat grains germination and embryonic root growth in conditions of fungal infection. 1H and 13C NMR characteristics of 5-O-allosylantirrinoside in Py-d5 are for the first time presented. Structures of two conformers of 5-O-allosylantirrinoside in D2O and Py-d5 solutions are proposed, based on the experimental NMR evidence and molecular modelling studies.

  3. STUDY OF MICROBIAL DIVERSITY OF FUNGAL COMMUNITIES FROM RHIZOSPHERE AND PHYLOSPHERE OF STRAWBERRY TREATED WITH CHEMICAL AND BIOLOGICAL AGENTS FOR THE CONTROL OF PATHOGENS

    Directory of Open Access Journals (Sweden)

    Gabi-Mirela Matei

    2011-12-01

    Full Text Available The negative impact of long term utilization of pesticides on yields quality, as well as on the human health made scientific community to seek new ways, less expensive and environmental friendly for protecting cultivated plants against pathogens. Biological control agents of microbial origin represented by living selected strains or their metabolites are more and more frequently utilized for protecting horticultural plants intensely consumed by European population, such as strawberry. A green house experiment was designed to compare the structure of rhizospheric and phylospheric microflora of strawberry cv. Senga Sengana, sensible to Botrytis cinerea (the agent of grey mould treated with systemic and contact fungicides, as well as with four biological control preparations of microbial origin administrated on plant leaves or in the soil. The structure of fungal communities in rhizosphere and phylosphere of strawberry cv. Senga Sengana varied as a function of the nature of control agent and the method of administration. Non significant influence on soil fungal community diversity index and species number was registered after the treatment with chemical and biological control agents, but significant increments were induced in time by control agents as compared with both non-treated control and chemical pesticides. Fungal community structure from strawberry leaves was not significantly influenced by chemical and biological control agents. The most favourable influence on fungal communities registered for bio-control agents E1 and E2 due to

  4. Biological control of strawberry soil-borne pathogens Macrophomina phaseolina and Fusarium solani, using Trichoderma asperellum and Bacillus spp.

    Directory of Open Access Journals (Sweden)

    Ana María PASTRANA

    2016-05-01

    Full Text Available In south-western Spain, Macrophomina phaseolina and Fusarium solani were found to be associated in strawberry plants with, respectively, charcoal rot, and crown and root rot symptoms. For management of both fungal diseases, the antagonistic effects of two commercial formulations, one based on Trichoderma asperellum T18 strain (Prodigy® and the other on Bacillus megaterium and B. laterosporus (Fusbact®, were evaluated in vitro and under controlled environment and field conditions. Two inoculation methods (root-dipping and soil application and two application times (pre- and post-pathogen inoculation, as preventive and curative treatments, respectively were assessed. Dual plate confrontation experiments demonstrated the antagonistic effects of T. asperellum and Bacillus spp. by inhibiting radial growth of M. phaseolina and F. solani by more than 36%. Preventive application of T. asperellum by root-dipping reduced the incidence of charcoal rot (up to 44% in a growth chamber and up to 65% under field conditions and also reduced disease progression, the percentage of crown necrosis, as well as the level of infection measured as ng of pathogen DNA g-1 plant by quantitative real-time PCR. This treatment was also the most effective for reduction of crown and root rot caused by F. solani (up to 100% in a greenhouse and up to 81% under field conditions. These results were nearly comparable with the control achieved using chemical fungicides. The Bacillus spp.-based formulation was also effective for control of charcoal rot and showed variable results for control of F. solani, depending on the growth conditions.

  5. Effects of Simplicillium lanosoniveum on Phakopsora pachyrhizi, the soybean rust pathogen, and its use as a biological control agent.

    Science.gov (United States)

    Ward, N A; Robertson, C L; Chanda, A K; Schneider, R W

    2012-08-01

    The fungus Simplicillium lanosoniveum was isolated from soybean leaves infected with Phakopsora pachyrhizi, the soybean rust pathogen, in Louisiana and Florida. The fungus did not grow or become established on leaf surfaces until uredinia erupted, but when soybean rust signs and symptoms were evident, S. lanosoniveum colonized leaves within 3 days and sporulated within 4 days. Development of new uredinia was suppressed by about fourfold when S. lanosoniveum colonized uredinia. In the presence of S. lanosoniveum, uredinia became increasingly red-brown, and urediniospores turned brown and germinated at very low rates. Assays using quantitative real time polymerase chain reaction revealed that the fungus colonized leaf surfaces when plants were infected with P. pachyrhizi, either in a latent stage of infection or when symptoms were present. However, when plants were inoculated before infection, there was no increase of DNA of S. lanosoniveum, suggesting that the pathogen must be present in order for the antagonist to become established on soybean leaf surfaces. We documented significantly lower amounts of DNA of P. pachyrhizi and lower disease severity when soybean leaves were colonized with S. lanosoniveum. These studies documented the mycophilic and disease-suppressive nature of S. lanosoniveum.

  6. Biological Control in Agroecosystems

    Science.gov (United States)

    Batra, Suzanne W. T.

    1982-01-01

    Living organisms are used as biological pest control agents in (i) classical biological control, primarily for permanent control of introduced perennial weed pests or introduced pests of perennial crops; (ii) augmentative biological control, for temporary control of native or introduced pests of annual crops grown in monoculture; and (iii) conservative or natural control, in which the agroecosystem is managed to maximize the effect of native or introduced biological control agents. The effectiveness of biological control can be improved if it is based on adequate ecological information and theory, and if it is integrated with other pest management practices.

  7. Biological control of the cucurbit powdery mildew pathogen Podosphaera xanthii by means of the epiphytic fungus Pseudozyma aphidis and parasitism as a mode of action

    Directory of Open Access Journals (Sweden)

    Aviva eGafni

    2015-03-01

    Full Text Available Epiphytic yeasts, which colonize plant surfaces, may possess activity that can be harnessed to help plants defend themselves against various pathogens. Due to their unique characteristics, epiphytic yeasts belonging to the genus Pseudozyma hold great potential for use as biocontrol agents. We identified a unique, biologically active isolate of the epiphytic yeast Pseudozyma aphidis that is capable of inhibiting Botrytis cinerea via a dual mode of action, namely induced resistance and antibiosis. Here, we show that strain L12 of P. aphidis can reduce the severity of powdery mildew caused by Podosphaera xanthii on cucumber plants with an efficacy of 75%. Confocal and scanning electron microscopy analyses demonstrated P. aphidis proliferation on infected tissue and its production of long hyphae that parasitize the powdery mildew hyphae and spores as an ectoparasite. We also show that crude extract of P. aphidis metabolites can inhibit P. xanthii spore germination in planta. Our results suggest that in addition to its antibiosis mode of action, P. aphidis may also act as an ectoparasite on P. xanthii. These results indicate that P. aphidis strain L12 has the potential to control powdery mildew.

  8. Evolutionary biology of bacterial and fungal pathogens

    National Research Council Canada - National Science Library

    Cassell, Gail H; Gutierrez-Fuentes, Jose A; Barquero, Fernando; Nombela, Cesar

    2008-01-01

    ... and Evolutionary Dynamics of Pathogens * 21 Keith A. Crandall and Marcos Pérez-Losada II. Evolutionary Genetics of Microbial Pathogens 4. Environmental and Social Influences on Infectious Disea...

  9. Integrated Biological Control

    International Nuclear Information System (INIS)

    JOHNSON, A.R.

    2002-01-01

    Biological control is any activity taken to prevent, limit, clean up, or remediate potential environmental, health and safety, or workplace quality impacts from plants, animals, or microorganisms. At Hanford the principal emphasis of biological control is to prevent the transport of radioactive contamination by biological vectors (plants, animals, or microorganisms), and where necessary, control and clean up resulting contamination. Other aspects of biological control at Hanford include industrial weed control (e.g.; tumbleweeds), noxious weed control (invasive, non-native plant species), and pest control (undesirable animals such as rodents and stinging insects; and microorganisms such as molds that adversely affect the quality of the workplace environment). Biological control activities may be either preventive (apriori) or in response to existing contamination spread (aposteriori). Surveillance activities, including ground, vegetation, flying insect, and other surveys, and apriori control actions, such as herbicide spraying and placing biological barriers, are important in preventing radioactive contamination spread. If surveillance discovers that biological vectors have spread radioactive contamination, aposteriori control measures, such as fixing contamination, followed by cleanup and removal of the contamination to an approved disposal location are typical response functions. In some cases remediation following the contamination cleanup and removal is necessary. Biological control activities for industrial weeds, noxious weeds and pests have similar modes of prevention and response

  10. Insecticides and Biological Control

    Science.gov (United States)

    Furness, G. O.

    1972-01-01

    Use of insecticides has been questioned due to their harmful effects on edible items. Biological control of insects along with other effective practices for checking spread of parasites on crops are discussed. (PS)

  11. Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests.

    Science.gov (United States)

    Cassells, Alan C

    2012-01-01

    The ability to establish and grow plant cell, organ, and tissue cultures has been widely exploited for basic and applied research, and for the commercial production of plants (micro-propagation). Regardless of whether the application is for research or commerce, it is essential that the cultures be established in vitro free of biological contamination and be maintained as aseptic cultures during manipulation, growth, and storage. The risks from microbial contamination are spurious experimental results due to the effects of latent contaminants or losses of valuable experimental or commercial cultures. Much of the emphasis in culture contamination management historically focussed on the elimination of phytopathogens and the maintenance of cultures free from laboratory contamination by environmental bacteria, fungi (collectively referred to as "vitro pathogens", i.e. pathogens or environmental micro-organisms which cause culture losses), and micro-arthropods ("vitro pests"). Microbial contamination of plant tissue cultures is due to the high nutrient availability in the almost universally used Murashige and Skoog (Physiol Plant 15:473-497, 1962) basal medium or variants of it. In recent years, it has been shown that many plants, especially perennials, are at least locally endophytically colonized intercellularly by bacteria. The latter, and intracellular pathogenic bacteria and viruses/viroids, may pass latently into culture and be spread horizontally and vertically in cultures. Growth of some potentially cultivable endophytes may be suppressed by the high salt and sugar content of the Murashige and Skoog basal medium and suboptimal temperatures for their growth in plant tissue growth rooms. The management of contamination in tissue culture involves three stages: disease screening (syn. disease indexing) of the stock plants with disease and endophyte elimination where detected; establishment and pathogen and contaminant screening of established initial cultures

  12. Prevention and control strategies for ticks and pathogen transmission.

    Science.gov (United States)

    de La Fuente, J; Kocan, K M; Contreras, M

    2015-04-01

    Ticks and tick-borne pathogens have evolved together, resulting in a complex relationship in which the pathogen's life cycle is perfectly coordinated with the tick's feeding cycle, and the tick can harbour high pathogen levels without affecting its biology. Tick-borne diseases (TBDs) continue to emerge and/or spread, and pose an increasing threatto human and animal health. The disruptive impacts of global change have resulted in ecosystem instability and the future outcomes of management and control programmes for ticks and TBDs are difficult to predict. In particular, the selection of acaricide-resistant ticks has reduced the value of acaricides as a sole means of tick control. Vaccines provide an alternative control method, but the use of tick vaccines has not advanced since the first vaccines were registered in the early 1990s. An understanding of the complex molecular relationship between hosts, ticks and pathogens and the use of systems biology and vaccinomics approaches are needed to discover proteins with the relevant biological function in tick feeding, reproduction, development, immune response, the subversion of host immunity and pathogen transmission, all of which mediate tick and pathogen success. The same approaches will also be required to characterise candidate protective antigens and to validate vaccine formulations. Tick vaccines with a dual effect on tick infestations and pathogen transmission could reduce both tick infestations and their vector capacity for humans, animals and reservoir hosts. The development of integrated tick control strategies, including vaccines and synthetic and botanical acaricides, in combination with managing drug resistance and educating producers, should lead to the sustainable control of ticks and TBDs.

  13. Assessment of the relevance of the antibiotic 2-amino-3-(oxirane-2,3-dicarboxamido)-propanoyl-valine from Pantoea agglomerans biological control strains against bacterial plant pathogens.

    Science.gov (United States)

    Sammer, Ulrike F; Reiher, Katharina; Spiteller, Dieter; Wensing, Annette; Völksch, Beate

    2012-12-01

    The epiphyte Pantoea agglomerans 48b/90 (Pa48b) is a promising biocontrol strain against economically important bacterial pathogens such as Erwinia amylovora. Strain Pa48b produces the broad-spectrum antibiotic 2-amino-3-(oxirane-2,3-dicarboxamido)-propanoyl-valine (APV) in a temperature-dependent manner. An APV-negative mutant still suppressed the E. amylovora population and fire blight disease symptoms in apple blossom experiments under greenhouse conditions, but was inferior to the Pa48b wild-type indicating the influence of APV in the antagonism. In plant experiments with the soybean pathogen Pseudomonas syringae pv. glycinea both, Pa48b and the APV-negative mutant, successfully suppressed the pathogen. Our results demonstrate that the P. agglomerans strain Pa48b is an efficient biocontrol organism against plant pathogens, and we prove its ability for fast colonization of plant surfaces over a wide temperature range. © 2012 The Authors. Published by Blackwell Publishing Ltd.

  14. Endophytic fungi harbored inPanax notoginseng: diversity and potential as biological control agents against host plant pathogens of root-rot disease.

    Science.gov (United States)

    Zheng, You-Kun; Miao, Cui-Ping; Chen, Hua-Hong; Huang, Fang-Fang; Xia, Yu-Mei; Chen, You-Wei; Zhao, Li-Xing

    2017-07-01

    Endophytic fungi play an important role in balancing the ecosystem and boosting host growth. In the present study, we investigated the endophytic fungal diversity of healthy Panax notoginseng and evaluated its potential antimicrobial activity against five major phytopathogens causing root-rot of P. notoginseng . A culture-dependent technique, combining morphological and molecular methods, was used to analyze endophytic fungal diversity. A double-layer agar technique was used to challenge the phytopathogens of P. notoginseng . A total of 89 fungi were obtained from the roots, stems, leaves, and seeds of P. notoginseng , and 41 isolates representing different morphotypes were selected for taxonomic characterization. The fungal isolates belonged to Ascomycota (96.6%) and Zygomycota (3.4%). All isolates were classified to 23 genera and an unknown taxon belonging to Sordariomycetes. The number of isolates obtained from different tissues ranged from 12 to 42 for leaves and roots, respectively. The selected endophytic fungal isolates were challenged by the root-rot pathogens Alternaria panax , Fusarium oxysporum , Fusarium solani , Phoma herbarum , and Mycocentrospora acerina. Twenty-six of the 41 isolates (63.4%) exhibited activity against at least one of the pathogens tested. Our results suggested that P. notoginseng harbors diversified endophytic fungi that would provide a basis for the identification of new bioactive compounds, and for effective biocontrol of notoginseng root rot.

  15. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2009-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  16. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2010-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  17. Biological Control of Plant Disease Caused by Bacteria

    Directory of Open Access Journals (Sweden)

    Triwidodo Arwiyanto

    2014-07-01

    Full Text Available Bacterial diseases in plants are difficult to control. The emphasis is on preventing the spread of the bacteria rather than curing the diseased plant. Integrated management measures for bacterial plant pathogens should be applied for successfull control. Biological control is one of the control measures viz. through the use of microorganisms to suppress the growth and development of bacterial plant pathogen and ultimately reduce the possibility of disease onset. The study of biological control of bacterial plant pathogen was just began compared with of fungal plant pathogen. The ecological nature of diverse bacterial plant pathogens has led scientists to apply different approach in the investigation of its biological control. The complex process of entrance to its host plant for certain soil-borne bacterial plant pathogens need special techniques and combination of more than one biological control agent. Problem and progress in controlling bacterial plant pathogens biologically will be discussed in more detail in the paper and some commercial products of biological control agents (biopesticides will be introduced.     Penyakit tumbuhan karena bakteri sulit dikendalikan. Penekanan pengendalian adalah pada pencegahan penyebaran bakteri patogen dan bukan pada penyembuhan tanaman yang sudah sakit. Untuk suksesnya pengendalian bakteri patogen tumbuhan diperlukan cara pengelolaan yang terpadu. Pengendalian secara biologi merupakan salah satu cara pengendalian dengan menggunakan mikroorganisme untuk menekan pertumbuhan dan perkembangan bakteri patogen tumbuhan dengan tujuan akhir menurunkan kemungkinan timbulnya penyakit. Sifat ekologi bakteri patogen tumbuhan yang berbeda-beda mengharuskan pendekatan yang berbeda pula dalam pengendaliannya secara biologi. Masalah dan perkembangan dalam pengendalian bakteri patogen tumbuhan secara biologi didiskusikan secara detail dalam makalah ini.

  18. OSHA Bloodborne Pathogens Standards Exposure Control Plan

    Science.gov (United States)

    Luhrs, Caro Elise; Teitelbaum, Rita

    1993-01-01

    The Hummer Associates Exposure Control Plan is designed to reduce significant occupational exposure to bloodborne pathogens and infectious materials for Hummer Associates health care personnel. Under universal precautions, all patients and all body fluids are considered potentially infectious for bloodborne pathogens. Medical personnel need not be at increased risk if universal precautions are correctly understood and followed. This program covers all employees who could reasonably anticipate contact with blood or other potentially infectious materials during the performance of their job responsibilities. Although HIV and hepatitis B are mentioned most often, this program applies to all bloodborne diseases. The two main components needed to implement this program are universal precautions and engineering/work practice controls. This program covers all employees who may have occupational exposure to blood or other potentially infectious materials. Other aspects of this program are discussed.

  19. Biological control of toxic cyanobacteria

    CSIR Research Space (South Africa)

    Ndlela, L

    2016-04-01

    Full Text Available harmful algal blooms and their impacts in over 30 countries. Biological control is a method of introducing natural enemies to control an organism and has been more successful using microorganisms....

  20. Biological Control in Brazil: an overview

    Directory of Open Access Journals (Sweden)

    José Roberto Postali Parra

    2014-10-01

    Full Text Available The use of Biological Control methods is on the increase, mainly as a result of the mobilization of human resources in entomology studies since the establishment of graduate programs in this country in the 1960s. This review approaches the retrospective of Biological Control in Brazil in recent decades, with an emphasis on the "culture of applying agrochemicals" adopted by Brazilian growers, which constrains progress in this area. Successful cases of Biological Control have been reported on in Brazil and there are, in fact, excellent programs in place that use insects or entomopathogenic microrganisms for insect pest control. Most of the studies in this area have been published in Portuguese and are, therefore, not readily available internationally. Importantly, half of the planted sugarcane (Saccharum officinarum, around four million hectares, is treated with natural enemies (insects and/or pathogens. In contrast to other countries that employ Biological Control in small areas, the challenge in Brazil is to implement programs in large farms. Many obstacles must be overcome and discussed in working groups so that we can assume a world leadership position in the use of Biological Control in tropical regions as Brazil is already considered the leader in tropical agriculture. In this review, use of Biological Control is discussed within the Integrated Pest Management philosophy, as a path toward sustainable agriculture that is in harmony with other pest control methods. We must develop a technology of Biological Control adapted to tropical regions, rather than copying models developed for temperate regions, which are usually inappropriate for Brazilian conditions.

  1. Bacteriophages in the control of pathogenic vibrios

    Directory of Open Access Journals (Sweden)

    Nicolás Plaza

    2018-01-01

    Full Text Available Vibrios are common inhabitants of marine and estuarine environments. Some of them can be pathogenic to humans and/or marine animals using a broad repertory of virulence factors. Lately, several reports have indicated that the incidence of Vibrio infections in humans is rising and also in animals constitute a continuing threat for aquaculture. Moreover, the continuous use of antibiotics has been accompanied by an emergence of antibiotic resistance in Vibrio species, implying a necessity for efficient treatments. One promising alternative that emerges is the use of lytic bacteriophages; however, there are some drawbacks that should be overcome to make phage therapy a widely accepted method. In this work, we discuss about the major pathogenic Vibrio species and the progress, benefits and disadvantages that have been detected during the experimental use of bacteriophages to their control.

  2. Sporothrix schenckii complex biology: environment and fungal pathogenicity.

    Science.gov (United States)

    Téllez, M D; Batista-Duharte, A; Portuondo, D; Quinello, C; Bonne-Hernández, R; Carlos, I Z

    2014-11-01

    Sporothrix schenckii is a complex of various species of fungus found in soils, plants, decaying vegetables and other outdoor environments. It is the aetiological agent of sporotrichosis in humans and several animals. Humans and animals can acquire the disease through traumatic inoculation of the fungus into subcutaneous tissue. Despite the importance of sporotrichosis, it being currently regarded as an emergent disease in several countries, the factors driving its increasing medical importance are still largely unknown. There have only been a few studies addressing the influence of the environment on the virulence of these pathogens. However, recent studies have demonstrated that adverse conditions in its natural habitats can trigger the expression of different virulence factors that confer survival advantages both in animal hosts and in the environment. In this review, we provide updates on the important advances in the understanding of the biology of Spor. schenckii and the modification of its virulence linked to demonstrated or putative environmental factors. © 2014 The Authors.

  3. Structure and Biological Activity of Pathogen-like Synthetic Nanomedicines

    Science.gov (United States)

    Lőrincz, Orsolya; Tőke, Enikő R.; Somogyi, Eszter; Horkay, Ferenc; Chandran, Preethi; Douglas, Jack F.; Szebeni, János; Lisziewicz, Julianna

    2011-01-01

    Here we characterize the structure, stability and intracellular mode-of-action of DermaVir nanomedicine that is under clinical development for the treatment of HIV/AIDS. This nanomedicine is comprised of pathogen-like pDNA/PEIm nanoparticles (NPs) having the structure and function resembling spherical viruses that naturally evolved to deliver nucleic acids to the cells. Atomic force microscopy demonstrated spherical 100–200nm NPs with a smooth polymer surface protecting the pDNA in the core. Optical-absorption determined both the NP structural stability and biological activity relevant to their ability to escape from the endosome and release the pDNA at the nucleus. Salt, pH and temperature influence the nanomedicine shelf-life and intracellular stability. This approach facilitates the development of diverse polyplex nanomedicines where the delivered pDNA-expressed antigens induce immune responses to kill infected cells. PMID:21839051

  4. Control of indigenous pathogenic bacteria in seafood

    DEFF Research Database (Denmark)

    Huss, Hans Henrik

    1997-01-01

    of disease, are used to place the various seafood products in risk categories and to identify areas of concern. It is concluded that the presence of pathogens in molluscs and the growth of Listeria monocytogenes in lightly preserved fish products are hazards which are presently not under control. In order...... to prevent growth and toxin production by Clostridium botulinum when products are stored at abuse temperature, it is recommended that additional barriers to growth are included in lightly preserved (e.g. cold smoked salmon) and low-heat treated (e.g REPFEDS) products. It is finally pointed out...

  5. Bacteriophages in the control of pathogenic vibrios

    DEFF Research Database (Denmark)

    Plaza, Nicolás; Castillo Bermúdez, Daniel Elías; Perez-Reytor, Diliana

    2018-01-01

    constitute a continuing threat for aquaculture. Moreover, the continuous use of antibiotics has been accompanied by an emergence of antibiotic resistance in Vibrio species, implying a necessity for efficient treatments. One promising alternative that emerges is the use of lytic bacteriophages; however......, there are some drawbacks that should be overcome to make phage therapy a widely accepted method. In this work, we discuss about the major pathogenic Vibrio species and the progress, benefits and disadvantages that have been detected during the experimental use of bacteriophages to their control....

  6. TNF biology, pathogenic mechanisms and emerging therapeutic strategies

    Science.gov (United States)

    Kalliolias, George D.; Ivashkiv, Lionel B.

    2016-01-01

    TNF is a pleiotropic cytokine with important functions in homeostasis and disease pathogenesis. Recent discoveries have provided insights into TNF biology that introduce new concepts for the development of therapeutics for TNF-mediated diseases. The model of TNF receptor signalling has been extended to include linear ubiquitination and the formation of distinct signalling complexes that are linked with different functional outcomes, such as inflammation, apoptosis and necroptosis. Our understanding of TNF-induced gene expression has been enriched by the discovery of epigenetic mechanisms and concepts related to cellular priming, tolerization and induction of ‘short-term transcriptional memory’. Identification of distinct homeostatic or pathogenic TNF-induced signalling pathways has introduced the concept of selectively inhibiting the deleterious effects of TNF while preserving its homeostatic bioactivities for therapeutic purposes. In this Review, we present molecular mechanisms underlying the roles of TNF in homeostasis and inflammatory disease pathogenesis, and discuss novel strategies to advance therapeutic paradigms for the treatment of TNF-mediated diseases. PMID:26656660

  7. Non- chemical methods of seed treatment for control of seed- borne pathogens on vegetables

    NARCIS (Netherlands)

    Amein, T.; Wright, S.A.I.; Wickstrom, M.; Schmitt, A.; Koch, E.; Wolf, van der J.M.; Groot, S.P.C.; Werner, S.; Jahn, M.

    2006-01-01

    The aim of EU-project "Seed Treatments for Organic Vegetable Production" (STOVE) was to evaluate non-chemical methods for control of seed-borne pathogens in organic vegetable production. Physical (hot air, hot water and electron) and biologi-cal (microorganisms and different agents of natural

  8. Integrating chemical and biological control

    Science.gov (United States)

    Scott Salom; Albert Mayfield; Tom McAvoy

    2011-01-01

    Research and management efforts to establish an effective biological control program against HWA has received significant support by the U.S. Forest Service over the past 17 years. Other federal and state agencies, universities, and private entities have also contributed to this overall research and management effort. Although a number of HWA-specific predator species...

  9. Control theory meets synthetic biology.

    Science.gov (United States)

    Del Vecchio, Domitilla; Dy, Aaron J; Qian, Yili

    2016-07-01

    The past several years have witnessed an increased presence of control theoretic concepts in synthetic biology. This review presents an organized summary of how these control design concepts have been applied to tackle a variety of problems faced when building synthetic biomolecular circuits in living cells. In particular, we describe success stories that demonstrate how simple or more elaborate control design methods can be used to make the behaviour of synthetic genetic circuits within a single cell or across a cell population more reliable, predictable and robust to perturbations. The description especially highlights technical challenges that uniquely arise from the need to implement control designs within a new hardware setting, along with implemented or proposed solutions. Some engineering solutions employing complex feedback control schemes are also described, which, however, still require a deeper theoretical analysis of stability, performance and robustness properties. Overall, this paper should help synthetic biologists become familiar with feedback control concepts as they can be used in their application area. At the same time, it should provide some domain knowledge to control theorists who wish to enter the rising and exciting field of synthetic biology. © 2016 The Author(s).

  10. Identifying and controlling emerging foodborne pathogens: research needs.

    OpenAIRE

    Buchanan, R. L.

    1997-01-01

    Systems for managing the risks associated with foodborne pathogens are based on detailed knowledge of the microorganisms and the foods with which they are associated--known hazards. An emerging pathogen, however, is an unknown hazard; therefore, to control it, key data must be acquired to convert the pathogen from an unknown to a known hazard. The types of information required are similar despite the identity of the new agent. The key to rapid control is rapid mobilization of research capabil...

  11. Funding needed for assessments of weed biological control

    Science.gov (United States)

    John L. Maron; Dean E. Pearson; Stephen M. Hovick; Walter P. Carson

    2010-01-01

    Invasive non-native plants are a serious economic and ecological problem worldwide, and major efforts are therefore devoted to reducing weed abundance in agricultural and natural settings. Effective options for reducing invasive abundance and spread are few, although one common approach is biological control - the introduction of specialist herbivores or pathogens from...

  12. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen

    NARCIS (Netherlands)

    Bolton, M.D.; Thomma, B.P.H.J.; Nelson, B.D.

    2006-01-01

    Sclerotinia sclerotiorum (Lib.) de Bary is a necrotrophic fungal pathogen causing disease in a wide range of plants. This review summarizes current knowledge of mechanisms employed by the fungus to parasitize its host with emphasis on biology, physiology and molecular aspects of pathogenicity. In

  13. Control of indigenous pathogenic bacteria in seafood

    DEFF Research Database (Denmark)

    Huss, Hans Henrik

    1997-01-01

    The pathogenic bacteria indigenous to the aquatic and general environment are listed. Their distribution in nature, prevalence in seafood and the possibilities for growth of these organisms in various types of products are outlined These data, combined with what is known regarding the epidemiology...

  14. Use of Bacteriophages to control bacterial pathogens

    Science.gov (United States)

    Lytic bacteriophages can provide a natural method and an effective alternative to antibiotics to reduce bacterial pathogens in animals, foods, and other environments. Bacteriophages (phages) are viruses which infect bacterial cells and eventually kill them through lysis, and represent the most abun...

  15. The Promise of Systems Biology Approaches for Revealing Host Pathogen Interactions in Malaria

    Directory of Open Access Journals (Sweden)

    Meghan Zuck

    2017-11-01

    Full Text Available Despite global eradication efforts over the past century, malaria remains a devastating public health burden, causing almost half a million deaths annually (WHO, 2016. A detailed understanding of the mechanisms that control malaria infection has been hindered by technical challenges of studying a complex parasite life cycle in multiple hosts. While many interventions targeting the parasite have been implemented, the complex biology of Plasmodium poses a major challenge, and must be addressed to enable eradication. New approaches for elucidating key host-parasite interactions, and predicting how the parasite will respond in a variety of biological settings, could dramatically enhance the efficacy and longevity of intervention strategies. The field of systems biology has developed methodologies and principles that are well poised to meet these challenges. In this review, we focus our attention on the Liver Stage of the Plasmodium lifecycle and issue a “call to arms” for using systems biology approaches to forge a new era in malaria research. These approaches will reveal insights into the complex interplay between host and pathogen, and could ultimately lead to novel intervention strategies that contribute to malaria eradication.

  16. Microbial control of root-pathogenic fungi and oomycetes

    NARCIS (Netherlands)

    Thomashow, L.S.; Bakker, P.A.H.M.

    2015-01-01

    The rhizosphere is a complex and dynamic environment in which microbes introduced to control root pathogens must establish and maintain populations of sufficient size and activity to antagonize pathogens directly or by manipulating the host plant’s own defenses. Genetic and physiological studies of

  17. Advances on plant-pathogen interactions from molecular toward systems biology perspectives.

    Science.gov (United States)

    Peyraud, Rémi; Dubiella, Ullrich; Barbacci, Adelin; Genin, Stéphane; Raffaele, Sylvain; Roby, Dominique

    2017-05-01

    In the past 2 decades, progress in molecular analyses of the plant immune system has revealed key elements of a complex response network. Current paradigms depict the interaction of pathogen-secreted molecules with host target molecules leading to the activation of multiple plant response pathways. Further research will be required to fully understand how these responses are integrated in space and time, and exploit this knowledge in agriculture. In this review, we highlight systems biology as a promising approach to reveal properties of molecular plant-pathogen interactions and predict the outcome of such interactions. We first illustrate a few key concepts in plant immunity with a network and systems biology perspective. Next, we present some basic principles of systems biology and show how they allow integrating multiomics data and predict cell phenotypes. We identify challenges for systems biology of plant-pathogen interactions, including the reconstruction of multiscale mechanistic models and the connection of host and pathogen models. Finally, we outline studies on resistance durability through the robustness of immune system networks, the identification of trade-offs between immunity and growth and in silico plant-pathogen co-evolution as exciting perspectives in the field. We conclude that the development of sophisticated models of plant diseases incorporating plant, pathogen and climate properties represent a major challenge for agriculture in the future. © 2016 The Authors. The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

  18. Biological and epidemiological aspects of the quarantine pathogen Phytophthora ramorum

    Directory of Open Access Journals (Sweden)

    Beatrice Ginetti

    2015-12-01

    Full Text Available Phytophthora ramorum is a quarantine pathogen that causes leaf blight and shoot dieback of the crown, bark cankers and death on a number of both ornamental and forest trees, especially in North America and northern Europe, where it has produced severe outbreaks.In Italy it was first reported in 2002, on Rhodondendron yakushimanum in a Piedmont nursery; after that it seemed to have disappeared, only to re-emerge in 2013 when numerous isolates were detected on batches of Viburnum tinus plants growing in some nurseries in the Pistoia area (Tuscany, which is an important district in the trade of nursery plants world-wide. This work reports on a number of laboratory tests that were carried out on isolates from infected plant samples. The micromorphological and macromorphological characteristics of the pathogen growing on carrot agar (CA, corn meal agar (CMA, malt extract agar (MEA potato dextrose agar, and V8 agar with added PARPNH (see text were determined, as was the growth rate at 10º, 15º, 20º, 25°, 30º, 32º and 35ºC. Molecular analysis was employed to identify the isolates more precisely. Inoculation trials under the bark were also carried out to ascertain the isolate virulence and the Koch’s Postulates.The Plant Protection Service of the Tuscan Region (SFR, Servizio Fitosanitario Regionale was alerted as soon as the pathogen infection was detected and it took the prescribed steps to eradicate the infection in the field and prevent the recurrence of an epidemic.

  19. "Protected biological control"- Biological pest management in the greenhouse industry

    NARCIS (Netherlands)

    Pilkington, L.J.; Messelink, G.J.; Lenteren, van J.C.; Mottee, Le K.

    2010-01-01

    This paper briefly describes the foundations and characteristics of biological control in protected cropping and what drivers are behind adoption of this management system within this industry. Examining a brief history of biological control in greenhouses and what makes it a successful management

  20. Periodontal pathogen CaZymes: host-pathogen biology, biochemistry and biotechnological exploitation

    OpenAIRE

    Stafford, Graham P.; Frey, Andrew M.; Satur, Marianne J.

    2017-01-01

    ABSTRACT One often neglected aspect of the host-pathogen interface is the presence of myriad glycoproteins and the carbohydrate glycans that they present. These are often the first point of contact for bacteria, with the oral cavity being rich in glycoprotein mucins within secretions such as saliva and crevicular fluid. Therefore, unsurprisingly, bacteria have evolved a myriad of enzymes (that one can consider virulence attributes) to access these glycans to allow attachment to host surfaces,...

  1. Leaf Rust of Wheat: Pathogen Biology, Variation and Host Resistance

    Directory of Open Access Journals (Sweden)

    James Kolmer

    2013-01-01

    Full Text Available Rusts are important pathogens of angiosperms and gymnosperms including cereal crops and forest trees. With respect to cereals, rust fungi are among the most important pathogens. Cereal rusts are heteroecious and macrocyclic requiring two taxonomically unrelated hosts to complete a five spore stage life cycle. Cereal rust fungi are highly variable for virulence and molecular polymorphism. Leaf rust, caused by Puccinia triticina is the most common rust of wheat on a worldwide basis. Many different races of P. triticina that vary for virulence to leaf rust resistance genes in wheat differential lines are found annually in the US. Molecular markers have been used to characterize rust populations in the US and worldwide. Highly virulent races of P. triticina are selected by leaf rust resistance genes in the soft red winter wheat, hard red winter wheat and hard red spring wheat cultivars that are grown in different regions of the US. Cultivars that only have race-specific leaf rust resistance genes that are effective in seedling plants lose their effective resistance and become susceptible within a few years of release. Cultivars with combinations of race non-specific resistance genes have remained resistant over a period of years even though races of the leaf rust population have changed constantly.

  2. Suitability of Commercial Transport Media for Biological Pathogens under Nonideal Conditions

    Directory of Open Access Journals (Sweden)

    Kyle Hubbard

    2011-01-01

    Full Text Available There is extensive data to support the use of commercial transport media as a stabilizer for known clinical samples; however, there is little information to support their use outside of controlled conditions specified by the manufacturer. Furthermore, there is no data to determine the suitability of said media for biological pathogens, specifically those of interest to the US military. This study evaluates commercial off-the-shelf (COTS transport media based on sample recovery, viability, and quality of nucleic acids and peptides for nonpathogenic strains of Bacillus anthracis, Yersinia pestis, and Venezuelan equine encephalitis virus, in addition to ricin toxin. Samples were stored in COTS, PBST, or no media at various temperatures over an extended test period. The results demonstrate that COTS media, although sufficient for the preservation of nucleic acid and proteinaceous material, are not capable of maintaining an accurate representation of biothreat agents at the time of collection.

  3. Serine Protease Inhibitors in Ticks: An Overview of Their Role in Tick Biology and Tick-Borne Pathogen Transmission

    Directory of Open Access Journals (Sweden)

    Adrien A. Blisnick

    2017-05-01

    Full Text Available New tick and tick-borne pathogen control approaches that are both environmentally sustainable and which provide broad protection are urgently needed. Their development, however, will rely on a greater understanding of tick biology, tick-pathogen, and tick-host interactions. The recent advances in new generation technologies to study genomes, transcriptomes, and proteomes has resulted in a plethora of tick biomacromolecular studies. Among these, many enzyme inhibitors have been described, notably serine protease inhibitors (SPIs, whose importance in various tick biological processes is only just beginning to be fully appreciated. Among the multiple active substances secreted during tick feeding, SPIs have been shown to be directly involved in regulation of inflammation, blood clotting, wound healing, vasoconstriction and the modulation of host defense mechanisms. In light of these activities, several SPIs were examined and were experimentally confirmed to facilitate tick pathogen transmission. In addition, to prevent coagulation of the ingested blood meal within the tick alimentary canal, SPIs are also involved in blood digestion and nutrient extraction from the meal. The presence of SPIs in tick hemocytes and their involvement in tick innate immune defenses have also been demonstrated, as well as their implication in hemolymph coagulation and egg development. Considering the involvement of SPIs in multiple crucial aspects of tick-host-pathogen interactions, as well as in various aspects of the tick parasitic lifestyle, these molecules represent highly suitable and attractive targets for the development of effective tick control strategies. Here we review the current knowledge regarding this class of inhibitors in tick biology and tick-borne pathogen transmission, and their potential as targets for future tick control trials.

  4. Electronic integrated disease surveillance system and pathogen asset control system.

    Science.gov (United States)

    Wahl, Tom G; Burdakov, Aleksey V; Oukharov, Andrey O; Zhilokov, Azamat K

    2012-06-20

    Electronic Integrated Disease Surveillance System (EIDSS) has been used to strengthen and support monitoring and prevention of dangerous diseases within One Health concept by integrating veterinary and human surveillance, passive and active approaches, case-based records including disease-specific clinical data based on standardised case definitions and aggregated data, laboratory data including sample tracking linked to each case and event with test results and epidemiological investigations. Information was collected and shared in secure way by different means: through the distributed nodes which are continuously synchronised amongst each other, through the web service, through the handheld devices. Electronic Integrated Disease Surveillance System provided near real time information flow that has been then disseminated to the appropriate organisations in a timely manner. It has been used for comprehensive analysis and visualisation capabilities including real time mapping of case events as these unfold enhancing decision making. Electronic Integrated Disease Surveillance System facilitated countries to comply with the IHR 2005 requirements through a data transfer module reporting diseases electronically to the World Health Organisation (WHO) data center as well as establish authorised data exchange with other electronic system using Open Architecture approach. Pathogen Asset Control System (PACS) has been used for accounting, management and control of biological agent stocks. Information on samples and strains of any kind throughout their entire lifecycle has been tracked in a comprehensive and flexible solution PACS.Both systems have been used in a combination and individually. Electronic Integrated Disease Surveillance System and PACS are currently deployed in the Republics of Kazakhstan, Georgia and Azerbaijan as a part of the Cooperative Biological Engagement Program (CBEP) sponsored by the US Defense Threat Reduction Agency (DTRA).

  5. Electronic Integrated Disease Surveillance System and Pathogen Asset Control System

    Directory of Open Access Journals (Sweden)

    Tom G. Wahl

    2012-06-01

    Full Text Available Electronic Integrated Disease Surveillance System (EIDSS has been used to strengthen and support monitoring and prevention of dangerous diseases within One Health concept by integrating veterinary and human surveillance, passive and active approaches, case-based records including disease-specific clinical data based on standardised case definitions and aggregated data, laboratory data including sample tracking linked to each case and event with test results and epidemiological investigations. Information was collected and shared in secure way by different means: through the distributed nodes which are continuously synchronised amongst each other, through the web service, through the handheld devices. Electronic Integrated Disease Surveillance System provided near real time information flow that has been then disseminated to the appropriate organisations in a timely manner. It has been used for comprehensive analysis and visualisation capabilities including real time mapping of case events as these unfold enhancing decision making. Electronic Integrated Disease Surveillance System facilitated countries to comply with the IHR 2005 requirements through a data transfer module reporting diseases electronically to the World Health Organisation (WHO data center as well as establish authorised data exchange with other electronic system using Open Architecture approach. Pathogen Asset Control System (PACS has been used for accounting, management and control of biological agent stocks. Information on samples and strains of any kind throughout their entire lifecycle has been tracked in a comprehensive and flexible solution PACS. Both systems have been used in a combination and individually. Electronic Integrated Disease Surveillance System and PACS are currently deployed in the Republics of Kazakhstan, Georgia and Azerbaijan as a part of the Cooperative Biological Engagement Program (CBEP sponsored by the US Defense Threat Reduction Agency (DTRA.

  6. Biological control and sustainable food production

    NARCIS (Netherlands)

    Bale, J.S.; Lenteren, van J.C.; Bigler, F.

    2008-01-01

    The use of biological control for the management of pest insects pre-dates the modern pesticide era. The first major successes in biological control occurred with exotic pests controlled by natural enemy species collected from the country or area of origin of the pest (classical control).

  7. Metabolic adaptation of a human pathogen during chronic infections - a systems biology approach

    DEFF Research Database (Denmark)

    Thøgersen, Juliane Charlotte

    modeling to uncover how human pathogens adapt to the human host. Pseudomonas aeruginosa infections in cystic fibrosis patients are used as a model system for under-­‐ standing these adaptation processes. The exploratory systems biology approach facilitates identification of important phenotypes...... by classical molecular biology approaches where genes and reactions typically are investigated in a one to one relationship. This thesis is an example of how mathematical approaches and modeling can facilitate new biologi-­‐ cal understanding and provide new surprising ideas to important biological processes....

  8. Quality Control Guidelines for SAM Pathogen Methods

    Science.gov (United States)

    Learn more about quality control guidelines and recommendations for the analysis of samples using the biotoxin methods listed in EPA's Selected Analytical Methods for Environmental Remediation and Recovery (SAM).

  9. Biology and Water Pollution Control.

    Science.gov (United States)

    Warren, Charles E.

    Within this text, the reader is attuned to the role biology can and should play in combating the alarming increase in water pollution. Both the urgency of the problem and the biological techniques that are being developed to cope with the water pollution crisis are scrutinized; what is and is not known about the problem is explained; past,…

  10. A Systems Biology Approach to Infectious Disease Research: Innovating the Pathogen-Host Research Paradigm

    Energy Technology Data Exchange (ETDEWEB)

    Aderem, Alan; Adkins, Joshua N.; Ansong, Charles; Galagan, James; Kaiser, Shari; Korth, Marcus J.; Law, G. L.; McDermott, Jason E.; Proll, Sean; Rosenberger, Carrie; Schoolnik, Gary; Katze, Michael G.

    2011-02-01

    The 20th century was marked by extraordinary advances in our understanding of microbes and infectious disease, but pandemics remain, food and water borne illnesses are frequent, multi-drug resistant microbes are on the rise, and the needed drugs and vaccines have not been developed. The scientific approaches of the past—including the intense focus on individual genes and proteins typical of molecular biology—have not been sufficient to address these challenges. The first decade of the 21st century has seen remarkable innovations in technology and computational methods. These new tools provide nearly comprehensive views of complex biological systems and can provide a correspondingly deeper understanding of pathogen-host interactions. To take full advantage of these innovations, the National Institute of Allergy and Infectious Diseases recently initiated the Systems Biology Program for Infectious Disease Research. As participants of the Systems Biology Program we think that the time is at hand to redefine the pathogen-host research paradigm.

  11. Meat products: main pathogens and non-thermal control strategies

    Directory of Open Access Journals (Sweden)

    Norma Heredia

    2014-12-01

    Full Text Available Meat is a rich nutrient matrix that allows the proper environment for diverse microorganisms’ proliferation, deteriorative and pathogen. E. coli O157 and non-O157, Salmonella spp. and Listeria monocytogenes are among the pathogen ones. On other hand, the growing demand for “fresh-like” products with high sanitary, organoleptic and nutritional quality had drive the development of alternative technologies to traditional or thermal, to satisfy consumers’ demand. In the last decades new food preservation techniques with no effect on nutritional or organoleptic characteristics had been developed, maintaining or improving microbiological stability and quality. This work is review of the most common pathogen microorganisms in meat and meat products, and the emerging technologies like high hydrostatic pressure, radiation, intelligent and active packages, and the use of natutal compounds for their control.

  12. Biological Systems Thinking for Control Engineering Design

    Directory of Open Access Journals (Sweden)

    D. J. Murray-Smith

    2004-01-01

    Full Text Available Artificial neural networks and genetic algorithms are often quoted in discussions about the contribution of biological systems thinking to engineering design. This paper reviews work on the neuromuscular system, a field in which biological systems thinking could make specific contributions to the development and design of automatic control systems for mechatronics and robotics applications. The paper suggests some specific areas in which a better understanding of this biological control system could be expected to contribute to control engineering design methods in the future. Particular emphasis is given to the nonlinear nature of elements within the neuromuscular system and to processes of neural signal processing, sensing and system adaptivity. Aspects of the biological system that are of particular significance for engineering control systems include sensor fusion, sensor redundancy and parallelism, together with advanced forms of signal processing for adaptive and learning control

  13. Fumigant dosages below maximum label rate control some soilborne pathogens

    Directory of Open Access Journals (Sweden)

    Shachaf Triky-Dotan

    2016-08-01

    Full Text Available The activity of commercial soil fumigants on some key soilborne pathogens was assessed in sandy loam soil under controlled conditions. Seven soil fumigants that are registered in California or are being or have been considered for registration were used in this study: dimethyl disulfide (DMDS mixed with chloropicrin (Pic (79% DMDS and 21% Pic, Tri-Con (50% methyl bromide and 50% Pic, Midas Gold (33% methyl iodide [MI] and 67% Pic, Midas Bronze (50% MI and 50% Pic, Midas (MI, active ingredient [a.i.] 97.8%, Pic (a.i. 99% trichloronitromethane and Pic-Clor 60 (57% Pic and 37% 1,3-dichloropropene [1–3,D]. Dose-response models were calculated for pathogen mortality after 24 hours of exposure to fumigants. Overall, the tested fumigants achieved good efficacy with dosages below the maximum label rate against the tested pathogens. In this study, Pythium ultimum and citrus nematode were sensitive to all the fumigants and Verticillium dahliae was resistant. For most fumigants, California regulations restrict application rates to less than the maximum (federal label rate, meaning that it is possible that the fumigants may not control major plant pathogens. This research provides information on the effectiveness of these alternatives at these lower application rates. The results from this study will help growers optimize application rates for registered fumigants (such as Pic and 1,3-D and will help accelerate the adoption of new fumigants (such as DMDS if they are registered in California.

  14. Opportunities for biological weed control in Europe

    NARCIS (Netherlands)

    Scheepens, P.C.; Müller-Schärer, H.; Kempenaar, C.

    2001-01-01

    The development and application of biological weed control offer greatopportunities not only for farmers, nature conservationists and othervegetation managers but also for institutions and companies that wish tosell plant protection services and products, and for the general publicthat demands safe

  15. Is the efficacy of biological control against plant diseases likely to be more durable than that of chemical pesticides?

    Science.gov (United States)

    Bardin, Marc; Ajouz, Sakhr; Comby, Morgane; Lopez-Ferber, Miguel; Graillot, Benoît; Siegwart, Myriam; Nicot, Philippe C.

    2015-01-01

    The durability of a control method for plant protection is defined as the persistence of its efficacy in space and time. It depends on (i) the selection pressure exerted by it on populations of plant pathogens and (ii) on the capacity of these pathogens to adapt to the control method. Erosion of effectiveness of conventional plant protection methods has been widely studied in the past. For example, apparition of resistance to chemical pesticides in plant pathogens or pests has been extensively documented. The durability of biological control has often been assumed to be higher than that of chemical control. Results concerning pest management in agricultural systems have shown that this assumption may not always be justified. Resistance of various pests to one or several toxins of Bacillus thuringiensis and apparition of resistance of the codling moth Cydia pomonella to the C. pomonella granulovirus have, for example, been described. In contrast with the situation for pests, the durability of biological control of plant diseases has hardly been studied and no scientific reports proving the loss of efficiency of biological control agents against plant pathogens in practice has been published so far. Knowledge concerning the possible erosion of effectiveness of biological control is essential to ensure a durable efficacy of biological control agents on target plant pathogens. This knowledge will result in identifying risk factors that can foster the selection of strains of plant pathogens resistant to biological control agents. It will also result in identifying types of biological control agents with lower risk of efficacy loss, i.e., modes of action of biological control agents that does not favor the selection of resistant isolates in natural populations of plant pathogens. An analysis of the scientific literature was then conducted to assess the potential for plant pathogens to become resistant to biological control agents. PMID:26284088

  16. Is the efficacy of biological control against plant diseases likely to be more durable than that of chemical pesticides?

    Directory of Open Access Journals (Sweden)

    Marc eBardin

    2015-07-01

    Full Text Available The durability of a control method for plant protection is defined as the persistence of its efficacy in space and time. It depends on (i the selection pressure exerted by it on populations of plant pathogens and (ii on the capacity of these pathogens to adapt to the control method. Erosion of effectiveness of conventional plant protection methods has been widely studied in the past. For example, apparition of resistance to chemical pesticides in plant pathogens or pests has been extensively documented. The durability of biological control has often been assumed to be higher than that of chemical control. Results concerning pest management in agricultural systems have shown that this assumption may not always be justified. Resistance of various pests to one or several toxins of Bacillus thuringensis and apparition of resistance of the codling moth Cydia pomonella to the Cydia pomonella granulovirus have, for example, been described. In contrast with the situation for pests, the durability of biological control of plant diseases has hardly been studied and no scientific reports proving the loss of efficiency of biological control agents against plant pathogens in practice has been published so far. Knowledge concerning the possible erosion of effectiveness of biological control is essential to ensure a durable efficacy of biological control agents on target plant pathogens. This knowledge will result in identifying risk factors that can foster the selection of strains of plant pathogens resistant to biological control agents. It will also result in identifying types of biological control agents with lower risk of efficacy loss i.e. modes of action of biological control agents that does not favor the selection of resistant isolates in natural populations of plant pathogens. An analysis of the scientific literature was then conducted to assess the potential for plant pathogens to become resistant to biological control agents.

  17. Factors controlling pathogen destruction during anaerobic digestion of biowastes

    International Nuclear Information System (INIS)

    Smith, S.R.; Lang, N.L.; Cheung, K.H.M.; Spanoudaki, K.

    2005-01-01

    Anaerobic digestion is the principal method of stabilising biosolids from urban wastewater treatment in the UK, and it also has application for the treatment of other types of biowaste. Increasing awareness of the potential risks to human and animal health from environmental sources of pathogens has focused attention on the efficacy of waste treatment processes at destroying pathogenic microorganisms in biowastes recycled to agricultural land. The degree of disinfection achieved by a particular anaerobic digester is influenced by a variety of interacting operational variables and conditions, which can often deviate from the ideal. Experimental investigations demonstrate that Escherichia coli and Salmonella spp. are not damaged by mesophilic temperatures, whereas rapid inactivation occurs by thermophilic digestion. A hydraulic, biokinetic and thermodynamic model of pathogen inactivation during anaerobic digestion showed that a 2 log 10 reduction in E. coli (the minimum removal required for agricultural use of conventionally treated biosolids) is likely to challenge most conventional mesophilic digesters, unless strict maintenance and management practices are adopted to minimise dead zones and by-pass flow. Efficient mixing and organic matter stabilisation are the main factors controlling the rate of inactivation under mesophilic conditions and not a direct effect of temperature per se on pathogenic organisms

  18. Use of nuclear techniques in biological control

    International Nuclear Information System (INIS)

    Greany, Patrick D.; Carpenter, James E.

    2000-01-01

    As pointed out by Benbrook (1996), pest management is at a crossroads, and there is a great need for new, biointensive pest management strategies. Among these approaches, biological control is a keystone. However, because of increasing concerns about the introduction of exotic natural enemies of insect pests and weeds (Howarth 1991, Delfosse 1997), the overall thrust of biological control has moved toward augmentative biological control, involving releases of established natural enemy species (Knipling 1992). This in turn has created a need to develop more cost-effective mass rearing technologies for beneficial insects. Nuclear techniques could play an especially important role in augmentative biological control, not only in facilitating mass rearing, but in several other ways, as indicated below. Recognising the potential value for use of nuclear techniques in biological control, the Insect and Pest Control Section of the Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, sponsored a Consultants' Group Meeting on this subject in April 1997. The Group produced a document entitled Use of Nuclear Techniques in Biological Control: Managing Pests, Facilitating Trade and Protecting the Environment. The consultants included the authors of this paper as well as Ernest Delfosse (at that time, with the USDA-APHIS National Biological Control Institute), Garry Hill (Intl. Institute for Biological Control), Sinthya Penn (Beneficial Insectary), and Felipe Jeronimo (USDA-APHIS PPQ, Guatemala). The remarks presented in this paper reflect the thoughts presented by these consultants and other participants at the IAEA-sponsored meeting. Several potential uses for nuclear techniques were identified by the Consultants' Group, including: 1) improvements in rearing media (either artificial diets or natural hosts/prey), 2) provision of sterilised natural prey to be used as food during shipment, to ameliorate concerns relating to the

  19. Biological control of livestock pests : Parasitoids

    Science.gov (United States)

    House flies, Musca domestica L., and stable flies, Stomoxys calcitrans (L.), are common pests on livestock, poultry, and equine facilities. Biological control of filth flies with pupal parasitoids can be used in conjunction with other control methods as part of an integrated fly management program. ...

  20. Gene expression platform for synthetic biology in the human pathogen Streptococcus pneumoniae.

    Science.gov (United States)

    Sorg, Robin A; Kuipers, Oscar P; Veening, Jan-Willem

    2015-03-20

    The human pathogen Streptococcus pneumoniae (pneumococcus) is a bacterium that owes its success to complex gene expression regulation patterns on both the cellular and the population level. Expression of virulence factors enables a mostly hazard-free presence of the commensal, in balance with the host and niche competitors. Under specific circumstances, changes in this expression can result in a more aggressive behavior and the reversion to the invasive form as pathogen. These triggering conditions are very difficult to study due to the fact that environmental cues are often unknown or barely possible to simulate outside the host (in vitro). An alternative way of investigating expression patterns is found in synthetic biology approaches of reconstructing regulatory networks that mimic an observed behavior with orthogonal components. Here, we created a genetic platform suitable for synthetic biology approaches in S. pneumoniae and characterized a set of standardized promoters and reporters. We show that our system allows for fast and easy cloning with the BglBrick system and that reliable and robust gene expression after integration into the S. pneumoniae genome is achieved. In addition, the cloning system was extended to allow for direct linker-based assembly of ribosome binding sites, peptide tags, and fusion proteins, and we called this new generally applicable standard "BglFusion". The gene expression platform and the methods described in this study pave the way for employing synthetic biology approaches in S. pneumoniae.

  1. Augmenting Plant Immune Responses and Biological Control by Microbial Determinants

    Directory of Open Access Journals (Sweden)

    Sang Moo Lee

    2015-09-01

    Full Text Available Plant have developed sophisticated defence mechanisms against microbial pathogens. The recent accumulated information allow us to understand the nature of plant immune responses followed by recognition of microbial factors/determinants through cutting-edge genomics and multi-omics techniques. However, the practical approaches to sustain plant health using enhancement of plant immunity is yet to be fully appreciated. Here, we overviewed the general concept and representative examples on the plant immunity. The fungal, bacterial, and viral determinants that was previously reported as the triggers of plant immune responses are introduced and described as the potential protocol of biological control. Specifically, the role of chitin, glucan, lipopolysaccharides/extracellular polysaccharides, microbe/pathogen-associated molecular pattern, antibiotics, mimic-phytohormones, N-acyl homoserine lactone, harpin, vitamins, and volatile organic compounds are considered. We hope that this review stimulates scientific community and farmers to broaden their knowledge on the microbial determinant-based biological control and to apply the technology on the integrated pest management program.

  2. Biological activity of the non-microbial fraction of kefir: antagonism against intestinal pathogens.

    Science.gov (United States)

    Iraporda, Carolina; Abatemarco Júnior, Mário; Neumann, Elisabeth; Nunes, Álvaro Cantini; Nicoli, Jacques R; Abraham, Analía G; Garrote, Graciela L

    2017-08-01

    Kefir is a fermented milk obtained by the activity of kefir grains which are composed of lactic and acetic acid bacteria, and yeasts. Many beneficial health effects have been associated with kefir consumption such as stimulation of the immune system and inhibition of pathogenic microorganisms. The biological activity of kefir may be attributed to the presence of a complex microbiota as well as the microbial metabolites that are released during fermentation. The aim of this work was to characterise the non-microbial fraction of kefir and to study its antagonism against Escherichia coli, Salmonella spp. and Bacillus cereus. During milk fermentation there was a production of organic acids, mainly lactic and acetic acid, with a consequent decrease in pH and lactose content. The non-microbial fraction of kefir added to nutrient broth at concentrations above 75% v/v induced a complete inhibition of pathogenic growth that could be ascribed to the presence of un-dissociated lactic acid. In vitro assays using an intestinal epithelial cell model indicated that pre-incubation of cells with the non-microbial fraction of kefir did not modify the association/invasion of Salmonella whereas pre-incubation of Salmonella with this fraction under conditions that did not affect their viability significantly decreased the pathogen's ability to invade epithelial cells. Lactate exerted a protective effect against Salmonella in a mouse model, demonstrating the relevance of metabolites present in the non-microbial fraction of kefir produced during milk fermentation.

  3. Evaluation of a Biological Pathogen Decontamination Protocol for Animal Feed Mills.

    Science.gov (United States)

    Huss, Anne R; Cochrane, Roger A; Deliephan, Aiswariya; Stark, Charles R; Jones, Cassandra K

    2015-09-01

    Animal feed and ingredients are potential vectors of pathogenic bacteria. Contaminated ingredients can contaminate facility equipment, leading to cross-contamination of other products. This experiment was conducted to evaluate a standardized protocol for decontamination of an animal feed manufacturing facility using Enterococcus faecium (ATCC 31282) as an indicator. A pelleted swine diet inoculated with E. faecium was manufactured, and environmental samples (swabs, replicate organism detection and counting plates, and air samples) were collected (i) before inoculation (baseline data), (ii) after production of inoculated feed, (iii) after physical removal of organic material using pressurized air, (iv) after application of a chemical sanitizer containing a quaternary ammonium-glutaraldehyde blend, (v) after application of a chemical sanitizer containing sodium hypochlorite, (vi) after facility heat-up to 60 8 C for 24 h, (vii) for 48 h, and (viii) for 72 h. Air samples collected outside the facility confirmed pathogen containment; E. faecium levels were equal to or lower than baseline levels at each sample location. The decontamination step and its associated interactions were the only variables that affected E. faecium incidence (P 0.22). After production of the inoculated diet, 85.7% of environmental samples were positive for E. faecium. Physical cleaning of equipment had no effect on contamination (P = 0.32). Chemical cleaning with a quaternary ammonium-glutaraldehyde blend and sodium hypochlorite each significantly reduced E. faecium contamination (P decontamination. These results confirmed both successful containment and decontamination of biological pathogens in the tested pilot-scale feed mill.

  4. Molecular and Biological Compatibility with Host Alpha-Synuclein Influences Fibril Pathogenicity

    Directory of Open Access Journals (Sweden)

    Kelvin C. Luk

    2016-09-01

    Full Text Available The accumulation and propagation of misfolded α-synuclein (α-Syn is a central feature of Parkinson’s disease and other synucleinopathies. Molecular compatibility between a fibrillar seed and its native protein state is a major determinant of amyloid self-replication. We show that cross-seeded aggregation of human (Hu and mouse (Ms α-Syn is bidirectionally restricted. Although fibrils formed by Hu-Ms-α-Syn chimeric mutants can overcome this inhibition in cell-free systems, sequence homology poorly predicts their efficiency in inducing α-Syn pathology in primary neurons or after intracerebral injection into wild-type mice. Chimeric α-Syn fibrils demonstrate enhanced or reduced pathogenicities compared with wild-type Hu- or Ms-α-Syn fibrils. Furthermore, α-Syn mutants induced to polymerize by fibrillar seeds inherit the functional properties of their template, suggesting that transferable pathogenic and non-pathogenic states likely influence the initial engagement between exogenous α-Syn seeds and endogenous neuronal α-Syn. Thus, transmission of synucleinopathies is regulated by biological processes in addition to molecular compatibility.

  5. Characterization and control of biological microrobots

    NARCIS (Netherlands)

    Khalil, I.S.M.; Pichel, Marc Philippe; Zondervan, L.; Abelmann, Leon; Misra, Sarthak; Desai, Jaydev P.; Dudek, Gregory; Khatib, Oussama; Kumar, Vijay

    2013-01-01

    This work addresses the characterization and control of Magnetotactic Bacterium (MTB) which can be considered as a biological microrobot. Magnetic dipole moment of the MTB and response to a field-with-alternating-direction are characterized. First, the magnetic dipole moment is characterized using

  6. Characterization and Control of Biological Microrobots

    NARCIS (Netherlands)

    Khalil, I.S.M.; Pichel, Marc Philippe; Pichel, M.P.; Zondervan, L.; Abelmann, Leon; Misra, Sarthak

    2012-01-01

    This work addresses the characterization and control of Magnetotactic Bacterium (MTB) which can be considered as a biological microrobot. Magnetic dipole moment of the MTB and response to a field-with-alternating-direction are characterized. First, the magnetic dipole moment is characterized using

  7. Biological control agents for suppression of post-harvest diseases of potatoes: strategies on discovery and development

    Science.gov (United States)

    As used in plant pathology, the term "biological control" or its short form “biocontrol” commonly refers to the decrease in the inoculum or the disease-producing activity of a pathogen accomplished through one or more organisms, including the host plant but excluding man. Biological control of plant...

  8. Biological Control of Aquatic Plants with Pathogenic Fungi

    Science.gov (United States)

    1981-01-01

    methods have not been entirely satisfactory because of cost, overall ineffectiveness, or environmental pollution . The energy problem as it relates to...canal system near Cocoa, Florida, and in Palm Beach and Broward counties. With the exception of the Palm Beach and Broward areas, all the waterways in...Marvel’ 11 Phaseolus limensis MacF.* Butter Bean, ’Henderson’ 0 NT P. limensis* Lima Bean, ’Fordhook’ 5 3 d P. limensis* Lima Bean, ’Thorogreen’ 100

  9. Biological control of necrotrophic plant pathogenic fungi: Tomato ...

    African Journals Online (AJOL)

    However, it was less effective against Phytophthora infestans (64.7 % RGI), Botrytis cinerea (58.3 % RGI), Sclerotinia sclerotiorum (57.4 % RGI) Rhizoctonia solani (42.7 % RGI). When B. subtilis was applied to Tomato field, it exhibited different efficiency in suppressing Fusarium wilt. Time of implementation was critical for ...

  10. [Biological control in the preservation of pome fruits].

    Science.gov (United States)

    Viñas, I

    1995-03-01

    Fresh fruits are susceptible of be attacked by several pathogenic fungi after harvest due to both their high water and nutrients content and their loss of most of the intrinsic resistance that protected them over their development while attached to the plant. Most rot pathogens can be controlled by various methods such as refrigeration, controlled atmospheres and fungicides. Biological control strategies are emerging as promising alternatives to the use of synthetic fungicides. Several factors must be considered for the selection of biocontrol agents to be used against postharvest fruits diseases. Survivability of the antagonist is a major factor to determine its usefulness. Antagonists must survive and be effective after their exposure to both postharvest treatments and storage conditions. Several antagonistic microorganisms have been found that can effectively inhibit postharvest diseases. Just as there is a diversity among microorganisms, there is also a diversity of mechanisms by which they operate. Although in most cases these mechanisms have not been satisfactorily elucidated, they are likely to involve antibiosis, nutrient competition, stimulation of host defense, predation and parasitism. In many cases, probably more than one mechanism operate. The marketing of some of these antagonists may be feasible and they could be an alternative to synthetic pesticides.

  11. Host–Pathogen Interactions

    NARCIS (Netherlands)

    Smits, M.A.; Schokker, D.J.

    2011-01-01

    The outcome of an infection is determined by numerous interactions between hosts and pathogens occurring at many different biological levels, ranging from molecule to population. To develop new control strategies for infectious diseases in livestock species, appropriate methodologies are needed

  12. A functional overview of conservation biological control

    DEFF Research Database (Denmark)

    Begg, Graham S; Cook, Samantha M; Dye, Richard

    2017-01-01

    Conservation biological control (CBC) is a sustainable approach to pest management that can contribute to a reduction in pesticide use as part of an Integrated Pest Management (IPM) strategy. CBC is based on the premise that countering habitat loss and environmental disturbance associated...... limitation to the development of effective CBC is due to a failure to adequately direct biological control services to achieve suppression of the target pests. By considering the performance of these and other components of CBC within the context of an integrated system, we believe that the limiting factors...... with intensive crop production will conserve natural enemies, thus contributing to pest suppression. The abundance and diversity of natural enemies increases in response to a variety of conservation measures, including plant and habitat diversification, a reduction in cropping intensity, and increased landscape...

  13. Evaluation of Puccinia carduorum for biological control of Carduus pycnocephalus in Tunisia

    Science.gov (United States)

    The rust fungus Puccinia carduorum is a candidate for biological control of Carduus pycnocephalus in the USA. In Tunisia, rusted C. pycnocephalus has been found in many fields during surveys conducted in the north of the country. The pathogenicity of Puccinia carduorum was evaluated under greenhou...

  14. Biological control of fusarium wilt of tomato by antagonist fungi and ...

    African Journals Online (AJOL)

    Biological control of Fusarium oxysporum f. sp. lycopersici (FOL) causing wilt disease of tomato was studied in vitro as well as under pot conditions. Dual culture technique showed that Aspergillus niger, Penicillium citrinum, Penicillium sp. and Trichoderma harzianum inhibited the radial colony growth of the test pathogen.

  15. The infection biology of Sphaerulina musiva: clues to understanding a forest pathogen.

    Directory of Open Access Journals (Sweden)

    Ruqian Qin

    Full Text Available Trees in the genus Populus and their interspecific hybrids are used across North America for fiber production and as a potential source of biofuel. Plantations of these species are severely impacted by a fungal pathogen, Sphaerulina musiva, the cause of leaf spot and stem canker. An inoculation protocol that does not rely on stem wounding to achieve infection was recently developed. Using this protocol two experiments were conducted to examine infection biology and disease development in the S. musiva-Populus interaction. In the first experiment non-wounded stems of one moderately resistant clone (NM6 and one susceptible clone (NC11505 were inoculated and examined by scanning electron microscopy at six different times (6 h, 12 h, 24 h, 72 h, 1 week, and 3 weeks post-inoculation. The images indicate that the pathogen appears to enter host tissue through small openings and lenticels and that there are no significant differences in the penetration rate between the moderately resistant (NM6 and susceptible (NC11505 clones at 12 h post-inoculation. In a second experiment a histological comparison of stem cankers for resistant clone DN74 and susceptible clone NC11505 were conducted at three time points (3 weeks, 5 weeks, and 7 weeks post-inoculation. Distinct differences in disease development were apparent between the resistant and susceptible clones at each time point, with the susceptible clone exhibiting a weak and delayed defense response. These results suggest, that following penetration, the pathogen may be able to interfere with the defense response in the susceptible host.

  16. Onchocerciasis control: biological research is still needed

    Directory of Open Access Journals (Sweden)

    Boussinesq M.

    2008-09-01

    Full Text Available Achievements obtained by the onchocerciasis control programmes should not lead to a relaxation in the biological research on Onchocerca volvulus. Issues such as the Loa loa-related postivermectin serious adverse events, the uncertainties as to whether onchocerciasis can be eliminated by ivermectin treatments, and the possible emergence of ivermectin-resistant O. volvulus populations should be addressed proactively. Doxycycline, moxidectin and emodepside appear to be promising as alternative drugs against onchocerciasis but support to researches in immunology and genomics should also be increased to develop new control tools, including both vaccines and macrofilaricidal drugs.

  17. A microfluidic platform with integrated arrays for immunologic assays for biological pathogen detection

    Science.gov (United States)

    Klemm, Richard; Becker, Holger; Hlawatsch, Nadine; Julich, Sandra; Miethe, Peter; Moche, Christian; Schattschneider, Sebastian; Tomaso, Herbert; Gärtner, Claudia

    2014-05-01

    The ability to integrate complete assays on a microfluidic chip helps to greatly simplify instrument requirements and allows the use of lab-on-a-chip technology in the field. A core application for such field-portable systems is the detection of pathogens in a CBRN scenario such as permanent monitoring of airborne pathogens, e.g. in subway stations or hospitals etc. An immunological assay was chosen as method for the pathogen identification. The conceptual approach was its realization as a lab-on-a-chip system, enabling an easy handling of the sample in an automated manner. The immunological detection takes place on an antibody array directly implemented in the microfluidic network. Different immobilization strategies will be presented showing the performance of the system. Central elements of the disposable microfluidic device like fluidic interface, turning valves, liquid introduction and waste storage, as well as the architecture of measurement and control fluidic network, will be introduced. Overall process times of about 30 minutes were achieved and assays for the detection of Francisella tularensis and Yersinia pestis are presented. An important feature of the integrated lab-on-a-chip approach is that all waste liquids remain on-chip and contamination risks can be avoided.

  18. G-quadruplexes in pathogens: a common route to virulence control?

    Directory of Open Access Journals (Sweden)

    Lynne M Harris

    2015-02-01

    Full Text Available DNA can form several secondary structures besides the classic double helix: one that has received much attention in recent years is the G-quadruplex (G4. This is a stable four-stranded structure formed by the stacking of quartets of guanine bases. Recent work has convincingly shown that G4s can form in vivo as well as in vitro and can affect both replication and transcription of DNA. They also play important roles at G-rich telomeres. Now, a spate of exciting reports has begun to reveal roles for G4 structures in virulence processes in several important microbial pathogens of humans. Interestingly, these come from a range of kingdoms--bacteria and protozoa as well as viruses--and all facilitate immune evasion in different ways. In particular, roles for G4s have been posited in the antigenic variation systems of bacteria and protozoa, as well as in the silencing of at least two major human viruses, human immunodeficiency virus (HIV and Epstein-Barr virus (EBV. Although antigenic variation and the silencing of latent viruses are quite distinct from one another, both are routes to immune evasion and the maintenance of chronic infections. Thus, highly disparate pathogens can use G4 motifs to control DNA/RNA dynamics in ways that are relevant to common virulence phenotypes. This review explores the evidence for G4 biology in such processes across a range of important human pathogens.

  19. An Overview of the Control of Bacterial Pathogens in Cattle Manure

    Directory of Open Access Journals (Sweden)

    Christy E. Manyi-Loh

    2016-08-01

    Full Text Available Cattle manure harbors microbial constituents that make it a potential source of pollution in the environment and infections in humans. Knowledge of, and microbial assessment of, manure is crucial in a bid to prevent public health and environmental hazards through the development of better management practices and policies that should govern manure handling. Physical, chemical and biological methods to reduce pathogen population in manure do exist, but are faced with challenges such as cost, odor pollution, green house gas emission, etc. Consequently, anaerobic digestion of animal manure is currently one of the most widely used treatment method that can help to salvage the above-mentioned adverse effects and in addition, produces biogas that can serve as an alternative/complementary source of energy. However, this method has to be monitored closely as it could be fraught with challenges during operation, caused by the inherent characteristics of the manure. In addition, to further reduce bacterial pathogens to a significant level, anaerobic digestion can be combined with other methods such as thermal, aerobic and physical methods. In this paper, we review the bacterial composition of cattle manure as well as methods engaged in the control of pathogenic microbes present in manure and recommendations that need to be respected and implemented in order to prevent microbial contamination of the environment, animals and humans.

  20. Biological Stability of Drinking Water: Controlling Factors, Methods, and Challenges.

    Science.gov (United States)

    Prest, Emmanuelle I; Hammes, Frederik; van Loosdrecht, Mark C M; Vrouwenvelder, Johannes S

    2016-01-01

    Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g., development of opportunistic pathogens), aesthetic (e.g., deterioration of taste, odor, color) or operational (e.g., fouling or biocorrosion of pipes) problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors, such as (i) type and concentration of available organic and inorganic nutrients, (ii) type and concentration of residual disinfectant, (iii) presence of predators, such as protozoa and invertebrates, (iv) environmental conditions, such as water temperature, and (v) spatial location of microorganisms (bulk water, sediment, or biofilm). Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability) in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i) existing knowledge on biological stability controlling factors and (ii) how these factors are affected by drinking water production and distribution conditions. In addition, (iii) the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discussed, how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order

  1. Biological stability of drinking water: controlling factors, methods and challenges

    Directory of Open Access Journals (Sweden)

    Emmanuelle ePrest

    2016-02-01

    Full Text Available Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g. development of opportunistic pathogens, aesthetic (e.g. deterioration of taste, odour, colour or operational (e.g. fouling or biocorrosion of pipes problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors such as (i type and concentration of available organic and inorganic nutrients, (ii type and concentration of residual disinfectant, (iii presence of predators such as protozoa and invertebrates, (iv environmental conditions such as water temperature, and (v spatial location of microorganisms (bulk water, sediment or biofilm. Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i existing knowledge on biological stability controlling factors and (ii how these factors are affected by drinking water production and distribution conditions. In addition, (iii the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discuss how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order to

  2. Biological Stability of Drinking Water: Controlling Factors, Methods, and Challenges

    KAUST Repository

    Prest, Emmanuelle I.

    2016-02-01

    Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g., development of opportunistic pathogens), aesthetic (e.g., deterioration of taste, odor, color) or operational (e.g., fouling or biocorrosion of pipes) problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors, such as (i) type and concentration of available organic and inorganic nutrients, (ii) type and concentration of residual disinfectant, (iii) presence of predators, such as protozoa and invertebrates, (iv) environmental conditions, such as water temperature, and (v) spatial location of microorganisms (bulk water, sediment, or biofilm). Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability) in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i) existing knowledge on biological stability controlling factors and (ii) how these factors are affected by drinking water production and distribution conditions. In addition, (iii) the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discussed, how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order

  3. Biological Stability of Drinking Water: Controlling Factors, Methods, and Challenges

    Science.gov (United States)

    Prest, Emmanuelle I.; Hammes, Frederik; van Loosdrecht, Mark C. M.; Vrouwenvelder, Johannes S.

    2016-01-01

    Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g., development of opportunistic pathogens), aesthetic (e.g., deterioration of taste, odor, color) or operational (e.g., fouling or biocorrosion of pipes) problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors, such as (i) type and concentration of available organic and inorganic nutrients, (ii) type and concentration of residual disinfectant, (iii) presence of predators, such as protozoa and invertebrates, (iv) environmental conditions, such as water temperature, and (v) spatial location of microorganisms (bulk water, sediment, or biofilm). Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability) in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i) existing knowledge on biological stability controlling factors and (ii) how these factors are affected by drinking water production and distribution conditions. In addition, (iii) the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discussed, how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order

  4. Arthropod-borne pathogens of dogs and cats: From pathways and times of transmission to disease control.

    Science.gov (United States)

    Otranto, Domenico

    2018-02-15

    Vector-borne pathogens have developed a close relationship with blood feeding arthropod ectoparasites (e.g., mosquitoes, ticks, phlebotomine sand flies, black flies, fleas, kissing bugs, lice) and exploited a huge variety of vector transmission routes. Therefore, the life cycles of these pathogens result in a long evolved balance with the respective arthropod biology, ecology and blood feeding habits, instrumentally to the infection of several animal species, including humans. Amongst the many parasite transmission modes, such as ingestion of the arthropod, with its faeces or secretions, blood feeding represents the main focus for this article, as it is a central event to the life of almost all arthropod vectors. The time frame in which pathogens are transmitted to any animal host is governed by a large number of biological variables related to the vector, the pathogen, the host and environmental factors. Scientific data available on transmission times for each pathogen are discussed relative to their impact for the success of vector-borne disease control strategies. Blocking pathogen transmission, and thus preventing the infection of dogs and cats, may be achievable by the use of chemical compounds if they are characterised by a fast onset of killing activity or repellence against arthropods. The fast speed of kill exerted by systemic isoxazoline, as well as the repellent effect of pyrethroids have renewed the interest of the scientific community and pharmaceutical companies towards reducing the burden of vector-borne diseases under field conditions. However, endosymbionts and vaccines targeting arthropods or pathogen antigens should be further investigated as alternative strategies towards the goal of achieving an effective integrated control of vector-borne diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. AN INTEGRATED BIOLOGICAL CONTROL SYSTEM AT HANFORD

    Energy Technology Data Exchange (ETDEWEB)

    JOHNSON AR; CAUDILL JG; GIDDINGS RF; RODRIGUEZ JM; ROOS RC; WILDE JW

    2010-02-11

    In 1999 an integrated biological control system was instituted at the U.S. Department of Energy's Hanford Site. Successes and changes to the program needed to be communicated to a large and diverse mix of organizations and individuals. Efforts at communication are directed toward the following: Hanford Contractors (Liquid or Tank Waste, Solid Waste, Environmental Restoration, Science and Technology, Site Infrastructure), General Hanford Employees, and Hanford Advisory Board (Native American Tribes, Environmental Groups, Local Citizens, Washington State and Oregon State regulatory agencies). Communication was done through direct interface meetings, individual communication, where appropriate, and broadly sharing program reports. The objectives of the communication efforts was to have the program well coordinated with Hanford contractors, and to have the program understood well enough that all stakeholders would have confidence in the work performed by the program to reduce or elimated spread of radioactive contamination by biotic vectors. Communication of successes and changes to an integrated biological control system instituted in 1999 at the Department of Energy's Hanford Site have required regular interfaces with not only a diverse group of Hanford contractors (i.e., those responsible for liquid or tank waste, solid wastes, environmental restoration, science and technology, and site infrastructure), and general Hanford employees, but also with a consortium of designated stake holders organized as the Hanford Advisory Board (i.e., Native American tribes, various environmental groups, local citizens, Washington state and Oregon regulatory agencies, etc.). Direct interface meetings, individual communication where appropriate, and transparency of the biological control program were the methods and outcome of this effort.

  6. An Integrated Biological Control System At Hanford

    International Nuclear Information System (INIS)

    Johnson, A.R.; Caudill, J.G.; Giddings, R.F.; Rodriguez, J.M.; Roos, R.C.; Wilde, J.W.

    2010-01-01

    In 1999 an integrated biological control system was instituted at the U.S. Department of Energy's Hanford Site. Successes and changes to the program needed to be communicated to a large and diverse mix of organizations and individuals. Efforts at communication are directed toward the following: Hanford Contractors (Liquid or Tank Waste, Solid Waste, Environmental Restoration, Science and Technology, Site Infrastructure), General Hanford Employees, and Hanford Advisory Board (Native American Tribes, Environmental Groups, Local Citizens, Washington State and Oregon State regulatory agencies). Communication was done through direct interface meetings, individual communication, where appropriate, and broadly sharing program reports. The objectives of the communication efforts was to have the program well coordinated with Hanford contractors, and to have the program understood well enough that all stakeholders would have confidence in the work performed by the program to reduce or elimate spread of radioactive contamination by biotic vectors. Communication of successes and changes to an integrated biological control system instituted in 1999 at the Department of Energy's Hanford Site have required regular interfaces with not only a diverse group of Hanford contractors (i.e., those responsible for liquid or tank waste, solid wastes, environmental restoration, science and technology, and site infrastructure), and general Hanford employees, but also with a consortium of designated stake holders organized as the Hanford Advisory Board (i.e., Native American tribes, various environmental groups, local citizens, Washington state and Oregon regulatory agencies, etc.). Direct interface meetings, individual communication where appropriate, and transparency of the biological control program were the methods and outcome of this effort.

  7. Systems biology elucidates common pathogenic mechanisms between nonalcoholic and alcoholic-fatty liver disease.

    Directory of Open Access Journals (Sweden)

    Silvia Sookoian

    Full Text Available The abnormal accumulation of fat in the liver is often related either to metabolic risk factors associated with metabolic syndrome in the absence of alcohol consumption (nonalcoholic fatty liver disease, NAFLD or to chronic alcohol consumption (alcoholic fatty liver disease, AFLD. Clinical and histological studies suggest that NAFLD and AFLD share pathogenic mechanisms. Nevertheless, current data are still inconclusive as to whether the underlying biological process and disease pathways of NAFLD and AFLD are alike. Our primary aim was to integrate omics and physiological data to answer the question of whether NAFLD and AFLD share molecular processes that lead to disease development. We also explored the extent to which insulin resistance (IR is a distinctive feature of NAFLD. To answer these questions, we used systems biology approaches, such as gene enrichment analysis, protein-protein interaction networks, and gene prioritization, based on multi-level data extracted by computational data mining. We observed that the leading disease pathways associated with NAFLD did not significantly differ from those of AFLD. However, systems biology revealed the importance of each molecular process behind each of the two diseases, and dissected distinctive molecular NAFLD and AFLD-signatures. Comparative co-analysis of NAFLD and AFLD clarified the participation of NAFLD, but not AFLD, in cardiovascular disease, and showed that insulin signaling is impaired in fatty liver regardless of the noxa, but the putative regulatory mechanisms associated with NAFLD seem to encompass a complex network of genes and proteins, plausible of epigenetic modifications. Gene prioritization showed a cancer-related functional map that suggests that the fatty transformation of the liver tissue is regardless of the cause, an emerging mechanism of ubiquitous oncogenic activation. In conclusion, similar underlying disease mechanisms lead to NAFLD and AFLD, but specific ones depict a

  8. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen.

    Science.gov (United States)

    Bolton, Melvin D; Thomma, Bart P H J; Nelson, Berlin D

    2006-01-01

    SUMMARY Sclerotinia sclerotiorum (Lib.) de Bary is a necrotrophic fungal pathogen causing disease in a wide range of plants. This review summarizes current knowledge of mechanisms employed by the fungus to parasitize its host with emphasis on biology, physiology and molecular aspects of pathogenicity. In addition, current tools for research and strategies to combat S. sclerotiorum are discussed. Sclerotinia sclerotiorum (Lib.) de Bary: kingdom Fungi, phylum Ascomycota, class Discomycetes, order Helotiales, family Sclerotiniaceae, genus Sclerotinia. Hyphae are hyaline, septate, branched and multinucleate. Mycelium may appear white to tan in culture and in planta. No asexual conidia are produced. Long-term survival is mediated through the sclerotium; a pigmented, multi-hyphal structure that can remain viable over long periods of time under unfavourable conditions for growth. Sclerotia can germinate to produce mycelia or apothecia depending on environmental conditions. Apothecia produce ascospores, which are the primary means of infection in most host plants. S. sclerotiorum is capable of colonizing over 400 plant species found worldwide. The majority of these species are dicotyledonous, although a number of agriculturally significant monocotyledonous plants are also hosts. Disease symptoms: Leaves usually have water-soaked lesions that expand rapidly and move down the petiole into the stem. Infected stems of some species will first develop dark lesions whereas the initial indication in other hosts is the appearance of water-soaked stem lesions. Lesions usually develop into necrotic tissues that subsequently develop patches of fluffy white mycelium, often with sclerotia, which is the most obvious sign of plants infected with S. sclerotiorum. http://www.whitemoldresearch.com; http://www.broad.mit.edu/annotation/fungi/sclerotinia_sclerotiorum.

  9. Novel hypovirulence-associated RNA mycovirus in the plant pathogenic fungus botrytis cinerea: molecular and biological characterization

    Science.gov (United States)

    Botrytis cinerea is a pathogenic fungus causing gray mold disease on numerous economically important crops and ornamental plants. This study was conducted to characterize the biological and molecular features of a novel RNA mycovirus, Botrytis cinerea RNA virus 1 (BcRV1), in the hypovirulent strain ...

  10. Identification of Biocontrol Agents to Control the Fungal Pathogen, Geomyces destructans, in Bats

    Science.gov (United States)

    Braunstein, S.; Cheng, T.

    2013-12-01

    The fungal pathogen Geomyces destructans (Gd) causes the disease White-nose Syndrome (WNS) in bats and is estimated to have killed millions of bats since its emergence in North America in 2006. Gd is predicted to cause the local extinction of at least three bat species if rates of decline continue unabated. Given the devastating impacts of Gd to bat populations, identifying a viable method for controlling the pathogen is pertinent for conservation of affected bat species. Our work focuses on identifying naturally-occurring skin bacteria on bats that are antagonistic to Gd that could potentially be used as a biocontrol. We cultured bacteria from skin swabs taken from wild bats (Myotis lucifugus, Eptesicus fuscus, Myotis sodalis, Perimyotis subflavus). We conducted challenge experiments to identify bacterial strains that inhibited Gd growth. Bacteria that exhibited antifungal properties were identified using 16S and gyrB markers. Our methods identified several bacteria in the Pseudomonas fluorescens complex as potential biocontrol agents. Future work will continue to test the viability of these bacteria as biocontrol agents via experimental treatments with live captive bats. The failure of previous non-biocontrol methods highlights the importance of developing these bacteria as a biologically-friendly method for controlling Gd. A bat infected with Geomyces destructans. Photo by West Virginia Division of Natural Resources Bacterial culture from the swab of a bat's wings

  11. Biological control agents elevate hantavirus by subsidizing deer mouse populations

    Science.gov (United States)

    Dean E. Pearson; Ragan M. Callaway

    2006-01-01

    Biological control of exotic invasive plants using exotic insects is practiced under the assumption that biological control agents are safe if they do not directly attack non-target species. We tested this assumption by evaluating the potential for two host-specific biological control agents (Urophora spp.), widely established in North America for spotted...

  12. Isolation, Characterization and Biological Properties of Membrane Vesicles Produced by the Swine Pathogen Streptococcus suis.

    Directory of Open Access Journals (Sweden)

    Bruno Haas

    Full Text Available Streptococcus suis, more particularly serotype 2, is a major swine pathogen and an emerging zoonotic agent worldwide that mainly causes meningitis, septicemia, endocarditis, and pneumonia. Although several potential virulence factors produced by S. suis have been identified in the last decade, the pathogenesis of S. suis infections is still not fully understood. In the present study, we showed that S. suis produces membrane vesicles (MVs that range in diameter from 13 to 130 nm and that appear to be coated by capsular material. A proteomic analysis of the MVs revealed that they contain 46 proteins, 9 of which are considered as proven or suspected virulence factors. Biological assays confirmed that S. suis MVs possess active subtilisin-like protease (SspA and DNase (SsnA. S. suis MVs degraded neutrophil extracellular traps, a property that may contribute to the ability of the bacterium to escape the host defense response. MVs also activated the nuclear factor-kappa B (NF-κB signaling pathway in both monocytes and macrophages, inducing the secretion of pro-inflammatory cytokines, which may in turn contribute to increase the permeability of the blood brain barrier. The present study brought evidence that S. suis MVs may play a role as a virulence factor in the pathogenesis of S. suis infections, and given their composition be an excellent candidate for vaccine development.

  13. biological and biochemical effects of biocides and gamma radiation on pathogen attacked some horticulture crops

    International Nuclear Information System (INIS)

    Helal, I.M.M.

    2006-01-01

    the present investigation was aimed to study the possibility of formulation of some essential oils having antimicrobial activity to be used as biocides. the results of this study showed that fennel, peppermint and caraway oils were the most inhibitory effective oils against some post harvest pathogens. the used oils. were formulated as biocides using different emulsifiers with the addition of different types of fixed oils . the prepared biocides were effective for controlling the growth of the studied microorganisms in vitro and in vivo on the host plant products. also , the interaction of biocides and different doses of gamma radiation were effective for extending the shelf life of potato tubers and orange fruits during storage at room temperature for periods of 150 and 75 days, respectively. biochemical changes in potato tubers and orange fruits as a result of treatments were studied

  14. Biological control of cattle fever ticks

    Science.gov (United States)

    Cattle fever ticks (CFT) Rhipicephalus microplus and Rhipicephalus annulatus are invasive livestock pests that are endemic to Mexico and invasive along the Texas – Mexico border. Acaricide resistance, alternate wildlife hosts, and pathogenic landscape forming weeds present challenges for sustainable...

  15. Programmable temperature control system for biological materials

    Science.gov (United States)

    Anselmo, V. J.; Harrison, R. G.; Rinfret, A. P.

    1982-01-01

    A system was constructed which allows programmable temperature-time control for a 5 cu cm sample volume of arbitrary biological material. The system also measures the parameters necessary for the determination of the sample volume specific heat and thermal conductivity as a function of temperature, and provides a detailed measurement of the temperature during phase change and a means of calculating the heat of the phase change. Steady-state and dynamic temperature control is obtained by supplying heat to the sample volume through resistive elements constructed as an integral part of the sample container. For cooling purposes, this container is totally immersed into a cold heat sink. Using a mixture of dry ice and alcohol at 79 C, the sample volume can be controlled from +40 to -60 C at rates from steady state to + or - 65 C/min. Steady-state temperature precision is better than 0.2 C, while the dynamic capability depends on the temperature rate of change as well as the mass of both the sample and the container.

  16. BIOMASS PRODUCTION AND FORMULATION OF Bacillus subtilis FOR BIOLOGICAL CONTROL

    Directory of Open Access Journals (Sweden)

    Amran Muis

    2016-10-01

    Full Text Available Bacillus subtilis is a widespread bacterium found in soil, water, and air. It controls the growth of certain harmful bacteria and fungi, presumably by competing for nutrients, growth sites on plants, and by directly colonizing and attaching to fungal pathogens. When applied to seeds, it colonizes the developing root system of the plants and continues to live on the root system and provides protection throughout the growing season. The study on biomass production and formulation of B. subtilis for biological control was conducted in the laboratory of Department of Plant Pathology, College of Agriculture, University of the Philippines Los Baños (UPLB-CA, College, Laguna from May to July 2005. The objective of the study was to determine the optimum pH and a good carbon source for biomass production of B. subtilis and to develop a seed treatment formulation of B. subtilis as biological control agent. Results showed that the optimum pH for growth of B. subtilis was pH 6 (1.85 x 109 cfu/ml. In laboratory tests for biomass production using cassava flour, corn flour, rice flour, and brown sugar as carbon sources, it grew best in brown sugar plus yeast extract medium (6.8 x 108 cfu ml-1 in sterile distilled water and 7.8 x 108 cfu ml-1 in coconut water. In test for bacterial biomass carriers, talc proved to be the best in terms of number of bacteria recovered from the seeds (3.98 x 105 cfu seed-1.

  17. Irradiation of ready-to-eat meats for pathogen control

    Science.gov (United States)

    Ionizing (gamma) radiation is a safe and effective technology that can be used to inactivate foodborne pathogens in a variety of food types, including ready-to-eat (RTE) meats. The U.S. Food and Drug Administration is currently evaluating a petition to allow irradiation of RTE meats in the U.S. In t...

  18. Prevention And Control Of Highly Pathogenic Avian Influenza In Africa

    African Journals Online (AJOL)

    Highly Pathogenic Avian Influenza (HPAI) is a zoonotic trans-boundary disease. Its occurrence in a country constitutes a major constraint to profitable livestock operations and poses a high public health risk at regional and global levels. Since February 2006, HPAI has infected eleven African countries (Nigeria, Egypt, Niger, ...

  19. Delivery of gene biotechnologies to plants: Pathogen and pest control

    Science.gov (United States)

    Treatment of oligonucleotides to plants for host delivered suppression of microbes and insect pests of citrus was successful. FANA_ASO, (2'-deoxy-2'-fluoro-D- arabinonucleic acid)_( antisense oligonucleotides- AUM LifeTech) designed to: Asian citrus psyllid; Citrus plant bacterial pathogen of citru...

  20. Current knowledge on groundwater microbial pathogens and their control

    Science.gov (United States)

    Macler, Bruce A.; Merkle, Jon C.

    Those who drink groundwater that has not been disinfected are at increased risk of infection and disease from pathogenic microorganisms. Recent studies have shown that up to half of all US drinking-water wells tested had evidence of fecal contamination. A significant fraction of all waterborne disease outbreaks is associated with groundwater. An estimated 750,000 to 5.9million illnesses per year result from contaminated groundwaters in the US. Mortality from these illnesses may be 1400-9400 deaths per year. Control of these pathogens starts with source-water protection activities to prevent fecal contamination of aquifers and wells. These include assessment of wellhead vulnerability to fecal contamination and correction of identified deficiencies. Correction may include control of sources or rehabilitation of the well itself. Disinfection can serve as a useful barrier and is recommended as a prudent public-health policy for all groundwater systems. Ceux qui boivent une eau souterraine non désinfectée présentent un risque accru d'infection et de maladie par des germes pathogènes. De récentes études ont montré que près de la moitié de tous les puits américains testés, captés pour l'eau potable, sont soumis à une contamination fécale. Une fraction significative de l'ensemble des premières manifestations de maladies liées à l'eau est associée aux eaux souterraines. On estime qu'entre 750 000 et 5,9millions de personnes sont malades chaque année aux États-Unis à cause d'eaux souterraines polluées. La mortalité parmi ces malades doit ètre de l'ordre de 1400 à 9400 décès par an. La protection contre ces germes pathogènes commence avec des mesures prises au niveau du captage pour empècher la pollution des aquifères et des puits. Celles-ci comprennent une évaluation de la vulnérabilité des tètes de puits à la pollution fécale et une correction des insuffisances mises en évidence. Cette correction peut comprendre une maîtrise des sources

  1. Biopreservative methods to control the growth of foodborne pathogens on fresh-cut lettuce.

    Science.gov (United States)

    Oliveira, M; Abadias, M; Colás-Medà, P; Usall, J; Viñas, I

    2015-12-02

    Fruits and vegetables can become contaminated by foodborne pathogens such as Escherichia coli O157:H7, Salmonella and Listeria monocytogenes, and it has been demonstrated that current industrial sanitizing treatments do not eliminate the pathogens when present. Chemical control is widely used, but biological control appears to be a better solution, mainly using the native microbiota present on fresh produce. The first objective of this study was to isolate native microbiota from whole and fresh-cut produce and to determine whether these bacteria were antagonistic toward foodborne pathogens. A total of 112 putative antagonist isolates were screened for their ability to inhibit the growth of Salmonella enterica on lettuce disks. Five different genera reduced S. enterica growth more than 1-log unit at 20°C at the end of 3 days. When tested against L. monocytogenes 230/3, only Pseudomonas sp. strain M309 (M309) was able to reduce pathogen counts by more than 1-log unit. Therefore, M309 strain was selected to be tested on lettuce disks at 10°C against S. enterica, E. coli O157:H7 and L. monocytogenes. M309 strain was only able to reduce S. enterica and E. coli O157:H7 populations. The second objective was to test different biopreservative methods including M309 strain, Pseudomonas graminis CPA-7 (CPA-7), bacteriophages (Listex P100 and Salmonelex) and nisin at conditions simulating commercial applications against Salmonella and L. monocytogenes on fresh-cut lettuce. The addition of the biopreservative agents did not result in a significant reduction of Salmonella population. However, CPA-7 strain together with nisin reduced L. monocytogenes numbers after 6 days of storage at 10°C. The cocktail of Salmonella and L. monocytogenes was not markedly inactivated by their respective bacteriophage solutions. This study highlighted the potential of biocontrol, but the combination with other technologies may be required to improve their application on fresh-cut lettuce

  2. MODELING HOST-PATHOGEN INTERACTIONS: COMPUTATIONAL BIOLOGY AND BIOINFORMATICS FOR INFECTIOUS DISEASE RESEARCH (Session introduction)

    Energy Technology Data Exchange (ETDEWEB)

    McDermott, Jason E.; Braun, Pascal; Bonneau, Richard A.; Hyduke, Daniel R.

    2011-12-01

    Pathogenic infections are a major cause of both human disease and loss of crop yields and animal stocks and thus cause immense damage to the worldwide economy. The significance of infectious diseases is expected to increase in an ever more connected warming world, in which new viral, bacterial and fungal pathogens can find novel hosts and ecologic niches. At the same time, the complex and sophisticated mechanisms by which diverse pathogenic agents evade defense mechanisms and subvert their hosts networks to suit their lifestyle needs is still very incompletely understood especially from a systems perspective [1]. Thus, understanding host-pathogen interactions is both an important and a scientifically fascinating topic. Recently, technology has offered the opportunity to investigate host-pathogen interactions on a level of detail and scope that offers immense computational and analytical possibilities. Genome sequencing was pioneered on some of these pathogens, and the number of strains and variants of pathogens sequenced to date vastly outnumbers the number of host genomes available. At the same time, for both plant and human hosts more and more data on population level genomic variation becomes available and offers a rich field for analysis into the genetic interactions between host and pathogen.

  3. Complexity, Analysis and Control of Singular Biological Systems

    CERN Document Server

    Zhang, Qingling; Zhang, Xue

    2012-01-01

    Complexity, Analysis and Control of Singular Biological Systems follows the control of real-world biological systems at both ecological and phyisological levels concentrating on the application of now-extensively-investigated singular system theory. Much effort has recently been dedicated to the modelling and analysis of developing bioeconomic systems and the text establishes singular examples of these, showing how proper control can help to maintain sustainable economic development of biological resources. The book begins from the essentials of singular systems theory and bifurcations before tackling  the use of various forms of control in singular biological systems using examples including predator-prey relationships and viral vaccination and quarantine control. Researchers and graduate students studying the control of complex biological systems are shown how a variety of methods can be brought to bear and practitioners working with the economics of biological systems and their control will also find the ...

  4. Maternal feeding controls fetal biological clock.

    Directory of Open Access Journals (Sweden)

    Hidenobu Ohta

    Full Text Available BACKGROUND: It is widely accepted that circadian physiological rhythms of the fetus are affected by oscillators in the maternal brain that are coupled to the environmental light-dark (LD cycle. METHODOLOGY/PRINCIPAL FINDINGS: To study the link between fetal and maternal biological clocks, we investigated the effects of cycles of maternal food availability on the rhythms of Per1 gene expression in the fetal suprachiasmatic nucleus (SCN and liver using a transgenic rat model whose tissues express luciferase in vitro. Although the maternal SCN remained phase-locked to the LD cycle, maternal restricted feeding phase-advanced the fetal SCN and liver by 5 and 7 hours respectively within the 22-day pregnancy. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that maternal feeding entrains the fetal SCN and liver independently of both the maternal SCN and the LD cycle. This indicates that maternal-feeding signals can be more influential for the fetal SCN and particular organ oscillators than hormonal signals controlled by the maternal SCN, suggesting the importance of a regular maternal feeding schedule for appropriate fetal molecular clockwork during pregnancy.

  5. Optimal strategies for the surveillance and control of forest pathogens: A case study with oak wilt

    Science.gov (United States)

    Tetsuya Horie; Robert G. Haight; Frances R. Homans; Robert C. Venette

    2013-01-01

    Cost-effective strategies are needed to find and remove diseased trees in forests damaged by pathogens. We develop a model of cost-minimizing surveillance and control of forest pathogens across multiple sites where there is uncertainty about the extent of the infestation in each site and when the goal is to minimize the expected number of new infections. We allow for a...

  6. Bacillus spp as a biological control agent against panama disease in banana

    CSIR Research Space (South Africa)

    Gumede, WHN

    2006-02-01

    Full Text Available reported in some banana producing regions (Figure 1). The ability of the fungal pathogens (especially race 4) to infect a wide range of banana cultivars and to establish resistance to chemical pesticides is a threat to the continued cultivation... of bananas. Alternative remedies to curb proliferation of Panama disease have therefore been initiated. CSIR Biosciences is extensively engaged in the development of biological control strategies and has identified an isolate of Bacillus spp., which...

  7. Will the Convention on Biological Diversity put an end to biological control?

    Directory of Open Access Journals (Sweden)

    Joop C. van Lenteren

    2011-03-01

    Full Text Available Will the Convention on Biological Diversity put an end to biological control? Under the Convention on Biological Diversity countries have sovereign rights over their genetic resources. Agreements governing the access to these resources and the sharing of the benefits arising from their use need to be established between involved parties. This also applies to species collected for potential use in biological control. Recent applications of access and benefit sharing principles have already made it difficult or impossible to collect and export natural enemies for biological control research in several countries. If such an approach is widely applied it would impede this very successful and environmentally safe pest management method based on the use of biological diversity. The International Organization for Biological Control of Noxious Animals and Plants has, therefore, created the "Commission on Biological Control and Access and Benefit Sharing". This commission is carrying out national and international activities to make clear how a benefit sharing regime might seriously frustrate the future of biological control. In addition, the IOBC Commission members published information on current regulations and perceptions concerning exploration for natural enemies and drafted some 30 case studies selected to illustrate a variety of points relevant to access and benefit sharing. In this article, we summarize our concern about the effects of access and benefit sharing systems on the future of biological control.

  8. Effectiveness of a biological control agent Palexorista gilvoides in ...

    African Journals Online (AJOL)

    ACSS

    Effectiveness of a biological control agent Palexorista gilvoides in controlling Gonometa podorcarpi in conifer ... gilvoides as a potential biological control agent for G. podocarpi. Field and laboratory studies further established that P. .... version for windows (SPSS, 2002). Results. Gonometa podocarpi was present in.

  9. Biological control of alien and invasive species in agriculture

    International Nuclear Information System (INIS)

    Calvitti, Maurizio; Moretti Riccardo; Lampazzi, Elena

    2015-01-01

    Agricultural production in Europe faces many challenges including limited availability of water, nitrogen input and fossil fuels. It is necessary, therefore, to identify methods of production and new technologies to increase the efficiency of the primary systems, guaranteeing amount of food, quality, safety and eco-sustainability . One of the most important aspects, though often undervalued in relation to the food chain, is the adversity of biological management of agricultural crops due to pests, pathogens or fitomizi with potential invasive already present in the territory or of recent origin alien. In this context, two main objectives should be implemented at the same time reduce production losses and protect the agro-ecosystem. To meet these expectations, as of January 1, 2015 all farms in the European Union countries are bound to the application of the Integrated Defense principles, as indicated by the Directive on the sustainable use of plant protection products (128/09 / EC) .In response to this and other new entomological emergencies plant health and medical-veterinary entomologist researchers of the Laboratory sustainable management of Agro-Ecosystems in ENEA, have directed their research towards the development of innovative systems for the sustainable control of invasive species of insects is in the agricultural sector that health. [it

  10. Potential nontarget effects of Metarhizium anisopliae (Deuteromycetes) used for biological control of ticks (Acari: Ixodidae)

    Science.gov (United States)

    Ginsberg, Howard S.; LeBrun, Roger A.; Heyer, Klaus; Zhioua, Elyes

    2002-01-01

    The potential for nontarget effects of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin, when used for biological control of ticks, was assessed in laboratory trials. Fungal pathogenicity was studied against convergent ladybird beetles, Hippodamia convergens Guérin-Méneville, house crickets, Acheta domesticus (L.), and the milkweed bugs Oncopeltus fasciatus (Dallas). Fungal spores applied with a spray tower produced significant mortality in H. convergens and A. domesticus, but effects on O. fasciatus were marginal. Placing treated insects with untreated individuals resulted in mortality from horizontal transmission to untreated beetles and crickets, but not milkweed bugs. Spread of fungal infection in the beetles resulted in mortality on days 4–10 after treatment, while in crickets mortality was on day 2 after treatment, suggesting different levels of pathogenicity and possibly different modes of transmission. Therefore, M. anisopliae varies in pathogenicity to different insects. Inundative applications can potentially affect nontarget species, but M. anisopliae is already widely distributed in North America, so applications for tick control generally would not introduce a novel pathogen into the environment. Pathogenicity in lab trials does not, by itself, demonstrate activity under natural conditions, so field trials are needed to confirm these results and to assess methods to minimize nontarget exposure.

  11. Crossover fungal pathogens: the biology and pathogenesis of fungi capable of crossing kingdoms to infect plants and humans.

    Science.gov (United States)

    Gauthier, Gregory M; Keller, Nancy P

    2013-12-01

    The outbreak of fungal meningitis associated with contaminated methylprednisolone acetate has thrust the importance of fungal infections into the public consciousness. The predominant pathogen isolated from clinical specimens, Exserohilum rostratum (teleomorph: Setosphaeria rostrata), is a dematiaceous fungus that infects grasses and rarely humans. This outbreak highlights the potential for fungal pathogens to infect both plants and humans. Most crossover or trans-kingdom pathogens are soil saprophytes and include fungi in Ascomycota and Mucormycotina phyla. To establish infection, crossover fungi must overcome disparate, host-specific barriers, including protective surfaces (e.g. cuticle, skin), elevated temperature, and immune defenses. This review illuminates the underlying mechanisms used by crossover fungi to cause infection in plants and mammals, and highlights critical events that lead to human infection by these pathogens. Several genes including veA, laeA, and hapX are important in regulating biological processes in fungi important for both invasive plant and animal infections. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. CONTROL OF SOME PATHOGENS BY USING SPECIAL FOLIAR FERTILIZERS

    Directory of Open Access Journals (Sweden)

    I OROIAN

    2004-04-01

    Full Text Available The present work points out to the interdisciplinary experimental results, obtained in the experimental fields of the Plant Protection and Soil Science Department, as well as at data which stress upon the interdependency between the satisfaction of the trophically needs of the wheat plants and the aggressiveness of the pathogens which cause the disease. The experimental results underline the fact that the attack level expressed through intensity and attack degree is different, both with the “out of root” fertilized variants and with the soil fertilization variants. The conclusions which come off the study of the obtained data point out at the fact that the fertilizer application, no matter the method, determines the growth or the regress of the attack degree. They also have an influence upon the Puccinia striformis f.sp. tritici, Blumeria graminis and, Septoria spp. fungus manifestation.

  13. Microbes versus microbes: control of pathogens in the food chain.

    Science.gov (United States)

    Jordan, Kieran; Dalmasso, Marion; Zentek, Juergen; Mader, Anneluise; Bruggeman, Geert; Wallace, John; De Medici, Dario; Fiore, Alfonsina; Prukner-Radovcic, Estella; Lukac, Maja; Axelsson, Lars; Holck, Askild; Ingmer, Hanne; Malakauskas, Mindaugas

    2014-12-01

    Foodborne illness continues as a considerable threat to public health. Despite improved hygiene management systems and increased regulation, pathogenic bacteria still contaminate food, causing sporadic cases of illness and disease outbreaks worldwide. For many centuries, microbial antagonism has been used in food processing to improve food safety. An understanding of the mode of action of this microbial antagonism has been gained in recent years and potential applications in food and feed safety are now being explored. This review focuses on the potential opportunities presented, and the limitations, of using microbial antagonism as a biocontrol mechanism to reduce contamination along the food chain; including animal feed as its first link. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  14. Biological control of the terrestrial carbon sink

    Directory of Open Access Journals (Sweden)

    E.-D. Schulze

    2006-01-01

    Full Text Available This lecture reviews the past (since 1964 when the International Biological Program began and the future of our understanding of terrestrial carbon fluxes with focus on photosynthesis, respiration, primary-, ecosystem-, and biome-productivity. Photosynthetic capacity is related to the nitrogen concentration of leaves, but the capacity is only rarely reached under field conditions. Average rates of photosynthesis and stomatal conductance are closely correlated and operate near 50% of their maximal rate, with light being the limiting factor in humid regions and air humidity and soil water the limiting factor in arid climates. Leaf area is the main factor to extrapolate from leaves to canopies, with maximum surface conductance being dependent on leaf level stomatal conductance. Additionally, gas exchange depends also on rooting depth which determines the water and nutrient availability and on mycorrhizae which regulate the nutrient status. An important anthropogenic disturbance is the nitrogen uptake from air pollutants, which is not balanced by cation uptake from roots and this may lead to damage and breakdown of the plant cover. Photosynthesis is the main carbon input into ecosystems, but it alone does not represent the ecosystem carbon balance, which is determined by respiration of various kinds. Plant respiration and photosynthesis determine growth (net primary production and microbial respiration balances the net ecosystem flux. In a spruce forest, 30% of the assimilatory carbon gain is used for respiration of needles, 20% is used for respiration in stems. Soil respiration is about 50% the carbon gain, half of which is root respiration, half is microbial respiration. In addition, disturbances lead to carbon losses, where fire, harvest and grazing bypass the chain of respiration. In total, the carbon balance at the biome level is only about 1% of the photosynthetic carbon input, or may indeed become negative. The recent observed increase in

  15. Selection of a new Pseudomonas chlororaphis strain for the biological control of Fusarium oxysporum f. sp. radicis-lycopersici

    Directory of Open Access Journals (Sweden)

    Gerardo PUOPOLO

    2011-09-01

    Full Text Available Fluorescent pseudomonads possess several physiological characteristics exploitable for the biological control of phytopathogenic fungi. A group of 11 pseudomonads able to inhibit tomato pathogenic fungi in vitro were identified using the Biolog test and the phylogenetic analysis of recA. Strain M71 of Pseudomonas chlororaphis was selected as a new potential biocontrol agent. This strain drastically reduced Fusarium oxysporum f. sp. radicis-lycopersici pathogenicity on tomato plantlets in seed assays and greenhouse trials. Moreover, the strain produced several important secondary metabolites, including proteases, siderophores and antibiotics. The presence of a region involved in phenazine production and the biosynthesis of N-acyl homoserine lactones were also assessed.

  16. Biological control of Aspergillus flavus growth and subsequent ...

    African Journals Online (AJOL)

    ONOS

    2010-07-05

    Jul 5, 2010 ... constraint of grain quality and sorghum production. Various ... respectively. Key words: Sorghum, Aspergillus flavus, AFB1, biological control. ..... J. Appl. Microbiol. 2: 297-306. Mishra HN, Chitrangada D (2003). A review on biological control and metabolism of aflatoxin. Crit. Rev. Food Sci. Nutr. 43(3): ...

  17. EFFECTIVENESS OF SOME PATHOGENIC CONTROL AGENTS AGAINST PESTS IN GREENHOUSE VEGETABLE CROPS

    Directory of Open Access Journals (Sweden)

    Dima Markova

    2017-09-01

    Full Text Available Greenhouse tomato and cucumber are attacked by a great number of pests. The most frequently occurred pests are: greenhouse whitefly (Trialeurodes vaporariorum Westw., cotton aphids (Aphis gossypii Glov., tobacco and western flower thrips (Thrips tabaci Lindeman, Frankliniella occidentalis Perg., cotton bollworm (Helicoverpa armigera Hb. and two spotted spider mite (Tetranychus urticae Koch.. Plant protection products applied in practice are not always efficient enough due to arising of resistance to these products in the populations. Moreover their use could results in accumulation of residual amounts and environmental pollution. Recently a great interest to find alternative solutions for pest control is observed. Some viruses, bacteria and fungi which are pathogenic to the pests but safety for human, could be used. There are products with good efficacy, which are developed on this basis and applied for pest control. Investigations for determining of the biological activity in the following products were carried out during the period 2016-2017 in the “Maritsa” Vegetable Crops Research Institute - Plovdiv: Naturalis (a. i. Beauveria bassiana strain АТСС 74040 at a dose of 100 ml/da, Rapax (a. i. Bacillus thuringiensis subsp. kurstaki strain EG 2348 at a dose of 100 ml/da and Helicovex (a. i. Helicoverpa armigera nucleopolyhedrovirus Hear NVP, DSMZ-BV0003 – 7,5 x 1012 NPV/liter at a dose of 20 ml/da. The product Naturalis at a dose 100 ml/da has a good effectiveness (over 75% against greenhouse whitefly, cotton aphids, thrips, and movable forms of the two spotted spider mite in tomato and cucumber grown under greenhouses. The products Rapax at a dose of 100 ml/da and Helicovex at a dose of 20 ml/da have a good biological activity (E = 76,32% and E = 76,92%, respectively towards to the larvae of the cotton bollworm in greenhouse tomatoes.

  18. Experimental manipulation of population-level MHC diversity controls pathogen virulence evolution in Mus musculus.

    Science.gov (United States)

    Cornwall, D H; Kubinak, J L; Zachary, E; Stark, D L; Seipel, D; Potts, W K

    2018-02-01

    The virulence levels attained by serial passage of pathogens through similar host genotypes are much higher than observed in natural systems; however, it is unknown what keeps natural virulence levels below these empirically demonstrated maximum levels. One hypothesis suggests that host diversity impedes pathogen virulence, because adaptation to one host genotype carries trade-offs in the ability to replicate and cause disease in other host genotypes. To test this hypothesis, with the simplest level of population diversity within the loci of the major histocompatibility complex (MHC), we serially passaged Friend virus complex (FVC) through two rounds, in hosts with either the same MHC genotypes (pure passage) or hosts with different MHC genotypes (alternated passage). Alternated passages showed a significant overall reduction in viral titre (31%) and virulence (54%) when compared to pure passages. Furthermore, a resistant host genotype initially dominated any effects due to MHC diversity; however, when FVC was allowed to adapt to the resistant host genotype, predicted MHC effects emerged; that is, alternated lines show reduced virulence. These data indicate serial exposure to diverse MHC genotypes is an impediment to pathogen adaptation, suggesting genetic variation at MHC loci is important for limiting virulence in a rapidly evolving pathogen and supports negative frequency-dependent selection as a force maintaining MHC diversity in host populations. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

  19. Access and benefit sharing (ABS) under the convention on biological diversity (CBD): implications for microbial biological control

    Science.gov (United States)

    Researchers and implementers of biological control are confronted with a variety of scientific, regulatory and administrative challenges to their biological control programs. One developing challenge will arise from the implementation of provisions of the Convention on Biological Diversity (CBD) co...

  20. Biology and control of Varroa destructor.

    Science.gov (United States)

    Rosenkranz, Peter; Aumeier, Pia; Ziegelmann, Bettina

    2010-01-01

    The ectoparasitic honey bee mite Varroa destructor was originally confined to the Eastern honey bee Apis cerana. After a shift to the new host Apis mellifera during the first half of the last century, the parasite dispersed world wide and is currently considered the major threat for apiculture. The damage caused by Varroosis is thought to be a crucial driver for the periodical colony losses in Europe and the USA and regular Varroa treatments are essential in these countries. Therefore, Varroa research not only deals with a fascinating host-parasite relationship but also has a responsibility to find sustainable solutions for the beekeeping. This review provides a survey of the current knowledge in the main fields of Varroa research including the biology of the mite, damage to the host, host tolerance, tolerance breeding and Varroa treatment. We first present a general view on the functional morphology and on the biology of the Varroa mite with special emphasis on host-parasite interactions during reproduction of the female mite. The pathology section describes host damage at the individual and colony level including the problem of transmission of secondary infections by the mite. Knowledge of both the biology and the pathology of Varroa mites is essential for understanding possible tolerance mechanisms in the honey bee host. We comment on the few examples of natural tolerance in A. mellifera and evaluate recent approaches to the selection of Varroa tolerant honey bees. Finally, an extensive listing and critical evaluation of chemical and biological methods of Varroa treatments is given. This compilation of present-day knowledge on Varroa honey bee interactions emphasizes that we are still far from a solution for Varroa infestation and that, therefore, further research on mite biology, tolerance breeding, and Varroa treatment is urgently needed. Copyright 2009 Elsevier Inc. All rights reserved.

  1. Biological activity of the mite Sancassania sp. (Acari: Acaridae from bat guano associated with the pathogenic fungus Histoplasma capsulatum

    Directory of Open Access Journals (Sweden)

    Daniel A Estrada-Bárcenas

    2010-03-01

    Full Text Available Mites and the mammal pathogenic fungus Histoplasma capsulatum are the major components of bat guano microbiota. Interactions between mites and H. capsulatum were evaluated under laboratory conditions. Acarid mites, mainly Sancassania sp., were the most abundant microarthropod in the sampled guano of the Mexican bat Tadarida brasiliensis mexicana and, based on its morphology, Sancassania sp. was similar to the cosmopolitan species Sancassania sphaerogaster. The mycophagous and vectoring activities of this mite were tested for H. capsulatum and two other fungal species, Sporothrix schenckii (pathogenic and Aspergillus sclerotiorum (non-pathogenic. S. ca. sphaerogaster was able to reproduce in H. capsulatum and S. schenckii colonies, multiplying in great numbers under controlled fungal mycelial-phase culture conditions. H. capsulatum colonies were completely destroyed after 14 days of in vitro interaction with mites. In contrast, S. ca. sphaerogaster did not reproduce in A. sclerotiorum cultures. S. ca. sphaerogaster was found vectoring H. capsulatum, but not the two other fungal species studied.

  2. Gene Expression Platform for Synthetic Biology in the Human Pathogen Streptococcus pneumoniae

    NARCIS (Netherlands)

    Sorg, Robin A; Kuipers, Oscar P; Veening, Jan-Willem

    2015-01-01

    The human pathogen Streptococcus pneumoniae (pneumococcus) is a bacterium that owes its success to complex gene expression regulation patterns on both the cellular and the population level. Expression of virulence factors enables a mostly hazard-free presence of the commensal, in balance with the

  3. Fungal life-styles and ecosystem dynamics: biological aspects of plant pathogens, plant endophytes and saprophytes

    Science.gov (United States)

    Rodriguez, R.J.; Redman, R.S.

    1997-01-01

    This chapter discusses various biochemical, genetic, ecological, and evolutionary aspects of fungi that express either symbiotic or saprophytic life-styles. An enormous pool of potential pathogens exists in both agricultural and natural ecosystems, and virtually all plant species are susceptible to one or more fungal pathogens. Fungal pathogens have the potential to impact on the genetic structure of populations of individual plant species, the composition of plant communities and the process of plant succession. Endophytic fungi exist for at least part of their life cycles within the tissues of a plant host. This group of fungi is distinguished from plant pathogens because they do not elicit significant disease symptoms. However, endophytes do maintain the genetic and biochemical mechanisms required for infection and colonization of plant hosts. Fungi that obtain chemical nutrients from dead organic matter are known as saprophytes and are critical to the dynamics and resilience of ecosystems. There are two modes of saprophytic growth: one in which biomolecules that are amenable to transport across cell walls and membranes are directly absorbed, and another in which fungi must actively convert complex biopolymers into subunit forms amenable to transportation into cells. Regardless of life-style, fungi employ similar biochemical mechanisms for the acquisition and conversion of nutrients into complex biomolecules that are necessary for vegetative growth, production and dissemination of progeny, organismal competition, and survival during periods of nutrient deprivation or environmental inclemency.

  4. Integrating concepts of landscape ecology with the molecular biology of forest pathogens

    Science.gov (United States)

    John E. Lundquist; Ned B. Klopfenstein

    2001-01-01

    Increasingly more research has focused on characterizing diversity within forest pathogen populations using molecular markers but few studies have characterized features of the landscape that help create or maintain this diversity. Forest diseases commonly occur in patchy distributions across natural landscapes which can be reflected in the genetic composition of the...

  5. Thermal control of some post-harvest rot pathogens of Irish potato (solanum tuberosum l.)

    OpenAIRE

    Salami Olusola Abiodun; Popoola Omololu Olumide

    2007-01-01

    Thermal control effect on the incidence of some post-harvest rot pathogens of Solanum tuberosum (potato) was investigated in this study. Three cultivars of potato tuber whose local names are, Patiska, Mai Bawondoya and Nicola were used for the study. Five pathogenic fungi viz: Botryodiplodia theobromae, Fusarium redolens, Fusarium oxysporum, Penicillium sp. and Rhizopus oryzae associated with post harvest storage rot of root-tubers, were isolated from diseased potatoes. Among the three specie...

  6. Pathogen detection, testing, and control in fresh broccoli sprouts

    Directory of Open Access Journals (Sweden)

    Fahey Jed W

    2006-04-01

    Full Text Available Abstract Background The recent increased interest in consuming green vegetable sprouts has been tempered by the fact that fresh sprouts can in some cases be vehicles for food-borne illnesses. They must be grown according to proper conditions of sanitation and handled as a food product rather than as an agricultural commodity. When sprouts are grown in accordance with the criteria proposed from within the sprout industry, developed by regulatory agencies, and adhered to by many sprouters, green sprouts can be produced with very low risk. Contamination may occur when these guidelines are not followed. Methods A one year program of microbial hold-and-release testing, conducted in concert with strict seed and facility cleaning procedures by 13 U.S. broccoli sprout growers was evaluated. Microbial contamination tests were performed on 6839 drums of sprouts, equivalent to about 5 million consumer packages of fresh green sprouts. Results Only 24 (0.75% of the 3191 sprout samples gave an initial positive test for Escherichia coli O157:H7 or Salmonella spp., and when re-tested, 3 drums again tested positive. Composite testing (e.g., pooling up to 7 drums for pathogen testing was equally sensitive to single drum testing. Conclusion By using a "test-and-re-test" protocol, growers were able to minimize crop destruction. By pooling drums for testing, they were also able to reduce testing costs which now represent a substantial portion of the costs associated with sprout growing. The test-and-hold scheme described herein allowed those few batches of contaminated sprouts to be found prior to packaging and shipping. These events were isolated, and only safe sprouts entered the food supply.

  7. Suitability of Commercial Transport Media for Biological Pathogens under Nonideal Conditions

    Science.gov (United States)

    2011-01-01

    water and was made in-house. For the liquid transport media, one milliliter of each was added to sterile transport tubes containing a sponge (kindly...for microorganisms capable of sporulation in nutrient-poor transport media. Unfortunately, if a sample slowly converts from the vegetative to the...Efficient methods for large-area surface sampling of sites contaminated with pathogenic microorgan - isms and other hazardous agents: current state, needs

  8. Biology of Leptoypha hospita (Hemiptera: Tingidae), a Potential Biological Control Agent of Chinese Privet

    Science.gov (United States)

    Yanzhuo Zhang; James L. Hanula; Scott Horn; Kristine Braman; Jianghua Sun

    2011-01-01

    The biology of Leptoypha hospita Drake et Poor (Hemiptera: Tingidae), a potential biological control agent from China for Chinese privet, Ligustrum sinense Lour., was studied in quarantine in the United States. Both nymphs and adults feed on Chinese privet mesophyll cells that lead to a bleached appearance of leaves and dieback of branch tips. L. hospita has five...

  9. Microbial Inhibition of Fusarium Pathogens and Biological Modification of Trichothecenes in Cereal Grains

    Directory of Open Access Journals (Sweden)

    Urszula Wachowska

    2017-12-01

    Full Text Available Fungi of the genus Fusarium infect cereal crops during the growing season and cause head blight and other diseases. Their toxic secondary metabolites (mycotoxins contaminate grains. Several dozen toxic compounds produced by fungal pathogens have been identified to date. Type B trichothecenes—deoxynivalenol, its acetyl derivatives and nivalenol (produced mainly by F. graminearum and F. culmorum—are most commonly detected in cereal grains. “T-2 toxin” (produced by, among others, F. sporotrichioides belongs to type-A trichothecenes which are more toxic than other trichothecenes. Antagonistic bacteria and fungi can affect pathogens of the genus Fusarium via different modes of action: direct (mycoparasitism or hyperparasitism, mixed-path (antibiotic secretion, production of lytic enzymes and indirect (induction of host defense responses. Microbial modification of trichothecenes involves acetylation, deacetylation, oxidation, de-epoxidation, and epimerization, and it lowers the pathogenic potential of fungi of the genus Fusarium. Other modifing mechanisms described in the paper involve the physical adsorption of mycotoxins in bacterial cells and the conjugation of mycotoxins to glucose and other compounds in plant and fungal cells. The development of several patents supports the commercialization and wider application of microorganisms biodegrading mycotoxins in grains and, consequently, in feed additives.

  10. Selection of Trichoderma isolates for biological control of Sclerotinia minor and S. sclerotiorum in lettuce

    Directory of Open Access Journals (Sweden)

    Luciana Mecatti Elias

    Full Text Available ABSTRACT Lettuce drop is one of the most important and difficult-to-control diseases affecting lettuce in Brazil and worldwide. This study was carried out to select Trichoderma isolates antagonistic to Sclerotinia minor and S. sclerotiorum, aiming to develop biological control for this pathosystem in Brazil. Thirty-one Trichoderma isolates were obtained with the use of baits and were tested under laboratory conditions for their ability to control S. minor and S. sclerotiorum in seedlings of lettuce cultivar Tainá cultured in Petri dishes containing water-agar medium. Subsequently, four isolates effective for control and showing high sporulation under laboratory conditions were evaluated in greenhouse in two experiments carried out with both pathogens in lettuce seedlings of the same cultivar. Twenty-two isolates showed ability to control S. minor and S. sclerotiorum in the in vitro experiments. The isolates tested under greenhouse conditions, identified as T. asperellum (IBLF 897, IBLF 904 and IBLF 914 and T. asperelloides (IBLF 908, reduced lettuce drop of seedlings caused by both pathogens but were more effective against S. minor. Biological control is a promising technology for the management of lettuce drop, especially because S. minor is the predominant species in infested lettuce fields in Brazil.

  11. Engineering Biology by Controlling Tissue Folding.

    Science.gov (United States)

    Hookway, Tracy A

    2018-04-01

    Achieving complex self-organization in vitro has remained a fundamental challenge in tissue engineering. A recent study in Developmental Cell by Hughes and colleagues uses computational and experimental approaches to understand and control the morphogenic process of tissue folding. These approaches provide an engineering framework to reproducibly control tissue shape. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Explaining Biological Functionality: Is Control Theory Enough ...

    African Journals Online (AJOL)

    I argue that the etiological approach, as understood in terms of control theory, suffers from a problem of symmetry, by which function can equally well be placed in the environment as in the organism. Focusing on the autonomy view, I note that it can be understood to some degree in terms of control theory in its version called ...

  13. Biological and application-oriented factors influencing plant disease suppression by biological control: a meta-analytical review.

    Science.gov (United States)

    Ojiambo, P S; Scherm, H

    2006-11-01

    ABSTRACT Studies to evaluate the effectiveness of biological control in suppressing plant disease often report inconsistent results, highlighting the need to identify general factors that influence the success or failure of biological control in plant pathology. We conducted a quantitative synthesis of previously published research by applying meta-analysis to determine the overall effectiveness of biocontrol in relation to biological and application-oriented factors. For each of 149 entries (antagonist-disease combinations) from 53 reports published in Biological & Cultural Tests between 2000 and 2005, an effect size was calculated as the difference in disease intensity expressed in standard deviation units between the biocontrol treatment and its corresponding untreated control. Effect sizes ranged from -1.15 (i.e., disease strongly enhanced by application of the biocontrol agent) to 4.83 (strong disease suppression by the antagonist) with an overall weighted mean of 0.62, indicating moderate effectiveness on average. There were no significant (P >0.05) differences in effect sizes between entries from studies carried out in the greenhouse versus the field, between those involving soilborne versus aerial diseases, or among those carried out in conditions of low, medium, or high disease pressure (expressed relative to the disease intensity in the untreated control). However, effect sizes were greater on annual than on perennial crops, regardless of whether the analysis was carried out for all entries (P = 0.0268) or for those involving only soilborne diseases (P = 0.0343). Effect sizes were not significantly different for entries utilizing fungal versus bacterial biocontrol agents or for those targeting fungal versus bacterial pathogens. However, entries that used r-selected biological control agents (i.e., those having short generation times and producing large numbers of short-lived offspring) were more effective than those that applied antagonists that were not

  14. Controlling spread of the oak wilt pathogen (Ceratocystis fagacearum) in a Minnesota urban forest park reserve

    Science.gov (United States)

    Jennifer Juzwik; Joseph O' Brien; Charles Evenson; Paul Castillo; Graham. Mahal

    2010-01-01

    Effectiveness of oak wilt control actions taken between 1997 and 1999 were evaluated for an urban forest park reserve in Minnesota, U.S. A high level of success (84% of evaluated disease centers) was achieved in controlling belowground spread of the vascular pathogen for four to six years by mechanically disrupting inter-tree root connections with the blade of a cable...

  15. 9 CFR 381.94 - Contamination with Microorganisms; process control verification criteria and testing; pathogen...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Contamination with Microorganisms... § 381.94 Contamination with Microorganisms; process control verification criteria and testing; pathogen... maintaining process controls sufficient to prevent fecal contamination. FSIS shall take further action as...

  16. ENGINEERING OF PEPTIDOGLYCAN HYDROLASES FOR CONTROL OF PATHOGENIC BACTERIA

    Science.gov (United States)

    Bacteriophages are viruses exclusively infecting bacteria and therefore offer suitable tools for their detection and control. At the end of their multiplication cycle, most phages lyse their hosts from within by means of an endolysin (peptidoglycan hydrolase), thereby enabling release of the phage p...

  17. Biological control of tortricids and aphids in strawberries

    DEFF Research Database (Denmark)

    Sigsgaard, Lene; Enkegaard, Annie; Eilenberg, Jørgen

    Cropping practice and biological control can contribute to reduced pesticide use in strawberries. Organic strawberries are less attacked by strawberry tortricid and buckwheat flower strips can augment its natural enemies. Against shallot aphid the two-spot ladybird is promising....

  18. Arms Control: US and International efforts to ban biological weapons

    Energy Technology Data Exchange (ETDEWEB)

    1992-12-01

    The Bacteriological (Biological) and Toxin Weapons Convention, the treaty that bans the development, production, and stockpiling and acquisition of biological weapons was opened for signature in 1972 and came into force in 1975 after being ratified by 22 governments, including the depository nations of the USA, the United Kingdom, and the former Soviet Union. In support of the Convention, the USA later established export controls on items used to make biological weapons. Further, in accordance with the 1990 President`s Enhanced Proliferation Control Initiative, actions were taken to redefine and expand US export controls, as well as to encourage multilateral controls through the Australia Group. Thus far, the Convention has not been effective in stopping the development of biological weapons. The principal findings as to the reasons of the failures of the Convention are found to be: the Convention lacks universality, compliance measures are effective, advantage of verification may outweigh disadvantages. Recommendations for mitigating these failures are outlined in this report.

  19. Domestic geese: biological weed control in an agricultural setting.

    Science.gov (United States)

    Tricia L. Wurtz

    1995-01-01

    Vertebrate herbivores can be effective agents of biological weed control in certain applications. I compared the use of domestic geese for weed control in an agricultural field with the herbicide hexazinone and with hand control. Newly planted spruce seedlings acted as a prototype crop that would be unpalatable to the geese. Trampling by geese led to as much as 47%...

  20. Isolation of microorganisms for biological control the moniliophthora roreri

    OpenAIRE

    suarez contreras, liliana yanet; Rangel Riaño, Alba Luz

    2014-01-01

    Moniliophlhora roreri is the causal agent of cocoa Moniliasis, which produces losses of up to 60% of the crop, as it affects only its commercial product, the cob. Biological control appears as an alternative management, using endophytic microorganisms. The reason because of this research came up was that it was aimed to isolate microorganisms with antagonist potential for biological control towards the phytopathogen M. roreri in Norte de Santander. This is done through isolation and identifica...

  1. Biology and control of hemlock woolly adelgid

    Science.gov (United States)

    Nathan P. Havill; Ligia C. Vieira; Scott M. Salom

    2014-01-01

    This publication is a substantial revision of FHTET 2001-03, Hemlock Woolly Adelgid, which was published in 2001. This publication contains information on the native range of hemlock and range of hemlock woolly adelgid, the importance of hemlocks in eastern forest ecosystems, and on hosts, life cycle, control, and population trends of the hemlock woolly adelgid.

  2. Project Summary: Biology-Inspired Autonomous Control

    Science.gov (United States)

    2011-02-01

    stabilization system will appear as image blur. In the early half of the 20th century, mathematicians such as Norbert Wiener and colleagues...Interscience Publications. 3. Wiener , N., 1948, Cybernetics: Or Control and Communication in the Animal and the Machine, MIT Press, Cambridge Mass. 4

  3. Controllability and observability of Boolean networks arising from biology

    Science.gov (United States)

    Li, Rui; Yang, Meng; Chu, Tianguang

    2015-02-01

    Boolean networks are currently receiving considerable attention as a computational scheme for system level analysis and modeling of biological systems. Studying control-related problems in Boolean networks may reveal new insights into the intrinsic control in complex biological systems and enable us to develop strategies for manipulating biological systems using exogenous inputs. This paper considers controllability and observability of Boolean biological networks. We propose a new approach, which draws from the rich theory of symbolic computation, to solve the problems. Consequently, simple necessary and sufficient conditions for reachability, controllability, and observability are obtained, and algorithmic tests for controllability and observability which are based on the Gröbner basis method are presented. As practical applications, we apply the proposed approach to several different biological systems, namely, the mammalian cell-cycle network, the T-cell activation network, the large granular lymphocyte survival signaling network, and the Drosophila segment polarity network, gaining novel insights into the control and/or monitoring of the specific biological systems.

  4. Biological effect of penetration controlled irradiation with ion beams

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Atsushi; Shimizu, Takashi; Kikuchi, Masahiro; Kobayashi, Yasuhiko; Watanabe, Hiroshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Yamashita, Takao

    1997-03-01

    To investigate the effect of local irradiation with ion beams on biological systems, technique for penetration controlled irradiation has been established. The range in a target was controlled by changing the distance from beam window in the atmosphere, and could be controlled linearly up to about 31 {mu}m in biological material. In addition, the effects of the penetration controlled irradiations with 1.5 MeV/u C and He ions were examined using tobacco pollen. The increased frequency of leaky pollen produced by ion beams suggests that the efficient pollen envelope damages would be induced at the range-end of ion beams. (author)

  5. Phenotypic charactheristics of fluorescent pseudomonss, biological control agent of lincat disease of temanggung tobacco

    Directory of Open Access Journals (Sweden)

    NINING NURUL AZIZAH

    2007-04-01

    Full Text Available Fluorescent pseudomonass isolated from local plants-rishosphere in temanggung controlled lincat disease of tobacco. This report describe phenotypic charactheristics of the bacteria in order to be used as a base for the development of the bacteria as a biological control agent of lincat disease. Phenotypic charactheristics of six isolates of fluorescent Pseudomonass which controlled lincat disease in the field were determined in the laboratory of Plant Bacteriology, Faculty of Agriculture, Gadjah Mada University. Plant pathogenicity tests were conducted by hypersensitive reaction into tobacco leaf and inoculation to tobacco plants. Antagonism test between fluorescent Pseudomonass and other candidate of biological control agents were also conducted. The results indicated that the bacteria were rod shape, Gram negative, positive reaction in catalase and oxidase tests. Nitrate reduce to nitrite, arginine was hydrolysed, fluorescent pigment were produced on King’s B medium, levan formation positive and all bacteria denitrifiy. The bacteria used urea, tween 80 and amylum were not hydrolised, poly--hydroxybutyrate was not accumulated in the cells. Negative reactions were observed for lysine decarboxylation, indol production, VP/MR reaction, and gelatn liquefation. Some compounds could be used as solely carbon sources. All isolates grew on the medium containing 2% NaCl. The best pH for growth was 6-7 and all isolates grew at 20-41C. Negative result were obtained for hypersensitive reaction and pathogenicity tests.

  6. Genetic diversity in the oral pathogen Porphyromonas gingivalis: molecular mechanisms and biological consequences

    Science.gov (United States)

    Tribble, Gena D; Kerr, Jennifer E; Wang, Bing-Yan

    2013-01-01

    Porphyromonas gingivalis is a Gram-negative anaerobic bacterium that colonizes the human oral cavity. It is implicated in the development of periodontitis, a chronic periodontal disease affecting half of the adult population in the USA. To survive in the oral cavity, these bacteria must colonize dental plaque biofilms in competition with other bacterial species. Long-term survival requires P. gingivalis to evade host immune responses, while simultaneously adapting to the changing physiology of the host and to alterations in the plaque biofilm. In reflection of this highly variable niche, P. gingivalis is a genetically diverse species and in this review the authors summarize genetic diversity as it relates to pathogenicity in P. gingivalis. Recent studies revealing a variety of mechanisms by which adaptive changes in genetic content can occur are also reviewed. Understanding the genetic plasticity of P. gingivalis will provide a better framework for understanding the host–microbe interactions associated with periodontal disease. PMID:23642116

  7. Asymmetric total synthesis of 6-Tuliposide B and its biological activities against tulip pathogenic fungi.

    Science.gov (United States)

    Shigetomi, Kengo; Omoto, Shoko; Kato, Yasuo; Ubukata, Makoto

    2011-01-01

    The structure-activity relationship was investigated to evaluate the antifungal activities of tuliposides and tulipalins against tulip pathogenic fungi. 6-Tuliposide B was effectively synthesized via the asymmetric Baylis-Hillman reaction. Tuliposides and tulipalins showed antifungal activities against most of the strains tested at high concentrations (2.5 mM), while Botrytis tulipae was resistant to tuliposides. Tulipalin formation was involved in the antifungal activity, tulipalin A showed higher inhibitory activity than 6-tuliposide B and tulipalin B. Both the tuliposides and tulipalins showed pigment-inducing activity against Gibberella zeae and inhibitory activity against Fusarium oxysporum f. sp tulipae. These activities were induced at a much lower concentration (0.05 mM) than the antifungal MIC values.

  8. Ecology of Pathogen Groups: Fungi

    DEFF Research Database (Denmark)

    Hajek, Ann E.; Meyling, Nicolai Vitt

    2018-01-01

    Summary This chapter investigates the recent results of studies of the ecology of fungal pathogens, including ecological insights obtained by implementation of molecular tools. It spans a spectrum of invertebrates as hosts, although emphasis will be on pathogens of terrestrial insects, which have...... been the focus of most ecological research. Some taxa of invertebrate pathogenic fungi have evolved adaptations for utilizing living plants as substrates, and these lifestyles have recently received increased attention from researchers following the initial documentations of such plant associations...... by Beauveria and Metarhizium. This topic has recently been reviewed; the chapter mainly focuses on aspects of ecological relevance, including trophic interactions. Fungal pathogens are used to provide biological control in numerous ways. The primary type of biological control emphasized for fungal pathogens...

  9. Biological control of banana black Sigatoka disease with Trichoderma

    OpenAIRE

    Poholl Adan Sagratzki Cavero; Rogério Eiji Hanada; Luadir Gasparotto; Rosalee Albuquerque Coelho Neto; Jorge Teodoro de Souza

    2015-01-01

    Black Sigatoka disease caused by Mycosphaerella fijiensis is the most severe banana disease worldwide. The pathogen is in an invasive phase in Brazil and is already present in most States of the country. The potential of 29 isolates of Trichoderma spp. was studied for the control of black Sigatoka disease under field conditions. Four isolates were able to significantly reduce disease severity and were further tested in a second field experiment. Isolate 2.047 showed the best results in both f...

  10. Use of Epidemiologic Models in the Control of Highly Pathogenic Avian Influenza

    NARCIS (Netherlands)

    Stegeman, J.A.; Bouma, A.; Jong, de M.C.M.

    2010-01-01

    In the past decades, mathematical models have become more and more accepted as a tool to develop surveillance programs and to evaluate the efficacy of intervention measures for the control of infectious diseases such as highly pathogenic avian influenza. Predictive models are used to simulate the

  11. Controlling risks of pathogen transmission by flies on organic pig farms

    NARCIS (Netherlands)

    Meerburg, B.G.; Vermeer, H.M.; Kijlstra, A.

    2007-01-01

    Fly prevention and control on animal production units is necessary to prevent the transmission of pathogens that could affect animal and human health and the maintenance of good hygiene. Organic farmers are often hesitant to apply insecticides for this purpose because of their farming philosophy.

  12. Non-Mendelian segregation influences the infection biology and genetic structure of the African tree pathogen Ceratocystis albifundus.

    Science.gov (United States)

    Lee, Dong-Hyeon; Roux, Jolanda; Wingfield, Brenda D; Wingfield, Michael J

    2018-04-01

    The African fungal tree pathogen, Ceratocystis albifundus, undergoes uni-directional mating type switching, giving rise to either self-fertile or self-sterile progeny. Self-sterile isolates lack the MAT1-2-1 gene and have reduced fitness such as slower growth and reduced pathogenicity, relative to self-fertile isolates. While it has been hypothesized that there is a 1:1 ratio of self-fertile to self-sterile ascospore progeny in relatives of C. albifundus, some studies have reported a significant bias in this ratio. This could be due to the fact that either fewer self-sterile ascospores are produced or that self-sterile ascospores have low viability. We quantified the percentage of self-sterile and self-fertile ascospores from ascospore masses in C. albifundus using real-time PCR. Primers were designed to distinguish between spores that contained the MAT1-2-1 gene and those where this gene had been deleted. A significant bias towards the self-fertile mating type was observed in all single ascospore masses taken from sexual structures produced in haploid-selfed cultures. The same result was observed from a disease outbreak situation in an intensively managed field of cultivated native trees, and this was coupled with very low population diversity in the pathogen. This was in contrast to the results obtained from ascospore masses taken from the crosses performed under laboratory conditions or ascomata on native trees in a non-disease situation, where either self-fertile or self-sterile ascospores were dominant. The results suggest that reproductive strategies play a significant role in the infection biology and genetic structure of C. albifundus populations. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  13. Biological control by ( Coccinella algerica , Kovar 1977) against the ...

    African Journals Online (AJOL)

    Inputs from chemicals, particularly pesticides, to control crop pests have adverse effects on soil and the environment, among others. To reduce pest attacks, biological control with indigenous predators is the alternative and the cleanest, most environmentally friendly and ecologically balanced way. In order to achieve this ...

  14. Protecting Ecosystems by way of Biological Control: Cursory ...

    African Journals Online (AJOL)

    ... Act 10 of 2004. It also considers possible future developments on the regulatio n ofbiological control agents. KEYWORDS: Biological control and regulation, alien and invasive plants, alien and invasive species, ecosystem, ecosystem services, biodiversity, Conservation of Agricultural Resources Act, Agricultural Pests Act, ...

  15. Biological control of Salvinia molesta in some areas of Moremi ...

    African Journals Online (AJOL)

    Biological control of Salvinia molesta in some areas of Moremi Game Reserve, Botswana. ... Random samples of salvinia were collected from each site at monthly intervals in 1998 to extract weevils and to demonstrate the effect of weevil on the weed. The rate at which the weed was controlled at different sites varied with ...

  16. Environmental Impacts of Arthropod Biological Control: An Ecological Perspective

    Science.gov (United States)

    Arthropod biological control has long been used against insect and mite pests in agriculture production systems, forests, and other natural ecosystems. Depending on the methods of deploying natural enemies and the type of control agents (herbivores, parasitoids, and/or predators), potential environ...

  17. Augmentative biological control of arthropods in Latin America

    NARCIS (Netherlands)

    Lenteren, van J.C.; Bueno, V.H.P.

    2003-01-01

    Augmentative forms of biological control, where natural enemies are periodically introduced, are applied over large areas in various cropping systems in Latin America. About 25% of the world area under augmentative control is situated in this region. Well-known examples are the use of species of the

  18. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Directory of Open Access Journals (Sweden)

    Sandra Pritzkow

    Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological

  19. Effectiveness of biological control of Phytophthora capsici in pepper by Trichoderma asperellum strain T34

    Directory of Open Access Journals (Sweden)

    Guillem SEGARRA

    2013-05-01

    Full Text Available Pepper (Capsicum annuum L., one of the most widely grown vegetables worldwide, is susceptible to root rot caused by Phytophthora capsici. Many biocides have recently been banned in Europe because of human health and environmental concerns. Integrated pest management is a European priority, where biological control together with other agronomic practices should replace pesticide management of plant diseases in the future. Application of different concentrations of the fungus Trichoderma asperellum strain T34 (the in T34 Biocontrol® on incidence of disease caused by P. capsici in pepper was studied. Different methods of application of the microbial control agent and inoculation of the pathogen were examined. T34 and etridiazole (Terrazole® were compared for their ability to suppress P. capsici. T34 reduced disease in most of the assayed situations (up to 71% disease reduction, while etridiazole was effective only when applied at the same time as the pathogen. The results obtained are discussed on the basis of the different modes of action of T34 and etridiazole. T34 is a useful biological alternative to chemicals for the control of P. capsici in pepper.

  20. Methods for the Control of Foodborne Pathogens in Low-Moisture Foods.

    Science.gov (United States)

    Sánchez-Maldonado, Alma Fernanda; Lee, Alvin; Farber, Jeffrey M

    2018-03-25

    Low-moisture foods (LMFs) have been defined as those food products with a water activity (a w ) less than 0.85 and are generally considered less susceptible to microbial spoilage and the growth of foodborne pathogens. However, in recent years, outbreaks linked to LMFs have increased, with Salmonella spp., Bacillus cereus, Cronobacter sakazakii, Clostridium spp., Escherichia coli O157:H7, non-O157 E. coli, and Staphylococcus aureus being the principal pathogens involved. Because of the new concerns raised as a result of recent outbreaks, new approaches need to be developed to control foodborne pathogens in LMFs. This review summarizes the recent research on novel inactivation methods suitable for use on LMFs. Among the methods discussed are the nonthermal inactivation methods as well as other novel methods such as radio-frequency and microwave heating. Additional research is needed to evaluate older technologies and develop new technologies, either alone or in combination, to understand the mechanisms of inactivation.

  1. Subolesin/Akirin vaccines for the control of arthropod vectors and vectorborne pathogens.

    Science.gov (United States)

    de la Fuente, J; Moreno-Cid, J A; Galindo, R C; Almazan, C; Kocan, K M; Merino, O; Perez de la Lastra, J M; Estrada-Peña, A; Blouin, E F

    2013-11-01

    Diseases transmitted by arthropod vectors such as mosquitoes, ticks and sand flies greatly impact human and animal health, and therefore, their control is important for the eradication of vectorborne diseases (VBD). Vaccination is an environmentally friendly alternative for vector control that allows control of several VBD by targeting their common vector. Recent results have suggested that subolesin (SUB) and its orthologue in insects, akirin (AKR) are good candidate antigens for the control of arthropod vector infestations and pathogen infection. SUB was discovered as a tick-protective antigen in Ixodes scapularis. Vaccination trials with recombinant SUB/AKR demonstrated effective control of arthropod vector infestations in various hard and soft tick species, mosquitoes, sand flies, poultry red mites and sea lice by reducing their numbers, weight, oviposition, fertility and/or moulting. SUB/AKR vaccination also reduced tick infection with tickborne pathogens, Anaplasma phagocytophilum, A. marginale, Babesia bigemina and Borrelia burgdorferi. The effect of vaccination on different hosts, vector species, developmental stages and vectorborne pathogen infections demonstrated the feasibility of SUB/AKR universal vaccines for the control of multiple vector infestations and for reduction in VBD. © 2013 Blackwell Verlag GmbH.

  2. Genetics of mechanisms controlling responses to two major pathogens in broiler and layer chickens

    DEFF Research Database (Denmark)

    Hamzic, Edin

    The objective of this thesis was to improve the understanding of molecular mechanisms controlling the response to two major pathogens, Eimeria maxima (coccidiosis) and infectious bronchitis virus (IBV), in broiler and layer chickens, respectively. Breeding for the improved response to the two...... pathogens is a possible complementary approach for their control in poultry production. A key step is to understand the molecular mechanisms controlling the host’s response to a disease. For E. maxima, a large-scale challenge study on Cobb500 broilers and a follow-up genome-wide association study (GWAS......), respectively. MBL plays a key role in innate immunity which is crucial for improving disease resistance. We observed large differences in the immune parameters and the spleen transcriptome profiles for uninfected and IBV infected birds between the two MBL lines. The large differences in expression of genes...

  3. Impulsive Biological Pest Control Strategies of the Sugarcane Borer

    Directory of Open Access Journals (Sweden)

    Marat Rafikov

    2012-01-01

    Full Text Available We propose an impulsive biological pest control of the sugarcane borer (Diatraea saccharalis by its egg parasitoid Trichogramma galloi based on a mathematical model in which the sugarcane borer is represented by the egg and larval stages, and the parasitoid is considered in terms of the parasitized eggs. By using the Floquet theory and the small amplitude perturbation method, we show that there exists a globally asymptotically stable pest-eradication periodic solution when some conditions hold. The numerical simulations show that the impulsive release of parasitoids provides reliable strategies of the biological pest control of the sugarcane borer.

  4. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2009-12-01

    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method.Methods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued .Results: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months.Conclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed. 

  5. Biological screening of araripe basin medicinal plants using Artemia salina Leach and pathogenic bacteria.

    Science.gov (United States)

    da Costa, José Galberto M; Campos, Adriana R; Brito, Samara A; Pereira, Carla Karine B; Souza, Erlânio O; Rodrigues, Fabíola Fernandes G

    2010-10-01

    Many medicinal plant species from the Araripe Basin are widely known and used in folk medicine and for commercial manufacturing of phytotherapeutic products. Few ethnobotanical and pharmacological studies have been undertaken in this region, however, in spite of the great cultural and biological diversity found there. Extracts of 11 plant species collected from Ceará state, Brazil, were subjected to the brine shrimp lethality test in order to detect potential sources of novel cytotoxic, antitumor compounds. The larvicidal activity, based on the percentage of larval mortality, was evaluated after 24 h exposure to the treatments. All species tested showed good larvicidal activity as compared to a reference compound and literature data. The extract from Vanillosmopsis arborea was the most active with an LC(50) of 3.9 μg/ml. Best results were shown by Lantana montevidensis against Pseudomonas aeruginosa [minimum inhibitory concentration (MIC) 8μg/ml] and Escherichia coli (MIC 32 μg/ml), Zanthoxylum rhoifolium against E. coli (MIC, 256 μg/ml) and Staphylococcus aureus (MIC 64 μg/ml) and Croton zenhtneri against S. aureus (MIC 64 μg/ml). Chemical tests indicated that a wide variety of natural product classes was present in those extracts that showed significant activities in the bioassays.

  6. Biological Screening of Eichornia crassipes against Different Pathogenic Microbes: An In Vitro Study

    Directory of Open Access Journals (Sweden)

    Rubina Rehman

    2016-09-01

    Full Text Available The present research is a biological screening of Eichornia crassipes (Pontederiaceae. Dichloromethane and methanol extracts of the whole plant were investigated for their antibacterial, antifungal, phytotoxic, and cytotoxic activities. The antibacterial activity was evaluated using agar well-diffusion method against Bacillus subtilis, Staphylococcus aureus, Escherichia coli, Shigella flexneri, Pseudomonas aeruginosa, and Salmonella typhi. The antifungal activity was evaluated using the agar tube–dilution method against Candida albicans, Candida glabrata, Aspergillus flavus, Microsporum canis, and Fusarium solani. The phytotoxicity activity was determined using Lemna bioassay against Lemna minor. Brine shrimp–cytotoxicity assay was determined against brine-shrimp larvae. Dichloromethane extract exhibited significant phytotoxicity (100% growth regulation at 1,000 µg/ml concentration against Lemna minor whereas methanolic extracts showed moderate (75% growth regulation phytotoxicity at the same concentration. Methanolic extract showed cytotoxicity at the highest level of dose whereas dichloromethane extract showed no activity having Etoposide as standard drug. Both of the extracts have nonsignificant antifungal and antibacterial activity.

  7. Biological insect control using Metarhizium anisopliae: morphological, molecular, and ecological aspects

    Directory of Open Access Journals (Sweden)

    Patricia Vieira Tiago

    2014-04-01

    Full Text Available Microbial control of insects is based on the rational use of pathogens to maintain environmentally balanced pest population levels, and Metarhizium anisopliae has been the most studied and most utilized fungal species for that purpose. The natural genetic variability of entomopathogenic fungi is considered one of the principal advantages of microbial insect control. The inter- and intraspecific variability and the genetic diversity and population structures of Metarhizium and other entomopathogenic fungi have been examined using ITS-RFLP, ISSR, and ISSP molecular markers. The persistence of M. anisopliae in the soil and its possible effects on the structures of resident microbial communities must be considered when selecting isolates for biological insect control.

  8. Pathogenic characterization of lasiodplodia causing stem end rot of mango and its control using botanicals

    International Nuclear Information System (INIS)

    Ullah, S. F.; Hussain, Y.; Iram, S.

    2017-01-01

    Two widely cultivated mango fruit varieties White chounsa and Sindhri were collected from two major mango growing areas of Punjab and Sindh Provinces of Pakistan. This study was focused on pathological characterization of predominant postharvest diseases such as stem end rot of mango (Mangifera indica) caused by Lasiodiplodia theobromae, and evaluation of bio-control activity by different plant extracts. L. theobromae aggressiveness of isolates was tested by artificial inoculations under controlled conditions, all isolates proved pathogenic in varying degree of aggressiveness on (Sindhri and White chounsa) with reference to control. Calculated standard error mean varied in lesion area produced by pathogens 6-63cm/sup 2/ (Sindhri) and 60-170 cm/sup 2/ (White chounsa). Re-isolation of respective fungi verified the Koch's postulates. Plant extract of Datura stramonium, Aloe-vera, Eucalyptus camaldulensis, were used to control the radial growth of L. theobromae. Comparative analysis showed D. Stramonium and E. camaldulensis extracts most efficiently reduced the growth of Lasiodiplodia isolates, in comparison to Aloe-vera extract, restrict the 15-20% growth. All pathological results and treatments were significant at p<0.05 through ANOVA. This study emphasizes the behavior of pathogens which could be helpful in mango breeding to introduce resistance toward Lasiodiplodia and referred plants provide the best alternative of chemical fungicides. (author)

  9. Dynamics of Introduced Populations of Phragmidium violaceum and Implications for Biological Control of European Blackberry in Australia▿

    OpenAIRE

    Gomez, D. R.; Evans, K. J.; Baker, J.; Harvey, P. R.; Scott, E. S.

    2008-01-01

    Phragmidium violaceum causes leaf rust on the European blackberry (Rubus fruticosus L. aggregate). Multiple strains of this pathogen have been introduced into southern Australia for the biological control of at least 15 taxa of European blackberry, a nonindigenous, invasive plant. In climates conducive to leaf rust, the intensity of disease varies within and among infestations of the genetically variable host. Genetic markers developed from the selective amplification of microsatellite polymo...

  10. Novel Hypovirulence-Associated RNA Mycovirus in the Plant-Pathogenic Fungus Botrytis cinerea: Molecular and Biological Characterization

    Science.gov (United States)

    Yu, Lin; Sang, Wen; Wu, Ming-De; Zhang, Jing; Yang, Long; Zhou, Ying-Jun; Chen, Wei-Dong

    2015-01-01

    Botrytis cinerea is a pathogenic fungus causing gray mold on numerous economically important crops and ornamental plants. This study was conducted to characterize the biological and molecular features of a novel RNA mycovirus, Botrytis cinerea RNA virus 1 (BcRV1), in the hypovirulent strain BerBc-1 of B. cinerea. The genome of BcRV1 is 8,952 bp long with two putative overlapped open reading frames (ORFs), ORF1 and ORF2, coding for a hypothetical polypeptide (P1) and RNA-dependent RNA polymerase (RdRp), respectively. A −1 frameshifting region (designated the KNOT element) containing a shifty heptamer, a heptanucleotide spacer, and an H-type pseudoknot was predicted in the junction region of ORF1 and ORF2. The −1 frameshifting role of the KNOT element was experimentally confirmed through determination of the production of the fusion protein red fluorescent protein (RFP)-green fluorescent protein (GFP) by the plasmid containing the construct dsRed-KNOT-eGFP in Escherichia coli. BcRV1 belongs to a taxonomically unassigned double-stranded RNA (dsRNA) mycovirus group. It is closely related to grapevine-associated totivirus 2 and Sclerotinia sclerotiorum nonsegmented virus L. BcRV1 in strain BerBc-1 was found capable of being transmitted vertically through macroconidia and horizontally to other B. cinerea strains through hyphal contact. The presence of BcRV1 was found to be positively correlated with hypovirulence in B. cinerea, with the attenuation effects of BcRV1 on mycelial growth and pathogenicity being greatly affected by the accumulation level of BcRV1. PMID:25595766

  11. Biological control agent for mosquito larvae: Review on the killifish ...

    African Journals Online (AJOL)

    This review attempts to give an account on the recent advances on the killifish Aphanius dispar dispar as a biological control agent for mosquito larvae. Thirty six (36) articles of literature (scientific papers, technical and workshop reports) on this subject covering the period between 1980 and 2009 were reviewed.

  12. Biological control agent for mosquito larvae: Review on the killifish ...

    African Journals Online (AJOL)

    Jane

    2011-08-15

    Aug 15, 2011 ... Biological control of mosquito larvae by using fish has shown many advantages over ... number of malaria cases in India that has been reduced from 75 million to 150,000 and deaths from 750,000 to ... aquatic weeds and G. affinis on the mosquito larvae. In addition to that G. affinis has some adverse effects ...

  13. Studies on bacterial flora and biological control agent of Cydia ...

    African Journals Online (AJOL)

    In the present study, in order to find a more effective and safe biological control agent against Cydia pomonella, we investigated the bacterial flora and tested them for insecticidal effects on this insect. According to morphological, physiological and biochemical tests, bacterial flora were identified as Proteus rettgeri (Cp1), ...

  14. protecting ecosystems by way of biological control: cursory ...

    African Journals Online (AJOL)

    Jurie Moolman

    three main instruments used to regulate biological control agents in South Africa, namely the Conservation of .... species richness of native ecosystems, they also change the bio-fuel properties of the ecosystem, which in turn affects the ...... are used inadvertently as bio-pesticides for commercial use. Last the issuing authority ...

  15. Controlled release of biologically active silver from nanosilver surfaces.

    Science.gov (United States)

    Liu, Jingyu; Sonshine, David A; Shervani, Saira; Hurt, Robert H

    2010-11-23

    Major pathways in the antibacterial activity and eukaryotic toxicity of nanosilver involve the silver cation and its soluble complexes, which are well established thiol toxicants. Through these pathways, nanosilver behaves in analogy to a drug delivery system, in which the particle contains a concentrated inventory of an active species, the ion, which is transported to and released near biological target sites. Although the importance of silver ion in the biological response to nanosilver is widely recognized, the drug delivery paradigm has not been well developed for this system, and there is significant potential to improve nanosilver technologies through controlled release formulations. This article applies elements of the drug delivery paradigm to nanosilver dissolution and presents a systematic study of chemical concepts for controlled release. After presenting thermodynamic calculations of silver species partitioning in biological media, the rates of oxidative silver dissolution are measured for nanoparticles and macroscopic foils and used to derive unified area-based release kinetics. A variety of competing chemical approaches are demonstrated for controlling the ion release rate over 4 orders of magnitude. Release can be systematically slowed by thiol and citrate ligand binding, formation of sulfidic coatings, or the scavenging of peroxy-intermediates. Release can be accelerated by preoxidation or particle size reduction, while polymer coatings with complexation sites alter the release profile by storing and releasing inventories of surface-bound silver. Finally, the ability to tune biological activity is demonstrated through a bacterial inhibition zone assay carried out on selected formulations of controlled release nanosilver.

  16. Transcription control engineering and applications in synthetic biology

    Directory of Open Access Journals (Sweden)

    Michael D. Engstrom

    2017-09-01

    Full Text Available In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein, a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators (cis-factors were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators (trans-factors, giving examples of how cis- and trans-acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli, we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  17. Transcription control engineering and applications in synthetic biology.

    Science.gov (United States)

    Engstrom, Michael D; Pfleger, Brian F

    2017-09-01

    In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein), a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity) levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators ( cis -factors) were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators ( trans- factors), giving examples of how cis- and trans -acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli , we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  18. Methylene Diphosphonate Chemical and Biological control of MDP complex

    CERN Document Server

    Aungurarat, A

    2000-01-01

    Technetium-9 sup 9 sup m MDP easy prepared from MDP kits which different sources such as OAP (In house), SIGMA. The resulting Tc 9 sup 9 sup m -MDP preparations were controlled in chemical and biological tests to compare the different results in these cases: radiochemical purity, the quantity of starting material and biodistribution result.

  19. Conservation biological control and enemy diversity on a landscape scale

    NARCIS (Netherlands)

    Tscharntke, T.; Bommarco, R.; Clough, Y.; Crist, T.O.; Kleijn, D.; Rand, T.A.; Tylianakis, J.M.; Nouhuys, S.; Vidal, S.

    2007-01-01

    Conservation biological control in agroecosystems requires a landscape management perspective, because most arthropod species experience their habitat at spatial scales beyond the plot level, and there is spillover of natural enemies across the crop–noncrop interface. The species pool in the

  20. Identification and evaluation of Trichogramma parasitoids for biological pest control

    NARCIS (Netherlands)

    Silva, e I.M.M.S.

    1999-01-01

    Egg parasitoids of the genus Trichogramma are used as biological control agents against lepidopterous pests. From the 180 species described world-wide, only 5 have large scale application. The development of better methods to select other

  1. The perception of corn farmers about biological control of Caradrina ...

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... The purpose of this study was to analyze the perception of corn farmers about biological control of. Caradrina by Braconid in Dezful Township, Khouzestan Province, Iran. The method used in this study was correlative descriptive and causal relation. A random sample of Dezful township corn farmers of.

  2. The perception of corn farmers about biological control of Caradrina ...

    African Journals Online (AJOL)

    The purpose of this study was to analyze the perception of corn farmers about biological control of Caradrina by Braconid in Dezful Township, Khouzestan Province, Iran. The method used in this study was correlative descriptive and causal relation. A random sample of Dezful township corn farmers of Khouzestan Province, ...

  3. Stakeholder perceptions: Biological control of Russian olive (Elaeagnus angustifolia)

    Science.gov (United States)

    Sharlene E. Sing; Kevin J. Delaney

    2016-01-01

    An online survey was distributed through email lists provided by various stakeholder groups on behalf of the International Consortium for Biological Control of Russian Olive in spring of 2012. A total of 392 respondents replied from 24 U.S. states and 1 Canadian province. Questions posed in the survey were designed to identify and categorize 1) stakeholders by...

  4. Autophagy response: manipulating the mTOR-controlled machinery by amino acids and pathogens.

    Science.gov (United States)

    Fader, Claudio Marcelo; Aguilera, Milton Osmar; Colombo, María Isabel

    2015-10-01

    Macroautophagy is a self-degradative process that normally maintains cellular homeostasis via a lysosomal pathway. It is induced by different stress signals, including nutrients and growth factors' restriction as well as pathogen invasions. These stimuli are modulated by the serine/threonine protein kinase mammalian target of rapamycin (mTOR) which control not only autophagy but also protein translation and gene expression. This review focuses on the important role of mTOR as a master regulator of cell growth and the autophagy pathway. Here, we have discussed the role of intracellular amino acid availability and intracellular pH in the redistribution of autophagic structures, which may contribute to mammalian target of rapamycin complex 1 (mTORC1) activity regulation. We have also discussed that mTORC1 complex and components of the autophagy machinery are localized at the lysosomal surface, representing a fascinating mechanism to control the metabolism, cellular clearance and also to restrain invading intracellular pathogens.

  5. Control of biological hazards in cold smoked salmon production

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Embarek, Peter Karim Ben; Jeppesen, V.F.

    1995-01-01

    An outline of the common processing technology for cold smoked salmon in Denmark is presented. The safety hazards related to pathogenic bacteria, parasites and biogenic amines are discussed with special emphasis on hazards related to Clostridium botulinum and Listeria monocytogenes. Critical cont...... control points are identified for all hazards except growth of L. monocytogenes. For this reason a limitation of shelf life to three weeks at +5 degrees C far cold smoked vacuum-packed salmon having greater than or equal to 3% water phase salt is recommended...

  6. Biological control of Egyptian broomrape (Orobanche aegyptiaca using Fusarium spp.

    Directory of Open Access Journals (Sweden)

    I. Ghannam

    2007-08-01

    Full Text Available The broomrape (Orobanche spp. is an obligate holoparasitic weed that causes severe damage to many important vegetable crops. Many broomrape control strategies have been tested over the years. In this investigation, 125 Fusarium spp. isolates were recovered from diseased broomrape spikes collected from fields in agricultural areas near Hebron. The pathogenicity of isolates on broomrape was evaluated using an inoculum suspension containing mycelia and conidia. The most effective Fusarium isolates significantly increased the dead spikes of broomrape by 33.6–72.7% compared to the control; there was no obvious pathogenic effect on the tomato plants. Fusarium spp. isolates Fu 20, 25 and 119 were identified as F. solani, while Fu 30, 52, 59, 87 and 12-04 were F. oxysporum. In addition, the two previously known Fusarium strains, F. oxysporum strain EId (CNCM-I-1622 (Foxy and F. arthrosporioides strain E4a (CNCM-I-1621 (Farth were equally effective in controlling broomrape parasitizing tomato plants grown in pots, where the dead spikes of broomrape increased by 50.0 and 51.6%, respectively.

  7. Diaporthe endophytica and D. terebinthifolii from medicinal plants for biological control of Phyllosticta citricarpa.

    Science.gov (United States)

    Santos, Paulo José Camargo Dos; Savi, Daiani Cristina; Gomes, Renata Rodrigues; Goulin, Eduardo Henrique; Da Costa Senkiv, Camila; Tanaka, Francisco André Ossamu; Almeida, Álvaro Manuel Rodrigues; Galli-Terasawa, Lygia; Kava, Vanessa; Glienke, Chirlei

    2016-01-01

    The citrus industry is severely affected by citrus black spot (CBS), a disease caused by the pathogen Phyllosticta citricarpa. This disease causes loss of production, decrease in the market price of the fruit, and reduction in its export to the European Union. Currently, CBS disease is being treated in orchards with various pesticides and fungicides every year. One alternative to CBS disease control without harming the environment is the use of microorganisms for biological control. Diaporthe endophytica and D. terebinthifolii, isolated from the medicinal plants Maytenus ilicifolia and Schinus terebinthifolius have an inhibitory effect against P. citricarpa in vitro and in detached fruits. Moreover, D. endophytica and D. terebinthifolii were transformed by Agrobacterium tumefaciens for in vivo studies. The transformants retained the ability to control of phytopathogenic fungus P. citricarpa after transformation process. Furthermore, D. endophytica and D. terebinthifolii were able to infect and colonize citrus plants, which is confirmed by reisolation of transformants from inoculated and uninoculated leaves. Light microscopic analysis showed fungus mycelium colonizing intercellular region and oil glands of citrus, suggesting that these two new species are capable of colonizing citrus plants, in addition to controlling the pathogen P. citricarpa. Copyright © 2016 Elsevier GmbH. All rights reserved.

  8. Evolutionary Control of Infectious Disease: Prospects for Vectorborne and Waterborne Pathogens

    Directory of Open Access Journals (Sweden)

    Ewald Paul W

    1998-01-01

    Full Text Available Evolutionary theory may contribute to practical solutions for control of disease by identifying interventions that may cause pathogens to evolve to reduced virulence. Theory predicts, for example, that pathogens transmitted by water or arthropod vectors should evolve to relatively high levels of virulence because such pathogens can gain the evolutionary benefits of relatively high levels of host exploitation while paying little price from host illness. The entrance of Vibrio cholerae into South America in 1991 has generated a natural experiment that allows testing of this idea by determining whether geographic and temporal variations in toxigenicity correspond to variation in the potential for waterborne transmission. Preliminary studies show such correspondences: toxigenicity is negatively associated with access to uncontaminated water in Brazil; and in Chile, where the potential for waterborne transmission is particularly low, toxigenicity of strains declined between 1991 and 1998. In theory vector-proofing of houses should be similarly associated with benignity of vectorborne pathogens, such as the agents of dengue, malaria, and Chagas' disease. These preliminary studies draw attention to the need for definitive prospective experiments to determine whether interventions such as provisioning of uncontaminated water and vector-proofing of houses cause evolutionary reductions in virulence

  9. DEVELOPMENT OF FUSARIUM DISEASE CONTROL TECHNOLOGY WITH BIOLOGICAL AGENT IN MAS CULTIVAR BANANA IN LAND INFECTED

    Directory of Open Access Journals (Sweden)

    Anis Shofiyani

    2014-12-01

    Full Text Available Based on the data of General Director of Production and Horticulture, the damage of plantation areas in banana plantation centers in Indonesia always increases in years, this is due to Fusarium attack caused by fungus Fusarium oxisphorum and causing damage of 30- 70 % banana plantation areas.The aim of this empirically for due to biological control technology Fusarium wilt effective and environmentally friendly to the infected area in District Baturaden, Banyumas through soil solarization treatments and utilization of biological agents..The Research was conducted at the wilt disease endemic Fusarium land located in the village Pamijen, District Baturraden, Banyumas. The research design was a Split Plot Design consisting of 2 treatments, the main plot treatments is soil solarization, whereas treatment subplot is the type and dose of biological agents antagonist. The results showed that the treatment given soil solarization proved to increase the temperature of the surface of the soil up to 8.8 ° C compared with without solarization and reduces demand Fussarium population at ground level up to 53.61%, whereas without solarization Fussarium population decline by 22, 33%. Provision of biological agents Trichoderma, Gliocladium and P. Fluoroscens during the study proved to provide inhibition of the development of Fussarium on seedling disease, indicated by the appearance of symptoms of the disease until the end of the study. This is possible due to the formation of phenolic compounds such as tannins, saponins and glicosida and colonization between biological agents with the root system of plants in which the contact between pathogen inhibition with banana plant seedlings root system so that it protects the roots of the disease-causing pathogen infection Fussarium wilt. Treatment of biological agents proved capable of providing better vegetative growth when compared to the untreated biological agents (control in which had significant effect on the

  10. Biological control of banana black Sigatoka disease with Trichoderma

    Directory of Open Access Journals (Sweden)

    Poholl Adan Sagratzki Cavero

    2015-06-01

    Full Text Available Black Sigatoka disease caused by Mycosphaerella fijiensis is the most severe banana disease worldwide. The pathogen is in an invasive phase in Brazil and is already present in most States of the country. The potential of 29 isolates of Trichoderma spp. was studied for the control of black Sigatoka disease under field conditions. Four isolates were able to significantly reduce disease severity and were further tested in a second field experiment. Isolate 2.047 showed the best results in both field experiments and was selected for fungicide sensitivity tests and mass production. This isolate was identified as Trichoderma atroviride by sequencing fragments of the ITS region of the rDNA and tef-1α of the RNA polymerase. Trichoderma atroviride was as effective as the fungicide Azoxystrobin, which is recommended for controlling black Sigatoka. This biocontrol agent has potential to control the disease and may be scaled-up for field applications on rice-based solid fermentation

  11. Economic Benefit for Cuban Laurel Thrips Biological Control.

    Science.gov (United States)

    Shogren, C; Paine, T D

    2016-02-01

    The Cuban laurel thrips, Gynaikothrips ficorum Marchal (Thysanoptera: Phlaeothripidae), is a critical insect pest of Ficus microcarpa in California urban landscapes and production nurseries. Female thrips feed and oviposit on young Ficus leaves, causing the expanding leaves to fold or curl into a discolored leaf gall. There have been attempts to establish specialist predator natural enemies of the thrips, but no success has been reported. We resampled the same areas in 2013-2014 where we had released Montandoniola confusa (= morguesi) Streito and Matocq (Hemiptera: Anthocoridae) in southern California in 1995 but had been unable to recover individuals in 1997-1998. Thrips galls were significantly reduced in all three of the locations in the recent samples compared with the earlier samples. M. confusa was present in all locations and appears to be providing successful biological control. The value of the biological control, the difference between street trees in good foliage condition and trees with poor foliage, was $58,766,166. If thrips damage reduced the foliage to very poor condition, the value of biological control was $73,402,683. Total cost for the project was $61,830. The benefit accrued for every dollar spent on the biological control of the thrips ranged from $950, if the foliage was in poor condition, to $1,187, if the foliage was in very poor condition. The value of urban forest is often underappreciated. Economic analyses that clearly demonstrate the very substantial rates of return on investment in successful biological control in urban forests provide compelling arguments for supporting future efforts. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Landscape simplification reduces classical biological control and crop yield.

    Science.gov (United States)

    Grab, Heather; Danforth, Bryan; Poveda, Katja; Loeb, Greg

    2018-03-01

    Agricultural intensification resulting in the simplification of agricultural landscapes is known to negatively impact the delivery of key ecosystem services such as the biological control of crop pests. Both conservation and classical biological control may be influenced by the landscape context in which they are deployed; yet studies examining the role of landscape structure in the establishment and success of introduced natural enemies and their interactions with native communities are lacking. In this study, we investigated the relationship between landscape simplification, classical and conservation biological control services and importantly, the outcome of these interactions for crop yield. We showed that agricultural simplification at the landscape scale is associated with an overall reduction in parasitism rates of crop pests. Additionally, only introduced parasitoids were identified, and no native parasitoids were found in crop habitat, irrespective of agricultural landscape simplification. Pest densities in the crop were lower in landscapes with greater proportions of semi-natural habitats. Furthermore, farms with less semi-natural cover in the landscape and consequently, higher pest numbers, had lower yields than farms in less agriculturally dominated landscapes. Our study demonstrates the importance of landscape scale agricultural simplification in mediating the success of biological control programs and highlights the potential risks to native natural enemies in classical biological control programs against native insects. Our results represent an important contribution to an understanding of the landscape-mediated impacts on crop yield that will be essential to implementing effective policies that simultaneously conserve biodiversity and ecosystem services. © 2018 by the Ecological Society of America.

  13. Aspergillus alliaceus, a new potential biological control of the root parasitic weed Orobanche.

    Science.gov (United States)

    Aybeke, Mehmet; Sen, Burhan; Okten, Suzan

    2014-07-01

    During extensive surveys in fields heavily infested by broomrape in the Trakya Region-Turkey, a different new fungus, Aspergillus alliaceus, was isolated from the infected broomrape. It is aimed to investigate whether or not it is really a pathogen for Orobanche. The fungi was exposed to a greenhouse environment in order to assess its pathogenicity and virulence against Orobanche cernua. In addition, infection tests on Orobanche seeds were also performed under laboratory conditions. The fungus was subjected using two different methods, exposure to a liquid culture with conidial solution and a sclerotial solid culture with fungal mycelia. Cytological studies were carried out at light, TEM and SEM levels. The results show that the sclerotial solid culture with fungal mycelia quickly caused necrosis and was more effective than the other type. It also greatly diminished attachments, tubercles, and caused the emergence of shoots and an increase in the total shoot number of Orobanche. In addition, both when the fungi was exposed to both soil and used to contaminate sunflower seeds, its pathogenicity was more effective. Consequently, it was determined that A. alliaceus was an effective potential biological control of broomrape throughout its life cycle from dormant seed to mature plant. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Control of Candida albicans morphology and pathogenicity by post-transcriptional mechanisms

    Science.gov (United States)

    2017-01-01

    Candida albicans is a major human fungal pathogen responsible for both systemic and mucosal infections in a wide variety of immunocompromised individuals. Because the ability of C. albicans to undergo a reversible morphological transition from yeast to filaments is important for virulence, significant research efforts have focused on mechanisms that control this transition. While transcriptional and post-translational mechanisms have been well-studied, considerably less is known about the role of post-transcriptional mechanisms. However, in recent years several discoveries have begun to shed light on this important, but understudied, area. Here, I will review a variety of post-transcriptional mechanisms that have recently been shown to control C. albicans morphology, virulence and/or virulence-related processes, including those involving alternative transcript localization, mRNA stability and translation. I will also discuss the role that these mechanisms play in other pathogens as well as the potential they may hold to serve as targets for new antifungal strategies. Ultimately, gaining a better understanding of C. albicans post-transcriptional mechanisms will significantly improve our knowledge of how morphogenesis and virulence are controlled in fungal pathogens and open new avenues for the development of novel and more effective antifungals. PMID:27312239

  15. Recommendations for control of pathogens and infectious diseases in fish research facilities

    Science.gov (United States)

    Kent, M.L.; Feist, S.W.; Harper, C.; Hoogstraten-Miller, S.; Law, J.M.; Sanchez-Morgado, J. M.; Tanguay, R.L.; Sanders, G.E.; Spitsbergen, J.M.; Whipps, Christopher M.

    2009-01-01

    Concerns about infectious diseases in fish used for research have risen along with the dramatic increase in the use of fish as models in biomedical research. In addition to acute diseases causing severe morbidity and mortality, underlying chronic conditions that cause low-grade or subclinical infections may confound research results. Here we present recommendations and strategies to avoid or minimize the impacts of infectious agents in fishes maintained in the research setting. There are distinct differences in strategies for control of pathogens in fish used for research compared to fishes reared as pets or in aquaculture. Also, much can be learned from strategies and protocols for control of diseases in rodents used in research, but there are differences. This is due, in part, the unique aquatic environment that is modified by the source and quality of the water provided and the design of facilities. The process of control of pathogens and infectious diseases in fish research facilities is relatively new, and will be an evolving process over time. Nevertheless, the goal of documenting, detecting, and excluding pathogens in fish is just as important as in mammalian research models.

  16. Evaluation of Orius species for biological control of Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae)

    NARCIS (Netherlands)

    Tommasini, M.G.

    2003-01-01

    Key words: Thysanoptera, Frankliniella occidentalis, Heteroptera, Orius leavigatu, Orius majusculu, Orius niger, Orius insidiosus, Biology, Diapause, Biological control.The overall aim of this research was to develop a biological control programme for F. occidentalis through the selection of

  17. The effect of biological and chemical control agents on the health status of the very early potato cultivar Rosara

    Directory of Open Access Journals (Sweden)

    Cwalina-Ambroziak Bożena

    2015-12-01

    Full Text Available The external appearance and quality of table potatoes are determined, among other factors, by the health status of the plants during the growing season. Chemical control methods are often combined with biocontrol agents to effectively fight potato pathogens. Potatoes of the very early cultivar Rosara were grown in experimental plots. The plots were located in Tomaszkowo (NE Poland, 2007-2009. The experiment involved the following treatments: 1 biological control − mycorrhizal Glomus spp. inoculum was applied to the roots, − tubers were dressed and plants were sprayed with Polyversum three times during the growing season, 2 chemical control - at two-week intervals, plants were sprayed with the following fungicides: Infinito 687.5 SC and Tanos 50 WG, Valbon 72 WG and Tanos 50 WG. In the control treatment, potato plants were not protected against pathogens. During the growing season, the severity of late blight and early blight was evaluated on a nine-point scale. The composition of fungal communities colonising potato stems was analysed. The fungistatic properties of the fungicides used in the field experiment were evaluated in an in vitro test. The symptoms of infections caused by Phytophthora infestans and Alternaria spp. were significantly reduced in the treatment which used the integrated chemical and biological control. The least diverse fungal community was isolated from fungicide-treated plants. In the in vitro test, fungicides at all analysed concentrations inhibited the linear mycelial growth of selected pathogens.

  18. Selection of endophytic fungi from comfrey (Symphytum officinale L.) for in vitro biological control of the phytopathogen Sclerotinia sclerotiorum (Lib.)

    Science.gov (United States)

    Rocha, Rafaeli; da Luz, Daniela Eleutério; Engels, Cibelle; Pileggi, Sônia Alvim Veiga; de Souza Jaccoud Filho, David; Matiello, Rodrigo Rodrigues; Pileggi, Marcos

    2009-01-01

    Biological control consists of using one organism to attack another that may cause economic damage to crops. Integrated Pest Management (IPM) is a very common strategy. The white mold produced by Sclerotinia sclerotiorum (Lib.) causes considerable damage to bean crops. This fungus is a soil inhabitant, the symptoms of which are characterized by water-soaked lesions covered by a white cottony fungal growth on the soil surface and/or the host plant. Possible biological control agents taken from plants are being investigated as phytopathogen inhibitors. These are endophytic microorganisms that inhabit the intercellular spaces of vegetal tissues and are often responsible for antimicrobial production. The objective of the present study was to select endophytic fungi isolated from comfrey (Symphytum officinale L.) leaves with in vitro antagonist potential against the phytopathogenic fungus S. sclerotiorum. Twelve isolates of endophytic fungi and a pathogenic strain of S. sclerotiorum were used in the challenge method. With the aid of this method, four endophytes with the best antagonistic activity against S. sclerotiorum were selected. Pathogen growth inhibition zones were considered indicative of antibiosis. The percentages of pathogenic mycelia growth were measured both with and without the antagonist, resulting in growth reductions of 46.7% to 50.0% for S. sclerotiorum. These analyses were performed by evaluating the endophytic/pathogenic mycelia growth in mm/day over an eight-day period of antagonistic tests. PMID:24031320

  19. Selection of endophytic fungi from comfrey (Symphytum officinale L.) for in vitro biological control of the phytopathogen Sclerotinia sclerotiorum (Lib.).

    Science.gov (United States)

    Rocha, Rafaeli; da Luz, Daniela Eleutério; Engels, Cibelle; Pileggi, Sônia Alvim Veiga; de Souza Jaccoud Filho, David; Matiello, Rodrigo Rodrigues; Pileggi, Marcos

    2009-01-01

    Biological control consists of using one organism to attack another that may cause economic damage to crops. Integrated Pest Management (IPM) is a very common strategy. The white mold produced by Sclerotinia sclerotiorum (Lib.) causes considerable damage to bean crops. This fungus is a soil inhabitant, the symptoms of which are characterized by water-soaked lesions covered by a white cottony fungal growth on the soil surface and/or the host plant. Possible biological control agents taken from plants are being investigated as phytopathogen inhibitors. These are endophytic microorganisms that inhabit the intercellular spaces of vegetal tissues and are often responsible for antimicrobial production. The objective of the present study was to select endophytic fungi isolated from comfrey (Symphytum officinale L.) leaves with in vitro antagonist potential against the phytopathogenic fungus S. sclerotiorum. Twelve isolates of endophytic fungi and a pathogenic strain of S. sclerotiorum were used in the challenge method. With the aid of this method, four endophytes with the best antagonistic activity against S. sclerotiorum were selected. Pathogen growth inhibition zones were considered indicative of antibiosis. The percentages of pathogenic mycelia growth were measured both with and without the antagonist, resulting in growth reductions of 46.7% to 50.0% for S. sclerotiorum. These analyses were performed by evaluating the endophytic/pathogenic mycelia growth in mm/day over an eight-day period of antagonistic tests.

  20. Epigenetics and Why Biological Networks are More Controllable than Expected

    Science.gov (United States)

    Motter, Adilson

    2013-03-01

    A fundamental property of networks is that perturbations to one node can affect other nodes, potentially causing the entire system to change behavior or fail. In this talk, I will show that it is possible to exploit this same principle to control network behavior. This approach takes advantage of the nonlinear dynamics inherent to real networks, and allows bringing the system to a desired target state even when this state is not directly accessible or the linear counterpart is not controllable. Applications show that this framework permits both reprogramming a network to a desired task as well as rescuing networks from the brink of failure, which I will illustrate through various biological problems. I will also briefly review the progress our group has made over the past 5 years on related control of complex networks in non-biological domains.

  1. A theoretical approach on controlling agricultural pest by biological controls.

    Science.gov (United States)

    Mondal, Prasanta Kumar; Jana, Soovoojeet; Kar, T K

    2014-03-01

    In this paper we propose and analyze a prey-predator type dynamical system for pest control where prey population is treated as the pest. We consider two classes for the pest namely susceptible pest and infected pest and the predator population is the natural enemy of the pest. We also consider average delay for both the predation rate i.e. predation to the susceptible pest and infected pest. Considering a subsystem of original system in the absence of infection, we analyze the existence of all possible non-negative equilibria and their stability criteria for both the subsystem as well as the original system. We present the conditions for transcritical bifurcation and Hopf bifurcation in the disease free system. The theoretical evaluations are demonstrated through numerical simulations.

  2. An endophytic/pathogenic Phoma sp. from creosote bush producing biologically active volatile compounds having fuel potential.

    Science.gov (United States)

    Strobel, Gary; Singh, Sanjay K; Riyaz-Ul-Hassan, Syed; Mitchell, Angela M; Geary, Brad; Sears, Joe

    2011-07-01

    A Phoma sp. was isolated and characterized as endophytic and as a pathogen of Larrea tridentata (creosote bush) growing in the desert region of southern Utah, USA. This fungus produces a unique mixture of volatile organic compounds (VOCs), including a series of sesquiterpenoids, some alcohols and several reduced naphthalene derivatives. Trans-caryophyllene, a product in the fungal VOCs, was also noted in the VOCs of this pungent plant. The gases of Phoma sp. possess antifungal properties and is markedly similar to that of a methanolic extract of the host plant. Some of the test organisms with the greatest sensitivity to the Phoma sp. VOCs were Verticillium, Ceratocystis, Cercospora and Sclerotinia while those being the least sensitive were Trichoderma, Colletotrichum and Aspergillus. We discuss the possible involvement of VOC production by the fungus and its role in the biology/ecology of the fungus/plant/environmental relationship with implications for utilization as an energy source. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. Ross, macdonald, and a theory for the dynamics and control of mosquito-transmitted pathogens.

    Science.gov (United States)

    Smith, David L; Battle, Katherine E; Hay, Simon I; Barker, Christopher M; Scott, Thomas W; McKenzie, F Ellis

    2012-01-01

    Ronald Ross and George Macdonald are credited with developing a mathematical model of mosquito-borne pathogen transmission. A systematic historical review suggests that several mathematicians and scientists contributed to development of the Ross-Macdonald model over a period of 70 years. Ross developed two different mathematical models, Macdonald a third, and various "Ross-Macdonald" mathematical models exist. Ross-Macdonald models are best defined by a consensus set of assumptions. The mathematical model is just one part of a theory for the dynamics and control of mosquito-transmitted pathogens that also includes epidemiological and entomological concepts and metrics for measuring transmission. All the basic elements of the theory had fallen into place by the end of the Global Malaria Eradication Programme (GMEP, 1955-1969) with the concept of vectorial capacity, methods for measuring key components of transmission by mosquitoes, and a quantitative theory of vector control. The Ross-Macdonald theory has since played a central role in development of research on mosquito-borne pathogen transmission and the development of strategies for mosquito-borne disease prevention.

  4. Possibilities of avoidance and control of bacterial plant diseases when using pathogen-tested (certified) or - treated planting material

    NARCIS (Netherlands)

    Janse, J.; Wenneker, M.

    2002-01-01

    Testing of planting material for freedom from phytopathogenic bacteria is an important, although not exclusive, method for control of bacterial diseases of plants. Ideally, pathogen-free or pathogen-/disease-resistant planting material is desirable, but this situation is not always possible on a

  5. ESSENTIAL OILS OF CYMBOPOGON SP. IN THE CONTROL OF FOODBORNE PATHOGENIC BACTERIA

    Directory of Open Access Journals (Sweden)

    Danilo Florisvaldo BRUGNERA

    2011-08-01

    Full Text Available In this study, the agar well diffusion technique was used to determine the antibacterial activity of Cymbopogon nardus (citronella and Cymbopogon citratus (lemongrass essential oils, which were applied at different concentrations. The bacterial species used were the foodborne pathogens Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. Both essential oils presented antibacterial activity in most concentrations tested. The Minimum Inhibitory Concentrations (MICs founded were: 7.81μL/mL (S. aureus and 3.90μL/mL (E. coli and P. aeruginosa, for C. nardus essential oil; and 3.90μL/mL (S. aureus, E. coli and P. aeruginosa, for C. citratus essential oil. The essential oils used were shown as promising natural antibacterials for pathogenic bacteria control in the food industry.

  6. Pathogen Reduction and Hazard Analysis and Critical Control Point (HACCP) systems for meat and poultry. USDA.

    Science.gov (United States)

    Hogue, A T; White, P L; Heminover, J A

    1998-03-01

    The United States Department of Agriculture (USDA) Food Safety Inspection Service (FSIS) adopted Hazard Analysis and Critical Control Point Systems and established finished product standards for Salmonella in slaughter plants to improve food safety for meat and poultry. In order to make significant improvements in food safety, measures must be taken at all points in the farm-to-table chain including production, transportation, slaughter, processing, storage, retail, and food preparation. Since pathogens can be introduced or multiplied anywhere along the continuum, success depends on consideration and comparison of intervention measures throughout the continuum. Food animal and public health veterinarians can create the necessary preventative environment that mitigates risks for food borne pathogen contamination.

  7. Quality control of X-ray irradiator by biological markers

    International Nuclear Information System (INIS)

    Miura, Miwa; Lukmanul Hakkim, F.; Yoshida, Masahiro; Matsuda, Naoki; Morita, Naoko

    2011-01-01

    The exposure of animals or cultured cells to radiation is the essential and common step in experimental researches to elucidate biological effects of radiation. When an X-ray generator is used as a radiation source, physical parameters including dose, dose rate, and the energy spectrum of X-ray play crucial roles in biological outcome. Therefore, those parameters are the important points to be checked in quality control and to be carefully considered in advance to the irradiation to obtain the accurate and reproductive results. Here we measured radiation dose emitted from the X-ray irradiator for research purposes by using clonogenic survival of cultured mammalian cells as a biological marker in parallel with physical dosimetry. The results drawn from both methods exhibited good consistency in the dose distribution on the irradiation stage. Furthermore, the close relationship was observed between cell survival and the photon energy spectrum by using different filter components. These results suggest that biological dosimetry is applicable to quality control of X-ray irradiator in adjunct to physical dosimetry and that it possibly helps better understanding of the optimal irradiating condition by X-ray users in life-science field. (author)

  8. Potential Biological and Climatic Factors That Influence the Incidence and Persistence of Highly Pathogenic H5N1 Avian Influenza Virus in Egypt

    Directory of Open Access Journals (Sweden)

    Ahmed H. Salaheldin

    2018-03-01

    Full Text Available Highly pathogenic H5N1 avian influenza virus (A/H5N1 of clade 2.2.1 is endemic in poultry in Egypt where the highest number of human infections worldwide was reported. During the last 12 years the Egyptian A/H5N1 evolved into several genotypes. In 2007-2014 vaccinated poultry suffered from antigenic drift variants of clade 2.2.1.1 and in 2014/2015 an unprecedented upsurge of A/H5N1 clade 2.2.1.2 occurred in poultry and humans. Factors contributing to the endemicity or re-emergence of A/H5N1 in poultry in Egypt remain unclear. Here, three potential factors were studied: climatic factors (temperature, relative humidity, and wind speed, biological fitness in vitro, and pathogenicity in domestic Pekin and Muscovy ducks. Statistical analyses using negative binomial regression models indicated that ambient temperature in winter months influenced the spread of A/H5N1 in different geographic areas analyzed in this study. In vitro, at 4 and 56°C 2.2.1.1 and recent 2.2.1.2 viruses were more stable than other viruses used in this study. Further, Pekin ducks were more resistant than Muscovy ducks and the viruses were excreted for up to 2 weeks post-infection assuming a strong role as a reservoir. Taken together, ambient temperature in winter months potentially contributes to increasing outbreaks in some regions in Egypt. Heat stability of clade 2.2.1.1 and recent 2.2.1.2 viruses probably favors their persistence at elevated temperatures. Importantly, asymptomatically infected Pekin ducks may play an important role in the spread of avian and human-like A/H5N1 in Egypt. Therefore, control measures including targeted surveillance and culling of silently infected Pekin ducks should be considered.

  9. The use of compost for the biological pest control. An alternative for pesticides; Utilizacion de compost en el control biologico de plagas. Una alternativa a los plaguicidas quimicos

    Energy Technology Data Exchange (ETDEWEB)

    Pascual, J. A.

    2000-07-01

    Traditional methods of controlling pests and diseases using chemical pesticides can provide highly effective pest control but these methods might be damaging to the environment. Compost or other organic matter added to soil has the potential to control many soil borne plant pathogens, therefore they can be used in the sustainable agriculture. The mechanisms of action of compost are not well defined, being a mix of mycoparasitism, antibiotic production and nutrient competition. Our research is focused on the potential action of compost from municipal wastes in the biological control on pest. The addition of organic waste compost improved the biological control against Pythium furthermore raised the organic matter content of an arid soil. The addition of urban waste to the soil also could act long-term against Pythium, reducing the application times. One of the compost fraction more active in biological control are the humic substances. Nowadays, composts cannot be used by themselves to prevent plant pathogens action, it also is needed some pesticide application, but the use of these pesticides can be considerably reduced with the application of compost. (Author)

  10. Biological Control of Fusarium Stalk Rot of Maize Using Bacillus spp

    Directory of Open Access Journals (Sweden)

    Joon-Hee Han

    2015-12-01

    Full Text Available Maize (Zea mays L. is an economically important crop in worldwide. While the consumption of the maize is steadily increasing, the yield is decreasing due to continuous mono-cultivation and infection of soil-borne fungal pathogens such as Fusarium species. Recently, stalk rot disease in maize, caused by F. subglutinans and F. temperatum has been reported in Korea. In this study, we isolated bacterial isolates in rhizosphere soil of maize and subsequently tested for antagonistic activities against F. subglutinans and F. temperatum. A total of 1,357 bacterial strains were isolated from rhizosphere. Among them three bacterial isolates (GC02, GC07, GC08 were selected, based on antagonistic effects against Fusarium species. The isolates GC02 and GC07 were most efficient in inhibiting the mycelium growth of the pathogens. The three isolates GC02, GC07 and GC08 were identified as Bacillus methylotrophicus, B. amyloliquefaciens and B. thuringiensis using 16S rRNA sequence analysis, respectively. GC02 and GC07 bacterial suspensions were able to suppress over 80% conidial germination of the pathogens. GC02, GC07 and GC08 were capable of producing large quantities of protease enzymes, whereas the isolates GC07 and GC08 produced cellulase enzymes. The isolates GC02 and GC07 were more efficient in phosphate solubilization and siderophore production than GC08. Analysis of disease suppression revealed that GC07 was most effective in suppressing the disease development of stalk rot. It was also found that B. methylotrophicus GC02 and B. amyloliquefaciens GC07 have an ability to inhibit the growth of other plant pathogenic fungi. This study indicated B. methylotrophicus GC02 and B. amyloliquefaciens GC07 has potential for being used for the development of a biological control agent.

  11. Biopesticides: An option for the biological pest control

    OpenAIRE

    Eusebio Nava Pérez; Cipriano García Gutiérrez; Jesús Ricardo Camacho Báez; Elva Lorena Vázquez Montoya

    2012-01-01

    The indiscriminate use of synthetic pesticides and the problems that its cause to human health, agriculture and the environment is comment, this paper also present general aspects about of biopesticides, and their uses in the biological pest control. By the nature these can be safely used in a sustainable agriculture. An example is the use of botanical pesticides whose active ingredient are the terpenes, alkaloids and phenolics, these have insecticide effects for many agriculture pests; also...

  12. Controlled polymer synthesis--from biomimicry towards synthetic biology.

    Science.gov (United States)

    Pasparakis, George; Krasnogor, Natalio; Cronin, Leroy; Davis, Benjamin G; Alexander, Cameron

    2010-01-01

    The controlled assembly of synthetic polymer structures is now possible with an unprecedented range of functional groups and molecular architectures. In this critical review we consider how the ability to create artificial materials over lengthscales ranging from a few nm to several microns is generating systems that not only begin to mimic those in nature but also may lead to exciting applications in synthetic biology (139 references).

  13. Assessing Probabilistic Risk Assessment Approaches for Insect Biological Control Introductions

    OpenAIRE

    Kaufman, Leyla V.; Wright, Mark G.

    2017-01-01

    The introduction of biological control agents to new environments requires host specificity tests to estimate potential non-target impacts of a prospective agent. Currently, the approach is conservative, and is based on physiological host ranges determined under captive rearing conditions, without consideration for ecological factors that may influence realized host range. We use historical data and current field data from introduced parasitoids that attack an endemic Lepidoptera species in H...

  14. A novel bacterial pathogen of Biomphalaria glabrata: a potential weapon for schistosomiasis control?

    Science.gov (United States)

    Duval, David; Galinier, Richard; Mouahid, Gabriel; Toulza, Eve; Allienne, Jean François; Portela, Julien; Calvayrac, Christophe; Rognon, Anne; Arancibia, Nathalie; Mitta, Guillaume; Théron, André; Gourbal, Benjamin

    2015-02-01

    Schistosomiasis is the second-most widespread tropical parasitic disease after malaria. Various research strategies and treatment programs for achieving the objective of eradicating schistosomiasis within a decade have been recommended and supported by the World Health Organization. One of these approaches is based on the control of snail vectors in endemic areas. Previous field studies have shown that competitor or predator introduction can reduce snail numbers, but no systematic investigation has ever been conducted to identify snail microbial pathogens and evaluate their molluscicidal effects. In populations of Biomphalaria glabrata snails experiencing high mortalities, white nodules were visible on snail bodies. Infectious agents were isolated from such nodules. Only one type of bacteria, identified as a new species of Paenibacillus named Candidatus Paenibacillus glabratella, was found, and was shown to be closely related to P. alvei through 16S and Rpob DNA analysis. Histopathological examination showed extensive bacterial infiltration leading to overall tissue disorganization. Exposure of healthy snails to Paenibacillus-infected snails caused massive mortality. Moreover, eggs laid by infected snails were also infected, decreasing hatching but without apparent effects on spawning. Embryonic lethality was correlated with the presence of pathogenic bacteria in eggs. This is the first account of a novel Paenibacillus strain, Ca. Paenibacillus glabratella, as a snail microbial pathogen. Since this strain affects both adult and embryonic stages and causes significant mortality, it may hold promise as a biocontrol agent to limit schistosomiasis transmission in the field.

  15. A novel bacterial pathogen of Biomphalaria glabrata: a potential weapon for schistosomiasis control?

    Directory of Open Access Journals (Sweden)

    David Duval

    2015-02-01

    Full Text Available Schistosomiasis is the second-most widespread tropical parasitic disease after malaria. Various research strategies and treatment programs for achieving the objective of eradicating schistosomiasis within a decade have been recommended and supported by the World Health Organization. One of these approaches is based on the control of snail vectors in endemic areas. Previous field studies have shown that competitor or predator introduction can reduce snail numbers, but no systematic investigation has ever been conducted to identify snail microbial pathogens and evaluate their molluscicidal effects.In populations of Biomphalaria glabrata snails experiencing high mortalities, white nodules were visible on snail bodies. Infectious agents were isolated from such nodules. Only one type of bacteria, identified as a new species of Paenibacillus named Candidatus Paenibacillus glabratella, was found, and was shown to be closely related to P. alvei through 16S and Rpob DNA analysis. Histopathological examination showed extensive bacterial infiltration leading to overall tissue disorganization. Exposure of healthy snails to Paenibacillus-infected snails caused massive mortality. Moreover, eggs laid by infected snails were also infected, decreasing hatching but without apparent effects on spawning. Embryonic lethality was correlated with the presence of pathogenic bacteria in eggs.This is the first account of a novel Paenibacillus strain, Ca. Paenibacillus glabratella, as a snail microbial pathogen. Since this strain affects both adult and embryonic stages and causes significant mortality, it may hold promise as a biocontrol agent to limit schistosomiasis transmission in the field.

  16. Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen

    International Nuclear Information System (INIS)

    Chitra, K.; Annadurai, G.

    2013-01-01

    In this present study the bio conjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were poly dispersed and the size of the silica nanoparticles was in the range of 114-164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 keV and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment of dye and carboxyl group onto the silica nanoparticles surface. The fluorescent silica nanoparticles showed highly efficient fluorescence and the fluorescent emission of silica nanoparticles occurred at 536 nm. The SEM image showed the aggregation of nanoparticles and bacteria. The growth of the pathogenic E. coli was controlled using silica nanoparticles; therefore silica nanoparticles could be used in food packaging material, biomedical material, and so forth. This work provides a rapid, simple, and accurate method for the detection of pathogen using fluorescent-based immunoassay.

  17. Biologically-Inspired Control Architecture for Musical Performance Robots

    Directory of Open Access Journals (Sweden)

    Jorge Solis

    2014-10-01

    Full Text Available At Waseda University, since 1990, the authors have been developing anthropomorphic musical performance robots as a means for understanding human control, introducing novel ways of interaction between musical partners and robots, and proposing applications for humanoid robots. In this paper, the design of a biologically-inspired control architecture for both an anthropomorphic flutist robot and a saxophone playing robot are described. As for the flutist robot, the authors have focused on implementing an auditory feedback system to improve the calibration procedure for the robot in order to play all the notes correctly during a performance. In particular, the proposed auditory feedback system is composed of three main modules: an Expressive Music Generator, a Feed Forward Air Pressure Control System and a Pitch Evaluation System. As for the saxophone-playing robot, a pressure-pitch controller (based on the feedback error learning to improve the sound produced by the robot during a musical performance was proposed and implemented. In both cases studied, a set of experiments are described to verify the improvements achieved while considering biologically-inspired control approaches.

  18. Environmental controls, oceanography and population dynamics of pathogens and harmful algal blooms: connecting sources to human exposure

    Directory of Open Access Journals (Sweden)

    Minnett Peter

    2008-11-01

    Full Text Available Abstract Coupled physical-biological models are capable of linking the complex interactions between environmental factors and physical hydrodynamics to simulate the growth, toxicity and transport of infectious pathogens and harmful algal blooms (HABs. Such simulations can be used to assess and predict the impact of pathogens and HABs on human health. Given the widespread and increasing reliance of coastal communities on aquatic systems for drinking water, seafood and recreation, such predictions are critical for making informed resource management decisions. Here we identify three challenges to making this connection between pathogens/HABs and human health: predicting concentrations and toxicity; identifying the spatial and temporal scales of population and ecosystem interactions; and applying the understanding of population dynamics of pathogens/HABs to management strategies. We elaborate on the need to meet each of these challenges, describe how modeling approaches can be used and discuss strategies for moving forward in addressing these challenges.

  19. Self-Organized Biological Dynamics and Nonlinear Control

    Science.gov (United States)

    Walleczek, Jan

    2006-04-01

    The frontiers and challenges of biodynamics research Jan Walleczek; Part I. Nonlinear Dynamics in Biology and Response to Stimuli: 1. External signals and internal oscillation dynamics - principal aspects and response of stimulated rhythmic processes Friedemann Kaiser; 2. Nonlinear dynamics in biochemical and biophysical systems: from enzyme kinetics to epilepsy Raima Larter, Robert Worth and Brent Speelman; 3. Fractal mechanisms in neural control: human heartbeat and gait dynamics in health and disease Chung-Kang Peng, Jeffrey M. Hausdorff and Ary L. Goldberger; 4. Self-organising dynamics in human coordination and perception Mingzhou Ding, Yanqing Chen, J. A. Scott Kelso and Betty Tuller; 5. Signal processing in biochemical reaction networks Adam P. Arkin; Part II. Nonlinear Sensitivity of Biological Systems to Electromagnetic Stimuli: 6. Electrical signal detection and noise in systems with long-range coherence Paul C. Gailey; 7. Oscillatory signals in migrating neutrophils: effects of time-varying chemical and electrical fields Howard R. Petty; 8. Enzyme kinetics and nonlinear biochemical amplification in response to static and oscillating magnetic fields Jan Walleczek and Clemens F. Eichwald; 9. Magnetic field sensitivity in the hippocampus Stefan Engström, Suzanne Bawin and W. Ross Adey; Part III. Stochastic Noise-Induced Dynamics and Transport in Biological Systems: 10. Stochastic resonance: looking forward Frank Moss; 11. Stochastic resonance and small-amplitude signal transduction in voltage-gated ion channels Sergey M. Bezrukov and Igor Vodyanoy; 12. Ratchets, rectifiers and demons: the constructive role of noise in free energy and signal transduction R. Dean Astumian; 13. Cellular transduction of periodic and stochastic energy signals by electroconformational coupling Tian Y. Tsong; Part IV. Nonlinear Control of Biological and Other Excitable Systems: 14. Controlling chaos in dynamical systems Kenneth Showalter; 15. Electromagnetic fields and biological

  20. Biology, treatment, and control of flea and tick infestations.

    Science.gov (United States)

    Blagburn, Byron L; Dryden, Michael W

    2009-11-01

    Flea and tick infestations are common and elimination can be expensive and time consuming. Many advances in control of fleas can be directly linked to improved knowledge of the intricacies of flea host associations, reproduction, and survival in the premises. Understanding tick biology and ecology is far more difficult than with fleas, because North America can have up to 9 different tick species infesting cats and dogs compared to 1 primary flea species. Effective tick control is more difficult to achieve than effective flea control, because of the abundance of potential alternative hosts in the tick life cycle. Many effective host-targeted tick control agents exist, several of which also possess activity against adult or immature fleas and other parasites.

  1. Decentralized control of ecological and biological networks through Evolutionary Network Control

    Directory of Open Access Journals (Sweden)

    Alessandro Ferrarini

    2016-09-01

    Full Text Available Evolutionary Network Control (ENC has been recently introduced to allow the control of any kind of ecological and biological networks, with an arbitrary number of nodes and links, acting from inside and/or outside. To date, ENC has been applied using a centralized approach where an arbitrary number of network nodes and links could be tamed. This approach has shown to be effective in the control of ecological and biological networks. However a decentralized control, where only one node and the correspondent input/output links are controlled, could be more economic from a computational viewpoint, in particular when the network is very large (i.e. big data. In this view, ENC is upgraded here to realize the decentralized control of ecological and biological nets.

  2. Biomimicry of volatile-based microbial control for managing emerging fungal pathogens.

    Science.gov (United States)

    Gabriel, K T; Joseph Sexton, D; Cornelison, C T

    2017-12-14

    Volatile organic compounds (VOCs) are known to be produced by a wide range of micro-organisms and for a number of purposes. Volatile-based microbial inhibition in environments such as soil is well-founded, with numerous antimicrobial VOCs having been identified. Inhibitory VOCs are of interest as microbial control agents, as low concentrations of gaseous VOCs can elicit significant antimicrobial effects. Volatile organic compounds are organic chemicals typically characterized as having low molecular weight, low solubility in water, and high vapour pressure. Consequently, VOCs readily evaporate to the gaseous phase at standard temperature and pressure. This contact-independent antagonism presents unique advantages over traditional, contact-dependent microbial control methods, including increased surface exposure and reduced environmental persistence. This approach has been the focus of our recent research, with positive results suggesting it may be particularly promising for the management of emerging fungal pathogens, such as the causative agents of white-nose syndrome of bats and snake fungal disease, which are difficult or impossible to treat using traditional approaches. Here, we review the history of volatile-based microbial control, discuss recent progress in formulations that mimic naturally antagonistic VOCs, outline the development of a novel treatment device, and highlight areas where further work is needed to successfully deploy VOCs against existing and emerging fungal pathogens. © 2017 The Society for Applied Microbiology.

  3. Disease control by chemical and biological fungicides in cultivated mushrooms: button mushroom, oyster mushroom and shiitake

    Directory of Open Access Journals (Sweden)

    Ivana Potočnik

    2015-12-01

    Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.

  4. Biological Control of Rice Bakanae by an Endophytic Bacillus oryzicola YC7007

    Directory of Open Access Journals (Sweden)

    Mohammad Tofajjal Hossain

    2016-06-01

    Full Text Available In our previous study, we reported that a novel endophytic bacterium Bacillus oryzicola YC7007 has suppressed bacterial diseases of rice via induced systemic resistance and antibiotic production. This endophytic strain, B. oryzicola YC7007 was used as a biological control agent against bakanae disease of rice caused by Fusarium fujikuroi, and its mechanism of interaction with the pathogen and the rice was further elucidated. Root drenching with B. oryzicola YC7007 suspension reduced the disease severity of bakanae significantly when compared with the untreated controls. The treatments of B. oryzicola YC7007 suspension (2.0 × 10⁷ cfu/ml to the rice rhizosphere reduced bakanae severity by 46–78% in pots and nursery box tests containing autoclaved and non-autoclaved soils. Moreover, in the detached rice leaves bioassay, the development of necrotic lesion and mycelial expansion of F. fujikuroi were inhibited significantly by spraying the culture filtrate of B. oryzicola YC7007. Drenching of ethyl acetate extracts of the culture filtrate to the rhizosphere of rice seedlings also reduced the bakanae disease severity in the plant culture dish tests. With the root drenching of B. oryzicola YC7007 suspension, the accumulation of hydrogen peroxide was observed at an early stage of rice seedlings, and a hormonal defense was elicited with and without pathogen inoculation. Our results showed that the strain B. oryzicola YC7007 had a good biocontrol activity against the bakanae disease of rice by direct inhibition, and was also capable of inducing systemic resistance against the pathogen via primed induction of the jasmonic acid pathway.

  5. Biopesticides: An option for the biological pest control

    Directory of Open Access Journals (Sweden)

    Eusebio Nava Pérez

    2012-09-01

    Full Text Available The indiscriminate use of synthetic pesticides and the problems that its cause to human health, agriculture and the environment is comment, this paper also present general aspects about of biopesticides, and their uses in the biological pest control. By the nature these can be safely used in a sustainable agriculture. An example is the use of botanical pesticides whose active ingredient are the terpenes, alkaloids and phenolics, these have insecticide effects for many agriculture pests; also its are less expensive, are biodegradable and safe for humans and the environment, however havelittle residuality. Microbial pesticides are being introduced successfully to pests control in important crops such as; coffee, sugar cane, beans and corn. These products contain bacteria, fungi, viruses or nematodes. However, few entomopathogenic agents have been developed as effective biocontrol agents, one of them is the bacterium Bacillus thuringiensis (Berlinier for control of armyworm Spodoptera frugiperda (J.E Smith covering about 74% of the market,fungus 10% , viruses 5% and 11% others. Other upstanding case is the use of the fungus Beauveria bassiana (Balsamoagainst bean weevil Acanthoscelides obtectus (Say. Biopesticides have shown that when are used properly in the biological pest control its favor the practice of a sustainable agriculture, with less dependence of chemical insecticides.

  6. A molecular biological protocol to distinguish potentially human pathogenic Stenotrophomonas maltophilia from plant-associated Stenotrophomonas rhizophila

    NARCIS (Netherlands)

    Ribbeck-Busch, K.; Roder, A.; Hasse, D.; De Boer, W.; Martinez, J.L.; Hagemann, M.; Berg, G.

    2005-01-01

    In recent years, the importance of the Gram-negative bacterium Stenotrophomonas as an opportunistic pathogen as well as in biotechnology has increased. The aim of the present study was to develop new methods for distinguishing between strains closely related to the potentially human pathogenic

  7. Synthetic biology and regulatory networks: where metabolic systems biology meets control engineering.

    Science.gov (United States)

    He, Fei; Murabito, Ettore; Westerhoff, Hans V

    2016-04-01

    Metabolic pathways can be engineered to maximize the synthesis of various products of interest. With the advent of computational systems biology, this endeavour is usually carried out through in silico theoretical studies with the aim to guide and complement further in vitro and in vivo experimental efforts. Clearly, what counts is the result in vivo, not only in terms of maximal productivity but also robustness against environmental perturbations. Engineering an organism towards an increased production flux, however, often compromises that robustness. In this contribution, we review and investigate how various analytical approaches used in metabolic engineering and synthetic biology are related to concepts developed by systems and control engineering. While trade-offs between production optimality and cellular robustness have already been studied diagnostically and statically, the dynamics also matter. Integration of the dynamic design aspects of control engineering with the more diagnostic aspects of metabolic, hierarchical control and regulation analysis is leading to the new, conceptual and operational framework required for the design of robust and productive dynamic pathways. © 2016 The Author(s).

  8. Bacillus cereus un patógeno importante en el control microbiológico de los alimentos / Bacillus cereus an important pathogen the microbiological control of food

    Directory of Open Access Journals (Sweden)

    Jennifer Sánchez

    2016-05-01

    Full Text Available Resumen Bacillus cereus es una bacteria genéticamente diversa que se encuentra comúnmente en el ambiente. Contamina los alimentos afectando la salud humana, al ingerir el microorganismo y/o sus toxinas, la emética o las enterotoxinas. En Colombia son escasos los reportes de intoxicación por B. cereus y se estima que hay un gran subregistro. Por lo anterior, se recomienda aumentar la vigilancia de este patógeno y realizar estudios sobre aspectos relevantes que permitan aplicar medidas de control para disminuir las intoxicaciones por B. cereus. El objetivo de esta revisión bibliográfica es presentar información actualizada sobre B. cereus, que incluye aspectos de su biología, taxonomía, toxinas, alimentos que contamina y metodologías para detectar, prevenir y controlar este microorganismo. La información presentada es de utilidad para el público en general, especialmente personas vinculadas al sector de alimentos, inocuidad alimentaria y control de procesos. / Abstract Bacillus cereus is a genetically diverse bacterium commonly found in the environment. It contaminates food, thus affecting human health upon ingestion of the microorganism and/or its toxins, the emetic or enterotoxins. In Colombia, reports of intoxication by B. cereus are scarce and under-registration is presumed. Because of this, it is recommended to increase surveillance of this pathogen and to develop studies on relevant aspects that allow the application of control measures to reduce intoxications by B. cereus. The aim of this review is to present current information on B. cereus, including aspects of its biology, taxonomy, toxins, food that it contaminates and methodologies for the detection, prevention and control of this microorganism. This information is useful for the general public, especially people involved with the food sector, food safety and process control.

  9. Multiple levels of epigenetic control for bone biology and pathology.

    Science.gov (United States)

    Montecino, Martin; Stein, Gary; Stein, Janet; Zaidi, Kaleem; Aguilar, Rodrigo

    2015-12-01

    Multiple dimensions of epigenetic control contribute to regulation of gene expression that governs bone biology and pathology. Once confined to DNA methylation and a limited number of post-translational modifications of histone proteins, the definition of epigenetic mechanisms is expanding to include contributions of non-coding RNAs and mitotic bookmarking, a mechanism for retaining phenotype identity during cell proliferation. Together these different levels of epigenetic control of physiological processes and their perturbations that are associated with compromised gene expression during the onset and progression of disease, have contributed to an unprecedented understanding of the activities (operation) of the genomic landscape. Here, we address general concepts that explain the contribution of epigenetic control to the dynamic regulation of gene expression during eukaryotic transcription. This article is part of a Special Issue entitled Epigenetics and Bone. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. A Biomechanical Comparison of Proportional Electromyography Control to Biological Torque Control Using a Powered Hip Exoskeleton.

    Science.gov (United States)

    Young, Aaron J; Gannon, Hannah; Ferris, Daniel P

    2017-01-01

    Despite a large increase in robotic exoskeleton research, there are few studies that have examined human performance with different control strategies on the same exoskeleton device. Direct comparison studies are needed to determine how users respond to different types of control. The purpose of this study was to compare user performance using a robotic hip exoskeleton with two different controllers: a controller that targeted a biological hip torque profile and a proportional myoelectric controller. We tested both control approaches on 10 able-bodied subjects using a pneumatically powered hip exoskeleton. The state machine controller targeted a biological hip torque profile. The myoelectric controller used electromyography (EMG) of lower limb muscles to produce a proportional control signal for the hip exoskeleton. Each subject performed two 30-min exoskeleton walking trials (1.0 m/s) using each controller and a 10-min trial with the exoskeleton unpowered. During each trial, we measured subjects' metabolic cost of walking, lower limb EMG profiles, and joint kinematics and kinetics (torques and powers) using a force treadmill and motion capture. Compared to unassisted walking in the exoskeleton, myoelectric control significantly reduced metabolic cost by 13% ( p  = 0.005) and biological hip torque control reduced metabolic cost by 7% ( p  = 0.261). Subjects reduced muscle activity relative to the unpowered condition for a greater number of lower limb muscles using myoelectric control compared to the biological hip torque control. More subjects subjectively preferred the myoelectric controller to the biological hip torque control. Myoelectric control had more advantages (metabolic cost and muscle activity reduction) compared to a controller that targeted a biological torque profile for walking with a robotic hip exoskeleton. However, these results were obtained with a single exoskeleton device with specific control configurations while level walking at a

  11. A Biomechanical Comparison of Proportional Electromyography Control to Biological Torque Control Using a Powered Hip Exoskeleton

    Directory of Open Access Journals (Sweden)

    Aaron J. Young

    2017-06-01

    Full Text Available BackgroundDespite a large increase in robotic exoskeleton research, there are few studies that have examined human performance with different control strategies on the same exoskeleton device. Direct comparison studies are needed to determine how users respond to different types of control. The purpose of this study was to compare user performance using a robotic hip exoskeleton with two different controllers: a controller that targeted a biological hip torque profile and a proportional myoelectric controller.MethodsWe tested both control approaches on 10 able-bodied subjects using a pneumatically powered hip exoskeleton. The state machine controller targeted a biological hip torque profile. The myoelectric controller used electromyography (EMG of lower limb muscles to produce a proportional control signal for the hip exoskeleton. Each subject performed two 30-min exoskeleton walking trials (1.0 m/s using each controller and a 10-min trial with the exoskeleton unpowered. During each trial, we measured subjects’ metabolic cost of walking, lower limb EMG profiles, and joint kinematics and kinetics (torques and powers using a force treadmill and motion capture.ResultsCompared to unassisted walking in the exoskeleton, myoelectric control significantly reduced metabolic cost by 13% (p = 0.005 and biological hip torque control reduced metabolic cost by 7% (p = 0.261. Subjects reduced muscle activity relative to the unpowered condition for a greater number of lower limb muscles using myoelectric control compared to the biological hip torque control. More subjects subjectively preferred the myoelectric controller to the biological hip torque control.ConclusionMyoelectric control had more advantages (metabolic cost and muscle activity reduction compared to a controller that targeted a biological torque profile for walking with a robotic hip exoskeleton. However, these results were obtained with a single exoskeleton device with specific

  12. Application of bacteriophages in post-harvest control of human pathogenic and food spoiling bacteria.

    Science.gov (United States)

    Pérez Pulido, Rubén; Grande Burgos, Maria José; Gálvez, Antonio; Lucas López, Rosario

    2016-10-01

    Bacteriophages have attracted great attention for application in food biopreservation. Lytic bacteriophages specific for human pathogenic bacteria can be isolated from natural sources such as animal feces or industrial wastes where the target bacteria inhabit. Lytic bacteriophages have been tested in different food systems for inactivation of main food-borne pathogens including Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Salmonella enterica, Shigella spp., Campylobacter jejuni and Cronobacter sakazkii, and also for control of spoilage bacteria. Application of lytic bacteriophages could selectively control host populations of concern without interfering with the remaining food microbiota. Bacteriophages could also be applied for inactivation of bacteria attached to food contact surfaces or grown as biofilms. Bacteriophages may receive a generally recognized as safe status based on their lack of toxicity and other detrimental effects to human health. Phage preparations specific for L. monocytogenes, E. coli O157:H7 and S. enterica serotypes have been commercialized and approved for application in foods or as part of surface decontamination protocols. Phage endolysins have a broader host specificity compared to lytic bacteriophages. Cloned endolysins could be used as natural preservatives, singly or in combination with other antimicrobials such as bacteriocins.

  13. VarR controls colonization and virulence in the marine macroalgal pathogen Nautella italica R11

    Directory of Open Access Journals (Sweden)

    Melissa eGardiner

    2015-10-01

    Full Text Available There is increasing evidence to suggest that macroalgae (seaweeds are susceptible to infectious disease. However, to date, little is known about the mechanisms that facilitate the colonization and virulence of microbial seaweed pathogens. One well-described example of a seaweed disease is the bleaching of the red alga Delisea pulchra, which can be caused by the bacterium Nautella italica R11, a member of the Roseobacter clade. This pathogen contains a unique luxR-type gene, varR, which we hypothesize controls its colonization and virulence. We show here that a varR knock-out strain is deficient in its ability to cause disease in D. pulchra and is defective in biofilm formation and attachment to a common algal polysaccharide. Moreover complementation of the varR gene in trans can restore these functions to the wild type levels. Proteomic analysis of bacterial cells in planktonic and biofilm growth highlight the potential importance of nitrogen scavenging, mobilization of energy reserves, and stress resistance in the biofilm lifestyle of N. italica R11. Moreover, we show that VarR regulates the expression of a specific subset of biofilm-associated proteins. Taken together these data suggest that VarR controls colonization and persistence of N. italica R11 on the surface of a macroalgal host and that it is an important regulator of virulence.

  14. Microstructure synthesis control of biological polyhydroxyalkanoates with mass spectrometry

    Science.gov (United States)

    Pederson, Erik Norman

    Polyhydroxyalkanoates (PHA's) are a class of biologically produced polymers, or plastic, that is synthesized by various microorganisms. PHA's are made from biorenewable resources and are fully biodegradable and biocompatible, making them an environmentally friendly green polymer. A method of incorporating polymer microstructure into the PHA synthesized in Ralstonia eutropha was developed. These microstructures were synthesized with polyhydroxybutyrate (PHB) and poly(hydroxybutyrate-co-hydroxyvalerate) (PHBV) as the polymer domains. To synthesize the PHB V copolymer, the additional presence of valerate was required. To control valerate substrate additions to the bioreactor, an off-gas mass spectrometry (MS) feedback control system was developed. Important process information including the cell physiology, growth kinetics, and product formation kinetics in the bioreactor was obtained with MS and used to control microstructure synthesis. The two polymer microstructures synthesized were core-shell granules and block copolymers. Block copolymers control the structure of the individual polymer chains while core-shell granules control the organization of many polymer chains. Both these microstructures result in properties unattainable by blending the two polymers together. The core-shell structures were synthesized with controlled domain thickness based on a developed model. Different block copolymers compositions were synthesized by varying the switching time of the substrate pulses responsible for block copolymer synthesis. The block copolymers were tested to determine their chemical properties and cast into films to determine the materials properties. These block copolymer films possessed new properties not achieved by copolymers or blends of the two polymers.

  15. Granular formulation of Fusarium oxysporum for biological control of faba bean and tomato Orobanche.

    Science.gov (United States)

    Nemat Alla, Mamdouh M; Shabana, Yasser M; Serag, Mamdouh M; Hassan, Nemat M; El-Hawary, Mohamed M

    2008-12-01

    Orobanche spp. represent a serious threat to a wide range of crops. They are difficult targets for herbicides, and biological control could provide a possible solution. This work therefore aimed to formulate mycoherbicides of Fusarium with adequate shelf life and virulence against Orobanche but safe to faba bean and tomato. Only two isolates of Fusarium oxysporum Schlecht. (Foxy I and Foxy II) obtained from diseased Orobanche shoots were found to be pathogenic to Orobanche crenata Forsk. and Orobanche ramosa L. Conidial suspension of both isolates significantly decreased germination, attachments and tubercles of Orobanche. Microconidia and chlamydospores of both isolates were formulated as mycoherbicides encapsulated in a wheat flour-kaolin matrix (four different formulations). All formulations greatly diminished Orobanche emerged shoots, total shoot number, shoot height, attachment of emerged shoots, the germinated seeds that succeeded in emerging above the soil surface and dry weight. Meanwhile, disease incidence and disease severity of emerged shoots were enhanced. The shelf life was adequate, particularly for coarse, freshly prepared, low-temperature-stored, microconidia-rich formulations. The induced growth reduction of Orobanche-infected host plants seemed to be nullified by formulations, particularly at the highest dose. These formulations seemed to destroy Orobanche but appeared harmless to host plants. Hence, they could be efficiently used as mycoherbicides for biological control of Orobanche in faba bean and tomato.

  16. Using biological control research in the classroom to promote scientific inquiry and literacy

    Science.gov (United States)

    Many scientists who research biological control also teach at universities or more informally through cooperative outreach. The purpose of this paper is to review biological control activities for the classroom in four refereed journals, The American Biology Teacher, Journal of Biological Education...

  17. Biologically inspired autonomous structural materials with controlled toughening and healing

    Science.gov (United States)

    Garcia, Michael E.; Sodano, Henry A.

    2010-04-01

    The field of structural health monitoring (SHM) has made significant contributions in the field of prognosis and damage detection in the past decade. The advantageous use of this technology has not been integrated into operational structures to prevent damage from propagating or to heal injured regions under real time loading conditions. Rather, current systems relay this information to a central processor or human operator, who then determines a course of action such as altering the mission or scheduling repair maintenance. Biological systems exhibit advanced sensory and healing traits that can be applied to the design of material systems. For instance, bone is the major structural component in vertebrates; however, unlike modern structural materials, bone has many properties that make it effective for arresting the propagation of cracks and subsequent healing of the fractured area. The foremost goal for the development of future adaptive structures is to mimic biological systems, similar to bone, such that the material system can detect damage and deploy defensive traits to impede damage from propagating, thus preventing catastrophic failure while in operation. After sensing and stalling the propagation of damage, the structure must then be repaired autonomously using self healing mechanisms motivated by biological systems. Here a novel autonomous system is developed using shape memory polymers (SMPs), that employs an optical fiber network as both a damage detection sensor and a network to deliver stimulus to the damage site initiating adaptation and healing. In the presence of damage the fiber optic fractures allowing a high power laser diode to deposit a controlled level of thermal energy at the fractured sight locally reducing the modulus and blunting the crack tip, which significantly slows the crack growth rate. By applying a pre-induced strain field and utilizing the shape memory recovery effect, thermal energy can be deployed to close the crack and return

  18. Control of foliar pathogens of spring barley using a combination of resistance elicitors

    Directory of Open Access Journals (Sweden)

    Dale Ronald Walters

    2014-05-01

    Full Text Available The ability of the resistance elicitors acibenzolar-S-methyl (ASM, β-aminobutyric acid (BABA, cis-jasmone (CJ, and a combination of the three products, to control infection of spring barley by Rhynchosporium commune was examined under glasshouse conditions. Significant control of R. commune was provided by ASM and CJ, but the largest reduction in infection was obtained with the combination of the three elicitors. This elicitor combination was found to up-regulate the expression of PR-1b, which is used as a molecular marker for systemic acquired resistance (SAR. However, the elicitor combination also down-regulated the expression of LOX2, a gene involved in the biosynthesis of jasmonic acid (JA. In field experiments over three consecutive years, the effects of the elicitor combination were influenced greatly by crop variety and by year. For example, the elicitor combination applied on its own provided significant control of powdery mildew (Blumeria graminis f.sp. hordei and R. commune in 2009, whereas no control on either variety was observed in 2007. In contrast, treatments involving both the elicitor combination and fungicides provided disease control and yield increases which were equal to, and in some cases better than that provided by the best fungicide-only treatment. The prospects for the use of elicitor plus fungicide treatments to control foliar pathogens of spring barley in practice are discussed.

  19. Impact of waning acquired immunity and asymptomatic infections on case-control studies for enteric pathogens.

    Science.gov (United States)

    Havelaar, Arie H; Swart, Arno

    2016-12-01

    Case-control studies of outbreaks and of sporadic cases of infectious diseases may provide a biased estimate of the infection rate ratio, due to selecting controls that are not at risk of disease. We use a dynamic mathematical model to explore biases introduced in results drawn from case-control studies of enteric pathogens by waning and boosting of immunity, and by asymptomatic infections, using Campylobacter jejuni as an example. Individuals in the population are either susceptible (at risk of infection and disease), fully protected (not at risk of either) or partially protected (at risk of infection but not of disease). The force of infection is a function of the exposure frequency and the exposure dose. We show that the observed disease odds ratios are indeed strongly biased towards the null, i.e. much lower than the infection rate ratio, and furthermore even not proportional to it. The bias could theoretically be controlled by sampling controls only from the reservoir of susceptible individuals. The population at risk is in a dynamic equilibrium, and cannot be identified as those who are not and have never experienced disease. Individual-level samples to measure protective immunity would be required, complicating the design, cost and execution of case-control studies. Copyright © 2016 The Author(s). Published by Elsevier B.V. All rights reserved.

  20. Biological Characteristics and Control of Orobanche Crenata Forsk., a Review

    Directory of Open Access Journals (Sweden)

    Giuseppe Restuccia

    2011-02-01

    Full Text Available Orobanche crenata is a holoparasitic phanerogam which is particularly noxious to legumes, such as faba bean (Vicia faba L., pea (Pisum sativum L., chickpea (Cicer arietinum L., lentil (Lens culinaris Medik., etc., and commonly considered one of the major causes which has contributed to re-rizing the area designed to their cultivation. After a few brief references on the origin and diffusion of O. crenata, in this work summarises the results of research into biological aspects and control of this species. The information obtained especially concerns seed production, seed viability, seed longevity and dormancy, seed conditioning and germination, parasitism phases, the effects of parasite attacks on host plants and the means of control.

  1. INTEGRATED MANAGEMENT OF CHROMOLAENA ODORATA EMPHASIZING THE CLASSICAL BIOLOGICAL CONTROL

    Directory of Open Access Journals (Sweden)

    SOEKISMAN TJITROSEMITO

    1998-01-01

    Full Text Available Chromolaena odorata, Siam weed, a very important weed of Java Island (Indonesia is native to Central and South America. In the laboratory it showed rapid growth (1.15 g/g/week in the first 8 weeks of its growth. The biomass was mainly as leaves (LAR : 317.50 cm'/g total weight. It slowed down in the following month as the biomass was utilized for stem and branch formation. This behavior supported the growth of C. odorata into a very dense stand. It flowered, fruited during the dry season, and senesced following maturation of seeds from inflorescence branches. These branches dried out, but soon the stem resumed aggressive growth following the wet season. Leaf biomass was affected by the size of the stem in its early phase of regrowth, but later on it was more affected by the number of branches. The introduction of Pareuchaetes pseudoinsulata to Indonesia, was successful only in North Sumatera. In Java it has not been reported to establish succesfully. The introduction of another biological control agent, Procecidochares conneca to Indonesia was shown to be sp ecific and upon release in West Java it established immediately. It spread exponentia lly in the first 6 months of its release. Field monitoring continues to eval uate the impact of the agents. Other biocontrol agents (Actmole anteas and Conotrachelus wilt be introduced to Indonesia in 1997 through ACIAR Project on the Biological Control of Chromolaena odorata in Indonesia and Papua New Guinea.

  2. Assessing Probabilistic Risk Assessment Approaches for Insect Biological Control Introductions.

    Science.gov (United States)

    Kaufman, Leyla V; Wright, Mark G

    2017-07-07

    The introduction of biological control agents to new environments requires host specificity tests to estimate potential non-target impacts of a prospective agent. Currently, the approach is conservative, and is based on physiological host ranges determined under captive rearing conditions, without consideration for ecological factors that may influence realized host range. We use historical data and current field data from introduced parasitoids that attack an endemic Lepidoptera species in Hawaii to validate a probabilistic risk assessment (PRA) procedure for non-target impacts. We use data on known host range and habitat use in the place of origin of the parasitoids to determine whether contemporary levels of non-target parasitism could have been predicted using PRA. Our results show that reasonable predictions of potential non-target impacts may be made if comprehensive data are available from places of origin of biological control agents, but scant data produce poor predictions. Using apparent mortality data rather than marginal attack rate estimates in PRA resulted in over-estimates of predicted non-target impact. Incorporating ecological data into PRA models improved the predictive power of the risk assessments.

  3. Reevaluation of the value of autoparasitoids in biological control.

    Directory of Open Access Journals (Sweden)

    Lian-Sheng Zang

    Full Text Available Autoparasitoids with the capacity of consuming primary parasitoids that share the same hosts to produce males are analogous to intraguild predators. The use of autoparasitoids in biological control programs is a controversial matter because there is little evidence to support the view that autoparasitoids do not disrupt and at times may promote suppression of insect pests in combination with primary parasitoids. We found that Encarsia sophia, a facultative autoparasitoid, preferred to use heterospecific hosts as secondary hosts for producing males. The autoparasitoids mated with males originated from heterospecifics may parasitize more hosts than those mated with males from conspecifics. Provided with an adequate number of males, the autoparasitoids killed more hosts than En. formosa, a commonly used parasitoid for biological control of whiteflies. This study supports the view that autoparasitoids in combination with primary parasitoids do not disrupt pest management and may enhance such programs. The demonstrated preference of an autoparasitoid for heterospecifics and improved performance of males from heterospecifics observed in this study suggests these criteria should be considered in strategies that endeavor to mass-produce and utilize autoparasitoids in the future.

  4. MYC Cofactors: Molecular Switches Controlling Diverse Biological Outcomes

    Science.gov (United States)

    Hann, Stephen R.

    2014-01-01

    The transcription factor MYC has fundamental roles in proliferation, apoptosis, tumorigenesis, and stem cell pluripotency. Over the last 30 years extensive information has been gathered on the numerous cofactors that interact with MYC and the target genes that are regulated by MYC as a means of understanding the molecular mechanisms controlling its diverse roles. Despite significant advances and perhaps because the amount of information learned about MYC is overwhelming, there has been little consensus on the molecular functions of MYC that mediate its critical biological roles. In this perspective, the major MYC cofactors that regulate the various transcriptional activities of MYC, including canonical and noncanonical transactivation and transcriptional repression, will be reviewed and a model of how these transcriptional mechanisms control MYC-mediated proliferation, apoptosis, and tumorigenesis will be presented. The basis of the model is that a variety of cofactors form dynamic MYC transcriptional complexes that can switch the molecular and biological functions of MYC to yield a diverse range of outcomes in a cell-type- and context-dependent fashion. PMID:24939054

  5. Competition and antibiosis in the biological control of potato scab.

    Science.gov (United States)

    Neeno-Eckwall, E C; Kinkel, L L; Schottel, J L

    2001-04-01

    Nonpathogenic, antibiotic-producing streptomycetes have been shown to reduce potato scab when added to disease-conducive soil. Spontaneous mutants of the pathogenic Streptomyces scabies RB4 that are resistant to at least one antibiotic activity produced by the nonpathogenic suppressive isolates Streptomyces diastatochromogenes strain PonSSII and S. scabies PonR have been isolated. To determine the importance of antibiosis in this biocontrol system, these mutants were investigated for their ability to cause disease in the presence of the two pathogen antagonists in a greenhouse assay. Disease caused by one of the mutant strains was reduced in the presence of both suppressive isolates, whereas disease caused by the other five mutants was not significantly reduced by either suppressive strain. In addition, a nonpathogenic mutant of S. scabies RB4 was isolated, which produced no detectable in vitro antibiotic activity and reduced disease caused by its pathogenic parent strain when the pathogen and mutant were coinoculated into soil. Population densities of the pathogen were consistently lower than those of the suppressive strains when individual strains were inoculated into soil. When a pathogen was coinoculated with a suppressive strain, the total streptomycete population density in the pot was always less than that observed when the suppressive isolate was inoculated alone. When the pathogens were inoculated individually into soil, a positive correlation was seen between population density and disease severity. In coinoculation experiments with pathogen and suppressive strains, higher total streptomycete population densities were correlated with lower amounts of disease.

  6. Emerging Preservation Techniques for Controlling Spoilage and Pathogenic Microorganisms in Fruit Juices

    Directory of Open Access Journals (Sweden)

    Kamal Rai Aneja

    2014-01-01

    Full Text Available Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed.

  7. Incorporation of plant materials in the control of root pathogens in muskmelon

    Directory of Open Access Journals (Sweden)

    Andréa Mirne de Macêdo Dantas

    2013-12-01

    Full Text Available The effect of plant materials[Sunn Hemp (Crotalaria juncea, Castor Bean (Ricinus communis L., Cassava (Manihot esculenta Crantz and Neem (Azadirachta indica] and the times of incorporation of these materials in regards to the incidence of root rot in melon was evaluated in Ceará state, Brazil. The experiment was conducted in a commercial area with a history of root pathogens in cucurbitaceae. The randomized block design was used, in a 5 x 3 factorial arrangement with four repetitions. The treatments consisted of a combination of four plant materials (sunn hemp, castor beans, cassava and neem and a control with no soil incorporation of plant material and three times of incorporation (28, 21, and 14 days before the transplanting of the seedlings. Lower incidence of root rot was observed in practically all of the treatments where materials were incorporated at different times, with variation between the materials, corresponding with the time of incorporation, in relation to the soil without plant material. The pathogens isolated from the symptomatic muskmelon plants were Fusarium solani, Macrophomina phaseolina, Monosporascus cannonballus and Rhizoctonia solani, F. solani being encountered most frequently.

  8. A Flexible Spatial Framework for Modeling Spread of Pathogens in Animals with Biosurveillance and Disease Control Applications

    Directory of Open Access Journals (Sweden)

    Montiago X. LaBute

    2014-05-01

    Full Text Available Biosurveillance activities focus on acquiring and analyzing epidemiological and biological data to interpret unfolding events and predict outcomes in infectious disease outbreaks. We describe a mathematical modeling framework based on geographically aligned data sources and with appropriate flexibility that partitions the modeling of disease spread into two distinct but coupled levels. A top-level stochastic simulation is defined on a network with nodes representing user-configurable geospatial “patches”. Intra-patch disease spread is treated with differential equations that assume uniform mixing within the patch. We use U.S. county-level aggregated data on animal populations and parameters from the literature to simulate epidemic spread of two strikingly different animal diseases agents: foot-and-mouth disease and highly pathogenic avian influenza. Results demonstrate the capability of this framework to leverage low-fidelity data while producing meaningful output to inform biosurveillance and disease control measures. For example, we show that the possible magnitude of an outbreak is sensitive to the starting location of the outbreak, highlighting the strong geographic dependence of livestock and poultry infectious disease epidemics and the usefulness of effective biosurveillance policy. The ability to compare different diseases and host populations across the geographic landscape is important for decision support applications and for assessing the impact of surveillance, detection, and mitigation protocols.

  9. Application of Biosynthesized Silver Nanoparticles for the Control of Land Snail Eobania vermiculata and Some Plant Pathogenic Fungi

    Directory of Open Access Journals (Sweden)

    Safaa M. Ali

    2015-01-01

    Full Text Available The land snail Eobania vermiculata is an important crop pest causing considerable damage in agriculture. The aim of the present work is to evaluate the possibilities of using silver nanoparticles (AgNPs to control the land snail. The AgNPs have been synthesized biologically using white radish (Raphanus sativus var. aegyptiacus. The biosynthesis was regularly monitored by UV-Vis spectroscopy. X-ray diffraction spectra revealed peaks of crystalline nature of AgNPs and the transmission electron micrographs further confirmed the size of the synthesized nanoparticles ranging from 6 to 38 nm. The exposure of the snails and soil matrix to AgNPs in a laboratory experiment reduced the activity and the viability of the land snail (20% of AgNPs treated snails died as well as the frequency of fungal population in the surrounding soil. Moreover histology and ultrastructure alterations have been found in both kidney and the digestive gland of AgNPs treated land snails. The synergistic effect of synthesized AgNPs as antifungal was evaluated and clearly revealed that AgNPs can be effectively used against various plant pathogenic fungi. The present study results may open a new avenue to use the snail as bioindicator organism of environmental pollution.

  10. Models for integrated pest control and their biological implications.

    Science.gov (United States)

    Tang, Sanyi; Cheke, Robert A

    2008-09-01

    Successful integrated pest management (IPM) control programmes depend on many factors which include host-parasitoid ratios, starting densities, timings of parasitoid releases, dosages and timings of insecticide applications and levels of host-feeding and parasitism. Mathematical models can help us to clarify and predict the effects of such factors on the stability of host-parasitoid systems, which we illustrate here by extending the classical continuous and discrete host-parasitoid models to include an IPM control programme. The results indicate that one of three control methods can maintain the host level below the economic threshold (ET) in relation to different ET levels, initial densities of host and parasitoid populations and host-parasitoid ratios. The effects of host intrinsic growth rate and parasitoid searching efficiency on host mean outbreak period can be calculated numerically from the models presented. The instantaneous pest killing rate of an insecticide application is also estimated from the models. The results imply that the modelling methods described can help in the design of appropriate control strategies and assist management decision-making. The results also indicate that a high initial density of parasitoids (such as in inundative releases) and high parasitoid inter-generational survival rates will lead to more frequent host outbreaks and, therefore, greater economic damage. The biological implications of this counter intuitive result are discussed.

  11. A Window of Opportunity to Control the Bacterial Pathogen Pseudomonas aeruginosa Combining Antibiotics and Phages

    Science.gov (United States)

    Torres-Barceló, Clara; Arias-Sánchez, Flor I.; Vasse, Marie; Ramsayer, Johan

    2014-01-01

    The evolution of antibiotic resistance in bacteria is a global concern and the use of bacteriophages alone or in combined therapies is attracting increasing attention as an alternative. Evolutionary theory predicts that the probability of bacterial resistance to both phages and antibiotics will be lower than to either separately, due for example to fitness costs or to trade-offs between phage resistance mechanisms and bacterial growth. In this study, we assess the population impacts of either individual or combined treatments of a bacteriophage and streptomycin on the nosocomial pathogen Pseudomonas aeruginosa. We show that combining phage and antibiotics substantially increases bacterial control compared to either separately, and that there is a specific time delay in antibiotic introduction independent of antibiotic dose, that minimizes both bacterial density and resistance to either antibiotics or phage. These results have implications for optimal combined therapeutic approaches. PMID:25259735

  12. Babaco (Vasconcellea heilbornii var. pentagona Badillo. Major plant pathogens and control strategies

    Directory of Open Access Journals (Sweden)

    Angel Rolando Robles-Carrión

    2016-04-01

    Full Text Available This work was carried out with the aim of documenting the importance of Babaco for the Andean region, its main plant pathogens, and possible control strategies and integrated management, emphasizing the MVB. Was performed a systematic review of scientific papers published in prestigious journals and thesis diplomas, masters and doctorates from various universities. As a criterion for inclusion-exclusion studies were taken into account in the genus Vasconcellea. Ecuador has 15 of the 21 described species, of which more than half are located in the province of Loja. Vascular Wilt Babaco (MVB is caused by a complex of Fusarium fungi that interact with the plant. There are no integrated management strategies for Vascular Wilt Babaco scientifically proven.

  13. Effectiveness of electron beam irradiation in the control of some soilborne pathogens

    International Nuclear Information System (INIS)

    Orlikowski, L.B.; Ptaszek, M.; Migdal, W.; Gryczka, U.

    2011-01-01

    Electron beam (EB) irradiation was tested against Botrytis cinerea, Pythium ultimum and Phytophthora citricola the most dangerous pathogens causing stem and root rot of seedlings, cuttings and older plants. In the laboratory trials cultures of 3 species were irradiated with doses 0 (control), 1.5, 3.0, 4.5 and 6.0 kGy whereas peat was treated with 10, 15 and 25 kGy. P. citricola was the most sensitive species for irradiation. In greenhouse trials 15 kGy irradiation of peat protected chrysanthemum cuttings against B. cinerea and P. ultimum as well as rhododendron young plants against P. citricola. Irradiation of peat did not influence the growth and development of the tested plants. (authors)

  14. Effectiveness of sanitizing products on controlling selected pathogen surrogates on retail deli slicers.

    Science.gov (United States)

    Yeater, Michael C; Kirsch, Katie R; Taylor, T Matthew; Mitchell, Jeff; Osburn, Wesley N

    2015-04-01

    The objectives of this study were (i) to assess the efficacy of quaternary ammonium chloride-based wet foam (WF) and dry foam (DF) sanitizer systems (600 ppm) for reducing Listeria innocua (a nonpathogenic surrogate of Listeria monocytogenes) or a 100.0 μg/ml rifampin-resistant Salmonella Typhimurium LT2 (a nonpathogenic surrogate of Salmonella enterica serovar Typhimurium) on niche and transfer point areas of an unwashed retail deli slicer as compared with traditional chlorine (Cl(-)) treatment (200 ppm) and (ii) to compare sanitizer surface contact times (10 and 15 min) for pathogen surrogate control. Turkey frankfurter slurries inoculated with L. innocua or Salmonella Typhimurium were used to inoculate seven high-risk sites on a commercial slicer. After 30 min of bacterial attachment, slicers were dry wiped to remove excess food matter, followed by a randomly assigned sanitizer treatment. Surviving pathogen surrogate cells were enumerated on modified Oxford's agar not containing antimicrobic supplement (L. innocua) or on tryptic soy agar supplemented with 100 μg/ml rifampin (Salmonella Typhimurium LT2). Replicate-specific L. innocua and Salmonella Typhimurium reductions were calculated as log CFU per square centimeter of control minus log CFU per square centimeter of enumerated survivors for each site. For both organisms, all sanitizer treatments differed from each other, with Cl(-) producing the least reduction and WF the greatest reduction. A significant (P < 0.05) site-by-treatment interaction was observed. The results of the study indicate that quaternary ammonium chloride sanitizers (600 ppm) applied by both WF and DF were more effective at reducing L. innocua and Salmonella Typhimurium than a traditional Cl sanitizer (200 ppm) on unwashed slicer surfaces.

  15. Cell death control: the interplay of apoptosis and autophagy in the pathogenicity of Sclerotinia sclerotiorum.

    Directory of Open Access Journals (Sweden)

    Mehdi Kabbage

    Full Text Available Programmed cell death is characterized by a cascade of tightly controlled events that culminate in the orchestrated death of the cell. In multicellular organisms autophagy and apoptosis are recognized as two principal means by which these genetically determined cell deaths occur. During plant-microbe interactions cell death programs can mediate both resistant and susceptible events. Via oxalic acid (OA, the necrotrophic phytopathogen Sclerotinia sclerotiorum hijacks host pathways and induces cell death in host plant tissue resulting in hallmark apoptotic features in a time and dose dependent manner. OA-deficient mutants are non-pathogenic and trigger a restricted cell death phenotype in the host that unexpectedly exhibits markers associated with the plant hypersensitive response including callose deposition and a pronounced oxidative burst, suggesting the plant can recognize and in this case respond, defensively. The details of this plant directed restrictive cell death associated with OA deficient mutants is the focus of this work. Using a combination of electron and fluorescence microscopy, chemical effectors and reverse genetics, we show that this restricted cell death is autophagic. Inhibition of autophagy rescued the non-pathogenic mutant phenotype. These findings indicate that autophagy is a defense response in this necrotrophic fungus/plant interaction and suggest a novel function associated with OA; namely, the suppression of autophagy. These data suggest that not all cell deaths are equivalent, and though programmed cell death occurs in both situations, the outcome is predicated on who is in control of the cell death machinery. Based on our data, we suggest that it is not cell death per se that dictates the outcome of certain plant-microbe interactions, but the manner by which cell death occurs that is crucial.

  16. Biological control strategies of mycotoxigenic fungi and associated mycotoxins in Mediterranean basin crops

    Directory of Open Access Journals (Sweden)

    Dimitrios I. TSITSIGIANNIS

    2012-05-01

    Full Text Available Fungi that belong to the genera Aspergillus, Fusarium, and Penicillium pose serious phytopathological and mycotoxicological risks at pre-harvest and post-harvest stages, as well as in processed food products because they can produce several mycotoxins. Mycotoxins pose a serious problem for animal and human health and have a significant economic impact worldwide. The Mediterranean basin is a large geographical region with a temperate climate supporting the cultivation of a wealth of field and greenhouse crops with a high risk of mycotoxin contamination. The most important mycotoxins that occur in the Mediterranean basin are aflatoxins (B1, B2, G1 and G2 in dried fruits and nuts, ochratoxin A in grapes and raisins as well as trichothecenes and fumonisins in cereals. A variety of chemical, biological and physical strategies have been developed to control the mycotoxigenic pathogens; to minimize mycotoxin production at pre- or post-harvest level; to contribute to decontamination and/or detoxification of mycotoxins from contaminated foods and feeds; or to inhibit mycotoxin absorption in the gastrointestinal tract. Biological control using microbial antagonists either alone or as part of an integrated control strategy to reduce pesticide inputs, has emerged as a promising approach for control of mycotoxins in crops, both pre- and post-harvest. Several organisms including atoxigenic Aspergilli, yeasts, bacteria and fungi have been tested for their ability to reduce both fungal infection and mycotoxin contamination. For instance, atoxigenic fungal strains are being used widely to prevent pre-harvest aflatoxin contamination of crops such as peanuts, pistachios, maize, and cottonseed in several parts of the world including the Mediterranean area. Recent advancements in the use of biocontrol strategies have led to registration of commercial products with increased practical applications for the benefit of growers in several countries.

  17. Biology and life history of Argopistes tsekooni (Coleoptera: Chrysomelidae) in China, a promising biological control agent of Chinese privet.

    Science.gov (United States)

    Y-Z Zhang; J. Sun; J.L. Hanula

    2009-01-01

    The biology and life history of Argopistes tsekooni Chen (Coleoptera: Chrysomelidae), a potential biological control agent of Chinese privet, Ligustrum sinense Lour., was studied under laboratory and outdoor conditions in Huangshan City of Anhui Province, China, in 2006. A. tsekooni larvae are leafminers that...

  18. The transcription factor Rbf1 is the master regulator for b-mating type controlled pathogenic development in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Kai Heimel

    Full Text Available In the phytopathogenic basidiomycete Ustilago maydis, sexual and pathogenic development are tightly connected and controlled by the heterodimeric bE/bW transcription factor complex encoded by the b-mating type locus. The formation of the active bE/bW heterodimer leads to the formation of filaments, induces a G2 cell cycle arrest, and triggers pathogenicity. Here, we identify a set of 345 bE/bW responsive genes which show altered expression during these developmental changes; several of these genes are associated with cell cycle coordination, morphogenesis and pathogenicity. 90% of the genes that show altered expression upon bE/bW-activation require the zinc finger transcription factor Rbf1, one of the few factors directly regulated by the bE/bW heterodimer. Rbf1 is a novel master regulator in a multilayered network of transcription factors that facilitates the complex regulatory traits of sexual and pathogenic development.

  19. Meta-analysis of the randomized controlled trials of the hemostatic efficacy and capacity of pathogen-reduced platelets.

    Science.gov (United States)

    Vamvakas, Eleftherios C

    2011-05-01

    A recent independently funded randomized controlled trial (RCT; Br J Haematol 2010;150:209-17) questioned prevailing opinion concerning the hemostatic capacity of pathogen-reduced platelets (PLTs). Meta-analysis was used to calculate the effect of pathogen reduction (PR) of PLTs on hemostatic efficacy and capacity based on all available data and to investigate possible reasons for the variation in reported findings. RCTs allocating patients to receive routine PLT transfusions with pathogen-reduced or untreated PLTs and reporting on at least one of six hemostasis endpoints were eligible for analysis. Five RCTs of hemato-oncology patients met eligibility criteria. Endpoints determined by similar criteria in all RCTs were integrated by fixed-effects methods. Endpoints determined by different criteria were integrated by random-effects methods. Studies were statistically homogeneous in all analyses. Pathogen-reduced PLTs were associated with a significant (p benefits from PR. © 2010 American Association of Blood Banks.

  20. Real-time Experiment Interface for Biological Control Applications

    Science.gov (United States)

    Lin, Risa J.; Bettencourt, Jonathan; White, John A.; Christini, David J.; Butera, Robert J.

    2013-01-01

    The Real-time Experiment Interface (RTXI) is a fast and versatile real-time biological experimentation system based on Real-Time Linux. RTXI is open source and free, can be used with an extensive range of experimentation hardware, and can be run on Linux or Windows computers (when using the Live CD). RTXI is currently used extensively for two experiment types: dynamic patch clamp and closed-loop stimulation pattern control in neural and cardiac single cell electrophysiology. RTXI includes standard plug-ins for implementing commonly used electrophysiology protocols with synchronized stimulation, event detection, and online analysis. These and other user-contributed plug-ins can be found on the website (http://www.rtxi.org). PMID:21096883

  1. Quagga and zebra mussels: biology, impacts, and control

    Science.gov (United States)

    Nalepa, Thomas F.; Schloesser, Don W.; Nalepa, Thomas F.; Schloesser, Don W.

    2013-01-01

    Quagga and Zebra Mussels: Biology, Impacts, and Control, Second Edition provides a broad view of the zebra/quagga mussel issue, offering a historic perspective and up-to-date information on mussel research. Comprising 48 chapters, this second edition includes reviews of mussel morphology, physiology, and behavior. It details mussel distribution and spread in Europe and across North America, and examines policy and regulatory responses, management strategies, and mitigation efforts. In addition, this book provides extensive coverage of the impact of invasive mussel species on freshwater ecosystems, including effects on water clarity, phytoplankton, water quality, food web changes, and consequences to other aquatic fauna. It also reviews and offers new insights on how zebra and quagga mussels respond and adapt to varying environmental conditions. This new edition includes seven video clips that complement chapter text and, through visual documentation, provide a greater understanding of mussel behavior and distribution.

  2. Biological Control of Sclerotinia sclerotiorum in Lettuce Using Antagonistic Bacteria

    Directory of Open Access Journals (Sweden)

    Bong-Goan Chon

    2013-03-01

    Full Text Available To isolate antagonistic bacteria against sclerotinia rot of lettuce, caused by Sclerotinia sclerotiorum, soil samples were collected from the diseased greenhouse field in Namyangju city, Gyeong-gi province from 2007 to 2008. A total of 196 bacterial isolates were isolated using serial dilution method. In dual culture assay in vitro, 26 isolates showed more than 80% of inhibition rates of mycelial growth of S. sclerotiorum. Based on 16S rDNA sequence analysis, the 26 isolates were identified as Bacillus megaterium, B. cereus, B. subtilis, Arthrobacter nicotianae, A. ramosus, Pseudomonas filiscindens, Stenotrophomonas maltophilia, Brevibacterium frigoritolerans and Sphingobacterium faecium. The 26 isolates inhibited the mycelial growth of S. sclerotiorum up to 80% and the sclerotial germination 0−100%. In the greenhouse pot test of ten isolates conducted in summer, 2 isolates B. megaterium (DK6 and B. cereus (C210 showed control efficacy on sclerotia viability of S. sclerotiorum, 20% and 35%, respectively. In the greenhouse pot test in winter, the disease incidence of the control group was 80%, whereas those of 9 isolates among 26 were approximately 20%. From the result, the 9 isolates are expected as potentially antagonistic bacteria for biological control of sclerotinia rot of lettuce caused by S. sclerotiorum.

  3. Biological control of rice brown spot with native isolates of three Trichoderma species.

    Science.gov (United States)

    Khalili, Elham; Sadravi, Mehdi; Naeimi, Shahram; Khosravi, Vahid

    2012-01-01

    Brown spot caused by Bipolaris oryzae is an important rice disease in Southern coast of Caspian Sea, the major rice growing region in Iran. A total of 45 Trichoderma isolates were obtained from rice paddy fields in Golestan and Mazandaran provinces which belonged to Trichoderma harzianum, T. virens and T. atroviride species. Initially, they were screened against B. oryzae by antagonism tests including dual culture, volatile and nonvolatile metabolites and hyperparasitism. Results showed that Trichoderma isolates can significantly inhibit mycelium growth of pathogen in vitro by producing volatile and nonvolatile metabolites Light microscopic observations showed no evidence of mycoparasitic behaviour of the tested isolates of Trichoderma spp. such as coiling around the B. oryzae. According to in vitro experiments, Trichoderma isolates were selected in order to evaluate their efficacy in controlling brown spot in glasshouse using seed treatment and foliar spray methods. Concerning the glasshouse tests, two strains of T. harzianum significantly controlled the disease and one strain of T. atroviride increased the seedling growth. It is the first time that the biological control of rice brown spot and increase of seedling growth with Trichoderma species have been studied in Iran.

  4. Biological control of rice brown spot with native isolates of three Trichoderma species

    Directory of Open Access Journals (Sweden)

    Elham Khalili

    2012-03-01

    Full Text Available Brown spot caused by Bipolaris oryzae is an important rice disease in Southern coast of Caspian Sea, the major rice growing region in Iran. A total of 45 Trichoderma isolates were obtained from rice paddy fields in Golestan and Mazandaran provinces which belonged to Trichoderma harzianum, T. virens and T. atroviride species. Initially, they were screened against B. oryzae by antagonism tests including dual culture, volatile and nonvolatile metabolites and hyperparasitism. Results showed that Trichoderma isolates can significantly inhibit mycelium growth of pathogen in vitro by producing volatile and nonvolatile metabolites Light microscopic observations showed no evidence of mycoparasitic behaviour of the tested isolates of Trichoderma spp. such as coiling around the B. oryzae. According to in vitro experiments, Trichoderma isolates were selected in order to evaluate their efficacy in controlling brown spot in glasshouse using seed treatment and foliar spray methods. Concerning the glasshouse tests, two strains of T. harzianum significantly controlled the disease and one strain of T. atroviride increased the seedling growth. It is the first time that the biological control of rice brown spot and increase of seedling growth with Trichoderma species have been studied in Iran.

  5. Innate immune response to a bovine mastitis pathogen profiled in milk and blood monocytes using a systems biology approach

    Science.gov (United States)

    Bovine mastitis is an inflammatory condition of the mammary gland which leads to reduced milk yield and increased milk somatic cell counts (SCC) resulting in an estimated annual cost to the dairy industry worldwide of ~ 2 billion euros. Mastitis has a complex etiology, with pathogenic, host and envi...

  6. [Principles of management in biological infections].

    Science.gov (United States)

    Płusa, Tadeusz

    2012-11-01

    The effectiveness of the management in respiratory infection is depending on the nature of the biological pathogen and the immune status of the patient. For this reason, providing assistance to victims the organ function support, similarly as defining the pathogen and targeted antibiotic therapy should be applied. Available diagnostic tests provide rapid ability to identify the pathogen and antibiotics are able to control infection. Lack of efficacy of treatment may indicate the diversity of the pathogen than previously known and raises suspicion of biological warfare pathogen.

  7. Biological control of fusarium wilt of tomato by antagonist fungi and ...

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... inhibited the growth of phytopathogenic fungi (Biondi et al., 2004; Zulpa et al., 2006; Tassara et al., 2008). Cyanobacteria produce biologically active compounds that have antifungal activity (Kulik, 1995; Schlegel et al.,. 1998) and antibiotic and toxic activity against plant pathogens (Bonjouklian et al., 1991; ...

  8. Insect-plant-pathogen interactions as shaped by future climate: effects on biology, distribution, and implications for agriculture.

    Science.gov (United States)

    Trębicki, Piotr; Dáder, Beatriz; Vassiliadis, Simone; Fereres, Alberto

    2017-12-01

    Carbon dioxide (CO 2 ) is the main anthropogenic gas which has drastically increased since the industrial revolution, and current concentrations are projected to double by the end of this century. As a consequence, elevated CO 2 is expected to alter the earths' climate, increase global temperatures and change weather patterns. This is likely to have both direct and indirect impacts on plants, insect pests, plant pathogens and their distribution, and is therefore problematic for the security of future food production. This review summarizes the latest findings and highlights current knowledge gaps regarding the influence of climate change on insect, plant and pathogen interactions with an emphasis on agriculture and food production. Direct effects of climate change, including increased CO 2 concentration, temperature, patterns of rainfall and severe weather events that impact insects (namely vectors of plant pathogens) are discussed. Elevated CO 2 and temperature, together with plant pathogen infection, can considerably change plant biochemistry and therefore plant defense responses. This can have substantial consequences on insect fecundity, feeding rates, survival, population size, and dispersal. Generally, changes in host plant quality due to elevated CO 2 (e.g., carbon to nitrogen ratios in C3 plants) negatively affect insect pests. However, compensatory feeding, increased population size and distribution have also been reported for some agricultural insect pests. This underlines the importance of additional research on more targeted, individual insect-plant scenarios at specific locations to fully understand the impact of a changing climate on insect-plant-pathogen interactions. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  9. Understanding the alphaviruses: recent research on important emerging pathogens and progress towards their control.

    Science.gov (United States)

    Gould, E A; Coutard, B; Malet, H; Morin, B; Jamal, S; Weaver, S; Gorbalenya, A; Moureau, G; Baronti, C; Delogu, I; Forrester, N; Khasnatinov, M; Gritsun, T; de Lamballerie, X; Canard, B

    2010-08-01

    The alphaviruses were amongst the first arboviruses to be isolated, characterized and assigned a taxonomic status. They are globally very widespread, infecting a large variety of terrestrial animals, insects and even fish, and circulate both in the sylvatic and urban/peri-urban environment, causing considerable human morbidity and mortality. Nevertheless, despite their obvious importance as pathogens, there are currently no effective antiviral drugs with which to treat humans or animals infected by any of these viruses. The EU-supported project-VIZIER (Comparative Structural Genomics of Viral Enzymes Involved in Replication, FP6 PROJECT: 2004-511960) was instigated with an ultimate view of contributing to the development of antiviral therapies for RNA viruses, including the alphaviruses [Coutard, B., Gorbalenya, A.E., Snijder, E.J., Leontovich, A.M., Poupon, A., De Lamballerie, X., Charrel, R., Gould, E.A., Gunther, S., Norder, H., Klempa, B., Bourhy, H., Rohayemj, J., L'hermite, E., Nordlund, P., Stuart, D.I., Owens, R.J., Grimes, J.M., Tuckerm, P.A., Bolognesi, M., Mattevi, A., Coll, M., Jones, T.A., Aqvist, J., Unger, T., Hilgenfeld, R., Bricogne, G., Neyts, J., La Colla, P., Puerstinger, G., Gonzalez, J.P., Leroy, E., Cambillau, C., Romette, J.L., Canard, B., 2008. The VIZIER project: preparedness against pathogenic RNA viruses. Antiviral Res. 78, 37-46]. This review highlights some of the major features of alphaviruses that have been investigated during recent years. After describing their classification, epidemiology and evolutionary history and the expanding geographic distribution of Chikungunya virus, we review progress in understanding the structure and function of alphavirus replicative enzymes achieved under the VIZIER programme and the development of new disease control strategies. Copyright 2009 Elsevier B.V. All rights reserved.

  10. Controlled droplet microfluidic systems for multistep chemical and biological assays.

    Science.gov (United States)

    Kaminski, T S; Garstecki, P

    2017-10-16

    Droplet microfluidics is a relatively new and rapidly evolving field of science focused on studying the hydrodynamics and properties of biphasic flows at the microscale, and on the development of systems for practical applications in chemistry, biology and materials science. Microdroplets present several unique characteristics of interest to a broader research community. The main distinguishing features include (i) large numbers of isolated compartments of tiny volumes that are ideal for single cell or single molecule assays, (ii) rapid mixing and negligible thermal inertia that all provide excellent control over reaction conditions, and (iii) the presence of two immiscible liquids and the interface between them that enables new or exotic processes (the synthesis of new functional materials and structures that are otherwise difficult to obtain, studies of the functions and properties of lipid and polymer membranes and execution of reactions at liquid-liquid interfaces). The most frequent application of droplet microfluidics relies on the generation of large numbers of compartments either for ultrahigh throughput screens or for the synthesis of functional materials composed of millions of droplets or particles. Droplet microfluidics has already evolved into a complex field. In this review we focus on 'controlled droplet microfluidics' - a portfolio of techniques that provide convenient platforms for multistep complex reaction protocols and that take advantage of automated and passive methods of fluid handling on a chip. 'Controlled droplet microfluidics' can be regarded as a group of methods capable of addressing and manipulating droplets in series. The functionality and complexity of controlled droplet microfluidic systems can be positioned between digital microfluidics (DMF) addressing each droplet individually using 2D arrays of electrodes and ultrahigh throughput droplet microfluidics focused on the generation of hundreds of thousands or even millions of

  11. Use of rhizobacteria and endophytes for biological control of weeds

    Directory of Open Access Journals (Sweden)

    Trognitz, Friederike

    2014-02-01

    Full Text Available Weeds cause severe yield losses in agriculture, with a maximum estimate of 34% of yield loss worldwide due to competition between the crops and the weeds for nutrition, light and humidity (OERKE, 2006. Invasive plants contribute partially to other problems. The pollen of common ragweed, Ambrosia artemisiifolia L., for example, is five times more allergenic than grass pollen; already ten pollen grains per m3 air can trigger allergy in sensitized patients, including rhinitis, conjunctivitis and asthma. This neophyte from America has extended the season of allergy in European patients to October. Common ragweed is currently most frequent in Hungary, France and Italy. In Austria, ragweed populations along roads have increased dramatically since 2000. The effective means to control this weed of the Asteraceae family are limited; a single plant can produce up to 6000 seeds which stay in the soil for 40 years. Control using selective herbicides is not possible within stands of the Asteraceae member sunflower. Efforts to use herbivore insects as biological control agents also failed due to the unavailability of insects specializing on this ragweed. The use of plant-associated rhizobacteria and endophytes as bio-herbicides offers a novel alternative to conventional methods. By analogy to experiences from other plant-microbe systems, the chances to find microbes of the desired characteristics are highest when isolating and testing specimens directly from ragweed plants. These organisms often have an extremely narrow host range that permits their use for the control of among several even closely related plant species growing together in a field.

  12. Biological control of Botrytis cinerea on tomato plants using Streptomyces ahygroscopicus strain CK-15.

    Science.gov (United States)

    Ge, B B; Cheng, Y; Liu, Y; Liu, B H; Zhang, K C

    2015-12-01

    We developed a real-time PCR assay to specifically detect and quantify the efficacy of a biological fungicide from Streptomyces ahygroscopicus var. wuyiensis on tomato leaves. This fungicide, the natural secondary metabolite wuyiencin, is an antifungal agent against Botrytis cinerea. Specific primers were designed based on the β-actin gene sequences, which were used to detect a 303 bp fragment from B. cinerea isolates. Our assay is highly sensitive and can be used to reliably detect and quantify as little as 1·75 pg of B. cinerea DNA. We used this detection method to monitor the progression of B. cinerea infection in inoculated plant material under preventive (wuyiencin) and nonpreventive treatment. After 5 days, plants under preventive treatment exhibited a sharp decrease in fungal biomass and no symptoms, whereas plants under nonpreventive treatment displayed severe disease symptoms. The results demonstrate that wuyiencin has significant effects on B. cinerea in tomato plants and that real-time PCR is a reliable method for evaluating the effects of Streptomyces wuyiensis CK-15 on B. cinerea. Botrytis cinerea commonly produces latent or nonsymptomatic infection on and within plant tissues, which can develop into symptomatic infection when triggered by changes in environmental conditions or host plant physiology. In this study, we develop a specific, sensitive real-time PCR assay for detecting and quantifying B. cinerea on tomato leaves to determine the control efficacy of Streptomyces ahygroscopicus var. wuyiensis as a biological fungicide. Our findings demonstrate that wuyiencin has significant effects on B. cinerea in tomato plants and that real-time PCR is a reliable method for evaluating the effects of biological fungicides on plant pathogens. © 2015 The Society for Applied Microbiology.

  13. Using Biological-Control Research in the Classroom to Promote Scientific Inquiry & Literacy

    Science.gov (United States)

    Richardson, Matthew L.; Richardson, Scott L.; Hall, David G.

    2012-01-01

    Scientists researching biological control should engage in education because translating research programs into classroom activities is a pathway to increase scientific literacy among students. Classroom activities focused on biological control target all levels of biological organization and can be cross-disciplinary by drawing from subject areas…

  14. BIOLOGICAL CONTROL - AS A MEANS TO CONTROL INSECT PESTS IN AZERBAIJAN

    Directory of Open Access Journals (Sweden)

    Z. M. Mamedov

    2013-01-01

    Full Text Available Two hundreds and twenty species parasites and predators of pests of various agricultures are revealed in Azerbaijan. The complex of entomophages of certain pests of agricultures is studied: 48 species of parasites and predators of Chloridea obsoleta 21 species of entomophages of Pectinophora malvella Hb., over 160 species of entomophages of pests of ozehards and vegetables, 34 species of entomophages of pests of forests. The hundreds species of entomophages and some entomophogenous microbes and antagonists are revealed. Biology and ecology of over 60 species of entomophages and useful microorganisims which are prospective as biological control agents are studied.

  15. Screening of chitinolytic actinomycetes for biological control of Sclerotium rolfsii stem rot disease of chilli

    Directory of Open Access Journals (Sweden)

    Pranee Pattanapipitpaisal

    2012-09-01

    Full Text Available Two hundred and eighty three strains were isolated from rhizoshere-associated soils, from Ubon Ratchathani andSrisaket province, using Enrichment Media for isolation of Chitinase-producing Actinomycetes agar (EMCA agar. All strainswere screened for chitinolytic activity and sixty eight strains gave significant clear zone on EMCA agar plates. The selectedchitinolytic strains were assayed for in vitro antagonism against Sclerotium rolfsii using cornmeal agar (CMA agar assayprocedure and the result showed that thirteen isolates have remarkable inhibiting the growth of the fungus and the top fiveantagonistic actinomycetes were PACCH 277, PACCH129, PACCH225, PACCH24 and PACCH246, respectively. The resultindicated that these actinomycetes produce chitinase which catalyze the degradation of chitin, resulting in inhibition of S.rolfsii growth. Their abilities to control the disease development were tested for in vivo biocontrol assay on chilli seedlings.Two out of thirteen candidate, PACCH24 and PACCH225, antagonists reduced the disease development at 90%. It wassuggested that the ability to inhibit the growth of pathogen in vitro was not related to the disease reduction in vivo. Thestrain PACCH24 was further identified as Streptomyces hygroscopicus according to morphological characteristic, cell walland cellular sugar analysis and 16S rDNA sequencing. The study implies a novel chitinolytic actinomycete which could bedeveloped to be a biological agent which would be included as a complement with organic fertilizers in order to control stemrot disease and promote growth of chilli.

  16. Biological Control of Bacterial Fruit Blotch of Watermelon Pathogen (Acidovorax citrulli with Rhizosphere Associated Bacteria

    Directory of Open Access Journals (Sweden)

    Mahesh Adhikari

    2017-04-01

    Full Text Available Bacterial fruit blotch (BFB, which is caused by Acidovorax citrulli, is a serious threat to watermelon growers around the world. The present study was conducted to screen effective rhizobacterial isolates against 35 different A. citrulli isolates and determine their efficacy on BFB and growth parameters of watermelon. Two rhizobacterial isolates viz. Paenibacillus polymyxa (SN-22, Sinomonas atrocyanea (NSB-27 showed high inhibitory activity in the preliminary screening and were further evaluated for their effect on BFB and growth parameters of three different watermelon varieties under greenhouse conditions. The greenhouse experiment result revealed that SN-22 and NSB-27 significantly reduced BFB and had significant stimulatory effect on total chlorophyll content, plant height, total fresh weight and total dry weight compared to uninoculated plants across the tested three watermelon varieties. Analysis of the 16S ribosomal RNA (rRNA sequences revealed that strains SN-22 belong to P. polymyxa and NSB-27 to S. atrocyanea with the bootstrap value of 99% and 98%, respectively. The isolates SN-22 and NSB-27 were tested for antagonistic and PGP traits. The result showed that the tested isolates produced siderophore, hydrolytic enzymes (protease and cellulose, chitinase, starch hydrolytic enzymes and they showed phosphate as well as zinc solubilizing capacity. This is the first report of P. polymyxa (SN-22 and S. atrocyanea (NSB-27 as biocontrol-plant growth promoting rhizobacteria on watermelon.

  17. Fate of biological control introductions: monitoring an Australian fungal pathogen of grasshoppers in North America.

    Science.gov (United States)

    Bidochka, M J; Walsh, S R; Ramos, M E; St Leger, R J; Silver, J C; Roberts, D W

    1996-01-01

    In North America there are two generally recognized pathotypes (pathotypes 1 and 2) of the fungus Entomophaga grylli which show host-preferential infection of grasshopper subfamilies. Pathotype 3, discovered in Australia, has a broader grasshopper host range and was considered to be a good biocontrol agent. Between 1989 and 1991 pathotype 3 was introduced at two field sites in North Dakota. Since resting spores are morphologically indistinguishable among pathotypes, we used pathotype-specific DNA probes to confirm pathotype identification in E. grylli-infected grasshoppers collected at the release sites in 1992, 1993, and 1994. In 1992, up to 23% of E. grylli-infected grasshoppers of the subfamilies Melanoplinae, Oedipodinae, and Gomphocerinae were infected by pathotype 3, with no infections > 1 km from the release sites. In 1993, pathotype 3 infections declined to 1.7%. In 1994 grasshopper populations were low and no pathotype 3 infections were found. The frequency of pathotype 3 infection has declined to levels where its long-term survival in North America is questionable. Analyses of biocontrol releases are critical to evaluating the environmental risks associated with these ecological manipulations, and molecular probes are powerful tools for monitoring biocontrol releases. Images Fig. 1 PMID:8570660

  18. A new threat to bees? Entomopathogenic nematodes used in biological pest control cause rapid mortality in Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Alexandrea Dutka

    2015-11-01

    Full Text Available There is currently a great deal of concern about population declines in pollinating insects. Many potential threats have been identified which may adversely affect the behaviour and health of both honey bees and bumble bees: these include pesticide exposure, and parasites and pathogens. Whether biological pest control agents adversely affect bees has been much less well studied: it is generally assumed that biological agents are safer for wildlife than chemical pesticides. The aim of this study was to test whether entomopathogenic nematodes sold as biological pest control products could potentially have adverse effects on the bumble bee Bombus terrestris. One product was a broad spectrum pest control agent containing both Heterorhabditis sp. and Steinernema sp., the other product was specifically for weevil control and contained only Steinernema kraussei. Both nematode products caused ≥80% mortality within the 96 h test period when bees were exposed to soil containing entomopathogenic nematodes at the recommended field concentration of 50 nematodes per cm2 soil. Of particular concern is the fact that nematodes from the broad spectrum product could proliferate in the carcasses of dead bees, and therefore potentially infect a whole bee colony or spread to the wider environment.

  19. Extension of Shelf Life and Control of Human Pathogens in Produce by Antimicrobial Edible Films and Coatings

    Science.gov (United States)

    This chapter provides general information about edible films and coatings, and their use with fruits and vegetables to control human pathogens. It reviews potential antimicrobial phytochemicals used in edible films and coatings, and summarizes methods for measuring the antimicrobial activity and ph...

  20. Landscape epidemiology and control of pathogens with cryptic and long-distance dispersal: Sudden oak death in northern Californian forests

    Science.gov (United States)

    Joao A. N. Filipe; Richard C. Cobb; Ross K. Meentemeyer; Christopher A. Lee; Yana S. Valachovic; Alex R. Cook; David M. Rizzo; Christopher A. Gilligan

    2012-01-01

    Exotic pathogens and pests threaten ecosystem service, biodiversity, and crop security globally. If an invasive agent can disperse asymptomatically over long distances, multiple spatial and temporal scales interplay, making identification of effective strategies to regulate, monitor, and control disease extremely difficult. The management of outbreaks is also...

  1. Effects of surface seals and application shanks on nematode, pathogen and weed control with 1,3-dichloropropene

    Science.gov (United States)

    Pre-plant soil fumigation with methyl bromide (MeBr) has been used for decades for controlling plant parasitic nematodes, soilborne pathogens and weeds in many high value annual, perennial and nursery crops. However, MeBr was identified as an ozone depleting substance and its availability was restri...

  2. Biological Control of Meloidogyne hapla Using an Antagonistic Bacterium

    Directory of Open Access Journals (Sweden)

    Jiyeong Park

    2014-09-01

    Full Text Available We examined the efficacy of a bacterium for biocontrol of the root-knot nematode (RKN Meloidogyne hapla in carrot (Daucus carota subsp. sativus and tomato (Solanum lycopersicum. Among 542 bacterial isolates from various soils and plants, the highest nematode mortality was observed for treatments with isolate C1-7, which was identified as Bacillus cereus based on cultural and morphological characteristics, the Biolog program, and 16S rRNA sequencing analyses. The population density and the nematicidal activity of B. cereus C1-7 remained high until the end of culture in brain heart infusion broth, suggesting that it may have sustainable biocontrol potential. In pot experiments, the biocontrol efficacy of B. cereus C1-7 was high, showing complete inhibition of root gall or egg mass formation by RKN in carrot and tomato plants, and subsequently reducing RKN damage and suppressing nematode population growth, respectively. Light microscopy of RKN-infected carrot root tissues treated with C1-7 showed reduced formation of gall cells and fully developed giant cells, while extensive gall cells and fully mature giant cells with prominent cell wall ingrowths formed in the untreated control plants infected with RKNs. These histopathological characteristics may be the result of residual or systemic biocontrol activity of the bacterium, which may coincide with the biocontrol efficacies of nematodes in pots. These results suggest that B. cereus C1-7 can be used as a biocontrol agent for M. hapla.

  3. Assessment of national strategies for control of high-pathogenicity avian influenza and low-pathogenicity notifiable avian influenza in poultry, with emphasis on vaccines and vaccination.

    Science.gov (United States)

    Swayne, D E; Pavade, G; Hamilton, K; Vallat, B; Miyagishima, K

    2011-12-01

    Twenty-nine distinct epizootics of high-pathogenicity avian influenza (HPAI) have occurred since 1959. The H5N1 HPAI panzootic affecting Asia, Africa and Eastern Europe has been the largest among these, affecting poultry and/or wild birds in 63 countries. A stamping-out programme achieved eradication in 24 of these epizootics (and is close to achieving eradication in the current H5N2 epizootic in South African ostriches), but vaccination was added to the control programmes in four epizootics when stamping out alone was not effective. During the 2002 to 2010 period, more than 113 billion doses of avian influenza (AI) vaccine were used in at-risk national poultry populations of over 131 billion birds. At two to three doses per bird for the 15 vaccinating countries, the average national vaccination coverage rate was 41.9% and the global AI vaccine coverage rate was 10.9% for all poultry. The highest national coverage rate was nearly 100% for poultry in Hong Kong and the lowest national coverage was less than 0.01% for poultry in Israel and The Netherlands. Inactivated AI vaccines accounted for 95.5% and live recombinant virus vaccines for 4.5% of the vaccines used. Most of these vaccines were used in the H5N1 HPAI panzootic, with more than 99% employed in the People's Republic of China, Egypt, Indonesia and Vietnam. Implementation of vaccination in these four countries occurred after H5N1 HPAI became enzootic in domestic poultry and vaccination did not result in the enzootic infections. Vaccine usage prevented clinical disease and mortality in chickens, and maintained rural livelihoods and food security during HPAI outbreaks. Low-pathogenicity notifiable avian influenza (LPNAI) became reportable to the World Organisation for Animal Health in 2006 because some H5 and H7 low-pathogenicity avian influenza (LPAI) viruses have the potential to mutate to HPAI viruses. Fewer outbreaks of LPNAI have been reported than of HPAI and only six countries used vaccine in control

  4. Biological agents for whitefly control in Sardinian greenhouse tomatoes.

    Science.gov (United States)

    Nannini, M; Foddi, F; Manca, L; Pisci, R; Sanna, F

    2009-01-01

    To evaluate the effectiveness of alternative options for biocontrol of whiteflies in greenhouse tomatoes, an experiment was carried out during the cropping season 2005-2006 in one of Sardinia's major horticultural districts (S. Margherita di Pula, Cagliari, Italy). Twelve long-cycle and 17 short-cycle tomato crops (8 autumn and 9 spring crops) were surveyed. All of them were treated for insect pest control at the beginning of the growing season, but in 19 out of 29 cases whitefly natural enemies were also released (BCA greenhouses), at least four weeks after the last treatment. The following release programmes were tested: on autumn crops, 1 Macrolophus caliginosus and 12 Eretmocerus mundus/m2; on long-cycle crops, 1 M. caliginosus (released in autumn or spring) and 24 Encarsia formosa/m2 or 48 E. formosa/m2; on spring crops, 1 M. caliginosus and 24 E. formosa/m2 or 48 E. formosa/m2. The cost of each option was fixed at approximately 0.25 Euros/m2. The remaining greenhouses were maintained as controls (no BCA greenhouses). While whitefly and mirid populations were monitored monthly, whitefly species composition and mortality of immature stages were estimated at least twice during the growing season. On short-cycle autumn crops, the release of M. caliginosus and E. mundus produced negligible results in terms of Bemisia tabaci control. On long-cycle and spring crops, even though in June mortality rates in BCA greenhouses were found to be 2- to 3-fold higher than in no-BCA greenhouses, Trialeurodes vaporariorum population growth was not significantly affected by natural enemies. Among the beneficials tested, E. formosa proved to be the most effective; E. mundus and M. caliginosus did not establish well, probably owing to the persistence of insecticide residues, scarce prey availability and intense plant de-leafing. The presence of indigenous natural enemies of whiteflies was observed in most sites, but in general they contributed little to biological control. The

  5. Control of biological hazards in cold smoked salmon production

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Embarek, Peter Karim Ben; Jeppesen, V.F.

    1995-01-01

    An outline of the common processing technology for cold smoked salmon in Denmark is presented. The safety hazards related to pathogenic bacteria, parasites and biogenic amines are discussed with special emphasis on hazards related to Clostridium botulinum and Listeria monocytogenes. Critical...

  6. Seed diseases and seedborne pathogens of North America

    Science.gov (United States)

    Michelle Cram; Stephen Fraedrich

    2010-01-01

    Seedborne pathogenic fungi can greatly affect seed quality and cause diseases that impact seedling production in nurseries. Management strategies for the control of various seedborne diseases are based on the epidemiology of the diseases and the biology of the host and pathogen. This paper provides a brief review of seedborne fungal problems that affect conifer seeds...

  7. Workshop summary: detection, impact, and control of specific pathogens in animal resource facilities.

    Science.gov (United States)

    Mansfield, Keith G; Riley, Lela K; Kent, Michael L

    2010-01-01

    Despite advances, infectious diseases remain a threat to animal facilities, continue to affect animal health, and serve as potential confounders of experimental research. A workshop entitled Detection, Impact, and Control of Specific Pathogens in Animal Resource Facilities was sponsored by the National Center for Research Resources (NCRR) and National Institutes of Aging (NIA) and held April 23-24, 2009, at the Lister Hill Conference Center on the National Institutes of Health's (NIH) Bethesda campus. The meeting brought together laboratory animal scientists and veterinarians with experience in fish, rodent, and nonhuman primate models to identify common issues and problems. Session speakers addressed (1) common practices and current knowledge of these species, (2) new technologies in the diagnosis of infectious diseases, (3) impact of environmental quality on infectious disease, (4) normal microbial flora in health and disease, (5) genetics and infectious disease, and (6) specific infectious agents and their impact on research. Attendees discussed current challenges and future needs, highlighting the importance of education and training, the funding of critical infrastructure and resource research, and the need for improved communication of disease risks and integration of these risks with strategic planning. NIH and NCRR have a strong record of supporting resource initiatives that have helped address many of these issues and recent efforts have focused on the building of consortium activities among such programs. This manuscript summarizes the presentations and conclusions of participants at the meeting; abstracts and a full conference report are available online (www.ncrr.nih.gov).

  8. Control of pathogen growth and biofilm formation using a urinary catheter that releases antimicrobial nitrogen oxides.

    Science.gov (United States)

    Kishikawa, Hiroaki; Ebberyd, Anette; Römling, Ute; Brauner, Annelie; Lüthje, Petra; Lundberg, Jon O; Weitzberg, Eddie

    2013-12-01

    Antibacterial nitrogen oxides including nitric oxide are formed from nitrite under acidic conditions. In a continuous-flow model of the urinary bladder we used the retention cuff of an all-silicone Foley catheter as a depot for export of nitrogen oxides. The cuff was filled with sodium nitrite (50mM) and an acidic buffer solution (pH 3.6) and the growth of nine common uropathogens in the surrounding artificial urine was measured along with biofilm formation on the catheter surface. In experiments with control catheters (NaCl) bacteria grew readily and biofilm developed within hours in five of nine strains. In contrast, with test catheters bacterial counts were markedly reduced and biofilm formation by Pseudomonas aeruginosa, Klebsiella pneumoniae, and Enterobacter cloace was prevented, whereas Escherichia coli and Staphylococcus aureus were unaffected. We conclude that antibacterial nitrogen oxides generated in the retention cuff of a urinary catheter diffuse into urine and prevent the growth of urinary pathogens and biofilm formation. Although promising, future studies will reveal if this novel approach can be clinically useful for the prevention of catheter-associated urinary tract infections. © 2013 Elsevier Inc. All rights reserved.

  9. Irradiation control of pathogenic bacteria and their growth during storage in short neckde clam

    International Nuclear Information System (INIS)

    Ju Hua; Wang Feng; Ha Yiming; Liu Shuliang

    2009-01-01

    The growth of pathogenic bacteria during storage and their D 10 values by irradiation in short necked clam were evaluated. The results showed that the D 10 values of the total bacteria count, E. coli, Vibrio parahaemolyticus in short necked clam at 0 degree C ∼ 4 degree C condition were 0.70, 0.56, 0.20kGy, respectively. The results showed that total bacteria count in vacuum packaged short necked clam sample was 4.46 log (CFU/g) after 3kGy 60 Co γ-irradiation and 28 days stored under 0 degree C ∼ 4 degree C, which could meet the requirement of related aquatic product standards, the E. coli and Vibrio parahaemolyticus would not detected after 0.4kGy irradiation and 7 days storage at 0 degree C ∼ 4 degree C. Therefore, micro-organisms could be controled effectively by 3 kGy irradiation and its shelf-life could extend to 28 days. (authors)

  10. The Secreted Protease PrtA Controls Cell Growth, Biofilm Formation and Pathogenicity in Xylella fastidiosa

    Science.gov (United States)

    Gouran, Hossein; Gillespie, Hyrum; Nascimento, Rafael; Chakraborty, Sandeep; Zaini, Paulo A.; Jacobson, Aaron; Phinney, Brett S.; Dolan, David; Durbin-Johnson, Blythe P.; Antonova, Elena S.; Lindow, Steven E.; Mellema, Matthew S.; Goulart, Luiz R.; Dandekar, Abhaya M.

    2016-01-01

    Pierce’s disease (PD) is a deadly disease of grapevines caused by the Gram-negative bacterium Xylella fastidiosa. Though disease symptoms were formerly attributed to bacteria blocking the plant xylem, this hypothesis is at best overly simplistic. Recently, we used a proteomic approach to characterize the secretome of X. fastidiosa, both in vitro and in planta, and identified LesA as one of the pathogenicity factors of X. fastidiosa in grapevines that leads to leaf scorching and chlorosis. Herein, we characterize another such factor encoded by PD0956, designated as an antivirulence secreted protease “PrtA” that displays a central role in controlling in vitro cell proliferation, length, motility, biofilm formation, and in planta virulence. The mutant in X. fastidiosa exhibited reduced cell length, hypermotility (and subsequent lack of biofilm formation) and hypervirulence in grapevines. These findings are supported by transcriptomic and proteomic analyses with corresponding plant infection data. Of particular interest, is the hypervirulent response in grapevines observed when X. fastidiosa is disrupted for production of PrtA, and that PD-model tobacco plants transformed to express PrtA exhibited decreased symptoms after infection by X. fastidiosa. PMID:27492542

  11. Biological Control of Rhizoctonia solani AG1-1A, the Causal Agent of Rice Sheath Blight with Trichoderma Strains

    OpenAIRE

    Shahram NAEIMI; Sayyed Mahmood OKHOVVAT; Mohammad JAVAN-NIKKHAH; Csaba VÁGVÖLGYI; Vahid KHOSRAVI; Laszlo KREDICS

    2011-01-01

    Sheath blight caused by Rhizoctonia solani is one of the most serious rice diseases worldwide. The disease is currently managed only by the excessive application of chemical fungicides which are toxic and not environmentally friendly. Therefore, greater emphasis should be given to biological control as being both safe and effective. Trichoderma species are ubiquitous fungi in the soil and have an antagonistic activity against several soil-borne plant pathogens including R. solani. The present...

  12. Synthetic biology and regulatory networks: where metabolic systems biology meets control engineering

    NARCIS (Netherlands)

    He, F.; Murabito, E.; Westerhoff, H.V.

    2016-01-01

    Metabolic pathways can be engineered to maximize the synthesis of various products of interest. With the advent of computational systems biology, this endeavour is usually carried out throughin silicotheoretical studies with the aim to guide and complement furtherin vitroandin vivoexperimental

  13. Simulations of population dynamics of hemlock woolly adelgid and potential impact of biological control agents

    Science.gov (United States)

    Joseph S. Elkinton; Robert T. Trotter; Ann F. Paradis

    2011-01-01

    The hemlock woolly adelgid (Adelges tsugae) is a small invasive Hemipteran herbivore that threatens the continued presence and abundance of hemlock in eastern North America. Efforts to control the adelgid have focused on the introduction of classical biological control agents. These biological controls include six different species of predatory...

  14. Biological relevance of volatile organic compounds emitted during the pathogenic interactions between apple plants and Erwinia amylovora.

    Science.gov (United States)

    Cellini, Antonio; Buriani, Giampaolo; Rocchi, Lorenzo; Rondelli, Elena; Savioli, Stefano; Rodriguez Estrada, Maria T; Cristescu, Simona M; Costa, Guglielmo; Spinelli, Francesco

    2018-01-01

    Volatile organic compounds emitted during the infection of apple (Malus pumila var. domestica) plants by Erwinia amylovora or Pseudomonas syringae pv. syringae were studied by gas chromatography-mass spectrometry and proton transfer reaction-mass spectrometry, and used to treat uninfected plants. Infected plants showed a disease-specific emission of volatile organic compounds, including several bio-active compounds, such as hexenal isomers and 2,3-butanediol. Leaf growth promotion and a higher resistance to the pathogen, expressed as a lower bacterial growth and migration in plant tissues, were detected in plants exposed to volatile compounds from E. amylovora-infected plants. Transcriptional analysis revealed the activation of salicylic acid synthesis and signal transduction in healthy plants exposed to volatiles produced by E. amylovora-infected neighbour plants. In contrast, in the same plants, salicylic acid-dependent responses were repressed after infection, whereas oxylipin metabolism was activated. These results clarify some metabolic and ecological aspects of the pathogenic adaptation of E. amylovora to its host. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  15. A molecular biological protocol to distinguish potentially human pathogenic Stenotrophomonas maltophilia from plant-associated Stenotrophomonas rhizophila.

    Science.gov (United States)

    Ribbeck-Busch, Kathrin; Roder, Anja; Hasse, Dirk; de Boer, Wietse; Martínez, José Luis; Hagemann, Martin; Berg, Gabriele

    2005-11-01

    In recent years, the importance of the Gram-negative bacterium Stenotrophomonas as an opportunistic pathogen as well as in biotechnology has increased. The aim of the present study was to develop new methods for distinguishing between strains closely related to the potentially human pathogenic Stenotrophomonas maltophilia and those closely related to the plant-associated Stenotrophomonas rhizophila. To accomplish this, 58 strains were characterized by 16S rDNA sequencing and amplified ribosomal DNA restriction analysis (ARDRA), and the occurrence of specific functional genes. Based on 16S rDNA sequences, an ARDRA protocol was developed which allowed differentiation between strains of the S. maltophilia and the S. rhizophila group. As it was known that only salt-treated cells of S. rhizophila were able to synthesize the compatible solute glucosylglycerol (GG), the ggpS gene responsible for GG synthesis was used for differentiation between both species and it was confirmed that it only occurred in S. rhizophila strains. As a further genetic marker the smeD gene, which is part of the genes coding for the multidrug efflux pump SmeDEF from S. maltophilia, was used. Based on the results we propose a combination of fingerprinting techniques using the 16S rDNA and the functional genes ggpS and smeD to distinguish both Stenotrophomonas species.

  16. Predator interference effects on biological control: The "paradox" of the generalist predator revisited

    OpenAIRE

    Bhowmick, Suman; Quansah, Emmanuel; Basheer, Aladeen; Parshad, Rana D.; Upadhyay, Ranjit Kumar

    2015-01-01

    An interesting conundrum in biological control questions the efficiency of generalist predators as biological control agents. Theory suggests, generalist predators are poor agents for biological control, primarily due to mutual interference. However field evidence shows they are actually quite effective in regulating pest densities. In this work we provide a plausible answer to this paradox. We analyze a three species model, where a generalist top predator is introduced into an ecosystem as a...

  17. Playing on a pathogen's weakness: using evolution to guide sustainable plant disease control strategies.

    Science.gov (United States)

    Zhan, Jiasui; Thrall, Peter H; Papaïx, Julien; Xie, Lianhui; Burdon, Jeremy J

    2015-01-01

    Wild plants and their associated pathogens are involved in ongoing interactions over millennia that have been modified by coevolutionary processes to limit the spatial extent and temporal duration of disease epidemics. These interactions are disrupted by modern agricultural practices and social activities, such as intensified monoculture using superior varieties and international trading of agricultural commodities. These activities, when supplemented with high resource inputs and the broad application of agrochemicals, create conditions uniquely conducive to widespread plant disease epidemics and rapid pathogen evolution. To be effective and durable, sustainable disease management requires a significant shift in emphasis to overtly include ecoevolutionary principles in the design of adaptive management programs aimed at minimizing the evolutionary potential of plant pathogens by reducing their genetic variation, stabilizing their evolutionary dynamics, and preventing dissemination of pathogen variants carrying new infectivity or resistance to agrochemicals.

  18. The complex symbiotic relationships of bark beetles with microorganisms: a potential practical approach for biological control in forestry.

    Science.gov (United States)

    Popa, Valentin; Déziel, Eric; Lavallée, Robert; Bauce, Eric; Guertin, Claude

    2012-07-01

    Bark beetles, especially Dendroctonus species, are considered to be serious pests of the coniferous forests in North America. Bark beetle forest pests undergo population eruptions, causing region wide economic losses. In order to save forests, finding new and innovative environmentally friendly approaches in wood-boring insect pest management is more important than ever. Several biological control methods have been attempted over time to limit the damage and spreading of bark beetle epidemics. The use of entomopathogenic microorganisms against bark beetle populations is an attractive alternative tool for many biological control programmes in forestry. However, the effectiveness of these biological control agents is strongly affected by environmental factors, as well as by the susceptibility of the insect host. Bark beetle susceptibility to entomopathogens varies greatly between species. According to recent literature, bark beetles are engaged in symbiotic relationships with fungi and bacteria. These types of relationship are very complex and apparently involved in bark beetle defensive mechanisms against pathogens. The latest scientific discoveries in multipartite symbiosis have unravelled unexpected opportunities in bark beetle pest management, which are discussed in this article. Copyright © 2012 Society of Chemical Industry.

  19. Ultraviolet-Mediated Activation of Photo toxins from Peganum Harmala L. Seedlings to Control both Human-and Phyto-Pathogenic Microorganisms and Tumor Cells

    International Nuclear Information System (INIS)

    Kord, M.; Khafagi, I.; Dewedar, A.

    2003-01-01

    The medicinal plant Peganum harmala L. (zygophyllaceae) contains a number of Beta-carboline alkaloids, which are photosensitizers to bacteria, yeasts and eukaryotic cells in the presence of sunlight and artificial sources of long-wave UV radiation (365 nm). Ultraviolet irradiation of ten-day old aseptically germinated Peganum harmala inoculated on bacterial and yeast bioassay plates elicits strong phototoxic antimicrobials. Callus as well as crude methanol extracts of in vitro cultures were also investigated for the accumulation of photosensitizers. High performance liquid chromatographic analyses of irradiated and control tissues followed by fluorescent detection at 302 nm revealed the formation of serotonin (5-hydroxytryptamine) in irradiated tissues only. Eluted compounds detected at 330 nm revealed more than ten-fold accumulation of harmine, isoharmine and harmol in irradiated tissues. Moreover, several simple beta-carboline alkaloids were produced through irradiation with UV such as harmalanine and harmalacidine. UV-induced phototoxicity was proven against phyto pathogenic bacteria and human-pathogenic bacteria and yeasts. Photo-induced cytotoxicity was observed from two different toxicity bioassays, which are Artemia saline and potato discs tumor assay. The selective UV-dependent biological activities may imply a pharmacological potential of Peganum harmala in the control of infectious diseases and tumor tissues

  20. Patterns and controls on nitrogen cycling of biological soil crusts

    Science.gov (United States)

    Barger, Nichole N.; Zaady, Eli; Weber, Bettina; Garcia-Pichel, Ferran; Belnap, Jayne

    2016-01-01

    Biocrusts play a significant role in the nitrogen [N ] cycle within arid and semi-arid ecosystems, as they contribute major N inputs via biological fixation and dust capture, harbor internal N transformation processes, and direct N losses via N dissolved, gaseous and erosional loss processes (Fig. 1). Because soil N availability in arid and semi-arid ecosystems is generally low and may limit net primary production (NPP), especially during periods when adequate water is available, understanding the mechanisms and controls of N input and loss pathways in biocrusts is critically important to our broader understanding of N cycling in dryland environments. In particular, N cycling by biocrusts likely regulates short-term soil N availability to support vascular plant growth, as well as long-term N accumulation and maintenance of soil fertility. In this chapter, we review the influence of biocrust nutrient input, internal cycling, and loss pathways across a range of biomes. We examine linkages between N fixation capabilities of biocrust organisms and spatio-temporal patterns of soil N availability that may influence the longer-term productivity of dryland ecosystems. Lastly, biocrust influence on N loss pathways such as N gas loss, leakage of N compounds from biocrusts, and transfer in wind and water erosion are important to understand the maintenance of dryland soil fertility over longer time scales. Although great strides have been made in understanding the influence of biocrusts on ecosystem N cycling, there are important knowledge gaps in our understanding of the influence of biocrusts on ecosystem N cycling that should be the focus of future studies. Because work on the interaction of N cycling and biocrusts was reviewed in Belnap and Lange (2003), this chapter will focus primarily on research findings that have emerged over the last 15 years (2000-2015).

  1. Modes of action for biological control of Botrytis cinerea by antagonistic bacteria

    Directory of Open Access Journals (Sweden)

    Rana HAIDAR

    2017-01-01

    Full Text Available The role of beneficial bacteria in biocontrol of plant diseases, particularly those caused by the necrotrophic fungus Botrytis cinerea, has been investigated by testing many bacteria under laboratory and field conditions. Bacteria may protect plants against B. cinerea by direct antagonistic interactions between biocontrol agents and this pathogen, as well as indirect effects through the induction of host resistance. This review focuses on various bacteria that act as biological control agents (BCAs of B. cinerea and their associated mechanisms. The modes of action (MoAs include: i synthesis of anti-fungal metabolites, such as antibiotics, cell wall-degrading enzymes and volatile organic compounds (VOCs; ii competition for nutrients and/or a niche; and iii induction of host resistance. The challenge for development of BCAs is to reduce the variability of efficiency and to prove persistence under a large range of conditions. We discuss the advantages and drawbacks of MoA for future applications of bacteria in the field and in post-harvest storage, as well as combination of different MoAs as a strategy to achieve a more regular efficacy.

  2. PROTECTING ECOSYSTEMS BY WAY OF BIOLOGICAL CONTROL: CURSORY REFLECTIONS ON THE MAIN REGULATORY INSTRUMENTS FOR BIOLOGICAL CONTROL AGENTS, PRESENT AND FUTURE

    Directory of Open Access Journals (Sweden)

    R Alberts

    2013-06-01

    Full Text Available Although there are numerous threats to ecosystems and the resultant ecosystem services, alien and invasive plants (AIP have been identified as being one of the major causes of ecosystem destruction. In addressing the threat of alien and invasive plants through the use of various mechanisms, the regulatory framework imposed by legislation is key in ensuring that that controlling AIPs does in fact not do more harm than good. One such control mechanism, which has the potential to do wonders or wreak havoc if not adroitly implemented, is that of using biological control agents. This contribution provides a brief overview on the three main regulatory instruments used to control biological control agents in South Africa, namely the Conservation of Agricultural Resources Act 43 of 1983, the Agricultural Pests Act 36 of 1983 and the National Environmental Management: Biodiversity Act 10 of 2004. It also considers possible future developments on the regulation of biological control agents.

  3. Biological Predispositions and Social Control in Adolescent Sexual Behavior.

    Science.gov (United States)

    Udry, J. Richard

    1988-01-01

    Proposes a biosocial model of adolescent sexuality. Examines both sociological and biological factors in the sexual behavior of a sample of 102 male and 99 female urban public high school students. (FMW)

  4. WILD PIGS: BIOLOGY, DAMAGE, CONTROL TECHINQUES AND MANAGEMENT

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, John; Brisbin, I. Lehr

    2009-12-31

    about anything; and, they can live just about anywhere. On top of that, wild pigs are both very difficult to control and, with the possible exception of island ecosystems, almost impossible to eradicate (Dickson et al. 2001, Sweeney et al. 2003). The solution to the wild pig problem has not been readily apparent. The ultimate answer as to how to control these animals has not been found to date. In many ways, wild pigs are America's most successful large invasive species. All of which means that wild pigs are a veritable nightmare for land and resource managers trying to keep the numbers of these animals and the damage that they do under control. Since the more that one knows about an invasive species, the easier it is to deal with and hopefully control. For wild pigs then, it is better to 'know thy enemy' than to not, especially if one expects to be able to successfully control them. In an effort to better 'know thy enemy,' a two-day symposium was held in Augusta, Georgia, on April 21-22, 2004. This symposium was organized and sponsored by U.S.D.A. Forest Service-Savannah River (USFS-SR), U. S. Department of Energy-Savannah River Operations Office (DOE-SR), the Westinghouse Savannah River Company (WSRC), the South Carolina Chapter of the Soil & Water Conservation Society, and the Savannah River Ecology Laboratory (SREL). The goal of this symposium was to assemble researchers and land managers to first address various aspects of the biology and damage of wild pigs, and then review the control techniques and management of this invasive species. The result would then be a collected synopsis of what is known about wild pigs in the United States. Although the focus of the symposium was primarily directed toward federal agencies, presenters also included professionals from academic institutions, and private-sector control contractors and land managers. Most of the organizations associated with implementing this symposium were affiliated with the

  5. Controlled Release of Biologically Active Silver from Nanosilver Surfaces

    OpenAIRE

    Liu, Jingyu; Sonshine, David A.; Shervani, Saira; Hurt, Robert H.

    2010-01-01

    Major pathways in the antibacterial activity and eukaryotic toxicity of nano-silver involve the silver cation and its soluble complexes, which are well established thiol toxicants. Through these pathways, nano-silver behaves in analogy to a drug delivery system, in which the particle contains a concentrated inventory of an active species, the ion, which is transported to and released near biological target sites. Although the importance of silver ion in the biological response to nano-silver ...

  6. Genomic analysis of a ginger pathogen Bacillus pumilus providing the understanding to the pathogenesis and the novel control strategy.

    Science.gov (United States)

    Yuan, Yihui; Gao, Meiying

    2015-05-19

    Bacillus pumilus has been widely identified as a pathogen of plant and human, while the genetic information is rarely available for pathogenic B. pumilus strains. B. pumilus GR8 is a pathogen that causes ginger rhizome rot disease by invading ginger rhizome parenchymatous tissues, growing in the extracellular space, and producing plant cell wall-degrading enzymes to destroy ginger cells. In this study, the genome of GR8 was sequenced and characterized. This genome was the third completely sequenced genome of the B. pumilus species, and it exhibited high similarity to the genome of the B. pumilus strain B6033. The genome of GR8 was 3.67 Mb in length and encoded 3,713 putative ORFs. Among these predicted proteins, numerous plant cell wall-degrading enzymes and several proteins associated with invading and adapting to the environment in the extracellular space of the ginger rhizome parenchymatous tissue were found. The GR8 genome contained only one restriction-modification system and no CRISPR/Cas system. The lack of phage-resistant system suggested that phages might be potential agents for the control of GR8. The genomic analysis of GR8 provided the understanding to the pathogenesis and the phage-control strategy of pathogenic B. pumilus strains.

  7. In vitro growth control of selected pathogens by Lactobacillus acidophilus- and Lactobacillus casei-fermented milk.

    Science.gov (United States)

    Millette, M; Luquet, F M; Lacroix, M

    2007-03-01

    Food-borne pathogen inhibition was tested in the presence of a mixture of Lactobacillus acidophilus and Lactobacillus casei during fermentation under controlled pH conditions. The growth of Escherichia coli O157:H7, Salmonella serotype Typhimurium, Staphylococcus aureus, Listeria innocua, Enterococcus faecium and Enterococcus faecalis was evaluated for 48 h at 37 degrees C. In the presence of the lactic acid bacteria (LAB), an increase of the generation time was observed for all the gram-positive bacteria evaluated. Staphylococcus aureus was the most sensitive strain showing an increase of the generation time by 210%. However, for all the gram-negative bacteria evaluated, no inhibition occurred after 8 h of fermentation. The soluble portion of Lact. acidophilus- and Lact. casei-fermented milk was recuperated and tested for its antimicrobial activity. Listeria innocua and Staph. aureus were the most sensitive to the presence of fermented milk supernatant showing an inhibition of 85.9% and 84.7%, respectively. This soluble fraction was neutralized to eliminate the antimicrobial effect of the organic acids produced; the most sensitive strains were L. innocua and E. coli O157:H7 showing an inhibition of 65.9% and 61.9%, respectively. Finally, the soluble fraction was neutralized and irradiated at 45 kGy using a (60)Co source to eliminate the possible antimicrobial effect of both organic acids and bacteriocin-like substances. Enterococcus faecalis, E. coli O157:H7 and Staph. aureus were the most affected bacteria by this fraction, showing 39.1, 32 and 31.2% inhibition, respectively. The results obtained in this study suggest the implication of both organic acids and bacteriocin-like inhibitory substances in the antimicrobial activity observed in the soluble fraction of the probiotic preparation. This study revealed the antimicrobial mechanisms of action of Lact. acidophilus- and Lact. casei-fermented milk used to prevent antibiotic-associated diarrhoea.

  8. Biological control of Botrytis spp. by Ulocladium atrum : an ecological analysis

    NARCIS (Netherlands)

    Kessel, G.

    1999-01-01

    Plant pathogenic fungi from the genus Botrytis cause economically important diseases in a wide range of crops during the production phase as well as post harvest phase. Control is based on the frequent use of fungicides. Alternative approaches for control are studied

  9. Transcriptional control of drug resistance, virulence and immune system evasion in pathogenic fungi: a cross-species comparison.

    Directory of Open Access Journals (Sweden)

    Pedro Pais

    2016-10-01

    Full Text Available Transcription factors are key players in the control of the activation or repression of gene expression programs in response to environmental stimuli. The study of regulatory networks taking place in fungal pathogens is a promising research topic that can help in the fight against these pathogens by targeting specific fungal pathways as a whole, instead of targeting more specific effectors of virulence or drug resistance. This review is focused on the analysis of regulatory networks playing a central role in the referred mechanisms in the human fungal pathogens Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Candida glabrata, Candida parapsilosis and Candida tropicalis. Current knowledge on the activity of the transcription factors characterized in each of these pathogenic fungal species will be addressed. Particular focus is given to their mechanisms of activation, regulatory targets and phenotypic outcome. The review further provides an evaluation on the conservation of transcriptional circuits among different fungal pathogens, highlighting the pathways that translate common or divergent traits among these species in what concerns their drug resistance, virulence and host immune evasion features. It becomes evident that the regulation of transcriptional networks is complex and presents significant variations among different fungal pathogens. Only the oxidative stress regulators Yap1 and Skn7 are conserved among all studied species; while some transcription factors, involved in nutrient homeostasis, pH adaptation, drug resistance and morphological switching are present in several, though not all species. Interestingly, in some cases not very homologous transcription factors display orthologous functions, whereas some homologous proteins have diverged in terms of their function in different species. A few cases of species specific transcription factors are also observed.

  10. Transcriptional Control of Drug Resistance, Virulence and Immune System Evasion in Pathogenic Fungi: A Cross-Species Comparison.

    Science.gov (United States)

    Pais, Pedro; Costa, Catarina; Cavalheiro, Mafalda; Romão, Daniela; Teixeira, Miguel C

    2016-01-01

    Transcription factors are key players in the control of the activation or repression of gene expression programs in response to environmental stimuli. The study of regulatory networks taking place in fungal pathogens is a promising research topic that can help in the fight against these pathogens by targeting specific fungal pathways as a whole, instead of targeting more specific effectors of virulence or drug resistance. This review is focused on the analysis of regulatory networks playing a central role in the referred mechanisms in the human fungal pathogens Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Candida glabrata, Candida parapsilosis , and Candida tropicalis . Current knowledge on the activity of the transcription factors characterized in each of these pathogenic fungal species will be addressed. Particular focus is given to their mechanisms of activation, regulatory targets and phenotypic outcome. The review further provides an evaluation on the conservation of transcriptional circuits among different fungal pathogens, highlighting the pathways that translate common or divergent traits among these species in what concerns their drug resistance, virulence and host immune evasion features. It becomes evident that the regulation of transcriptional networks is complex and presents significant variations among different fungal pathogens. Only the oxidative stress regulators Yap1 and Skn7 are conserved among all studied species; while some transcription factors, involved in nutrient homeostasis, pH adaptation, drug resistance and morphological switching are present in several, though not all species. Interestingly, in some cases not very homologous transcription factors display orthologous functions, whereas some homologous proteins have diverged in terms of their function in different species. A few cases of species specific transcription factors are also observed.

  11. Molecular and biological characterization of a highly pathogenic Trypanosoma cruzi strain isolated from a patient with congenital infection.

    Science.gov (United States)

    Gulin, Julián Ernesto Nicolás; Bisio, Margarita; Rocco, Daniela Marisa; Altcheh, Jaime; Solana, María Elisa; García-Bournissen, Facundo

    2018-03-01

    Although many Trypanosoma cruzi (T. cruzi) strains isolated from a wide range of hosts have been characterized, there is a lack of information about biological features from vertically transmitted strains. We describe the molecular and biological characteristics of the T. cruzi VD strain isolated from a congenital Chagas disease patient. The VD strain was typified as DTU TcVI; in vitro sensitivity to nifurtimox (NFX) and beznidazole (BZ) were 2.88 μM and 6.19 μM respectively, while inhibitory concentrations for intracellular amastigotes were 0.24 μM for BZ, and 0.66 μM for NFX. Biological behavior of VD strain was studied in a mouse model of acute infection, resulting in high levels of parasitemia and mortality with a rapid clearence of bloodstream trypomastigotes when treated with BZ or NFX, preventing mortality and reducing parasitic load and intensity of inflammatory infiltrate in skeletal and cardiac muscle. Treatment-induced parasitological cure, evaluated after immunossupression were 41% and 35% for BZ and NFX treatment respectively, suggesting a partial response to these drugs in elimination of parasite burden. This exhaustive characterization of this T. cruzi strain provides the basis for inclusion of this strain in a panel of reference strains for drug screening and adds a new valuable tool for the study of experimental T. cruzi infection. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Ecological theory as a foundation to control pathogenic invasion in aquaculture

    Science.gov (United States)

    De Schryver, Peter; Vadstein, Olav

    2014-01-01

    Detrimental host–pathogen interactions are a normal phenomenon in aquaculture animal production, and have been counteracted by prophylactic use of antibiotics. Especially, the youngest life stages of cultivated aquatic animals are susceptible to pathogen invasion, resulting in disease and mortality. To establish a more sustainable aquatic food production, there is a need for new microbial management strategies that focus on ‘join them' and not the traditional ‘beat them' approaches. We argue that ecological theory could serve as a foundation for developing sustainable microbial management methods that prevent pathogenic disease in larviculture. Management of the water microbiota in aquaculture systems according to ecological selection principles has been shown to decrease opportunistic pathogen pressure and to result in an improved performance of the cultured animals. We hypothesize that manipulation of the biodiversity of the gut microbiota can increase the host's resistance against pathogenic invasion and infection. However, substantial barriers need to be overcome before active management of the intestinal microbiota can effectively be applied in larviculture. PMID:24892581

  13. Control of Salmonella and other pathogenic and spoilage microorganisms in poultry by gamma and electron irradiation

    International Nuclear Information System (INIS)

    Singh, H.

    1992-07-01

    Salmonella contamination of chicken is a major public health concern, causing sickness and loss of productivity. Modern, concentrated production methods increase the difficulty of Salmonella control. The current and suggested treatments with chlorinated water or heat pasteurization are unsatisfactory. In pasteurization, the end product is partially cooked, and in the chlorine water wash the poultry skin gets bleached if too much chlorine is used. There is also a risk of formation of toxic chloro-organic compounds. Further, the chlorine water wash does not completely eliminate salmonella. Low-dose radiation treatment is much more effective for the control of Salmonella and has the additional benefit of preserving the freshness of the product. Irradiation of fresh chicken carcasses, pieces or deboned chicken meat with a dose of 2.5 kGy appears to be sufficient to eliminate naturally occurring Salmonella contamination, which is generally present in extremely low numbers on this continent (1 to 30 cells/100 g). For elimination of Salmonella in frozen chicken, doses higher than 2.5 kGy are required. There is a large range of D 10 - values for the different Salmonella serotypes that have been tested, with the highest being 0.72 kGy for S. oranienberg at 22 degrees C. Thus the 2.5-kGy dose would reduce the most radio-resistant Salmonella serotype by four orders of magnitude, and the most common serotypes (with D 10 - values of 0.3 to 0.4 kGy) by greater than six orders of magnitude. The 2.5-kGy dose also appears to be sufficient to eliminate other bacterial pathogens, such as Campylobactor jejuni and Yersinia enterocolitica. The microbiological shelf life of fresh chicken carcass or deboned chicken meat (6 to 11 d) is extended by a factor of 2 to 3 with irradiation to a dose of 2.5 kGy followed by storage between 1 and 4 degrees C. In radappertization (at a dose of ≥ 45 kGy at -30 degrees C), the shelf life of enzyme-inactivated chicken meat is extended to years, on

  14. Systems Biology Analysis of Temporal In vivo Brucella melitensis and Bovine Transcriptomes Predicts host:Pathogen Protein–Protein Interactions

    Directory of Open Access Journals (Sweden)

    Carlos A. Rossetti

    2017-07-01

    Full Text Available To date, fewer than 200 gene-products have been identified as Brucella virulence factors, and most were characterized individually without considering how they are temporally and coordinately expressed or secreted during the infection process. Here, we describe and analyze the in vivo temporal transcriptional profile of Brucella melitensis during the initial 4 h interaction with cattle. Pathway analysis revealed an activation of the “Two component system” providing evidence that the in vivo Brucella sense and actively regulate their metabolism through the transition to an intracellular lifestyle. Contrarily, other Brucella pathways involved in virulence such as “ABC transporters” and “T4SS system” were repressed suggesting a silencing strategy to avoid stimulation of the host innate immune response very early in the infection process. Also, three flagellum-encoded loci (BMEII0150-0168, BMEII1080-1089, and BMEII1105-1114, the “flagellar assembly” pathway and the cell components “bacterial-type flagellum hook” and “bacterial-type flagellum” were repressed in the tissue-associated B. melitensis, while RopE1 sigma factor, a flagellar repressor, was activated throughout the experiment. These results support the idea that Brucella employ a stealthy strategy at the onset of the infection of susceptible hosts. Further, through systems-level in silico host:pathogen protein–protein interactions simulation and correlation of pathogen gene expression with the host gene perturbations, we identified unanticipated interactions such as VirB11::MAPK8IP1; BtaE::NFKBIA, and 22 kDa OMP precursor::BAD and MAP2K3. These findings are suggestive of new virulence factors and mechanisms responsible for Brucella evasion of the host's protective immune response and the capability to maintain a dormant state. The predicted protein–protein interactions and the points of disruption provide novel insights that will stimulate advanced hypothesis

  15. Biology and host range of Omolabus piceus, a weevil rejected for biological control for Schinus terebinthifolius in the USA

    Science.gov (United States)

    Surveys for biological control agents of the invasive weed Schinus terebinthifolius (Anacardiaceae) discovered two Omolabus weevils (Coleoptera: Attelabidae) feeding on the plant in its native range. Molecular and morphological analysis indicated that one of these species consistently fed on the tar...

  16. Complete genome sequence of Bacillus velezensis S3-1, a potential biological pesticide with plant pathogen inhibiting and plant promoting capabilities.

    Science.gov (United States)

    Jin, Qing; Jiang, Qiuyue; Zhao, Lei; Su, Cuizhu; Li, Songshuo; Si, Fangyi; Li, Shanshan; Zhou, Chenhao; Mu, Yonglin; Xiao, Ming

    2017-10-10

    Antagonistic soil microorganisms, which are non-toxic, harmless non-pollutants, can effectively reduce the density of pathogenic species by some ways. Bacillus velezensis strain S3-1 was isolated from the rhizosphere soil of cucumber, and was shown to inhibit plant pathogens, promote plant growth and efficiently colonize rhizosphere soils. The strain produced 13 kinds of lipopeptide antibiotics, belonging to the surfactin, iturin and fengycin families. Here, we presented the complete genome sequence of S3-1. The genome consists of one chromosome without plasmids and also contains the biosynthetic gene cluster that encodes difficidin, macrolactin, surfactin and fengycin. The genome contains 86 tRNA genes, 27 rRNA genes and 57 antibiotic-related genes. The complete genome sequence of B. velezensis S3-1 provides useful information to further detect the molecular mechanisms behind antifungal actions, and will facilitate its potential as a biological pesticide in the agricultural industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Landscape epidemiology and control of pathogens with cryptic and long-distance dispersal: sudden oak death in northern Californian forests.

    Directory of Open Access Journals (Sweden)

    João A N Filipe

    2012-01-01

    Full Text Available Exotic pathogens and pests threaten ecosystem service, biodiversity, and crop security globally. If an invasive agent can disperse asymptomatically over long distances, multiple spatial and temporal scales interplay, making identification of effective strategies to regulate, monitor, and control disease extremely difficult. The management of outbreaks is also challenged by limited data on the actual area infested and the dynamics of spatial spread, due to financial, technological, or social constraints. We examine principles of landscape epidemiology important in designing policy to prevent or slow invasion by such organisms, and use Phytophthora ramorum, the cause of sudden oak death, to illustrate how shortfalls in their understanding can render management applications inappropriate. This pathogen has invaded forests in coastal California, USA, and an isolated but fast-growing epidemic focus in northern California (Humboldt County has the potential for extensive spread. The risk of spread is enhanced by the pathogen's generalist nature and survival. Additionally, the extent of cryptic infection is unknown due to limited surveying resources and access to private land. Here, we use an epidemiological model for transmission in heterogeneous landscapes and Bayesian Markov-chain-Monte-Carlo inference to estimate dispersal and life-cycle parameters of P. ramorum and forecast the distribution of infection and speed of the epidemic front in Humboldt County. We assess the viability of management options for containing the pathogen's northern spread and local impacts. Implementing a stand-alone host-free "barrier" had limited efficacy due to long-distance dispersal, but combining curative with preventive treatments ahead of the front reduced local damage and contained spread. While the large size of this focus makes effective control expensive, early synchronous treatment in newly-identified disease foci should be more cost-effective. We show how the

  18. The role of ionizing radiation in biological control of agricultural pests

    International Nuclear Information System (INIS)

    Mansour, M.

    2011-01-01

    Although the commercial biological control industry is growing, it still represents only a small portion of the international market of pest control sales (about 3%). This low ratio is due to several factors including high cost of production of biological control agents and technical and regulatory difficulties that complicate the shipping procedures and create trade barriers. This article summarizes the role of ionizing radiation in supporting the use of biological control agents in insect pest control and concentrates on its role in the production, transport, distribution, and release of parasites and predators and the advantages that ionizing radiation can offer, in comparison with traditional techniques. (author)

  19. Radiochemical and biological control for metaiodobenzylguanidine (MIBG) labelled with 131I

    International Nuclear Information System (INIS)

    Barbosa, M.R.F.F. de; Muramoto, E.; Colturato, M.T.; Goncalves, R.S.V.; Pereira, N.P.S. de; Almeida, M.A.T.M. de; Silva, C.P.G. da

    1988-01-01

    This study shows the standardization of the radiochemical control of MIBG- 131 I in eletrophoretic system and also the biological control in Wistar rat for a period of time, not longer than 60 minutes after the tracer administration. (author) [pt

  20. Radiochemical and biological control of metaiodobenzyl-guanidine (MIBG) labeled with 131I

    International Nuclear Information System (INIS)

    Barboza, M.R.F.F. de; Muramoto, E.; Colturato, M.T.; Silva Valente Goncalves, R. da; Pereira, N.P.S. de; Almeida, M.A.T.M. de; Silva, C.P.G. da.

    1988-07-01

    This study shows the standardization of the radiochemical control of MIBG - 131 I in eletrophoretic system and also the biological control in Wistar rat for a period of time, not longer than 60 minutes after tracer administration. (author) [pt

  1. The Uptake and Metabolism of Amino Acids, and Their Unique Role in the Biology of Pathogenic Trypanosomatids.

    Science.gov (United States)

    Marchese, Letícia; Nascimento, Janaina de Freitas; Damasceno, Flávia Silva; Bringaud, Frédéric; Michels, Paul A M; Silber, Ariel Mariano

    2018-04-01

    Trypanosoma brucei , as well as Trypanosoma cruzi and more than 20 species of the genus Leishmania , form a group of flagellated protists that threaten human health. These organisms are transmitted by insects that, together with mammals, are their natural hosts. This implies that during their life cycles each of them faces environments with different physical, chemical, biochemical, and biological characteristics. In this work we review how amino acids are obtained from such environments, how they are metabolized, and how they and some of their intermediate metabolites are used as a survival toolbox to cope with the different conditions in which these parasites should establish the infections in the insects and mammalian hosts.

  2. Screening and Scoring of Antimicrobial and Biological Activities of Italian Vulnerary Plants against Major Oral Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Gianmaria F. Ferrazzano

    2013-01-01

    Full Text Available This study aims to evaluate the activity of Italian vulnerary plants against the most important oral pathogenic bacteria. This estimate was accomplished through a fivefold process: (a a review of ethnobotanical and microbiological data concerning the Italian vulnerary plants; (b the development of a scoring system to rank the plants; (c the comparative assessment of microbiological properties; (d the assessment of potential cytotoxic effects on keratinocyte-like cells and gingival fibroblasts in culture by XTT cell viability assay; (e clinical evaluation of the most suitable plant extract as antibacterial agent in a home-made mouthwash. The study assays hexane (H, ethanol (E, and water (W extracts from 72 plants. The agar diffusion method was used to evaluate the activity against Streptococcus mutans, Streptococcus sobrinus, Lactobacillus casei, and Actinomyces viscosus. Twenty-two plants showed appreciable activity. The extracts showing the strongest antibacterial power were those from Cotinus coggygria Scop., Equisetum hyemale L., Helichrysum litoreum Guss, Juniperus communis L., and Phyllitis scolopendrium (L. Newman subsp. scolopendrium. The potential cytotoxic effect of these extracts was assessed. On the basis of these observations, a mouth-rinse containing the ethanolic extract of H. litoreum has been tested in vivo, resulting in reduction of the salivary concentration of S. mutans.

  3. The status of biological control and recommendations for improving uptake for the future

    NARCIS (Netherlands)

    Barratt, B.I.P.; Moran, V.C.; Bigler, F.; Lenteren, van J.C.

    2018-01-01

    Classical and augmentative biological control of insect pests and weeds has enjoyed a long history of successes. However, biocontrol practices have not been as universally accepted or optimally utilised as they could be. An International Organisation for Biological Control (IOBC) initiative brought

  4. Managing conflict over biological control: the case of strawberry guava in Hawaii

    Science.gov (United States)

    Tracy Johnson

    2016-01-01

    Biological control researchers commonly avoid targets with potential for high conflict, but for certain highly damaging invaders with no viable management alternatives, it may be necessary to consider biological control even when it is likely to generate conflict. Discussed here is a case study, strawberry guava (Psidium cattleianum Sabine...

  5. Sources of Infestation, Biology, Damage by and control of Megaselia ...

    African Journals Online (AJOL)

    A study was carried out to identify sources of infestation by the Megaselia rufipes Meigen (Diptera: Phoridae) on some germinated oil palm seeds in the Seed Production facilities of the CSIR-Oil Palm Research Institute. The study also covered the identification of the pest, some aspects of the biology, cost of damage and ...

  6. Mechanism of biological control of Rhizoctonia damping-off of ...

    African Journals Online (AJOL)

    MOHSEN

    2014-01-29

    Jan 29, 2014 ... 4Laboratory of Plant Pathology, Faculty of Applied Biological Sciences, Gifu University, 1-1 Yanagido,. Gifu City 501-1193, ... isolate of R. solani AG-4 isolate C4 and examined with light microscopy and scanning and transmission electron ... 1987b), bedding plants (capsicum and celosia) and cucumber ...

  7. Biological stability of drinking water : Controlling factors, methods, and challenges

    NARCIS (Netherlands)

    Prest, E.I.E.D.; Hammes, F.; Van Loosdrecht, M.C.M.; Vrouwenvelder, J.S.

    2016-01-01

    Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and

  8. Controlling the Biological Effects of Spermine Using a Synthetic Receptor

    NARCIS (Netherlands)

    Vial, Laurent; Ludlow, R. Frederick; Leclaire, Julien; Pérez-Fernández, Ruth; Otto, Sijbren

    2006-01-01

    Polyamines play an important role in biology, yet their exact function in many processes is poorly understood. Artificial host molecules capable of sequestering polyamines could be useful tools for studying their cellular function. However, designing synthetic receptors with affinities sufficient to

  9. [We control our bodies: the biological and social dialectic].

    Science.gov (United States)

    Giffin, K M

    1991-01-01

    This article aims at reviewing the discussion of biological and social factors in the analysis of women's social condition. With the appearance of a feminist perspective, the dominance of earlier biologically-based explanations was substituted by an emphasis on the social construction of female identity. Even when women's identification with the body and with nature, and their secondary status, were considered universal, biological determinism was rejected. In this process of re-definition of the object of study, the ideological role of science was pointed out, since male dominance in science and society accompanied the historical tendency which relegated "the woman question" to the sphere of natural fact. Although growing awareness of the socially-constructed nature of scientific activity itself is producing a tendency to abandon the biological/social dichotomy at the conceptual level, differences between men and women in the reproductive sphere continue to exist. It is argued that analysis of reproduction requires characterization of the sexes as biosocial entities in relationship, situated in specific historical contexts, and that in modern society women are subject to a double reproductive contradiction.

  10. Activated Sludge. Student Manual. Biological Treatment Process Control.

    Science.gov (United States)

    Boe, Owen K.; Klopping, Paul H.

    This student manual contains the textual material for a seven-lesson unit on activated sludge. Topic areas addressed in the lessons include: (1) activated sludge concepts and components (including aeration tanks, aeration systems, clarifiers, and sludge pumping systems); (2) activated sludge variations and modes; (3) biological nature of activated…

  11. Biology, etiology, and control of virus diseases of banana and plantain.

    Science.gov (United States)

    Kumar, P Lava; Selvarajan, Ramasamy; Iskra-Caruana, Marie-Line; Chabannes, Matthieu; Hanna, Rachid

    2015-01-01

    Banana and plantain (Musa spp.), produced in 10.3 million ha in the tropics, are among the world's top 10 food crops. They are vegetatively propagated using suckers or tissue culture plants and grown almost as perennial plantations. These are prone to the accumulation of pests and pathogens, especially viruses which contribute to yield reduction and are also barriers to the international exchange of germplasm. The most economically important viruses of banana and plantain are Banana bunchy top virus (BBTV), a complex of banana streak viruses (BSVs) and Banana bract mosaic virus (BBrMV). BBTV is known to cause the most serious economic losses in the "Old World," contributing to a yield reduction of up to 100% and responsible for a dramatic reduction in cropping area. The BSVs exist as episomal and endogenous forms are known to be worldwide in distribution. In India and the Philippines, BBrMV is known to be economically important but recently the virus was discovered in Colombia and Costa Rica, thus signaling its spread into the "New World." Banana and plantain are also known to be susceptible to five other viruses of minor significance, such as Abaca mosaic virus, Abaca bunchy top virus, Banana mild mosaic virus, Banana virus X, and Cucumber mosaic virus. Studies over the past 100 years have contributed to important knowledge on disease biology, distribution, and spread. Research during the last 25 years have led to a better understanding of the virus-vector-host interactions, virus diversity, disease etiology, and epidemiology. In addition, new diagnostic tools were developed which were used for surveillance and the certification of planting material. Due to a lack of durable host resistance in the Musa spp., phytosanitary measures and the use of virus-free planting material are the major methods of virus control. The state of knowledge on BBTV, BBrMV, and BSVs, and other minor viruses, disease spread, and control are summarized in this review. © 2015 Elsevier Inc

  12. Potential for widespread application of biological control of stored-product pests

    DEFF Research Database (Denmark)

    Hansen, Lise Stengaard

    2007-01-01

    Biological control of stored product pests has substantial potential in Europe". This is essentially the conclusion of the activities of a European working group funded by the COST system, an intergovernmental networking system. Working group 4 of COST action 842 (2000-2005) focussed on biological...... control of stored-product pests and has considered a number of existing and potential fields for application of biological control. Three situations were identified where biological control would be a valuable component of integrated pest management: (1) Empty room treatment against stored-product mites......, beetles and moths; (2) Preventative treatment of bulk commodities against weevils (Sitophilus spp.) and storage mites; (3) Preventative application of egg-parasitoids against moths in packaged products. Development of methods for biological control and of mass production of natural enemies...

  13. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  14. Identification of control agents and factors affecting pathogenicity of Phytophthora ramorum

    Science.gov (United States)

    Marianne Elliott; Simon F. Shamoun; Grace Sumampong; Delano James; Stephan C. Briere; Saad Masri; Aniko Varga

    2008-01-01

    A collection of 67 isolates of Phytophthora ramorum from the United States (U.S.), European Union (EU), and Canada was screened using differences in phenotypic traits (pathogenicity, growth rate at several temperatures, and sensitivity/resistance to metalaxyl, dimethomorph, and streptomycin) and for presence of cytoplasmic elements (dsRNA and...

  15. Pathogen control at the intestinal mucosa - H2O2 to the rescue

    NARCIS (Netherlands)

    Knaus, U.G.; Hertzberger, R.; Pircalabioru, G.G.; Yousefi, S.P.M.; Branco dos Santos, F.

    2017-01-01

    Intestinal infections are a global challenge, connected to malnutrition and inadequate hygiene in developing countries, and to expanding antibiotic resistance in developed countries. In general, a healthy host is capable of fighting off gut pathogens or at least to recover from infections quickly.

  16. Survival of pathogenic enterohemorrhagic Escherichia coli (EHEC) and control with calcium oxide in frozen meat products.

    Science.gov (United States)

    Ro, Eun Young; Ko, Young Mi; Yoon, Ki Sun

    2015-08-01

    This study investigated both the level of microbial contamination and the presence of enterohemorrhagic Escherichia coli (EHEC) in frozen meat products, followed by the evaluation of its survival over 180 days under frozen temperature. We also examined the effect of calcium oxide on the populations of EHEC, E. coli O157:H7 and EPEC under both 10 °C and -18 °C storage conditions. Afterward, the morphological changes occurring in EHEC cells in response to freezer storage temperature and calcium oxide (CaO) treatments were examined using transmission electron microscopy. Among the frozen meat products tested, the highest contamination levels of total aerobic counts, coliforms and E. coli were observed in pork cutlets. Examination showed that 20% of the frozen meat products contained virulence genes, including verotoxin (VT) 1 and 2. Over 180 days of frozen storage and after 3 freeze-thaw cycles, the population of EHEC did not change regardless of the type of products or initial inoculated concentration, indicating the strong survival ability of EHEC. Subsequent testing revealed that the growth of three pathogenic E. coli strains was completely inhibited in meat patties prepared with 1% CaO, stored at 10 °C. However, the addition of 2% CaO was necessary to control the survival of EHEC, E. coli O157:H7 and EPEC in meat patties stored at -18 °C. CaO reduced the population of E. coli O157:H7 more effectively than the other EHEC and EPEC strains at both 10 °C and -18 °C. Transmission electron microscopy analysis revealed that exposed EHEC cells were resistant to the freezer storage temperature, although some cells incurred injury and death after several freeze-thaw cycles. Most of the cells exposed to CaO were found to have died or lost their cellular integrity and membranes, indicating that CaO has the potential to be used as a powerful antimicrobial agent for manufacturing frozen meat products. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Determinant Variables, Enteric Pathogen Burden, Gut Function and Immune-related Inflammatory Biomarkers Associated With Childhood Malnutrition: A Prospective Case-Control Study in Northeastern Brazil.

    Science.gov (United States)

    Lima, Aldo A M; Leite, Álvaro M; Di Moura, Alessandra; Lima, Noélia L; Soares, Alberto M; Abreu, Cláudia B; Filho, José Quirino; Mota, Rosa M S; Lima, Ila F N; Havt, Alexandre; Medeiros, Pedro H Q S; Prata, Mara M G; Guedes, Marjorie M; Cavalcante, Paloma A; Veras, Herlice N; Santos, Ana K S; Moore, Sean R; Pinkerton, Relana C; Houpt, Eric R; Guerrant, Richard L

    2017-12-01

    Malnutrition results in serious consequences for growth and cognitive development in children. We studied select child and maternal biologic factors, socioeconomic factors, enteric pathogenic burden and gut function biomarkers in 402 children 6-24 months of age in Northeastern Brazil. In this prospective case-control study, not being fed colostrum [odds ratio (OR): 3.29, 95% confidence interval (CI): 1.73-6.26], maternal age ≥18 years (OR: 1.88, 95% CI: 1.10-3.22) and no electric fan (OR: 2.46, 95% CI: 1.22-4.96) or bicycle (OR: 1.80, 95% CI: 1.10-2.95) in the household were positively associated, and higher birth weight (OR: 0.27, 95% CI: 0.19-0.38), larger head circumference (OR: 0.74, 95% CI: 0.66-0.82) and shortness of breath in the last 2 weeks (OR: 0.49, 95% CI: 0.27-0.90) were negatively associated with malnutrition. Subclinical enteric pathogen infections were common, and enteroaggregative Escherichia coli infections were more prevalent in malnourished children (P = 0.045). Biomarkers such as the lactulose-mannitol test, myeloperoxidase, neopterin and calprotectin were highly elevated in both malnourished and nourished children. Nourished children had a better systemic immune response than the malnourished children, as detected by elevated serum amyloid A-1 and soluble cluster of differentiation protein 14 biomarkers (P malnutrition in children. There was a substantial subclinical enteric pathogen burden, particularly with enteroaggregative E. coli, in malnourished children.

  18. Biology

    Indian Academy of Sciences (India)

    I am particularly happy that the Academy is bringing out this document by Professor M S. Valiathan on Ayurvedic Biology. It is an effort to place before the scientific community, especially that of India, the unique scientific opportunities that arise out of viewing Ayurveda from the perspective of contemporary science, its tools ...

  19. Use of Gamma Rays to Control of Internal Parasites and Pathogenic Bacteria in Silver side Fish (Bissaria)

    International Nuclear Information System (INIS)

    Shawki, H.A.; El-Hanafy, A.E.A.; Shagar, G.I.A.

    2014-01-01

    The usefulness of Gamma irradiation to control of internal parasites and pathogenic bacteria found in silver side fish (Atherina) (Bissaria) was investigated. The detected parasites and the prevalence were adult Trematode (37.5%); Cestodes (95%) and Nematode (22.5%) for control silver side fish. The counts of detected microorganisms, (Total bacterial count; Psychrophilic bacteria; Mold and yeast; E.coli and Staphyloccous aureus ) were 4.89 ; 2.30; 2.32; 2.31 and 2.04 log 10 cfu/g for control silver side fish, respectively. Applied irradiation doses reduce the infected rate by Trematode, Cestodes and Nematode, furthermore, gamma irradiation with different doses (0.5, 1, 2, 4 and 5 kGy) reduce the microorganisms count of silver side fish (Bissaria) samples and the rate of decrement increase with the dose increase. Total bacterial count was not detected by using dose 5 kGy while Psychrophilic bacteria were completely eliminated using dose 1 kGy. On the other hand mold and yeast; E.coli and Staph aureus in silver side fish samples were not detected after subjected to gamma irradiation with dose 4 kGy. The results suggest that the applied doses completely elimination different internal parasites and pathogenic bacteria found in silver side fish. Thus, it could be conclude that the irradiation dose of 4 kGy can be effectively applied to ensure the safety of internal parasites and pathogenic bacteria found in silver side fish (Atherina) (Bissaria) with regards to these harmful parasites and pathogenic bacteria

  20. Integration of host plant resistance and biological control: using Arabidopsis-insect interactions as a model system

    NARCIS (Netherlands)

    Yang, L.

    2008-01-01

    Two main methods in sustainable pest control are host plant resistance and biological control. These methods have been developed in isolation. However, host plant characteristics can decisively affect the effectiveness of biological control agents, and therefore when altering plant characteristics

  1. The biological control as a strategy to support nontraditional agricultural exports in Peru: An empirical analysis

    Directory of Open Access Journals (Sweden)

    Franklin Duarte Cueva

    2012-12-01

    Full Text Available The study is oriented to explore the general characteristics of agriculture, the biological control as a pest control mechanism and agro export industry. In this context, we try to promote the use of biological control as a strategy to support nontraditional exports related to products such as asparagus and fresh avocados grown in the La Libertad Department (Peru, through an agronomic and management approach. Biological control is the basis of integrated pest management (IPM and contributes to the conservation of agricultural ecosystems allowing to export companies reduce costs, fulfill international phytosanitary measures and supports the preservation of the environment and health. Thus, the Peruvian agro export companies could build a sustainable competitive advantage and seek a positioning as socially responsible firms. We analyze variables such as crop statistics, comparative costs between biological control and chemical control, main destination markets for asparagus and fresh avocados, international standards, among others.

  2. Roles of Forkhead-box Transcription Factors in Controlling Development, Pathogenicity, and Stress Response in Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Jaejin Park

    2014-06-01

    Full Text Available Although multiple transcription factors (TFs have been characterized via mutagenesis to understand their roles in controlling pathogenicity and infection-related development in Magnaporthe oryzae, the causal agent of rice blast, if and how forkhead-box (FOX TFs contribute to these processes remain to be characterized. Four putative FOX TF genes were identified in the genome of M. oryzae, and phylogenetic analysis suggested that two of them (MoFKH1 and MoHCM1 correspond to Ascomycota-specific members of the FOX TF family while the others (MoFOX1 and MoFOX2 are Pezizomycotina-specific members. Deletion of MoFKH1 (ΔMofkh1 resulted in reduced mycelial growth and conidial germination, abnormal septation and stress response, and reduced virulence. Similarly, ΔMohcm1 exhibited reduced mycelial growth and conidial germination. Conidia of ΔMofkh1 and ΔMohcm1 were more sensitive to one or both of the cell cycle inhibitors hydroxyurea and benomyl, suggesting their role in cell cycle control. On the other hand, loss of MoFOX1 (ΔMofox1 did not show any noticeable changes in development, pathogenicity, and stress response. Deletion of MoFOX2 was not successful even after repeated attempts. Taken together, these results suggested that MoFKH1 and Mo-HCM1 are important in fungal development and that MoFKH1 is further implicated in pathogenicity and stress response in M. oryzae.

  3. A Novel Bacterial Pathogen of Biomphalaria glabrata: A Potential Weapon for Schistosomiasis Control?

    OpenAIRE

    Duval, David; Galinier, Richard; Mouahid, Gabriel; Toulza, Eve; Allienne, Jean-François,; Portela, Julien; Calvayrac, Christophe; Rognon, Anne; Arancibia, Nathalie; Mitta, Guillaume; Théron, André; Gourbal, Benjamin

    2015-01-01

    International audience; The present paper reports the isolation and the characterization of a new microbial pathogen of the freshwater snail, Biomphalaria glabrata. Genetic analyses revealed that the species has not been previously described and could be classified into the Paenibacillus genus. These bacteria invade most snail tissues and proliferate, causing massive lethality. Moreover, the bacterial infection can be transmitted both vertically and horizontally to other snails, causing their...

  4. Sigma E regulators control hemolytic activity and virulence in a shrimp pathogenic Vibrio harveyi.

    Directory of Open Access Journals (Sweden)

    Pimonsri Rattanama

    Full Text Available Members of the genus Vibrio are important marine and aquaculture pathogens. Hemolytic activity has been identified as a virulence factor in many pathogenic vibrios including V. cholerae, V. parahaemolyticus, V. alginolyticus, V. harveyi and V. vulnificus. We have used transposon mutagenesis to identify genes involved in the hemolytic activity of shrimp-pathogenic V. harveyi strain PSU3316. Out of 1,764 mutants screened, five mutants showed reduced hemolytic activity on sheep blood agar and exhibited virulence attenuation in shrimp (Litopenaeus vannamei. Mutants were identified by comparing transposon junction sequences to a draft of assembly of the PSU3316 genome. Surprisingly none of the disrupted open reading frames or gene neighborhoods contained genes annotated as hemolysins. The gene encoding RseB, a negative regulator of the sigma factor (σ(E, was interrupted in 2 out of 5 transposon mutants, in addition, the transcription factor CytR, a threonine synthetase, and an efflux-associated cytoplasmic protein were also identified. Knockout mutations introduced into the rpoE operon at the rseB gene exhibited low hemolytic activity in sheep blood agar, and were 3-to 7-fold attenuated for colonization in shrimp. Comparison of whole cell extracted proteins in the rseB mutant (PSU4030 to the wild-type by 2-D gel electrophoresis revealed 6 differentially expressed proteins, including two down-regulated porins (OmpC-like and OmpN and an upregulated protease (DegQ which have been associated with σ(E in other organisms. Our study is the first report linking hemolytic activity to the σ(E regulators in pathogenic Vibrio species and suggests expression of this virulence-linked phenotype is governed by multiple regulatory pathways within the V. harveyi.

  5. Control of foodborne pathogens on fresh-cut fruit by a novel strain of Pseudomonas graminis.

    Science.gov (United States)

    Alegre, Isabel; Viñas, Inmaculada; Usall, Josep; Teixidó, Neus; Figge, Marian J; Abadias, Maribel

    2013-06-01

    The consumption of fresh-cut fruit has substantially risen over the last few years, leading to an increase in the number of outbreaks associated with fruit. Moreover, consumers are currently demanding wholesome, fresh-like, safe foods without added chemicals. As a response, the aim of this study was to determine if the naturally occurring microorganisms on fruit are "competitive with" or "antagonistic to" potentially encountered pathogens. Of the 97 and 107 isolates tested by co-inoculation with Escherichia coli O157:H7, Salmonella and Listeria innocua on fresh-cut apple and peach, respectively, and stored at 20 °C, seven showed a strong antagonistic capacity (more than 1-log unit reduction). One of the isolates, CPA-7, achieved the best reduction values (from 2.8 to 5.9-log units) and was the only isolate able to inhibit E. coli O157:H7 at refrigeration temperatures on both fruits. Therefore, CPA-7 was selected for further assays. Dose-response assays showed that CPA-7 should be present in at least the same amount as the pathogen to adequately reduce the numbers of the pathogen. From the results obtained in in vitro assays, competition seemed to be CPA-7's mode of action against E. coli O157:H7. The CPA-7 strain was identified as Pseudomonas graminis. Thus, the results support the potential use of CPA-7 as a bioprotective agent against foodborne pathogens in minimally processed fruit. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. The Use of Predatory Bacteria to Control Select Pathogens and Treat Respiratory Infections

    Science.gov (United States)

    2015-04-13

    detectable levels of predators using RT- qPCR (Fig. 7). As previously stated, for the one hour time point experiment, an inoculation dose of 4 x 109 PFU... detect 1010 gene copies of Bdellovibrio in three of the mice. qPCR has been found to slightly overestimate quantities of bacteria compared to...smaller inductions of TNF and IL-6 as compared to that induced by pathogenic E. coli. As TLR-4 is responsible for detecting LPS expressed on or released

  7. Environmental dimensionality controls the interaction of phagocytes with the pathogenic fungi Aspergillus fumigatus and Candida albicans.

    Science.gov (United States)

    Behnsen, Judith; Narang, Priyanka; Hasenberg, Mike; Gunzer, Frank; Bilitewski, Ursula; Klippel, Nina; Rohde, Manfred; Brock, Matthias; Brakhage, Axel A; Gunzer, Matthias

    2007-02-01

    The fungal pathogens Aspergillus fumigatus and Candida albicans are major health threats for immune-compromised patients. Normally, macrophages and neutrophil granulocytes phagocytose inhaled Aspergillus conidia in the two-dimensional (2-D) environment of the alveolar lumen or Candida growing in tissue microabscesses, which are composed of a three-dimensional (3-D) extracellular matrix. However, neither the cellular dynamics, the per-cell efficiency, the outcome of this interaction, nor the environmental impact on this process are known. Live imaging shows that the interaction of phagocytes with Aspergillus or Candida in 2-D liquid cultures or 3-D collagen environments is a dynamic process that includes phagocytosis, dragging, or the mere touching of fungal elements. Neutrophils and alveolar macrophages efficiently phagocytosed or dragged Aspergillus conidia in 2-D, while in 3-D their function was severely impaired. The reverse was found for phagocytosis of Candida. The phagocytosis rate was very low in 2-D, while in 3-D most neutrophils internalized multiple yeasts. In competitive assays, neutrophils primarily incorporated Aspergillus conidia in 2-D and Candida yeasts in 3-D despite frequent touching of the other pathogen. Thus, phagocytes show activity best in the environment where a pathogen is naturally encountered. This could explain why "delocalized" Aspergillus infections such as hematogeneous spread are almost uncontrollable diseases, even in immunocompetent individuals.

  8. Fungal Control of Pathogenic Fungi Isolated From Some Wild Plants in Taif Governorate, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Abou-Zeid, A. M.

    2008-01-01

    Full Text Available Twenty two plants were collected from Taif Governorate and identified as: Aerva lanata, Arnebia hispidissima, Artemisia judaica, Artemisia monosperma, Asphodelus aestives, Avena barbata, Capparis dcidua, Eucalyptus globulus, Euphorbia glomerifera, Foeniculum vulgare, Forsskaolea tenacissima, Juniperus procera, Launaea mucronata, Launaea sonchoides, Medicago sativa, Opuntia ficus, Phagnalon sinaicum, Prunus persica, Pulicaria crispa, Punica granatum, Rumex dentatus and Trichodesma calathiforme. Pathogenic fungi were isolated from some of these plants and identified as Alternaria alternata, Cephalosporium madurae, Cladosporium herbarum, Fusarium oxysporum, Humicola grisea, Penicillium chrysogenum and Ulocladium botrytis. Four antagonistic isolates were tested, 2 from Gliocladium fungus and 2 from Trichoderma fungus. We found that all the four antagonistic isolates (G. deliquescens, G. virens, T. viride and T. hamatum significantly inhibited the radial growth of the pathogenic fungi tested, with different ratios. The results indicated that the antibiotics produced by the antagonists were more effective than the fungus itself and differ with different fungi. Coating plant stems with antagonists or with antagonist extracts reduce the severity of the disease but not prevent it in all tested pathogens.

  9. Environmental dimensionality controls the interaction of phagocytes with the pathogenic fungi Aspergillus fumigatus and Candida albicans.

    Directory of Open Access Journals (Sweden)

    Judith Behnsen

    2007-02-01

    Full Text Available The fungal pathogens Aspergillus fumigatus and Candida albicans are major health threats for immune-compromised patients. Normally, macrophages and neutrophil granulocytes phagocytose inhaled Aspergillus conidia in the two-dimensional (2-D environment of the alveolar lumen or Candida growing in tissue microabscesses, which are composed of a three-dimensional (3-D extracellular matrix. However, neither the cellular dynamics, the per-cell efficiency, the outcome of this interaction, nor the environmental impact on this process are known. Live imaging shows that the interaction of phagocytes with Aspergillus or Candida in 2-D liquid cultures or 3-D collagen environments is a dynamic process that includes phagocytosis, dragging, or the mere touching of fungal elements. Neutrophils and alveolar macrophages efficiently phagocytosed or dragged Aspergillus conidia in 2-D, while in 3-D their function was severely impaired. The reverse was found for phagocytosis of Candida. The phagocytosis rate was very low in 2-D, while in 3-D most neutrophils internalized multiple yeasts. In competitive assays, neutrophils primarily incorporated Aspergillus conidia in 2-D and Candida yeasts in 3-D despite frequent touching of the other pathogen. Thus, phagocytes show activity best in the environment where a pathogen is naturally encountered. This could explain why "delocalized" Aspergillus infections such as hematogeneous spread are almost uncontrollable diseases, even in immunocompetent individuals.

  10. Fungal control of pathogenic fungi isolated from wild plants in Taif Governorate, Saudia Arabia.

    Science.gov (United States)

    Abou-Zeid, A M; Altalhi, A D; Abd El-Fattah, R I

    2007-01-01

    Twenty two plants were collected from Taif Governorate and identified as: Euphorbia glomerifera, Juniperus procera, Launaea mucronata, Capparis dcidua, Punica granatum, Opuntia ficus, Prunus persica, Eucalyptus globulus, Medicago sativa, Artemisia monosperma, Trichodesma calathiforme, Artemisia judaica, Foeniculum vulgare, Phagnalon sinaicum, Rumex dentatus, Asphodelus aestives, Pulicaria crispa, Launae sonchoides, Forsskaolea tenacissima, Arnebia hispidissima, Avena spp and Aerva lanata. Pathogenic fungi were isolated from some of these plants and identified as Alternaria alternate, Ulocladium botrytis, Cladosporium spp, Cephalosporium spp, Penicillium chrysogenum, Fusarium oxysporum and Humicola grisea. Four antagonistic isolates were tested, 2 from Gliocladium fungus and 2 from Trichoderma fungus. We found that all the four antagonistic isolates (G. deliquescens, G. virens, T. viride and T. hamatum) significantly inhibited the radial growth of the pathogenic fungi tested, with different ratios. The results indicated that the antibiotics produced by the antagonists were more effective than the fungus itself and differ with different fungi. Coating plant stems with antagonists or with antagonist extracts reduce the severity of the disease but not prevent it in all tested pathogens.

  11. Complete Host Range Testing on Common Reed with Potential Biological Control Agents and Investigation into Biological Control for Flowering Rush

    Science.gov (United States)

    2016-07-01

    invasive and a threat to biodiversity (Wapshere 1990; Marks et al. 1994; Tewksbury et al. 2002). Only in the last century did P. australis start to...In 2015, haplotype I was added in a similar experiment. 1.1.2 Objectives The objectives of this research were to test the oviposition preference...A., and C. G. Eckert, 2005. Interaction between founder effect and selection during biological invasion in an aquatic plant. Evolution 59:1900–1913

  12. Anaerobic Digestion. Student Manual. Biological Treatment Process Control.

    Science.gov (United States)

    Carnegie, John W., Ed.

    This student manual contains the textual material for a four-lesson unit on anaerobic digestion control. Areas addressed include: (1) anaerobic sludge digestion (considering the nature of raw sludge, purposes of anaerobic digestion, the results of digestion, types of equipment, and other topics); (2) digester process control (considering feeding…

  13. Biological activities of Allium sativum and Zingiber officinale extracts on clinically important bacterial pathogens, their phytochemical and FT-IR spectroscopic analysis.

    Science.gov (United States)

    Awan, Uzma Azeem; Ali, Shaukat; Shahnawaz, Amna Mir; Shafique, Irsa; Zafar, Atiya; Khan, Muhammad Abdul Rauf; Ghous, Tahseen; Saleem, Azhar; Andleeb, Saiqa

    2017-05-01

    The spread of bacterial infectious diseases is a major public threat. Herbs and spices have offered an excellent, important and useful source of antimicrobial agents against many pathological infections. In the current study, the antimicrobial potency of fresh, naturally and commercial dried Allium sativum and Zingiber officinale extracts had been investigated against seven local clinical bacterial isolates such as Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, Staphylococcus aureus, Streptococcus pyogenes, Staphylococcus epidermidis, and Serratia marcesnces by the agar disc diffusion method. All tested pathogens except P. aeruginosa and E. coli were most susceptible to ethanolic and methanolic extracts of A. sativum. Similarly, chloroform and diethyl ether extracts of Z. officinale showed a greater zone of inhibition of tested pathogens except for P. aeruginosa and E. coli. We found that all extracts of A. sativum and Z. officinale have a strong antibacterial effect compared to recommended standard antibiotics through activity index. All results were evaluated statistically and a significant difference was recorded at P< 0.05. Antioxidant activity of extracts showed that 10 out of 13 extracts have high scavenging potential. Thin layer chromatography profiling of all extracts of A. sativum and Z. officinale proposed the presence of various phytochemicals such as tannins, phenols, alkaloids, steroids and saponins. Retention factor of diverse phytochemicals provides a valuable clue regarding their polarity and the selection of solvents for separation of phytochemicals. Significant inhibition of S. aureus was also observed through TLC-Bioautography. FT-IR Spectrometry was also performed to characterize both natural and commercial extracts of A. sativum and Z. officinale to evaluate bioactive compounds. These findings provide new insights to use A. sativum and Z. officinale as potential plant sources for controlling pathogenic bacteria and potentially

  14. A host-specific biological control of grape crown gall by Agrobacterium vitis strain F2/5: its regulation and population dynamics.

    Science.gov (United States)

    Kaewnum, Supaporn; Zheng, Desen; Reid, Cheryl L; Johnson, Kameka L; Gee, Jodi C; Burr, Thomas J

    2013-05-01

    Nontumorigenic Agrobacterium vitis strain F2/5 is able to prevent crown gall caused by tumorigenic A. vitis on grape but not on other plant species such as tobacco. Mutations in a quorum-sensing transcription factor, aviR, and in caseinolytic protease (clp) component genes clpA and clpP1 resulted in reduced or loss of biological control. All mutants were complemented; however, restoration of biological control by complemented clpA and clpP1 mutants was dependent on the copy number of vector that was used as well as timing of application of the complemented mutants to grape wounds in relation to inoculation with pathogen. Mutations in other quorum-sensing and clp genes and in a gene associated with polyketide synthesis did not affect biological control. It was determined that, although F2/5 inhibits transformation by tumorigenic A. vitis strains on grape, it does not affect growth of the pathogen in wounded grape tissue over time.

  15. Biological control and management of the detoxication wastewater treatment technologies

    Directory of Open Access Journals (Sweden)

    Topalova Yana

    2007-01-01

    Full Text Available Detoxication technologies require the combination of theoretical and practical knowledge of xenobiotic biodegradation, wastewater treatment technologies, and management rules. The purpose of this complicated combination is to propose specialized strategies for detoxication, based on lab- and pilot-scale modeling. These strategies include preliminary created algorithms for preventing the risk of water pollution and sediments. The technologies and algorithms are essentially important outcome, applied in the textile, pharmaceutical, cosmetic, woodtreating, and oiltreating industries. In this paper four rehabilitation technologies for pretreatment of water contaminated by pentachlorophenol (PCP have been developed in the frame of the European and Bulgarian National projects. Emphasize is put on the biological systems and their potential of detoxication management. The light and transmission electron microscopy of the reconstructed activated sludges the microbial, kinetic and enzymological indicators are presented and approved as critical points in the biocontrol.

  16. SOME ASPECTS OF THE BIOLOGY AND CONTROL OF ...

    African Journals Online (AJOL)

    Key Words: Callosobruchus maculatus, developmental period, soya bean, Azadirachta indica, Citrus sinensis. ASPECTS DE LA BIOLOGIE ET DU CONTROLE DU CALLOSOBRUCHUS MACULATUS (F.) SUR LA CONSERVATION DES GRAINES DE SOJA DES VARIETES GLYCINE MAX (L.) MERR NOTE DE SYNTHESE

  17. [Bacillus thuringiensis: general aspects. An approach to its use in the biological control of lepidopteran insects behaving as agricultural pests].

    Science.gov (United States)

    Sauka, Diego H; Benintende, Graciela B

    2008-01-01

    Bacillus thuringiensis is the most widely applied biological pesticide used to control insects that affect agriculture and forestry and which transmit human and animal pathogens. During the past decades B. thuringiensis has been the subject of intensive research. These efforts have yielded considerable data about the relationships between the structure, mechanism of action, and genetics of their pesticidal crystal proteins. As a result, a coherent picture of these relationships has emerged. Other studies have focused on the ecological role of the B. thuringiensis crystal proteins and their performance in agricultural and other natural settings. With this knowledge as background and the help of biotechnological tools, researchers are now reporting promising results in the development of more useful toxins, recombinant bacteria, new formulations and transgenic plants that express pesticidal activity, in order to assure that these products are utilized with the best efficiency and benefit. This article is an attempt to integrate all these recent developments in the study of B. thuringiensis into a context of biological control of lepidopteran insect pest of agricultural importance.

  18. Biosynthesis of silver and gold nanoparticles usingTrichoderma atroviridefor the biological control ofPhomopsiscanker disease in tea plants.

    Science.gov (United States)

    Ponmurugan, Ponnusamy

    2017-04-01

    The biological way of metallic nanoparticles production using ecofriendly biocontrol agents are largely used to control many plant pathogenic microorganisms in agriculture. Hence, an attempt was made to evaluate the potential of suppressive activity of nanoparticles produced by an indigenous isolate, Trichoderma atroviride against a tea pathogenic fungus namely Phomopsis theae . The presence of biosynthesised nanoparticles was primarily confirmed through ultraviolet-visible spectroscopy analysis and was characterised using X-ray diffraction and scanning electron microscopy-energy dispersive X-ray analysis to delineate the size, shape and nature of particles. Further, Fourier transform infrared analysis revealed the functional biomolecules responsible for capping and stabilisation of nanoparticles. In addition, culture filtrate containing nanoparticles was subjected to invitro antifungal studies which revealed a considerable suppression on the growth of P. theae . The biosynthesised nanoparticles were found to be active even after 3 months which established and confirmed the stability. Finally, field experiments conducted with soil application and wound dressing of nanoparticles exhibited a significant reduction in canker size when plants treated with gold followed by silver nanoparticles. Similarly, improvement in leaf yield was noted in response to these treatments. The above study confirmed the efficacy of metallic nanoparticles in management of stem disease in tea plantation.

  19. Lactobacillus plantarum strains as a bio-control strategy against food-borne pathogenic microorganisms

    Directory of Open Access Journals (Sweden)

    Mattia Pia Arena

    2016-04-01

    Full Text Available Lactobacillus plantarum is one of the most versatile species extensively used in the food industry both as microbial starters and probiotic microorganisms. Several L. plantarum strains have been shown to produce different antimicrobial compounds such as organic acids, hydrogen peroxide, diacetyl, and also bacteriocins and antimicrobial peptides, both denoted by a variable spectrum of action. In the recent decades, the selection of microbial molecules and/or bacterial strains able to produce antagonistic molecules to be used as antimicrobials and preservatives has been attracting scientific interest, in order to eliminate or reduce chemical additives, because of the growing attention of consumers for healthy and natural food products. The aim of this work was to investigate the antimicrobial activity of several food-isolated L. plantarum strains, analyzed against the pathogenic bacteria Listeria monocytogenes, Salmonella Enteritidis, Escherichia coli O157:H7 and Staphylococcus aureus. Antagonistic activity was assayed by agar spot test and revealed that strain L. plantarum 105 had the strongest ability to contrast the growth of L. monocytogenes, while strains L. plantarum 106 and 107 were the most active microorganisms against E. coli O157:H7. The antimicrobial ability was also screened by well diffusion assay and broth micro-dilution method using cell-free supernatants (CFS from each Lactobacillus strain. Moreover, the chemical nature of the molecules released in the CFS, and possibly underlying the antagonistic activity, was preliminary characterized by exposure to different constraints such as pH neutralization, heating, catalase and proteinase treatments. Our data suggest that the ability of L. plantarum cultures to contrast pathogens growth in vitro depends, at least in part, on a pH-lowering effect of supernatants and/or on the presence of organic acids. Cluster analysis was performed in order to group L. plantarum strains according to

  20. Biological control of lettuce drop and host plant colonization by rhizospheric and endophytic streptomycetes

    Directory of Open Access Journals (Sweden)

    Xiaoyulong eChen

    2016-05-01

    Full Text Available Lettuce drop, caused by the soil borne pathogen Sclerotinia sclerotiorum, is one of the most common and serious diseases of lettuce worldwide. Increased concerns about the side effects of chemical pesticides have resulted in greater interest in developing biocontrol strategies against S. sclerotiorum. However, relatively little is known about the mechanisms of Streptomyces spp. as biological control agents against S. sclerotiorum on lettuce. Two Streptomyces isolates, S. exfoliatus FT05W and S. cyaneus ZEA17I, inhibit mycelial growth of Sclerotinia sclerotiorum by more than 75% in vitro. We evaluated their biocontrol activity against S. sclerotiorum in vivo, and compared them to Streptomyces lydicus WYEC 108, isolated from Actinovate®. When Streptomyces spp. (106 CFU/mL were applied to S. sclerotiorum inoculated substrate in a growth chamber one week prior lettuce sowing, they significantly reduced the risk of lettuce drop disease, compared to the inoculated control. Interestingly, under field conditions, S. exfoliatus FT05W and S. cyaneus ZEA17I protected lettuce from drop by 40% and 10% respectively, whereas S. lydicus WYEC 108 did not show any protection. We further labeled S. exfoliatus FT05W and S. cyaneus ZEA17I with the enhanced GFP (EGFP marker to investigate their rhizosphere competence and ability to colonize lettuce roots using confocal laser scanning microscopy (CLSM. The abundant colonization of young lettuce seedlings by both strains demonstrated Streptomyces’ capability to interact with the host from early stages of seed germination and root development. Moreover, the two strains were detected also on two-week-old roots, indicating their potential of long-term interactions with lettuce. Additionally, scanning electron microscopy (SEM observations showed EGFP-S. exfoliatus FT05W endophytic colonization of lettuce root cortex tissues. Finally, we determined its viability and persistence in the rhizosphere and endorhiza up to

  1. Biological Control of Lettuce Drop and Host Plant Colonization by Rhizospheric and Endophytic Streptomycetes.

    Science.gov (United States)

    Chen, Xiaoyulong; Pizzatti, Cristina; Bonaldi, Maria; Saracchi, Marco; Erlacher, Armin; Kunova, Andrea; Berg, Gabriele; Cortesi, Paolo

    2016-01-01

    Lettuce drop, caused by the soil borne pathogen Sclerotinia sclerotiorum, is one of the most common and serious diseases of lettuce worldwide. Increased concerns about the side effects of chemical pesticides have resulted in greater interest in developing biocontrol strategies against S. sclerotiorum. However, relatively little is known about the mechanisms of Streptomyces spp. as biological control agents against S. sclerotiorum on lettuce. Two Streptomyces isolates, S. exfoliatus FT05W and S. cyaneus ZEA17I, inhibit mycelial growth of Sclerotinia sclerotiorum by more than 75% in vitro. We evaluated their biocontrol activity against S. sclerotiorum in vivo, and compared them to Streptomyces lydicus WYEC 108, isolated from Actinovate®. When Streptomyces spp. (10(6) CFU/mL) were applied to S. sclerotiorum inoculated substrate in a growth chamber 1 week prior lettuce sowing, they significantly reduced the risk of lettuce drop disease, compared to the inoculated control. Interestingly, under field conditions, S. exfoliatus FT05W and S. cyaneus ZEA17I protected lettuce from drop by 40 and 10% respectively, whereas S. lydicus WYEC 108 did not show any protection. We further labeled S. exfoliatus FT05W and S. cyaneus ZEA17I with the enhanced GFP (EGFP) marker to investigate their rhizosphere competence and ability to colonize lettuce roots using confocal laser scanning microscopy (CLSM). The abundant colonization of young lettuce seedlings by both strains demonstrated Streptomyces' capability to interact with the host from early stages of seed germination and root development. Moreover, the two strains were detected also on 2-week-old roots, indicating their potential of long-term interactions with lettuce. Additionally, scanning electron microscopy (SEM) observations showed EGFP-S. exfoliatus FT05W endophytic colonization of lettuce root cortex tissues. Finally, we determined its viability and persistence in the rhizosphere and endorhiza up to 3 weeks by quantifying

  2. Biological control of saltcedar (Tamarix spp.) by saltcedar leaf beetles (Diorhabda spp.): effects on small mammals

    Science.gov (United States)

    The spread of introduced saltcedar (Tamarix spp.) throughout many riparian systems across the western United States motivated the introduction of biological control agents that are specific to saltcedar, saltcedar leaf beetles (Diorhabda carinulata, D. elongata; Chrysomelidae). I monitored small mam...

  3. Sex determination meltdown upon biological control introduction of the parasitoid Cotesia rubecula?

    NARCIS (Netherlands)

    Boer, de J.G.; Kuijper, B.; Heimpel, G.E.; Beukeboom, L.W.

    2012-01-01

    Natural enemies may go through genetic bottlenecks during the process of biological control introductions. Such bottlenecks are expected to be particularly detrimental in parasitoid Hymenoptera that exhibit complementary sex determination (CSD). CSD is associated with a severe form of inbreeding

  4. Sex determination meltdown upon biological control introduction of the parasitoid Cotesia rubecula?

    NARCIS (Netherlands)

    de Boer, Jetske G.; Kuijper, Bram; Heimpel, George E.; Beukeboom, Leo W.

    Natural enemies may go through genetic bottlenecks during the process of biological control introductions. Such bottlenecks are expected to be particularly detrimental in parasitoid Hymenoptera that exhibit complementary sex determination (CSD). CSD is associated with a severe form of inbreeding

  5. Prospects for the biological control of invasive Pinus species (Pinaceae) in South Africa

    CSIR Research Space (South Africa)

    Hoffmann, JH

    2011-09-01

    Full Text Available Nine Pinus species (Pinaceae) have become invasive plants in South Africa after being deliberately introduced and cultivated in commercial forests, for timber. A proposal to use biological control to contain the problem raised concerns among...

  6. Comparative evaluation of two populations of Pseudophilothrips ichini as candidates for biological control of Brazilian peppertree

    Science.gov (United States)

    Brazilian peppertree, Schinus terebinthifolius Raddi (Sapindales: Anacardiaceae) is one of the worst invasive species in Florida. The thrips Pseudophilothrips ichini Hood (Thysanoptera: Phlaeothripidae) is being considered as a potential biological control agent of Brazilian peppertree. Two populati...

  7. Plant genotype effects on a host specific thrips and the impact on biological control

    Science.gov (United States)

    A promising thrips, Pseudophilothrips ichini (Phlaeothripidae) has been considered for biological control of the invasive weed Brazilian pepper Schinus terebinthifolius. This thrips was originally collected from a southern region of Brazil where it was frequently found associated with significant da...

  8. Host Specificity of Argopistes tsekooni (Coleoptera: Chrysomelidae), a Potential Biological Control Agent of Chinese Privet

    Science.gov (United States)

    Yan Zhuo Zhang; James Hanula; Jiang Hua Sun

    2008-01-01

    Chinese privet, Ligustrum sinense Lour., is a perennial semi-evergreen shrub that is aserious invasive weed in the United States. Classical biological control offers the best hope forcontrolling it in an economic, effective, and persistent way. Host...

  9. Parasitoids attacking emerald ash borers in western Pennsylvania and their potential use in biological control

    Science.gov (United States)

    J.J. Duan; R.W. Fuester; J. Wildonger; P.B. Taylor; S. Barth; S-E. Spichiger

    2009-01-01

    Current biological control programs against the emerald ash borer (EAB, Agrilus planipennis Fairmaire) have primarily focused on the introduction and releases of exotic parasitoids from China, home of the pest origin....

  10. Regio-controlled hydrogen-deuterium exchange of biologically important indoles under uv irradiation

    International Nuclear Information System (INIS)

    Saito, Isao; Muramatsu, Shigeru; Sugiyama, Hiroshi; Yamamoto, Akihiro; Matsuura, Teruo

    1985-01-01

    Photochemical hydrogen-deuterium exchange reaction of biologically important indoles is reported. The regioselectivity of the photodeuteration was found to be controlled by the ammonium group of the side chain. (author)

  11. Prospects for the use of biological control agents against Anoplophora in Europe

    Science.gov (United States)

    This review summarises the literature on the biological control of Anoplophora spp. (Coleoptera: Cerambycidae) and discusses its potential for use in Europe. Entomopathogenic fungi: Beauveria brongniartii Petch (Hypocreales: Cordycipitaceae) has already been developed into a commercial product in Ja...

  12. The biological basis for the control of prenatal irradiation

    International Nuclear Information System (INIS)

    1988-01-01

    The embryo and fetus have been generally considered to be more sensitive than the adult to the detrimental effects of radiation exposure. In particular, recent re-evaluations of epidemiological data on human population exposed to radiation have suggested that there may be greater sensitivity than heretofore recognized to the induction of mental retardation and reduced intelligence by exposure during gestation. To assist national authorities in evaluating this problem and establishing appropriate protection measures for limiting the dose to the embryo and fetus and, thus, to pregnant or potentially pregnant women, the Nuclear Energy Agency has appointed a Group of Consultants to assemble and evaluate the biological data relevant to the protection of the human conceptus, and to make recommendations for achieving this in the operational practice. The Group has surveyed the human data dealing with the biologcal effects of radiation exposure at low doses, and has supplemented this with information derived from animal studies. The Group has also taken full account of the studies and recommendations issued in this area by other international organizations, primarily the United Nations Scientific Committee on the Effects of Atomic Radiation (UNSCEAR) and the International Commission on Radiological Protection (ICRP). This report is published under the responsibility of the Secretary General of the OECD, and does not commit Member governments of the Organization

  13. Nuclear polyhedrosis virus as biological control agent of Spodoptera exigua

    NARCIS (Netherlands)

    Smits, P.H.

    1987-01-01

    Several aspects of the control of the beet armyworm, Spodopteraexigua (Hübner) (Lepidoptera: Noctuidae) in greenhouse crops with nuclear polyhedrosis viruses (NPVs) (Baculoviridae, subgroup A) were studied.

    Beet armyworm behaviour was observed in various

  14. Efficiency of using green algae as biological controllers against toxic ...

    African Journals Online (AJOL)

    Treatment I (untreated) served as a control, Treatment II was seeded with Microcystis aeruginosa, Treatment III was seeded with green algae Chlorella ellipsoidea and Scenedesmus bijuga, and Treatment IV was seeded with a mixture of M. aeruginosa and C. ellipsoidea and S. bijuga. After 10 days, Treatment IV showed ...

  15. Comparison between chemical and biological control of Fusarium ...

    African Journals Online (AJOL)

    ... College of Education, Jeddah, Saudi Arabia. The results revealed that treatment with the fungicide carbomar or T. harzianum as well as with B. subtilis, in presence of F. solani increased the % of healthy seedlings as well as their length , fresh and dry weight than in presence of F. solani alone but still less than the control.

  16. Biological control of post harvest disease caused by Aspergillus ...

    African Journals Online (AJOL)

    The highest control was obtained by the cell suspension of Pantoea agglomerans RK-153. Erwinia chrysanthemi RK-67 and Bacillus subtilis RK-6 treatments reduced disease severity on both lemon cultivars. Furthermore, both the cell suspension and culture filtrates of Burkholderia cepacia strain RK- 277 reduced disease ...

  17. The potential of classical biological control against Leucaena Psyllid ...

    African Journals Online (AJOL)

    The Leucaena psyllid Heteropsylla cubana Crawford (Homoptera: Psyllidae) has caused damaging effects to Leucaena leucocephala (Lam.) de Wit in Tanzania since its outbreak in 1992. Cultural, genetic and chemical controls have been tried in some localised areas. In 1995, a hymenopterous parasitoids, Tamarixia ...

  18. Anaerobic Digestion. Instructor's Guide. Biological Treatment Process Control.

    Science.gov (United States)

    Carnegie, John W., Ed.

    This instructor's guide contains materials needed to teach a four-lesson unit on anaerobic digestion control. These materials include: (1) unit overview; (2) lesson plans; (3) lecture outlines; (4) student worksheets for each lesson (with answers); and (5) two copies of a final quiz (with and without answers). Lesson 1 is a review of the theory of…

  19. Biological control of Verticillium dahliae by Talaromyces flavus

    NARCIS (Netherlands)

    Nagtzaam, M.P.M.

    1998-01-01

    Verticillium dahliae causes vascular wilt in a wide range of host plants. Control of Verticillium wilt is by soil disinfestation and to a lesser extent by crop rotation or, for a few host plants, by growing resistant varieties. For environmental reasons, the development

  20. Biological control of Rhizoctonia solani on potato by Verticillium ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... sclerotia of R. solani was reduced by V. biguttatum isolates. V. biguttatum also significantly reduced the disease severity of R. solani on potato sprouts in pot experiments. This is the first report of V. biguttatum from sclerotia of R. solani in Turkey. Key words: Bio-control, potato, Rhizoctonia solani, Verticillium ...

  1. A biologically inspired neural network controller for ballistic arm movements

    Directory of Open Access Journals (Sweden)

    Schmid Maurizio

    2007-09-01

    Full Text Available Abstract Background In humans, the implementation of multijoint tasks of the arm implies a highly complex integration of sensory information, sensorimotor transformations and motor planning. Computational models can be profitably used to better understand the mechanisms sub-serving motor control, thus providing useful perspectives and investigating different control hypotheses. To this purpose, the use of Artificial Neural Networks has been proposed to represent and interpret the movement of upper limb. In this paper, a neural network approach to the modelling of the motor control of a human arm during planar ballistic movements is presented. Methods The developed system is composed of three main computational blocks: 1 a parallel distributed learning scheme that aims at simulating the internal inverse model in the trajectory formation process; 2 a pulse generator, which is responsible for the creation of muscular synergies; and 3 a limb model based on two joints (two degrees of freedom and six muscle-like actuators, that can accommodate for the biomechanical parameters of the arm. The learning paradigm of the neural controller is based on a pure exploration of the working space with no feedback signal. Kinematics provided by the system have been compared with those obtained in literature from experimental data of humans. Results The model reproduces kinematics of arm movements, with bell-shaped wrist velocity profiles and approximately straight trajectories, and gives rise to the generation of synergies for the execution of movements. The model allows achieving amplitude and direction errors of respectively 0.52 cm and 0.2 radians. Curvature values are similar to those encountered in experimental measures with humans. The neural controller also manages environmental modifications such as the insertion of different force fields acting on the end-effector. Conclusion The proposed system has been shown to properly simulate the development of

  2. Screening of Fungi for Biological Control of a Triatomine Vector of Chagas Disease: Temperature and Trypanosome Infection as Factors.

    Directory of Open Access Journals (Sweden)

    Aline R M Garcia

    2016-11-01

    Full Text Available Entomopathogenic fungi have been investigated as an alternative tool for controlling various insects, including triatomine vectors of the protozoan Trypanosoma cruzi, the etiological agent of Chagas disease. Here we tested the pathogenicity and virulence of ten isolates of the fungi Metarhizium spp. and Beauveria bassiana against Rhodnius prolixus and found all of the isolates to be virulent. We used two isolates (URPE-11 Metarhizium anisopliae and ENT-1 Beauveria bassiana for further screening based on their prolific sporulation in vitro (an important property of fungal biopesticides. We characterized their virulences in a dose-response experiment and then examined virulence across a range of temperatures (21, 23, 27 and 30°C. We found isolate ENT-1 to maintain higher levels of virulence over these temperatures than URPE-11. We therefore used B. bassiana ENT-1 in the final experiment in which we examined the survival of insects parasitized with T. cruzi and then infected with this fungus (once again over a range of temperatures. Contrary to our expectations, the survival of insects challenged with the pathogenic fungus was greater when they had previously been infected with the parasite T. cruzi than when they had not (independent of temperature. We discuss these results in terms of aspects of the biologies of the three organisms. In practical terms, we concluded that, while we have fungal isolates of potential interest for development as biopesticides against R. prolixus, we have identified what could be a critical problem for this biological tool: the parasite T. cruzi appears to confer a measure of resistance to the insect against the potential biopesticide agent so use of this fungus as a biopesticide could lead to selection for vector competence.

  3. Controlled flight of a biologically inspired, insect-scale robot.

    Science.gov (United States)

    Ma, Kevin Y; Chirarattananon, Pakpong; Fuller, Sawyer B; Wood, Robert J

    2013-05-03

    Flies are among the most agile flying creatures on Earth. To mimic this aerial prowess in a similarly sized robot requires tiny, high-efficiency mechanical components that pose miniaturization challenges governed by force-scaling laws, suggesting unconventional solutions for propulsion, actuation, and manufacturing. To this end, we developed high-power-density piezoelectric flight muscles and a manufacturing methodology capable of rapidly prototyping articulated, flexure-based sub-millimeter mechanisms. We built an 80-milligram, insect-scale, flapping-wing robot modeled loosely on the morphology of flies. Using a modular approach to flight control that relies on limited information about the robot's dynamics, we demonstrated tethered but unconstrained stable hovering and basic controlled flight maneuvers. The result validates a sufficient suite of innovations for achieving artificial, insect-like flight.

  4. Biological Control of Mosquito Vectors: Past, Present, and Future

    Directory of Open Access Journals (Sweden)

    Giovanni Benelli

    2016-10-01

    Full Text Available Mosquitoes represent the major arthropod vectors of human disease worldwide transmitting malaria, lymphatic filariasis, and arboviruses such as dengue virus and Zika virus. Unfortunately, no treatment (in the form of vaccines or drugs is available for most of these diseases andvectorcontrolisstillthemainformofprevention. Thelimitationsoftraditionalinsecticide-based strategies, particularly the development of insecticide resistance, have resulted in significant efforts to develop alternative eco-friendly methods. Biocontrol strategies aim to be sustainable and target a range of different mosquito species to reduce the current reliance on insecticide-based mosquito control. In thisreview, weoutline non-insecticide basedstrategiesthat havebeenimplemented orare currently being tested. We also highlight the use of mosquito behavioural knowledge that can be exploited for control strategies.

  5. The biological control on Si cycling in the Okavango Delta

    Science.gov (United States)

    Struyf, Eric; Mosimane, Keotshepile; Van Pelt, Dimitri; Murray-Hudson, Mike; Meire, Patrick; Frings, Patrick; Schoelynck, Jonas; Gondwé, Mangaliso; Wolski, Piotr; Conley, Daniel

    2015-04-01

    We assessed the role of vegetation and hydrology in the Si cycle in the Okavango Delta (Botswana). Our results show a large storage of biogenic Si (BSi) in vegetation and the sediments. The biological storage is among the highest observed so far for any ecosystem worldwide. Floodplain vegetation accumulates similar amounts of BSi in both the temporary floodplains and the permanent floodplains, with most values observed between 20-100 g Si m-2. This vegetation Si, after litterfall, contributes to a large biogenic Si storage in the sediments. In temporary floodplains, sediments contain less BSi (375 -1950 g Si m-2 in the top 5 cm) than in the permanent floodplains (1950 - 3600 g Si m-2 in the top 5 cm). BSi concentrations in the floodplain sediments decline exponentially indicating rapid dissolution. In the occasional and seasonal floodplains, unidirectional solute transfer from floodplains to tree covered islands removes Si from the riverine systems. The hydrology of many tropical wetlands is undergoing major changes due to human alteration of river morphology and watersheds. Model predictions also project substantial future changes in hydrology and climate . This will have implications for flooding extent and seasonality, factors that may induce changes in Si storage in the Okavango Delta. Recently, annual BSi uptake in global vegetation was estimated at about 85 Tmole. Of this, the total surface of wetlands worldwide contributes approximately 4.16 Tmole a-1. Our conservative vegetation BSi production estimate of 0.02 Tmole of Si a-1 would represent about 0.4% of total annual uptake in wetland vegetation worldwide within the Okavango Delta alone, despite it covering only about 0.1% of global wetland area. Tropical rivers deliver about 70-80% of the global Si load into the ocean , implying it is crucial to assess environmental factors that can influence its transport. Our data and the limited available literature data available clearly show that wetlands and

  6. Exploration for the Biological Control of Flowering Rush, Butomus umbellatus

    Science.gov (United States)

    2015-06-01

    mid- May and early August onto about 70 potted flowering rush plants covered with gauze bags. An additional 66 adults were kept for oviposition on 17... flowering rush plants . Ten replicates were established per density. Only egg laying females were used. Prior to set up plant size was measured and it...maintained flowering rush and test plants . Finally, we are very grateful to Jennifer Andreas (Integrated Weed Control Project, Washington State

  7. Biological control of Verticillium dahliae by Talaromyces flavus

    OpenAIRE

    Nagtzaam, M.P.M.

    1998-01-01

    Verticillium dahliae causes vascular wilt in a wide range of host plants. Control of Verticillium wilt is by soil disinfestation and to a lesser extent by crop rotation or, for a few host plants, by growing resistant varieties. For environmental reasons, the development of alternatives to chemical soil disinfestation is being sought. Biocontrol by microbial agents is one of the options. The potential of Talaromyces flavus as a biocontrol agen...

  8. Can Flowering Greencover Crops Promote Biological Control in German Vineyards?

    OpenAIRE

    Hoffmann, Christoph; Köckerling, Janine; Biancu, Sandra; Gramm, Thomas; Michl, Gertraud; Entling, Martin H.

    2017-01-01

    Greencover crops are widely recommended to provide predators and parasitoids with floral resources for improved pest control. We studied parasitism and predation of European grapevine moth (Lobesia botrana) eggs and pupae as well as predatory mite abundances in an experimental vineyard with either one or two sowings of greencover crops compared to spontaneous vegetation. The co-occurrence between greencover flowering time and parasitoid activity differed greatly between the two study years. P...

  9. Computational Biomathematics: Toward Optimal Control of Complex Biological Systems

    Science.gov (United States)

    2016-09-26

    Pareto optimization. In general, genetic algorithms returned the best results in most cases. Pareto optimization is a means of multi-objective...optimization, wherein one does not have to determine a cost function ahead of time, but rather only specify the variables of interest. For example, if we...wish to determine a controller that reduces cost and maximizes efficiency, Pareto optimization allows us to conduct a search without specifying

  10. Use of isotopes for research and control of vectors of animal diseases, host-pathogen relationships and the environmental impact of control procedures

    International Nuclear Information System (INIS)

    1979-01-01

    Full text: To cope with the world-wide problems of famine, malnutrition and environmental pollution it is imperative that all techniques and resources for the protection of animals and plants be utilized. As an example, nagana alone (animal trypanosomiasis) profoundly affects socioeconomic development in Africa. Its vector, the tsetse fly, is widespread and prevents agricultural development over much of the more than 7 million square kilometres where it is present. The need to control this disease has been emphasized by a mandate from the 1974 World Food Conference of the United Nations. If this disease alone could be eliminated, the cattle population could be increased by at least 120 million head with a resultant yearly increase in meat production of 1.5 million tons having a value totalling 750 million US dollars. The symposium was convened to discuss the various research and control aspects of nagana and related diseases and was the first of its kind to be convened by the sponsoring organizations The symposium amply demonstrated the value and usefulness of isotopes in the research and control of vectors of animal diseases, the elucidation of host-pathogen relationships and the degradation of pesticides. The symposium received an enthusiastic response, reflected in the large number of papers presented, which covered a variety of topics, including the sterile insect technique (SIT) as applied to tsetse flies. Several papers were presented covering its different aspects such as mass-rearing, sterility induction, ecology, behaviour and computer modelling. Other topics emphasized were pathogenesis and immunology of vector borne diseases such as trypanosomiasis, anaplasmosis, babesiosis and leishmaniasis. Also included were presentations on insect repellents and the biotransformation and degradation of labelled pesticides. The technical sessions began with 3 review papers, one on the FAO Animal Health Division's field research on tsetse flies, the second on the

  11. Parasitoids of Queensland Fruit Fly Bactrocera tryoni in Australia and Prospects for Improved Biological Control

    Directory of Open Access Journals (Sweden)

    Olivia L. Reynolds

    2012-10-01

    Full Text Available This review draws together available information on the biology, methods for study, and culturing of hymenopteran parasitoids of the Queensland fruit fly, Bactrocera tryoni, and assesses prospects for improving biological control of this serious pest. Augmentative release of the native and naturalised Australian parasitoids, especially the braconid Diachasmimorpha tryoni, may result in better management of B. tryoni in some parts of Australia. Mass releases are an especially attractive option for areas of inland eastern Australia around the Fruit Fly Exclusion Zone that produces B. tryoni-free fruits for export. Diachasmimorpha tryoni has been successful in other locations such as Hawaii for the biological control of other fruit fly species. Biological control could contribute to local eradication of isolated outbreaks and more general suppression and/or eradication of the B. tryoni population in endemic areas. Combining biological control with the use of sterile insect technique offers scope for synergy because the former is most effective at high pest densities and the latter most economical when the pest becomes scarce. Recommendations are made on methods for culturing and study of four B. tryoni parasitoids present in Australia along with research priorities for optimising augmentative biological control of B. tryoni.

  12. Parasitoids of Queensland Fruit Fly Bactrocera tryoni in Australia and Prospects for Improved Biological Control.

    Science.gov (United States)

    Zamek, Ashley L; Spinner, Jennifer E; Micallef, Jessica L; Gurr, Geoff M; Reynolds, Olivia L

    2012-10-22

    This review draws together available information on the biology, methods for study, and culturing of hymenopteran parasitoids of the Queensland fruit fly, Bactrocera tryoni, and assesses prospects for improving biological control of this serious pest. Augmentative release of the native and naturalised Australian parasitoids, especially the braconid Diachasmimorpha tryoni, may result in better management of B. tryoni in some parts of Australia. Mass releases are an especially attractive option for areas of inland eastern Australia around the Fruit Fly Exclusion Zone that produces B. tryoni-free fruits for export. Diachasmimorpha tryoni has been successful in other locations such as Hawaii for the biological control of other fruit fly species. Biological control could contribute to local eradication of isolated outbreaks and more general suppression and/or eradication of the B. tryoni population in endemic areas. Combining biological control with the use of sterile insect technique offers scope for synergy because the former is most effective at high pest densities and the latter most economical when the pest becomes scarce. Recommendations are made on methods for culturing and study of four B. tryoni parasitoids present in Australia along with research priorities for optimising augmentative biological control of B. tryoni.

  13. Targeting the Mitochondrial Respiratory Chain of Cryptococcus through Antifungal Chemosensitization: A Model for Control of Non-Fermentative Pathogens

    Directory of Open Access Journals (Sweden)

    Kathleen L. Chan

    2013-07-01

    Full Text Available Enhanced control of species of Cryptococcus, non-fermentative yeast pathogens, was achieved by chemosensitization through co-application of certain compounds with a conventional antimicrobial drug. The species of Cryptococcus tested showed higher sensitivity to mitochondrial respiratory chain (MRC inhibition compared to species of Candida. This higher sensitivity results from the inability of Cryptococcus to generate cellular energy through fermentation. To heighten disruption of cellular MRC, octyl gallate (OG or 2,3-dihydroxybenzaldehyde (2,3-DHBA, phenolic compounds inhibiting mitochondrial functions, were selected as chemosensitizers to pyraclostrobin (PCS; an inhibitor of complex III of MRC. The cryptococci were more susceptible to the chemosensitization (i.e., PCS + OG or 2,3-DHBA than the Candida with all Cryptococcus strains tested being sensitive to this chemosensitization. Alternatively, only few of the Candida strains showed sensitivity. OG possessed higher chemosensitizing potency than 2,3-DHBA, where the concentration of OG required with the drug to achieve chemosensitizing synergism was much lower than that required of 2,3-DHBA. Bioassays with gene deletion mutants of the model yeast Saccharomyces cerevisiae showed that OG or 2,3-DHBA affect different cellular targets. These assays revealed mitochondrial superoxide dismutase or glutathione homeostasis plays a relatively greater role in fungal tolerance to 2,3-DHBA or OG, respectively. These findings show that application of chemosensitizing compounds that augment MRC debilitation is a promising strategy to antifungal control against yeast pathogens.

  14. Can Flowering Greencover Crops Promote Biological Control in German Vineyards?

    Directory of Open Access Journals (Sweden)

    Christoph Hoffmann

    2017-11-01

    Full Text Available Greencover crops are widely recommended to provide predators and parasitoids with floral resources for improved pest control. We studied parasitism and predation of European grapevine moth (Lobesia botrana eggs and pupae as well as predatory mite abundances in an experimental vineyard with either one or two sowings of greencover crops compared to spontaneous vegetation. The co-occurrence between greencover flowering time and parasitoid activity differed greatly between the two study years. Parasitism was much higher when flowering and parasitoid activity coincided. While egg predation was enhanced by greencover crops, there were no significant benefits of greencover crops on parasitism of L. botrana eggs or pupae. Predatory mites did not show an as strong increase on grapevines in greencover crop plots as egg predation. Overall, our study demonstrates only limited pest control benefits of greencover crops. Given the strong within- and between year variation in natural enemy activity, studies across multiple years will be necessary to adequately describe the role of greencover crops for pest management and to identify the main predators of L. botrana eggs.

  15. Impact of waning acquired immunity and asymptomatic infections on case-control studies for enteric pathogens

    NARCIS (Netherlands)

    Havelaar, Arie H; Swart, Arno

    2016-01-01

    Case-control studies of outbreaks and of sporadic cases of infectious diseases may provide a biased estimate of the infection rate ratio, due to selecting controls that are not at risk of disease. We use a dynamic mathematical model to explore biases introduced in results drawn from case-control

  16. Dynamics of introduced populations of Phragmidium violaceum and implications for biological control of European blackberry in Australia.

    Science.gov (United States)

    Gomez, D R; Evans, K J; Baker, J; Harvey, P R; Scott, E S

    2008-09-01

    Phragmidium violaceum causes leaf rust on the European blackberry (Rubus fruticosus L. aggregate). Multiple strains of this pathogen have been introduced into southern Australia for the biological control of at least 15 taxa of European blackberry, a nonindigenous, invasive plant. In climates conducive to leaf rust, the intensity of disease varies within and among infestations of the genetically variable host. Genetic markers developed from the selective amplification of microsatellite polymorphic loci were used to assess the population genetic structure and reproductive biology of P. violaceum within and among four geographically isolated and diseased infestations of the European blackberry in Victoria, Australia. Despite the potential for long-distance aerial dispersal of urediniospores, there was significant genetic differentiation among all populations, which was not associated with geographic separation. An assessment of multilocus linkage disequilibrium revealed temporal and geographic variation in the occurrence of random mating among the four populations. The presence of sexual spore states and the results of genetic analyses indicated that recombination, and potentially random migration and genetic drift, played an important role in maintaining genotypic variation within populations. Recombination and genetic differentiation in P. violaceum, as well as the potential for metapopulation structure, suggest the need to release additional, genetically diverse strains of the biocontrol agent at numerous sites across the distribution of the Australian blackberry infestation for maximum establishment and persistence.

  17. Dynamics of Introduced Populations of Phragmidium violaceum and Implications for Biological Control of European Blackberry in Australia▿

    Science.gov (United States)

    Gomez, D. R.; Evans, K. J.; Baker, J.; Harvey, P. R.; Scott, E. S.

    2008-01-01

    Phragmidium violaceum causes leaf rust on the European blackberry (Rubus fruticosus L. aggregate). Multiple strains of this pathogen have been introduced into southern Australia for the biological control of at least 15 taxa of European blackberry, a nonindigenous, invasive plant. In climates conducive to leaf rust, the intensity of disease varies within and among infestations of the genetically variable host. Genetic markers developed from the selective amplification of microsatellite polymorphic loci were used to assess the population genetic structure and reproductive biology of P. violaceum within and among four geographically isolated and diseased infestations of the European blackberry in Victoria, Australia. Despite the potential for long-distance aerial dispersal of urediniospores, there was significant genetic differentiation among all populations, which was not associated with geographic separation. An assessment of multilocus linkage disequilibrium revealed temporal and geographic variation in the occurrence of random mating among the four populations. The presence of sexual spore states and the results of genetic analyses indicated that recombination, and potentially random migration and genetic drift, played an important role in maintaining genotypic variation within populations. Recombination and genetic differentiation in P. violaceum, as well as the potential for metapopulation structure, suggest the need to release additional, genetically diverse strains of the biocontrol agent at numerous sites across the distribution of the Australian blackberry infestation for maximum establishment and persistence. PMID:18641150

  18. Investigating Biological Control Agents for Controlling Invasive Populations of the Mealybug Pseudococcus comstocki in France.

    Science.gov (United States)

    Malausa, Thibaut; Delaunay, Mathilde; Fleisch, Alexandre; Groussier-Bout, Géraldine; Warot, Sylvie; Crochard, Didier; Guerrieri, Emilio; Delvare, Gérard; Pellizzari, Giuseppina; Kaydan, M Bora; Al-Khateeb, Nadia; Germain, Jean-François; Brancaccio, Lisa; Le Goff, Isabelle; Bessac, Melissa; Ris, Nicolas; Kreiter, Philippe

    2016-01-01

    Pseudococcus comstocki (Hemiptera: Pseudococcidae) is a mealybug species native to Eastern Asia and present as an invasive pest in northern Italy and southern France since the start of the century. It infests apple and pear trees, grapevines and some ornamental trees. Biocontrol programmes against this pest proved successful in central Asia and North America in the second half of the 20th century. In this study, we investigated possible biocontrol agents against P. comstocki, with the aim of developing a biocontrol programme in France. We carried out systematic DNA-barcoding at each step in the search for a specialist parasitoid. First we characterised the French target populations of P. comstocki. We then identified the parasitoids attacking P. comstocki in France. Finally, we searched for foreign mealybug populations identified a priori as P. comstocki and surveyed their hymenopteran parasitoids. Three mealybug species (P. comstocki, P. viburni and P. cryptus) were identified during the survey, together with at least 16 different parasitoid taxa. We selected candidate biological control agent populations for use against P. comstocki in France, from the species Allotropa burrelli (Hymenoptera: Platygastridae) and Acerophagus malinus (Hymenoptera: Encyrtidae). The coupling of molecular and morphological characterisation for both pests and natural enemies facilitated the programme development and the rejection of unsuitable or generalist parasitoids.

  19. Investigating Biological Control Agents for Controlling Invasive Populations of the Mealybug Pseudococcus comstocki in France.

    Directory of Open Access Journals (Sweden)

    Thibaut Malausa

    Full Text Available Pseudococcus comstocki (Hemiptera: Pseudococcidae is a mealybug species native to Eastern Asia and present as an invasive pest in northern Italy and southern France since the start of the century. It infests apple and pear trees, grapevines and some ornamental trees. Biocontrol programmes against this pest proved successful in central Asia and North America in the second half of the 20th century. In this study, we investigated possible biocontrol agents against P. comstocki, with the aim of developing a biocontrol programme in France. We carried out systematic DNA-barcoding at each step in the search for a specialist parasitoid. First we characterised the French target populations of P. comstocki. We then identified the parasitoids attacking P. comstocki in France. Finally, we searched for foreign mealybug populations identified a priori as P. comstocki and surveyed their hymenopteran parasitoids. Three mealybug species (P. comstocki, P. viburni and P. cryptus were identified during the survey, together with at least 16 different parasitoid taxa. We selected candidate biological control agent populations for use against P. comstocki in France, from the species Allotropa burrelli (Hymenoptera: Platygastridae and Acerophagus malinus (Hymenoptera: Encyrtidae. The coupling of molecular and morphological characterisation for both pests and natural enemies facilitated the programme development and the rejection of unsuitable or generalist parasitoids.

  20. A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

    Science.gov (United States)

    Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

    2015-04-24

    disease that has become an important public health problem. Traditional serological methods are the gold standard for the detection of pathogenic strains of Leptospira. However, serological procedures are cumbersome, require more complex experimental techniques, and are based on a large number of international and domestic reference strains. Additionally, these experiments involve the immunization of animals with antigens from different serotypes to produce immune serum, and improper techniques may result in a rapid decrease in antibody titer, which would affect the final results. It is difficult to perform cumbersome detection procedures in a basic laboratory. Therefore, the use of conventional serological methods is limited, which significantly impacts daily leptospirosis epidemic surveillance, prevention, and control. Molecular biology methods, such as 16S rRNA and PCR-based methods, can be used to identify the pathogenic Leptospira. However, DNA extraction and gene sequencing methods are laborious and time consuming. Therefore, more rapid and reliable high-throughput identification methods are urgently needed for the clinical diagnosis of leptospirosis to improve epidemic control. Here, molecular fingerprinting technique was use to identify the pathogenicity. We constructed the reference spectra database and the super reference spectra of pathogenic and non-pathogenic Leptospira, which can rapidly identified Leptospira at the species level and the pathogenicity of these isolates can be simultaneously confirmed. Furthermore, the protein components of Leptospira pathogenicity were revealed. These findings thus provide a new way for Leptospira pathogenicity identification. Copyright © 2014. Published by Elsevier B.V.

  1. Predator interference effects on biological control: The "paradox" of the generalist predator revisited

    Science.gov (United States)

    Parshad, Rana D.; Bhowmick, Suman; Quansah, Emmanuel; Basheer, Aladeen; Upadhyay, Ranjit Kumar

    2016-10-01

    An interesting conundrum in biological control questions the efficiency of generalist predators as biological control agents. Theory suggests, generalist predators are poor agents for biological control, primarily due to mutual interference. However field evidence shows they are actually quite effective in regulating pest densities. In this work we provide a plausible answer to this paradox. We analyze a three species model, where a generalist top predator is introduced into an ecosystem as a biological control, to check the population of a middle predator, that in turn is depredating on a prey species. We show that the inclusion of predator interference alone, can cause the solution of the top predator equation to blow-up in finite time, while there is global existence in the no interference case. This result shows that interference could actually cause a population explosion of the top predator, enabling it to control the target species, thus corroborating recent field evidence. Our results might also partially explain the population explosion of certain species, introduced originally for biological control purposes, such as the cane toad (Bufo marinus) in Australia, which now functions as a generalist top predator. We also show both Turing instability and spatio-temporal chaos in the model. Lastly we investigate time delay effects.

  2. Bacterial antagonists of fungal pathogens also control root-knot nematodes by induced systemic resistance of tomato plants.

    Science.gov (United States)

    Adam, Mohamed; Heuer, Holger; Hallmann, Johannes

    2014-01-01

    The potential of bacterial antagonists of fungal pathogens to control the root-knot nematode Meloidogyne incognita was investigated under greenhouse conditions. Treatment of tomato seeds with several strains significantly reduced the numbers of galls and egg masses compared with the untreated control. Best performed Bacillus subtilis isolates Sb4-23, Mc5-Re2, and Mc2-Re2, which were further studied for their mode of action with regard to direct effects by bacterial metabolites or repellents, and plant mediated effects. Drenching of soil with culture supernatants significantly reduced the number of egg masses produced by M. incognita on tomato by up to 62% compared to the control without culture supernatant. Repellence of juveniles by the antagonists was shown in a linked twin-pot set-up, where a majority of juveniles penetrated roots on the side without inoculated antagonists. All tested biocontrol strains induced systemic resistance against M. incognita in tomato, as revealed in a split-root system where the bacteria and the nematodes were inoculated at spatially separated roots of the same plant. This reduced the production of egg masses by up to 51%, while inoculation of bacteria and nematodes in the same pot had only a minor additive effect on suppression of M. incognita compared to induced systemic resistance alone. Therefore, the plant mediated effect was the major reason for antagonism rather than direct mechanisms. In conclusion, the bacteria known for their antagonistic potential against fungal pathogens also suppressed M. incognita. Such "multi-purpose" bacteria might provide new options for control strategies, especially with respect to nematode-fungus disease complexes that cause synergistic yield losses.

  3. Biology and control of swamp dodder (Cuscuta gronovii)

    International Nuclear Information System (INIS)

    Bewick, T.A.

    1987-01-01

    A simple model predicting swamp dodder (Cuscuta gronovii Willd.) emergence was developed. The model states that 0.1% of the cranberry seedlings will emerge after 150 to 170 GDD have accumulated after the winter ice has melted on the cranberry beds, using 0 C as the low temperature threshold. Experiments in cranberry showed that pronamide [3,5-dichloro-(N-1,1-dimethyl-2-propynyl)benzamide] was effective in controlling swamp dodder when applied preemergence. Rates below 2.4 kg ai/ha appeared to be safe for cranberry plants and fruit. Experiments with 14 C glyphosate showed that the herbicide moved out of carrot leaves to the physiological sinks in the plant. In carrots parasitized by swamp dodder the dodder acted as one of the strongest sinks for photosynthates from the host. In cranberry glyphosate moved out of the leaves, but most remained in the stem to which the treated leaves were attached. The only physiological sinks that accumulated significant amounts of label were the stem apices. The concentration of the herbicide in this sink decreased with time. Swamp dodder stems were able to absorb glyphosate directly from solution

  4. Spider Communities and Biological Control in Native Habitats Surrounding Greenhouses

    Directory of Open Access Journals (Sweden)

    Belén Cotes

    2018-03-01

    Full Text Available The promotion of native vegetation as a habitat for natural enemies, which could increase their abundance and fitness, is especially useful in highly simplified settings such as Mediterranean greenhouse landscapes. Spiders as generalist predators may also be involved in intra-guild predation. However, the niche complementarity provided by spiders as a group means that increased spider diversity may facilitate complementary control actions. In this study, the interactions between spiders, the two major horticultural pests, Bemisia tabaci and Frankliniella occidentalis, and their naturally occurring predators and parasitoids were evaluated in a mix of 21 newly planted shrubs selected for habitat management in a highly disturbed horticultural system. The effects of all factors were evaluated using redundancy analysis (RDA and the generalized additive model (GAM to assess the statistical significance of abundance of spiders and pests. The GAM showed that the abundance of both pests had a significant effect on hunter spider’s abundance, whereas the abundance of B. tabaci, but not F. occidentalis, affected web-weavers’ abundance. Ordination analysis showed that spider abundance closely correlated with that of B. tabaci but not with that of F. occidentalis, suggesting that complementarity occurs, and thereby probability of biocontrol, with respect to the targeted pest B. tabaci, although the temporal patterns of the spiders differed from those of F. occidentalis. Conservation strategies involving the establishment of these native plants around greenhouses could be an effective way to reduce pest populations outdoors.

  5. Incorporation of essential oils and nanoparticles in pullulan films to control foodborne pathogens on meat and poultry products.

    Science.gov (United States)

    Morsy, Mohamed K; Khalaf, Hassan H; Sharoba, Ashraf M; El-Tanahi, Hassan H; Cutter, Catherine N

    2014-04-01

    The incorporation of essential oils and nanotechnology into edible films has the potential to improve the microbiological safety of foods. The aim of this study was to evaluate the effectiveness of pullulan films containing essential oils and nanoparticles against 4 foodborne pathogens. Initial experiments using plate overlay assays demonstrated that 2% oregano essential oil was active against Staphylococcus aureus and Salmonella Typhimurium, whereas Listeria monocytogenes and Escherichia coli O157:H7 were not inhibited. Two percent rosemary essential oil was active against S. aureus, L. monocytogenes, E. coli O157:H7, and S. Typhimurium, when compared with 1%. Zinc oxide nanoparticles at 110 nm were active against S. aureus, L. monocytogenes, E. coli O157:H7, and S. Typhimurium, when compared with 100 or 130 nm. Conversely, 100 nm silver (Ag) nanoparticles were more active against S. aureus than L. monocytogenes. Using the results from these experiments, the compounds exhibiting the greatest activity were incorporated into pullulan films and found to inhibit all or some of the 4 pathogens in plate overlay assays. In challenge studies, pullulan films containing the compounds effectively inhibited the pathogens associated with vacuum packaged meat and poultry products stored at 4 °C for up to 3 wk, as compared to control films. Additionally, the structure and cross-section of the films were evaluated using electron microscopy. The results from this study demonstrate that edible films made from pullulan and incorporated with essential oils or nanoparticles may improve the safety of refrigerated, fresh or further processed meat and poultry products. © 2014 Institute of Food Technologists®

  6. Control biológico del entrenamiento de resistencia. Biological control of endurance training.

    Directory of Open Access Journals (Sweden)

    González Gross, Marcela

    2006-01-01

    Full Text Available ResumenLa alta exigencia en los deportistas de elite hace cada vez más necesario controlar el proceso de adaptación al entrenamiento. El objetivo de esta revisión es analizar la información biológica de un análisis de sangre, al objeto de obtener información de la carga de entrenamiento en atletas de resistencia. La mayor parte de los parámetros sanguíneos han sido empleados, más que para determinar el proceso del entrenamiento, precisamente, para lo opuesto: el sobreentrenamiento. La concentración en plasma de sustratos metabólicos (glucosa y ácidos grasos no son parámetros que pueda utilizarse para controlar el entrenamiento, debido a las bajas especificidad y sensibilidad. No obstante, la concentración de determinados enzimas que intervienen en la utilización de los sustratos puede ser importante. Valores de creatín kinasa superiores a 200 U/l en una persona sana sugiere claramente que la carga de entrenamiento total de una determinada sesión ha sido elevada. La concentración en plasma de algún producto de degradación del catabolismo también puede señalar la adaptación del organismo al entrenamiento. La concentración de ácido láctico en plasma es la herramienta más común en la valoración de la carga de entrenamiento. La concentración de urea es un buen marcador biológico de la carga de entrenamiento. Valores superiores a 8 mmol/l en varones y de 6,5 mmol/l en mujeres, indican que el entrenamiento ha sido muy intenso. La determinación de otros productos (amonio o sustratos (glutamina se han utilizado para detectar el sobreentrenamiento.AbstractThe high exigency in the elite sportsmen does more necessary to control the process of training adaptation. The purpose of this review is to analyze the biological information of a blood analysis to obtain data of load training in endurance athletes. Most blood parameters has been used to evaluate the overtraining state instead of determining the training process. The

  7. UV-Heat Treatments for the Control of Foodborne Microbial Pathogens in Chicken Broth

    Directory of Open Access Journals (Sweden)

    M. Gouma

    2015-01-01

    Full Text Available This investigation established the process criteria for using UV-C light and mild heat (UV-H treatment to inactivate 5-Log10 cycles (performance criterion of common foodborne pathogen populations, Escherichia coli, Salmonella Typhimurium, Listeria monocytogenes, and Staphylococcus aureus, when inoculated in chicken broth. To define the target microorganism and the proper UV-H treatment conditions (including UV dose, treatment time, and temperature that would achieve the stated performance criterion, mathematical equations based on Geeraerd’s model were developed for each microorganism. For the sake of comparison, inactivation equations for heat treatments were also performed on the same chicken broth and for the same microorganisms. L. monocytogenes was the most UV-H resistant microorganism at all temperatures, requiring a UV dose between 6.10 J/mL (5.6 min and 2.26 J/mL (2.09 min to achieve 5-Log10 reductions. In comparison with UV treatments at room temperatures, the combination of UV and mild heat allowed both the UV dose and treatment time to be reduced by 30% and 63% at 55°C and 60°C, respectively. Compared to heat treatments, the UV-H process reduced the heating time for 5-Log10 reductions of all the investigated microorganisms in chicken broth from 20-fold to 2-fold when the operating temperature varied from 53 to 60°C.

  8. Biologically inspired control of humanoid robot arms robust and adaptive approaches

    CERN Document Server

    Spiers, Adam; Herrmann, Guido

    2016-01-01

    This book investigates a biologically inspired method of robot arm control, developed with the objective of synthesising human-like motion dynamically, using nonlinear, robust and adaptive control techniques in practical robot systems. The control method caters to a rising interest in humanoid robots and the need for appropriate control schemes to match these systems. Unlike the classic kinematic schemes used in industrial manipulators, the dynamic approaches proposed here promote human-like motion with better exploitation of the robot’s physical structure. This also benefits human-robot interaction. The control schemes proposed in this book are inspired by a wealth of human-motion literature that indicates the drivers of motion to be dynamic, model-based and optimal. Such considerations lend themselves nicely to achievement via nonlinear control techniques without the necessity for extensive and complex biological models. The operational-space method of robot control forms the basis of many of the techniqu...

  9. Candidate predators for biological control of the poultry red mite Dermanyssus gallinae

    NARCIS (Netherlands)

    Lesna, I.; Wolfs, P.; Faraji, F.; Roy, L.; Komdeur, J.; Sabelis, M.W.

    2009-01-01

    The poultry red mite, Dermanyssus gallinae, is currently a significant pest in the poultry industry in Europe. Biological control by the introduction of predatory mites is one of the various options for controlling poultry red mites. Here, we present the first results of an attempt to identify

  10. Candidate predators for biological control of the poultry red mite Dermanyssus gallinae

    NARCIS (Netherlands)

    Lesna, Izabela; Wolfs, Peter; Faraji, Farid; Roy, Lise; Komdeur, Jan; Sabelis, Maurice W.

    The poultry red mite, Dermanyssus gallinae, is currently a significant pest in the poultry industry in Europe. Biological control by the introduction of predatory mites is one of the various options for controlling poultry red mites. Here, we present the first results of an attempt to identify

  11. Hybridization between a native and introduced predator of Adelgidae: An unintended result of classical biological control

    Science.gov (United States)

    N.P. Havill; Gina Davis; David Mausel; Joanne Klein; Richard McDonald; Cera Jones; Melissa Fischer; Scott Salom; Adelgisa. Caccone

    2012-01-01

    Hybridization between introduced biological control agents and native species has the potential to impact native biodiversity and pest control efforts. This study reports progress towards predicting the outcome of hybridization between two beetle species, the introduced Laricobius nigrinus Fender and the native L. rubidus LeConte...

  12. Costs and benefits of biological control of invasive alien plants: case studies from South Africa

    CSIR Research Space (South Africa)

    Van Wilgen, BW

    2004-01-01

    Full Text Available . In many cases, plants are brought under complete control. In this paper, we describe an attempt to estimate the costs and benefits of the biological control of 6 weed species (Opuntia, aurantiaca, Sesbania punicea, Lantana camara, Acacia longifolia, A...

  13. Reliability of pathogen control in direct potable reuse: Performance evaluation and QMRA of a full-scale 1 MGD advanced treatment train.

    Science.gov (United States)

    Pecson, Brian M; Triolo, Sarah C; Olivieri, Simon; Chen, Elise C; Pisarenko, Aleksey N; Yang, Chao-Chun; Olivieri, Adam; Haas, Charles N; Trussell, R Shane; Trussell, R Rhodes

    2017-10-01

    To safely progress toward direct potable reuse (DPR), it is essential to ensure that DPR systems can provide public health protection equivalent to or greater than that of conventional drinking water sources. This study collected data over a one-year period from a full-scale DPR demonstration facility, and used both performance distribution functions (PDFs) and quantitative microbial risk assessment (QMRA) to define and evaluate the reliability of the advanced water treatment facility (AWTF). The AWTF's ability to control enterovirus, Giardia, and Cryptosporidium was characterized using online monitoring of surrogates in a treatment train consisting of ozone, biological activated carbon, microfiltration, reverse osmosis, and ultraviolet light with an advanced oxidation process. This process train was selected to improve reliability by providing redundancy, defined as the provision of treatment beyond the minimum needed to meet regulatory requirements. The PDFs demonstrated treatment that consistently exceeded the 12/10/10-log thresholds for virus, Giardia, and Cryptosporidium, as currently required for potable reuse in California (via groundwater recharge and surface water augmentation). Because no critical process failures impacted pathogen removal performance during the yearlong testing, hypothetical failures were incorporated into the analysis to understand the benefit of treatment redundancy on performance. Each unit process was modeled with a single failure per year lasting four different failure durations: 15 min, 60 min, 8 h, and 24 h. QMRA was used to quantify the impact of failures on pathogen risk. The median annual risk of infection for Cryptosporidium was 4.9 × 10 -11 in the absence of failures, and reached a maximum of 1.1 × 10 -5 assuming one 24-h failure per process per year. With the inclusion of free chlorine disinfection as part of the treatment process, enterovirus had a median annual infection risk of 1.5 × 10 -14 (no failures) and

  14. 9 CFR 310.25 - Contamination with microorganisms; process control verification criteria and testing; pathogen...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Contamination with microorganisms... CERTIFICATION POST-MORTEM INSPECTION § 310.25 Contamination with microorganisms; process control verification... controls sufficient to prevent fecal contamination. FSIS shall take further action as appropriate to ensure...

  15. labelling and quality control of some 99m Tc-radiopharmaceuticals of expected biological activity

    International Nuclear Information System (INIS)

    Abdallah, A.B.I.

    2009-01-01

    this thesis addresses the labelling and quality control of some 99m Tc-radiopharmaceuticals which could be used for infection imaging. this study focuses on the labelling of sarafloxation, gatifloxation and cefepine with technetium-99m and biological evaluation of these labeled complexes and biodistribution in both normal and inflamed mice. the thesis is organized into two chapters: chapter I :labelling of some antibiotics chapter II :biological evaluation.

  16. Parasitoids of Queensland Fruit Fly Bactrocera tryoni in Australia and Prospects for Improved Biological Control

    OpenAIRE

    Zamek, Ashley L.; Spinner, Jennifer E.; Micallef, Jessica L.; Gurr, Geoff M.; Reynolds, Olivia L.

    2012-01-01

    This review draws together available information on the biology, methods for study, and culturing of hymenopteran parasitoids of the Queensland fruit fly, Bactrocera tryoni, and assesses prospects for improving biological control of this serious pest. Augmentative release of the native and naturalised Australian parasitoids, especially the braconid Diachasmimorpha tryoni, may result in better management of B. tryoni in some parts of Australia. Mass releases are an especially attractive option...

  17. NFP, a LysM protein controlling Nod factor perception, also intervenes in Medicago truncatula resistance to pathogens.

    Science.gov (United States)

    Rey, Thomas; Nars, Amaury; Bonhomme, Maxime; Bottin, Arnaud; Huguet, Stéphanie; Balzergue, Sandrine; Jardinaud, Marie-Françoise; Bono, Jean-Jacques; Cullimore, Julie; Dumas, Bernard; Gough, Clare; Jacquet, Christophe

    2013-05-01

    Plant LysM proteins control the perception of microbial-derived N-acetylglucosamine compounds for the establishment of symbiosis or activation of plant immunity. This raises questions about how plants, and notably legumes, can differentiate friends and foes using similar molecular actors and whether any receptors can intervene in both symbiosis and resistance. To study this question, nfp and lyk3 LysM-receptor like kinase mutants of Medicago truncatula that are affected in the early steps of nodulation, were analysed following inoculation with Aphanomyces euteiches, a root oomycete. The role of NFP in this interaction was further analysed by overexpression of NFP and by transcriptome analyses. nfp, but not lyk3, mutants were significantly more susceptible than wildtype plants to A. euteiches, whereas NFP overexpression increased resistance. Transcriptome analyses on A. euteiches inoculation showed that mutation in the NFP gene led to significant changes in the expression of c. 500 genes, notably involved in cell dynamic processes previously associated with resistance to pathogen penetration. nfp mutants also showed an increased susceptibility to the fungus Colletotrichum trifolii. These results demonstrate that NFP intervenes in M. truncatula immunity, suggesting an unsuspected role for NFP in the perception of pathogenic signals. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  18. Control of highly pathogenic avian influenza in Quang Tri province, Vietnam: voices from the human-animal interface.

    Science.gov (United States)

    Farrell, Penny C; Hunter, Cynthia; Truong, Bui; Bunning, Michel

    2015-01-01

    Highly pathogenic avian influenza (HPAI) is caused by the haemagglutinin 5, neuraminidase 1 (H5N1) influenza A virus. Around 80% of households in rural Vietnam raise poultry, which provides food security and nutrition to their households and beyond. Of these, around 15-20% are semi-commercial producers, producing at least 28% of the country's chicken. Through learning the experiences of these semi-commercial farmers, this study aimed to explore the local understandings and sociocultural aspects of HPAI's impact, particularly the aetiology, diagnosis, and the prevention and control methods in one Vietnamese rural province. This study was conducted in Quang Tri province, Vietnam. Quang Tri province has eight districts. Five of these districts were at high risk of HPAI during the study period, of which three were selected for the present study. Within these three districts, six communes were randomly selected for the study from the list of intervention communes in Quang Tri province. Six out of the 26 intervention communes in Quang Tri were therefore selected. Participants were randomly selected and recruited from lists of semi-commercial farmers, village animal health workers, village human health workers and local authorities so that the study population (representative population) included an amount of variability similar to that of the wider population. A key benefit of this village-level control program was the residential proximity of animal and human health professionals. Participants were well aware of the typical clinical signs for avian influenza and of the reporting process for suspect cases. However there was extensive room for improvement in Quang Tri province regarding access to the HPAI vaccine, essential medical equipment for animal use, and available financial support. This qualitative research study provided an important insight for in-country policy makers and international stakeholders. It is vital that there are continued efforts to prevent and

  19. Pythium invasion of plant-based life support systems: biological control and sources

    Science.gov (United States)

    Jenkins, D. G.; Cook, K. L.; Garland, J. L.; Board, K. F.; Sager, J. C. (Principal Investigator)

    2000-01-01

    Invasion of plant-based life support systems by plant pathogens could cause plant disease and disruption of life support capability. Root rot caused by the fungus, Pythium, was observed during tests of prototype plant growth systems containing wheat at the Kennedy Space Center (KSC). We conducted experiments to determine if the presence of complex microbial communities in the plant root zone (rhizosphere) resisted invasion by the Pythium species isolated from the wheat root. Rhizosphere inocula of different complexity (as assayed by community-level physiological profile: CLPP) were developed using a dilution/extinction approach, followed by growth in hydroponic rhizosphere. Pythium growth on wheat roots and concomitant decreases in plant growth were inversely related to the complexity of the inocula during 20-day experiments in static hydroponic systems. Pythium was found on the seeds of several different wheat cultivars used in controlled environmental studies, but it is unclear if the seed-borne fungal strain(s) were identical to the pathogenic strain recovered from the KSC studies. Attempts to control pathogens and their effects in hydroponic life support systems should include early inoculation with complex microbial communities, which is consistent with ecological theory.

  20. Hybridization of an invasive shrub affects tolerance and resistance to defoliation by a biological control agent

    OpenAIRE

    Williams, Wyatt I; Friedman, Jonathan M; Gaskin, John F; Norton, Andrew P

    2014-01-01

    Evolution has contributed to the successful invasion of exotic plant species in their introduced ranges, but how evolution affects particular control strategies is still under evaluation. For instance, classical biological control, a common strategy involving the utilization of highly specific natural enemies to control exotic pests, may be negatively affected by host hybridization because of shifts in plant traits, such as root allocation or chemical constituents. We investigated introgressi...

  1. A proteomic approach provides new insights into the control of soil-borne plant pathogens by Bacillus species.

    Directory of Open Access Journals (Sweden)

    Omür Baysal

    Full Text Available Beneficial microorganisms (also known as biopesticides are considered to be one of the most promising methods for more rational and safe crop management practices. We used Bacillus strains EU07, QST713 and FZB24, and investigated their inhibitory effect on Fusarium. Bacterial cell cultures, cell-free supernatants and volatiles displayed varying degrees of suppressive effect. Proteomic analysis of secreted proteins from EU07 and FZB24 revealed the presence of lytic enzymes, cellulases, proteases, 1,4-β-glucanase and hydrolases, all of which contribute to degradation of the pathogen cell wall. Further proteomic investigations showed that proteins involved in metabolism, protein folding, protein degradation, translation, recognition and signal transduction cascade play an important role in the control of Fusarium oxysporum. Our findings provide new knowledge on the mechanism of action of Bacillus species and insight into biocontrol mechanisms.

  2. Health behaviors, periodontal conditions, and periodontal pathogens in spontaneous preterm birth: a case-control study in Korea.

    Science.gov (United States)

    Ryu, Jae-In; Oh, Kyungjoon; Yang, Hyejin; Choi, Bong-Kyu; Ha, Jung-Eun; Jin, Bo-Hyoung; Kim, Hyun-Duck; Bae, Kwang-Hak

    2010-06-01

    This study aims to determine whether periodontal conditions or dental health behaviors are risk factors for preterm birth (PTB), and whether periodontal pathogens are risk indicators for PTB among Korean mothers. This study was designed as a hospital-based case-control study. Examiner masking was ensured for the validity of the examinations. The mothers included those who gave birth between November 2007 and July 2009 at the obstetrics clinic of a general hospital in Seoul, Korea. Information on demographic and health conditions, periodontal conditions, and microbacterial data was collected. A total of 172 women met the inclusion criteria, 59 mothers who delivered a preterm neonate were assigned to the case group while the other 113 were assigned to the control group. There were no significant differences in demographic information, oral health conditions, and obstetric characteristics. Among health-related behaviors, only scaling within 12 months before pregnancy showed a significant difference (P = 0.031). Even in the adjusted logistic model, only the difference in the experience of scaling before pregnancy was significant between the PTB cases and the controls (P = 0.039). Periodontal disease did not exhibit a significant relationship with PTB even after adjustment for potential confounding factors. Among the microbacterial factors, only Porphyromonas gingivalis showed a slight difference (P = 0.060). There was a significant difference in scaling experience within 12 months before pregnancy and P. gingivalis showed a marginal difference between the PTB and the control groups but clinical periodontal conditions showed no association with PTB.

  3. Using consumption rate to assess potential predators for biological control of white perch

    Directory of Open Access Journals (Sweden)

    Gosch N.J.C.

    2011-08-01

    Full Text Available Control of undesirable fishes is important in aquatic systems, and using predation as a tool for biological control is an attractive option to fishery biologists. However, determining the appropriate predators for biological control is critical for success. The objective of this study was to evaluate the utility of consumption rate as an index to determine the most effective predators for biological control of an invasive fish. Consumption rate values were calculated for nine potential predators that prey on white perch Morone americana in Branched Oak and Pawnee reservoirs, Nebraska. The consumption rate index provided a unique and insightful means of determining the potential effectiveness of each predator species in controlling white perch. Cumulative frequency distributions facilitated interpretation by providing a graphical presentation of consumption rates by all individuals within each predator species. Largemouth bass Micropterus salmoides, walleye Sander vitreus and sauger S. canadensis were the most efficient white perch predators in both reservoirs; however, previous attempts to increase biomass of these predators have failed suggesting that successful biological control is unlikely using existing predator species in these Nebraska reservoirs.

  4. Using consumption rate to assess potential predators for biological control of white perch

    Science.gov (United States)

    Gosch, N.J.C.; Pope, K.L.

    2011-01-01

    Control of undesirable fishes is important in aquatic systems, and using predation as a tool for biological control is an attractive option to fishery biologists. However, determining the appropriate predators for biological control is critical for success. The objective of this study was to evaluate the utility of consumption rate as an index to determine the most effective predators for biological control of an invasive fish. Consumption rate values were calculated for nine potential predators that prey on white perch Morone americana in Branched Oak and Pawnee reservoirs, Nebraska. The consumption rate index provided a unique and insightful means of determining the potential effectiveness of each predator species in controlling white perch. Cumulative frequency distributions facilitated interpretation by providing a graphical presentation of consumption rates by all individuals within each predator species. Largemouth bass Micropterus salmoides, walleye Sander vitreus and sauger S. canadensis were the most efficient white perch predators in both reservoirs; however, previous attempts to increase biomass of these predators have failed suggesting that successful biological control is unlikely using existing predator species in these Nebraska reservoirs. ?? 2011 ONEMA.

  5. Biological Control Outcomes Using the Generalist Aphid Predator Aphidoletes aphidimyza under Multi-Prey Conditions

    Directory of Open Access Journals (Sweden)

    Sarah E. Jandricic

    2016-12-01

    Full Text Available The aphidophagous midge Aphidoletes aphidimyza (Diptera: Cecidomyiidae is used in biological control programs against aphids in many crops. Short-term trials with this natural enemy demonstrated that that females prefer to oviposit among aphids colonizing the new growth of plants, leading to differential attack rates for aphid species that differ in their within-plant distributions. Thus, we hypothesized that biological control efficacy could be compromised when more than one aphid species is present. We further hypothesized that control outcomes may be different at different crop stages if aphid species shift their preferred feeding locations. Here, we used greenhouse trials to determine biological control outcomes using A. aphidimyza under multi-prey conditions and at different crop stages. At all plant stages, aphid species had a significant effect on the number of predator eggs laid. More eggs were found on M. persicae versus A. solani-infested plants, since M. persicae consistently colonized plant meristems across plant growth stages. This translated to higher numbers of predatory larvae on M. periscae-infested plants in two out of our three experiments, and more consistent control of this pest (78%–95% control across all stages of plant growth. In contrast, control of A. solani was inconsistent in the presence of M. persicae, with 36%–80% control achieved. An additional experiment demonstrated control of A. solani by A. aphidimyza was significantly greater in the absence of M. persicae than in its presence. Our study illustrates that suitability of a natural enemy for pest control may change over a crop cycle as the position of prey on the plant changes, and that prey preference based on within-plant prey location can negatively influence biological control programs in systems with pest complexes. Careful monitoring of the less-preferred pest and its relative position on the plant is suggested.

  6. Molecular Approach to the Nyctinastic Movement of the Plant Controlled by a Biological Clock

    Directory of Open Access Journals (Sweden)

    Shosuke Yamamura

    2001-10-01

    Full Text Available Most leguminous plants close their leaves in the evening, as if to sleep, and open them early in the morning. This circadian rhythm is known to be controlled by the biological clock of such plants. Extensive studies on other nyctinastic plants led to the isolation of a variety of leaf-closing and leaf-opening substances. And, we found that the circadian rhythmic leaf-movement of these plants is controlled by a biological clock that regulates the balance of concentration between leaf-opening and -closing substances.

  7. The challenges of implementing pathogen control strategies for fishes used in biomedical research

    Science.gov (United States)

    Lawrence, C.; Ennis, D.G.; Harper, C.; Kent, M.L.; Murray, K.; Sanders, G.E.

    2012-01-01

    Over the past several decades, a number of fish species, including the zebrafish, medaka, and platyfish/swordtail, have become important models for human health and disease. Despite the increasing prevalence of these and other fish species in research, methods for health maintenance and the management of diseases in laboratory populations of these animals are underdeveloped. There is a growing realization that this trend must change, especially as the use of these species expands beyond developmental biology and more towards experimental applications where the presence of underlying disease may affect the physiology animals used in experiments and potentially compromise research results. Therefore, there is a critical need to develop, improve, and implement strategies for managing health and disease in aquatic research facilities. The purpose of this review is to report the proceedings of a workshop entitled "Animal Health and Disease Management in Research Animals" that was recently held at the 5th Aquatic Animal Models for Human Disease in September 2010 at Corvallis, Oregon to discuss the challenges involved with moving the field forward on this front. ?? 2011 Elsevier Inc. All rights reserved.

  8. Aquatic Plant Control Research Program: Review of Senescence as an Important Factor Determining the Relationship Among Aquatic Plants, Their Epiphytes, and Pathogens

    Science.gov (United States)

    1989-04-01

    34Enzymatic Penetration of the Plant Cuticle by Fungal Pathogens," Annual Review of Phytopathology , Vol 23, pp 223-250. Krishnamani, M. R. S., and...Leben, C. 1965. "Epiphytic Organisms in Relation to Plant Disease," Annual Review of Phytopathology , Vol 3, pp 209-230. Lee, J. J. 1980. "A Conceptual...34 Annual Review of Phytopathology , Vol 23, pp 475-490. Smith, H., and Grierson, D., eds. 1982. "The Molecular Biology of Plant Development," Botanical

  9. A Systems Biology Approach to the Coordination of Defensive and Offensive Molecular Mechanisms in the Innate and Adaptive Host-Pathogen Interaction Networks.

    Science.gov (United States)

    Wu, Chia-Chou; Chen, Bor-Sen

    2016-01-01

    Infected zebrafish coordinates defensive and offensive molecular mechanisms in response to Candida albicans infections, and invasive C. albicans coordinates corresponding molecular mechanisms to interact with the host. However, knowledge of the ensuing infection-activated signaling networks in both host and pathogen and their interspecific crosstalk during the innate and adaptive phases of the infection processes remains incomplete. In the present study, dynamic network modeling, protein interaction databases, and dual transcriptome data from zebrafish and C. albicans during infection were used to infer infection-activated host-pathogen dynamic interaction networks. The consideration of host-pathogen dynamic interaction systems as innate and adaptive loops and subsequent comparisons of inferred innate and adaptive networks indicated previously unrecognized crosstalk between known pathways and suggested roles of immunological memory in the coordination of host defensive and offensive molecular mechanisms to achieve specific and powerful defense against pathogens. Moreover, pathogens enhance intraspecific crosstalk and abrogate host apoptosis to accommodate enhanced host defense mechanisms during the adaptive phase. Accordingly, links between physiological phenomena and changes in the coordination of defensive and offensive molecular mechanisms highlight the importance of host-pathogen molecular interaction networks, and consequent inferences of the host-pathogen relationship could be translated into biomedical applications.

  10. Isolation and characterization of Enterobacteriaceae species infesting post-harvest strawberries and their biological control using bacteriophages.

    Science.gov (United States)

    Kurtböke, D Ipek; Palk, A; Marker, A; Neuman, C; Moss, L; Streeter, K; Katouli, M

    2016-10-01

    Strawberry is a significantly consumed fruit worldwide, mostly without being subjected to disinfection processes. During the harvest and transfer from farm to consumers as well as where organic farming practises have been employed, the surface of the fruit may become contaminated by pathogenic bacteria. Post-harvest strawberry fruits in punnets available for public consumption were thus screened for the presence of enteric bacteria in the Sunshine Coast region of Queensland, Australia. Some of the tested samples (13 %) were found to carry such bacteria and even in greater numbers if organic amendments were used (69 %). The bacteria were found to belong in the genera of Escherichia, Enterobacter, Raoultella, Klebsiella, Pantoea, Shigella, Citrobacter and Cronobacter within the family Enterobacteriaceae. Some of the isolates were found to adhere to Caco-2 cells representing human gut epithelium as well as carrying virulence and toxin genes. Resistance mostly against sulphafurazole, cefoxitin, ampicillin and nitrofurantoin was found among 14 different antimicrobial agents tested including 100 % resistance to cefoxitin and ampicillin in the genus Pantoea. In the second phase of the study, bacteriophages were isolated against the isolates and were subsequently applied to post-harvest fruits. A significant (P ≤ 0.001) reduction in the number of enteric bacteria was observed when a high-titre polyvalent bacteriophage suspension (×10(12) PFU/mL) was applied to the fruit surface. Bacteriophages also decreased the adhesion of the Escherichia coli isolates to Caco-2 cells. Findings might indicate that biological control using bacteriophages might be of significant value for the industry targeting to reduce pathogenic loads of bacteria on the fruit.

  11. Foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Thomas Bintsis

    2017-06-01

    Full Text Available Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy. The characteristics of the most common pathogenic bacteria (Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium perfringens, Cronobacter sakazakii, Esherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Staphylococccus aureus, Vibrio spp. and Yersinia enterocolitica, viruses (Hepatitis A and Noroviruses and parasites (Cyclospora cayetanensis, Toxoplasma gondii and Trichinella spiralis, together with some important outbreaks, are reviewed. Food safety management systems based on to classical hazard-based approach has been proved to be inefficient, and risk-based food safety approach is now suggested from leading researchers and organizations. In this context, a food safety management system should be designed in a way to estimate the risks to human health from food consumption and to identify, select and implement mitigation strategies in order to control and reduce these risks. In addition, the application of suitable food safety education programs for all involved people in the production and consumption of foods is suggested.

  12. Analysis of Adoption of Biological Control practices in Tomato Farms of Jiroft County Using Duration Analysis

    Directory of Open Access Journals (Sweden)

    Mohseen Adeli- Sardooei

    2015-11-01

    Full Text Available The human need for food, during recent decades has increased dependence on pesticides and chemical pesticides. Due to the destructions effect of chemical toxins, adoption of bio and non-bio technologies Identical with the sustainable agriculture such as pest control by natural enemies, is taken into consideration by agriculture researchers. so, the process of adopting biological control technology is investigated in the farms of tomato in Jiroft County during the period of 2010 until 2014. Why some farmers are faster to adopt this technology is investigated using duration analysis, which allows the timing of an event to be explored in a dynamic framework. The empirical results highlight the negative importance of age variable, and positive effect of farm size and attitude to control biologic. In this study due to the use of survival analysis model it was possible to evaluate the effect of time dependent variables include product price and years of knowledge about control biologic on speed of adoption. Therefore, it became clear that if in a year the price of the product is increase the probability of adoption is increased as well as if the farmer has been informed about biological control technology earlier the technology adoption rate increases.

  13. Biologically inspired control and modeling of (biorobotic systems and some applications of fractional calculus in mechanics

    Directory of Open Access Journals (Sweden)

    Lazarević Mihailo P.

    2013-01-01

    Full Text Available In this paper, the applications of biologically inspired modeling and control of (biomechanical (nonredundant mechanisms are presented, as well as newly obtained results of author in mechanics which are based on using fractional calculus. First, it is proposed to use biological analog-synergy due to existence of invariant features in the execution of functional motion. Second, the model of (biomechanical system may be obtained using another biological concept called distributed positioning (DP, which is based on the inertial properties and actuation of joints of considered mechanical system. In addition, it is proposed to use other biological principles such as: principle of minimum interaction, which takes a main role in hierarchical structure of control and self-adjusting principle (introduce local positive/negative feedback on control with great amplifying, which allows efficiently realization of control based on iterative natural learning. Also, new, recently obtained results of the author in the fields of stability, electroviscoelasticity, and control theory are presented which are based on using fractional calculus (FC. [Projekat Ministarstva nauke Republike Srbije, br. 35006

  14. A Novel Bacterial Pathogen of Biomphalaria glabrata: A Potential Weapon for Schistosomiasis Control?

    OpenAIRE

    Duval, David; Galinier, Richard; Mouahid, Gabriel; Toulza, Eve; Allienne, Jean Fran?ois; Portela, Julien; Calvayrac, Christophe; Rognon, Anne; Arancibia, Nathalie; Mitta, Guillaume; Th?ron, Andr?; Gourbal, Benjamin

    2015-01-01

    Background Schistosomiasis is the second-most widespread tropical parasitic disease after malaria. Various research strategies and treatment programs for achieving the objective of eradicating schistosomiasis within a decade have been recommended and supported by the World Health Organization. One of these approaches is based on the control of snail vectors in endemic areas. Previous field studies have shown that competitor or predator introduction can reduce snail numbers, but no systematic ...

  15. Multiresistant pathogens in geriatric nursing – infection control in residential facilities for geriatric nursing in Germany

    Directory of Open Access Journals (Sweden)

    Peters, Claudia

    2014-09-01

    Full Text Available [english] Background: The increase of multidrug-resistant organisms (MDROs causes problems in geriatric nursing homes. Older people are at increased a growing risk of infection due to multimorbidity and frequent stays in hospital. A high proportion of the elderly require residential care in geriatric nursing facilities, where hygiene requirements in nursing homes are similar to those in hospitals. For this reason we examined how well nursing homes are prepared for MDROs and how effectively protect their infection control residents and staff.Methods: A cross-sectional study was performed on infection control in residential geriatric nursing facilities in Germany 2012. The questionnaire recorded important parameters of hygiene, resident and staff protection and actions in case of existing MDROs.Results: The response was 54% in Hamburg and 27% in the rest of Germany. Nursing homes were generally well equipped for dealing with infection control: There were standards for MDROs and regular hygiene training for staff. The facilities provided adequate protective clothing, affected residents are usually isolated and hygienic laundry processing conducted. There are deficits in the communication of information on infected residents with hospitals and general practitioners. 54% of nursing homes performed risk assessments for staff infection precaution.Conclusion: There is a growing interest in MDROs and infection control will be a challenge in for residential geriatric nursing facilities in the future. This issue has also drawn increasing attention. Improvements could be achieved by improving communication between different participants in the health service, together with specific measures for staff protection at work.

  16. A Review of Occurrence of Fungal Pathogens on Significant Brassicaceous Vegetable Crops and their Control Measures

    OpenAIRE

    M. Srivastava; S.K. Gupta, A.P. Saxena, L.A.J. Shittu and S.K. Gupta

    2011-01-01

    Brassica vegetables are subjected to viral, bacterial as well as fungal attack, which causes a high yield loss. Temperature and moisture conditions, which promote the growth of fungus, are needed to be studied in order for an effective control of the disease to be estimated. The present review gives a brief account of the fungal diseases which have been considered responsible for major economic loss to the Brassica crops. The epidemiological conditions necessary for the occurrence and prevale...

  17. Antifungal activity of plant extracts with potential to control plant pathogens in pineapple

    Directory of Open Access Journals (Sweden)

    Maria Diana Cerqueira Sales

    2016-01-01

    Conclusions: The findings of the present study concluded that mother tinctures can effectively control phytopathogens. The mother tincture extract of Myroxylon balsamum showed antifungal activity and was used here for the first time for inhibition of phytopathogenic fungi. This study paves the way for the development of bioactive natural products with phytosanitary applications, with the added benefits of an environmentally safe and economically viable product.

  18. Biology, behavior, and larval morphology of Salbia lotanalis (Lepidoptera: Crambidae), a potential biological control agent of Miconia calvescens (Myrtales: Melastomataceae) from Costa Rica

    Science.gov (United States)

    Alexander Castillo; M. Tracy Johnson; Francisco R. Badenes-Pérez

    2014-01-01

    The leaf roller Salbia lotanalis Druce (Lepidoptera: Crambidae), a potential biological control agent of Miconia calvescens de Candolle (Melastomataceae), was studied in Costa Rica. Larvae were collected from a field site near San Jose and the insect was reared in the laboratory to study its biology and behavior. Chaetotaxy and...

  19. The role of evolutionary biology in research and control of liver flukes in Southeast Asia.

    Science.gov (United States)

    Echaubard, Pierre; Sripa, Banchob; Mallory, Frank F; Wilcox, Bruce A

    2016-09-01

    Stimulated largely by the availability of new technology, biomedical research at the molecular-level and chemical-based control approaches arguably dominate the field of infectious diseases. Along with this, the proximate view of disease etiology predominates to the exclusion of the ultimate, evolutionary biology-based, causation perspective. Yet, historically and up to today, research in evolutionary biology has provided much of the foundation for understanding the mechanisms underlying disease transmission dynamics, virulence, and the design of effective integrated control strategies. Here we review the state of knowledge regarding the biology of Asian liver Fluke-host relationship, parasitology, phylodynamics, drug-based interventions and liver Fluke-related cancer etiology from an evolutionary biology perspective. We consider how evolutionary principles, mechanisms and research methods could help refine our understanding of clinical disease associated with infection by Liver Flukes as well as their transmission dynamics. We identify a series of questions for an evolutionary biology research agenda for the liver Fluke that should contribute to an increased understanding of liver Fluke-associated diseases. Finally, we describe an integrative evolutionary medicine approach to liver Fluke prevention and control highlighting the need to better contextualize interventions within a broader human health and sustainable development framework. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Randomized controlled trial of toothbrushing to reduce ventilator-associated pneumonia pathogens and dental plaque in a critical care unit.

    Science.gov (United States)

    Needleman, Ian G; Hirsch, Nicholas P; Leemans, Michele; Moles, David R; Wilson, Michael; Ready, Derren R; Ismail, Salim; Ciric, Lena; Shaw, Michael J; Smith, Martin; Garner, Anne; Wilson, Sally

    2011-03-01

    To investigate the effect of a powered toothbrush on colonization of dental plaque by ventilator-associated pneumonia (VAP)-associated organisms and dental plaque removal. Parallel-arm, single-centre, examiner- and analyst-masked randomized controlled trial. Forty-six adults were recruited within 48 h of admission. Test intervention: powered toothbrush, control intervention: sponge toothette, both used four times per day for 2 min. Groups received 20 ml, 0.2% chlorhexidine mouthwash at each time point. The results showed a low prevalence of respiratory pathogens throughout with no statistically significant differences between groups. A highly statistically significantly greater reduction in dental plaque was produced by the powered toothbrush compared with the control treatment; mean plaque index at day 5, powered toothbrush 0.75 [95% confidence interval (CI) 0.53, 1.00], sponge toothette 1.35 (95% CI 0.95, 1.74), p=0.006. Total bacterial viable count was also highly statistically significantly lower in the test group at day 5; Log(10) mean total bacterial counts: powered toothbrush 5.12 (95% CI 4.60, 5.63), sponge toothette 6.61 (95% CI 5.93, 7.28), p=0.002. Powered toothbrushes are highly effective for plaque removal in intubated patients in a critical unit and should be tested for their potential to reduce VAP incidence and health complications. © 2011 John Wiley & Sons A/S.

  1. Effect of plant extracts and a disinfectant on biological parameters and pathogenicity of the fungus Beauveria bassiana (Bals. Vuill. (Ascomycota: Cordycipitaceae

    Directory of Open Access Journals (Sweden)

    C. C. Martins

    Full Text Available Abstract The fungus Beauveria bassiana is naturally found in poultry houses and causes high rates of mortality in Alphitobius diaperinus. Laboratory and field experiments have shown the potential of this fungus as an insect control agent. However, in poultry houses, bacteria as Salmonella, can be found and have been studied alternative control methods for this pathogen. Thus, this study aimed to evaluate the effect of plant extracts and a disinfectant on the fungus Beauveria bassiana (strain Unioeste 4. Conidial viability, colony-forming unit (CFU counts, vegetative growth, conidia production, insecticidal activity of the fungus and compatibility were used as parameters in the evaluation of the effect of these products on the fungus. Alcoholic and aqueous extracts of jabuticaba (Myrciaria cauliflora (Mart., guava (Psidium guajava (L., and jambolan (Syzygium cumini (L., at concentrations of 10% as well as the commercial disinfectant, Peroxitane® 1512 AL, were evaluated at the recommended concentrations (RC, 1:200 (RC, 0.5 RC and 2 RC. There was a negative influence of alcoholic and aqueous extracts of jabuticaba, guava and three dilutions of Peroxitane on the viability of conidia. The CFUs and vegetative growth of the fungus were affected only by the Peroxitane (all dilutions. For conidial production, the aqueous extract of guava had a positive effect, increasing production, while the Peroxitane at the R and RC concentrations resulted in a negative influence. The mortality of A. diaperinus, caused by the fungus after exposure to these products, was 60% for the peracetic acid at 0.5 RC, and above 80% for the extracts. Thus, the results showed that all the extracts and Peroxitane at RC 0.5 are compatible with the fungus B. bassiana Unioeste 4, however only the extracts had a low impact on inoculum potential.

  2. Effect of plant extracts and a disinfectant on biological parameters and pathogenicity of the fungus Beauveria bassiana (Bals.) Vuill. (Ascomycota: Cordycipitaceae).

    Science.gov (United States)

    Martins, C C; Alves, L F A; Mamprim, A P

    2016-06-01

    The fungus Beauveria bassiana is naturally found in poultry houses and causes high rates of mortality in Alphitobius diaperinus. Laboratory and field experiments have shown the potential of this fungus as an insect control agent. However, in poultry houses, bacteria as Salmonella, can be found and have been studied alternative control methods for this pathogen. Thus, this study aimed to evaluate the effect of plant extracts and a disinfectant on the fungus Beauveria bassiana (strain Unioeste 4). Conidial viability, colony-forming unit (CFU) counts, vegetative growth, conidia production, insecticidal activity of the fungus and compatibility were used as parameters in the evaluation of the effect of these products on the fungus. Alcoholic and aqueous extracts of jabuticaba (Myrciaria cauliflora (Mart.), guava (Psidium guajava (L.)), and jambolan (Syzygium cumini (L.), at concentrations of 10% as well as the commercial disinfectant, Peroxitane® 1512 AL, were evaluated at the recommended concentrations (RC), 1:200 (RC), 0.5 RC and 2 RC. There was a negative influence of alcoholic and aqueous extracts of jabuticaba, guava and three dilutions of Peroxitane on the viability of conidia. The CFUs and vegetative growth of the fungus were affected only by the Peroxitane (all dilutions). For conidial production, the aqueous extract of guava had a positive effect, increasing production, while the Peroxitane at the R and RC concentrations resulted in a negative influence. The mortality of A. diaperinus, caused by the fungus after exposure to these products, was 60% for the peracetic acid at 0.5 RC, and above 80% for the extracts. Thus, the results showed that all the extracts and Peroxitane at RC 0.5 are compatible with the fungus B. bassiana Unioeste 4, however only the extracts had a low impact on inoculum potential.

  3. Biological control of Orobanche aegyptiaca by Fusarium oxysporum F. sp. Orobanchein northwest Iran.

    Science.gov (United States)

    Saremi, H; Okhovvat, S M

    2008-01-01

    Broomrape (Orobanche aegyptiaca) is one of the most serious weed pathogen on many plants all over the world, especially in northwest Iran. It causes damage on some plants particularly on tomato, cucumber and other dicotyledonous crops in zanjan province. Broomrape as weed, caused reductions in crop yield, adversely affected crop quality, and resulted in loss of cultivated land due to reduced crop alternatives. Since there were no any chemical methods and other proper technique to control this plant parasite we tried to find a good mechanism for its management in the fields. Our study showed there was a specific species, Fusarium oxysporum f. sp. orobonche that had infected Broomrapes naturally in the field. In point of fact the species was isolated from naturally infected Broomrape in studied Locations. Our surveys showed F. oxysporum f. sp. orobanche caused disease on orobanche spp. in different agricultural fields. Although there were other fungal species which can nearly manage the orobanche but it can be fungal pathogen to other plants. However the best fungal isolate can be F. oxysporum f. sp. orobanche since it may not be pathogen for other plants.

  4. Food-borne pathogens

    International Nuclear Information System (INIS)

    Niemand, J.G.

    1985-01-01

    The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process

  5. EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on the risk posed by Shiga toxinproducing Escherichia coli (STEC) and other pathogenic bacteria in seeds and sprouted seeds

    DEFF Research Database (Denmark)

    Hald, Tine

    , Listeria monocytogenes, Staphylococcus aureus and Yersinia enterocolitica have also been transmitted by sprouted seeds, albeit very rarely. Dry seed contaminated with bacterial pathogens has been identified as the most likely initial source of sprout-associated outbreaks; although other routes...

  6. Pathogen control in complex fluids with water-coupled excimer lamps at 282 and 308 nm.

    Science.gov (United States)

    Coogan, John J

    2005-01-01

    Water-coupled excimer lamp systems have been developed to inactivate microorganisms within complex, low-optical quality, fluids. Monochromatic lamps were selected to minimize UV-B and UV-C absorption within the carrier fluids while maximizing deposition within specific chemical targets. Fundamentals, system scaling and power supply design are discussed. This work used two large-surface area excimer lamps as intense sources of near monochromatic radiation at 308 and 282 nm. Data are presented for two distinct fluid systems: flow-through processing of large-volume metalworking fluids used in heavy industry and batch irradiation of human blood plasma and platelet suspensions used in transfusion medicine. In the first, a 200-600 L/min reactor is used to control bacterial concentrations within metalworking fluids used in large-scale metal machining processes. Control is defined as the maintenance of 10(3) to 10(4) CFU/mL in fluids that without treatment would have concentrations over 10(7) CFU/mL. The second is a batch process for viral inactivation in undiluted blood bank products. Samples of fresh frozen plasma and platelet suspensions were spiked with high titers of porcine parvovirus (PPV) and irradiated at 308 and 282 nm. Although both wavelengths were effective at reducing PPV levels, 308 nm light resulted in both higher rates of viral inactivation (greater than 6 log units) and lower rates of fluid degradation.

  7. Biology, host specificity tests, and risk assessment of the sawfly Heteroperreyia hubrichi, a potential biological control agent of Schinus terebinthifolius in Hawaii

    Science.gov (United States)

    Abstract. Heteroperreyia hubrichi Malaise (Hymenoptera: Pergidae), a foliage feeding sawfly of Schinus terebinthifolius Raddi (Sapindales: Anacardiaceae), was studied to assess its suitability as a classical biological control agent of this invasive weed in Hawaii. Nochoice host-specificity tests we...

  8. TLR4- and TLR2-mediated B cell responses control the clearance of the bacterial pathogen, Leptospira interrogans.

    Science.gov (United States)

    Chassin, Cécilia; Picardeau, Mathieu; Goujon, Jean-Michel; Bourhy, Pascale; Quellard, Nathalie; Darche, Sylvie; Badell, Edgar; d'Andon, Martine Fanton; Winter, Nathalie; Lacroix-Lamandé, Sonia; Buzoni-Gatel, Dominique; Vandewalle, Alain; Werts, Catherine

    2009-08-15

    Leptospirosis is a widespread zoonosis caused by pathogenic Leptospira interrogans that are transmitted by asymptomatic infected rodents. Leptospiral lipoproteins and LPS have been shown to stimulate murine cells via TLRs 2 and 4. Host defense mechanisms remain obscure, although TLR4 has been shown to be involved in clearing Leptospira. In this study, we show that double (TLR2 and TLR4) knockout (DKO) mice rapidly died from severe hepatic and renal failure following Leptospira inoculation. Strikingly, the severe proinflammatory response detected in the liver and kidney from Leptospira-infected DKO mice appears to be independent of MyD88, the main adaptor of TLRs. Infection of chimeric mice constructed with wild-type and DKO mice, and infection of several lines of transgenic mice devoid of T and/or B lymphocytes, identified B cells as the crucial lymphocyte subset responsible for the clearance of Leptospira, through the early production of specific TLR4-dependent anti-Leptospira IgMs elicited against the leptospiral LPS. We also found a protective tissue compartmentalized TLR2/TLR4-mediated production of IFN-gamma by B and T lymphocytes, in the liver and kidney, respectively. In contrast, the tissue inflammation observed in Leptospira-infected DKO mice was further characterized to be mostly due to B lymphocytes in the liver and T cells in the kidney. Altogether these findings demonstrate that TLR2 and TLR4 play a key role in the early control of leptospirosis, but do not directly trigger the inflammation induced by pathogenic Leptospira.

  9. Specific detection of common pathogens of acute bacterial meningitis using an internally controlled tetraplex-PCR assay.

    Science.gov (United States)

    Farahani, Hamidreza; Ghaznavi-Rad, Ehsanollah; Mondanizadeh, Mahdieh; MirabSamiee, Siamak; Khansarinejad, Behzad

    2016-08-01

    Accurate and timely diagnosis of acute bacterial meningitis is critical for antimicrobial treatment of patients. Although PCR-based methods have been widely used for the diagnosis of acute meningitis caused by bacterial pathogens, the main disadvantage of these methods is their high cost. This disadvantage has hampered the widespread use of molecular assays in many developing countries. The application of multiplex assays and "in-house" protocols are two main approaches that can reduce the overall cost of a molecular test. In the present study, an internally controlled tetraplex-PCR was developed and validated for the specific detection of Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae in cerebrospinal fluid (CSF) samples. The analysis of a panel of other human pathogens showed no cross-reactivity in the assay. The analytical sensitivity of the in-house assay was 792.3 copies/ml, when all three bacteria were presentin the specimens. This value was calculated as 444.5, 283.7, 127.8 copies/ml when only S. pneumoniae, N. meningitidis and H. influenzae, respectively, were present. To demonstrate the diagnostic performance of the assay, a total of 150 archival CSF samples were tested and compared with a commercial multiplex real-time PCR kit. A diagnostic sensitivity of 92.8% and a specificity of 95.1% were determined for the present tetraplex-PCR assay. The results indicate that the established method is sensitive, specific and cost-effective, and can be used particularly in situations where the high cost of commercial kits prevents the use of molecular methods for the diagnosis of bacterial meningitis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Polynomial-Time Algorithm for Controllability Test of a Class of Boolean Biological Networks

    Directory of Open Access Journals (Sweden)

    Koichi Kobayashi

    2010-01-01

    Full Text Available In recent years, Boolean-network-model-based approaches to dynamical analysis of complex biological networks such as gene regulatory networks have been extensively studied. One of the fundamental problems in control theory of such networks is the problem of determining whether a given substance quantity can be arbitrarily controlled by operating the other substance quantities, which we call the controllability problem. This paper proposes a polynomial-time algorithm for solving this problem. Although the algorithm is based on a sufficient condition for controllability, it is easily computable for a wider class of large-scale biological networks compared with the existing approaches. A key to this success in our approach is to give up computing Boolean operations in a rigorous way and to exploit an adjacency matrix of a directed graph induced by a Boolean network. By applying the proposed approach to a neurotransmitter signaling pathway, it is shown that it is effective.

  11. Biological potantial of some Iranian Trichoderma isolates in the ...

    African Journals Online (AJOL)

    SERVER

    2008-04-17

    Apr 17, 2008 ... +989143186861.Fax: +984527463417. new resistant strains of pathogens. In the recent years, there has been a world wide swing to the use of eco-friendly methods for protecting the crops from pest and disease (Rao et al., 1998). Biological control of plant disease especially soil borne plant pathogens and ...

  12. Observations on root disease of container whitebark pine seedlings treated with biological controls

    Science.gov (United States)

    R. Kasten Dumroese

    2008-01-01

    I observed that whitebark pine (Pinus albicaulis Engelm. [Pinaceae]) germinants treated with biological controls, one commercially available (Trichoderma harzianum strain T-22), and the other being studied for potential efficacy (Fusarium oxysporum isolate Q12), experienced less seedling mortality caused by root disease than did a...

  13. Endophytic colonization of tomato plants by the biological control agent Clonostachys rosea

    DEFF Research Database (Denmark)

    Høyer, Anna Kaja; Jørgensen, Hans Jørgen Lyngs; Amby, Daniel Buchvaldt

    -style. Clonostachys rosea occurs naturally world-wide and is capable of colonizing many different habitats. The fungus is primarily known as a versatile biological control agent. However, it has also been reported as a plant endophyte in, e.g., soybean, red clover and cacao. The C. rosea isolate IK726 efficiently...

  14. Assessing risks and benefits of floral supplements in conservation biological control

    NARCIS (Netherlands)

    Winkler, K.; Wackers, F.L.; Termorshuizen, A.J.; Lenteren, van J.C.

    2010-01-01

    The use of flowering field margins is often proposed as a method to support biological control in agro-ecosystems. In addition to beneficial insects, many herbivores depend on floral food as well. The indiscriminate use of flowering species in field margins can therefore lead to higher pest numbers.

  15. Evaluation of Serangium parcesetosum (Coleoptera: Coccinellidae) as a biological control agent of the silverleaf whitefly

    Science.gov (United States)

    The coccinellid predator from India, Serangium parcesetosum Sicard, was studied as a potential biological control agent of the silverleaf whitefly, Bemisia argentifolii Bellows & Perring [also known as the sweetpotato whitefly, B. tahaci (Gennadius) Biotype B]. Studies were performed on prey prefere...

  16. Potentials of biological control of plant diseases in the tropics | Ofor ...

    African Journals Online (AJOL)

    This paper highlights the various categories of biological control, which are employed in an Integrated Disease Management (IDM) scheme. These include conservation, classical biocontrol and augmentation. Also, the various types of biocontrol agents/agencies which are currently in use in various parts of the world like, ...

  17. Potential for biological control of native North American Dendroctonus beetles (Coleoptera: Scolytidae)

    Science.gov (United States)

    M.C. Miller; John C. Moser; M. McGregor; J.C. Gregoire; M. Baisier; D.L. Dahlsten; R.A. Werner

    1987-01-01

    Bark beetles of the genus Dendroctonus inflict serious damage in North American coniferous forests. Biological control, which has never been seriously attempted with bark beetles in the United States, should be reconsidered in light of results disclosed here. Impact of indigenous associates is discussed, as well as previous, unsuccessful attempts to...

  18. Host range of Secusio extensa (Lepidoptera: Arctiidae), and potential for biological control of Senecio madagascariensis (Asteraceae)

    Science.gov (United States)

    M. M. Ramadan; K. T. Murai; T. Johnson

    2010-01-01

    Secusio extensa (Lepidoptera: Arctiidae) was evaluated as a potential biological control agent for Madagascar fireweed, Senecio madagascariensis (Asteraceae), which has invaded over 400 000 acres of rangeland in the Hawaiian Islands and is toxic to cattle and horses. The moth was introduced from southeastern Madagascar...

  19. Effects of biological control agents and exotic plant invasion on deer mouse populations

    Science.gov (United States)

    Yvette K. Ortega; Dean E. Pearson; Kevin S. McKelvey

    2004-01-01

    Exotic insects are commonly introduced as biological control agents to reduce densities of invasive exotic plants. Although current biocontrol programs for weeds take precautions to minimize ecological risks, little attention is paid to the potential nontarget effects of introduced food subsidies on native consumers. Previous research demonstrated that two gall flies (...

  20. Flower power? Potential benefits and pitfalls of using (flowering) vegetation for conservation biological control

    NARCIS (Netherlands)

    Wackers, F.L.; Rijn, van P.C.J.; Winkler, K.; Olson, D.

    2006-01-01

    Whereas nectar and pollen provision to predators and parasitoids is a main objective in pursuing agricultural biodiversity, we often know little about whether the flowering plant species involved are actually suitable as insect food sources or about their ultimate impact on biological pest control.

  1. Biological control in agro-systems by means of the handling of entomophagous insects

    International Nuclear Information System (INIS)

    Nicholls, Clara Ines; Altieri, Miguel A

    1998-01-01

    From several decades ago the importance of natural enemies of the noxious organisms has been recognized. Unfortunately the introduction of the biological control has not had the desired dimension. The indiscriminate use of biocides products has altered the biodiversity of the agro-ecosystem. The parasitoids and predators have suffered the noxious effects of the plaguicides. These natural enemies of the plagues play a momentous paper in the regulation of noxious insects population. The predators of the insecta class register in diverse orders and the abundance of species is impressive. But the knowledge of their importance is only partial. In many countries the kindness of these organisms has not been specified and does not protect them. In the case of parasitoids something similar occurs. It is say that their biotic diversity is incalculable but very few species are exploited. In these two groups rest the classic biological control projects. The successes in projects of biological control are recognized and they are enlarging in several countries but more impulse is required. Due to demands of a sustainable agricultural production it should support the biological control of plagues. In this document general looks on the topic are expounded

  2. Biological control of whitefly on greenhouse tomato in Colombia: Encarsia formosa or Amitus fuscipennis?

    NARCIS (Netherlands)

    Vis, De R.M.J.

    2001-01-01

    In Colombia, biological control of pests in greenhouse crops is only applied on a very limited scale in ornamentals and as yet non-existent in greenhouse vegetables. Greenhouse production of vegetables - mostly tomatoes- is a recent development, as a result of the high losses of field production due

  3. 41 CFR 101-42.1102-5 - Drugs, biologicals, and reagents other than controlled substances.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Drugs, biologicals, and reagents other than controlled substances. 101-42.1102-5 Section 101-42.1102-5 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS...

  4. DEFOLIATING BROAD NOSED WEEVIL, Plectrophoroides lutra; NOT SUITABLE FOR BIOLOGICAL CONTROL OF BRAZILIAN PEPPER

    Science.gov (United States)

    The adults of the weevil Plectrophoroides lutra were evaluated for potential as an agent for biological control of Schinus terebinthifolius. Our Brazilian field observations indicated that the adults were only collected from S. terebinthifolius, however when tested on North American and other valued...

  5. Status of biological control projects on terrestrial invasive alien weeds in California

    Science.gov (United States)

    In cooperation with foreign scientists, we are currently developing new classical biological control agents for five species of invasive alien terrestrial weeds. Cape-Ivy. A gall-forming fly, Parafreutreta regalis, and a stem-boring moth, Digitivalva delaireae, have been favorably reviewed by TAG...

  6. The effect of initial density and parasitoid intergenerational survival rate on classical biological control

    International Nuclear Information System (INIS)

    Xiao Yanni; Tang Sanyi

    2008-01-01

    Models of biological control have a long history of theoretical development that have focused on the interaction of a parasitoid and its host. The host-parasitoid systems have identified several important and general factors affecting the long-term dynamics of interacting populations. However, much less is known about how the initial densities of host-parasitoid populations affect the biological control as well as the stability of host-parasitoid systems. To do this, the classical Nicholson-Bailey model with host self-regulation and parasitoid intergenerational survival rate is used to uncover the effect of initial densities on the successful biological control. The results indicate that the simplest Nicholson-Bailey model has various coexistence with a wide range of parameters, including boundary attractors where the parasitoid population is absent and interior attractors where host-parasitoid coexists. The final stable states of host-parasitoid populations depend on their initial densities as well as their ratios, and those results are confirmed by basins of attraction of initial densities. The results also indicate that the parasitoid intergenerational survival rate increases the stability of the host-parasitoid systems. Therefore, the present research can help us to further understand the dynamical behavior of host-parasitoid interactions, to improve the classical biological control and to make management decisions

  7. Nuclear polyhedrosis virus as a biological control agent for Malacosoma americanum (Lepidoptera: Lasiocampidae)

    Science.gov (United States)

    R.A. Progar; M.J. Rinella; D. Fekedulegn; L. Butler

    2010-01-01

    In addition to damaging trees, the eastern tent caterpillar is implicated in early fetal loss and late-term abortion in horses. In a field study, we evaluated the potential biological control of the caterpillar using eastern tent caterpillar nuclear polyhedrosis virus (ETNPV), a naturally occurring virus that is nearly species-specific. Egg masses were hatched and...

  8. Biological control of Miconia calvescens with a suite of insect herbivores from Costa Rica and Brazil

    Science.gov (United States)

    F.R. Badenes-Perez; M.S. Alfaro-Alpizar; A. Castillo-Castillo; M.T. Johnson

    2008-01-01

    Miconia calvescens DC. (Melastomataceae) is an invasive tree considered the most serious threat to the natural ecosystems of Hawaii and other Pacific islands. We evaluated nine species natural enemies that feed on inflorescences or leaves of  M. calvescens for their potential as biological control agents, comparing their...

  9. Evaluation of Amitus fuscipennis as biological control agent of Trialeurodes vaporariorum on bean in Colombia

    NARCIS (Netherlands)

    Manzano Martinez, M.R.

    2000-01-01

    The research described in this thesis concerns the study of a natural enemy of whiteflies, Amitus fuscipennis MacGown & Nebeker under Colombian field and laboratory conditions. The general aim of the project was to study whether biological control of

  10. Status of biological control of the shrub gorse (Ulex europaeus) on the Island of Hawaii

    Science.gov (United States)

    G. P. Markin; P. Conant

    2013-01-01

    On the island of Hawaii, gorse (Ulex europaeus L.) is limited to an isolated core infestation of approximately 2000 hectares with scattered plants and small patches in the surrounding 10,000 hectares. Between 1985 and 2000, seven biological control agents were introduced, five of which successfully established. By 2000, their combined impact had reduced the yearly...

  11. Control of Rhizoctonia solani in potato by biological, chemical and integrated measures

    NARCIS (Netherlands)

    Jager, G.; Velvis, H.; Lamers, J.G.; Mulder, A.; Roosjen, J.

    1991-01-01

    The effects of biological, chemical and integrated control on the formation of selerotia ofRhizoctonia solani on new potato tubers were studied in experimental fields. Sprouts of seed tubers, sprouted in daylight, were inoculated withVerticillium biguttatum, an ecologically obligate mycoparasite

  12. Ex-ante analysis of economic returns from biological control of coconut mite in Tanzania

    NARCIS (Netherlands)

    Oleke, J.M.; Manyong, V.; Mignouna, D.; Isinika, A.; Mutabazi, K.; Hanna, R.; Sabelis, M.

    2013-01-01

    The coconut mite, Aceria guerreronis Keifer, has been identified as one of the pests that pose a threat to the coconut industry in Benin. The study presents the simulation results of the economic benefits of the biological control of coconut mites in Benin using a standard economic surplus model. In

  13. Trichogramma spp. (Hymenoptera: Trichogrammatidae) as biological control agents in the Philippines: history and current practice

    Science.gov (United States)

    Trichogramma parasitoids have long been recognized as important and viable biological control agents against lepidopteran pests of rice, corn and sugarcane in the Philippines. We describe the history of research and use of Trichogramma spp. in the Philippines in three main areas: 1) field surveys – ...

  14. Augmentative Biological Control Using Parasitoids for Fruit Fly Management in Brazil

    Directory of Open Access Journals (Sweden)

    Flávio R. M. Garcia

    2012-12-01

    Full Text Available The history of classical biological control of fruit flies in Brazil includes two reported attempts in the past 70 years. The first occurred in 1937 when an African species of parasitoid larvae (Tetrastichus giffardianus was introduced to control the Mediterranean fruit fly, Ceratitis capitata and other tephritids. The second occurred in September 1994 when the exotic parasitoid Diachasmimorpha longicaudata, originally from Gainesville, Florida, was introduced by a Brazilian agricultural corporation (EMBRAPA to evaluate the parasitoid’s potential for the biological control of Anastrepha spp. and Ceratitis capitata. Although there are numerous native Brazilian fruit fly parasitoids, mass rearing of these native species is difficult. Thus, D. longicaudata was chosen due to its specificity for the family Tephritidae and its ease of laboratory rearing. In this paper we review the literature on Brazilian fruit fly biological control and suggest that those tactics can be used on a large scale, together creating a biological barrier to the introduction of new fruit fly populations, reducing the source of outbreaks and the risk of species spread, while decreasing the use of insecticides on fruit destined for domestic and foreign markets.

  15. Augmentative Biological Control Using Parasitoids for Fruit Fly Management in Brazil.

    Science.gov (United States)

    Garcia, Flávio R M; Ricalde, Marcelo P

    2012-12-21

    The history of classical biological control of fruit flies in Brazil includes two reported attempts in the past 70 years. The first occurred in 1937 when an African species of parasitoid larvae (Tetrastichus giffardianus) was introduced to control the Mediterranean fruit fly, Ceratitis capitata and other tephritids. The second occurred in September 1994 when the exotic parasitoid Diachasmimorpha longicaudata, originally from Gainesville, Florida, was introduced by a Brazilian agricultural corporation (EMBRAPA) to evaluate the parasitoid's potential for the biological control of Anastrepha spp. and Ceratitis capitata. Although there are numerous native Brazilian fruit fly parasitoids, mass rearing of these native species is difficult. Thus, D. longicaudata was chosen due to its specificity for the family Tephritidae and its ease of laboratory rearing. In this paper we review the literature on Brazilian fruit fly biological control and suggest that those tactics can be used on a large scale, together creating a biological barrier to the introduction of new fruit fly populations, reducing the source of outbreaks and the risk of species spread, while decreasing the use of insecticides on fruit destined for domestic and foreign markets.

  16. Grape Berry Colonization and Biological Control of Botrytis cinerea by Indigenous Vineyard Yeasts

    Science.gov (United States)

    Botrytis bunch rot, caused by Botrytis cinerea, is the most important disease of grape berries, especially during transportation and storage. Biological control is a potential means of postharvest management of Botrytis bunch rot. The study was aimed at testing the hypothesis that antagonistic yeast...

  17. Biological control of tropical soda apple (Solanaceae) in Florida: Post-release evaluation

    Science.gov (United States)

    The leaf feeding beetle Gratiana boliviana Spaeth (Coleoptera: Chrysomelidae) was released as a biological control agent against tropical soda apple (TSA) (Solanum viarum Dunal (Solanaceae)) in Sumter County, FL in 2006. Evaluation of beetle feeding damage to TSA plants and changes in the beetle po...

  18. Releases of natural enemies in Hawaii since 1980 for classical biological control of weeds

    Science.gov (United States)

    P. Conant; J. N. Garcia; M. T. Johnson; W. T. Nagamine; C. K. Hirayama; G. P. Markin; R. L. Hill

    2013-01-01

    A comprehensive review of biological control of weeds in Hawaii was last published in 1992, covering 74 natural enemy species released from 1902 through 1980. The present review summarizes releases of 21 natural enemies targeting seven invasive weeds from 1981 to 2010. These projects were carried out by Hawaii Department of Agriculture (HDOA), USDA Forest Service (USFS...

  19. Using matrix population models to inform biological control management of the wheat stem sawfly, Cephus cinctus

    Science.gov (United States)

    Demographic models are a powerful means of identifying vulnerable life stages of pest species and assessing the potential effectiveness of various management approaches in reducing pest population growth and spread. In a biological control context, such models can be used to focus foreign explorati...

  20. Erroneous host identification frustrates systematics and delays implementation of biological control

    NARCIS (Netherlands)

    Bin, F.; Roversi, P.F.; Lenteren, van J.C.

    2012-01-01

    Misidentifications of pests and their natural enemies and misinterpretations of pest-natural enemy associations have led to the failure of a number of biological control projects. In addition to misidentification, more complicated kinds of errors, such as mistakes in establishing host records of