WorldWideScience

Sample records for biological control pathogen

  1. BIOLOGICAL CONTROL OF WEEDS BY MEANS OF PLANT PATHOGENS

    OpenAIRE

    Marija Ravlić; Renata Baličević

    2014-01-01

    Biological control is the use of live beneficial organisms and products of their metabolism in the pests control. Plant pathogens can be used for weed control in three different ways: as classical, conservation and augmentative (inoculative and inundated) biological control. Inundated biological control involves the use of bioherbicides (mycoherbicides) or artificial breeding of pathogens and application in specific stages of crops and weeds. Biological control of weeds can be used where chem...

  2. BIOLOGICAL CONTROL OF WEEDS BY MEANS OF PLANT PATHOGENS

    Directory of Open Access Journals (Sweden)

    Marija Ravlić

    2014-06-01

    Full Text Available Biological control is the use of live beneficial organisms and products of their metabolism in the pests control. Plant pathogens can be used for weed control in three different ways: as classical, conservation and augmentative (inoculative and inundated biological control. Inundated biological control involves the use of bioherbicides (mycoherbicides or artificial breeding of pathogens and application in specific stages of crops and weeds. Biological control of weeds can be used where chemical herbicides are not allowed, if resistant weed species are present or in the integrated pest management against weeds with reduced herbicides doses and other non-chemical measures, but it has certain limitations and disadvantages.

  3. Microbiome studies in the biological control of plant pathogens

    Science.gov (United States)

    Biological control of plant pathogens, although it has been a successful alternative that has allowed to select microorganisms for the generation of bioproducts and to understand multiple biological mechanisms, cannot be considered as a strategy defined only from the selection of a range of cultiva...

  4. Biological control of livestock pests: Pathogens

    Science.gov (United States)

    Interest in biological methods for livestock and poultry pest management is largely motivated by the development of resistance to most of the available synthetic pesticides by the major pests. There also has been a marked increase in organic systems, and those that promote animal welfare by reducing...

  5. Insect pathogens as biological control agents: Back to the future.

    Science.gov (United States)

    Lacey, L A; Grzywacz, D; Shapiro-Ilan, D I; Frutos, R; Brownbridge, M; Goettel, M S

    2015-11-01

    The development and use of entomopathogens as classical, conservation and augmentative biological control agents have included a number of successes and some setbacks in the past 1years. In this forum paper we present current information on development, use and future directions of insect-specific viruses, bacteria, fungi and nematodes as components of integrated pest management strategies for control of arthropod pests of crops, forests, urban habitats, and insects of medical and veterinary importance. Insect pathogenic viruses are a fruitful source of microbial control agents (MCAs), particularly for the control of lepidopteran pests. Most research is focused on the baculoviruses, important pathogens of some globally important pests for which control has become difficult due to either pesticide resistance or pressure to reduce pesticide residues. Baculoviruses are accepted as safe, readily mass produced, highly pathogenic and easily formulated and applied control agents. New baculovirus products are appearing in many countries and gaining an increased market share. However, the absence of a practical in vitro mass production system, generally higher production costs, limited post application persistence, slow rate of kill and high host specificity currently contribute to restricted use in pest control. Overcoming these limitations are key research areas for which progress could open up use of insect viruses to much larger markets. A small number of entomopathogenic bacteria have been commercially developed for control of insect pests. These include several Bacillus thuringiensis sub-species, Lysinibacillus (Bacillus) sphaericus, Paenibacillus spp. and Serratia entomophila. B. thuringiensis sub-species kurstaki is the most widely used for control of pest insects of crops and forests, and B. thuringiensis sub-species israelensis and L. sphaericus are the primary pathogens used for control of medically important pests including dipteran vectors. These pathogens

  6. Biological control of dodder (Cuscuta campestris L. by fungi pathogens

    Directory of Open Access Journals (Sweden)

    F. Fallahpour

    2016-04-01

    Full Text Available Parasite weeds are the most important yield reducing factors, and among them dodder (Cuscuta campestris L. is an obligate parasite of many plant families. In order to find a suitable biocontrol agent for dodder a study was conducted based on a randomized complete design with four replications at research greenhouse of Faculty of Agriculture, Ferdowsi University of Mashhad, Iran during 2007-2009. Diseased dodders sampled from sugarbeet farms of Chenaran, Iran. After culturing and isolating exiting fungi from infected tissues of dodder, Fusarium sp., Alternaria sp. and Colletotrichum sp. were recognized. Inoculation of isolates was carried out with concenteration of 1×108 spores per ml sterile water at different growth stages of dodder in labratoary and greenhouse. Among different fungi, isolate of 323 of F. oxysporum showed an effective control on germination of dodder seeds and the highest level of plant pathogencity was before the contact of dodder with host and infection in older plants decreased. Infection of this isolate with crops such as sugarbeet (Beta vulgaris L., alfalfa (Medigago sativa L., basil (Ocimum basilicum L., wheat (Triticum aestivum L. and barley (Hordeum vulgare L. showed no symptoms.

  7. Trichoderma-plant-pathogen interactions: advances in genetics of biological control.

    Science.gov (United States)

    Mukherjee, Mala; Mukherjee, Prasun K; Horwitz, Benjamin A; Zachow, Christin; Berg, Gabriele; Zeilinger, Susanne

    2012-12-01

    Trichoderma spp. are widely used in agriculture as biofungicides. Induction of plant defense and mycoparasitism (killing of one fungus by another) are considered to be the most important mechanisms of Trichoderma-mediated biological control. Understanding these mechanisms at the molecular level would help in developing strains with superior biocontrol properties. In this article, we review our current understanding of the genetics of interactions of Trichoderma with plants and plant pathogens.

  8. Utilization of biological control agents for the management of postharvest pathogens of tomato

    International Nuclear Information System (INIS)

    Zafar, M.U.; Ansari, S.U.

    2016-01-01

    Twenty five isolates of Trichoderma, Bacillus and Pseudomonas spp. were obtained from rhizosphere of tomato growing fields using soil dilution technique on potato dextrose agar (PDA) and nutrient agar (NA) medium. Screening of these isolates were done against Geotrichum candidum, Trichothecium roseum and Rhizopus oryzae, causal agents of sour rot, pink mold rot and Rhizopus soft rot of tomato under the laboratory conditions. One promising isolate of each Trichoderma harzianum, Bacillus spp. and Pseudomonas fluorescens from the twenty five isolates were chosen and further evaluated as potential biological control agents (BCAs) against three important postharvest pathogens of tomato. Dual culture and spore concentration assay revealed that all three isolates inhibited radial growth of G. candidum, T. roseum and R. oryzae. Tomato fruits were inoculated with 25 micro L suspension of 10/sup 8/ cfu mL-1 for T. harzianum and 10/sup 8/cfu mL-1for each Bacillus sp. and P. fluorescens. Twenty four hours later the treated fruits were inoculated with 25 micro L of 105 conidia/mL of each of three postharvest pathogens. The results showed that P. fluorescens provided good control (78.1%) of G. candidum and (82.2%) R. oryzae, while, T. harzianum proved less effective to control all three pathogens. Bacillus spp. was only effective (88.4%) against T. roseum. Hence, our results depicted that Bacillus spp. and P. fluorescens proved to be a potential antagonist of T. roseum and R. oryzae however, all the tested BCAs were not consistent in their action against three postharvest pathogens of tomato. (author)

  9. Entomopathogenic fungi as biological controllers: New insights into their virulence and pathogenicity

    Directory of Open Access Journals (Sweden)

    Shahid Ali Ahmad

    2012-01-01

    Full Text Available Entomopathogenic fungi vary considerably in their mode of action and virulence. Successful infection depends primarily on the adherence and penetration ability of a fungus to the host integuments. A variety of extracellular enzymes is produced during the degradation of insect integument. The attempts to control insects have changed over time from chemicals to natural control methods. This is why the development of natural methods of insect control or biopesticides, is preferred. By the use of fungal entomopathogens, insect pests can be controlled. There is no doubt that insects have been used for many years, but their effective use in the field remains elusive. However, their additional role in nature has also been discovered. Comparison of entomopathogens with conventional chemical pesticides depends on their efficiency and cost. In addition to efficiency, there are advantages in using microbial control agents, such as human safety and other non-target organisms; pesticide residues are minimized in food and biodiversity increased in managed ecosystems. In the present review the pathogenicity and virulence of entomopathogenic fungi and their role as biological control agents using biotechnology will be discussed.

  10. [An example of research on biological control: Entomophthora fungi pathogenic for aphids].

    Science.gov (United States)

    Latgé, J P; Remaudière, G; Papierok, B

    1978-01-01

    The results obtained in 15 years of research on the Entomophthorales pathogen of aphids showed the importance of the action of these fungi in the regulation of natural aphid populations and their possible use in agriculture as a biological control agent. Recent ecological studies on natural populations of aphids established the seasonal variation of the different fungal species and the diverse degrees of specificity between the species or groups of species of aphid and the various species of Entomophthora. The study of populations dynamics of an aphid species on a cultivated plant permitted the determination of the way a certain number of biotic and abiotic factors, such as temperature, humidity, thresholds of the insect population and of the infecting fungus lead to an epizootic development. If the air propagation of the disease by conidia is understood for a long time, the role of the soil as a reservoir for the infecting fungus has been demonstrated recently. Under favourable climatic conditions, the use of industrially produced resistant resting spores would allow the regulation of aphid populations in nature.

  11. Stepwise screening of microorganisms for commercial use in biological control of plant pathogenic fungi and bacteria. Biological Control

    NARCIS (Netherlands)

    Köhl, J.; Postma, J.; Nicot, P.; Ruocco, M.

    2011-01-01

    The development of new biocontrol products against plant diseases requires screening of high numbers of candidate antagonists. Antagonists for commercial use have to fulfill many different requirements. Besides being active against the specific targeted plant pathogens they must be safe and

  12. Management of plant pathogens and pests using microbial biological control agents. In: Trigiano, R.N. and Ownley, B.H., editors. Plant Pathology Concepts and Laboratory Exercises

    Science.gov (United States)

    All parts of plants face continual attack by plant pathogens and insects. Some insects are vectors of pathogens. Plant pests can be controlled by a variety of methods including application of pesticides but one of the most stainable and environmentally friendly approaches is biological control. Mic...

  13. Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control.

    Science.gov (United States)

    Churchill, Alice C L

    2011-05-01

    Banana (Musa spp.) is grown throughout the tropical and subtropical regions of the world. The fruits are a key staple food in many developing countries and a source of income for subsistence farmers. Bananas are also a major, multibillion-dollar export commodity for consumption primarily in developed countries, where few banana cultivars are grown. The fungal pathogen Mycosphaerella fijiensis causes black leaf streak disease (BLSD; aka black Sigatoka leaf spot) on the majority of edible banana cultivars grown worldwide. The fact that most of these cultivars are sterile and unsuitable for the breeding of resistant lines necessitates the extensive use of fungicides as the primary means of disease control. BLSD is a significant threat to the food security of resource-poor populations who cannot afford fungicides, and increases the environmental and health hazards where large-acreage monocultures of banana (Cavendish subgroup, AAA genome) are grown for export. Mycosphaerella fijiensis M. Morelet is a sexual, heterothallic fungus having Pseudocercospora fijiensis (M. Morelet) Deighton as the anamorph stage. It is a haploid, hemibiotrophic ascomycete within the class Dothideomycetes, order Capnodiales and family Mycosphaerellaceae. Its taxonomic placement is based on DNA phylogeny, morphological analyses and cultural characteristics. Mycosphaerella fijiensis is a leaf pathogen that causes reddish-brown streaks running parallel to the leaf veins, which aggregate to form larger, dark-brown to black compound streaks. These streaks eventually form fusiform or elliptical lesions that coalesce, form a water-soaked border with a yellow halo and, eventually, merge to cause extensive leaf necrosis. The disease does not kill the plants immediately, but weakens them by decreasing the photosynthetic capacity of leaves, causing a reduction in the quantity and quality of fruit, and inducing the premature ripening of fruit harvested from infected plants. Although Musa spp. are the

  14. Effcacy of different biological control agents against major postharvest pathogens of grapes under room temperature storage conditions

    Directory of Open Access Journals (Sweden)

    Ramu SENTHIL

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 Grapes were treated post harvest with a variety of biological agents to determine their effcacy in reducing yield loss. The agents Pseudomonas, Bacillus, Trichoderma and yeast isolates were individually screened against a number of postharvest pathogens including Aspergillus carbonarius, Penicillum expansum, and Fusarium moniliforme. B. subtilis strains EPC-8 and EPCO-16 showed high mycelial growth suppression of A. carbonarius and P. expansum  in vitro. The fungal antagonist Trichoderma viride strain (Tv Tvm was the most effective, inhibiting mycelial growth by 88.8 per cent. The biological control agents were tested in pre, post and combined inoculation studies against postharvest pathogens of grapes.  In the pre inoculation, B. subtilis (EPC-8 reduced the disease incidence of A. carbonarius causing rot, T. harzianum (Th Co was effective against P. expansum, and T. viride (Tv Tvm was effective against F. moniliforme. The same trend of effectiveness was also found in the post-inoculation and combined inoculation tests.

  15. Fungal pathogens of Miconia calvescens (Melastomataceae) from Brazil, with reference to classical biological control.

    Science.gov (United States)

    Seixas, Claudine D S; Barreto, Robert W; Killgore, Eloise

    2007-01-01

    A survey of fungal pathogens of Miconia calvescens was carried out in Brazil aimed at finding potential classical biocontrol agents for management of this invasive alien weed in Hawaii. Coccodiella miconiae, Glomerella cingulata (= Colletotrichum gloeosporioides f. sp. miconiae) and the new species Guignardia miconiae and Korunomyces prostratus were found associated with foliar diseases and are described herein. Two previously undescribed spore stages of Coccodiella miconiae also were obtained allowing a complete description of this species. Pseudocercospora tamonae associated with leaf spots of other species of Miconia also was collected and also was proven to be pathogenic to M. calvescens.

  16. Entomopathogenic fungi as biological controllers: New insights into their virulence and pathogenicity

    OpenAIRE

    Shahid Ali Ahmad; Rao Qayyum Abdul; Bakhsh Allah; Husnain Tayyab

    2012-01-01

    Entomopathogenic fungi vary considerably in their mode of action and virulence. Successful infection depends primarily on the adherence and penetration ability of a fungus to the host integuments. A variety of extracellular enzymes is produced during the degradation of insect integument. The attempts to control insects have changed over time from chemicals to natural control methods. This is why the development of natural methods of insect control or biopesticides, is preferred. By the ...

  17. IRIDOID GLYCOSIDES FROM LINARIA GENISTIFOLIA (L. MILL. IN BIOLOGICAL CONTROL OF SOIL-BORNE FUNGAL PATHOGENS OF WHEAT AND SOME STRUCTURE CONSIDERATIONS

    Directory of Open Access Journals (Sweden)

    Natalia Mashcenko

    2015-06-01

    Full Text Available Biological activity of the iridoid glycosides extract from Linaria genistifolia (L. Mill. has been investigated, namely its influence on the resistance of the winter wheat Odesschi 51 plant to the caused by the Fusarium oxysporum and Helminthosporium avenae pathogenic fungi root rot. Our results indicate that summary iridoid glycosides from this plant, containing four major known compounds: 5-O-allosylantirrinoside, antirrinoside, linarioside and 6-β-hidroxiantirride, can be successfully employed in biological control of the afore-mentioned wheat pathogens: it stimulates wheat grains germination and embryonic root growth in conditions of fungal infection. 1H and 13C NMR characteristics of 5-O-allosylantirrinoside in Py-d5 are for the first time presented. Structures of two conformers of 5-O-allosylantirrinoside in D2O and Py-d5 solutions are proposed, based on the experimental NMR evidence and molecular modelling studies.

  18. PCR-based identification of the pathogenic bacterium, Acaricomes phytoseiuli, in the biological control agent Phytoseiulus persimilis (Acari: Phytoseiidae)

    NARCIS (Netherlands)

    Gols, R.; Schütte, C.; Stouthamer, R.; Dicke, M.

    2007-01-01

    The predatory mite, Phytoseiulus persimilis is an important biological control agent of herbivorous spider mites. This species is also intensively used in the study of tritrophic effects of plant volatiles in interactions involving plants, herbivores, and their natural enemies. Recently, a novel

  19. Biological control of strawberry soil-borne pathogens Macrophomina phaseolina and Fusarium solani, using Trichoderma asperellum and Bacillus spp.

    Directory of Open Access Journals (Sweden)

    Ana María PASTRANA

    2016-05-01

    Full Text Available In south-western Spain, Macrophomina phaseolina and Fusarium solani were found to be associated in strawberry plants with, respectively, charcoal rot, and crown and root rot symptoms. For management of both fungal diseases, the antagonistic effects of two commercial formulations, one based on Trichoderma asperellum T18 strain (Prodigy® and the other on Bacillus megaterium and B. laterosporus (Fusbact®, were evaluated in vitro and under controlled environment and field conditions. Two inoculation methods (root-dipping and soil application and two application times (pre- and post-pathogen inoculation, as preventive and curative treatments, respectively were assessed. Dual plate confrontation experiments demonstrated the antagonistic effects of T. asperellum and Bacillus spp. by inhibiting radial growth of M. phaseolina and F. solani by more than 36%. Preventive application of T. asperellum by root-dipping reduced the incidence of charcoal rot (up to 44% in a growth chamber and up to 65% under field conditions and also reduced disease progression, the percentage of crown necrosis, as well as the level of infection measured as ng of pathogen DNA g-1 plant by quantitative real-time PCR. This treatment was also the most effective for reduction of crown and root rot caused by F. solani (up to 100% in a greenhouse and up to 81% under field conditions. These results were nearly comparable with the control achieved using chemical fungicides. The Bacillus spp.-based formulation was also effective for control of charcoal rot and showed variable results for control of F. solani, depending on the growth conditions.

  20. Biological control of ticks

    Science.gov (United States)

    Samish, M.; Ginsberg, H.; Glazer, I.; Bowman, A.S.; Nuttall, P.

    2004-01-01

    Ticks have numerous natural enemies, but only a few species have been evaluated as tick biocontrol agents (BCAs). Some laboratory results suggest that several bacteria are pathogenic to ticks, but their mode of action and their potential value as biocontrol agents remain to be determined. The most promising entomopathogenic fungi appear to be Metarhizium anisopliae and Beauveria bassiana, strains of which are already commercially available for the control of some pests. Development of effective formulations is critical for tick management. Entomopathogenic nematodes that are pathogenic to ticks can potentially control ticks, but improved formulations and selection of novel nematode strains are needed. Parasitoid wasps of the genus Ixodiphagus do not typically control ticks under natural conditions, but inundative releases show potential value. Most predators of ticks are generalists, with a limited potential for tick management (one possible exception is oxpeckers in Africa). Biological control is likely to play a substantial role in future IPM programmes for ticks because of the diversity of taxa that show high potential as tick BCAs. Considerable research is required to select appropriate strains, develop them as BCAs, establish their effectiveness, and devise production strategies to bring them to practical use.

  1. The Tick Microbiome: Why Non-pathogenic Microorganisms Matter in Tick Biology and Pathogen Transmission

    Directory of Open Access Journals (Sweden)

    Sarah I. Bonnet

    2017-06-01

    Full Text Available Ticks are among the most important vectors of pathogens affecting humans and other animals worldwide. They do not only carry pathogens however, as a diverse group of commensal and symbiotic microorganisms are also present in ticks. Unlike pathogens, their biology and their effect on ticks remain largely unexplored, and are in fact often neglected. Nonetheless, they can confer multiple detrimental, neutral, or beneficial effects to their tick hosts, and can play various roles in fitness, nutritional adaptation, development, reproduction, defense against environmental stress, and immunity. Non-pathogenic microorganisms may also play a role in driving transmission of tick-borne pathogens (TBP, with many potential implications for both human and animal health. In addition, the genetic proximity of some pathogens to mutualistic symbionts hosted by ticks is evident when studying phylogenies of several bacterial genera. The best examples are found within members of the Rickettsia, Francisella, and Coxiella genera: while in medical and veterinary research these bacteria are traditionally recognized as highly virulent vertebrate pathogens, it is now clear to evolutionary ecologists that many (if not most Coxiella, Francisella, and Rickettsia bacteria are actually non-pathogenic microorganisms exhibiting alternative lifestyles as mutualistic ticks symbionts. Consequently, ticks represent a compelling yet challenging system in which to study microbiomes and microbial interactions, and to investigate the composition, functional, and ecological implications of bacterial communities. Ultimately, deciphering the relationships between tick microorganisms as well as tick symbiont interactions will garner invaluable information, which may aid in the future development of arthropod pest and vector-borne pathogen transmission control strategies.

  2. Detection and treatment of chemical weapons and/or biological pathogens

    Science.gov (United States)

    Mariella Jr., Raymond P.

    2004-09-07

    A system for detection and treatment of chemical weapons and/or biological pathogens uses a detector system, an electrostatic precipitator or scrubber, a circulation system, and a control. The precipitator or scrubber is activated in response to a signal from the detector upon the detection of chemical weapons and/or biological pathogens.

  3. Biological control of the cucurbit powdery mildew pathogen Podosphaera xanthii by means of the epiphytic fungus Pseudozyma aphidis and parasitism as a mode of action.

    Science.gov (United States)

    Gafni, Aviva; Calderon, Claudia E; Harris, Raviv; Buxdorf, Kobi; Dafa-Berger, Avis; Zeilinger-Reichert, Einat; Levy, Maggie

    2015-01-01

    Epiphytic yeasts, which colonize plant surfaces, may possess activity that can be harnessed to help plants defend themselves against various pathogens. Due to their unique characteristics, epiphytic yeasts belonging to the genus Pseudozyma hold great potential for use as biocontrol agents. We identified a unique, biologically active isolate of the epiphytic yeast Pseudozyma aphidis that is capable of inhibiting Botrytis cinerea via a dual mode of action, namely induced resistance and antibiosis. Here, we show that strain L12 of P. aphidis can reduce the severity of powdery mildew caused by Podosphaera xanthii on cucumber plants with an efficacy of 75%. Confocal and scanning electron microscopy analyses demonstrated P. aphidis proliferation on infected tissue and its production of long hyphae that parasitize the powdery mildew hyphae and spores as an ectoparasite. We also show that crude extract of P. aphidis metabolites can inhibit P. xanthii spore germination in planta. Our results suggest that in addition to its antibiosis as mode of action, P. aphidis may also act as an ectoparasite on P. xanthii. These results indicate that P. aphidis strain L12 has the potential to control powdery mildew.

  4. Biological control of the cucurbit powdery mildew pathogen Podosphaera xanthii by means of the epiphytic fungus Pseudozyma aphidis and parasitism as a mode of action

    Directory of Open Access Journals (Sweden)

    Aviva eGafni

    2015-03-01

    Full Text Available Epiphytic yeasts, which colonize plant surfaces, may possess activity that can be harnessed to help plants defend themselves against various pathogens. Due to their unique characteristics, epiphytic yeasts belonging to the genus Pseudozyma hold great potential for use as biocontrol agents. We identified a unique, biologically active isolate of the epiphytic yeast Pseudozyma aphidis that is capable of inhibiting Botrytis cinerea via a dual mode of action, namely induced resistance and antibiosis. Here, we show that strain L12 of P. aphidis can reduce the severity of powdery mildew caused by Podosphaera xanthii on cucumber plants with an efficacy of 75%. Confocal and scanning electron microscopy analyses demonstrated P. aphidis proliferation on infected tissue and its production of long hyphae that parasitize the powdery mildew hyphae and spores as an ectoparasite. We also show that crude extract of P. aphidis metabolites can inhibit P. xanthii spore germination in planta. Our results suggest that in addition to its antibiosis mode of action, P. aphidis may also act as an ectoparasite on P. xanthii. These results indicate that P. aphidis strain L12 has the potential to control powdery mildew.

  5. Evolutionary biology of bacterial and fungal pathogens

    National Research Council Canada - National Science Library

    Baquero, F

    2008-01-01

    ... and Evolutionary Dynamics of Pathogens * 21 Keith A. Crandall and Marcos Pérez-Losada II. Evolutionary Genetics of Microbial Pathogens 4. Environmental and Social Influences on Infectious Disea...

  6. Biological control of postharvest pathogens

    Science.gov (United States)

    Postharvest diseases of harvested commodities cause significant reductions in food availability and financial profits. Additionally, regulatory agencies are increasingly restricting or banning the postharvest use of synthetic chemical fungicides. This has increased the need to develop more ecofrie...

  7. Bacterial genome engineering and synthetic biology: combating pathogens.

    Science.gov (United States)

    Krishnamurthy, Malathy; Moore, Richard T; Rajamani, Sathish; Panchal, Rekha G

    2016-11-04

    The emergence and prevalence of multidrug resistant (MDR) pathogenic bacteria poses a serious threat to human and animal health globally. Nosocomial infections and common ailments such as pneumonia, wound, urinary tract, and bloodstream infections are becoming more challenging to treat due to the rapid spread of MDR pathogenic bacteria. According to recent reports by the World Health Organization (WHO) and Centers for Disease Control and Prevention (CDC), there is an unprecedented increase in the occurrence of MDR infections worldwide. The rise in these infections has generated an economic strain worldwide, prompting the WHO to endorse a global action plan to improve awareness and understanding of antimicrobial resistance. This health crisis necessitates an immediate action to target the underlying mechanisms of drug resistance in bacteria. The advent of new bacterial genome engineering and synthetic biology (SB) tools is providing promising diagnostic and treatment plans to monitor and treat widespread recalcitrant bacterial infections. Key advances in genetic engineering approaches can successfully aid in targeting and editing pathogenic bacterial genomes for understanding and mitigating drug resistance mechanisms. In this review, we discuss the application of specific genome engineering and SB methods such as recombineering, clustered regularly interspaced short palindromic repeats (CRISPR), and bacterial cell-cell signaling mechanisms for pathogen targeting. The utility of these tools in developing antibacterial strategies such as novel antibiotic production, phage therapy, diagnostics and vaccine production to name a few, are also highlighted. The prevalent use of antibiotics and the spread of MDR bacteria raise the prospect of a post-antibiotic era, which underscores the need for developing novel therapeutics to target MDR pathogens. The development of enabling SB technologies offers promising solutions to deliver safe and effective antibacterial therapies.

  8. Integrated Biological Control

    International Nuclear Information System (INIS)

    JOHNSON, A.R.

    2002-01-01

    Biological control is any activity taken to prevent, limit, clean up, or remediate potential environmental, health and safety, or workplace quality impacts from plants, animals, or microorganisms. At Hanford the principal emphasis of biological control is to prevent the transport of radioactive contamination by biological vectors (plants, animals, or microorganisms), and where necessary, control and clean up resulting contamination. Other aspects of biological control at Hanford include industrial weed control (e.g.; tumbleweeds), noxious weed control (invasive, non-native plant species), and pest control (undesirable animals such as rodents and stinging insects; and microorganisms such as molds that adversely affect the quality of the workplace environment). Biological control activities may be either preventive (apriori) or in response to existing contamination spread (aposteriori). Surveillance activities, including ground, vegetation, flying insect, and other surveys, and apriori control actions, such as herbicide spraying and placing biological barriers, are important in preventing radioactive contamination spread. If surveillance discovers that biological vectors have spread radioactive contamination, aposteriori control measures, such as fixing contamination, followed by cleanup and removal of the contamination to an approved disposal location are typical response functions. In some cases remediation following the contamination cleanup and removal is necessary. Biological control activities for industrial weeds, noxious weeds and pests have similar modes of prevention and response

  9. Exotic biological control agents

    NARCIS (Netherlands)

    Hajek, Ann E.; Hurley, Brett P.; Kenis, Marc; Garnas, Jeffrey R.; Bush, Samantha J.; Wingfield, Michael J.; Lenteren, van Joop C.; Cock, Matthew J.W.

    2016-01-01

    Biological control is a valuable and effective strategy for controlling arthropod pests and has been used extensively against invasive arthropods. As one approach for control of invasives, exotic natural enemies from the native range of a pest are introduced to areas where control is needed.

  10. Epigenetic control of effectors in plant pathogens

    Directory of Open Access Journals (Sweden)

    Mark eGijzen

    2014-11-01

    Full Text Available Plant pathogens display impressive versatility in adapting to host immune systems. Pathogen effector proteins facilitate disease but can become avirulence (Avr factors when the host acquires discrete recognition capabilities that trigger immunity. The mechanisms that lead to changes to pathogen Avr factors that enable escape from host immunity are diverse, and include epigenetic switches that allow for reuse or recycling of effectors. This perspective outlines possibilities of how epigenetic control of Avr effector gene expression may have arisen and persisted in plant pathogens, and how it presents special problems for diagnosis and detection of specific pathogen strains or pathotypes.

  11. The systems biology of host pathogen interactions.

    Directory of Open Access Journals (Sweden)

    Nikolai Petrovsky

    2013-06-01

    Full Text Available Infectious diseases constitute a major public health burden, particularly in developing countries. Amongst the pathogens afflicting humans, malaria, HIV, shigellosis and tuberculosis (TB cause a large number of deaths. Whilst antivirals, antibiotics and antiparasitic drugs have all helped to reduce the burden of disease, problems of drug resistance are increasingly common, presenting the need to come up with alternative approaches to disease prevention. Ideally, effective prophylactic vaccines would be developed against each of these infections, but unfortunately with the exception of TB, no vaccine is currently available against the other three infections. Baring a breakthrough, coming for example from the application of newer more potent adjuvants to vaccine candidates, new paradigms are needed to help tackle these infectious diseases.

  12. Insecticides and Biological Control

    Science.gov (United States)

    Furness, G. O.

    1972-01-01

    Use of insecticides has been questioned due to their harmful effects on edible items. Biological control of insects along with other effective practices for checking spread of parasites on crops are discussed. (PS)

  13. Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests.

    Science.gov (United States)

    Cassells, Alan C

    2012-01-01

    The ability to establish and grow plant cell, organ, and tissue cultures has been widely exploited for basic and applied research, and for the commercial production of plants (micro-propagation). Regardless of whether the application is for research or commerce, it is essential that the cultures be established in vitro free of biological contamination and be maintained as aseptic cultures during manipulation, growth, and storage. The risks from microbial contamination are spurious experimental results due to the effects of latent contaminants or losses of valuable experimental or commercial cultures. Much of the emphasis in culture contamination management historically focussed on the elimination of phytopathogens and the maintenance of cultures free from laboratory contamination by environmental bacteria, fungi (collectively referred to as "vitro pathogens", i.e. pathogens or environmental micro-organisms which cause culture losses), and micro-arthropods ("vitro pests"). Microbial contamination of plant tissue cultures is due to the high nutrient availability in the almost universally used Murashige and Skoog (Physiol Plant 15:473-497, 1962) basal medium or variants of it. In recent years, it has been shown that many plants, especially perennials, are at least locally endophytically colonized intercellularly by bacteria. The latter, and intracellular pathogenic bacteria and viruses/viroids, may pass latently into culture and be spread horizontally and vertically in cultures. Growth of some potentially cultivable endophytes may be suppressed by the high salt and sugar content of the Murashige and Skoog basal medium and suboptimal temperatures for their growth in plant tissue growth rooms. The management of contamination in tissue culture involves three stages: disease screening (syn. disease indexing) of the stock plants with disease and endophyte elimination where detected; establishment and pathogen and contaminant screening of established initial cultures

  14. Biological Control of Bacterial Wilt in South East Asia

    OpenAIRE

    Arwiyanto, Triwidodo

    2014-01-01

    Bacterial wilt disease caused by Ralstonia solanacearum destroys many crops of different plant families in South East Asia despite many researches about the disease, and the availability of developed control method in other parts of the world. There is no chemical available for the bacterial wilt pathogen and biological control is then chosen as an alternative to save the crops. Most of the biological control studies were based on antagonism between biological control agent and the pathogen. ...

  15. The Genome Biology of Effector Gene Evolution in Filamentous Plant Pathogens.

    Science.gov (United States)

    Sánchez-Vallet, Andrea; Fouché, Simone; Fudal, Isabelle; Hartmann, Fanny E; Soyer, Jessica L; Tellier, Aurélien; Croll, Daniel

    2018-05-16

    Filamentous pathogens, including fungi and oomycetes, pose major threats to global food security. Crop pathogens cause damage by secreting effectors that manipulate the host to the pathogen's advantage. Genes encoding such effectors are among the most rapidly evolving genes in pathogen genomes. Here, we review how the major characteristics of the emergence, function, and regulation of effector genes are tightly linked to the genomic compartments where these genes are located in pathogen genomes. The presence of repetitive elements in these compartments is associated with elevated rates of point mutations and sequence rearrangements with a major impact on effector diversification. The expression of many effectors converges on an epigenetic control mediated by the presence of repetitive elements. Population genomics analyses showed that rapidly evolving pathogens show high rates of turnover at effector loci and display a mosaic in effector presence-absence polymorphism among strains. We conclude that effective pathogen containment strategies require a thorough understanding of the effector genome biology and the pathogen's potential for rapid adaptation. Expected final online publication date for the Annual Review of Phytopathology Volume 56 is August 25, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

  16. Cloning, characterization, expression and antifungal activity of an alkaline serine protease of Aureobasidium pullulans PL5 involved in the biological control of postharvest pathogens.

    Science.gov (United States)

    Zhang, Dianpeng; Spadaro, Davide; Valente, Silvia; Garibaldi, Angelo; Gullino, Maria Lodovica

    2012-02-15

    An alkaline protease gene was amplified from genomic DNA and cDNA of the antagonistic yeast-like fungus Aureobasidium pullulans PL5, a biocontrol agent effective against Monilinia laxa on stone fruit and Botrytis cinerea and Penicillium expansum on pome fruits. An open reading frame of 1248 bp encoding a 415-amino acid (aa) protein with a calculated molecular weight (M(r)) of 42.9 kDa and an isoelectric point (pI) of 4.5 was characterized. The cDNAALP5 gene had an 18-amino acid signal peptide, one N-gylcosylation, one histidine active site, and one serine active site. The ALP5 gene with a M(r) of 1351 bp contained two introns. One intron was of 54 bp, while the other was of 50 bp. Protein BLAST and phylogenetic tree analysis of the deduced amino sequences from the cDNAALP5 gene showed that the encoded protein had 100% homology to a protease enzyme (ALP2) of a sea strain of A. pullulans, suggesting that the protein ALP5 was an alkaline serine protease. Expression of ALP5 in Escherichia coli BL21 (DE3), followed by identification with Western-blotting, purification with Ni-NTA and analysis of enzymatic activity, yielded an homogeneous recombinant ALP5 which hydrolysed the substrate casein and inhibited the mycelial growth of the pathogens. At its optimal pH of 10.0 and reaction temperature of 50°C, the recombinant protease exhibited the highest activity towards the substrate casein, though the highest stability was at lower temperatures and pH between 7.0 and 9.0. This study provided the direct evidence that extracellular proteases secreted by the antagonist A. pullulans PL5 played a role in the biocontrol activities against some postharvest pathogens of apple and peach. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Molecular biology of Ganoderma pathogenicity and diagnosis in coconut seedlings.

    Science.gov (United States)

    Kandan, A; Radjacommare, R; Ramanathan, A; Raguchander, T; Balasubramanian, P; Samiyappan, R

    2009-01-01

    The pathogenicity of Ganoderma boninense was tested on coconut seedlings under greenhouse conditions and infection confirmed by using immunological and molecular diagnostic tools. Desiccation of older leaves and the emergence of sporophores were observed from pathogen-inoculated seedlings, whereas a control seedling does not show any pathogenic symptoms. Mature sporophores were formed within 10-13 weeks after inoculation. Polyclonal antibodies raised against mycelial proteins of Ganoderma were used for detection of Ganoderma in infected field palm and seedlings through indirect enzyme-linked immunosorbent assay technique. We adopted dot-immunobinding assay for the detection of Ganoderma from greenhouse and field samples. Under nucleic-acid-based diagnosis, G. boninense (167 bp) was detected from artificially inoculated seedlings and infected field palms by polymerase chain reaction. Apart from these, histopathological studies also support the Ganoderma pathogenicity in coconut seedlings. The pathogenicity test and combination of all the three diagnostic methods for Ganoderma could be highly reliable, rapid, sensitive and effective screening of resistance in planting material in the future.

  18. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2009-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  19. Novel Micro-organisms controlling plant pathogens

    NARCIS (Netherlands)

    Köhl, J.

    2010-01-01

    The invention relates to control of pathogen caused diseases on leaves, fruits and ears in plants, such as apple scab (Venturia inaequalis by treatment of plant with an isolate of Cladosporium cladosporioides. The treatment is effective in both prevention and treatment of the fungal infection

  20. Biological Control of Plant Disease Caused by Bacteria

    Directory of Open Access Journals (Sweden)

    Triwidodo Arwiyanto

    2014-07-01

    Full Text Available Bacterial diseases in plants are difficult to control. The emphasis is on preventing the spread of the bacteria rather than curing the diseased plant. Integrated management measures for bacterial plant pathogens should be applied for successfull control. Biological control is one of the control measures viz. through the use of microorganisms to suppress the growth and development of bacterial plant pathogen and ultimately reduce the possibility of disease onset. The study of biological control of bacterial plant pathogen was just began compared with of fungal plant pathogen. The ecological nature of diverse bacterial plant pathogens has led scientists to apply different approach in the investigation of its biological control. The complex process of entrance to its host plant for certain soil-borne bacterial plant pathogens need special techniques and combination of more than one biological control agent. Problem and progress in controlling bacterial plant pathogens biologically will be discussed in more detail in the paper and some commercial products of biological control agents (biopesticides will be introduced.     Penyakit tumbuhan karena bakteri sulit dikendalikan. Penekanan pengendalian adalah pada pencegahan penyebaran bakteri patogen dan bukan pada penyembuhan tanaman yang sudah sakit. Untuk suksesnya pengendalian bakteri patogen tumbuhan diperlukan cara pengelolaan yang terpadu. Pengendalian secara biologi merupakan salah satu cara pengendalian dengan menggunakan mikroorganisme untuk menekan pertumbuhan dan perkembangan bakteri patogen tumbuhan dengan tujuan akhir menurunkan kemungkinan timbulnya penyakit. Sifat ekologi bakteri patogen tumbuhan yang berbeda-beda mengharuskan pendekatan yang berbeda pula dalam pengendaliannya secara biologi. Masalah dan perkembangan dalam pengendalian bakteri patogen tumbuhan secara biologi didiskusikan secara detail dalam makalah ini.

  1. OSHA Bloodborne Pathogens Standards Exposure Control Plan

    Science.gov (United States)

    Luhrs, Caro Elise; Teitelbaum, Rita

    1993-01-01

    The Hummer Associates Exposure Control Plan is designed to reduce significant occupational exposure to bloodborne pathogens and infectious materials for Hummer Associates health care personnel. Under universal precautions, all patients and all body fluids are considered potentially infectious for bloodborne pathogens. Medical personnel need not be at increased risk if universal precautions are correctly understood and followed. This program covers all employees who could reasonably anticipate contact with blood or other potentially infectious materials during the performance of their job responsibilities. Although HIV and hepatitis B are mentioned most often, this program applies to all bloodborne diseases. The two main components needed to implement this program are universal precautions and engineering/work practice controls. This program covers all employees who may have occupational exposure to blood or other potentially infectious materials. Other aspects of this program are discussed.

  2. Biological control of chestnut blight in Croatia: an interaction between host sweet chestnut, its pathogen Cryphonectria parasitica and the biocontrol agent Cryphonectria hypovirus 1.

    Science.gov (United States)

    Krstin, Ljiljana; Katanić, Zorana; Ježić, Marin; Poljak, Igor; Nuskern, Lucija; Matković, Ivana; Idžojtić, Marilena; Ćurković-Perica, Mirna

    2017-03-01

    Chestnut blight, caused by the fungus Cryphonectria parasitica, is a severe chestnut disease that can be controlled with naturally occurring hypoviruses in many areas of Europe. The aim of this research was to measure the effect of different Cryphonectria hypovirus 1 (CHV1) strains on the growth of the fungal host and select strains that could potentially be used for human-mediated biocontrol in forests and orchards, and to investigate whether and how chestnut-fungus-virus interactions affect the development and growth of the lesion area on cut stems. Two Croatian CHV1 strains (CR23 and M56/1) were selected as potential biocontrol agents. The sequencing of CHV1/ORF-A showed that both of these virus strains belonged to the Italian subtype of CHV1. In vitro transfection of selected virus strains from hypovirulent to genetically diverse virus-free fungal isolates and subsequent inoculation of all virus/fungus combinations on stems of genetically diverse sweet chestnut trees revealed that Croatian virus strain CR23 had an equally hypovirulent effect on the host as the strong French strain CHV1-EP713, while M56/1 had a weaker effect. Furthermore, it was shown that in some cases the same hypovirus/fungus combinations induced various degrees of canker development on different chestnut genotypes. Some CHV1 strains belonging to the Italian subtype have similar hypovirulent effects on C. parasitica to those belonging to the French subtype. Furthermore, chestnut susceptibility and recovery could be influenced by the response of chestnut trees to particular hypovirulent C. parasitica isolates, and virus-fungus-chestnut interactions could have significant implications for the success of chestnut blight biocontrol. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  3. Structure and Biological Activity of Pathogen-like Synthetic Nanomedicines

    Science.gov (United States)

    Lőrincz, Orsolya; Tőke, Enikő R.; Somogyi, Eszter; Horkay, Ferenc; Chandran, Preethi; Douglas, Jack F.; Szebeni, János; Lisziewicz, Julianna

    2011-01-01

    Here we characterize the structure, stability and intracellular mode-of-action of DermaVir nanomedicine that is under clinical development for the treatment of HIV/AIDS. This nanomedicine is comprised of pathogen-like pDNA/PEIm nanoparticles (NPs) having the structure and function resembling spherical viruses that naturally evolved to deliver nucleic acids to the cells. Atomic force microscopy demonstrated spherical 100–200nm NPs with a smooth polymer surface protecting the pDNA in the core. Optical-absorption determined both the NP structural stability and biological activity relevant to their ability to escape from the endosome and release the pDNA at the nucleus. Salt, pH and temperature influence the nanomedicine shelf-life and intracellular stability. This approach facilitates the development of diverse polyplex nanomedicines where the delivered pDNA-expressed antigens induce immune responses to kill infected cells. PMID:21839051

  4. Biological activity of Penaeus monodon GILT in shrimp pathogen protection

    Directory of Open Access Journals (Sweden)

    Aekkaraj Nualla-ong

    2017-04-01

    Full Text Available Gamma-interferon-inducible lysosomal thiol reductase (GILT contains a CXXC active site motif that possesses thiol reductase activity by catalyzing the disulfide bond reduction of exogenous antigens. Mutating the active site of human GILT to change the cysteine residues to serine residues eliminates this property. Our previous study reported that Penaeus monodon GILT (PmGILT contained a CXXS active site motif. Therefore, we assessed the enzymatic activity of PmGILT and demonstrated that it displayed identical thiol reductase activity at an acidic pH. In addition, the biological activity of PmGILT against shrimp pathogens, including white spot syndrome virus (WSSV and Gram-negative bacteria, was investigated. The neutralization of WSSV with PmGILT indicated the inhibition of WSSV invasion into shrimp hemocyte cells. Moreover, the relative percentage survival of shrimp injected with PmGILT-treated virus solution was 75%. Finally, the antimicrobial activity of PmGILT was confirmed by the growth inhibition of Vibrio harveyi. These results establish the role of PmGILT in the inhibition of the virulence of two major shrimp pathogens.

  5. Intervention strategies for control of foodborne pathogens

    Science.gov (United States)

    Juneja, Vijay K.

    2004-03-01

    The increasing numbers of illnesses associated with foodborne pathogens such as Listeria monocytogenes and Escherichia coli O157:H7, has renewed concerns about food safety because of consumer preferences for minimally processed foods that offer convenience in availability and preparation. Accordingly, the need for better control of foodborne pathogens has been paramount in recent years. Mechanical removal of microorganisms from food can be accomplished by centrifugation, filtration, trimming and washing. Cleaning and sanitation strategies can be used for minimizing the access of microorganisms in foods from various sources. Other strategies for control of foodborne pathogens include established physical microbiocidal treatments such as ionizing radiation and heating. Research has continued to demonstrate that food irradiation is a suitable process to control and possibly eliminate foodborne pathogens, for example Listeria monocytogenes and Escherichia coli O157:H7, from a number of raw and cooked meat and poultry products. Heat treatment is the most common method in use today for the inactivation of microorganisms. Microorganisms can also be destroyed by nonthermal treatments, such as application of high hydrostatic pressure, pulsed electric fields, oscillating magnetic fields or a combination of physical processes such as heat-irradiation, or heat-high hydrostatic pressure, etc. Each of the non-thermal technologies has specific applications in terms of the types of food that can be processed. Both conventional and newly developed physical treatments can be used in combination for controlling foodborne pathogens and enhancing the safety and shelf life of foods. Recent research has focused on combining traditional preservation factors with emerging intervention technologies. However, many key issues still need to be addressed for combination preservation factors or technologies to be useful in the food industry to meet public demands for foods with enhanced safety

  6. Advance in the biological handling of pathogen forming sclerocios

    International Nuclear Information System (INIS)

    Avila de Moreno, L.C.E.; Velandia Mosalve, J.

    1995-01-01

    Field rehearsals in the Center of Investigations Tibaitata allowed to determine that the mushrooms Trichoderma sp., Trichogramma search. Konigui No.1, Trichoderma search Konigui No.2 and Gliocladium sp. They have antagonistic effects against Rhizoctonia solani, that which showed in low percentages of tubers affected by R. solani, when the soil was treated with the mentioned mushrooms. In the control of Sclerotinia sclerotiorum, it was determined that Trichoderma barzianum should be applied in the moment in that it is presented more than 3 days of continuous humidity in the soil; lower these conditions 14.3 percent of plants it was only observed affected by the pathogen

  7. Biological control of toxic cyanobacteria

    CSIR Research Space (South Africa)

    Ndlela, L

    2016-04-01

    Full Text Available harmful algal blooms and their impacts in over 30 countries. Biological control is a method of introducing natural enemies to control an organism and has been more successful using microorganisms....

  8. Bacteriophages in the control of pathogenic vibrios

    DEFF Research Database (Denmark)

    Plaza, Nicolás; Castillo Bermúdez, Daniel Elías; Perez-Reytor, Diliana

    2018-01-01

    constitute a continuing threat for aquaculture. Moreover, the continuous use of antibiotics has been accompanied by an emergence of antibiotic resistance in Vibrio species, implying a necessity for efficient treatments. One promising alternative that emerges is the use of lytic bacteriophages; however......, there are some drawbacks that should be overcome to make phage therapy a widely accepted method. In this work, we discuss about the major pathogenic Vibrio species and the progress, benefits and disadvantages that have been detected during the experimental use of bacteriophages to their control....

  9. Pythium species and isolate diversity influence inhibition by the biological control agent Streptomyces lydicus

    Science.gov (United States)

    Disease control of soilborne pathogens by biological control agents has often been inconsistent under field conditions. One factor that may contribute to this inconsistency is the variability in response among pathogen populations and/or communities to the selected biological control agent. One hund...

  10. Non- chemical methods of seed treatment for control of seed- borne pathogens on vegetables

    NARCIS (Netherlands)

    Amein, T.; Wright, S.A.I.; Wickstrom, M.; Schmitt, A.; Koch, E.; Wolf, van der J.M.; Groot, S.P.C.; Werner, S.; Jahn, M.

    2006-01-01

    The aim of EU-project "Seed Treatments for Organic Vegetable Production" (STOVE) was to evaluate non-chemical methods for control of seed-borne pathogens in organic vegetable production. Physical (hot air, hot water and electron) and biologi-cal (microorganisms and different agents of natural

  11. Bacterial Genome Engineering and Synthetic Biology: Combating Pathogens

    Science.gov (United States)

    2016-11-04

    extremely high genome sequence similarity between non-pathogenic and pathogenic strains by targeting small sequence variations present in the...Microbiol 2011, 14(5):524-531. 46. Bikard D, Euler CW, Jiang W, Nussenzweig PM, Goldberg GW, Duportet X, Fischetti VA, Marraffini LA: Exploiting

  12. Biological Control of Bacterial Wilt in South East Asia

    Directory of Open Access Journals (Sweden)

    Triwidodo Arwiyanto

    2014-12-01

    Full Text Available Bacterial wilt disease caused by Ralstonia solanacearum destroys many crops of different plant families in South East Asia despite many researches about the disease, and the availability of developed control method in other parts of the world. There is no chemical available for the bacterial wilt pathogen and biological control is then chosen as an alternative to save the crops. Most of the biological control studies were based on antagonism between biological control agent and the pathogen. The biological control agents were intended to reduce the initial inoculum of the pathogen. The effort to minimize the initial inoculum of the pathogen by baiting with the use of hypersensitive host-plant was only reliable when conducted in the greenhouse experiments. Various microorganisms have been searched as possible biological control agents, for instance avirulent form of the pathogen, soil or rhizosphere bacteria (Bacillus spp. and fluorescent pseudomonads, actinomycetes (Streptomyces spp., yeast (Pichia uillermondii, Candida ethanolica, and a consortium of microorganisms known as effective microorganisms (EM. None of these biological control agents has been used in field application and they need further investigation in order to effectively control bacterial wilt. Opportunities and challenges in developing biological control to combat bacterial wilt are discussed in the paper. Penyakit layu bakteri yang disebabkan oleh Ralstonia solanacearum menghancurkan banyak tanaman dalam famili yang berbeda di Asia Tenggara meskipun telah banyak penelitian tentang metode pengendaliannya. Penyakit ini sulit dikendalikan karena banyaknya variabilitas patogen dan belum tersedianya sumber ketahanan yang mapan. Di samping itu, sampai saat ini belum ada bahan kimia yang tersedia untuk patogen layu bakteri ini sehingga pengendalian biologi kemudian dipilih sebagai cara alternatif untuk menyelamatkan tanaman. Sebagian besar penelitian pengendalian biologi didasarkan

  13. THE OCCURRENCE, GROWTH AND CONTROL OF PATHOGENS ...

    African Journals Online (AJOL)

    Fermented foods have many advantageous attributes such as improved nutritional value and safety against bacterial pathogens. These foods are also important for weaning purposes and hence play a role in protecting infants against foodborne diseases. However, pathogens have been isolated from some fermented foods ...

  14. Exposure Control--OSHA's Bloodborne Pathogens Standard.

    Science.gov (United States)

    Granville, Mark F.

    1993-01-01

    Explains schools' responsibilities in complying with the Occupational Safety and Health Administration's (OSHA) Bloodborne Pathogens Standard. Describes exposure determination plan, protective equipment, housekeeping practices, labeling of waste, training employees, hepatitis B vaccinations, postexposure evaluation and medical follow-up, and…

  15. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen

    NARCIS (Netherlands)

    Bolton, M.D.; Thomma, B.P.H.J.; Nelson, B.D.

    2006-01-01

    Sclerotinia sclerotiorum (Lib.) de Bary is a necrotrophic fungal pathogen causing disease in a wide range of plants. This review summarizes current knowledge of mechanisms employed by the fungus to parasitize its host with emphasis on biology, physiology and molecular aspects of pathogenicity. In

  16. Biological Control Strategies for Mosquito Vectors of Arboviruses.

    Science.gov (United States)

    Huang, Yan-Jang S; Higgs, Stephen; Vanlandingham, Dana L

    2017-02-10

    Historically, biological control utilizes predatory species and pathogenic microorganisms to reduce the population of mosquitoes as disease vectors. This is particularly important for the control of mosquito-borne arboviruses, which normally do not have specific antiviral therapies available. Although development of resistance is likely, the advantages of biological control are that the resources used are typically biodegradable and ecologically friendly. Over the past decade, the advancement of molecular biology has enabled optimization by the manipulation of genetic materials associated with biological control agents. Two significant advancements are the discovery of cytoplasmic incompatibility induced by Wolbachia bacteria, which has enhanced replacement programs, and the introduction of dominant lethal genes into local mosquito populations through the release of genetically modified mosquitoes. As various arboviruses continue to be significant public health threats, biological control strategies have evolved to be more diverse and become critical tools to reduce the disease burden of arboviruses.

  17. Biological Control Strategies for Mosquito Vectors of Arboviruses

    Directory of Open Access Journals (Sweden)

    Yan-Jang S. Huang

    2017-02-01

    Full Text Available Historically, biological control utilizes predatory species and pathogenic microorganisms to reduce the population of mosquitoes as disease vectors. This is particularly important for the control of mosquito-borne arboviruses, which normally do not have specific antiviral therapies available. Although development of resistance is likely, the advantages of biological control are that the resources used are typically biodegradable and ecologically friendly. Over the past decade, the advancement of molecular biology has enabled optimization by the manipulation of genetic materials associated with biological control agents. Two significant advancements are the discovery of cytoplasmic incompatibility induced by Wolbachia bacteria, which has enhanced replacement programs, and the introduction of dominant lethal genes into local mosquito populations through the release of genetically modified mosquitoes. As various arboviruses continue to be significant public health threats, biological control strategies have evolved to be more diverse and become critical tools to reduce the disease burden of arboviruses.

  18. Funding needed for assessments of weed biological control

    Science.gov (United States)

    John L. Maron; Dean E. Pearson; Stephen M. Hovick; Walter P. Carson

    2010-01-01

    Invasive non-native plants are a serious economic and ecological problem worldwide, and major efforts are therefore devoted to reducing weed abundance in agricultural and natural settings. Effective options for reducing invasive abundance and spread are few, although one common approach is biological control - the introduction of specialist herbivores or pathogens from...

  19. Control theory meets synthetic biology.

    Science.gov (United States)

    Del Vecchio, Domitilla; Dy, Aaron J; Qian, Yili

    2016-07-01

    The past several years have witnessed an increased presence of control theoretic concepts in synthetic biology. This review presents an organized summary of how these control design concepts have been applied to tackle a variety of problems faced when building synthetic biomolecular circuits in living cells. In particular, we describe success stories that demonstrate how simple or more elaborate control design methods can be used to make the behaviour of synthetic genetic circuits within a single cell or across a cell population more reliable, predictable and robust to perturbations. The description especially highlights technical challenges that uniquely arise from the need to implement control designs within a new hardware setting, along with implemented or proposed solutions. Some engineering solutions employing complex feedback control schemes are also described, which, however, still require a deeper theoretical analysis of stability, performance and robustness properties. Overall, this paper should help synthetic biologists become familiar with feedback control concepts as they can be used in their application area. At the same time, it should provide some domain knowledge to control theorists who wish to enter the rising and exciting field of synthetic biology. © 2016 The Author(s).

  20. Control of indigenous pathogenic bacteria in seafood

    DEFF Research Database (Denmark)

    Huss, Hans Henrik

    1997-01-01

    The pathogenic bacteria indigenous to the aquatic and general environment are listed. Their distribution in nature, prevalence in seafood and the possibilities for growth of these organisms in various types of products are outlined These data, combined with what is known regarding the epidemiology...

  1. The Promise of Systems Biology Approaches for Revealing Host Pathogen Interactions in Malaria

    Directory of Open Access Journals (Sweden)

    Meghan Zuck

    2017-11-01

    Full Text Available Despite global eradication efforts over the past century, malaria remains a devastating public health burden, causing almost half a million deaths annually (WHO, 2016. A detailed understanding of the mechanisms that control malaria infection has been hindered by technical challenges of studying a complex parasite life cycle in multiple hosts. While many interventions targeting the parasite have been implemented, the complex biology of Plasmodium poses a major challenge, and must be addressed to enable eradication. New approaches for elucidating key host-parasite interactions, and predicting how the parasite will respond in a variety of biological settings, could dramatically enhance the efficacy and longevity of intervention strategies. The field of systems biology has developed methodologies and principles that are well poised to meet these challenges. In this review, we focus our attention on the Liver Stage of the Plasmodium lifecycle and issue a “call to arms” for using systems biology approaches to forge a new era in malaria research. These approaches will reveal insights into the complex interplay between host and pathogen, and could ultimately lead to novel intervention strategies that contribute to malaria eradication.

  2. Biological characteristics and pathogenicity of a highly pathogenic Shewanella marisflavi infected sea cucumber (Apostichopus uaponicus)

    Science.gov (United States)

    Shewanella marisflavi isolate AP629 was characterized as a novel pathogen of sea cucumber. The LD50 values (14 days) in sea cucumber and swordtail fish were 3.89 × 106 and 4.85 × 104 CFU g-1 body weight, respectively. Studies on S. marisflavi had been conducted, including morphology, physiological a...

  3. [Screening strains for Trichoderma spp. for strong antagonism against ginseng root pathogens and study on their biological characters].

    Science.gov (United States)

    Zhao, A-Na; Ding, Wan-Long; Zhu, Dian-Long

    2006-10-01

    To screen the Trichodenna spp. for strong antagonist against ginseng root pathogens. The biological characters of ten Trichoderma strains were compared by culturing on different media. And their antagonistic activity against Phytophthora cactorum, Cylindrocarpon destructans and Rhizoctonia solani were measured on PDA. Tv04-2 and Th3080 showed a good growth on soil solution medium and PDA, and also showed high inhibitory efficacy to the three pathogens. The two Trichoderma strains showed different growth rate under light conditions and pH. Trichoderma strains were sensitive to most fungicides used in ginseng root disease controlling, however Tv04-2 was not sensitive to the fungicide Junchong Jueba.

  4. Biological and epidemiological aspects of the quarantine pathogen Phytophthora ramorum

    Directory of Open Access Journals (Sweden)

    Beatrice Ginetti

    2015-12-01

    Full Text Available Phytophthora ramorum is a quarantine pathogen that causes leaf blight and shoot dieback of the crown, bark cankers and death on a number of both ornamental and forest trees, especially in North America and northern Europe, where it has produced severe outbreaks.In Italy it was first reported in 2002, on Rhodondendron yakushimanum in a Piedmont nursery; after that it seemed to have disappeared, only to re-emerge in 2013 when numerous isolates were detected on batches of Viburnum tinus plants growing in some nurseries in the Pistoia area (Tuscany, which is an important district in the trade of nursery plants world-wide. This work reports on a number of laboratory tests that were carried out on isolates from infected plant samples. The micromorphological and macromorphological characteristics of the pathogen growing on carrot agar (CA, corn meal agar (CMA, malt extract agar (MEA potato dextrose agar, and V8 agar with added PARPNH (see text were determined, as was the growth rate at 10º, 15º, 20º, 25°, 30º, 32º and 35ºC. Molecular analysis was employed to identify the isolates more precisely. Inoculation trials under the bark were also carried out to ascertain the isolate virulence and the Koch’s Postulates.The Plant Protection Service of the Tuscan Region (SFR, Servizio Fitosanitario Regionale was alerted as soon as the pathogen infection was detected and it took the prescribed steps to eradicate the infection in the field and prevent the recurrence of an epidemic.

  5. Suitability of Commercial Transport Media for Biological Pathogens under Nonideal Conditions

    Directory of Open Access Journals (Sweden)

    Kyle Hubbard

    2011-01-01

    Full Text Available There is extensive data to support the use of commercial transport media as a stabilizer for known clinical samples; however, there is little information to support their use outside of controlled conditions specified by the manufacturer. Furthermore, there is no data to determine the suitability of said media for biological pathogens, specifically those of interest to the US military. This study evaluates commercial off-the-shelf (COTS transport media based on sample recovery, viability, and quality of nucleic acids and peptides for nonpathogenic strains of Bacillus anthracis, Yersinia pestis, and Venezuelan equine encephalitis virus, in addition to ricin toxin. Samples were stored in COTS, PBST, or no media at various temperatures over an extended test period. The results demonstrate that COTS media, although sufficient for the preservation of nucleic acid and proteinaceous material, are not capable of maintaining an accurate representation of biothreat agents at the time of collection.

  6. Exosome function: from tumor immunology to pathogen biology.

    Science.gov (United States)

    Schorey, Jeffrey S; Bhatnagar, Sanchita

    2008-06-01

    Exosomes are the newest family member of 'bioactive vesicles' that function to promote intercellular communication. Exosomes are derived from the fusion of multivesicular bodies with the plasma membrane and extracellular release of the intraluminal vesicles. Recent studies have focused on the biogenesis and composition of exosomes as well as regulation of exosome release. Exosomes have been shown to be released by cells of hematopoietic and non-hematopoietic origin, yet their function remains enigmatic. Much of the prior work has focused on exosomes as a source of tumor antigens and in presentation of tumor antigens to T cells. However, new studies have shown that exosomes might also promote cell-to-cell spread of infectious agents. Moreover, exosomes isolated from cells infected with various intracellular pathogens, including Mycobacterium tuberculosis and Toxoplasma gondii, have been shown to contain microbial components and can promote antigen presentation and macrophage activation, suggesting that exosomes may function in immune surveillance. In this review, we summarize our understanding of exosome biogenesis but focus primarily on new insights into exosome function. We also discuss their possible use as disease biomarkers and vaccine candidates.

  7. Electronic Integrated Disease Surveillance System and Pathogen Asset Control System

    Directory of Open Access Journals (Sweden)

    Tom G. Wahl

    2012-06-01

    Full Text Available Electronic Integrated Disease Surveillance System (EIDSS has been used to strengthen and support monitoring and prevention of dangerous diseases within One Health concept by integrating veterinary and human surveillance, passive and active approaches, case-based records including disease-specific clinical data based on standardised case definitions and aggregated data, laboratory data including sample tracking linked to each case and event with test results and epidemiological investigations. Information was collected and shared in secure way by different means: through the distributed nodes which are continuously synchronised amongst each other, through the web service, through the handheld devices. Electronic Integrated Disease Surveillance System provided near real time information flow that has been then disseminated to the appropriate organisations in a timely manner. It has been used for comprehensive analysis and visualisation capabilities including real time mapping of case events as these unfold enhancing decision making. Electronic Integrated Disease Surveillance System facilitated countries to comply with the IHR 2005 requirements through a data transfer module reporting diseases electronically to the World Health Organisation (WHO data center as well as establish authorised data exchange with other electronic system using Open Architecture approach. Pathogen Asset Control System (PACS has been used for accounting, management and control of biological agent stocks. Information on samples and strains of any kind throughout their entire lifecycle has been tracked in a comprehensive and flexible solution PACS. Both systems have been used in a combination and individually. Electronic Integrated Disease Surveillance System and PACS are currently deployed in the Republics of Kazakhstan, Georgia and Azerbaijan as a part of the Cooperative Biological Engagement Program (CBEP sponsored by the US Defense Threat Reduction Agency (DTRA.

  8. Electronic integrated disease surveillance system and pathogen asset control system.

    Science.gov (United States)

    Wahl, Tom G; Burdakov, Aleksey V; Oukharov, Andrey O; Zhilokov, Azamat K

    2012-06-20

    Electronic Integrated Disease Surveillance System (EIDSS) has been used to strengthen and support monitoring and prevention of dangerous diseases within One Health concept by integrating veterinary and human surveillance, passive and active approaches, case-based records including disease-specific clinical data based on standardised case definitions and aggregated data, laboratory data including sample tracking linked to each case and event with test results and epidemiological investigations. Information was collected and shared in secure way by different means: through the distributed nodes which are continuously synchronised amongst each other, through the web service, through the handheld devices. Electronic Integrated Disease Surveillance System provided near real time information flow that has been then disseminated to the appropriate organisations in a timely manner. It has been used for comprehensive analysis and visualisation capabilities including real time mapping of case events as these unfold enhancing decision making. Electronic Integrated Disease Surveillance System facilitated countries to comply with the IHR 2005 requirements through a data transfer module reporting diseases electronically to the World Health Organisation (WHO) data center as well as establish authorised data exchange with other electronic system using Open Architecture approach. Pathogen Asset Control System (PACS) has been used for accounting, management and control of biological agent stocks. Information on samples and strains of any kind throughout their entire lifecycle has been tracked in a comprehensive and flexible solution PACS.Both systems have been used in a combination and individually. Electronic Integrated Disease Surveillance System and PACS are currently deployed in the Republics of Kazakhstan, Georgia and Azerbaijan as a part of the Cooperative Biological Engagement Program (CBEP) sponsored by the US Defense Threat Reduction Agency (DTRA).

  9. "Protected biological control"- Biological pest management in the greenhouse industry

    NARCIS (Netherlands)

    Pilkington, L.J.; Messelink, G.J.; Lenteren, van J.C.; Mottee, Le K.

    2010-01-01

    This paper briefly describes the foundations and characteristics of biological control in protected cropping and what drivers are behind adoption of this management system within this industry. Examining a brief history of biological control in greenhouses and what makes it a successful management

  10. Biological control of corky root in tomato.

    Science.gov (United States)

    Fiume, G; Fiume, F

    2008-01-01

    Corky root caused by Pyrenochaeta lycopersici (Schneider et Gerlach) is one of the most important soil borne fungal pathogens which develops in the soils, causing diseases in different crops. The research was carried out to evaluate the effectiveness of the biological control of corky root on tomato. Biological control was performed by using Trichoderma viride Pers. 18/17 SS, Streptomyces spp. AtB42 and Bacillus subtilis M51 PI. According to present and future regulations on the use of chemical fungicides and considering that treatments must avoids environmental pollution, the main object of this research was to find alternative strategies by using biocontrol agents against P. lycopersici that affect tomato plants. In laboratory, the effectiveness of T. viride 18/17 SS, Streptomyces spp. AtB42 and B. subtilis M51 PI to control P. lycopersici were studied. In greenhouse, the research was carried out comparing the following treatments: 1) untreated control; 2) T. viride 18/17 SS; 3) Streptomyces spp. AtB42; 4) B. subtilis M51 PI. Roots of plants of tomato H3028 Hazera were treated with the antagonist suspensions just prior of transplant. Treatments were repeated about 2 months after, with the same suspensions sprayed on the soil to the plant collar. In dual culture, the inhibition of P. lycopersici ranged up to 81.2% (caused from T. viride 18/17 SS), 75.6% (from Streptomyces spp. AtB42) and 66.8% (from B. subtilis M51 PI). In greenhouse trials, with regard to corky root symptoms, all treated plots showed signifycative differences compared to untreated. T. viride gave the better results followed by Streptomyces spp. and then by B. subtilis. The fungus antagonist showed good root surface competence such as demonstrated its persistence on the roots surface of the tomato plants whose roots were treated with T. viride 18/17 SS up to 2 months before.

  11. Costs and benefits of biological control of invasive alien plants: case studies from South Africa

    CSIR Research Space (South Africa)

    Van Wilgen, BW

    2004-01-01

    Full Text Available Invasive alien species can have significant negative environmental and economic impacts. Such species are often controlled biologically by means of introducing host-specific insects or pathogens that can reduce the species' invasive potential...

  12. Quality Control Guidelines for SAM Pathogen Methods

    Science.gov (United States)

    Learn more about quality control guidelines and recommendations for the analysis of samples using the biotoxin methods listed in EPA's Selected Analytical Methods for Environmental Remediation and Recovery (SAM).

  13. Seed treatments to control seedborne fungal pathogens of vegetable crops.

    Science.gov (United States)

    Mancini, Valeria; Romanazzi, Gianfranco

    2014-06-01

    Vegetable crops are frequently infected by fungal pathogens, which can include seedborne fungi. In such cases, the pathogen is already present within or on the seed surface, and can thus cause seed rot and seedling damping-off. Treatment of vegetable seeds has been shown to prevent plant disease epidemics caused by seedborne fungal pathogens. Furthermore, seed treatments can be useful in reducing the amounts of pesticides required to manage a disease, because effective seed treatments can eliminate the need for foliar application of fungicides later in the season. Although the application of fungicides is almost always effective, their non-target environmental impact and the development of pathogen resistance have led to the search for alternative methods, especially in the past few years. Physical treatments that have already been used in the past and treatments with biopesticides, such as plant extracts, natural compounds and biocontrol agents, have proved to be effective in controlling seedborne pathogens. These have been applied alone or in combination, and they are widely used owing to their broad spectrum in terms of disease control and production yield. In this review, the effectiveness of different seed treatments against the main seedborne pathogens of some important vegetable crops is critically discussed. © 2013 Society of Chemical Industry.

  14. Biological control and sustainable food production

    NARCIS (Netherlands)

    Bale, J.S.; Lenteren, van J.C.; Bigler, F.

    2008-01-01

    The use of biological control for the management of pest insects pre-dates the modern pesticide era. The first major successes in biological control occurred with exotic pests controlled by natural enemy species collected from the country or area of origin of the pest (classical control).

  15. [Biosafety provision on handling pathogenic biological agents on the concept of biorisk assessment and management].

    Science.gov (United States)

    Dobrokhotskiĭ, O N; Kolombet, L V

    2010-01-01

    The paper shows it urgent to realize the concept of biological risk assessment and management on handling pathogenic biological agents (PBA). It gives a number of objective reasons that impede development of a methodology to assess laboratory biological risks. A concept of continuous improvement (a process approach) is proposed for use as a biorisk management tool for biosafety assurance when handling PBA. It is demonstrated that development of international cooperation urgently requires that national concepts and standards be harmonized with international regulatory documents on biosafety assurance on handling PBA.

  16. A Systems Biology Approach to Infectious Disease Research: Innovating the Pathogen-Host Research Paradigm

    Energy Technology Data Exchange (ETDEWEB)

    Aderem, Alan; Adkins, Joshua N.; Ansong, Charles; Galagan, James; Kaiser, Shari; Korth, Marcus J.; Law, G. L.; McDermott, Jason E.; Proll, Sean; Rosenberger, Carrie; Schoolnik, Gary; Katze, Michael G.

    2011-02-01

    The 20th century was marked by extraordinary advances in our understanding of microbes and infectious disease, but pandemics remain, food and water borne illnesses are frequent, multi-drug resistant microbes are on the rise, and the needed drugs and vaccines have not been developed. The scientific approaches of the past—including the intense focus on individual genes and proteins typical of molecular biology—have not been sufficient to address these challenges. The first decade of the 21st century has seen remarkable innovations in technology and computational methods. These new tools provide nearly comprehensive views of complex biological systems and can provide a correspondingly deeper understanding of pathogen-host interactions. To take full advantage of these innovations, the National Institute of Allergy and Infectious Diseases recently initiated the Systems Biology Program for Infectious Disease Research. As participants of the Systems Biology Program we think that the time is at hand to redefine the pathogen-host research paradigm.

  17. Biology and Water Pollution Control.

    Science.gov (United States)

    Warren, Charles E.

    Within this text, the reader is attuned to the role biology can and should play in combating the alarming increase in water pollution. Both the urgency of the problem and the biological techniques that are being developed to cope with the water pollution crisis are scrutinized; what is and is not known about the problem is explained; past,…

  18. Biological Control in Brazil: an overview

    OpenAIRE

    Parra,José Roberto Postali

    2014-01-01

    The use of Biological Control methods is on the increase, mainly as a result of the mobilization of human resources in entomology studies since the establishment of graduate programs in this country in the 1960s. This review approaches the retrospective of Biological Control in Brazil in recent decades, with an emphasis on the "culture of applying agrochemicals" adopted by Brazilian growers, which constrains progress in this area. Successful cases of Biological Control have been reported on i...

  19. Review of Pasteuria penetrans: Biology, Ecology, and Biological Control Potential.

    Science.gov (United States)

    Chen, Z X; Dickson, D W

    1998-09-01

    Pasteuria penetrans is a mycelial, endospore-forming, bacterial parasite that has shown great potential as a biological control agent of root-knot nematodes. Considerable progress has been made during the last 10 years in understanding its biology and importance as an agent capable of effectively suppressing root-knot nematodes in field soil. The objective of this review is to summarize the current knowledge of the biology, ecology, and biological control potential of P. penetrans and other Pasteuria members. Pasteuria spp. are distributed worldwide and have been reported from 323 nematode species belonging to 116 genera of free-living, predatory, plant-parasitic, and entomopathogenic nematodes. Artificial cultivation of P. penetrans has met with limited success; large-scale production of endospores depends on in vivo cultivation. Temperature affects endospore attachment, germination, pathogenesis, and completion of the life cycle in the nematode pseudocoelom. The biological control potential of Pasteuria spp. have been demonstrated on 20 crops; host nematodes include Belonolaimus longicaudatus, Heterodera spp., Meloidogyne spp., and Xiphinema diversicaudatum. Pasteuria penetrans plays an important role in some suppressive soils. The efficacy of the bacterium as a biological control agent has been examined. Approximately 100,000 endospores/g of soil provided immediate control of the peanut root-knot nematode, whereas 1,000 and 5,000 endospores/g of soil each amplified in the host nematode and became suppressive after 3 years.

  20. Conservation Physiology and Conservation Pathogens: White-Nose Syndrome and Integrative Biology for Host-Pathogen Systems.

    Science.gov (United States)

    Willis, Craig K R

    2015-10-01

    Conservation physiology aims to apply an understanding of physiological mechanisms to management of imperiled species, populations, or ecosystems. One challenge for physiologists hoping to apply their expertise to conservation is connecting the mechanisms we study, often in the laboratory, with the vital rates of populations in the wild. There is growing appreciation that infectious pathogens can threaten populations and species, and represent an important issue for conservation. Conservation physiology has much to offer in terms of addressing the threat posed to some host species by infectious pathogens. At the same time, the well-developed theoretical framework of disease ecology could provide a model to help advance the application of physiology to a range of other conservation issues. Here, I use white-nose syndrome (WNS) in hibernating North American bats as an example of a conservation problem for which integrative physiological research has been a critical part of research and management. The response to WNS highlights the importance of a well-developed theoretical framework for the application of conservation physiology to a particular threat. I review what is known about physiological mechanisms associated with mortality from WNS and emphasize the value of combining a strong theoretical background with integrative physiological studies in order to connect physiological mechanisms with population processes and thereby maximize the potential benefits of conservation physiology. © The Author 2015. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  1. Meat products: main pathogens and non-thermal control strategies

    Directory of Open Access Journals (Sweden)

    Norma Heredia

    2014-12-01

    Full Text Available Meat is a rich nutrient matrix that allows the proper environment for diverse microorganisms’ proliferation, deteriorative and pathogen. E. coli O157 and non-O157, Salmonella spp. and Listeria monocytogenes are among the pathogen ones. On other hand, the growing demand for “fresh-like” products with high sanitary, organoleptic and nutritional quality had drive the development of alternative technologies to traditional or thermal, to satisfy consumers’ demand. In the last decades new food preservation techniques with no effect on nutritional or organoleptic characteristics had been developed, maintaining or improving microbiological stability and quality. This work is review of the most common pathogen microorganisms in meat and meat products, and the emerging technologies like high hydrostatic pressure, radiation, intelligent and active packages, and the use of natutal compounds for their control.

  2. Pathogen filtration to control plant disease outbreak in greenhouse production

    Science.gov (United States)

    Jeon, Sangho; Krasnow, Charles; Bhalsod, Gemini; Granke, Leah; Harlan, Blair; Hausbeck, Mary; Zhang, Wei

    2016-04-01

    Previous research has been extensively focused on understanding the fate and transport of human microbial pathogens in soil and water environments. However, little is known about the transport of plant pathogens, although these pathogens are often found in irrigation waters and could cause severe crop damage and economical loss. Water mold pathogens including Phytophthora spp. and Pythium spp. are infective to a wide range of vegetable and floriculture crops, and they are primarily harbored in soils and disseminated through water flow. It is challenging to control these pathogens because they often quickly develop resistance to many fungicides. Therefore, this multi-scale study aimed to investigate physical removal of plant pathogens from water by filtration, thus reducing the pathogen exposure risks to crops. In column-scale experiments, we studied controlling factors on the transport and retention of Phytophthora capsici zoospores in saturated columns packed with iron oxide coated-sand and uncoated-sand under varying solution chemistry. Biflagellate zoospores were less retained than encysted zoospores, and lower solution pH and greater iron oxide content increased the retention of encysted zoospores. These results provided insights on environmental dispersal of Phytophthora zoospores in natural soils as well as on developing cost-effective engineered filtration systems for pathogen removal. Using small-scale greenhouse filtration systems, we further investigated the performance of varying filter media (i.e., granular sand, iron oxide coated ceramic porous media, and activated carbon) in mitigating disease outbreaks of Phytophthora and Pythium for greenhouse-grown squash and poinsettia, respectively, in comparison with fungicide treatment. For squash, filtration by iron oxide coated media was more effective in reducing the Phytophthora infection, comparing to sand filtration and fungicide application. For poinsettia, sand filtration performed better in controlling

  3. Multidrug-resistant opportunistic pathogens challenging veterinary infection control.

    Science.gov (United States)

    Walther, Birgit; Tedin, Karsten; Lübke-Becker, Antina

    2017-02-01

    Although the problems associated with healthcare-associated infections (HAI) and the emergence of zoonotic and multidrug-resistant pathogens in companion animal (dogs, cats and horses) medicine have been well-known for decades, current progress with respect to practical implementation of infection control programs in veterinary clinics has been limited. Clinical outbreak events reported for methicillin-resistant Staphylooccus aureus (MRSA) and Staphylococcus pseudintermedius (MRSP), extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and multidrug-resistant (MDR) Salmonella Serovars indicate the necessity of infection control strategies for protecting animal patients at risk as well as veterinary personnel. The close bond between humans and their companion animals provides opportunities for exchange of microorganisms, including MDR pathogens. This particular aspect of the "One Health" idea requires more representative surveillance efforts and infection control strategies with respect to animal-species specific characters. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Metabolic adaptation of a human pathogen during chronic infections - a systems biology approach

    DEFF Research Database (Denmark)

    Thøgersen, Juliane Charlotte

    modeling to uncover how human pathogens adapt to the human host. Pseudomonas aeruginosa infections in cystic fibrosis patients are used as a model system for under-­‐ standing these adaptation processes. The exploratory systems biology approach facilitates identification of important phenotypes...... by classical molecular biology approaches where genes and reactions typically are investigated in a one to one relationship. This thesis is an example of how mathematical approaches and modeling can facilitate new biologi-­‐ cal understanding and provide new surprising ideas to important biological processes....... and metabolic pathways that are necessary or related to establishment of chronic infections. Archetypal analysis showed to be successful in extracting relevant phenotypes from global gene expression da-­‐ ta. Furthermore, genome-­‐scale metabolic modeling showed to be useful in connecting the genotype...

  5. Fumigant dosages below maximum label rate control some soilborne pathogens

    Directory of Open Access Journals (Sweden)

    Shachaf Triky-Dotan

    2016-08-01

    Full Text Available The activity of commercial soil fumigants on some key soilborne pathogens was assessed in sandy loam soil under controlled conditions. Seven soil fumigants that are registered in California or are being or have been considered for registration were used in this study: dimethyl disulfide (DMDS mixed with chloropicrin (Pic (79% DMDS and 21% Pic, Tri-Con (50% methyl bromide and 50% Pic, Midas Gold (33% methyl iodide [MI] and 67% Pic, Midas Bronze (50% MI and 50% Pic, Midas (MI, active ingredient [a.i.] 97.8%, Pic (a.i. 99% trichloronitromethane and Pic-Clor 60 (57% Pic and 37% 1,3-dichloropropene [1–3,D]. Dose-response models were calculated for pathogen mortality after 24 hours of exposure to fumigants. Overall, the tested fumigants achieved good efficacy with dosages below the maximum label rate against the tested pathogens. In this study, Pythium ultimum and citrus nematode were sensitive to all the fumigants and Verticillium dahliae was resistant. For most fumigants, California regulations restrict application rates to less than the maximum (federal label rate, meaning that it is possible that the fumigants may not control major plant pathogens. This research provides information on the effectiveness of these alternatives at these lower application rates. The results from this study will help growers optimize application rates for registered fumigants (such as Pic and 1,3-D and will help accelerate the adoption of new fumigants (such as DMDS if they are registered in California.

  6. Synthetic biology expands chemical control of microorganisms.

    Science.gov (United States)

    Ford, Tyler J; Silver, Pamela A

    2015-10-01

    The tools of synthetic biology allow researchers to change the ways engineered organisms respond to chemical stimuli. Decades of basic biology research and new efforts in computational protein and RNA design have led to the development of small molecule sensors that can be used to alter organism function. These new functions leap beyond the natural propensities of the engineered organisms. They can range from simple fluorescence or growth reporting to pathogen killing, and can involve metabolic coordination among multiple cells or organisms. Herein, we discuss how synthetic biology alters microorganisms' responses to chemical stimuli resulting in the development of microbes as toxicity sensors, disease treatments, and chemical factories. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Is Vector Control Sufficient to Limit Pathogen Spread in Vineyards?

    Science.gov (United States)

    Daugherty, M P; O'Neill, S; Byrne, F; Zeilinger, A

    2015-06-01

    Vector control is widely viewed as an integral part of disease management. Yet epidemiological theory suggests that the effectiveness of control programs at limiting pathogen spread depends on a variety of intrinsic and extrinsic aspects of a pathosystem. Moreover, control programs rarely evaluate whether reductions in vector density or activity translate into reduced disease prevalence. In areas of California invaded by the glassy-winged sharpshooter (Homalodisca vitripennis Germar), Pierce's disease management relies heavily on chemical control of this vector, primarily via systemic conventional insecticides (i.e., imidacloprid). But, data are lacking that attribute reduced vector pressure and pathogen spread to sharpshooter control. We surveyed 34 vineyards over successive years to assess the epidemiological value of within-vineyard chemical control. The results showed that imidacloprid reduced vector pressure without clear nontarget effects or secondary pest outbreaks. Effects on disease prevalence were more nuanced. Treatment history over the preceding 5 yr affected disease prevalence, with significantly more diseased vines in untreated compared with regularly or intermittently treated vineyards. Yet, the change in disease prevalence between years was low, with no significant effects of insecticide treatment or vector abundance. Collectively, the results suggest that within-vineyard applications of imidacloprid can reduce pathogen spread, but with benefits that may take multiple seasons to become apparent. The relatively modest effect of vector control on disease prevalence in this system may be attributable in part to the currently low regional sharpshooter population densities stemming from area-wide control, without which the need for within-vineyard vector control would be more pronounced. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Factors controlling pathogen destruction during anaerobic digestion of biowastes

    International Nuclear Information System (INIS)

    Smith, S.R.; Lang, N.L.; Cheung, K.H.M.; Spanoudaki, K.

    2005-01-01

    Anaerobic digestion is the principal method of stabilising biosolids from urban wastewater treatment in the UK, and it also has application for the treatment of other types of biowaste. Increasing awareness of the potential risks to human and animal health from environmental sources of pathogens has focused attention on the efficacy of waste treatment processes at destroying pathogenic microorganisms in biowastes recycled to agricultural land. The degree of disinfection achieved by a particular anaerobic digester is influenced by a variety of interacting operational variables and conditions, which can often deviate from the ideal. Experimental investigations demonstrate that Escherichia coli and Salmonella spp. are not damaged by mesophilic temperatures, whereas rapid inactivation occurs by thermophilic digestion. A hydraulic, biokinetic and thermodynamic model of pathogen inactivation during anaerobic digestion showed that a 2 log 10 reduction in E. coli (the minimum removal required for agricultural use of conventionally treated biosolids) is likely to challenge most conventional mesophilic digesters, unless strict maintenance and management practices are adopted to minimise dead zones and by-pass flow. Efficient mixing and organic matter stabilisation are the main factors controlling the rate of inactivation under mesophilic conditions and not a direct effect of temperature per se on pathogenic organisms

  9. Is the efficacy of biological control against plant diseases likely to be more durable than that of chemical pesticides?

    Directory of Open Access Journals (Sweden)

    Marc eBardin

    2015-07-01

    Full Text Available The durability of a control method for plant protection is defined as the persistence of its efficacy in space and time. It depends on (i the selection pressure exerted by it on populations of plant pathogens and (ii on the capacity of these pathogens to adapt to the control method. Erosion of effectiveness of conventional plant protection methods has been widely studied in the past. For example, apparition of resistance to chemical pesticides in plant pathogens or pests has been extensively documented. The durability of biological control has often been assumed to be higher than that of chemical control. Results concerning pest management in agricultural systems have shown that this assumption may not always be justified. Resistance of various pests to one or several toxins of Bacillus thuringensis and apparition of resistance of the codling moth Cydia pomonella to the Cydia pomonella granulovirus have, for example, been described. In contrast with the situation for pests, the durability of biological control of plant diseases has hardly been studied and no scientific reports proving the loss of efficiency of biological control agents against plant pathogens in practice has been published so far. Knowledge concerning the possible erosion of effectiveness of biological control is essential to ensure a durable efficacy of biological control agents on target plant pathogens. This knowledge will result in identifying risk factors that can foster the selection of strains of plant pathogens resistant to biological control agents. It will also result in identifying types of biological control agents with lower risk of efficacy loss i.e. modes of action of biological control agents that does not favor the selection of resistant isolates in natural populations of plant pathogens. An analysis of the scientific literature was then conducted to assess the potential for plant pathogens to become resistant to biological control agents.

  10. Biological Systems Thinking for Control Engineering Design

    Directory of Open Access Journals (Sweden)

    D. J. Murray-Smith

    2004-01-01

    Full Text Available Artificial neural networks and genetic algorithms are often quoted in discussions about the contribution of biological systems thinking to engineering design. This paper reviews work on the neuromuscular system, a field in which biological systems thinking could make specific contributions to the development and design of automatic control systems for mechatronics and robotics applications. The paper suggests some specific areas in which a better understanding of this biological control system could be expected to contribute to control engineering design methods in the future. Particular emphasis is given to the nonlinear nature of elements within the neuromuscular system and to processes of neural signal processing, sensing and system adaptivity. Aspects of the biological system that are of particular significance for engineering control systems include sensor fusion, sensor redundancy and parallelism, together with advanced forms of signal processing for adaptive and learning control

  11. Control fast or control smart: When should invading pathogens be controlled?

    Directory of Open Access Journals (Sweden)

    Robin N Thompson

    2018-02-01

    Full Text Available The intuitive response to an invading pathogen is to start disease management as rapidly as possible, since this would be expected to minimise the future impacts of disease. However, since more spread data become available as an outbreak unfolds, processes underpinning pathogen transmission can almost always be characterised more precisely later in epidemics. This allows the future progression of any outbreak to be forecast more accurately, and so enables control interventions to be targeted more precisely. There is also the chance that the outbreak might die out without any intervention whatsoever, making prophylactic control unnecessary. Optimal decision-making involves continuously balancing these potential benefits of waiting against the possible costs of further spread. We introduce a generic, extensible data-driven algorithm based on parameter estimation and outbreak simulation for making decisions in real-time concerning when and how to control an invading pathogen. The Control Smart Algorithm (CSA resolves the trade-off between the competing advantages of controlling as soon as possible and controlling later when more information has become available. We show-using a generic mathematical model representing the transmission of a pathogen of agricultural animals or plants through a population of farms or fields-how the CSA allows the timing and level of deployment of vaccination or chemical control to be optimised. In particular, the algorithm outperforms simpler strategies such as intervening when the outbreak size reaches a pre-specified threshold, or controlling when the outbreak has persisted for a threshold length of time. This remains the case even if the simpler methods are fully optimised in advance. Our work highlights the potential benefits of giving careful consideration to the question of when to start disease management during emerging outbreaks, and provides a concrete framework to allow policy-makers to make this decision.

  12. Control fast or control smart: When should invading pathogens be controlled?

    Science.gov (United States)

    Thompson, Robin N; Gilligan, Christopher A; Cunniffe, Nik J

    2018-02-01

    The intuitive response to an invading pathogen is to start disease management as rapidly as possible, since this would be expected to minimise the future impacts of disease. However, since more spread data become available as an outbreak unfolds, processes underpinning pathogen transmission can almost always be characterised more precisely later in epidemics. This allows the future progression of any outbreak to be forecast more accurately, and so enables control interventions to be targeted more precisely. There is also the chance that the outbreak might die out without any intervention whatsoever, making prophylactic control unnecessary. Optimal decision-making involves continuously balancing these potential benefits of waiting against the possible costs of further spread. We introduce a generic, extensible data-driven algorithm based on parameter estimation and outbreak simulation for making decisions in real-time concerning when and how to control an invading pathogen. The Control Smart Algorithm (CSA) resolves the trade-off between the competing advantages of controlling as soon as possible and controlling later when more information has become available. We show-using a generic mathematical model representing the transmission of a pathogen of agricultural animals or plants through a population of farms or fields-how the CSA allows the timing and level of deployment of vaccination or chemical control to be optimised. In particular, the algorithm outperforms simpler strategies such as intervening when the outbreak size reaches a pre-specified threshold, or controlling when the outbreak has persisted for a threshold length of time. This remains the case even if the simpler methods are fully optimised in advance. Our work highlights the potential benefits of giving careful consideration to the question of when to start disease management during emerging outbreaks, and provides a concrete framework to allow policy-makers to make this decision.

  13. Conserving and enhancing biological control of nematodes.

    Science.gov (United States)

    Timper, Patricia

    2014-06-01

    Conservation biological control is the modification of the environment or existing practices to protect and enhance antagonistic organisms to reduce damage from pests. This approach to biological control has received insufficient attention compared with inundative applications of microbial antagonists to control nematodes. This review provides examples of how production practices can enhance or diminish biological control of plant-parasitic nematodes and other soilborne pests. Antagonists of nematodes can be enhanced by providing supplementary food sources such as occurs when organic amendments are applied to soil. However, some organic amendments (e.g., manures and plants containing allelopathic compounds) can also be detrimental to nematode antagonists. Plant species and genotype can strongly influence the outcome of biological control. For instance, the susceptibility of the plant to the nematode can determine the effectiveness of control; good hosts will require greater levels of suppression than poor hosts. Plant genotype can also influence the degree of rhizosphere colonization and antibiotic production by antagonists, as well the expression of induced resistance by plants. Production practices such as crop rotation, fallow periods, tillage, and pesticide applications can directly disrupt populations of antagonistic organisms. These practices can also indirectly affect antagonists by reducing their primary nematode host. One of the challenges of conservation biological control is that practices intended to protect or enhance suppression of nematodes may not be effective in all field sites because they are dependent on indigenous antagonists. Ultimately, indicators will need to be identified, such as the presence of particular antagonists, which can guide decisions on where it is practical to use conservation biological control. Antagonists can also be applied to field sites in conjunction with conservation practices to improve the consistency, efficacy, and

  14. Evaluation of biological control of fusarium wilt in gerbera with Trichoderma asperellum

    OpenAIRE

    Daiani Brandler; Luan Junior Divensi; Rodrigo José Tonin; Thalita Pedrozo Pilla; Ines Rezendes; Paola Mendes Milanesi

    2017-01-01

    The increase in flower cultivation in recent years has been reflecting the higher incidence of soil pathogens that can cause serious problems. This study aimed to evaluate the biological control of Fusarium wilt in gerbera with Trichoderma asperellum. The evaluated treatments were: T1) Control, only sterile substrate; T2) Substrate + Fusarium oxysporum; T3) Substrate + Fusarium oxysporum + Trichoderma asperellum; and T4) Substrate + Trichoderma asperellum. For this, the pathogen was isolated ...

  15. Opportunities for biological weed control in Europe

    NARCIS (Netherlands)

    Scheepens, P.C.; Müller-Schärer, H.; Kempenaar, C.

    2001-01-01

    The development and application of biological weed control offer greatopportunities not only for farmers, nature conservationists and othervegetation managers but also for institutions and companies that wish tosell plant protection services and products, and for the general publicthat demands safe

  16. Use of nuclear techniques in biological control

    International Nuclear Information System (INIS)

    Greany, Patrick D.; Carpenter, James E.

    2000-01-01

    As pointed out by Benbrook (1996), pest management is at a crossroads, and there is a great need for new, biointensive pest management strategies. Among these approaches, biological control is a keystone. However, because of increasing concerns about the introduction of exotic natural enemies of insect pests and weeds (Howarth 1991, Delfosse 1997), the overall thrust of biological control has moved toward augmentative biological control, involving releases of established natural enemy species (Knipling 1992). This in turn has created a need to develop more cost-effective mass rearing technologies for beneficial insects. Nuclear techniques could play an especially important role in augmentative biological control, not only in facilitating mass rearing, but in several other ways, as indicated below. Recognising the potential value for use of nuclear techniques in biological control, the Insect and Pest Control Section of the Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, sponsored a Consultants' Group Meeting on this subject in April 1997. The Group produced a document entitled Use of Nuclear Techniques in Biological Control: Managing Pests, Facilitating Trade and Protecting the Environment. The consultants included the authors of this paper as well as Ernest Delfosse (at that time, with the USDA-APHIS National Biological Control Institute), Garry Hill (Intl. Institute for Biological Control), Sinthya Penn (Beneficial Insectary), and Felipe Jeronimo (USDA-APHIS PPQ, Guatemala). The remarks presented in this paper reflect the thoughts presented by these consultants and other participants at the IAEA-sponsored meeting. Several potential uses for nuclear techniques were identified by the Consultants' Group, including: 1) improvements in rearing media (either artificial diets or natural hosts/prey), 2) provision of sterilised natural prey to be used as food during shipment, to ameliorate concerns relating to the

  17. Biological control component [Management of water hyacinth

    International Nuclear Information System (INIS)

    Harley, K.L.S.

    1981-01-01

    Both chemical and biological control have been used with limited success for the management of water hyacinth in Fiji. In some cases heavy application of chemicals have been successful in completely killing limited areas of water hyacinth, but have resulted in the destruction of biological agents introduced to control the water hyacinth and high contamination of natural water supplies. It is proposed that under the direction of Mr S R Singh, the Senior Research Scientist (Entomology) of the Koronivia Research Station, Suva, Fiji, a collaborative programme with Dr Harley of Australia on chemical and biological control of water hyacinth be initiated. This programme would be fundamentally short-term with the prime objective being an investigation of levels of insect population following varying levels of application of chemical sprays. By comparison with control areas, observations would be made of both chemical damage and insect damage within the limited time span of the period

  18. Structure, Biology, and Therapeutic Application of Toxin-Antitoxin Systems in Pathogenic Bacteria.

    Science.gov (United States)

    Lee, Ki-Young; Lee, Bong-Jin

    2016-10-22

    Bacterial toxin-antitoxin (TA) systems have received increasing attention for their diverse identities, structures, and functional implications in cell cycle arrest and survival against environmental stresses such as nutrient deficiency, antibiotic treatments, and immune system attacks. In this review, we describe the biological functions and the auto-regulatory mechanisms of six different types of TA systems, among which the type II TA system has been most extensively studied. The functions of type II toxins include mRNA/tRNA cleavage, gyrase/ribosome poison, and protein phosphorylation, which can be neutralized by their cognate antitoxins. We mainly explore the similar but divergent structures of type II TA proteins from 12 important pathogenic bacteria, including various aspects of protein-protein interactions. Accumulating knowledge about the structure-function correlation of TA systems from pathogenic bacteria has facilitated a novel strategy to develop antibiotic drugs that target specific pathogens. These molecules could increase the intrinsic activity of the toxin by artificially interfering with the intermolecular network of the TA systems.

  19. Biological activity of the non-microbial fraction of kefir: antagonism against intestinal pathogens.

    Science.gov (United States)

    Iraporda, Carolina; Abatemarco Júnior, Mário; Neumann, Elisabeth; Nunes, Álvaro Cantini; Nicoli, Jacques R; Abraham, Analía G; Garrote, Graciela L

    2017-08-01

    Kefir is a fermented milk obtained by the activity of kefir grains which are composed of lactic and acetic acid bacteria, and yeasts. Many beneficial health effects have been associated with kefir consumption such as stimulation of the immune system and inhibition of pathogenic microorganisms. The biological activity of kefir may be attributed to the presence of a complex microbiota as well as the microbial metabolites that are released during fermentation. The aim of this work was to characterise the non-microbial fraction of kefir and to study its antagonism against Escherichia coli, Salmonella spp. and Bacillus cereus. During milk fermentation there was a production of organic acids, mainly lactic and acetic acid, with a consequent decrease in pH and lactose content. The non-microbial fraction of kefir added to nutrient broth at concentrations above 75% v/v induced a complete inhibition of pathogenic growth that could be ascribed to the presence of un-dissociated lactic acid. In vitro assays using an intestinal epithelial cell model indicated that pre-incubation of cells with the non-microbial fraction of kefir did not modify the association/invasion of Salmonella whereas pre-incubation of Salmonella with this fraction under conditions that did not affect their viability significantly decreased the pathogen's ability to invade epithelial cells. Lactate exerted a protective effect against Salmonella in a mouse model, demonstrating the relevance of metabolites present in the non-microbial fraction of kefir produced during milk fermentation.

  20. Augmenting Plant Immune Responses and Biological Control by Microbial Determinants

    Directory of Open Access Journals (Sweden)

    Sang Moo Lee

    2015-09-01

    Full Text Available Plant have developed sophisticated defence mechanisms against microbial pathogens. The recent accumulated information allow us to understand the nature of plant immune responses followed by recognition of microbial factors/determinants through cutting-edge genomics and multi-omics techniques. However, the practical approaches to sustain plant health using enhancement of plant immunity is yet to be fully appreciated. Here, we overviewed the general concept and representative examples on the plant immunity. The fungal, bacterial, and viral determinants that was previously reported as the triggers of plant immune responses are introduced and described as the potential protocol of biological control. Specifically, the role of chitin, glucan, lipopolysaccharides/extracellular polysaccharides, microbe/pathogen-associated molecular pattern, antibiotics, mimic-phytohormones, N-acyl homoserine lactone, harpin, vitamins, and volatile organic compounds are considered. We hope that this review stimulates scientific community and farmers to broaden their knowledge on the microbial determinant-based biological control and to apply the technology on the integrated pest management program.

  1. Host–Pathogen Interactions

    NARCIS (Netherlands)

    Smits, M.A.; Schokker, D.J.

    2011-01-01

    The outcome of an infection is determined by numerous interactions between hosts and pathogens occurring at many different biological levels, ranging from molecule to population. To develop new control strategies for infectious diseases in livestock species, appropriate methodologies are needed

  2. A functional overview of conservation biological control

    DEFF Research Database (Denmark)

    Begg, Graham S; Cook, Samantha M; Dye, Richard

    2017-01-01

    Conservation biological control (CBC) is a sustainable approach to pest management that can contribute to a reduction in pesticide use as part of an Integrated Pest Management (IPM) strategy. CBC is based on the premise that countering habitat loss and environmental disturbance associated...... CBC prescriptions have proved elusive. To tackle this, we consolidate existing knowledge of CBC using a simple conceptual model that organises the functional elements of CBC into a common, unifying framework. We identify and integrate the key biological processes affecting natural enemies...... and their biological control function across local and regional scales, and consider the interactions, interdependencies and constraints that determine the outcome of CBC strategies. Conservation measures are often effective in supporting natural enemy populations but their success cannot be guaranteed; the greatest...

  3. Biological control of necrotrophic plant pathogenic fungi: Tomato ...

    African Journals Online (AJOL)

    Egyptian Journal of Biotechnology. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 25 (2007) >. Log in or Register to get access to full text downloads.

  4. Biological Control of Aquatic Plants with Pathogenic Fungi

    Science.gov (United States)

    1981-01-01

    methods have not been entirely satisfactory because of cost, overall ineffectiveness, or environmental pollution . The energy problem as it relates to...canal system near Cocoa, Florida, and in Palm Beach and Broward counties. With the exception of the Palm Beach and Broward areas, all the waterways in...Marvel’ 11 Phaseolus limensis MacF.* Butter Bean, ’Henderson’ 0 NT P. limensis* Lima Bean, ’Fordhook’ 5 3 d P. limensis* Lima Bean, ’Thorogreen’ 100

  5. Biological control agents for suppression of post-harvest diseases of potatoes: strategies on discovery and development

    Science.gov (United States)

    As used in plant pathology, the term "biological control" or its short form “biocontrol” commonly refers to the decrease in the inoculum or the disease-producing activity of a pathogen accomplished through one or more organisms, including the host plant but excluding man. Biological control of plant...

  6. Characterization and Control of Biological Microrobots

    NARCIS (Netherlands)

    Khalil, I.S.M.; Pichel, Marc Philippe; Pichel, M.P.; Zondervan, L.; Abelmann, Leon; Misra, Sarthak

    2012-01-01

    This work addresses the characterization and control of Magnetotactic Bacterium (MTB) which can be considered as a biological microrobot. Magnetic dipole moment of the MTB and response to a field-with-alternating-direction are characterized. First, the magnetic dipole moment is characterized using

  7. Characterization and control of biological microrobots

    NARCIS (Netherlands)

    Khalil, I.S.M.; Pichel, Marc Philippe; Zondervan, L.; Abelmann, Leon; Misra, Sarthak; Desai, Jaydev P.; Dudek, Gregory; Khatib, Oussama; Kumar, Vijay

    2013-01-01

    This work addresses the characterization and control of Magnetotactic Bacterium (MTB) which can be considered as a biological microrobot. Magnetic dipole moment of the MTB and response to a field-with-alternating-direction are characterized. First, the magnetic dipole moment is characterized using

  8. Incorporating biological control into IPM decision making

    Science.gov (United States)

    Of the many ways biological control can be incorporated into Integrated Pest Management (IPM) programs, natural enemy thresholds are arguably most easily adopted by stakeholders. Integration of natural enemy thresholds into IPM programs requires ecological and cost/benefit crop production data, thr...

  9. Selection of Trichogramma for inundative biological control

    NARCIS (Netherlands)

    Pak, G.A.

    1988-01-01

    This thesis presents a study of the potential for biological control of lepidopterous pests on cabbage crops in the Netherlands, by means of inundative releases of the egg parasite Trichogramma (Hymenoptera, Trichogrammatidae). The objective of this study is to investigate the

  10. Biological control of Meloidogyne incognita by Trichoderma ...

    African Journals Online (AJOL)

    Biological control against the root-knot nematode, Meloidogyne incognita was proven to occur in tomato, Solanum lycopersicom, soil-drenched with different isolates of Trichoderma harzianum and a commercial suspension of Serratia marcescens (Nemaless). The potential of such biocontrol agents to trigger plant defense ...

  11. The infection biology of Sphaerulina musiva: clues to understanding a forest pathogen.

    Directory of Open Access Journals (Sweden)

    Ruqian Qin

    Full Text Available Trees in the genus Populus and their interspecific hybrids are used across North America for fiber production and as a potential source of biofuel. Plantations of these species are severely impacted by a fungal pathogen, Sphaerulina musiva, the cause of leaf spot and stem canker. An inoculation protocol that does not rely on stem wounding to achieve infection was recently developed. Using this protocol two experiments were conducted to examine infection biology and disease development in the S. musiva-Populus interaction. In the first experiment non-wounded stems of one moderately resistant clone (NM6 and one susceptible clone (NC11505 were inoculated and examined by scanning electron microscopy at six different times (6 h, 12 h, 24 h, 72 h, 1 week, and 3 weeks post-inoculation. The images indicate that the pathogen appears to enter host tissue through small openings and lenticels and that there are no significant differences in the penetration rate between the moderately resistant (NM6 and susceptible (NC11505 clones at 12 h post-inoculation. In a second experiment a histological comparison of stem cankers for resistant clone DN74 and susceptible clone NC11505 were conducted at three time points (3 weeks, 5 weeks, and 7 weeks post-inoculation. Distinct differences in disease development were apparent between the resistant and susceptible clones at each time point, with the susceptible clone exhibiting a weak and delayed defense response. These results suggest, that following penetration, the pathogen may be able to interfere with the defense response in the susceptible host.

  12. An Overview of the Control of Bacterial Pathogens in Cattle Manure

    Directory of Open Access Journals (Sweden)

    Christy E. Manyi-Loh

    2016-08-01

    Full Text Available Cattle manure harbors microbial constituents that make it a potential source of pollution in the environment and infections in humans. Knowledge of, and microbial assessment of, manure is crucial in a bid to prevent public health and environmental hazards through the development of better management practices and policies that should govern manure handling. Physical, chemical and biological methods to reduce pathogen population in manure do exist, but are faced with challenges such as cost, odor pollution, green house gas emission, etc. Consequently, anaerobic digestion of animal manure is currently one of the most widely used treatment method that can help to salvage the above-mentioned adverse effects and in addition, produces biogas that can serve as an alternative/complementary source of energy. However, this method has to be monitored closely as it could be fraught with challenges during operation, caused by the inherent characteristics of the manure. In addition, to further reduce bacterial pathogens to a significant level, anaerobic digestion can be combined with other methods such as thermal, aerobic and physical methods. In this paper, we review the bacterial composition of cattle manure as well as methods engaged in the control of pathogenic microbes present in manure and recommendations that need to be respected and implemented in order to prevent microbial contamination of the environment, animals and humans.

  13. Biological control of fusarium wilt of tomato by antagonist fungi and ...

    African Journals Online (AJOL)

    Biological control of Fusarium oxysporum f. sp. lycopersici (FOL) causing wilt disease of tomato was studied in vitro as well as under pot conditions. Dual culture technique showed that Aspergillus niger, Penicillium citrinum, Penicillium sp. and Trichoderma harzianum inhibited the radial colony growth of the test pathogen.

  14. Systems biology elucidates common pathogenic mechanisms between nonalcoholic and alcoholic-fatty liver disease.

    Directory of Open Access Journals (Sweden)

    Silvia Sookoian

    Full Text Available The abnormal accumulation of fat in the liver is often related either to metabolic risk factors associated with metabolic syndrome in the absence of alcohol consumption (nonalcoholic fatty liver disease, NAFLD or to chronic alcohol consumption (alcoholic fatty liver disease, AFLD. Clinical and histological studies suggest that NAFLD and AFLD share pathogenic mechanisms. Nevertheless, current data are still inconclusive as to whether the underlying biological process and disease pathways of NAFLD and AFLD are alike. Our primary aim was to integrate omics and physiological data to answer the question of whether NAFLD and AFLD share molecular processes that lead to disease development. We also explored the extent to which insulin resistance (IR is a distinctive feature of NAFLD. To answer these questions, we used systems biology approaches, such as gene enrichment analysis, protein-protein interaction networks, and gene prioritization, based on multi-level data extracted by computational data mining. We observed that the leading disease pathways associated with NAFLD did not significantly differ from those of AFLD. However, systems biology revealed the importance of each molecular process behind each of the two diseases, and dissected distinctive molecular NAFLD and AFLD-signatures. Comparative co-analysis of NAFLD and AFLD clarified the participation of NAFLD, but not AFLD, in cardiovascular disease, and showed that insulin signaling is impaired in fatty liver regardless of the noxa, but the putative regulatory mechanisms associated with NAFLD seem to encompass a complex network of genes and proteins, plausible of epigenetic modifications. Gene prioritization showed a cancer-related functional map that suggests that the fatty transformation of the liver tissue is regardless of the cause, an emerging mechanism of ubiquitous oncogenic activation. In conclusion, similar underlying disease mechanisms lead to NAFLD and AFLD, but specific ones depict a

  15. Onchocerciasis control: biological research is still needed

    Directory of Open Access Journals (Sweden)

    Boussinesq M.

    2008-09-01

    Full Text Available Achievements obtained by the onchocerciasis control programmes should not lead to a relaxation in the biological research on Onchocerca volvulus. Issues such as the Loa loa-related postivermectin serious adverse events, the uncertainties as to whether onchocerciasis can be eliminated by ivermectin treatments, and the possible emergence of ivermectin-resistant O. volvulus populations should be addressed proactively. Doxycycline, moxidectin and emodepside appear to be promising as alternative drugs against onchocerciasis but support to researches in immunology and genomics should also be increased to develop new control tools, including both vaccines and macrofilaricidal drugs.

  16. Biological stability of drinking water: controlling factors, methods and challenges

    Directory of Open Access Journals (Sweden)

    Emmanuelle ePrest

    2016-02-01

    Full Text Available Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g. development of opportunistic pathogens, aesthetic (e.g. deterioration of taste, odour, colour or operational (e.g. fouling or biocorrosion of pipes problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors such as (i type and concentration of available organic and inorganic nutrients, (ii type and concentration of residual disinfectant, (iii presence of predators such as protozoa and invertebrates, (iv environmental conditions such as water temperature, and (v spatial location of microorganisms (bulk water, sediment or biofilm. Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i existing knowledge on biological stability controlling factors and (ii how these factors are affected by drinking water production and distribution conditions. In addition, (iii the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discuss how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order to

  17. Biological Stability of Drinking Water: Controlling Factors, Methods, and Challenges

    Science.gov (United States)

    Prest, Emmanuelle I.; Hammes, Frederik; van Loosdrecht, Mark C. M.; Vrouwenvelder, Johannes S.

    2016-01-01

    Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g., development of opportunistic pathogens), aesthetic (e.g., deterioration of taste, odor, color) or operational (e.g., fouling or biocorrosion of pipes) problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors, such as (i) type and concentration of available organic and inorganic nutrients, (ii) type and concentration of residual disinfectant, (iii) presence of predators, such as protozoa and invertebrates, (iv) environmental conditions, such as water temperature, and (v) spatial location of microorganisms (bulk water, sediment, or biofilm). Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability) in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i) existing knowledge on biological stability controlling factors and (ii) how these factors are affected by drinking water production and distribution conditions. In addition, (iii) the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discussed, how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order

  18. Biological Stability of Drinking Water: Controlling Factors, Methods, and Challenges

    KAUST Repository

    Prest, Emmanuelle I.

    2016-02-01

    Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and can lead to hygienic (e.g., development of opportunistic pathogens), aesthetic (e.g., deterioration of taste, odor, color) or operational (e.g., fouling or biocorrosion of pipes) problems. Drinking water contains diverse microorganisms competing for limited available nutrients for growth. Bacterial growth and interactions are regulated by factors, such as (i) type and concentration of available organic and inorganic nutrients, (ii) type and concentration of residual disinfectant, (iii) presence of predators, such as protozoa and invertebrates, (iv) environmental conditions, such as water temperature, and (v) spatial location of microorganisms (bulk water, sediment, or biofilm). Water treatment and distribution conditions in water mains and premise plumbing affect each of these factors and shape bacterial community characteristics (abundance, composition, viability) in distribution systems. Improved understanding of bacterial interactions in distribution systems and of environmental conditions impact is needed for better control of bacterial communities during drinking water production and distribution. This article reviews (i) existing knowledge on biological stability controlling factors and (ii) how these factors are affected by drinking water production and distribution conditions. In addition, (iii) the concept of biological stability is discussed in light of experience with well-established and new analytical methods, enabling high throughput analysis and in-depth characterization of bacterial communities in drinking water. We discussed, how knowledge gained from novel techniques will improve design and monitoring of water treatment and distribution systems in order

  19. Identification of Biocontrol Agents to Control the Fungal Pathogen, Geomyces destructans, in Bats

    Science.gov (United States)

    Braunstein, S.; Cheng, T.

    2013-12-01

    The fungal pathogen Geomyces destructans (Gd) causes the disease White-nose Syndrome (WNS) in bats and is estimated to have killed millions of bats since its emergence in North America in 2006. Gd is predicted to cause the local extinction of at least three bat species if rates of decline continue unabated. Given the devastating impacts of Gd to bat populations, identifying a viable method for controlling the pathogen is pertinent for conservation of affected bat species. Our work focuses on identifying naturally-occurring skin bacteria on bats that are antagonistic to Gd that could potentially be used as a biocontrol. We cultured bacteria from skin swabs taken from wild bats (Myotis lucifugus, Eptesicus fuscus, Myotis sodalis, Perimyotis subflavus). We conducted challenge experiments to identify bacterial strains that inhibited Gd growth. Bacteria that exhibited antifungal properties were identified using 16S and gyrB markers. Our methods identified several bacteria in the Pseudomonas fluorescens complex as potential biocontrol agents. Future work will continue to test the viability of these bacteria as biocontrol agents via experimental treatments with live captive bats. The failure of previous non-biocontrol methods highlights the importance of developing these bacteria as a biologically-friendly method for controlling Gd. A bat infected with Geomyces destructans. Photo by West Virginia Division of Natural Resources Bacterial culture from the swab of a bat's wings

  20. Isolation and expression of recombinant antibody fragments to the biological warfare pathogen Brucella melitensis.

    Science.gov (United States)

    Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George

    2003-05-01

    Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.

  1. Isolation, Characterization and Biological Properties of Membrane Vesicles Produced by the Swine Pathogen Streptococcus suis.

    Directory of Open Access Journals (Sweden)

    Bruno Haas

    Full Text Available Streptococcus suis, more particularly serotype 2, is a major swine pathogen and an emerging zoonotic agent worldwide that mainly causes meningitis, septicemia, endocarditis, and pneumonia. Although several potential virulence factors produced by S. suis have been identified in the last decade, the pathogenesis of S. suis infections is still not fully understood. In the present study, we showed that S. suis produces membrane vesicles (MVs that range in diameter from 13 to 130 nm and that appear to be coated by capsular material. A proteomic analysis of the MVs revealed that they contain 46 proteins, 9 of which are considered as proven or suspected virulence factors. Biological assays confirmed that S. suis MVs possess active subtilisin-like protease (SspA and DNase (SsnA. S. suis MVs degraded neutrophil extracellular traps, a property that may contribute to the ability of the bacterium to escape the host defense response. MVs also activated the nuclear factor-kappa B (NF-κB signaling pathway in both monocytes and macrophages, inducing the secretion of pro-inflammatory cytokines, which may in turn contribute to increase the permeability of the blood brain barrier. The present study brought evidence that S. suis MVs may play a role as a virulence factor in the pathogenesis of S. suis infections, and given their composition be an excellent candidate for vaccine development.

  2. Evaluation of biological control of fusarium wilt in gerbera with Trichoderma asperellum

    Directory of Open Access Journals (Sweden)

    Daiani Brandler

    2017-09-01

    Full Text Available The increase in flower cultivation in recent years has been reflecting the higher incidence of soil pathogens that can cause serious problems. This study aimed to evaluate the biological control of Fusarium wilt in gerbera with Trichoderma asperellum. The evaluated treatments were: T1 Control, only sterile substrate; T2 Substrate + Fusarium oxysporum; T3 Substrate + Fusarium oxysporum + Trichoderma asperellum; and T4 Substrate + Trichoderma asperellum. For this, the pathogen was isolated from gerbera with disease symptoms and, subsequently, it was identified according to morphological characters. Furthermore, the degree of antagonism of T. asperellum against F. oxysporum was evaluated through the culture pairing test. For greenhouse evaluations, commercial autoclaved substrate was used and infested with corn grains infected by the pathogen. Morphological identification confirmed the pathogen species as Fusarium oxysporum. In the culture pairing test, it was found that T. asperellum did not present a high degree of antagonism. The plants cultivated on substrate infested by the pathogen had no visible symptoms of wilt, but the substrate infestation with the pathogen provided lower values of fresh and dry mass of shoots and roots. The treatment with T. asperellum obtained higher values of fresh and dry mass of both shoots and roots, and also more vigorous inflorescences in relation to the plants treated with the pathogen

  3. Biological control of Fusarium moniliforme in maize.

    Science.gov (United States)

    Bacon, C W; Yates, I E; Hinton, D M; Meredith, F

    2001-05-01

    Fusarium moniliforme Sheldon, a biological species of the mating populations within the (italic)Gibberella fujikuroi species complex, i.e., population A [= G. moniliformis (Sheld.) Wineland], is an example of a facultative fungal endophyte. During the biotrophic endophytic association with maize, as well as during saprophytic growth, F. moniliforme produces the fumonisins. The fungus is transmitted vertically and horizontally to the next generation of plants via clonal infection of seeds and plant debris. Horizontal infection is the manner by which this fungus is spread contagiously and through which infection occurs from the outside that can be reduced by application of certain fungicides. The endophytic phase is vertically transmitted. This type infection is important because it is not controlled by seed applications of fungicides, and it remains the reservoir from which infection and toxin biosynthesis takes place in each generation of plants. Thus, vertical transmission of this fungus is just as important as horizontal transmission. A biological control system using an endophytic bacterium, Bacillus subtilis, has been developed that shows great promise for reducing mycotoxin accumulation during the endophytic (vertical transmission) growth phase. Because this bacterium occupies the identical ecological niche within the plant, it is considered an ecological homologue to F. moniliforme, and the inhibitory mechanism, regardless of the mode of action, operates on the competitive exclusion principle. In addition to this bacterium, an isolate of a species of the fungus Trichoderma shows promise in the postharvest control of the growth and toxin accumulation from F. moniliforme on corn in storage.

  4. biological and biochemical effects of biocides and gamma radiation on pathogen attacked some horticulture crops

    International Nuclear Information System (INIS)

    Helal, I.M.M.

    2006-01-01

    the present investigation was aimed to study the possibility of formulation of some essential oils having antimicrobial activity to be used as biocides. the results of this study showed that fennel, peppermint and caraway oils were the most inhibitory effective oils against some post harvest pathogens. the used oils. were formulated as biocides using different emulsifiers with the addition of different types of fixed oils . the prepared biocides were effective for controlling the growth of the studied microorganisms in vitro and in vivo on the host plant products. also , the interaction of biocides and different doses of gamma radiation were effective for extending the shelf life of potato tubers and orange fruits during storage at room temperature for periods of 150 and 75 days, respectively. biochemical changes in potato tubers and orange fruits as a result of treatments were studied

  5. An Integrated Biological Control System At Hanford

    International Nuclear Information System (INIS)

    Johnson, A.R.; Caudill, J.G.; Giddings, R.F.; Rodriguez, J.M.; Roos, R.C.; Wilde, J.W.

    2010-01-01

    In 1999 an integrated biological control system was instituted at the U.S. Department of Energy's Hanford Site. Successes and changes to the program needed to be communicated to a large and diverse mix of organizations and individuals. Efforts at communication are directed toward the following: Hanford Contractors (Liquid or Tank Waste, Solid Waste, Environmental Restoration, Science and Technology, Site Infrastructure), General Hanford Employees, and Hanford Advisory Board (Native American Tribes, Environmental Groups, Local Citizens, Washington State and Oregon State regulatory agencies). Communication was done through direct interface meetings, individual communication, where appropriate, and broadly sharing program reports. The objectives of the communication efforts was to have the program well coordinated with Hanford contractors, and to have the program understood well enough that all stakeholders would have confidence in the work performed by the program to reduce or elimate spread of radioactive contamination by biotic vectors. Communication of successes and changes to an integrated biological control system instituted in 1999 at the Department of Energy's Hanford Site have required regular interfaces with not only a diverse group of Hanford contractors (i.e., those responsible for liquid or tank waste, solid wastes, environmental restoration, science and technology, and site infrastructure), and general Hanford employees, but also with a consortium of designated stake holders organized as the Hanford Advisory Board (i.e., Native American tribes, various environmental groups, local citizens, Washington state and Oregon regulatory agencies, etc.). Direct interface meetings, individual communication where appropriate, and transparency of the biological control program were the methods and outcome of this effort.

  6. AN INTEGRATED BIOLOGICAL CONTROL SYSTEM AT HANFORD

    Energy Technology Data Exchange (ETDEWEB)

    JOHNSON AR; CAUDILL JG; GIDDINGS RF; RODRIGUEZ JM; ROOS RC; WILDE JW

    2010-02-11

    In 1999 an integrated biological control system was instituted at the U.S. Department of Energy's Hanford Site. Successes and changes to the program needed to be communicated to a large and diverse mix of organizations and individuals. Efforts at communication are directed toward the following: Hanford Contractors (Liquid or Tank Waste, Solid Waste, Environmental Restoration, Science and Technology, Site Infrastructure), General Hanford Employees, and Hanford Advisory Board (Native American Tribes, Environmental Groups, Local Citizens, Washington State and Oregon State regulatory agencies). Communication was done through direct interface meetings, individual communication, where appropriate, and broadly sharing program reports. The objectives of the communication efforts was to have the program well coordinated with Hanford contractors, and to have the program understood well enough that all stakeholders would have confidence in the work performed by the program to reduce or elimated spread of radioactive contamination by biotic vectors. Communication of successes and changes to an integrated biological control system instituted in 1999 at the Department of Energy's Hanford Site have required regular interfaces with not only a diverse group of Hanford contractors (i.e., those responsible for liquid or tank waste, solid wastes, environmental restoration, science and technology, and site infrastructure), and general Hanford employees, but also with a consortium of designated stake holders organized as the Hanford Advisory Board (i.e., Native American tribes, various environmental groups, local citizens, Washington state and Oregon regulatory agencies, etc.). Direct interface meetings, individual communication where appropriate, and transparency of the biological control program were the methods and outcome of this effort.

  7. Predators indirectly control vector-borne disease: linking predator-prey and host-pathogen models.

    Science.gov (United States)

    Moore, Sean M; Borer, Elizabeth T; Hosseini, Parviez R

    2010-01-06

    Pathogens transmitted by arthropod vectors are common in human populations, agricultural systems and natural communities. Transmission of these vector-borne pathogens depends on the population dynamics of the vector species as well as its interactions with other species within the community. In particular, predation may be sufficient to control pathogen prevalence indirectly via the vector. To examine the indirect effect of predators on vectored-pathogen dynamics, we developed a theoretical model that integrates predator-prey and host-pathogen theory. We used this model to determine whether predation can prevent pathogen persistence or alter the stability of host-pathogen dynamics. We found that, in the absence of predation, pathogen prevalence in the host increases with vector fecundity, whereas predation on the vector causes pathogen prevalence to decline, or even become extinct, with increasing vector fecundity. We also found that predation on a vector may drastically slow the initial spread of a pathogen. The predator can increase host abundance indirectly by reducing or eliminating infection in the host population. These results highlight the importance of studying interactions that, within the greater community, may alter our predictions when studying disease dynamics. From an applied perspective, these results also suggest situations where an introduced predator or the natural enemies of a vector may slow the rate of spread of an emerging vector-borne pathogen.

  8. Biological control agents elevate hantavirus by subsidizing deer mouse populations

    Science.gov (United States)

    Dean E. Pearson; Ragan M. Callaway

    2006-01-01

    Biological control of exotic invasive plants using exotic insects is practiced under the assumption that biological control agents are safe if they do not directly attack non-target species. We tested this assumption by evaluating the potential for two host-specific biological control agents (Urophora spp.), widely established in North America for spotted...

  9. Delivery of gene biotechnologies to plants: Pathogen and pest control

    Science.gov (United States)

    Treatment of oligonucleotides to plants for host delivered suppression of microbes and insect pests of citrus was successful. FANA_ASO, (2'-deoxy-2'-fluoro-D- arabinonucleic acid)_( antisense oligonucleotides- AUM LifeTech) designed to: Asian citrus psyllid; Citrus plant bacterial pathogen of citru...

  10. Current knowledge on groundwater microbial pathogens and their control

    Science.gov (United States)

    Macler, Bruce A.; Merkle, Jon C.

    Those who drink groundwater that has not been disinfected are at increased risk of infection and disease from pathogenic microorganisms. Recent studies have shown that up to half of all US drinking-water wells tested had evidence of fecal contamination. A significant fraction of all waterborne disease outbreaks is associated with groundwater. An estimated 750,000 to 5.9million illnesses per year result from contaminated groundwaters in the US. Mortality from these illnesses may be 1400-9400 deaths per year. Control of these pathogens starts with source-water protection activities to prevent fecal contamination of aquifers and wells. These include assessment of wellhead vulnerability to fecal contamination and correction of identified deficiencies. Correction may include control of sources or rehabilitation of the well itself. Disinfection can serve as a useful barrier and is recommended as a prudent public-health policy for all groundwater systems. Ceux qui boivent une eau souterraine non désinfectée présentent un risque accru d'infection et de maladie par des germes pathogènes. De récentes études ont montré que près de la moitié de tous les puits américains testés, captés pour l'eau potable, sont soumis à une contamination fécale. Une fraction significative de l'ensemble des premières manifestations de maladies liées à l'eau est associée aux eaux souterraines. On estime qu'entre 750 000 et 5,9millions de personnes sont malades chaque année aux États-Unis à cause d'eaux souterraines polluées. La mortalité parmi ces malades doit ètre de l'ordre de 1400 à 9400 décès par an. La protection contre ces germes pathogènes commence avec des mesures prises au niveau du captage pour empècher la pollution des aquifères et des puits. Celles-ci comprennent une évaluation de la vulnérabilité des tètes de puits à la pollution fécale et une correction des insuffisances mises en évidence. Cette correction peut comprendre une maîtrise des sources

  11. MODELING HOST-PATHOGEN INTERACTIONS: COMPUTATIONAL BIOLOGY AND BIOINFORMATICS FOR INFECTIOUS DISEASE RESEARCH (Session introduction)

    Energy Technology Data Exchange (ETDEWEB)

    McDermott, Jason E.; Braun, Pascal; Bonneau, Richard A.; Hyduke, Daniel R.

    2011-12-01

    Pathogenic infections are a major cause of both human disease and loss of crop yields and animal stocks and thus cause immense damage to the worldwide economy. The significance of infectious diseases is expected to increase in an ever more connected warming world, in which new viral, bacterial and fungal pathogens can find novel hosts and ecologic niches. At the same time, the complex and sophisticated mechanisms by which diverse pathogenic agents evade defense mechanisms and subvert their hosts networks to suit their lifestyle needs is still very incompletely understood especially from a systems perspective [1]. Thus, understanding host-pathogen interactions is both an important and a scientifically fascinating topic. Recently, technology has offered the opportunity to investigate host-pathogen interactions on a level of detail and scope that offers immense computational and analytical possibilities. Genome sequencing was pioneered on some of these pathogens, and the number of strains and variants of pathogens sequenced to date vastly outnumbers the number of host genomes available. At the same time, for both plant and human hosts more and more data on population level genomic variation becomes available and offers a rich field for analysis into the genetic interactions between host and pathogen.

  12. BIOMASS PRODUCTION AND FORMULATION OF Bacillus subtilis FOR BIOLOGICAL CONTROL

    Directory of Open Access Journals (Sweden)

    Amran Muis

    2016-10-01

    Full Text Available Bacillus subtilis is a widespread bacterium found in soil, water, and air. It controls the growth of certain harmful bacteria and fungi, presumably by competing for nutrients, growth sites on plants, and by directly colonizing and attaching to fungal pathogens. When applied to seeds, it colonizes the developing root system of the plants and continues to live on the root system and provides protection throughout the growing season. The study on biomass production and formulation of B. subtilis for biological control was conducted in the laboratory of Department of Plant Pathology, College of Agriculture, University of the Philippines Los Baños (UPLB-CA, College, Laguna from May to July 2005. The objective of the study was to determine the optimum pH and a good carbon source for biomass production of B. subtilis and to develop a seed treatment formulation of B. subtilis as biological control agent. Results showed that the optimum pH for growth of B. subtilis was pH 6 (1.85 x 109 cfu/ml. In laboratory tests for biomass production using cassava flour, corn flour, rice flour, and brown sugar as carbon sources, it grew best in brown sugar plus yeast extract medium (6.8 x 108 cfu ml-1 in sterile distilled water and 7.8 x 108 cfu ml-1 in coconut water. In test for bacterial biomass carriers, talc proved to be the best in terms of number of bacteria recovered from the seeds (3.98 x 105 cfu seed-1.

  13. Microbial antagonism as a potential solution for controlling selected root pathogens of crops

    Science.gov (United States)

    Cooper, Sarah; Agnew, Linda; Pereg, Lily

    2016-04-01

    Root pathogens of crops can cause large reduction in yield, however, there is a limited range of effective methods to control such pathogens. Soilborne pathogens that infect roots often need to survive in the rhizosphere, where there is high competition from other organisms. In such hot spots of microbial activity and growth, supported by root exudates, microbes have evolved antagonistic mechanisms that give them competitive advantages in winning the limited resources. Among these mechanisms is antibiosis, with production of some significant antifungal compounds including, antibiotics, volatile organic compounds, hydrogen cyanide and lytic enzymes. Some of these mechanisms may suppress disease through controlling the growth of root pathogens. In this project we isolated various fungi and bacteria that suppress the growth of cotton pathogens in vitro. The pathogen-suppressive microbes were isolated from cotton production soils that are under different management strategies, with and without the use of organic amendments. The potential of pathogen-suppressing microbes for controlling the black root rot disease, caused by the soilborne pathogen Thielaviopsis basicola, was confirmed using soil assays. We identified isolates with potential use as inoculant for cotton production in Australia. Having isolated a diverse group of antagonistic microbes enhances the probability that some would survive well in the soil and provide an alternative approach to address the problem of root disease affecting agricultural crops.

  14. Recasting the theory of mosquito-borne pathogen transmission dynamics and control

    Science.gov (United States)

    Smith, David L.; Perkins, T. Alex; Reiner, Robert C.; Barker, Christopher M.; Niu, Tianchan; Chaves, Luis Fernando; Ellis, Alicia M.; George, Dylan B.; Le Menach, Arnaud; Pulliam, Juliet R. C.; Bisanzio, Donal; Buckee, Caroline; Chiyaka, Christinah; Cummings, Derek A. T.; Garcia, Andres J.; Gatton, Michelle L.; Gething, Peter W.; Hartley, David M.; Johnston, Geoffrey; Klein, Eili Y.; Michael, Edwin; Lloyd, Alun L.; Pigott, David M.; Reisen, William K.; Ruktanonchai, Nick; Singh, Brajendra K.; Stoller, Jeremy; Tatem, Andrew J.; Kitron, Uriel; Godfray, H. Charles J.; Cohen, Justin M.; Hay, Simon I.; Scott, Thomas W.

    2014-01-01

    Mosquito-borne diseases pose some of the greatest challenges in public health, especially in tropical and sub-tropical regions of the world. Efforts to control these diseases have been underpinned by a theoretical framework developed for malaria by Ross and Macdonald, including models, metrics for measuring transmission, and theory of control that identifies key vulnerabilities in the transmission cycle. That framework, especially Macdonald's formula for R0 and its entomological derivative, vectorial capacity, are now used to study dynamics and design interventions for many mosquito-borne diseases. A systematic review of 388 models published between 1970 and 2010 found that the vast majority adopted the Ross–Macdonald assumption of homogeneous transmission in a well-mixed population. Studies comparing models and data question these assumptions and point to the capacity to model heterogeneous, focal transmission as the most important but relatively unexplored component in current theory. Fine-scale heterogeneity causes transmission dynamics to be nonlinear, and poses problems for modeling, epidemiology and measurement. Novel mathematical approaches show how heterogeneity arises from the biology and the landscape on which the processes of mosquito biting and pathogen transmission unfold. Emerging theory focuses attention on the ecological and social context for mosquito blood feeding, the movement of both hosts and mosquitoes, and the relevant spatial scales for measuring transmission and for modeling dynamics and control. PMID:24591453

  15. Recasting the theory of mosquito-borne pathogen transmission dynamics and control.

    Science.gov (United States)

    Smith, David L; Perkins, T Alex; Reiner, Robert C; Barker, Christopher M; Niu, Tianchan; Chaves, Luis Fernando; Ellis, Alicia M; George, Dylan B; Le Menach, Arnaud; Pulliam, Juliet R C; Bisanzio, Donal; Buckee, Caroline; Chiyaka, Christinah; Cummings, Derek A T; Garcia, Andres J; Gatton, Michelle L; Gething, Peter W; Hartley, David M; Johnston, Geoffrey; Klein, Eili Y; Michael, Edwin; Lloyd, Alun L; Pigott, David M; Reisen, William K; Ruktanonchai, Nick; Singh, Brajendra K; Stoller, Jeremy; Tatem, Andrew J; Kitron, Uriel; Godfray, H Charles J; Cohen, Justin M; Hay, Simon I; Scott, Thomas W

    2014-04-01

    Mosquito-borne diseases pose some of the greatest challenges in public health, especially in tropical and sub-tropical regions of the world. Efforts to control these diseases have been underpinned by a theoretical framework developed for malaria by Ross and Macdonald, including models, metrics for measuring transmission, and theory of control that identifies key vulnerabilities in the transmission cycle. That framework, especially Macdonald's formula for R0 and its entomological derivative, vectorial capacity, are now used to study dynamics and design interventions for many mosquito-borne diseases. A systematic review of 388 models published between 1970 and 2010 found that the vast majority adopted the Ross-Macdonald assumption of homogeneous transmission in a well-mixed population. Studies comparing models and data question these assumptions and point to the capacity to model heterogeneous, focal transmission as the most important but relatively unexplored component in current theory. Fine-scale heterogeneity causes transmission dynamics to be nonlinear, and poses problems for modeling, epidemiology and measurement. Novel mathematical approaches show how heterogeneity arises from the biology and the landscape on which the processes of mosquito biting and pathogen transmission unfold. Emerging theory focuses attention on the ecological and social context for mosquito blood feeding, the movement of both hosts and mosquitoes, and the relevant spatial scales for measuring transmission and for modeling dynamics and control.

  16. 75 FR 10645 - Low Pathogenic Avian Influenza; Voluntary Control Program and Payment of Indemnity

    Science.gov (United States)

    2010-03-09

    ... pathogenic avian influenza outbreaks, provides that consistency with humane euthanasia guidelines will be... markets. In the commenter's view, this action would not only provide for disease control but would benefit...

  17. Complexity, Analysis and Control of Singular Biological Systems

    CERN Document Server

    Zhang, Qingling; Zhang, Xue

    2012-01-01

    Complexity, Analysis and Control of Singular Biological Systems follows the control of real-world biological systems at both ecological and phyisological levels concentrating on the application of now-extensively-investigated singular system theory. Much effort has recently been dedicated to the modelling and analysis of developing bioeconomic systems and the text establishes singular examples of these, showing how proper control can help to maintain sustainable economic development of biological resources. The book begins from the essentials of singular systems theory and bifurcations before tackling  the use of various forms of control in singular biological systems using examples including predator-prey relationships and viral vaccination and quarantine control. Researchers and graduate students studying the control of complex biological systems are shown how a variety of methods can be brought to bear and practitioners working with the economics of biological systems and their control will also find the ...

  18. Maternal feeding controls fetal biological clock.

    Directory of Open Access Journals (Sweden)

    Hidenobu Ohta

    Full Text Available BACKGROUND: It is widely accepted that circadian physiological rhythms of the fetus are affected by oscillators in the maternal brain that are coupled to the environmental light-dark (LD cycle. METHODOLOGY/PRINCIPAL FINDINGS: To study the link between fetal and maternal biological clocks, we investigated the effects of cycles of maternal food availability on the rhythms of Per1 gene expression in the fetal suprachiasmatic nucleus (SCN and liver using a transgenic rat model whose tissues express luciferase in vitro. Although the maternal SCN remained phase-locked to the LD cycle, maternal restricted feeding phase-advanced the fetal SCN and liver by 5 and 7 hours respectively within the 22-day pregnancy. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that maternal feeding entrains the fetal SCN and liver independently of both the maternal SCN and the LD cycle. This indicates that maternal-feeding signals can be more influential for the fetal SCN and particular organ oscillators than hormonal signals controlled by the maternal SCN, suggesting the importance of a regular maternal feeding schedule for appropriate fetal molecular clockwork during pregnancy.

  19. Will the Convention on Biological Diversity put an end to biological control?

    NARCIS (Netherlands)

    Lenteren, van J.C.; Cock, M.J.W.; Brodeur, J.; Barratt, B.I.P.; Bigler, F.; Bolckmans, K.; Haas, F.; Mason, P.G.; Parra, J.R.P.

    2011-01-01

    Will the Convention on Biological Diversity put an end to biological control? Under the Convention on Biological Diversity countries have sovereign rights over their genetic resources. Agreements governing the access to these resources and the sharing of the benefits arising from their use need to

  20. CONTROL OF SOME PATHOGENS BY USING SPECIAL FOLIAR FERTILIZERS

    Directory of Open Access Journals (Sweden)

    I OROIAN

    2004-04-01

    Full Text Available The present work points out to the interdisciplinary experimental results, obtained in the experimental fields of the Plant Protection and Soil Science Department, as well as at data which stress upon the interdependency between the satisfaction of the trophically needs of the wheat plants and the aggressiveness of the pathogens which cause the disease. The experimental results underline the fact that the attack level expressed through intensity and attack degree is different, both with the “out of root” fertilized variants and with the soil fertilization variants. The conclusions which come off the study of the obtained data point out at the fact that the fertilizer application, no matter the method, determines the growth or the regress of the attack degree. They also have an influence upon the Puccinia striformis f.sp. tritici, Blumeria graminis and, Septoria spp. fungus manifestation.

  1. Microbes versus microbes: control of pathogens in the food chain.

    Science.gov (United States)

    Jordan, Kieran; Dalmasso, Marion; Zentek, Juergen; Mader, Anneluise; Bruggeman, Geert; Wallace, John; De Medici, Dario; Fiore, Alfonsina; Prukner-Radovcic, Estella; Lukac, Maja; Axelsson, Lars; Holck, Askild; Ingmer, Hanne; Malakauskas, Mindaugas

    2014-12-01

    Foodborne illness continues as a considerable threat to public health. Despite improved hygiene management systems and increased regulation, pathogenic bacteria still contaminate food, causing sporadic cases of illness and disease outbreaks worldwide. For many centuries, microbial antagonism has been used in food processing to improve food safety. An understanding of the mode of action of this microbial antagonism has been gained in recent years and potential applications in food and feed safety are now being explored. This review focuses on the potential opportunities presented, and the limitations, of using microbial antagonism as a biocontrol mechanism to reduce contamination along the food chain; including animal feed as its first link. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  2. Effectiveness of a biological control agent Palexorista gilvoides in ...

    African Journals Online (AJOL)

    ACSS

    Effectiveness of a biological control agent Palexorista gilvoides in controlling Gonometa podorcarpi in conifer ... gilvoides as a potential biological control agent for G. podocarpi. Field and laboratory studies further established that P. .... version for windows (SPSS, 2002). Results. Gonometa podocarpi was present in.

  3. Status of biological control in vegetation management in forestry

    Science.gov (United States)

    George P. Markin; Donald E. Gardner

    1993-01-01

    Biological control traditionally depends upon importing the natural enemies of introduced weeds. Since vegetation management in forestry has primarily been aimed at protecting economic species of trees from competition from other native plants, biological control has been of little use in forestry. An alternative approach to controlling unwanted native plants,...

  4. Biological control of alien and invasive species in agriculture

    International Nuclear Information System (INIS)

    Calvitti, Maurizio; Moretti Riccardo; Lampazzi, Elena

    2015-01-01

    Agricultural production in Europe faces many challenges including limited availability of water, nitrogen input and fossil fuels. It is necessary, therefore, to identify methods of production and new technologies to increase the efficiency of the primary systems, guaranteeing amount of food, quality, safety and eco-sustainability . One of the most important aspects, though often undervalued in relation to the food chain, is the adversity of biological management of agricultural crops due to pests, pathogens or fitomizi with potential invasive already present in the territory or of recent origin alien. In this context, two main objectives should be implemented at the same time reduce production losses and protect the agro-ecosystem. To meet these expectations, as of January 1, 2015 all farms in the European Union countries are bound to the application of the Integrated Defense principles, as indicated by the Directive on the sustainable use of plant protection products (128/09 / EC) .In response to this and other new entomological emergencies plant health and medical-veterinary entomologist researchers of the Laboratory sustainable management of Agro-Ecosystems in ENEA, have directed their research towards the development of innovative systems for the sustainable control of invasive species of insects is in the agricultural sector that health. [it

  5. The ability to cause infection in a pathogenic fungus uncovers a new biological feature of honey bee viruses.

    Science.gov (United States)

    Li, Zhiguo; Su, Songkun; Hamilton, Michele; Yan, Limin; Chen, Yanping

    2014-07-01

    We demonstrated that honey bee viruses including Deformed wing virus (DWV), Black queen cell virus (BQCV) and Israeli acute paralysis virus (IAPV) could infect and replicate in the fungal pathogen Ascosphaera apis that causes honey bee chalkbrood disease, revealing a novel biological feature of honey bee viruses. The phylogenetic analysis show that viruses of fungal and honey bee origins form two clusters in the phylogenetic trees distinctly and that host range of honey bee viruses is dynamic. Further studies are warranted to investigate the impact of the viruses on the fitness of their fungal host and phenotypic effects the virus-fungus combination has on honey bee hosts. Published by Elsevier Inc.

  6. Biology of Paenibacillus larvae, a deadly pathogen of honey bee larvae.

    Science.gov (United States)

    Ebeling, Julia; Knispel, Henriette; Hertlein, Gillian; Fünfhaus, Anne; Genersch, Elke

    2016-09-01

    The gram-positive bacterium Paenibacillus larvae is the etiological agent of American Foulbrood of honey bees, a notifiable disease in many countries. Hence, P. larvae can be considered as an entomopathogen of considerable relevance in veterinary medicine. P. larvae is a highly specialized pathogen with only one established host, the honey bee larva. No other natural environment supporting germination and proliferation of P. larvae is known. Over the last decade, tremendous progress in the understanding of P. larvae and its interactions with honey bee larvae at a molecular level has been made. In this review, we will present the recent highlights and developments in P. larvae research and discuss the impact of some of the findings in a broader context to demonstrate what we can learn from studying "exotic" pathogens.

  7. Pathogen detection, testing, and control in fresh broccoli sprouts

    Directory of Open Access Journals (Sweden)

    Fahey Jed W

    2006-04-01

    Full Text Available Abstract Background The recent increased interest in consuming green vegetable sprouts has been tempered by the fact that fresh sprouts can in some cases be vehicles for food-borne illnesses. They must be grown according to proper conditions of sanitation and handled as a food product rather than as an agricultural commodity. When sprouts are grown in accordance with the criteria proposed from within the sprout industry, developed by regulatory agencies, and adhered to by many sprouters, green sprouts can be produced with very low risk. Contamination may occur when these guidelines are not followed. Methods A one year program of microbial hold-and-release testing, conducted in concert with strict seed and facility cleaning procedures by 13 U.S. broccoli sprout growers was evaluated. Microbial contamination tests were performed on 6839 drums of sprouts, equivalent to about 5 million consumer packages of fresh green sprouts. Results Only 24 (0.75% of the 3191 sprout samples gave an initial positive test for Escherichia coli O157:H7 or Salmonella spp., and when re-tested, 3 drums again tested positive. Composite testing (e.g., pooling up to 7 drums for pathogen testing was equally sensitive to single drum testing. Conclusion By using a "test-and-re-test" protocol, growers were able to minimize crop destruction. By pooling drums for testing, they were also able to reduce testing costs which now represent a substantial portion of the costs associated with sprout growing. The test-and-hold scheme described herein allowed those few batches of contaminated sprouts to be found prior to packaging and shipping. These events were isolated, and only safe sprouts entered the food supply.

  8. Microbial Inhibition of Fusarium Pathogens and Biological Modification of Trichothecenes in Cereal Grains

    Directory of Open Access Journals (Sweden)

    Urszula Wachowska

    2017-12-01

    Full Text Available Fungi of the genus Fusarium infect cereal crops during the growing season and cause head blight and other diseases. Their toxic secondary metabolites (mycotoxins contaminate grains. Several dozen toxic compounds produced by fungal pathogens have been identified to date. Type B trichothecenes—deoxynivalenol, its acetyl derivatives and nivalenol (produced mainly by F. graminearum and F. culmorum—are most commonly detected in cereal grains. “T-2 toxin” (produced by, among others, F. sporotrichioides belongs to type-A trichothecenes which are more toxic than other trichothecenes. Antagonistic bacteria and fungi can affect pathogens of the genus Fusarium via different modes of action: direct (mycoparasitism or hyperparasitism, mixed-path (antibiotic secretion, production of lytic enzymes and indirect (induction of host defense responses. Microbial modification of trichothecenes involves acetylation, deacetylation, oxidation, de-epoxidation, and epimerization, and it lowers the pathogenic potential of fungi of the genus Fusarium. Other modifing mechanisms described in the paper involve the physical adsorption of mycotoxins in bacterial cells and the conjugation of mycotoxins to glucose and other compounds in plant and fungal cells. The development of several patents supports the commercialization and wider application of microorganisms biodegrading mycotoxins in grains and, consequently, in feed additives.

  9. Biological control of the terrestrial carbon sink

    Science.gov (United States)

    Schulze, E.-D.

    2006-03-01

    This lecture reviews the past (since 1964 when the International Biological Program began) and the future of our understanding of terrestrial carbon fluxes with focus on photosynthesis, respiration, primary-, ecosystem-, and biome-productivity. Photosynthetic capacity is related to the nitrogen concentration of leaves, but the capacity is only rarely reached under field conditions. Average rates of photosynthesis and stomatal conductance are closely correlated and operate near 50% of their maximal rate, with light being the limiting factor in humid regions and air humidity and soil water the limiting factor in arid climates. Leaf area is the main factor to extrapolate from leaves to canopies, with maximum surface conductance being dependent on leaf level stomatal conductance. Additionally, gas exchange depends also on rooting depth which determines the water and nutrient availability and on mycorrhizae which regulate the nutrient status. An important anthropogenic disturbance is the nitrogen uptake from air pollutants, which is not balanced by cation uptake from roots and this may lead to damage and breakdown of the plant cover. Photosynthesis is the main carbon input into ecosystems, but it alone does not represent the ecosystem carbon balance, which is determined by respiration of various kinds. Plant respiration and photosynthesis determine growth (net primary production) and microbial respiration balances the net ecosystem flux. In a spruce forest, 30% of the assimilatory carbon gain is used for respiration of needles, 20% is used for respiration in stems. Soil respiration is about 50% the carbon gain, half of which is root respiration, half is microbial respiration. In addition, disturbances lead to carbon losses, where fire, harvest and grazing bypass the chain of respiration. In total, the carbon balance at the biome level is only about 1% of the photosynthetic carbon input, or may indeed become negative. The recent observed increase in plant growth has

  10. Biological control of the terrestrial carbon sink

    Directory of Open Access Journals (Sweden)

    E.-D. Schulze

    2006-01-01

    Full Text Available This lecture reviews the past (since 1964 when the International Biological Program began and the future of our understanding of terrestrial carbon fluxes with focus on photosynthesis, respiration, primary-, ecosystem-, and biome-productivity. Photosynthetic capacity is related to the nitrogen concentration of leaves, but the capacity is only rarely reached under field conditions. Average rates of photosynthesis and stomatal conductance are closely correlated and operate near 50% of their maximal rate, with light being the limiting factor in humid regions and air humidity and soil water the limiting factor in arid climates. Leaf area is the main factor to extrapolate from leaves to canopies, with maximum surface conductance being dependent on leaf level stomatal conductance. Additionally, gas exchange depends also on rooting depth which determines the water and nutrient availability and on mycorrhizae which regulate the nutrient status. An important anthropogenic disturbance is the nitrogen uptake from air pollutants, which is not balanced by cation uptake from roots and this may lead to damage and breakdown of the plant cover. Photosynthesis is the main carbon input into ecosystems, but it alone does not represent the ecosystem carbon balance, which is determined by respiration of various kinds. Plant respiration and photosynthesis determine growth (net primary production and microbial respiration balances the net ecosystem flux. In a spruce forest, 30% of the assimilatory carbon gain is used for respiration of needles, 20% is used for respiration in stems. Soil respiration is about 50% the carbon gain, half of which is root respiration, half is microbial respiration. In addition, disturbances lead to carbon losses, where fire, harvest and grazing bypass the chain of respiration. In total, the carbon balance at the biome level is only about 1% of the photosynthetic carbon input, or may indeed become negative. The recent observed increase in

  11. Understanding Federal regulations as guidelines for classical biological control programs

    Science.gov (United States)

    Michael E. Montgomery

    2011-01-01

    This chapter reviews the legislation and rules that provide the foundation for federal regulation of the introduction of natural enemies of insects as biological control agents. It also outlines the steps for complying with regulatory requirements, using biological control of Adelges tsugae Annand, the hemlock woolly adelgid (HWA), as an example. The...

  12. Efficiency of using green algae as biological controllers against toxic ...

    African Journals Online (AJOL)

    Efficiency of using green algae as biological controllers against toxic algal taxa in cultured ... of two green algal species as biological control of the growth of toxic blue-green algae. ... African Journal of Aquatic Science 2014, 39(4): 443–450 ...

  13. The Control of Chemical and Biological Weapons.

    Science.gov (United States)

    Alexander, Archibald S.; And Others

    This book is composed of four papers prepared to illuminate the problem areas which might arise if the policies of the 1925 Geneva Protocol and other measures to limit chemical and biological weapons are ratified by the United States Senate. The papers included are: Legal Aspects of the Geneva Protocol of 1925; The Use of Herbicides in War: A…

  14. Biology and control of Varroa destructor.

    Science.gov (United States)

    Rosenkranz, Peter; Aumeier, Pia; Ziegelmann, Bettina

    2010-01-01

    The ectoparasitic honey bee mite Varroa destructor was originally confined to the Eastern honey bee Apis cerana. After a shift to the new host Apis mellifera during the first half of the last century, the parasite dispersed world wide and is currently considered the major threat for apiculture. The damage caused by Varroosis is thought to be a crucial driver for the periodical colony losses in Europe and the USA and regular Varroa treatments are essential in these countries. Therefore, Varroa research not only deals with a fascinating host-parasite relationship but also has a responsibility to find sustainable solutions for the beekeeping. This review provides a survey of the current knowledge in the main fields of Varroa research including the biology of the mite, damage to the host, host tolerance, tolerance breeding and Varroa treatment. We first present a general view on the functional morphology and on the biology of the Varroa mite with special emphasis on host-parasite interactions during reproduction of the female mite. The pathology section describes host damage at the individual and colony level including the problem of transmission of secondary infections by the mite. Knowledge of both the biology and the pathology of Varroa mites is essential for understanding possible tolerance mechanisms in the honey bee host. We comment on the few examples of natural tolerance in A. mellifera and evaluate recent approaches to the selection of Varroa tolerant honey bees. Finally, an extensive listing and critical evaluation of chemical and biological methods of Varroa treatments is given. This compilation of present-day knowledge on Varroa honey bee interactions emphasizes that we are still far from a solution for Varroa infestation and that, therefore, further research on mite biology, tolerance breeding, and Varroa treatment is urgently needed. Copyright 2009 Elsevier Inc. All rights reserved.

  15. 9 CFR 381.94 - Contamination with Microorganisms; process control verification criteria and testing; pathogen...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Contamination with Microorganisms... § 381.94 Contamination with Microorganisms; process control verification criteria and testing; pathogen... maintaining process controls sufficient to prevent fecal contamination. FSIS shall take further action as...

  16. Microgravity as a biological tool to examine host-pathogen interactions and to guide development of therapeutics and preventatives that target pathogenic bacteria.

    Science.gov (United States)

    Higginson, Ellen E; Galen, James E; Levine, Myron M; Tennant, Sharon M

    2016-11-01

    Space exploration programs have long been interested in the effects of spaceflight on biology. This research is important not only in its relevance to future deep space exploration, but also because it has allowed investigators to ask questions about how gravity impacts cell behavior here on Earth. In the 1980s, scientists designed and built the first rotating wall vessel, capable of mimicking the low shear environment found in space. This vessel has since been used to investigate growth of both microorganisms and human tissue cells in low shear modeled microgravity conditions. Bacterial behavior has been shown to be altered both in space and under simulated microgravity conditions. In some cases, bacteria appear attenuated, whereas in others virulence is enhanced. This has consequences not only for manned spaceflight, but poses larger questions about the ability of bacteria to sense the world around them. By using the microgravity environment as a tool, we can exploit this phenomenon in the search for new therapeutics and preventatives against pathogenic bacteria for use both in space and on Earth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Biologically inspired rate control of chaos.

    Science.gov (United States)

    Olde Scheper, Tjeerd V

    2017-10-01

    The overall intention of chaotic control is to eliminate chaos and to force the system to become stable in the classical sense. In this paper, I demonstrate a more subtle method that does not eliminate all traces of chaotic behaviour; yet it consistently, and reliably, can provide control as intended. The Rate Control of Chaos (RCC) method is derived from metabolic control processes and has several remarkable properties. RCC can control complex systems continuously, and unsupervised, it can also maintain control across bifurcations, and in the presence of significant systemic noise. Specifically, I show that RCC can control a typical set of chaotic models, including the 3 and 4 dimensional chaotic Lorenz systems, in all modes. Furthermore, it is capable of controlling spatiotemporal chaos without supervision and maintains control of the system across bifurcations. This property of RCC allows a dynamic system to operate in parameter spaces that are difficult to control otherwise. This may be particularly interesting for the control of forced systems or dynamic systems that are chaotically perturbed. These control properties of RCC are applicable to a range of dynamic systems, thereby appearing to have far-reaching effects beyond just controlling chaos. RCC may also point to the existence of a biochemical control function of an enzyme, to stabilise the dynamics of the reaction cascade.

  18. Stem rots of oil palm caused by Ganoderma boninense: pathogen biology and epidemiology.

    Science.gov (United States)

    Pilotti, C A

    2005-01-01

    Oil palm (Elaeis guineensis Jacq.) has been grown in Papua New Guinea since the early 1960s. The most important disease of oil palm in PNG is a stem rot of the palm base. This is the same disease that constitutes a major threat to sustainable oil palm production in SE Asia. Investigations into the causal pathogen have revealed that the stem rots in PNG are caused predominantly by the basidiomycete Ganoderma boninense, with a minor pathogen identified as G. tornatum G. tornatum was found to have a broad host range whereas G. boninense appears to be restricted to palms. The population structure of G. boninense was investigated using inter-fertility studies between isolates collected from basal stem rots on oil palm. Although the G. boninense field populations are predominantly comprised of distinct individuals, a number of isolates were found that share single mating alleles. This indicates that out-crossing had occurred over several generations in the resident or wild population of G. boninense prior to colonization of oil palm. No direct hereditary relationship between isolates on neighbouring diseased palms was found, although an indirect link between isolates causing upper stem rot and basal stem rot was detected.

  19. Pandora formicae, a specialist ant pathogenic fungus: New insights into biology and taxonomy.

    Science.gov (United States)

    Małagocka, Joanna; Jensen, Annette Bruun; Eilenberg, Jørgen

    2017-02-01

    Among fungi from the order Entomophthorales (Entomophthoromycota), there are many specialized, obligatory insect-killing pathogens. Pandora formicae (Humber & Bałazy) Humber is a rare example of an entomophthoralean fungus adapted to exclusively infect social insects: wood ants from the genus Formica. There is limited information available on P. formicae; many important aspects of this host-pathogen system remain hitherto unknown, and the taxonomical status of the fungus is unclear. Our study fills out some main gaps in the life history of P. formicae, such as seasonal prevalence and overwintering strategy. Field studies of infection prevalence show a disease peak in late summer and early autumn. Typical thick-walled entomophthoralean resting spores of P. formicae are documented and described for the first time. The proportion of cadavers with resting spores increased from late summer throughout autumn, suggesting that these spores are the main overwintering fungal structures. In addition, the phylogenetic status of Pandora formicae is outlined. Finally, we review the available taxonomical literature and conclude that the name P. formicae should be used rather than the name P. myrmecophaga for ant-infecting fungi displaying described morphological features. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Biology of Leptoypha hospita (Hemiptera: Tingidae), a Potential Biological Control Agent of Chinese Privet

    Science.gov (United States)

    Yanzhuo Zhang; James L. Hanula; Scott Horn; Kristine Braman; Jianghua Sun

    2011-01-01

    The biology of Leptoypha hospita Drake et Poor (Hemiptera: Tingidae), a potential biological control agent from China for Chinese privet, Ligustrum sinense Lour., was studied in quarantine in the United States. Both nymphs and adults feed on Chinese privet mesophyll cells that lead to a bleached appearance of leaves and dieback of branch tips. L. hospita has five...

  1. Genetic diversity in the oral pathogen Porphyromonas gingivalis: molecular mechanisms and biological consequences

    Science.gov (United States)

    Tribble, Gena D; Kerr, Jennifer E; Wang, Bing-Yan

    2013-01-01

    Porphyromonas gingivalis is a Gram-negative anaerobic bacterium that colonizes the human oral cavity. It is implicated in the development of periodontitis, a chronic periodontal disease affecting half of the adult population in the USA. To survive in the oral cavity, these bacteria must colonize dental plaque biofilms in competition with other bacterial species. Long-term survival requires P. gingivalis to evade host immune responses, while simultaneously adapting to the changing physiology of the host and to alterations in the plaque biofilm. In reflection of this highly variable niche, P. gingivalis is a genetically diverse species and in this review the authors summarize genetic diversity as it relates to pathogenicity in P. gingivalis. Recent studies revealing a variety of mechanisms by which adaptive changes in genetic content can occur are also reviewed. Understanding the genetic plasticity of P. gingivalis will provide a better framework for understanding the host–microbe interactions associated with periodontal disease. PMID:23642116

  2. Asymmetric total synthesis of 6-Tuliposide B and its biological activities against tulip pathogenic fungi.

    Science.gov (United States)

    Shigetomi, Kengo; Omoto, Shoko; Kato, Yasuo; Ubukata, Makoto

    2011-01-01

    The structure-activity relationship was investigated to evaluate the antifungal activities of tuliposides and tulipalins against tulip pathogenic fungi. 6-Tuliposide B was effectively synthesized via the asymmetric Baylis-Hillman reaction. Tuliposides and tulipalins showed antifungal activities against most of the strains tested at high concentrations (2.5 mM), while Botrytis tulipae was resistant to tuliposides. Tulipalin formation was involved in the antifungal activity, tulipalin A showed higher inhibitory activity than 6-tuliposide B and tulipalin B. Both the tuliposides and tulipalins showed pigment-inducing activity against Gibberella zeae and inhibitory activity against Fusarium oxysporum f. sp tulipae. These activities were induced at a much lower concentration (0.05 mM) than the antifungal MIC values.

  3. Explaining Biological Functionality: Is Control Theory Enough ...

    African Journals Online (AJOL)

    I argue that the etiological approach, as understood in terms of control theory, suffers from a problem of symmetry, by which function can equally well be placed in the environment as in the organism. Focusing on the autonomy view, I note that it can be understood to some degree in terms of control theory in its version called ...

  4. Post-translational Control of Intracellular Pathogen Sensing Pathways.

    Science.gov (United States)

    Chiang, Cindy; Gack, Michaela U

    2017-01-01

    Mammalian cells recognize virus-derived nucleic acids using a defined set of intracellular sensors including the DNA sensors cyclic GMP-AMP (cGAMP) synthase (cGAS) and interferon gamma (IFNγ)-inducible protein 16 (IFI16) as well as viral RNA receptors of the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) family. Following innate immune recognition, these sensors launch an immune response that is characterized by the transcriptional upregulation of many antiviral molecules, including proinflammatory cytokines, chemokines, and IFN-stimulated genes. Recent studies have demonstrated that the signal transduction initiated by these sensors is sophisticatedly regulated by post-translational modifications (PTMs) resulting in a robust yet 'tunable' cytokine response to maintain immune homeostasis. Here we summarize recent advances in our understanding of how PTMs and regulatory enzymes control the signaling activity of RLRs, cGAS, and IFI16 as well as their proximal adaptor proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Card9 mediates susceptibility to intestinal pathogens through microbiota modulation and control of bacterial virulence.

    Science.gov (United States)

    Lamas, Bruno; Michel, Marie-Laure; Waldschmitt, Nadine; Pham, Hang-Phuong; Zacharioudaki, Vassiliki; Dupraz, Louise; Delacre, Myriam; Natividad, Jane M; Costa, Gregory Da; Planchais, Julien; Sovran, Bruno; Bridonneau, Chantal; Six, Adrien; Langella, Philippe; Richard, Mathias L; Chamaillard, Mathias; Sokol, Harry

    2017-08-08

    In association with innate and adaptive immunity, the microbiota controls the colonisation resistance against intestinal pathogens. Caspase recruitment domain 9 ( CARD9 ), a key innate immunity gene, is required to shape a normal gut microbiota. Card9 -/- mice are more susceptible to the enteric mouse pathogen Citrobacter rodentium that mimics human infections with enteropathogenic and enterohaemorrhagic Escherichia coli . Here, we examined how CARD9 controls C. rodentium infection susceptibility through microbiota-dependent and microbiota-independent mechanisms. C. rodentium infection was assessed in conventional and germ-free (GF) wild-type (WT) and Card9 -/- mice. To explore the impact of Card9 -/- microbiota in infection susceptibility, GF WT mice were colonised with WT (WT→GF) or Card9 -/- ( Card9 -/- →GF) microbiota before C. rodentium infection. Microbiota composition was determined by 16S rDNA gene sequencing. Inflammation severity was determined by histology score and lipocalin level. Microbiota-host immune system interactions were assessed by quantitative PCR analysis. CARD9 controls pathogen virulence in a microbiota-independent manner by supporting a specific humoral response. Higher susceptibility to C. rodentium -induced colitis was observed in Card9 -/- →GF mice. The microbiota of Card9 -/- mice failed to outcompete the monosaccharide-consuming C. rodentium , worsening the infection severity. A polysaccharide-enriched diet counteracted the ecological advantage of C. rodentium and the defective pathogen-specific antibody response in Card9 -/- mice. CARD9 modulates the susceptibility to intestinal infection by controlling the pathogen virulence in a microbiota-dependent and microbiota-independent manner. Genetic susceptibility to intestinal pathogens can be overridden by diet intervention that restores humoural immunity and a competing microbiota. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017

  6. Arms Control: US and International efforts to ban biological weapons

    Energy Technology Data Exchange (ETDEWEB)

    1992-12-01

    The Bacteriological (Biological) and Toxin Weapons Convention, the treaty that bans the development, production, and stockpiling and acquisition of biological weapons was opened for signature in 1972 and came into force in 1975 after being ratified by 22 governments, including the depository nations of the USA, the United Kingdom, and the former Soviet Union. In support of the Convention, the USA later established export controls on items used to make biological weapons. Further, in accordance with the 1990 President`s Enhanced Proliferation Control Initiative, actions were taken to redefine and expand US export controls, as well as to encourage multilateral controls through the Australia Group. Thus far, the Convention has not been effective in stopping the development of biological weapons. The principal findings as to the reasons of the failures of the Convention are found to be: the Convention lacks universality, compliance measures are effective, advantage of verification may outweigh disadvantages. Recommendations for mitigating these failures are outlined in this report.

  7. Biological control of tortricids and aphids in strawberries

    DEFF Research Database (Denmark)

    Sigsgaard, Lene; Enkegaard, Annie; Eilenberg, Jørgen

    Cropping practice and biological control can contribute to reduced pesticide use in strawberries. Organic strawberries are less attacked by strawberry tortricid and buckwheat flower strips can augment its natural enemies. Against shallot aphid the two-spot ladybird is promising....

  8. 9 CFR 310.25 - Contamination with microorganisms; process control verification criteria and testing; pathogen...

    Science.gov (United States)

    2010-01-01

    ... criteria and testing; pathogen reduction standards. (a) Criteria for verifying process control; E. coli... 1 (E.coli) Establishments that slaughter more than one type of livestock or both livestock and... E. coli that is approved as an AOAC Official Method of the AOAC International (formerly the...

  9. Use of Epidemiologic Models in the Control of Highly Pathogenic Avian Influenza

    NARCIS (Netherlands)

    Stegeman, J.A.; Bouma, A.; Jong, de M.C.M.

    2010-01-01

    In the past decades, mathematical models have become more and more accepted as a tool to develop surveillance programs and to evaluate the efficacy of intervention measures for the control of infectious diseases such as highly pathogenic avian influenza. Predictive models are used to simulate the

  10. Genetics of mechanisms controlling responses to two major pathogens in broiler and layer chickens

    DEFF Research Database (Denmark)

    Hamzic, Edin

    The objective of this thesis was to improve the understanding of molecular mechanisms controlling the response to two major pathogens, Eimeria maxima (coccidiosis) and infectious bronchitis virus (IBV), in broiler and layer chickens, respectively. Breeding for the improved response to the two...

  11. Controlling highly pathogenic avian influenza outbreaks : An epidemiological and economic model analysis

    NARCIS (Netherlands)

    Backer, J. A.; van Roermund, H. J W; Fischer, Egil; van Asseldonk, M. A P M; Bergevoet, R. H M

    2015-01-01

    Outbreaks of highly pathogenic avian influenza (HPAI) can cause large losses for the poultry sector and for animal disease controlling authorities, as well as risks for animal and human welfare. In the current simulation approach epidemiological and economic models are combined to compare different

  12. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Directory of Open Access Journals (Sweden)

    Sandra Pritzkow

    Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological

  13. Isolation of microorganisms for biological control the moniliophthora roreri

    OpenAIRE

    suarez contreras, liliana yanet; Rangel Riaño, Alba Luz

    2014-01-01

    Moniliophlhora roreri is the causal agent of cocoa Moniliasis, which produces losses of up to 60% of the crop, as it affects only its commercial product, the cob. Biological control appears as an alternative management, using endophytic microorganisms. The reason because of this research came up was that it was aimed to isolate microorganisms with antagonist potential for biological control towards the phytopathogen M. roreri in Norte de Santander. This is done through isolation and identifica...

  14. Biological Control of Diseases of Vegetables Grown Hydroponically in Thailand: Challenge and Opportunity.

    Science.gov (United States)

    Kanjanamaneesathian, Mana

    2015-01-01

    In Thailand, yield loss due to plant diseases in vegetables grown hydroponically is very high as a result of the growers` lack of knowledge for controlling diseases and their un- willingness to invest in setting-up the proper hydroponic system from the beginning. Severe root rot disease caused by Pythium spp. is frequent and can be anticipated in the hot climate in Thailand. This review focuses on the diseases in temperate lettuces which have been produced hydroponically and have been attacked by plant pathogens, particularly Pythium spp. Biological control of vegetable diseases grown hydroponically has been investigated in Thailand. Research is being carried out to identify effective strains of the antagonists, formulating the applicable products and delivering them appropriately to control the disease. Products of Bacillus subtilis, Chaetomium globosom and Trichoderma harzianum have been recommended for use to control diseases in vegetables grown hydroponically. Control efficacy of these products is varied as the biological products have been used by the growers in the paradigm of using chemical fungicide for disease control in hydroponic production system, overlooking the intrinsic characteristics of the biological control products. The recent patent, which minimizes the effects of sunlight and heat on the nutrient solution without the use of an external energy for cooling the nutrient, should be applied in producing hydroponic vegetables to mitigate poor plant growth and root rot disease outbreak in Thailand.

  15. Phenotypic charactheristics of fluorescent pseudomonss, biological control agent of lincat disease of temanggung tobacco

    Directory of Open Access Journals (Sweden)

    NINING NURUL AZIZAH

    2007-04-01

    Full Text Available Fluorescent pseudomonass isolated from local plants-rishosphere in temanggung controlled lincat disease of tobacco. This report describe phenotypic charactheristics of the bacteria in order to be used as a base for the development of the bacteria as a biological control agent of lincat disease. Phenotypic charactheristics of six isolates of fluorescent Pseudomonass which controlled lincat disease in the field were determined in the laboratory of Plant Bacteriology, Faculty of Agriculture, Gadjah Mada University. Plant pathogenicity tests were conducted by hypersensitive reaction into tobacco leaf and inoculation to tobacco plants. Antagonism test between fluorescent Pseudomonass and other candidate of biological control agents were also conducted. The results indicated that the bacteria were rod shape, Gram negative, positive reaction in catalase and oxidase tests. Nitrate reduce to nitrite, arginine was hydrolysed, fluorescent pigment were produced on King’s B medium, levan formation positive and all bacteria denitrifiy. The bacteria used urea, tween 80 and amylum were not hydrolised, poly--hydroxybutyrate was not accumulated in the cells. Negative reactions were observed for lysine decarboxylation, indol production, VP/MR reaction, and gelatn liquefation. Some compounds could be used as solely carbon sources. All isolates grew on the medium containing 2% NaCl. The best pH for growth was 6-7 and all isolates grew at 20-41C. Negative result were obtained for hypersensitive reaction and pathogenicity tests.

  16. Biology and control of hemlock woolly adelgid

    Science.gov (United States)

    Nathan P. Havill; Ligia C. Vieira; Scott M. Salom

    2014-01-01

    This publication is a substantial revision of FHTET 2001-03, Hemlock Woolly Adelgid, which was published in 2001. This publication contains information on the native range of hemlock and range of hemlock woolly adelgid, the importance of hemlocks in eastern forest ecosystems, and on hosts, life cycle, control, and population trends of the hemlock woolly adelgid.

  17. Controllability and observability of Boolean networks arising from biology

    Science.gov (United States)

    Li, Rui; Yang, Meng; Chu, Tianguang

    2015-02-01

    Boolean networks are currently receiving considerable attention as a computational scheme for system level analysis and modeling of biological systems. Studying control-related problems in Boolean networks may reveal new insights into the intrinsic control in complex biological systems and enable us to develop strategies for manipulating biological systems using exogenous inputs. This paper considers controllability and observability of Boolean biological networks. We propose a new approach, which draws from the rich theory of symbolic computation, to solve the problems. Consequently, simple necessary and sufficient conditions for reachability, controllability, and observability are obtained, and algorithmic tests for controllability and observability which are based on the Gröbner basis method are presented. As practical applications, we apply the proposed approach to several different biological systems, namely, the mammalian cell-cycle network, the T-cell activation network, the large granular lymphocyte survival signaling network, and the Drosophila segment polarity network, gaining novel insights into the control and/or monitoring of the specific biological systems.

  18. Endoplasmic reticulum-dependent redox reactions control endoplasmic reticulum-associated degradation and pathogen entry.

    Science.gov (United States)

    Walczak, Christopher P; Bernardi, Kaleena M; Tsai, Billy

    2012-04-15

    Protein misfolding within the endoplasmic reticulum (ER) is managed by an ER quality control system that retro-translocates aberrant proteins into the cytosol for proteasomal destruction. This process, known as ER-associated degradation, utilizes the action of ER redox enzymes to accommodate the disulfide-bonded nature of misfolded proteins. Strikingly, various pathogenic viruses and toxins co-opt these redox components to reach the cytosol during entry. These redox factors thus regulate critical cellular homeostasis and host-pathogen interactions. Recent studies identify specific members of the protein disulfide isomerase (PDI) family, which use their chaperone and catalytic activities, in engaging both misfolded ER proteins and pathogens. The precise molecular mechanism by which a dedicated PDI family member disrupts the disulfide bonds in the misfolded ER proteins and pathogens, as well as how they act to unfold these substrates to promote their ER-to-cytosol membrane transport, remain poorly characterized. How PDI family members distinguish folded versus misfolded ER substrates remains enigmatic. What physical characteristics surrounding a substrate's disulfide bond instruct PDI that it is mispaired or native? For the pathogens, as their disulfide bonds normally serve a critical role in providing physical support, what conformational changes experienced in the host enable their disulfide bonds to be disrupted? A combination of more rigorous biochemical and high-resolution structural studies should begin to address these questions.

  19. Biological effect of penetration controlled irradiation with ion beams

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Atsushi; Shimizu, Takashi; Kikuchi, Masahiro; Kobayashi, Yasuhiko; Watanabe, Hiroshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Yamashita, Takao

    1997-03-01

    To investigate the effect of local irradiation with ion beams on biological systems, technique for penetration controlled irradiation has been established. The range in a target was controlled by changing the distance from beam window in the atmosphere, and could be controlled linearly up to about 31 {mu}m in biological material. In addition, the effects of the penetration controlled irradiations with 1.5 MeV/u C and He ions were examined using tobacco pollen. The increased frequency of leaky pollen produced by ion beams suggests that the efficient pollen envelope damages would be induced at the range-end of ion beams. (author)

  20. Biological control of banana black Sigatoka disease with Trichoderma

    OpenAIRE

    Poholl Adan Sagratzki Cavero; Rogério Eiji Hanada; Luadir Gasparotto; Rosalee Albuquerque Coelho Neto; Jorge Teodoro de Souza

    2015-01-01

    Black Sigatoka disease caused by Mycosphaerella fijiensis is the most severe banana disease worldwide. The pathogen is in an invasive phase in Brazil and is already present in most States of the country. The potential of 29 isolates of Trichoderma spp. was studied for the control of black Sigatoka disease under field conditions. Four isolates were able to significantly reduce disease severity and were further tested in a second field experiment. Isolate 2.047 showed the best results in both f...

  1. Effectiveness of biological control of Phytophthora capsici in pepper by Trichoderma asperellum strain T34

    Directory of Open Access Journals (Sweden)

    Guillem SEGARRA

    2013-05-01

    Full Text Available Pepper (Capsicum annuum L., one of the most widely grown vegetables worldwide, is susceptible to root rot caused by Phytophthora capsici. Many biocides have recently been banned in Europe because of human health and environmental concerns. Integrated pest management is a European priority, where biological control together with other agronomic practices should replace pesticide management of plant diseases in the future. Application of different concentrations of the fungus Trichoderma asperellum strain T34 (the in T34 Biocontrol® on incidence of disease caused by P. capsici in pepper was studied. Different methods of application of the microbial control agent and inoculation of the pathogen were examined. T34 and etridiazole (Terrazole® were compared for their ability to suppress P. capsici. T34 reduced disease in most of the assayed situations (up to 71% disease reduction, while etridiazole was effective only when applied at the same time as the pathogen. The results obtained are discussed on the basis of the different modes of action of T34 and etridiazole. T34 is a useful biological alternative to chemicals for the control of P. capsici in pepper.

  2. Local and global control of ecological and biological networks

    OpenAIRE

    Alessandro Ferrarini

    2014-01-01

    Recently, I introduced a methodological framework so that ecological and biological networks can be controlled both from inside and outside by coupling network dynamics and evolutionary modelling. The endogenous control requires the network to be optimized at the beginning of its dynamics (by acting upon nodes, edges or both) so that it will then go inertially to the desired state. Instead, the exogenous control requires that exogenous controllers act upon the network at each time step. By th...

  3. Biological Screening of Eichornia crassipes against Different Pathogenic Microbes: An In Vitro Study

    Directory of Open Access Journals (Sweden)

    Rubina Rehman

    2016-09-01

    Full Text Available The present research is a biological screening of Eichornia crassipes (Pontederiaceae. Dichloromethane and methanol extracts of the whole plant were investigated for their antibacterial, antifungal, phytotoxic, and cytotoxic activities. The antibacterial activity was evaluated using agar well-diffusion method against Bacillus subtilis, Staphylococcus aureus, Escherichia coli, Shigella flexneri, Pseudomonas aeruginosa, and Salmonella typhi. The antifungal activity was evaluated using the agar tube–dilution method against Candida albicans, Candida glabrata, Aspergillus flavus, Microsporum canis, and Fusarium solani. The phytotoxicity activity was determined using Lemna bioassay against Lemna minor. Brine shrimp–cytotoxicity assay was determined against brine-shrimp larvae. Dichloromethane extract exhibited significant phytotoxicity (100% growth regulation at 1,000 µg/ml concentration against Lemna minor whereas methanolic extracts showed moderate (75% growth regulation phytotoxicity at the same concentration. Methanolic extract showed cytotoxicity at the highest level of dose whereas dichloromethane extract showed no activity having Etoposide as standard drug. Both of the extracts have nonsignificant antifungal and antibacterial activity.

  4. Biological control of Botrytis gray mould on tomato cultivated in greenhouse.

    Science.gov (United States)

    Fiume, F; Fiume, G

    2006-01-01

    Research was carried out to evaluate the effectiveness of the biological control of the Botrytis gray mould, caused by Botrytis cinerea Pers., one of the most important fungal diseases of the tomato (Lycopersicon esculentum Mill.). Biological control was performed by using Trichoderma harzianum Rifai, an antagonist that is a naturally occurring fungus found on some plants and in the soil worldwide. Trichoderma spp. are fungi diffused in nearly all agricultural soils and in other environments such as decaying wood. The object of this research is to find control strategies to reduce chemical treatments that cause damage to the environment and increase the pathogen resistance, applying the biological control by using T. harzianum against B. cinerea. A commercial product containing a natural isolate of T. harzianum is trichodex (Makhteshim Chemical Works, LTD). The research was performed in laboratory and in greenhouse. In laboratory, radial growth reduction of B. cinerea, in presence of T. harzianum, was calculated in relation to the growth of the pathogen control, by using a specific formula that measures the percentage of the inhibition of the radial mycelial growth. In greenhouse, starting from the tomato fruit setting, the research was carried out comparing, by a randomized complete block experiment design, replicated four times, the following treatments:1) untreated control; 2) pyrimethanil (400 g/L of a.i.), at 200 cc/hL of c.i. (pyrimidine fungicides); 3) trichodex at 100g/hL (1 kg/ha); 4) trichodex at 200 g/hL (2 kg/ha); 5) trichodex at 400 g/hL (4 kg/ha). Before fruit setting, the plots were all treated against Botrytis gray mould with iprodione 50% (100 g/hL), procymidone 50% (100 g/hL) and switch (Novartis plant protection) at 80 g/hL. In dual culture, the inhibition of B. cinerea radial mycelial growth was 76%. No inhibition halo was observed between B. cinerea and T. harzianum colonies but, after 3 days, the pathogen colony radius resulted no more than 1

  5. Biological control by ( Coccinella algerica , Kovar 1977) against the ...

    African Journals Online (AJOL)

    Inputs from chemicals, particularly pesticides, to control crop pests have adverse effects on soil and the environment, among others. To reduce pest attacks, biological control with indigenous predators is the alternative and the cleanest, most environmentally friendly and ecologically balanced way. In order to achieve this ...

  6. Augmentative biological control of arthropods in Latin America

    NARCIS (Netherlands)

    Lenteren, van J.C.; Bueno, V.H.P.

    2003-01-01

    Augmentative forms of biological control, where natural enemies are periodically introduced, are applied over large areas in various cropping systems in Latin America. About 25% of the world area under augmentative control is situated in this region. Well-known examples are the use of species of the

  7. Nematodes for the biological control of the woodwasp, Sirex noctilio

    Science.gov (United States)

    Robin A. Bedding

    2007-01-01

    The tylenchid nematode Beddingia (Deladenus) siricidicola (Bedding) is by far the most important control agent of Sirex noctilio F., a major pest of pine plantations. It sterilizes female sirex, is density dependent, can achieve nearly 100 percent parasitism and, as a result of its complicated biology can be readily manipulated for sirex control. Bedding and Iede (2005...

  8. Pathogenic characterization of lasiodplodia causing stem end rot of mango and its control using botanicals

    International Nuclear Information System (INIS)

    Ullah, S. F.; Hussain, Y.; Iram, S.

    2017-01-01

    Two widely cultivated mango fruit varieties White chounsa and Sindhri were collected from two major mango growing areas of Punjab and Sindh Provinces of Pakistan. This study was focused on pathological characterization of predominant postharvest diseases such as stem end rot of mango (Mangifera indica) caused by Lasiodiplodia theobromae, and evaluation of bio-control activity by different plant extracts. L. theobromae aggressiveness of isolates was tested by artificial inoculations under controlled conditions, all isolates proved pathogenic in varying degree of aggressiveness on (Sindhri and White chounsa) with reference to control. Calculated standard error mean varied in lesion area produced by pathogens 6-63cm/sup 2/ (Sindhri) and 60-170 cm/sup 2/ (White chounsa). Re-isolation of respective fungi verified the Koch's postulates. Plant extract of Datura stramonium, Aloe-vera, Eucalyptus camaldulensis, were used to control the radial growth of L. theobromae. Comparative analysis showed D. Stramonium and E. camaldulensis extracts most efficiently reduced the growth of Lasiodiplodia isolates, in comparison to Aloe-vera extract, restrict the 15-20% growth. All pathological results and treatments were significant at p<0.05 through ANOVA. This study emphasizes the behavior of pathogens which could be helpful in mango breeding to introduce resistance toward Lasiodiplodia and referred plants provide the best alternative of chemical fungicides. (author)

  9. Double impact of sterilizing pathogens: added value of increased life expectancy on pest control effectiveness.

    Science.gov (United States)

    Berec, Luděk; Maxin, Daniel

    2012-06-01

    Sterilizing pathogens are commonly assumed not to affect longevity of infected individuals, and if they do then negatively. Examples abound, however, of species in which the absence of reproduction actually increases life expectancy. This happens because by decreasing the energy outlay on reproduction individuals with lowered reproduction can live longer. Alternatively, fertile individuals are more susceptible to predators or parasitoids if the latter can capitalize on mating signals of the former. Here we develop and analyze an SI epidemiological model to explore whether and to what extent does such a life expectancy prolongation due to sterilizing pathogens affect host dynamics. In particular, we are interested in an added value of increased life expectancy on the possibility of successful pest control, that is, the effect of increased lifespan and hence increased potential of the infected individuals to spread the disease on pest control effectiveness. We show that although the parameter range in which we observe an effect of increased lifespan of the sterilized individuals is not large, the effect itself can be significant. In particular, the increase in pest control effectiveness can be very dramatic when disease transmission efficiency is close to birth rate, mortality rate of susceptibles is relatively high (i.e., the species is relatively short-lived), and sterilization efficiency is relatively high. Our results thus characterize pathogens that are promising candidates for an effective pest control and that might possibly be engineered if not occurring naturally.

  10. Biological control of Mycosphaerella fragariae in strawberry culture

    Directory of Open Access Journals (Sweden)

    Anderson Luis Heling

    2015-12-01

    Full Text Available The Mycosphaerella spot is one of the main foliar diseases of strawberry, degrating great leaf regions and reducing the photosynthetic area. Its control is mainly by the use of chemical fungicides, but, due the increasing demand for food free of pesticide, alternative control methods have been researched, such as biological control. This work aimed to evaluate the effect on strawberry plants, treated with the biological control agents Bacillus cereus, Saccharomyces boulardii and Saccharomyces cerevisiae, in the severity of Mycosphaerella fragariae, productivity and in the activity of β-1.3 glucanases, peroxidases and chitinases enzymes. It was verified that S. cerevisiae and B. cereus treatments were similar to fungicide for disease control. However, even reducing the severity of the disease, there was no increase in productivity, and the different control agents do not cause changes in the evaluated defense mechanisms.

  11. Autophagy response: manipulating the mTOR-controlled machinery by amino acids and pathogens.

    Science.gov (United States)

    Fader, Claudio Marcelo; Aguilera, Milton Osmar; Colombo, María Isabel

    2015-10-01

    Macroautophagy is a self-degradative process that normally maintains cellular homeostasis via a lysosomal pathway. It is induced by different stress signals, including nutrients and growth factors' restriction as well as pathogen invasions. These stimuli are modulated by the serine/threonine protein kinase mammalian target of rapamycin (mTOR) which control not only autophagy but also protein translation and gene expression. This review focuses on the important role of mTOR as a master regulator of cell growth and the autophagy pathway. Here, we have discussed the role of intracellular amino acid availability and intracellular pH in the redistribution of autophagic structures, which may contribute to mammalian target of rapamycin complex 1 (mTORC1) activity regulation. We have also discussed that mTORC1 complex and components of the autophagy machinery are localized at the lysosomal surface, representing a fascinating mechanism to control the metabolism, cellular clearance and also to restrain invading intracellular pathogens.

  12. Evolutionary Control of Infectious Disease: Prospects for Vectorborne and Waterborne Pathogens

    Directory of Open Access Journals (Sweden)

    Paul W Ewald

    1998-09-01

    Full Text Available Evolutionary theory may contribute to practical solutions for control of disease by identifying interventions that may cause pathogens to evolve to reduced virulence. Theory predicts, for example, that pathogens transmitted by water or arthropod vectors should evolve to relatively high levels of virulence because such pathogens can gain the evolutionary benefits of relatively high levels of host exploitation while paying little price from host illness. The entrance of Vibrio cholerae into South America in 1991 has generated a natural experiment that allows testing of this idea by determining whether geographic and temporal variations in toxigenicity correspond to variation in the potential for waterborne transmission. Preliminary studies show such correspondences: toxigenicity is negatively associated with access to uncontaminated water in Brazil; and in Chile, where the potential for waterborne transmission is particularly low, toxigenicity of strains declined between 1991 and 1998. In theory vector-proofing of houses should be similarly associated with benignity of vectorborne pathogens, such as the agents of dengue, malaria, and Chagas' disease. These preliminary studies draw attention to the need for definitive prospective experiments to determine whether interventions such as provisioning of uncontaminated water and vector-proofing of houses cause evolutionary reductions in virulence

  13. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2009-12-01

    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method.Methods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued .Results: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months.Conclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed. 

  14. Recommendations for control of pathogens and infectious diseases in fish research facilities

    Science.gov (United States)

    Kent, M.L.; Feist, S.W.; Harper, C.; Hoogstraten-Miller, S.; Law, J.M.; Sanchez-Morgado, J. M.; Tanguay, R.L.; Sanders, G.E.; Spitsbergen, J.M.; Whipps, Christopher M.

    2009-01-01

    Concerns about infectious diseases in fish used for research have risen along with the dramatic increase in the use of fish as models in biomedical research. In addition to acute diseases causing severe morbidity and mortality, underlying chronic conditions that cause low-grade or subclinical infections may confound research results. Here we present recommendations and strategies to avoid or minimize the impacts of infectious agents in fishes maintained in the research setting. There are distinct differences in strategies for control of pathogens in fish used for research compared to fishes reared as pets or in aquaculture. Also, much can be learned from strategies and protocols for control of diseases in rodents used in research, but there are differences. This is due, in part, the unique aquatic environment that is modified by the source and quality of the water provided and the design of facilities. The process of control of pathogens and infectious diseases in fish research facilities is relatively new, and will be an evolving process over time. Nevertheless, the goal of documenting, detecting, and excluding pathogens in fish is just as important as in mammalian research models.

  15. Biological insect control using Metarhizium anisopliae: morphological, molecular, and ecological aspects

    Directory of Open Access Journals (Sweden)

    Patricia Vieira Tiago

    2014-04-01

    Full Text Available Microbial control of insects is based on the rational use of pathogens to maintain environmentally balanced pest population levels, and Metarhizium anisopliae has been the most studied and most utilized fungal species for that purpose. The natural genetic variability of entomopathogenic fungi is considered one of the principal advantages of microbial insect control. The inter- and intraspecific variability and the genetic diversity and population structures of Metarhizium and other entomopathogenic fungi have been examined using ITS-RFLP, ISSR, and ISSP molecular markers. The persistence of M. anisopliae in the soil and its possible effects on the structures of resident microbial communities must be considered when selecting isolates for biological insect control.

  16. Possibilities of avoidance and control of bacterial plant diseases when using pathogen-tested (certified) or - treated planting material

    NARCIS (Netherlands)

    Janse, J.; Wenneker, M.

    2002-01-01

    Testing of planting material for freedom from phytopathogenic bacteria is an important, although not exclusive, method for control of bacterial diseases of plants. Ideally, pathogen-free or pathogen-/disease-resistant planting material is desirable, but this situation is not always possible on a

  17. Aspergillus alliaceus, a new potential biological control of the root parasitic weed Orobanche.

    Science.gov (United States)

    Aybeke, Mehmet; Sen, Burhan; Okten, Suzan

    2014-07-01

    During extensive surveys in fields heavily infested by broomrape in the Trakya Region-Turkey, a different new fungus, Aspergillus alliaceus, was isolated from the infected broomrape. It is aimed to investigate whether or not it is really a pathogen for Orobanche. The fungi was exposed to a greenhouse environment in order to assess its pathogenicity and virulence against Orobanche cernua. In addition, infection tests on Orobanche seeds were also performed under laboratory conditions. The fungus was subjected using two different methods, exposure to a liquid culture with conidial solution and a sclerotial solid culture with fungal mycelia. Cytological studies were carried out at light, TEM and SEM levels. The results show that the sclerotial solid culture with fungal mycelia quickly caused necrosis and was more effective than the other type. It also greatly diminished attachments, tubercles, and caused the emergence of shoots and an increase in the total shoot number of Orobanche. In addition, both when the fungi was exposed to both soil and used to contaminate sunflower seeds, its pathogenicity was more effective. Consequently, it was determined that A. alliaceus was an effective potential biological control of broomrape throughout its life cycle from dormant seed to mature plant. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Ross, macdonald, and a theory for the dynamics and control of mosquito-transmitted pathogens.

    Science.gov (United States)

    Smith, David L; Battle, Katherine E; Hay, Simon I; Barker, Christopher M; Scott, Thomas W; McKenzie, F Ellis

    2012-01-01

    Ronald Ross and George Macdonald are credited with developing a mathematical model of mosquito-borne pathogen transmission. A systematic historical review suggests that several mathematicians and scientists contributed to development of the Ross-Macdonald model over a period of 70 years. Ross developed two different mathematical models, Macdonald a third, and various "Ross-Macdonald" mathematical models exist. Ross-Macdonald models are best defined by a consensus set of assumptions. The mathematical model is just one part of a theory for the dynamics and control of mosquito-transmitted pathogens that also includes epidemiological and entomological concepts and metrics for measuring transmission. All the basic elements of the theory had fallen into place by the end of the Global Malaria Eradication Programme (GMEP, 1955-1969) with the concept of vectorial capacity, methods for measuring key components of transmission by mosquitoes, and a quantitative theory of vector control. The Ross-Macdonald theory has since played a central role in development of research on mosquito-borne pathogen transmission and the development of strategies for mosquito-borne disease prevention.

  19. Control of biological hazards in cold smoked salmon production

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Embarek, Peter Karim Ben; Jeppesen, V.F.

    1995-01-01

    An outline of the common processing technology for cold smoked salmon in Denmark is presented. The safety hazards related to pathogenic bacteria, parasites and biogenic amines are discussed with special emphasis on hazards related to Clostridium botulinum and Listeria monocytogenes. Critical...... control points are identified for all hazards except growth of L. monocytogenes. For this reason a limitation of shelf life to three weeks at +5 degrees C far cold smoked vacuum-packed salmon having greater than or equal to 3% water phase salt is recommended...

  20. Potential Biological and Climatic Factors That Influence the Incidence and Persistence of Highly Pathogenic H5N1 Avian Influenza Virus in Egypt

    Directory of Open Access Journals (Sweden)

    Ahmed H. Salaheldin

    2018-03-01

    Full Text Available Highly pathogenic H5N1 avian influenza virus (A/H5N1 of clade 2.2.1 is endemic in poultry in Egypt where the highest number of human infections worldwide was reported. During the last 12 years the Egyptian A/H5N1 evolved into several genotypes. In 2007-2014 vaccinated poultry suffered from antigenic drift variants of clade 2.2.1.1 and in 2014/2015 an unprecedented upsurge of A/H5N1 clade 2.2.1.2 occurred in poultry and humans. Factors contributing to the endemicity or re-emergence of A/H5N1 in poultry in Egypt remain unclear. Here, three potential factors were studied: climatic factors (temperature, relative humidity, and wind speed, biological fitness in vitro, and pathogenicity in domestic Pekin and Muscovy ducks. Statistical analyses using negative binomial regression models indicated that ambient temperature in winter months influenced the spread of A/H5N1 in different geographic areas analyzed in this study. In vitro, at 4 and 56°C 2.2.1.1 and recent 2.2.1.2 viruses were more stable than other viruses used in this study. Further, Pekin ducks were more resistant than Muscovy ducks and the viruses were excreted for up to 2 weeks post-infection assuming a strong role as a reservoir. Taken together, ambient temperature in winter months potentially contributes to increasing outbreaks in some regions in Egypt. Heat stability of clade 2.2.1.1 and recent 2.2.1.2 viruses probably favors their persistence at elevated temperatures. Importantly, asymptomatically infected Pekin ducks may play an important role in the spread of avian and human-like A/H5N1 in Egypt. Therefore, control measures including targeted surveillance and culling of silently infected Pekin ducks should be considered.

  1. Potential Biological and Climatic Factors That Influence the Incidence and Persistence of Highly Pathogenic H5N1 Avian Influenza Virus in Egypt

    Science.gov (United States)

    Salaheldin, Ahmed H.; Kasbohm, Elisa; El-Naggar, Heba; Ulrich, Reiner; Scheibner, David; Gischke, Marcel; Hassan, Mohamed K.; Arafa, Abdel-Satar A.; Hassan, Wafaa M.; Abd El-Hamid, Hatem S.; Hafez, Hafez M.; Veits, Jutta; Mettenleiter, Thomas C.; Abdelwhab, Elsayed M.

    2018-01-01

    Highly pathogenic H5N1 avian influenza virus (A/H5N1) of clade 2.2.1 is endemic in poultry in Egypt where the highest number of human infections worldwide was reported. During the last 12 years the Egyptian A/H5N1 evolved into several genotypes. In 2007-2014 vaccinated poultry suffered from antigenic drift variants of clade 2.2.1.1 and in 2014/2015 an unprecedented upsurge of A/H5N1 clade 2.2.1.2 occurred in poultry and humans. Factors contributing to the endemicity or re-emergence of A/H5N1 in poultry in Egypt remain unclear. Here, three potential factors were studied: climatic factors (temperature, relative humidity, and wind speed), biological fitness in vitro, and pathogenicity in domestic Pekin and Muscovy ducks. Statistical analyses using negative binomial regression models indicated that ambient temperature in winter months influenced the spread of A/H5N1 in different geographic areas analyzed in this study. In vitro, at 4 and 56°C 2.2.1.1 and recent 2.2.1.2 viruses were more stable than other viruses used in this study. Further, Pekin ducks were more resistant than Muscovy ducks and the viruses were excreted for up to 2 weeks post-infection assuming a strong role as a reservoir. Taken together, ambient temperature in winter months potentially contributes to increasing outbreaks in some regions in Egypt. Heat stability of clade 2.2.1.1 and recent 2.2.1.2 viruses probably favors their persistence at elevated temperatures. Importantly, asymptomatically infected Pekin ducks may play an important role in the spread of avian and human-like A/H5N1 in Egypt. Therefore, control measures including targeted surveillance and culling of silently infected Pekin ducks should be considered. PMID:29636730

  2. Irradiation control of pathogenic bacteria and their growth during storage time in cooled chicken

    International Nuclear Information System (INIS)

    Ha Yiming; Wang Feng; Fan Bei; Liu Shuliang; Ju Hua

    2009-01-01

    The growth of pathogenic bacteria during storage time and their D 10 values by irradiation in cooled chicken were evaluated. The total numbers of colony, E.coli 10003, Campylobacter jejuni33560 and CY04 of the D 10 values were 1.434 kGy, 0.408 kGy, 0.175 kGy, 0.2 kGy respectively in cooled chicken. The results show that total bacteria count in vacuum packaged cooled chicken sample is 5.66 lg(CFU/g) and 4.90 lg (CFU/g) after 3 kGy and 5 kGy irradiation. And in storage at 0∼4 degree C the storage shelf-life of irradiated vacuum packaged cooled chicken could extend to 21 d and 28 d. It can be deduced that pathogenic bacteria can be controlled effectively by irradiation. (authors)

  3. ESSENTIAL OILS OF CYMBOPOGON SP. IN THE CONTROL OF FOODBORNE PATHOGENIC BACTERIA

    Directory of Open Access Journals (Sweden)

    Danilo Florisvaldo BRUGNERA

    2011-08-01

    Full Text Available In this study, the agar well diffusion technique was used to determine the antibacterial activity of Cymbopogon nardus (citronella and Cymbopogon citratus (lemongrass essential oils, which were applied at different concentrations. The bacterial species used were the foodborne pathogens Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. Both essential oils presented antibacterial activity in most concentrations tested. The Minimum Inhibitory Concentrations (MICs founded were: 7.81μL/mL (S. aureus and 3.90μL/mL (E. coli and P. aeruginosa, for C. nardus essential oil; and 3.90μL/mL (S. aureus, E. coli and P. aeruginosa, for C. citratus essential oil. The essential oils used were shown as promising natural antibacterials for pathogenic bacteria control in the food industry.

  4. Biological control of Egyptian broomrape (Orobanche aegyptiaca using Fusarium spp.

    Directory of Open Access Journals (Sweden)

    I. Ghannam

    2007-08-01

    Full Text Available The broomrape (Orobanche spp. is an obligate holoparasitic weed that causes severe damage to many important vegetable crops. Many broomrape control strategies have been tested over the years. In this investigation, 125 Fusarium spp. isolates were recovered from diseased broomrape spikes collected from fields in agricultural areas near Hebron. The pathogenicity of isolates on broomrape was evaluated using an inoculum suspension containing mycelia and conidia. The most effective Fusarium isolates significantly increased the dead spikes of broomrape by 33.6–72.7% compared to the control; there was no obvious pathogenic effect on the tomato plants. Fusarium spp. isolates Fu 20, 25 and 119 were identified as F. solani, while Fu 30, 52, 59, 87 and 12-04 were F. oxysporum. In addition, the two previously known Fusarium strains, F. oxysporum strain EId (CNCM-I-1622 (Foxy and F. arthrosporioides strain E4a (CNCM-I-1621 (Farth were equally effective in controlling broomrape parasitizing tomato plants grown in pots, where the dead spikes of broomrape increased by 50.0 and 51.6%, respectively.

  5. Selection of endophytic fungi from comfrey (Symphytum officinale L.) for in vitro biological control of the phytopathogen Sclerotinia sclerotiorum (Lib.).

    Science.gov (United States)

    Rocha, Rafaeli; da Luz, Daniela Eleutério; Engels, Cibelle; Pileggi, Sônia Alvim Veiga; de Souza Jaccoud Filho, David; Matiello, Rodrigo Rodrigues; Pileggi, Marcos

    2009-01-01

    Biological control consists of using one organism to attack another that may cause economic damage to crops. Integrated Pest Management (IPM) is a very common strategy. The white mold produced by Sclerotinia sclerotiorum (Lib.) causes considerable damage to bean crops. This fungus is a soil inhabitant, the symptoms of which are characterized by water-soaked lesions covered by a white cottony fungal growth on the soil surface and/or the host plant. Possible biological control agents taken from plants are being investigated as phytopathogen inhibitors. These are endophytic microorganisms that inhabit the intercellular spaces of vegetal tissues and are often responsible for antimicrobial production. The objective of the present study was to select endophytic fungi isolated from comfrey (Symphytum officinale L.) leaves with in vitro antagonist potential against the phytopathogenic fungus S. sclerotiorum. Twelve isolates of endophytic fungi and a pathogenic strain of S. sclerotiorum were used in the challenge method. With the aid of this method, four endophytes with the best antagonistic activity against S. sclerotiorum were selected. Pathogen growth inhibition zones were considered indicative of antibiosis. The percentages of pathogenic mycelia growth were measured both with and without the antagonist, resulting in growth reductions of 46.7% to 50.0% for S. sclerotiorum. These analyses were performed by evaluating the endophytic/pathogenic mycelia growth in mm/day over an eight-day period of antagonistic tests.

  6. Transcription control engineering and applications in synthetic biology

    Directory of Open Access Journals (Sweden)

    Michael D. Engstrom

    2017-09-01

    Full Text Available In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein, a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators (cis-factors were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators (trans-factors, giving examples of how cis- and trans-acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli, we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  7. Transcription control engineering and applications in synthetic biology.

    Science.gov (United States)

    Engstrom, Michael D; Pfleger, Brian F

    2017-09-01

    In synthetic biology, researchers assemble biological components in new ways to produce systems with practical applications. One of these practical applications is control of the flow of genetic information (from nucleic acid to protein), a.k.a. gene regulation. Regulation is critical for optimizing protein (and therefore activity) levels and the subsequent levels of metabolites and other cellular properties. The central dogma of molecular biology posits that information flow commences with transcription, and accordingly, regulatory tools targeting transcription have received the most attention in synthetic biology. In this mini-review, we highlight many past successes and summarize the lessons learned in developing tools for controlling transcription. In particular, we focus on engineering studies where promoters and transcription terminators ( cis -factors) were directly engineered and/or isolated from DNA libraries. We also review several well-characterized transcription regulators ( trans- factors), giving examples of how cis- and trans -acting factors have been combined to create digital and analogue switches for regulating transcription in response to various signals. Last, we provide examples of how engineered transcription control systems have been used in metabolic engineering and more complicated genetic circuits. While most of our mini-review focuses on the well-characterized bacterium Escherichia coli , we also provide several examples of the use of transcription control engineering in non-model organisms. Similar approaches have been applied outside the bacterial kingdom indicating that the lessons learned from bacterial studies may be generalized for other organisms.

  8. Conservation biological control and enemy diversity on a landscape scale

    NARCIS (Netherlands)

    Tscharntke, T.; Bommarco, R.; Clough, Y.; Crist, T.O.; Kleijn, D.; Rand, T.A.; Tylianakis, J.M.; Nouhuys, S.; Vidal, S.

    2007-01-01

    Conservation biological control in agroecosystems requires a landscape management perspective, because most arthropod species experience their habitat at spatial scales beyond the plot level, and there is spillover of natural enemies across the crop–noncrop interface. The species pool in the

  9. Methylene Diphosphonate Chemical and Biological control of MDP complex

    International Nuclear Information System (INIS)

    Aungurarat, Angkanan; Ngamprayad, Tippanan

    2000-01-01

    Technetium-9 9m MDP easy prepared from MDP kits which different sources such as OAP (In house), SIGMA. The resulting Tc 9 9m -MDP preparations were controlled in chemical and biological tests to compare the different results in these cases: radiochemical purity, the quantity of starting material and biodistribution result

  10. Biological control agent for mosquito larvae: Review on the killifish ...

    African Journals Online (AJOL)

    This review attempts to give an account on the recent advances on the killifish Aphanius dispar dispar as a biological control agent for mosquito larvae. Thirty six (36) articles of literature (scientific papers, technical and workshop reports) on this subject covering the period between 1980 and 2009 were reviewed.

  11. Studies on bacterial flora and biological control agent of Cydia ...

    African Journals Online (AJOL)

    In the present study, in order to find a more effective and safe biological control agent against Cydia pomonella, we investigated the bacterial flora and tested them for insecticidal effects on this insect. According to morphological, physiological and biochemical tests, bacterial flora were identified as Proteus rettgeri (Cp1), ...

  12. Stakeholder perceptions: Biological control of Russian olive (Elaeagnus angustifolia)

    Science.gov (United States)

    Sharlene E. Sing; Kevin J. Delaney

    2016-01-01

    An online survey was distributed through email lists provided by various stakeholder groups on behalf of the International Consortium for Biological Control of Russian Olive in spring of 2012. A total of 392 respondents replied from 24 U.S. states and 1 Canadian province. Questions posed in the survey were designed to identify and categorize 1) stakeholders by...

  13. The perception of corn farmers about biological control of Caradrina ...

    African Journals Online (AJOL)

    The purpose of this study was to analyze the perception of corn farmers about biological control of Caradrina by Braconid in Dezful Township, Khouzestan Province, Iran. The method used in this study was correlative descriptive and causal relation. A random sample of Dezful township corn farmers of Khouzestan Province, ...

  14. The effect of biological and chemical control agents on the health status of the very early potato cultivar Rosara

    Directory of Open Access Journals (Sweden)

    Cwalina-Ambroziak Bożena

    2015-12-01

    Full Text Available The external appearance and quality of table potatoes are determined, among other factors, by the health status of the plants during the growing season. Chemical control methods are often combined with biocontrol agents to effectively fight potato pathogens. Potatoes of the very early cultivar Rosara were grown in experimental plots. The plots were located in Tomaszkowo (NE Poland, 2007-2009. The experiment involved the following treatments: 1 biological control − mycorrhizal Glomus spp. inoculum was applied to the roots, − tubers were dressed and plants were sprayed with Polyversum three times during the growing season, 2 chemical control - at two-week intervals, plants were sprayed with the following fungicides: Infinito 687.5 SC and Tanos 50 WG, Valbon 72 WG and Tanos 50 WG. In the control treatment, potato plants were not protected against pathogens. During the growing season, the severity of late blight and early blight was evaluated on a nine-point scale. The composition of fungal communities colonising potato stems was analysed. The fungistatic properties of the fungicides used in the field experiment were evaluated in an in vitro test. The symptoms of infections caused by Phytophthora infestans and Alternaria spp. were significantly reduced in the treatment which used the integrated chemical and biological control. The least diverse fungal community was isolated from fungicide-treated plants. In the in vitro test, fungicides at all analysed concentrations inhibited the linear mycelial growth of selected pathogens.

  15. Biological control of banana black Sigatoka disease with Trichoderma

    Directory of Open Access Journals (Sweden)

    Poholl Adan Sagratzki Cavero

    2015-06-01

    Full Text Available Black Sigatoka disease caused by Mycosphaerella fijiensis is the most severe banana disease worldwide. The pathogen is in an invasive phase in Brazil and is already present in most States of the country. The potential of 29 isolates of Trichoderma spp. was studied for the control of black Sigatoka disease under field conditions. Four isolates were able to significantly reduce disease severity and were further tested in a second field experiment. Isolate 2.047 showed the best results in both field experiments and was selected for fungicide sensitivity tests and mass production. This isolate was identified as Trichoderma atroviride by sequencing fragments of the ITS region of the rDNA and tef-1α of the RNA polymerase. Trichoderma atroviride was as effective as the fungicide Azoxystrobin, which is recommended for controlling black Sigatoka. This biocontrol agent has potential to control the disease and may be scaled-up for field applications on rice-based solid fermentation

  16. Biologically controlled minerals as potential indicators of life

    Science.gov (United States)

    Schwartz, D. E.; Mancinelli, R. L.; Kaneshiro, E.

    1991-01-01

    Minerals can be produced and deposited either by abiotic or biologic means. Regardless of their origin, mineral crystals reflect the environment conditions (e.g., temperature, pressure, chemical composition, and redox potential) present during crystal formation. Biologically-produced mineral crystals are grown or reworked under the control of their host organism and reflect an environment different from the abiotic environment. In addition, minerals of either biologic or abiotic origin have great longevities. For these reasons, biologically produced minerals have been proposed as biomarkers. Biomarkers are key morphological, chemical, and isotopic signatures of living systems that can be used to determine if life processes have occurred. Studies of biologically controlled minerals produced by the protist, Paramecium tetraurelia, were initiated since techniques have already been developed to culture them and isolate their crystalline material, and methods are already in place to analyze this material. Two direct crystalline phases were identified. One phase, whose chemical composition is high in Mg, was identified as struvite. The second phase, whose chemical composition is high in Ca, has not been previously found occurring naturally and may be considered a newly discovered material. Analyses are underway to determine the characteristics of these minerals in order to compare them with characteristics of these minerals in order to compare them with characteristics of minerals formed abiotically, but with the same chemical composition.

  17. Economic Benefit for Cuban Laurel Thrips Biological Control.

    Science.gov (United States)

    Shogren, C; Paine, T D

    2016-02-01

    The Cuban laurel thrips, Gynaikothrips ficorum Marchal (Thysanoptera: Phlaeothripidae), is a critical insect pest of Ficus microcarpa in California urban landscapes and production nurseries. Female thrips feed and oviposit on young Ficus leaves, causing the expanding leaves to fold or curl into a discolored leaf gall. There have been attempts to establish specialist predator natural enemies of the thrips, but no success has been reported. We resampled the same areas in 2013-2014 where we had released Montandoniola confusa (= morguesi) Streito and Matocq (Hemiptera: Anthocoridae) in southern California in 1995 but had been unable to recover individuals in 1997-1998. Thrips galls were significantly reduced in all three of the locations in the recent samples compared with the earlier samples. M. confusa was present in all locations and appears to be providing successful biological control. The value of the biological control, the difference between street trees in good foliage condition and trees with poor foliage, was $58,766,166. If thrips damage reduced the foliage to very poor condition, the value of biological control was $73,402,683. Total cost for the project was $61,830. The benefit accrued for every dollar spent on the biological control of the thrips ranged from $950, if the foliage was in poor condition, to $1,187, if the foliage was in very poor condition. The value of urban forest is often underappreciated. Economic analyses that clearly demonstrate the very substantial rates of return on investment in successful biological control in urban forests provide compelling arguments for supporting future efforts. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Evaluation of Orius species for biological control of Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae)

    NARCIS (Netherlands)

    Tommasini, M.G.

    2003-01-01

    Key words: Thysanoptera, Frankliniella occidentalis, Heteroptera, Orius leavigatu, Orius majusculu, Orius niger, Orius insidiosus, Biology, Diapause, Biological control.The overall aim of this research was to develop a biological control programme for F. occidentalis through the selection of

  19. Epigenetics and Why Biological Networks are More Controllable than Expected

    Science.gov (United States)

    Motter, Adilson

    2013-03-01

    A fundamental property of networks is that perturbations to one node can affect other nodes, potentially causing the entire system to change behavior or fail. In this talk, I will show that it is possible to exploit this same principle to control network behavior. This approach takes advantage of the nonlinear dynamics inherent to real networks, and allows bringing the system to a desired target state even when this state is not directly accessible or the linear counterpart is not controllable. Applications show that this framework permits both reprogramming a network to a desired task as well as rescuing networks from the brink of failure, which I will illustrate through various biological problems. I will also briefly review the progress our group has made over the past 5 years on related control of complex networks in non-biological domains.

  20. Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen

    International Nuclear Information System (INIS)

    Chitra, K.; Annadurai, G.

    2013-01-01

    In this present study the bio conjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were poly dispersed and the size of the silica nanoparticles was in the range of 114-164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 keV and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment of dye and carboxyl group onto the silica nanoparticles surface. The fluorescent silica nanoparticles showed highly efficient fluorescence and the fluorescent emission of silica nanoparticles occurred at 536 nm. The SEM image showed the aggregation of nanoparticles and bacteria. The growth of the pathogenic E. coli was controlled using silica nanoparticles; therefore silica nanoparticles could be used in food packaging material, biomedical material, and so forth. This work provides a rapid, simple, and accurate method for the detection of pathogen using fluorescent-based immunoassay.

  1. Environmental controls, oceanography and population dynamics of pathogens and harmful algal blooms: connecting sources to human exposure

    Directory of Open Access Journals (Sweden)

    Minnett Peter

    2008-11-01

    Full Text Available Abstract Coupled physical-biological models are capable of linking the complex interactions between environmental factors and physical hydrodynamics to simulate the growth, toxicity and transport of infectious pathogens and harmful algal blooms (HABs. Such simulations can be used to assess and predict the impact of pathogens and HABs on human health. Given the widespread and increasing reliance of coastal communities on aquatic systems for drinking water, seafood and recreation, such predictions are critical for making informed resource management decisions. Here we identify three challenges to making this connection between pathogens/HABs and human health: predicting concentrations and toxicity; identifying the spatial and temporal scales of population and ecosystem interactions; and applying the understanding of population dynamics of pathogens/HABs to management strategies. We elaborate on the need to meet each of these challenges, describe how modeling approaches can be used and discuss strategies for moving forward in addressing these challenges.

  2. Biological Control of Fusarium Stalk Rot of Maize Using Bacillus spp

    Directory of Open Access Journals (Sweden)

    Joon-Hee Han

    2015-12-01

    Full Text Available Maize (Zea mays L. is an economically important crop in worldwide. While the consumption of the maize is steadily increasing, the yield is decreasing due to continuous mono-cultivation and infection of soil-borne fungal pathogens such as Fusarium species. Recently, stalk rot disease in maize, caused by F. subglutinans and F. temperatum has been reported in Korea. In this study, we isolated bacterial isolates in rhizosphere soil of maize and subsequently tested for antagonistic activities against F. subglutinans and F. temperatum. A total of 1,357 bacterial strains were isolated from rhizosphere. Among them three bacterial isolates (GC02, GC07, GC08 were selected, based on antagonistic effects against Fusarium species. The isolates GC02 and GC07 were most efficient in inhibiting the mycelium growth of the pathogens. The three isolates GC02, GC07 and GC08 were identified as Bacillus methylotrophicus, B. amyloliquefaciens and B. thuringiensis using 16S rRNA sequence analysis, respectively. GC02 and GC07 bacterial suspensions were able to suppress over 80% conidial germination of the pathogens. GC02, GC07 and GC08 were capable of producing large quantities of protease enzymes, whereas the isolates GC07 and GC08 produced cellulase enzymes. The isolates GC02 and GC07 were more efficient in phosphate solubilization and siderophore production than GC08. Analysis of disease suppression revealed that GC07 was most effective in suppressing the disease development of stalk rot. It was also found that B. methylotrophicus GC02 and B. amyloliquefaciens GC07 have an ability to inhibit the growth of other plant pathogenic fungi. This study indicated B. methylotrophicus GC02 and B. amyloliquefaciens GC07 has potential for being used for the development of a biological control agent.

  3. Biological effects of paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium Paenibacillus larvae.

    Science.gov (United States)

    Garcia-Gonzalez, Eva; Müller, Sebastian; Hertlein, Gillian; Heid, Nina; Süssmuth, Roderich D; Genersch, Elke

    2014-10-01

    Paenibacillus larvae is the etiological agent of American Foulbrood (AFB) a world-wide distributed devastating disease of the honey bee brood. Previous comparative genome analysis and more recently, the elucidation of the bacterial genome, provided evidence that this bacterium harbors putative functional nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) and therefore, might produce nonribosomal peptides (NRPs) and polyketides (PKs). Such biosynthesis products have been shown to display a wide-range of biological activities such as antibacterial, antifungal or cytotoxic activity. Herein we present an in silico analysis of the first NRPS/PKS hybrid of P. larvae and we show the involvement of this cluster in the production of a compound named paenilamicin (Pam). For the characterization of its in vitro and in vivo bioactivity, a knock-out mutant strain lacking the production of Pam was constructed and subsequently compared to wild-type species. This led to the identification of Pam by mass spectrometry. Purified Pam-fractions showed not only antibacterial but also antifungal and cytotoxic activities. The latter suggested a direct effect of Pam on honey bee larval death which could, however, not be corroborated in laboratory infection assays. Bee larvae infected with the non-producing Pam strain showed no decrease in larval mortality, but a delay in the onset of larval death. We propose that Pam, although not essential for larval mortality, is a virulence factor of P. larvae influencing the time course of disease. These findings are not only of significance in elucidating and understanding host-pathogen interactions but also within the context of the quest for new compounds with antibiotic activity for drug development. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  4. Genetic Variation and Biological Control of Fusarium graminearum Isolated from Wheat in Assiut-Egypt

    Directory of Open Access Journals (Sweden)

    Amer F. Mahmoud

    2016-04-01

    Full Text Available Fusarium graminearum Schwabe causes Fusarium head blight (FHB, a devastating disease that leads to extensive yield and quality loss of wheat and other cereal crops. Twelve isolates of F. graminearum were collected from naturally infected spikes of wheat from Assiut Egypt. These isolates were compared using SRAP. The results indicated distinct genetic groups exist within F. graminearum, and demonstrated that these groups have different biological properties, especially with respect to their pathogenicity on wheat. There were biologically significant differences between the groups; with group (B isolates being more aggressive towards wheat than groups (A and (C. Furthermore, Trichoderma harzianum (Rifai and Bacillus subtilis (Ehrenberg which isolated from wheat kernels were screened for antagonistic activity against F. graminearum. They significantly reduced the growth of F. graminearum colonies in culture. In order to gain insight into biological control effect in situ, highly antagonistic isolates of T. harzianum and B. subtilis were selected, based on their in vitro effectiveness, for greenhouse test. It was revealed that T. harzianum and B. subtilis significantly reduced FHB severity. The obtained results indicated that T. harzianum and B. subtilis are very effective biocontrol agents that offer potential benefit in FHB and should be harnessed for further biocontrol applications. The accurate analysis of genetic variation and studies of population structures have significant implications for understanding the genetic traits and disease control programs in wheat. This is the first known report of the distribution and genetic variation of F. graminearum on wheat spikes in Assiut Egypt.

  5. A theoretical approach on controlling agricultural pest by biological controls.

    Science.gov (United States)

    Mondal, Prasanta Kumar; Jana, Soovoojeet; Kar, T K

    2014-03-01

    In this paper we propose and analyze a prey-predator type dynamical system for pest control where prey population is treated as the pest. We consider two classes for the pest namely susceptible pest and infected pest and the predator population is the natural enemy of the pest. We also consider average delay for both the predation rate i.e. predation to the susceptible pest and infected pest. Considering a subsystem of original system in the absence of infection, we analyze the existence of all possible non-negative equilibria and their stability criteria for both the subsystem as well as the original system. We present the conditions for transcritical bifurcation and Hopf bifurcation in the disease free system. The theoretical evaluations are demonstrated through numerical simulations.

  6. Thresholds for HLB vector control in infected commercial citrus and compatibility with biological control

    OpenAIRE

    Monzo, C.; Hendricks, K.; Roberts, P.; Stansly, P. A.

    2014-01-01

    Control of the HLB vector, Diaphorina citri Kuwayama, is considered a basic component for management this disease, even in a high HLB incidence scenario. Such control is mostly chemically oriented. However, over use of insecticides would increase costs and be incompatible with biological control. Establishment of economic thresholds for psyllid control under different price scenarios could optimize returns on investment.

  7. Biomimicry of volatile-based microbial control for managing emerging fungal pathogens.

    Science.gov (United States)

    Gabriel, K T; Joseph Sexton, D; Cornelison, C T

    2018-05-01

    Volatile organic compounds (VOCs) are known to be produced by a wide range of micro-organisms and for a number of purposes. Volatile-based microbial inhibition in environments such as soil is well-founded, with numerous antimicrobial VOCs having been identified. Inhibitory VOCs are of interest as microbial control agents, as low concentrations of gaseous VOCs can elicit significant antimicrobial effects. Volatile organic compounds are organic chemicals typically characterized as having low molecular weight, low solubility in water, and high vapour pressure. Consequently, VOCs readily evaporate to the gaseous phase at standard temperature and pressure. This contact-independent antagonism presents unique advantages over traditional, contact-dependent microbial control methods, including increased surface exposure and reduced environmental persistence. This approach has been the focus of our recent research, with positive results suggesting it may be particularly promising for the management of emerging fungal pathogens, such as the causative agents of white-nose syndrome of bats and snake fungal disease, which are difficult or impossible to treat using traditional approaches. Here, we review the history of volatile-based microbial control, discuss recent progress in formulations that mimic naturally antagonistic VOCs, outline the development of a novel treatment device, and highlight areas where further work is needed to successfully deploy VOCs against existing and emerging fungal pathogens. © 2017 The Society for Applied Microbiology.

  8. Research Regarding the Simultaneous Control of the Pathogens on Tomatoes Crops under High Plastic Tunnels

    Directory of Open Access Journals (Sweden)

    Gabriela ŞOVĂREL

    2017-05-01

    Full Text Available In Romania the most important pathogens on tomatoes crops are Alternaria porri f.sp. solani, Botrytis cinerea, Fulvia fulva, Phytophthora infestans and Erysiphe sp. During period of vegetation, the attack of mentioned pathogens are frequently overlapping. For simultaneously control of pathogenswere used some combination with different active substances (chlorothalonil 500g/l, iprodione 500 g/l, fenhexamid 500 g/l, thiophanate methyl 500g/l, metiram 80%, dimethomorph 9%, mancozeb 60%, difenoconazole 250 g/l , fenamidone 75g/l, propamocarb HCL 375 g/l. The best results for controlling Alternaria porri f.sp. solani, Botrytis cinerea and Fulvia fulva are metiram 80% 0.2% + thiophanate methyl 500g/l 0.14% with 93.5% efficacy. In the untreated check the degree of attack was 78.6% (44.3% A.solani, 7.0% B.cinerea and 27.3% F. Fulva. For controlling Phytophthora infestans, Erysiphe sp. and Fulvia fulva (fenamidone 75g/l + propamocarb HCL 375 g/l    0.2% +  difenoconazole 250 g/l 0.05% with 94.5% efficacy. In the untreated check the degree of attack is 81.2% (38.4% P. infestans, 27.4% Erysiphe sp. , 15.4% F. fulva.

  9. Quality control of X-ray irradiator by biological markers

    International Nuclear Information System (INIS)

    Miura, Miwa; Lukmanul Hakkim, F.; Yoshida, Masahiro; Matsuda, Naoki; Morita, Naoko

    2011-01-01

    The exposure of animals or cultured cells to radiation is the essential and common step in experimental researches to elucidate biological effects of radiation. When an X-ray generator is used as a radiation source, physical parameters including dose, dose rate, and the energy spectrum of X-ray play crucial roles in biological outcome. Therefore, those parameters are the important points to be checked in quality control and to be carefully considered in advance to the irradiation to obtain the accurate and reproductive results. Here we measured radiation dose emitted from the X-ray irradiator for research purposes by using clonogenic survival of cultured mammalian cells as a biological marker in parallel with physical dosimetry. The results drawn from both methods exhibited good consistency in the dose distribution on the irradiation stage. Furthermore, the close relationship was observed between cell survival and the photon energy spectrum by using different filter components. These results suggest that biological dosimetry is applicable to quality control of X-ray irradiator in adjunct to physical dosimetry and that it possibly helps better understanding of the optimal irradiating condition by X-ray users in life-science field. (author)

  10. Biological control and invading freshwater snails. A case study.

    Science.gov (United States)

    Pointier, J P; Augustin, D

    1999-12-01

    Introductions of four species of freshwater snails occurred between 1972 and 1996 onto Guadeloupe Island. Two of them, Melanoides tuberculata and Marisa cornuarietis, were subsequently used as biological control agents against Biomphalaria glabrata, the snail intermediate host of intestinal schistosomiasis. In 1996, a general survey was carried out in 134 sites which had already been investigated in 1972. The total number of mollusc species had increased from 19 to 21. Site numbers housing B. glabrata and two other species had strongly declined. This decline may be mainly attributed to a competitive displacement by M. tuberculata and M. cornuarietis as illustrated by several biological control programmes. There were no changes in the remainder of the malacological fauna.

  11. Design control considerations for biologic-device combination products.

    Science.gov (United States)

    Anderson, Dave; Liu, Roger; Anand Subramony, J; Cammack, Jon

    2017-03-01

    Combination products are therapeutic and diagnostic medical products that combine drugs, devices, and/or biological products with one another. Historically, biologics development involved identifying efficacious doses administered to patients intravenously or perhaps by a syringe. Until fairly recently, there has been limited focus on developing an accompanying medical device, such as a prefilled syringe or auto-injector, to enable easy and more efficient delivery. For the last several years, and looking forward, where there may be little to distinguish biologics medicines with relatively similar efficacy profiles, the biotechnology market is beginning to differentiate products by patient-focused, biologic-device based combination products. As innovative as biologic-device combination products are, they can pose considerable development, regulatory, and commercialization challenges due to unique physicochemical properties and special clinical considerations (e.g., dosing volumes, frequency, co-medications, etc.) of the biologic medicine. A biologic-device combination product is a marriage between two partners with "cultural differences," so to speak. There are clear differences in the development, review, and commercialization processes of the biologic and the device. When these two cultures come together in a combination product, developers and reviewers must find ways to address the design controls and risk management processes of both the biologic and device, and knit them into a single entity with supporting product approval documentation. Moreover, digital medicine and connected health trends are pushing the boundaries of combination product development and regulations even further. Despite an admirable cooperation between industry and FDA in recent years, unique product configurations and design features have resulted in review challenges. These challenges have prompted agency reviewers to modernize consultation processes, while at the same time, promoting

  12. Controlled polymer synthesis--from biomimicry towards synthetic biology.

    Science.gov (United States)

    Pasparakis, George; Krasnogor, Natalio; Cronin, Leroy; Davis, Benjamin G; Alexander, Cameron

    2010-01-01

    The controlled assembly of synthetic polymer structures is now possible with an unprecedented range of functional groups and molecular architectures. In this critical review we consider how the ability to create artificial materials over lengthscales ranging from a few nm to several microns is generating systems that not only begin to mimic those in nature but also may lead to exciting applications in synthetic biology (139 references).

  13. Assessing Probabilistic Risk Assessment Approaches for Insect Biological Control Introductions

    OpenAIRE

    Kaufman, Leyla V.; Wright, Mark G.

    2017-01-01

    The introduction of biological control agents to new environments requires host specificity tests to estimate potential non-target impacts of a prospective agent. Currently, the approach is conservative, and is based on physiological host ranges determined under captive rearing conditions, without consideration for ecological factors that may influence realized host range. We use historical data and current field data from introduced parasitoids that attack an endemic Lepidoptera species in H...

  14. Bacillus cereus un patógeno importante en el control microbiológico de los alimentos / Bacillus cereus an important pathogen the microbiological control of food

    Directory of Open Access Journals (Sweden)

    Jennifer Sánchez

    2016-05-01

    Full Text Available Resumen Bacillus cereus es una bacteria genéticamente diversa que se encuentra comúnmente en el ambiente. Contamina los alimentos afectando la salud humana, al ingerir el microorganismo y/o sus toxinas, la emética o las enterotoxinas. En Colombia son escasos los reportes de intoxicación por B. cereus y se estima que hay un gran subregistro. Por lo anterior, se recomienda aumentar la vigilancia de este patógeno y realizar estudios sobre aspectos relevantes que permitan aplicar medidas de control para disminuir las intoxicaciones por B. cereus. El objetivo de esta revisión bibliográfica es presentar información actualizada sobre B. cereus, que incluye aspectos de su biología, taxonomía, toxinas, alimentos que contamina y metodologías para detectar, prevenir y controlar este microorganismo. La información presentada es de utilidad para el público en general, especialmente personas vinculadas al sector de alimentos, inocuidad alimentaria y control de procesos. / Abstract Bacillus cereus is a genetically diverse bacterium commonly found in the environment. It contaminates food, thus affecting human health upon ingestion of the microorganism and/or its toxins, the emetic or enterotoxins. In Colombia, reports of intoxication by B. cereus are scarce and under-registration is presumed. Because of this, it is recommended to increase surveillance of this pathogen and to develop studies on relevant aspects that allow the application of control measures to reduce intoxications by B. cereus. The aim of this review is to present current information on B. cereus, including aspects of its biology, taxonomy, toxins, food that it contaminates and methodologies for the detection, prevention and control of this microorganism. This information is useful for the general public, especially people involved with the food sector, food safety and process control.

  15. Integration of Plant Defense Traits with Biological Control of Arthropod Pests: Challenges and Opportunities.

    Science.gov (United States)

    Peterson, Julie A; Ode, Paul J; Oliveira-Hofman, Camila; Harwood, James D

    2016-01-01

    Crop plants exhibit a wide diversity of defensive traits and strategies to protect themselves from damage by herbivorous pests and disease. These defensive traits may be naturally occurring or artificially selected through crop breeding, including introduction via genetic engineering. While these traits can have obvious and direct impacts on herbivorous pests, many have profound effects on higher trophic levels, including the natural enemies of herbivores. Multi-trophic effects of host plant resistance have the potential to influence, both positively and negatively, biological control. Plant defense traits can influence both the numerical and functional responses of natural enemies; these interactions can be semiochemically, plant toxin-, plant nutrient-, and/or physically mediated. Case studies involving predators, parasitoids, and pathogens of crop pests will be presented and discussed. These diverse groups of natural enemies may respond differently to crop plant traits based on their own unique biology and the ecological niches they fill. Genetically modified crop plants that have been engineered to express transgenic products affecting herbivorous pests are an additional consideration. For the most part, transgenic plant incorporated protectant (PIP) traits are compatible with biological control due to their selective toxicity to targeted pests and relatively low non-target impacts, although transgenic crops may have indirect effects on higher trophic levels and arthropod communities mediated by lower host or prey number and/or quality. Host plant resistance and biological control are two of the key pillars of integrated pest management; their potential interactions, whether they are synergistic, complementary, or disruptive, are key in understanding and achieving sustainable and effective pest management.

  16. Integration of plant defense traits with biological control of arthropod pests: challenges and opportunities

    Directory of Open Access Journals (Sweden)

    Julie A Peterson

    2016-11-01

    Full Text Available Crop plants exhibit a wide diversity of defensive traits and strategies to protect themselves from damage by herbivorous pests and disease. These defensive traits may be naturally occurring or artificially selected through crop breeding, including introduction via genetic engineering. While these traits can have obvious and direct impacts on herbivorous pests, many have profound effects on higher trophic levels, including the natural enemies of herbivores. Multi-trophic effects of host plant resistance have the potential to influence, both positively and negatively, biological control. Plant defense traits can influence both the numerical and functional responses of natural enemies; these interactions can be semiochemically-, plant toxin-, plant nutrient-, and/or physically-mediated. Case studies involving predators, parasitoids, and pathogens of crop pests will be presented and discussed. These diverse groups of natural enemies may respond differently to crop plant traits based on their own unique biology and the ecological niches they fill. Genetically modified crop plants that have been engineered to express transgenic products affecting herbivorous pests are an additional consideration. For the most part, transgenic plant incorporated protectant (PIP traits are compatible with biological control due to their selective toxicity to targeted pests and relatively low non-target impacts, although transgenic crops may have indirect effects on higher trophic levels and arthropod communities mediated by lower host or prey number and/or quality. Host plant resistance and biological control are two of the key pillars of integrated pest management; their potential interactions, whether they are synergistic, complementary, or disruptive, are key in understanding and achieving sustainable and effective pest management.

  17. Application of bacteriophages in post-harvest control of human pathogenic and food spoiling bacteria.

    Science.gov (United States)

    Pérez Pulido, Rubén; Grande Burgos, Maria José; Gálvez, Antonio; Lucas López, Rosario

    2016-10-01

    Bacteriophages have attracted great attention for application in food biopreservation. Lytic bacteriophages specific for human pathogenic bacteria can be isolated from natural sources such as animal feces or industrial wastes where the target bacteria inhabit. Lytic bacteriophages have been tested in different food systems for inactivation of main food-borne pathogens including Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Salmonella enterica, Shigella spp., Campylobacter jejuni and Cronobacter sakazkii, and also for control of spoilage bacteria. Application of lytic bacteriophages could selectively control host populations of concern without interfering with the remaining food microbiota. Bacteriophages could also be applied for inactivation of bacteria attached to food contact surfaces or grown as biofilms. Bacteriophages may receive a generally recognized as safe status based on their lack of toxicity and other detrimental effects to human health. Phage preparations specific for L. monocytogenes, E. coli O157:H7 and S. enterica serotypes have been commercialized and approved for application in foods or as part of surface decontamination protocols. Phage endolysins have a broader host specificity compared to lytic bacteriophages. Cloned endolysins could be used as natural preservatives, singly or in combination with other antimicrobials such as bacteriocins.

  18. VarR controls colonization and virulence in the marine macroalgal pathogen Nautella italica R11

    Directory of Open Access Journals (Sweden)

    Melissa eGardiner

    2015-10-01

    Full Text Available There is increasing evidence to suggest that macroalgae (seaweeds are susceptible to infectious disease. However, to date, little is known about the mechanisms that facilitate the colonization and virulence of microbial seaweed pathogens. One well-described example of a seaweed disease is the bleaching of the red alga Delisea pulchra, which can be caused by the bacterium Nautella italica R11, a member of the Roseobacter clade. This pathogen contains a unique luxR-type gene, varR, which we hypothesize controls its colonization and virulence. We show here that a varR knock-out strain is deficient in its ability to cause disease in D. pulchra and is defective in biofilm formation and attachment to a common algal polysaccharide. Moreover complementation of the varR gene in trans can restore these functions to the wild type levels. Proteomic analysis of bacterial cells in planktonic and biofilm growth highlight the potential importance of nitrogen scavenging, mobilization of energy reserves, and stress resistance in the biofilm lifestyle of N. italica R11. Moreover, we show that VarR regulates the expression of a specific subset of biofilm-associated proteins. Taken together these data suggest that VarR controls colonization and persistence of N. italica R11 on the surface of a macroalgal host and that it is an important regulator of virulence.

  19. Disease control by chemical and biological fungicides in cultivated mushrooms: button mushroom, oyster mushroom and shiitake

    Directory of Open Access Journals (Sweden)

    Ivana Potočnik

    2015-12-01

    Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.

  20. Biologically-Inspired Control Architecture for Musical Performance Robots

    Directory of Open Access Journals (Sweden)

    Jorge Solis

    2014-10-01

    Full Text Available At Waseda University, since 1990, the authors have been developing anthropomorphic musical performance robots as a means for understanding human control, introducing novel ways of interaction between musical partners and robots, and proposing applications for humanoid robots. In this paper, the design of a biologically-inspired control architecture for both an anthropomorphic flutist robot and a saxophone playing robot are described. As for the flutist robot, the authors have focused on implementing an auditory feedback system to improve the calibration procedure for the robot in order to play all the notes correctly during a performance. In particular, the proposed auditory feedback system is composed of three main modules: an Expressive Music Generator, a Feed Forward Air Pressure Control System and a Pitch Evaluation System. As for the saxophone-playing robot, a pressure-pitch controller (based on the feedback error learning to improve the sound produced by the robot during a musical performance was proposed and implemented. In both cases studied, a set of experiments are described to verify the improvements achieved while considering biologically-inspired control approaches.

  1. Self-Organized Biological Dynamics and Nonlinear Control

    Science.gov (United States)

    Walleczek, Jan

    2006-04-01

    The frontiers and challenges of biodynamics research Jan Walleczek; Part I. Nonlinear Dynamics in Biology and Response to Stimuli: 1. External signals and internal oscillation dynamics - principal aspects and response of stimulated rhythmic processes Friedemann Kaiser; 2. Nonlinear dynamics in biochemical and biophysical systems: from enzyme kinetics to epilepsy Raima Larter, Robert Worth and Brent Speelman; 3. Fractal mechanisms in neural control: human heartbeat and gait dynamics in health and disease Chung-Kang Peng, Jeffrey M. Hausdorff and Ary L. Goldberger; 4. Self-organising dynamics in human coordination and perception Mingzhou Ding, Yanqing Chen, J. A. Scott Kelso and Betty Tuller; 5. Signal processing in biochemical reaction networks Adam P. Arkin; Part II. Nonlinear Sensitivity of Biological Systems to Electromagnetic Stimuli: 6. Electrical signal detection and noise in systems with long-range coherence Paul C. Gailey; 7. Oscillatory signals in migrating neutrophils: effects of time-varying chemical and electrical fields Howard R. Petty; 8. Enzyme kinetics and nonlinear biochemical amplification in response to static and oscillating magnetic fields Jan Walleczek and Clemens F. Eichwald; 9. Magnetic field sensitivity in the hippocampus Stefan Engström, Suzanne Bawin and W. Ross Adey; Part III. Stochastic Noise-Induced Dynamics and Transport in Biological Systems: 10. Stochastic resonance: looking forward Frank Moss; 11. Stochastic resonance and small-amplitude signal transduction in voltage-gated ion channels Sergey M. Bezrukov and Igor Vodyanoy; 12. Ratchets, rectifiers and demons: the constructive role of noise in free energy and signal transduction R. Dean Astumian; 13. Cellular transduction of periodic and stochastic energy signals by electroconformational coupling Tian Y. Tsong; Part IV. Nonlinear Control of Biological and Other Excitable Systems: 14. Controlling chaos in dynamical systems Kenneth Showalter; 15. Electromagnetic fields and biological

  2. Adaptive Fuzzy-Lyapunov Controller Using Biologically Inspired Swarm Intelligence

    Directory of Open Access Journals (Sweden)

    Alejandro Carrasco Elizalde

    2008-01-01

    Full Text Available The collective behaviour of swarms produces smarter actions than those achieved by a single individual. Colonies of ants, flocks of birds and fish schools are examples of swarms interacting with their environment to achieve a common goal. This cooperative biological intelligence is the inspiration for an adaptive fuzzy controller developed in this paper. Swarm intelligence is used to adjust the parameters of the membership functions used in the adaptive fuzzy controller. The rules of the controller are designed using a computing-with-words approach called Fuzzy-Lyapunov synthesis to improve the stability and robustness of an adaptive fuzzy controller. Computing-with-words provides a powerful tool to manipulate numbers and symbols, like words in a natural language.

  3. Diffusible signal factor-dependent quorum sensing in pathogenic bacteria and its exploitation for disease control.

    Science.gov (United States)

    Dow, J M

    2017-01-01

    Cell-to-cell signals of the diffusible signal factor (DSF) family are cis-2-unsaturated fatty acids of differing chain length and branching pattern. DSF signalling has been described in diverse bacteria to include plant and human pathogens where it acts to regulate functions such as biofilm formation, antibiotic tolerance and the production of virulence factors. DSF family signals can also participate in interspecies signalling with other bacteria and interkingdom signalling such as with the yeast Candida albicans. Interference with DSF signalling may afford new opportunities for the control of bacterial disease. Such strategies will depend in part on detailed knowledge of the molecular mechanisms underlying the processes of signal synthesis, perception and turnover. Here, I review both recent progress in understanding DSF signalling at the molecular level and prospects for translating this knowledge into approaches for disease control. © 2016 The Society for Applied Microbiology.

  4. Biopesticides: An option for the biological pest control

    Directory of Open Access Journals (Sweden)

    Eusebio Nava Pérez

    2012-09-01

    Full Text Available The indiscriminate use of synthetic pesticides and the problems that its cause to human health, agriculture and the environment is comment, this paper also present general aspects about of biopesticides, and their uses in the biological pest control. By the nature these can be safely used in a sustainable agriculture. An example is the use of botanical pesticides whose active ingredient are the terpenes, alkaloids and phenolics, these have insecticide effects for many agriculture pests; also its are less expensive, are biodegradable and safe for humans and the environment, however havelittle residuality. Microbial pesticides are being introduced successfully to pests control in important crops such as; coffee, sugar cane, beans and corn. These products contain bacteria, fungi, viruses or nematodes. However, few entomopathogenic agents have been developed as effective biocontrol agents, one of them is the bacterium Bacillus thuringiensis (Berlinier for control of armyworm Spodoptera frugiperda (J.E Smith covering about 74% of the market,fungus 10% , viruses 5% and 11% others. Other upstanding case is the use of the fungus Beauveria bassiana (Balsamoagainst bean weevil Acanthoscelides obtectus (Say. Biopesticides have shown that when are used properly in the biological pest control its favor the practice of a sustainable agriculture, with less dependence of chemical insecticides.

  5. Synthetic biology and regulatory networks: where metabolic systems biology meets control engineering.

    Science.gov (United States)

    He, Fei; Murabito, Ettore; Westerhoff, Hans V

    2016-04-01

    Metabolic pathways can be engineered to maximize the synthesis of various products of interest. With the advent of computational systems biology, this endeavour is usually carried out through in silico theoretical studies with the aim to guide and complement further in vitro and in vivo experimental efforts. Clearly, what counts is the result in vivo, not only in terms of maximal productivity but also robustness against environmental perturbations. Engineering an organism towards an increased production flux, however, often compromises that robustness. In this contribution, we review and investigate how various analytical approaches used in metabolic engineering and synthetic biology are related to concepts developed by systems and control engineering. While trade-offs between production optimality and cellular robustness have already been studied diagnostically and statically, the dynamics also matter. Integration of the dynamic design aspects of control engineering with the more diagnostic aspects of metabolic, hierarchical control and regulation analysis is leading to the new, conceptual and operational framework required for the design of robust and productive dynamic pathways. © 2016 The Author(s).

  6. Emerging Preservation Techniques for Controlling Spoilage and Pathogenic Microorganisms in Fruit Juices

    Science.gov (United States)

    Aneja, Kamal Rai; Dhiman, Romika; Aggarwal, Neeraj Kumar; Aneja, Ashish

    2014-01-01

    Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed. PMID:25332721

  7. Emerging Preservation Techniques for Controlling Spoilage and Pathogenic Microorganisms in Fruit Juices

    Directory of Open Access Journals (Sweden)

    Kamal Rai Aneja

    2014-01-01

    Full Text Available Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed.

  8. Emerging preservation techniques for controlling spoilage and pathogenic microorganisms in fruit juices.

    Science.gov (United States)

    Aneja, Kamal Rai; Dhiman, Romika; Aggarwal, Neeraj Kumar; Aneja, Ashish

    2014-01-01

    Fruit juices are important commodities in the global market providing vast possibilities for new value added products to meet consumer demand for convenience, nutrition, and health. Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices. In order to reduce the incidence of outbreaks, fruit juices are preserved by various techniques. Thermal pasteurization is used commercially by fruit juice industries for the preservation of fruit juices but results in losses of essential nutrients and changes in physicochemical and organoleptic properties. Nonthermal pasteurization methods such as high hydrostatic pressure, pulsed electric field, and ultrasound and irradiations have also been employed in fruit juices to overcome the negative effects of thermal pasteurization. Some of these techniques have already been commercialized. Some are still in research or pilot scale. Apart from these emerging techniques, preservatives from natural sources have also shown considerable promise for use in some food products. In this review article, spoilage, pathogenic microflora, and food borne outbreaks associated with fruit juices of last two decades are given in one section. In other sections various prevention methods to control the growth of spoilage and pathogenic microflora to increase the shelf life of fruit juices are discussed.

  9. Defense reactions of bean genotypes to bacterial pathogens in controlled conditions

    Science.gov (United States)

    Uysal, B.; Bastas, K. K.

    2018-03-01

    This study was focused on the role of antioxidant enzymes and total protein in imparting resistance against common bacterial blight caused by Xanthomonas axonopodis pv. phaseoli (Xap) and halo blight caused by Pseudomonas syringae pv. phaseolicola (Psp) in bean. Activities of Ascorbate peroxidase (APX), Catalase (CAT) and total protein were studied in resistant and susceptible bean genotypes. Five-day-old seedlings were inoculated with a bacterial suspension (108 CFU ml-1) and harvested at different time intervals (0, 12, 24 and 36 up to 72 h) under controlled growing conditions and assayed for antioxidant enzymes and total protein. Temporal increase of CAT, APX enzymes activities showed maximum activity at 12 h after both pathogens inoculation (hpi) in resistant cultivar, whereas in susceptible it increased at 72 h after both pathogens inoculation for CAT and 12, 24 h for APX enzymes. Maximum total protein activities were observed at 12 h and 24 h respectively after Xap, Psp inoculation (hpi) in resistant and maximum activities were observed at 24 h and 72 h respectively after Xap, Psp inoculation (hpi) in susceptible. Increase of antioxidant enzyme and total protein activities might be an important component in the defense strategy of resistance and susceptible bean genotypes against the bacterial infection. These findings suggest that disease protection is proportional to the amount of enhanced CAT, APX enzyme and total protein activity.

  10. Natural Pathogen Control Chemistry to Replace Toxic Treatment of Microbes and Biofilm in Cooling Towers

    Science.gov (United States)

    Brouse, Lon; Brouse, Richard; Brouse, Daniel

    2017-01-01

    Application of toxic antibacterial agents is considered necessary to control prevalent fresh water microorganisms that grow in evaporative cooling water systems, but can adversely affect the environment and human health. However, natural antibacterial water chemistry has been applied in industrial cooling water systems for over 10 years to inhibit microorganisms with excellent results. The water chemistry method concentrates natural minerals in highly-softened water to produce elevated pH and dissolved solids, while maintaining low calcium and magnesium content. The method provides further benefits in water conservation, and generates a small volume of non-toxic natural salt concentrate for cost efficient separation and disposal if required. This report describes the antimicrobial effects of these chemistry modifications in the cooling water environment and the resultant collective inhibition of microbes, biofilm, and pathogen growth. This article also presents a novel perspective of parasitic microbiome functional relationships, including “Trojan Protozoans” and biofilms, and the function of polyvalent metal ions in the formation and inhibition of biofilms. Reducing global dependence on toxic antibacterial agents discharged to the environment is an emerging concern due to their impact on the natural microbiome, plants, animals and humans. Concurrently, scientists have concluded that discharge of antibacterial agents plays a key role in development of pathogen resistance to antimicrobials as well as antibiotics. Use of natural antibacterial chemistry can play a key role in managing the cooling water environment in a more ecologically sustainable manner. PMID:28420074

  11. Potentially pathogenic amoeba-associated microorganisms in cooling towers and their control.

    Science.gov (United States)

    Pagnier, Isabelle; Merchat, Michèle; La Scola, Bernard

    2009-06-01

    Cooling towers provide a favorable environment for the proliferation of microorganisms. Cooling towers generate a biofilm and often aerosolize contaminated water, thereby increasing the risk of microorganism dissemination by human inhalation. This pathogen dissemination was first revealed by the epidemics of Legionnaires' disease that were directly related to the presence of cooling towers, and since then, the ecology of Legionella pneumophila has been well studied. Each country has specific standards regarding the acceptable amount of microorganisms in cooling tower systems. However, those standards typically only concern L. pneumophila, even though many other microorganisms can also be isolated from cooling towers, including protozoa, bacteria and viruses. Microbiological control of the cooling tower system can be principally achieved by chemical treatments and also by improving the system's construction. Several new treatments are being studied to improve the efficiency of disinfection. However, as most of these treatments continue to focus solely on L. pneumophila, reports of other types of pathogens continue to increase. Therefore, how their dissemination affects the human populous health should be addressed now.

  12. Incorporation of plant materials in the control of root pathogens in muskmelon

    Directory of Open Access Journals (Sweden)

    Andréa Mirne de Macêdo Dantas

    2013-12-01

    Full Text Available The effect of plant materials[Sunn Hemp (Crotalaria juncea, Castor Bean (Ricinus communis L., Cassava (Manihot esculenta Crantz and Neem (Azadirachta indica] and the times of incorporation of these materials in regards to the incidence of root rot in melon was evaluated in Ceará state, Brazil. The experiment was conducted in a commercial area with a history of root pathogens in cucurbitaceae. The randomized block design was used, in a 5 x 3 factorial arrangement with four repetitions. The treatments consisted of a combination of four plant materials (sunn hemp, castor beans, cassava and neem and a control with no soil incorporation of plant material and three times of incorporation (28, 21, and 14 days before the transplanting of the seedlings. Lower incidence of root rot was observed in practically all of the treatments where materials were incorporated at different times, with variation between the materials, corresponding with the time of incorporation, in relation to the soil without plant material. The pathogens isolated from the symptomatic muskmelon plants were Fusarium solani, Macrophomina phaseolina, Monosporascus cannonballus and Rhizoctonia solani, F. solani being encountered most frequently.

  13. Multiple levels of epigenetic control for bone biology and pathology.

    Science.gov (United States)

    Montecino, Martin; Stein, Gary; Stein, Janet; Zaidi, Kaleem; Aguilar, Rodrigo

    2015-12-01

    Multiple dimensions of epigenetic control contribute to regulation of gene expression that governs bone biology and pathology. Once confined to DNA methylation and a limited number of post-translational modifications of histone proteins, the definition of epigenetic mechanisms is expanding to include contributions of non-coding RNAs and mitotic bookmarking, a mechanism for retaining phenotype identity during cell proliferation. Together these different levels of epigenetic control of physiological processes and their perturbations that are associated with compromised gene expression during the onset and progression of disease, have contributed to an unprecedented understanding of the activities (operation) of the genomic landscape. Here, we address general concepts that explain the contribution of epigenetic control to the dynamic regulation of gene expression during eukaryotic transcription. This article is part of a Special Issue entitled Epigenetics and Bone. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Granular formulation of Fusarium oxysporum for biological control of faba bean and tomato Orobanche.

    Science.gov (United States)

    Nemat Alla, Mamdouh M; Shabana, Yasser M; Serag, Mamdouh M; Hassan, Nemat M; El-Hawary, Mohamed M

    2008-12-01

    Orobanche spp. represent a serious threat to a wide range of crops. They are difficult targets for herbicides, and biological control could provide a possible solution. This work therefore aimed to formulate mycoherbicides of Fusarium with adequate shelf life and virulence against Orobanche but safe to faba bean and tomato. Only two isolates of Fusarium oxysporum Schlecht. (Foxy I and Foxy II) obtained from diseased Orobanche shoots were found to be pathogenic to Orobanche crenata Forsk. and Orobanche ramosa L. Conidial suspension of both isolates significantly decreased germination, attachments and tubercles of Orobanche. Microconidia and chlamydospores of both isolates were formulated as mycoherbicides encapsulated in a wheat flour-kaolin matrix (four different formulations). All formulations greatly diminished Orobanche emerged shoots, total shoot number, shoot height, attachment of emerged shoots, the germinated seeds that succeeded in emerging above the soil surface and dry weight. Meanwhile, disease incidence and disease severity of emerged shoots were enhanced. The shelf life was adequate, particularly for coarse, freshly prepared, low-temperature-stored, microconidia-rich formulations. The induced growth reduction of Orobanche-infected host plants seemed to be nullified by formulations, particularly at the highest dose. These formulations seemed to destroy Orobanche but appeared harmless to host plants. Hence, they could be efficiently used as mycoherbicides for biological control of Orobanche in faba bean and tomato.

  15. Streptococcus dysgalactiae subsp. dysgalactiae isolated from milk of the bovine udder as emerging pathogens: In vitro and in vivo infection of human cells and zebrafish as biological models.

    Science.gov (United States)

    Alves-Barroco, Cinthia; Roma-Rodrigues, Catarina; Raposo, Luís R; Brás, Catarina; Diniz, Mário; Caço, João; Costa, Pedro M; Santos-Sanches, Ilda; Fernandes, Alexandra R

    2018-03-25

    Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) is a major cause of bovine mastitis and has been regarded as an animal-restricted pathogen, although rare infections have been described in humans. Previous studies revealed the presence of virulence genes encoded by phages of the human pathogen Group A Streptococcus pyogenes (GAS) in SDSD isolated from the milk of bovine udder with mastitis. The isolates SDSD VSD5 and VSD13 could adhere and internalize human primary keratinocyte cells, suggesting a possible human infection potential of bovine isolates. In this work, the in vitro and in vivo potential of SDSD to internalize/adhere human cells of the respiratory track and zebrafish as biological models was evaluated. Our results showed that, in vitro, bovine SDSD strains could interact and internalize human respiratory cell lines and that this internalization was dependent on an active transport mechanism and that, in vivo, SDSD are able to cause invasive infections producing zebrafish morbidity and mortality. The infectious potential of these isolates showed to be isolate-specific and appeared to be independent of the presence or absence of GAS phage-encoded virulence genes. Although the infection ability of the bovine SDSD strains was not as strong as the human pathogenic S. pyogenes in the zebrafish model, results suggested that these SDSD isolates are able to interact with human cells and infect zebrafish, a vertebrate infectious model, emerging as pathogens with zoonotic capability. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  16. A Biomechanical Comparison of Proportional Electromyography Control to Biological Torque Control Using a Powered Hip Exoskeleton

    Directory of Open Access Journals (Sweden)

    Aaron J. Young

    2017-06-01

    Full Text Available BackgroundDespite a large increase in robotic exoskeleton research, there are few studies that have examined human performance with different control strategies on the same exoskeleton device. Direct comparison studies are needed to determine how users respond to different types of control. The purpose of this study was to compare user performance using a robotic hip exoskeleton with two different controllers: a controller that targeted a biological hip torque profile and a proportional myoelectric controller.MethodsWe tested both control approaches on 10 able-bodied subjects using a pneumatically powered hip exoskeleton. The state machine controller targeted a biological hip torque profile. The myoelectric controller used electromyography (EMG of lower limb muscles to produce a proportional control signal for the hip exoskeleton. Each subject performed two 30-min exoskeleton walking trials (1.0 m/s using each controller and a 10-min trial with the exoskeleton unpowered. During each trial, we measured subjects’ metabolic cost of walking, lower limb EMG profiles, and joint kinematics and kinetics (torques and powers using a force treadmill and motion capture.ResultsCompared to unassisted walking in the exoskeleton, myoelectric control significantly reduced metabolic cost by 13% (p = 0.005 and biological hip torque control reduced metabolic cost by 7% (p = 0.261. Subjects reduced muscle activity relative to the unpowered condition for a greater number of lower limb muscles using myoelectric control compared to the biological hip torque control. More subjects subjectively preferred the myoelectric controller to the biological hip torque control.ConclusionMyoelectric control had more advantages (metabolic cost and muscle activity reduction compared to a controller that targeted a biological torque profile for walking with a robotic hip exoskeleton. However, these results were obtained with a single exoskeleton device with specific

  17. A Biomechanical Comparison of Proportional Electromyography Control to Biological Torque Control Using a Powered Hip Exoskeleton.

    Science.gov (United States)

    Young, Aaron J; Gannon, Hannah; Ferris, Daniel P

    2017-01-01

    Despite a large increase in robotic exoskeleton research, there are few studies that have examined human performance with different control strategies on the same exoskeleton device. Direct comparison studies are needed to determine how users respond to different types of control. The purpose of this study was to compare user performance using a robotic hip exoskeleton with two different controllers: a controller that targeted a biological hip torque profile and a proportional myoelectric controller. We tested both control approaches on 10 able-bodied subjects using a pneumatically powered hip exoskeleton. The state machine controller targeted a biological hip torque profile. The myoelectric controller used electromyography (EMG) of lower limb muscles to produce a proportional control signal for the hip exoskeleton. Each subject performed two 30-min exoskeleton walking trials (1.0 m/s) using each controller and a 10-min trial with the exoskeleton unpowered. During each trial, we measured subjects' metabolic cost of walking, lower limb EMG profiles, and joint kinematics and kinetics (torques and powers) using a force treadmill and motion capture. Compared to unassisted walking in the exoskeleton, myoelectric control significantly reduced metabolic cost by 13% ( p  = 0.005) and biological hip torque control reduced metabolic cost by 7% ( p  = 0.261). Subjects reduced muscle activity relative to the unpowered condition for a greater number of lower limb muscles using myoelectric control compared to the biological hip torque control. More subjects subjectively preferred the myoelectric controller to the biological hip torque control. Myoelectric control had more advantages (metabolic cost and muscle activity reduction) compared to a controller that targeted a biological torque profile for walking with a robotic hip exoskeleton. However, these results were obtained with a single exoskeleton device with specific control configurations while level walking at a

  18. Biological Efficacy of Herbicides for Weed Control in Noncropped Areas

    Directory of Open Access Journals (Sweden)

    Tsvetanka Dimitrova

    2009-01-01

    Full Text Available An increasing problem facing agricultural producers is the invasion of weeds, perennial in particular, so that implementation of industrial technologies is impossible without their highly efficient and rational control. For the purpose of studying efficient herbicides for weed control in noncropped areas (stubbles, a biological study of five total systemic herbicides was conducted in areas under natural weed infestation and pressure from othersurrounding weeds at the Institute of Forage Crops in Pleven in 2005-2007. The trials were carried out in field conditions using the block method with plot size of 20 m². Treatment was conducted at the predominant stage of budding of perennial dicotyledonous weeds and earing of monocotyledonous weeds. Herbicidal efficacy was recorded on the EWRS 9-score scale (0-100% killed weeds = score 9-1. It was found that treatment of noncropped areas (stubbles with the total systemic herbicides Touchdown System 4 (360 g/l glyphosate; Cosmic (360 g/l glyphosate; Roundup Plus (441 g/l glyphosate potassium salt; Leon 36 SL (360 g/l glyphosate and Glyphos Super 45 SL (450 g/l glyphosate was highly efficient, so that it was a successful element of a strategy for controlling weeds of different biological groups, and was especially effective against perennial weeds.

  19. Control of the cassava mealybug in Africa: lessons from a biological ...

    African Journals Online (AJOL)

    Control of the cassava mealybug in Africa: lessons from a biological control project. ... Such studies are needed in order to attribute the observed effects to various causes and to advance the science of biological control. ( 4) It is concluded that biological control is the basis ofiPM but cannot usually be manipulated by the ...

  20. 75 FR 64984 - Availability of an Environmental Assessment for a Biological Control Agent for Hawkweeds

    Science.gov (United States)

    2010-10-21

    ... hawkweed gall wasp, Aulacidea subterminalis, into the continental United States as a biological control... United States for the biological control of hawkweeds (Hieracium pilosella, H. aurantiacum, H... control, and the use of biological control organisms. The use of herbicides, while effective, is limited...

  1. Differential pathogenicity of Metarhizium anisopliae and the control of the sugarcane root spittlebug Mahanarva fimbriolata

    Directory of Open Access Journals (Sweden)

    Patricia Vieira Tiago

    2011-06-01

    Full Text Available In order to assess the effectiveness of Metarhizium anisopliae var. anisopliae (Metschnikoff Sorokin isolates in controlling the sugarcane root spittlebug Mahanarva fimbriolata (Stal (Hemiptera: Cercopidae, nine isolates obtained from a single geographical region were studied. 'Confirmed cumulative' and 'corrected cumulative' spittlebug mortality rates were measured for each of the isolates. Based on the confirmed mortality curve, the isolates URM5946, URM5951 and URM6033 were considered to be potentially the most effective in a biological control program for M. fimbriolata.

  2. Using biological control research in the classroom to promote scientific inquiry and literacy

    Science.gov (United States)

    Many scientists who research biological control also teach at universities or more informally through cooperative outreach. The purpose of this paper is to review biological control activities for the classroom in four refereed journals, The American Biology Teacher, Journal of Biological Education...

  3. Asymmetric positive feedback loops reliably control biological responses.

    Science.gov (United States)

    Ratushny, Alexander V; Saleem, Ramsey A; Sitko, Katherine; Ramsey, Stephen A; Aitchison, John D

    2012-04-24

    Positive feedback is a common mechanism enabling biological systems to respond to stimuli in a switch-like manner. Such systems are often characterized by the requisite formation of a heterodimer where only one of the pair is subject to feedback. This ASymmetric Self-UpREgulation (ASSURE) motif is central to many biological systems, including cholesterol homeostasis (LXRα/RXRα), adipocyte differentiation (PPARγ/RXRα), development and differentiation (RAR/RXR), myogenesis (MyoD/E12) and cellular antiviral defense (IRF3/IRF7). To understand why this motif is so prevalent, we examined its properties in an evolutionarily conserved transcriptional regulatory network in yeast (Oaf1p/Pip2p). We demonstrate that the asymmetry in positive feedback confers a competitive advantage and allows the system to robustly increase its responsiveness while precisely tuning the response to a consistent level in the presence of varying stimuli. This study reveals evolutionary advantages for the ASSURE motif, and mechanisms for control, that are relevant to pharmacologic intervention and synthetic biology applications.

  4. Effectiveness of electron beam irradiation in the control of some soilborne pathogens

    International Nuclear Information System (INIS)

    Orlikowski, L.B.; Ptaszek, M.; Migdal, W.; Gryczka, U.

    2011-01-01

    Electron beam (EB) irradiation was tested against Botrytis cinerea, Pythium ultimum and Phytophthora citricola the most dangerous pathogens causing stem and root rot of seedlings, cuttings and older plants. In the laboratory trials cultures of 3 species were irradiated with doses 0 (control), 1.5, 3.0, 4.5 and 6.0 kGy whereas peat was treated with 10, 15 and 25 kGy. P. citricola was the most sensitive species for irradiation. In greenhouse trials 15 kGy irradiation of peat protected chrysanthemum cuttings against B. cinerea and P. ultimum as well as rhododendron young plants against P. citricola. Irradiation of peat did not influence the growth and development of the tested plants. (authors)

  5. Babaco (Vasconcellea heilbornii var. pentagona Badillo. Major plant pathogens and control strategies

    Directory of Open Access Journals (Sweden)

    Angel Rolando Robles-Carrión

    2016-04-01

    Full Text Available This work was carried out with the aim of documenting the importance of Babaco for the Andean region, its main plant pathogens, and possible control strategies and integrated management, emphasizing the MVB. Was performed a systematic review of scientific papers published in prestigious journals and thesis diplomas, masters and doctorates from various universities. As a criterion for inclusion-exclusion studies were taken into account in the genus Vasconcellea. Ecuador has 15 of the 21 described species, of which more than half are located in the province of Loja. Vascular Wilt Babaco (MVB is caused by a complex of Fusarium fungi that interact with the plant. There are no integrated management strategies for Vascular Wilt Babaco scientifically proven.

  6. Effectiveness of sanitizing products on controlling selected pathogen surrogates on retail deli slicers.

    Science.gov (United States)

    Yeater, Michael C; Kirsch, Katie R; Taylor, T Matthew; Mitchell, Jeff; Osburn, Wesley N

    2015-04-01

    The objectives of this study were (i) to assess the efficacy of quaternary ammonium chloride-based wet foam (WF) and dry foam (DF) sanitizer systems (600 ppm) for reducing Listeria innocua (a nonpathogenic surrogate of Listeria monocytogenes) or a 100.0 μg/ml rifampin-resistant Salmonella Typhimurium LT2 (a nonpathogenic surrogate of Salmonella enterica serovar Typhimurium) on niche and transfer point areas of an unwashed retail deli slicer as compared with traditional chlorine (Cl(-)) treatment (200 ppm) and (ii) to compare sanitizer surface contact times (10 and 15 min) for pathogen surrogate control. Turkey frankfurter slurries inoculated with L. innocua or Salmonella Typhimurium were used to inoculate seven high-risk sites on a commercial slicer. After 30 min of bacterial attachment, slicers were dry wiped to remove excess food matter, followed by a randomly assigned sanitizer treatment. Surviving pathogen surrogate cells were enumerated on modified Oxford's agar not containing antimicrobic supplement (L. innocua) or on tryptic soy agar supplemented with 100 μg/ml rifampin (Salmonella Typhimurium LT2). Replicate-specific L. innocua and Salmonella Typhimurium reductions were calculated as log CFU per square centimeter of control minus log CFU per square centimeter of enumerated survivors for each site. For both organisms, all sanitizer treatments differed from each other, with Cl(-) producing the least reduction and WF the greatest reduction. A significant (P < 0.05) site-by-treatment interaction was observed. The results of the study indicate that quaternary ammonium chloride sanitizers (600 ppm) applied by both WF and DF were more effective at reducing L. innocua and Salmonella Typhimurium than a traditional Cl sanitizer (200 ppm) on unwashed slicer surfaces.

  7. Biologically inspired autonomous structural materials with controlled toughening and healing

    Science.gov (United States)

    Garcia, Michael E.; Sodano, Henry A.

    2010-04-01

    The field of structural health monitoring (SHM) has made significant contributions in the field of prognosis and damage detection in the past decade. The advantageous use of this technology has not been integrated into operational structures to prevent damage from propagating or to heal injured regions under real time loading conditions. Rather, current systems relay this information to a central processor or human operator, who then determines a course of action such as altering the mission or scheduling repair maintenance. Biological systems exhibit advanced sensory and healing traits that can be applied to the design of material systems. For instance, bone is the major structural component in vertebrates; however, unlike modern structural materials, bone has many properties that make it effective for arresting the propagation of cracks and subsequent healing of the fractured area. The foremost goal for the development of future adaptive structures is to mimic biological systems, similar to bone, such that the material system can detect damage and deploy defensive traits to impede damage from propagating, thus preventing catastrophic failure while in operation. After sensing and stalling the propagation of damage, the structure must then be repaired autonomously using self healing mechanisms motivated by biological systems. Here a novel autonomous system is developed using shape memory polymers (SMPs), that employs an optical fiber network as both a damage detection sensor and a network to deliver stimulus to the damage site initiating adaptation and healing. In the presence of damage the fiber optic fractures allowing a high power laser diode to deposit a controlled level of thermal energy at the fractured sight locally reducing the modulus and blunting the crack tip, which significantly slows the crack growth rate. By applying a pre-induced strain field and utilizing the shape memory recovery effect, thermal energy can be deployed to close the crack and return

  8. The transcription factor Rbf1 is the master regulator for b-mating type controlled pathogenic development in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Kai Heimel

    Full Text Available In the phytopathogenic basidiomycete Ustilago maydis, sexual and pathogenic development are tightly connected and controlled by the heterodimeric bE/bW transcription factor complex encoded by the b-mating type locus. The formation of the active bE/bW heterodimer leads to the formation of filaments, induces a G2 cell cycle arrest, and triggers pathogenicity. Here, we identify a set of 345 bE/bW responsive genes which show altered expression during these developmental changes; several of these genes are associated with cell cycle coordination, morphogenesis and pathogenicity. 90% of the genes that show altered expression upon bE/bW-activation require the zinc finger transcription factor Rbf1, one of the few factors directly regulated by the bE/bW heterodimer. Rbf1 is a novel master regulator in a multilayered network of transcription factors that facilitates the complex regulatory traits of sexual and pathogenic development.

  9. Biological forcing controls the chemistry of the coral exoskeleton

    Science.gov (United States)

    Meibom, A.; Mostefaoui, S.; Cuif, J.; Yurimoto, H.; Dauphin, Y.; Houlbreque, F.; Dunbar, R.; Constantz, B.

    2006-12-01

    A multitude of marine organisms produce calcium carbonate skeletons that are used extensively to reconstruct water temperature variability of the tropical and subtropical oceans - a key parameter in global climate-change models. Such paleo-climate reconstructions are based on the notion that skeletal oxygen isotopic composition and certain trace-element abundances (e.g., Sr/Ca and Mg/Ca ratios) vary in response to changes in the water temperature. However, it is a fundamental problem that poorly understood biological processes introduce large compositional deviations from thermodynamic equilibrium and hinder precise calibrations of many paleo-climate proxies. Indeed, the role of water temperature in controlling the composition of the skeleton is far from understood. We have studied trace-element abundances as well as oxygen and carbon isotopic compositions of individual skeletal components in the zooxanthellate and non-zooxanthellate corals at ultra-structural, i.e. micrometer to sub-micrometer length scales. From this body of work we draw the following, generalized conclusions: 1) Centers of calcification (COC) are not in equilibrium with seawater. Notably, the Sr/Ca ratio is higher than expected for aragonite equilibrium with seawater at the temperature at which the skeleton was formed. Furthermore, the COC are further away from equilibrium with seawater than fibrous skeleton in terms of stable isotope composition. 2) COC are dramatically different from the fibrous aragonite skeleton in terms of trace element composition. 3) Neither trace element nor stable isotope variations in the fibrous (bulk) part of the skeleton are directly related to changes in SST. In fact, changes in SST can have very little to do with the observed compositional variations. 4) Trace element variations in the fibrous (bulk) part of the skeleton are not related to the activity of zooxanthellae. These observations are directly relevant to the issue of biological versus non-biological

  10. Biological Characteristics and Control of Orobanche Crenata Forsk., a Review

    Directory of Open Access Journals (Sweden)

    Alessia Restuccia

    2009-03-01

    Full Text Available Orobanche crenata is a holoparasitic phanerogam which is particularly noxious to legumes, such as faba bean (Vicia faba L., pea (Pisum sativum L., chickpea (Cicer arietinum L., lentil (Lens culinaris Medik., etc., and commonly considered one of the major causes which has contributed to re-rizing the area designed to their cultivation. After a few brief references on the origin and diffusion of O. crenata, in this work summarises the results of research into biological aspects and control of this species. The information obtained especially concerns seed production, seed viability, seed longevity and dormancy, seed conditioning and germination, parasitism phases, the effects of parasite attacks on host plants and the means of control.

  11. Entomopatogenic fungi as an alternative for biological pest control

    Directory of Open Access Journals (Sweden)

    Pablo Andrés Motta Delgado

    2011-08-01

    Full Text Available The entomopatogenic fungi are a diverse group of microorganisms that provide multiple services to agroecological systems. Among those the capacity to regulate the pests to keep them in suitable levels stands out. The present paper shows a description of the entomopatogenic fungi of most extensively used for the biological control of pests, their mechanism of action on their host, and also investigations about the in vitro and in situ behavior of the mostly used fungi for the control of some insects. Also, the formulations that are used for the development of this biotechnology in the field are described. In the development of bioinsecticides the entomopatogenic fungi are a viable option to minimize environmental damage.

  12. Biological Characteristics and Control of Orobanche Crenata Forsk., a Review

    Directory of Open Access Journals (Sweden)

    Giuseppe Restuccia

    2011-02-01

    Full Text Available Orobanche crenata is a holoparasitic phanerogam which is particularly noxious to legumes, such as faba bean (Vicia faba L., pea (Pisum sativum L., chickpea (Cicer arietinum L., lentil (Lens culinaris Medik., etc., and commonly considered one of the major causes which has contributed to re-rizing the area designed to their cultivation. After a few brief references on the origin and diffusion of O. crenata, in this work summarises the results of research into biological aspects and control of this species. The information obtained especially concerns seed production, seed viability, seed longevity and dormancy, seed conditioning and germination, parasitism phases, the effects of parasite attacks on host plants and the means of control.

  13. Assessing Probabilistic Risk Assessment Approaches for Insect Biological Control Introductions.

    Science.gov (United States)

    Kaufman, Leyla V; Wright, Mark G

    2017-07-07

    The introduction of biological control agents to new environments requires host specificity tests to estimate potential non-target impacts of a prospective agent. Currently, the approach is conservative, and is based on physiological host ranges determined under captive rearing conditions, without consideration for ecological factors that may influence realized host range. We use historical data and current field data from introduced parasitoids that attack an endemic Lepidoptera species in Hawaii to validate a probabilistic risk assessment (PRA) procedure for non-target impacts. We use data on known host range and habitat use in the place of origin of the parasitoids to determine whether contemporary levels of non-target parasitism could have been predicted using PRA. Our results show that reasonable predictions of potential non-target impacts may be made if comprehensive data are available from places of origin of biological control agents, but scant data produce poor predictions. Using apparent mortality data rather than marginal attack rate estimates in PRA resulted in over-estimates of predicted non-target impact. Incorporating ecological data into PRA models improved the predictive power of the risk assessments.

  14. INTEGRATED MANAGEMENT OF CHROMOLAENA ODORATA EMPHASIZING THE CLASSICAL BIOLOGICAL CONTROL

    Directory of Open Access Journals (Sweden)

    SOEKISMAN TJITROSEMITO

    1998-01-01

    Full Text Available Chromolaena odorata, Siam weed, a very important weed of Java Island (Indonesia is native to Central and South America. In the laboratory it showed rapid growth (1.15 g/g/week in the first 8 weeks of its growth. The biomass was mainly as leaves (LAR : 317.50 cm'/g total weight. It slowed down in the following month as the biomass was utilized for stem and branch formation. This behavior supported the growth of C. odorata into a very dense stand. It flowered, fruited during the dry season, and senesced following maturation of seeds from inflorescence branches. These branches dried out, but soon the stem resumed aggressive growth following the wet season. Leaf biomass was affected by the size of the stem in its early phase of regrowth, but later on it was more affected by the number of branches. The introduction of Pareuchaetes pseudoinsulata to Indonesia, was successful only in North Sumatera. In Java it has not been reported to establish succesfully. The introduction of another biological control agent, Procecidochares conneca to Indonesia was shown to be sp ecific and upon release in West Java it established immediately. It spread exponentia lly in the first 6 months of its release. Field monitoring continues to eval uate the impact of the agents. Other biocontrol agents (Actmole anteas and Conotrachelus wilt be introduced to Indonesia in 1997 through ACIAR Project on the Biological Control of Chromolaena odorata in Indonesia and Papua New Guinea.

  15. Reevaluation of the value of autoparasitoids in biological control.

    Directory of Open Access Journals (Sweden)

    Lian-Sheng Zang

    Full Text Available Autoparasitoids with the capacity of consuming primary parasitoids that share the same hosts to produce males are analogous to intraguild predators. The use of autoparasitoids in biological control programs is a controversial matter because there is little evidence to support the view that autoparasitoids do not disrupt and at times may promote suppression of insect pests in combination with primary parasitoids. We found that Encarsia sophia, a facultative autoparasitoid, preferred to use heterospecific hosts as secondary hosts for producing males. The autoparasitoids mated with males originated from heterospecifics may parasitize more hosts than those mated with males from conspecifics. Provided with an adequate number of males, the autoparasitoids killed more hosts than En. formosa, a commonly used parasitoid for biological control of whiteflies. This study supports the view that autoparasitoids in combination with primary parasitoids do not disrupt pest management and may enhance such programs. The demonstrated preference of an autoparasitoid for heterospecifics and improved performance of males from heterospecifics observed in this study suggests these criteria should be considered in strategies that endeavor to mass-produce and utilize autoparasitoids in the future.

  16. Assessing Probabilistic Risk Assessment Approaches for Insect Biological Control Introductions

    Directory of Open Access Journals (Sweden)

    Leyla V. Kaufman

    2017-07-01

    Full Text Available The introduction of biological control agents to new environments requires host specificity tests to estimate potential non-target impacts of a prospective agent. Currently, the approach is conservative, and is based on physiological host ranges determined under captive rearing conditions, without consideration for ecological factors that may influence realized host range. We use historical data and current field data from introduced parasitoids that attack an endemic Lepidoptera species in Hawaii to validate a probabilistic risk assessment (PRA procedure for non-target impacts. We use data on known host range and habitat use in the place of origin of the parasitoids to determine whether contemporary levels of non-target parasitism could have been predicted using PRA. Our results show that reasonable predictions of potential non-target impacts may be made if comprehensive data are available from places of origin of biological control agents, but scant data produce poor predictions. Using apparent mortality data rather than marginal attack rate estimates in PRA resulted in over-estimates of predicted non-target impact. Incorporating ecological data into PRA models improved the predictive power of the risk assessments.

  17. Understanding yield loss and pathogen biology to improve disease management: Stagonospora nodorum blotch - a case study in wheat

    Science.gov (United States)

    The estimated potential yield losses caused by plant pathogens are up to 16% globally, and most research in plant pathology aims to reduce yield loss in crops directly or indirectly. Yield losses caused by a certain disease depend not only on disease severity, but also on weather factors, the pathog...

  18. [Principles of management in biological infections].

    Science.gov (United States)

    Płusa, Tadeusz

    2012-11-01

    The effectiveness of the management in respiratory infection is depending on the nature of the biological pathogen and the immune status of the patient. For this reason, providing assistance to victims the organ function support, similarly as defining the pathogen and targeted antibiotic therapy should be applied. Available diagnostic tests provide rapid ability to identify the pathogen and antibiotics are able to control infection. Lack of efficacy of treatment may indicate the diversity of the pathogen than previously known and raises suspicion of biological warfare pathogen.

  19. Distinct Mechanisms of Pathogenic DJ-1 Mutations in Mitochondrial Quality Control

    Directory of Open Access Journals (Sweden)

    Daniela Strobbe

    2018-03-01

    Full Text Available The deglycase and chaperone protein DJ-1 is pivotal for cellular oxidative stress responses and mitochondrial quality control. Mutations in PARK7, encoding DJ-1, are associated with early-onset familial Parkinson’s disease and lead to pathological oxidative stress and/or disrupted protein degradation by the proteasome. The aim of this study was to gain insights into the pathogenic mechanisms of selected DJ-1 missense mutations, by characterizing protein–protein interactions, core parameters of mitochondrial function, quality control regulation via autophagy, and cellular death following dopamine accumulation. We report that the DJ-1M26I mutant influences DJ-1 interactions with SUMO-1, in turn enhancing removal of mitochondria and conferring increased cellular susceptibility to dopamine toxicity. By contrast, the DJ-1D149A mutant does not influence mitophagy, but instead impairs Ca2+ dynamics and free radical homeostasis by disrupting DJ-1 interactions with a mitochondrial accessory protein known as DJ-1-binding protein (DJBP/EFCAB6. Thus, individual DJ-1 mutations have different effects on mitochondrial function and quality control, implying mutation-specific pathomechanisms converging on impaired mitochondrial homeostasis.

  20. Insect-plant-pathogen interactions as shaped by future climate: effects on biology, distribution, and implications for agriculture.

    Science.gov (United States)

    Trębicki, Piotr; Dáder, Beatriz; Vassiliadis, Simone; Fereres, Alberto

    2017-12-01

    Carbon dioxide (CO 2 ) is the main anthropogenic gas which has drastically increased since the industrial revolution, and current concentrations are projected to double by the end of this century. As a consequence, elevated CO 2 is expected to alter the earths' climate, increase global temperatures and change weather patterns. This is likely to have both direct and indirect impacts on plants, insect pests, plant pathogens and their distribution, and is therefore problematic for the security of future food production. This review summarizes the latest findings and highlights current knowledge gaps regarding the influence of climate change on insect, plant and pathogen interactions with an emphasis on agriculture and food production. Direct effects of climate change, including increased CO 2 concentration, temperature, patterns of rainfall and severe weather events that impact insects (namely vectors of plant pathogens) are discussed. Elevated CO 2 and temperature, together with plant pathogen infection, can considerably change plant biochemistry and therefore plant defense responses. This can have substantial consequences on insect fecundity, feeding rates, survival, population size, and dispersal. Generally, changes in host plant quality due to elevated CO 2 (e.g., carbon to nitrogen ratios in C3 plants) negatively affect insect pests. However, compensatory feeding, increased population size and distribution have also been reported for some agricultural insect pests. This underlines the importance of additional research on more targeted, individual insect-plant scenarios at specific locations to fully understand the impact of a changing climate on insect-plant-pathogen interactions. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  1. Seaweed Bioactive Compounds against Pathogens and Microalgae: Potential Uses on Pharmacology and Harmful Algae Bloom Control.

    Science.gov (United States)

    Zerrifi, Soukaina El Amrani; El Khalloufi, Fatima; Oudra, Brahim; Vasconcelos, Vitor

    2018-02-09

    Cyanobacteria are found globally due to their adaptation to various environments. The occurrence of cyanobacterial blooms is not a new phenomenon. The bloom-forming and toxin-producing species have been a persistent nuisance all over the world over the last decades. Evidence suggests that this trend might be attributed to a complex interplay of direct and indirect anthropogenic influences. To control cyanobacterial blooms, various strategies, including physical, chemical, and biological methods have been proposed. Nevertheless, the use of those strategies is usually not effective. The isolation of natural compounds from many aquatic and terrestrial plants and seaweeds has become an alternative approach for controlling harmful algae in aquatic systems. Seaweeds have received attention from scientists because of their bioactive compounds with antibacterial, antifungal, anti-microalgae, and antioxidant properties. The undesirable effects of cyanobacteria proliferations and potential control methods are here reviewed, focusing on the use of potent bioactive compounds, isolated from seaweeds, against microalgae and cyanobacteria growth.

  2. Social and economic factors for the adoption of biological control of ...

    African Journals Online (AJOL)

    The results also showed that the decision on the application of biological control is determined by the educational level, income, mechanization level, extension activities, biological control awareness, social participation, attitude toward biological control and access to information sources which have significant influence.

  3. 77 FR 46373 - Availability of an Environmental Assessment for a Biological Control Agent for Hemlock Woolly...

    Science.gov (United States)

    2012-08-03

    ...] Availability of an Environmental Assessment for a Biological Control Agent for Hemlock Woolly Adelgid AGENCY... States for use as a biological control agent to reduce the severity of hemlock woolly adelgid... beetle from the western United States, into the eastern United States for use as a biological control...

  4. 75 FR 28232 - Availability of an Environmental Assessment for a Biological Control Agent for Hemlock Woolly...

    Science.gov (United States)

    2010-05-20

    ...] Availability of an Environmental Assessment for a Biological Control Agent for Hemlock Woolly Adelgid AGENCY..., into the continental United States for use as a biological control agent to reduce the severity of... biological control agent to reduce the severity of hemlock woolly adelgid (HWA) infestations. HWA, an...

  5. 75 FR 69396 - Availability of an Environmental Assessment for a Biological Control Agent for Arundo donax

    Science.gov (United States)

    2010-11-12

    ... Biological Control Agent for Arundo donax AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION... alternatives to, the release of Arundo scale into the continental United States for use as a biological control... a biological control agent to reduce the severity of Arundo donax infestations. A. donax is a highly...

  6. Biological control strategies of mycotoxigenic fungi and associated mycotoxins in Mediterranean basin crops

    Directory of Open Access Journals (Sweden)

    Dimitrios I. TSITSIGIANNIS

    2012-05-01

    Full Text Available Fungi that belong to the genera Aspergillus, Fusarium, and Penicillium pose serious phytopathological and mycotoxicological risks at pre-harvest and post-harvest stages, as well as in processed food products because they can produce several mycotoxins. Mycotoxins pose a serious problem for animal and human health and have a significant economic impact worldwide. The Mediterranean basin is a large geographical region with a temperate climate supporting the cultivation of a wealth of field and greenhouse crops with a high risk of mycotoxin contamination. The most important mycotoxins that occur in the Mediterranean basin are aflatoxins (B1, B2, G1 and G2 in dried fruits and nuts, ochratoxin A in grapes and raisins as well as trichothecenes and fumonisins in cereals. A variety of chemical, biological and physical strategies have been developed to control the mycotoxigenic pathogens; to minimize mycotoxin production at pre- or post-harvest level; to contribute to decontamination and/or detoxification of mycotoxins from contaminated foods and feeds; or to inhibit mycotoxin absorption in the gastrointestinal tract. Biological control using microbial antagonists either alone or as part of an integrated control strategy to reduce pesticide inputs, has emerged as a promising approach for control of mycotoxins in crops, both pre- and post-harvest. Several organisms including atoxigenic Aspergilli, yeasts, bacteria and fungi have been tested for their ability to reduce both fungal infection and mycotoxin contamination. For instance, atoxigenic fungal strains are being used widely to prevent pre-harvest aflatoxin contamination of crops such as peanuts, pistachios, maize, and cottonseed in several parts of the world including the Mediterranean area. Recent advancements in the use of biocontrol strategies have led to registration of commercial products with increased practical applications for the benefit of growers in several countries.

  7. Models for integrated pest control and their biological implications.

    Science.gov (United States)

    Tang, Sanyi; Cheke, Robert A

    2008-09-01

    Successful integrated pest management (IPM) control programmes depend on many factors which include host-parasitoid ratios, starting densities, timings of parasitoid releases, dosages and timings of insecticide applications and levels of host-feeding and parasitism. Mathematical models can help us to clarify and predict the effects of such factors on the stability of host-parasitoid systems, which we illustrate here by extending the classical continuous and discrete host-parasitoid models to include an IPM control programme. The results indicate that one of three control methods can maintain the host level below the economic threshold (ET) in relation to different ET levels, initial densities of host and parasitoid populations and host-parasitoid ratios. The effects of host intrinsic growth rate and parasitoid searching efficiency on host mean outbreak period can be calculated numerically from the models presented. The instantaneous pest killing rate of an insecticide application is also estimated from the models. The results imply that the modelling methods described can help in the design of appropriate control strategies and assist management decision-making. The results also indicate that a high initial density of parasitoids (such as in inundative releases) and high parasitoid inter-generational survival rates will lead to more frequent host outbreaks and, therefore, greater economic damage. The biological implications of this counter intuitive result are discussed.

  8. Biology and life history of Argopistes tsekooni (Coleoptera: Chrysomelidae) in China, a promising biological control agent of Chinese privet.

    Science.gov (United States)

    Y-Z Zhang; J. Sun; J.L. Hanula

    2009-01-01

    The biology and life history of Argopistes tsekooni Chen (Coleoptera: Chrysomelidae), a potential biological control agent of Chinese privet, Ligustrum sinense Lour., was studied under laboratory and outdoor conditions in Huangshan City of Anhui Province, China, in 2006. A. tsekooni larvae are leafminers that...

  9. Rearing and Release of Megamelus scutellaris Berg (Hemiptera: Delphacidae) for Biological Control of Water hyacinth in 2015

    Science.gov (United States)

    2017-06-01

    Hemiptera: Delphacidae) for Biological Control of Waterhyacinth in 2015 by Jan Freedman and Nathan Harms PURPOSE: Waterhyacinth biological control ... control agents. Three insects were released in the United States for biological control of waterhyacinth during the 1970s; two weevils, Neochetina...content) and competitive interactions with other biological control agents (e.g., Neochetina spp.), though their consideration in other biological

  10. Biological control of Microcystis dominated harmful algal blooms

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-29

    Dec 29, 2008 ... ... as activated carbon and/or oxidative ozone and chlorine (Haider et al., 2003). ... resistant to chemical breakdown and are persistent in natural waters for .... Lysis of cyanobacteria by different bacterial pathogens. Mechanism.

  11. Biological control of Rhizoctonia solani on potato by Verticillium ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... V. biguttatum isolates affected R. solani by antibiosis and parasitism. All isolates of V. ... After the coiling around of R. solani hyphae, V. ... is an important fungal pathogen ... Gliocladium spp., Trichoderma spp. and Verticillium.

  12. Biological control of rice brown spot with native isolates of three Trichoderma species

    Directory of Open Access Journals (Sweden)

    Elham Khalili

    2012-03-01

    Full Text Available Brown spot caused by Bipolaris oryzae is an important rice disease in Southern coast of Caspian Sea, the major rice growing region in Iran. A total of 45 Trichoderma isolates were obtained from rice paddy fields in Golestan and Mazandaran provinces which belonged to Trichoderma harzianum, T. virens and T. atroviride species. Initially, they were screened against B. oryzae by antagonism tests including dual culture, volatile and nonvolatile metabolites and hyperparasitism. Results showed that Trichoderma isolates can significantly inhibit mycelium growth of pathogen in vitro by producing volatile and nonvolatile metabolites Light microscopic observations showed no evidence of mycoparasitic behaviour of the tested isolates of Trichoderma spp. such as coiling around the B. oryzae. According to in vitro experiments, Trichoderma isolates were selected in order to evaluate their efficacy in controlling brown spot in glasshouse using seed treatment and foliar spray methods. Concerning the glasshouse tests, two strains of T. harzianum significantly controlled the disease and one strain of T. atroviride increased the seedling growth. It is the first time that the biological control of rice brown spot and increase of seedling growth with Trichoderma species have been studied in Iran.

  13. IPM potentials of microbial pathogens and diseases of mites

    NARCIS (Netherlands)

    van der Geest, L.P.S.; Ciancio, A.; Mukerji, K.G.

    2010-01-01

    An overview is given of diseases in mites, caused by infectious microorganisms. Many pathogens play an important role in the regulation of natural populations of mite populations and are for this reason subject of research on the feasibility to develop such pathogens to biological control agents.

  14. Quagga and zebra mussels: biology, impacts, and control

    Science.gov (United States)

    Nalepa, Thomas F.; Schloesser, Don W.; Nalepa, Thomas F.; Schloesser, Don W.

    2013-01-01

    Quagga and Zebra Mussels: Biology, Impacts, and Control, Second Edition provides a broad view of the zebra/quagga mussel issue, offering a historic perspective and up-to-date information on mussel research. Comprising 48 chapters, this second edition includes reviews of mussel morphology, physiology, and behavior. It details mussel distribution and spread in Europe and across North America, and examines policy and regulatory responses, management strategies, and mitigation efforts. In addition, this book provides extensive coverage of the impact of invasive mussel species on freshwater ecosystems, including effects on water clarity, phytoplankton, water quality, food web changes, and consequences to other aquatic fauna. It also reviews and offers new insights on how zebra and quagga mussels respond and adapt to varying environmental conditions. This new edition includes seven video clips that complement chapter text and, through visual documentation, provide a greater understanding of mussel behavior and distribution.

  15. Biological control of biofilms on membranes by metazoans.

    Science.gov (United States)

    Klein, Theresa; Zihlmann, David; Derlon, Nicolas; Isaacson, Carl; Szivak, Ilona; Weissbrodt, David G; Pronk, Wouter

    2016-01-01

    Traditionally, chemical and physical methods have been used to control biofouling on membranes by inactivating and removing the biofouling layer. Alternatively, the permeability can be increased using biological methods while accepting the presence of the biofouling layer. We have investigated two different types of metazoans for this purpose, the oligochaete Aelosoma hemprichi and the nematode Plectus aquatilis. The addition of these grazing metazoans in biofilm-controlled membrane systems resulted in a flux increase of 50% in presence of the oligochaetes (Aelosoma hemprichi), and a flux increase of 119-164% in presence of the nematodes (Plectus aquatilis) in comparison to the control system operated without metazoans. The change in flux resulted from (1) a change in the biofilm structure, from a homogeneous, cake-like biofilm to a more heterogeneous, porous structure and (2) a significant reduction in the thickness of the basal layer. Pyrosequencing data showed that due to the addition of the predators, also the community composition of the biofilm in terms of protists and bacteria was strongly affected. The results have implications for a range of membrane processes, including ultrafiltration for potable water production, membrane bioreactors and reverse osmosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Landscape epidemiology and control of pathogens with cryptic and long-distance dispersal: Sudden oak death in northern Californian forests

    Science.gov (United States)

    Joao A. N. Filipe; Richard C. Cobb; Ross K. Meentemeyer; Christopher A. Lee; Yana S. Valachovic; Alex R. Cook; David M. Rizzo; Christopher A. Gilligan

    2012-01-01

    Exotic pathogens and pests threaten ecosystem service, biodiversity, and crop security globally. If an invasive agent can disperse asymptomatically over long distances, multiple spatial and temporal scales interplay, making identification of effective strategies to regulate, monitor, and control disease extremely difficult. The management of outbreaks is also...

  17. Storage Stability of Dried Microsclerotia of the Biological Control Pathogen Mycoleptodiscus Terrestris

    Science.gov (United States)

    2009-09-01

    packed in polyethylene bags, and stored at 4 ºC on 3/6/07, 5/15/07, 6/13/07, and 7/11/07. Dry material was shipped overnight in refrigerated...into plastic weigh boats for aquarium efficacy testing on hydrilla (see below) and for spore production bioassays. After use, the polyethylene bags were...Introduction to Fungi . 3rd ed. Cambridge, UK: Cambridge University Press. NOTE: The contents of this technical note are not to be used for advertising

  18. Biological Control of Bacterial Fruit Blotch of Watermelon Pathogen (Acidovorax citrulli with Rhizosphere Associated Bacteria

    Directory of Open Access Journals (Sweden)

    Mahesh Adhikari

    2017-04-01

    Full Text Available Bacterial fruit blotch (BFB, which is caused by Acidovorax citrulli, is a serious threat to watermelon growers around the world. The present study was conducted to screen effective rhizobacterial isolates against 35 different A. citrulli isolates and determine their efficacy on BFB and growth parameters of watermelon. Two rhizobacterial isolates viz. Paenibacillus polymyxa (SN-22, Sinomonas atrocyanea (NSB-27 showed high inhibitory activity in the preliminary screening and were further evaluated for their effect on BFB and growth parameters of three different watermelon varieties under greenhouse conditions. The greenhouse experiment result revealed that SN-22 and NSB-27 significantly reduced BFB and had significant stimulatory effect on total chlorophyll content, plant height, total fresh weight and total dry weight compared to uninoculated plants across the tested three watermelon varieties. Analysis of the 16S ribosomal RNA (rRNA sequences revealed that strains SN-22 belong to P. polymyxa and NSB-27 to S. atrocyanea with the bootstrap value of 99% and 98%, respectively. The isolates SN-22 and NSB-27 were tested for antagonistic and PGP traits. The result showed that the tested isolates produced siderophore, hydrolytic enzymes (protease and cellulose, chitinase, starch hydrolytic enzymes and they showed phosphate as well as zinc solubilizing capacity. This is the first report of P. polymyxa (SN-22 and S. atrocyanea (NSB-27 as biocontrol-plant growth promoting rhizobacteria on watermelon.

  19. Economic value of biological control in integrated pest management of managed plant systems.

    Science.gov (United States)

    Naranjo, Steven E; Ellsworth, Peter C; Frisvold, George B

    2015-01-07

    Biological control is an underlying pillar of integrated pest management, yet little focus has been placed on assigning economic value to this key ecosystem service. Setting biological control on a firm economic foundation would help to broaden its utility and adoption for sustainable crop protection. Here we discuss approaches and methods available for valuation of biological control of arthropod pests by arthropod natural enemies and summarize economic evaluations in classical, augmentative, and conservation biological control. Emphasis is placed on valuation of conservation biological control, which has received little attention. We identify some of the challenges of and opportunities for applying economics to biological control to advance integrated pest management. Interaction among diverse scientists and stakeholders will be required to measure the direct and indirect costs and benefits of biological control that will allow farmers and others to internalize the benefits that incentivize and accelerate adoption for private and public good.

  20. Use of rhizobacteria and endophytes for biological control of weeds

    Directory of Open Access Journals (Sweden)

    Trognitz, Friederike

    2014-02-01

    Full Text Available Weeds cause severe yield losses in agriculture, with a maximum estimate of 34% of yield loss worldwide due to competition between the crops and the weeds for nutrition, light and humidity (OERKE, 2006. Invasive plants contribute partially to other problems. The pollen of common ragweed, Ambrosia artemisiifolia L., for example, is five times more allergenic than grass pollen; already ten pollen grains per m3 air can trigger allergy in sensitized patients, including rhinitis, conjunctivitis and asthma. This neophyte from America has extended the season of allergy in European patients to October. Common ragweed is currently most frequent in Hungary, France and Italy. In Austria, ragweed populations along roads have increased dramatically since 2000. The effective means to control this weed of the Asteraceae family are limited; a single plant can produce up to 6000 seeds which stay in the soil for 40 years. Control using selective herbicides is not possible within stands of the Asteraceae member sunflower. Efforts to use herbivore insects as biological control agents also failed due to the unavailability of insects specializing on this ragweed. The use of plant-associated rhizobacteria and endophytes as bio-herbicides offers a novel alternative to conventional methods. By analogy to experiences from other plant-microbe systems, the chances to find microbes of the desired characteristics are highest when isolating and testing specimens directly from ragweed plants. These organisms often have an extremely narrow host range that permits their use for the control of among several even closely related plant species growing together in a field.

  1. Immunological Control of Viral Infections in Bats and the Emergence of Viruses Highly Pathogenic to Humans

    Directory of Open Access Journals (Sweden)

    Tony Schountz

    2017-09-01

    Full Text Available Bats are reservoir hosts of many important viruses that cause substantial disease in humans, including coronaviruses, filoviruses, lyssaviruses, and henipaviruses. Other than the lyssaviruses, they do not appear to cause disease in the reservoir bats, thus an explanation for the dichotomous outcomes of infections of humans and bat reservoirs remains to be determined. Bats appear to have a few unusual features that may account for these differences, including evidence of constitutive interferon (IFN activation and greater combinatorial diversity in immunoglobulin genes that do not undergo substantial affinity maturation. We propose these features may, in part, account for why bats can host these viruses without disease and how they may contribute to the highly pathogenic nature of bat-borne viruses after spillover into humans. Because of the constitutive IFN activity, bat-borne viruses may be shed at low levels from bat cells. With large naive antibody repertoires, bats may control the limited virus replication without the need for rapid affinity maturation, and this may explain why bats typically have low antibody titers to viruses. However, because bat viruses have evolved in high IFN environments, they have enhanced countermeasures against the IFN response. Thus, upon infection of human cells, where the IFN response is not constitutive, the viruses overwhelm the IFN response, leading to abundant virus replication and pathology.

  2. Bioprospecting marine actinomycetes for multidrug-resistant pathogen control from Rameswaram coastal area, Tamil Nadu, India.

    Science.gov (United States)

    Wahaab, Femina; Subramaniam, Kalidass

    2018-01-01

    A potent Streptomyces bacillaris strain RAM25C4 was isolated for controlling methicillin-resistant Staphylococcus aureus and multidrug-resistant bacteria such as Staphylococcus aureus, Acinetobacter baumannii, and Pseudomonas aeruginosa. A total of 131 actinomycetes were isolated from the Rameswaram coastal region, Tamil Nadu, India. Among 131 actinomycetes, maximum number of actinomycetes (55%) isolated at the distance of 3-6 m from seashore. Out of 131 actinomycetes, 85% of the actinomycetes exhibited different degree of antagonistic activity against test pathogens. The antagonistic activity evaluated using actinomycetes direct culture filtrate and culture filtrate extracts. Among these culture filtrate, extracts had supreme antagonistic activity against multidrug-resistant bacteria and the solvent ethyl acetate was the best for extracting secondary metabolites from actinomycetes. In HPTLC analysis, the presence of macrolides, terpenoids, and quinolones was identified in RAM25C4 extract. In GC-MS analysis, various potent compounds such as phenolic compound-2,6-di-tert-butylphenol, alkaloid compound-1H, 5H, pyrrolo (1' 2':3, 4) imidazo, and quinolone compound-1,4-benzenediol, 2,5-bis(1,1-dimethylethyl) were identified in the ethyl acetate extract of RAM25C4. The phylogenetic analysis of 16S rRNA gene sequence of RAM25C4 isolate was deposited in NCBI with name Streptomyces bacillaris strain RAM25C4 and accession number KM513543.

  3. The Secreted Protease PrtA Controls Cell Growth, Biofilm Formation and Pathogenicity in Xylella fastidiosa.

    Science.gov (United States)

    Gouran, Hossein; Gillespie, Hyrum; Nascimento, Rafael; Chakraborty, Sandeep; Zaini, Paulo A; Jacobson, Aaron; Phinney, Brett S; Dolan, David; Durbin-Johnson, Blythe P; Antonova, Elena S; Lindow, Steven E; Mellema, Matthew S; Goulart, Luiz R; Dandekar, Abhaya M

    2016-08-05

    Pierce's disease (PD) is a deadly disease of grapevines caused by the Gram-negative bacterium Xylella fastidiosa. Though disease symptoms were formerly attributed to bacteria blocking the plant xylem, this hypothesis is at best overly simplistic. Recently, we used a proteomic approach to characterize the secretome of X. fastidiosa, both in vitro and in planta, and identified LesA as one of the pathogenicity factors of X. fastidiosa in grapevines that leads to leaf scorching and chlorosis. Herein, we characterize another such factor encoded by PD0956, designated as an antivirulence secreted protease "PrtA" that displays a central role in controlling in vitro cell proliferation, length, motility, biofilm formation, and in planta virulence. The mutant in X. fastidiosa exhibited reduced cell length, hypermotility (and subsequent lack of biofilm formation) and hypervirulence in grapevines. These findings are supported by transcriptomic and proteomic analyses with corresponding plant infection data. Of particular interest, is the hypervirulent response in grapevines observed when X. fastidiosa is disrupted for production of PrtA, and that PD-model tobacco plants transformed to express PrtA exhibited decreased symptoms after infection by X. fastidiosa.

  4. Workshop summary: detection, impact, and control of specific pathogens in animal resource facilities.

    Science.gov (United States)

    Mansfield, Keith G; Riley, Lela K; Kent, Michael L

    2010-01-01

    Despite advances, infectious diseases remain a threat to animal facilities, continue to affect animal health, and serve as potential confounders of experimental research. A workshop entitled Detection, Impact, and Control of Specific Pathogens in Animal Resource Facilities was sponsored by the National Center for Research Resources (NCRR) and National Institutes of Aging (NIA) and held April 23-24, 2009, at the Lister Hill Conference Center on the National Institutes of Health's (NIH) Bethesda campus. The meeting brought together laboratory animal scientists and veterinarians with experience in fish, rodent, and nonhuman primate models to identify common issues and problems. Session speakers addressed (1) common practices and current knowledge of these species, (2) new technologies in the diagnosis of infectious diseases, (3) impact of environmental quality on infectious disease, (4) normal microbial flora in health and disease, (5) genetics and infectious disease, and (6) specific infectious agents and their impact on research. Attendees discussed current challenges and future needs, highlighting the importance of education and training, the funding of critical infrastructure and resource research, and the need for improved communication of disease risks and integration of these risks with strategic planning. NIH and NCRR have a strong record of supporting resource initiatives that have helped address many of these issues and recent efforts have focused on the building of consortium activities among such programs. This manuscript summarizes the presentations and conclusions of participants at the meeting; abstracts and a full conference report are available online (www.ncrr.nih.gov).

  5. Irradiation control of pathogenic bacteria and their growth during storage in short neckde clam

    International Nuclear Information System (INIS)

    Ju Hua; Wang Feng; Ha Yiming; Liu Shuliang

    2009-01-01

    The growth of pathogenic bacteria during storage and their D 10 values by irradiation in short necked clam were evaluated. The results showed that the D 10 values of the total bacteria count, E. coli, Vibrio parahaemolyticus in short necked clam at 0 degree C ∼ 4 degree C condition were 0.70, 0.56, 0.20kGy, respectively. The results showed that total bacteria count in vacuum packaged short necked clam sample was 4.46 log (CFU/g) after 3kGy 60 Co γ-irradiation and 28 days stored under 0 degree C ∼ 4 degree C, which could meet the requirement of related aquatic product standards, the E. coli and Vibrio parahaemolyticus would not detected after 0.4kGy irradiation and 7 days storage at 0 degree C ∼ 4 degree C. Therefore, micro-organisms could be controled effectively by 3 kGy irradiation and its shelf-life could extend to 28 days. (authors)

  6. Thyrotropin-releasing hormone controls mitochondrial biology in human epidermis.

    Science.gov (United States)

    Knuever, Jana; Poeggeler, Burkhard; Gáspár, Erzsébet; Klinger, Matthias; Hellwig-Burgel, Thomas; Hardenbicker, Celine; Tóth, Balázs I; Bíró, Tamás; Paus, Ralf

    2012-03-01

    Mitochondrial capacity and metabolic potential are under the control of hormones, such as thyroid hormones. The most proximal regulator of the hypothalamic-pituitary-thyroid (HPT) axis, TRH, is the key hypothalamic integrator of energy metabolism via its impact on thyroid hormone secretion. Here, we asked whether TRH directly modulates mitochondrial functions in normal, TRH-receptor-positive human epidermis. Organ-cultured human skin was treated with TRH (5-100 ng/ml) for 12-48 h. TRH significantly increased epidermal immunoreactivity for the mitochondria-selective subunit I of respiratory chain complex IV (MTCO1). This resulted from an increased MTCO1 transcription and protein synthesis and a stimulation of mitochondrial biogenesis as demonstrated by transmission electron microscopy and TRH-enhanced mitochondrial DNA synthesis. TRH also significantly stimulated the transcription of several other mitochondrial key genes (TFAM, HSP60, and BMAL1), including the master regulator of mitochondrial biogenesis (PGC-1α). TRH significantly enhanced mitochondrial complex I and IV enzyme activity and enhanced the oxygen consumption of human skin samples, which shows that the stimulated mitochondria are fully vital because the main source for cellular oxygen consumption is mitochondrial endoxidation. These findings identify TRH as a potent, novel neuroendocrine stimulator of mitochondrial activity and biogenesis in human epidermal keratinocytes in situ. Thus, human epidermis offers an excellent model for dissecting neuroendocrine controls of human mitochondrial biology under physiologically relevant conditions and for exploring corresponding clinical applications.

  7. Using Biological-Control Research in the Classroom to Promote Scientific Inquiry & Literacy

    Science.gov (United States)

    Richardson, Matthew L.; Richardson, Scott L.; Hall, David G.

    2012-01-01

    Scientists researching biological control should engage in education because translating research programs into classroom activities is a pathway to increase scientific literacy among students. Classroom activities focused on biological control target all levels of biological organization and can be cross-disciplinary by drawing from subject areas…

  8. Screening of chitinolytic actinomycetes for biological control of Sclerotium rolfsii stem rot disease of chilli

    Directory of Open Access Journals (Sweden)

    Pranee Pattanapipitpaisal

    2012-09-01

    Full Text Available Two hundred and eighty three strains were isolated from rhizoshere-associated soils, from Ubon Ratchathani andSrisaket province, using Enrichment Media for isolation of Chitinase-producing Actinomycetes agar (EMCA agar. All strainswere screened for chitinolytic activity and sixty eight strains gave significant clear zone on EMCA agar plates. The selectedchitinolytic strains were assayed for in vitro antagonism against Sclerotium rolfsii using cornmeal agar (CMA agar assayprocedure and the result showed that thirteen isolates have remarkable inhibiting the growth of the fungus and the top fiveantagonistic actinomycetes were PACCH 277, PACCH129, PACCH225, PACCH24 and PACCH246, respectively. The resultindicated that these actinomycetes produce chitinase which catalyze the degradation of chitin, resulting in inhibition of S.rolfsii growth. Their abilities to control the disease development were tested for in vivo biocontrol assay on chilli seedlings.Two out of thirteen candidate, PACCH24 and PACCH225, antagonists reduced the disease development at 90%. It wassuggested that the ability to inhibit the growth of pathogen in vitro was not related to the disease reduction in vivo. Thestrain PACCH24 was further identified as Streptomyces hygroscopicus according to morphological characteristic, cell walland cellular sugar analysis and 16S rDNA sequencing. The study implies a novel chitinolytic actinomycete which could bedeveloped to be a biological agent which would be included as a complement with organic fertilizers in order to control stemrot disease and promote growth of chilli.

  9. BIOLOGICAL CONTROL - AS A MEANS TO CONTROL INSECT PESTS IN AZERBAIJAN

    Directory of Open Access Journals (Sweden)

    Z. M. Mamedov

    2013-01-01

    Full Text Available Two hundreds and twenty species parasites and predators of pests of various agricultures are revealed in Azerbaijan. The complex of entomophages of certain pests of agricultures is studied: 48 species of parasites and predators of Chloridea obsoleta 21 species of entomophages of Pectinophora malvella Hb., over 160 species of entomophages of pests of ozehards and vegetables, 34 species of entomophages of pests of forests. The hundreds species of entomophages and some entomophogenous microbes and antagonists are revealed. Biology and ecology of over 60 species of entomophages and useful microorganisims which are prospective as biological control agents are studied.

  10. Biological relevance of volatile organic compounds emitted during the pathogenic interactions between apple plants and Erwinia amylovora.

    Science.gov (United States)

    Cellini, Antonio; Buriani, Giampaolo; Rocchi, Lorenzo; Rondelli, Elena; Savioli, Stefano; Rodriguez Estrada, Maria T; Cristescu, Simona M; Costa, Guglielmo; Spinelli, Francesco

    2018-01-01

    Volatile organic compounds emitted during the infection of apple (Malus pumila var. domestica) plants by Erwinia amylovora or Pseudomonas syringae pv. syringae were studied by gas chromatography-mass spectrometry and proton transfer reaction-mass spectrometry, and used to treat uninfected plants. Infected plants showed a disease-specific emission of volatile organic compounds, including several bio-active compounds, such as hexenal isomers and 2,3-butanediol. Leaf growth promotion and a higher resistance to the pathogen, expressed as a lower bacterial growth and migration in plant tissues, were detected in plants exposed to volatile compounds from E. amylovora-infected plants. Transcriptional analysis revealed the activation of salicylic acid synthesis and signal transduction in healthy plants exposed to volatiles produced by E. amylovora-infected neighbour plants. In contrast, in the same plants, salicylic acid-dependent responses were repressed after infection, whereas oxylipin metabolism was activated. These results clarify some metabolic and ecological aspects of the pathogenic adaptation of E. amylovora to its host. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  11. A new threat to bees? Entomopathogenic nematodes used in biological pest control cause rapid mortality in Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Alexandrea Dutka

    2015-11-01

    Full Text Available There is currently a great deal of concern about population declines in pollinating insects. Many potential threats have been identified which may adversely affect the behaviour and health of both honey bees and bumble bees: these include pesticide exposure, and parasites and pathogens. Whether biological pest control agents adversely affect bees has been much less well studied: it is generally assumed that biological agents are safer for wildlife than chemical pesticides. The aim of this study was to test whether entomopathogenic nematodes sold as biological pest control products could potentially have adverse effects on the bumble bee Bombus terrestris. One product was a broad spectrum pest control agent containing both Heterorhabditis sp. and Steinernema sp., the other product was specifically for weevil control and contained only Steinernema kraussei. Both nematode products caused ≥80% mortality within the 96 h test period when bees were exposed to soil containing entomopathogenic nematodes at the recommended field concentration of 50 nematodes per cm2 soil. Of particular concern is the fact that nematodes from the broad spectrum product could proliferate in the carcasses of dead bees, and therefore potentially infect a whole bee colony or spread to the wider environment.

  12. Ultraviolet-Mediated Activation of Photo toxins from Peganum Harmala L. Seedlings to Control both Human-and Phyto-Pathogenic Microorganisms and Tumor Cells

    International Nuclear Information System (INIS)

    Kord, M.; Khafagi, I.; Dewedar, A.

    2003-01-01

    The medicinal plant Peganum harmala L. (zygophyllaceae) contains a number of Beta-carboline alkaloids, which are photosensitizers to bacteria, yeasts and eukaryotic cells in the presence of sunlight and artificial sources of long-wave UV radiation (365 nm). Ultraviolet irradiation of ten-day old aseptically germinated Peganum harmala inoculated on bacterial and yeast bioassay plates elicits strong phototoxic antimicrobials. Callus as well as crude methanol extracts of in vitro cultures were also investigated for the accumulation of photosensitizers. High performance liquid chromatographic analyses of irradiated and control tissues followed by fluorescent detection at 302 nm revealed the formation of serotonin (5-hydroxytryptamine) in irradiated tissues only. Eluted compounds detected at 330 nm revealed more than ten-fold accumulation of harmine, isoharmine and harmol in irradiated tissues. Moreover, several simple beta-carboline alkaloids were produced through irradiation with UV such as harmalanine and harmalacidine. UV-induced phototoxicity was proven against phyto pathogenic bacteria and human-pathogenic bacteria and yeasts. Photo-induced cytotoxicity was observed from two different toxicity bioassays, which are Artemia saline and potato discs tumor assay. The selective UV-dependent biological activities may imply a pharmacological potential of Peganum harmala in the control of infectious diseases and tumor tissues

  13. Characterization of Pathogenic Human MSH2 Missense Mutations Using Yeast as a Model System: A Laboratory Course in Molecular Biology

    Science.gov (United States)

    Gammie, Alison E.; Erdeniz, Naz

    2004-01-01

    This work describes the project for an advanced undergraduate laboratory course in cell and molecular biology. One objective of the course is to teach students a variety of cellular and molecular techniques while conducting original research. A second objective is to provide instruction in science writing and data presentation by requiring…

  14. Biological control of post harvest disease caused by Aspergillus ...

    African Journals Online (AJOL)

    Antagonistic activity of 24 selected bacterial strains detected by previous microbiological studies to Aspergillus flavus was tested in vitro and in vivo conditions. Within 24 strains, only ten strains showed remarkable inhibition zone (6-34 mm) against the pathogen in assays carried out in Petri plates. Both cell suspension and ...

  15. Implications of Plasmodium vivax Biology for Control, Elimination, and Research

    Science.gov (United States)

    Olliaro, Piero L.; Barnwell, John W.; Barry, Alyssa; Mendis, Kamini; Mueller, Ivo; Reeder, John C.; Shanks, G. Dennis; Snounou, Georges; Wongsrichanalai, Chansuda

    2016-01-01

    This paper summarizes our current understanding of the biology of Plasmodium vivax, how it differs from Plasmodium falciparum, and how these differences explain the need for P. vivax-tailored interventions. The article further pinpoints knowledge gaps where investments in research are needed to help identify and develop such specific interventions. The principal obstacles to reduce and eventually eliminate P. vivax reside in 1) its higher vectorial capacity compared with P. falciparum due to its ability to develop at lower temperature and over a shorter sporogonic cycle in the vector, allowing transmission in temperate zones and making it less sensitive to vector control measures that are otherwise effective on P. falciparum; 2) the presence of dormant liver forms (hypnozoites), sustaining multiple relapsing episodes from a single infectious bite that cannot be diagnosed and are not susceptible to any available antimalarial except primaquine, with routine deployment restricted by toxicity; 3) low parasite densities, which are difficult to detect with current diagnostics leading to missed diagnoses and delayed treatments (and protracted transmission), coupled with 4) transmission stages (gametocytes) occurring early in acute infections, before infection is diagnosed. PMID:27799636

  16. Biological Control of Meloidogyne hapla Using an Antagonistic Bacterium

    Directory of Open Access Journals (Sweden)

    Jiyeong Park

    2014-09-01

    Full Text Available We examined the efficacy of a bacterium for biocontrol of the root-knot nematode (RKN Meloidogyne hapla in carrot (Daucus carota subsp. sativus and tomato (Solanum lycopersicum. Among 542 bacterial isolates from various soils and plants, the highest nematode mortality was observed for treatments with isolate C1-7, which was identified as Bacillus cereus based on cultural and morphological characteristics, the Biolog program, and 16S rRNA sequencing analyses. The population density and the nematicidal activity of B. cereus C1-7 remained high until the end of culture in brain heart infusion broth, suggesting that it may have sustainable biocontrol potential. In pot experiments, the biocontrol efficacy of B. cereus C1-7 was high, showing complete inhibition of root gall or egg mass formation by RKN in carrot and tomato plants, and subsequently reducing RKN damage and suppressing nematode population growth, respectively. Light microscopy of RKN-infected carrot root tissues treated with C1-7 showed reduced formation of gall cells and fully developed giant cells, while extensive gall cells and fully mature giant cells with prominent cell wall ingrowths formed in the untreated control plants infected with RKNs. These histopathological characteristics may be the result of residual or systemic biocontrol activity of the bacterium, which may coincide with the biocontrol efficacies of nematodes in pots. These results suggest that B. cereus C1-7 can be used as a biocontrol agent for M. hapla.

  17. Synthesis, chemical and biological quality control of radioiodinated peptides

    International Nuclear Information System (INIS)

    Rafii, H.; Khalaj, A.; Beiki, D.; Motameidi, F.; Maloobi, M.; Karimian-dehghan, M.; Keshavarrzi, F.

    2002-01-01

    Iodinated compounds with I-131, 125 and 123 have been widely used for biochemical function studies. In conjunction with SPECT, [I-123] labelled proteins have various diagnostic and therapeutic applications in nuclear medicine. Preparation of some radioiodinated peptides with tyrosine and/or lysine groups on their main chain molecules can be carried out with both direct and indirect methods, but lack of these groups in molecule cause the molecule dose not lend itself for direct radioiodination. In this study, human IgG and Formyl-Methyl-Leucyl-Phenylalanine, FMLF, have been chosen as a model compounds for direct and indirect radioiodination respectively. Here, we will describe the labelling procedure of [I-125] IgG using chloramine-T as a suitable oxidant agent and [I-125 and I-131] FMLF by indirect method using ATE/SIB as a prosthetic group in multi-step reactions. The obtained results for chemical quality control of intermediate radioiodinated SIB by HPLC and two labelled IgG and FMLF will be also discussed. Biological results, biodistribution studies and SPECT scans on mice per-injected labelled FMLF show a low uptake of thyroid but a high at urine and bladder, perhaps because of low molecular weight of FMLF. In this case, it seems to be better to separate the reaction mixture of labelled FMLF by BPLC than Sephadex-G50 gel filtration. (Author)

  18. Implications of Plasmodium vivax Biology for Control, Elimination, and Research.

    Science.gov (United States)

    Olliaro, Piero L; Barnwell, John W; Barry, Alyssa; Mendis, Kamini; Mueller, Ivo; Reeder, John C; Shanks, G Dennis; Snounou, Georges; Wongsrichanalai, Chansuda

    2016-12-28

    This paper summarizes our current understanding of the biology of Plasmodium vivax, how it differs from Plasmodium falciparum, and how these differences explain the need for P. vivax-tailored interventions. The article further pinpoints knowledge gaps where investments in research are needed to help identify and develop such specific interventions. The principal obstacles to reduce and eventually eliminate P. vivax reside in 1) its higher vectorial capacity compared with P. falciparum due to its ability to develop at lower temperature and over a shorter sporogonic cycle in the vector, allowing transmission in temperate zones and making it less sensitive to vector control measures that are otherwise effective on P. falciparum; 2) the presence of dormant liver forms (hypnozoites), sustaining multiple relapsing episodes from a single infectious bite that cannot be diagnosed and are not susceptible to any available antimalarial except primaquine, with routine deployment restricted by toxicity; 3) low parasite densities, which are difficult to detect with current diagnostics leading to missed diagnoses and delayed treatments (and protracted transmission), coupled with 4) transmission stages (gametocytes) occurring early in acute infections, before infection is diagnosed. © The American Society of Tropical Medicine and Hygiene.

  19. Effect of Producing Different Phenazines on Bacterial Fitness and Biological Control in Pseudomonas chlororaphis 30-84

    Directory of Open Access Journals (Sweden)

    Jun Myoung Yu

    2018-02-01

    Full Text Available Pseudomonas chlororaphis 30-84 is a biological control agent selected for its ability to suppress diseases caused by fungal pathogens. P. chlororaphis 30-84 produces three phenazines: phenazine-1-carboxylic acid (PCA, 2-hydroxy-phenazine-1-carboxylic acid (2OHPCA and a small amount of 2-hydroxy-phenazine (2OHPHZ, and these are required for fungal pathogen inhibition and wheat rhizosphere competence. The two, 2-hydroxy derivatives are produced from PCA via the activity of a phenazine-modifying enzyme encoded by phzO. In addition to the seven biosynthetic genes responsible for the production of PCA, many other Pseudomonas strains possess one or more modifying genes, which encode enzymes that act independently or together to convert PCA into other phenazine derivatives. In order to understand the fitness effects of producing different phenazines, we constructed isogenic derivatives of P. chlororaphis 30-84 that differed only in the type of phenazines produced. Altering the type of phenazines produced by P. chlororaphis 30-84 enhanced the spectrum of fungal pathogens inhibited and altered the degree of take-all disease suppression. These strains also differed in their ability to promote extracellular DNA release, which may contribute to the observed differences in the amount of biofilm produced. All derivatives were equally important for survival over repeated plant/harvest cycles, indicating that the type of phenazines produced is less important for persistence in the wheat rhizosphere than whether or not cells produce phenazines. These findings provide a better understanding of the effects of different phenazines on functions important for biological control activity with implications for applications that rely on introduced or native phenazine producing populations.

  20. Transcriptional control of drug resistance, virulence and immune system evasion in pathogenic fungi: a cross-species comparison.

    Directory of Open Access Journals (Sweden)

    Pedro Pais

    2016-10-01

    Full Text Available Transcription factors are key players in the control of the activation or repression of gene expression programs in response to environmental stimuli. The study of regulatory networks taking place in fungal pathogens is a promising research topic that can help in the fight against these pathogens by targeting specific fungal pathways as a whole, instead of targeting more specific effectors of virulence or drug resistance. This review is focused on the analysis of regulatory networks playing a central role in the referred mechanisms in the human fungal pathogens Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Candida glabrata, Candida parapsilosis and Candida tropicalis. Current knowledge on the activity of the transcription factors characterized in each of these pathogenic fungal species will be addressed. Particular focus is given to their mechanisms of activation, regulatory targets and phenotypic outcome. The review further provides an evaluation on the conservation of transcriptional circuits among different fungal pathogens, highlighting the pathways that translate common or divergent traits among these species in what concerns their drug resistance, virulence and host immune evasion features. It becomes evident that the regulation of transcriptional networks is complex and presents significant variations among different fungal pathogens. Only the oxidative stress regulators Yap1 and Skn7 are conserved among all studied species; while some transcription factors, involved in nutrient homeostasis, pH adaptation, drug resistance and morphological switching are present in several, though not all species. Interestingly, in some cases not very homologous transcription factors display orthologous functions, whereas some homologous proteins have diverged in terms of their function in different species. A few cases of species specific transcription factors are also observed.

  1. Transcriptional Control of Drug Resistance, Virulence and Immune System Evasion in Pathogenic Fungi: A Cross-Species Comparison.

    Science.gov (United States)

    Pais, Pedro; Costa, Catarina; Cavalheiro, Mafalda; Romão, Daniela; Teixeira, Miguel C

    2016-01-01

    Transcription factors are key players in the control of the activation or repression of gene expression programs in response to environmental stimuli. The study of regulatory networks taking place in fungal pathogens is a promising research topic that can help in the fight against these pathogens by targeting specific fungal pathways as a whole, instead of targeting more specific effectors of virulence or drug resistance. This review is focused on the analysis of regulatory networks playing a central role in the referred mechanisms in the human fungal pathogens Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Candida glabrata, Candida parapsilosis , and Candida tropicalis . Current knowledge on the activity of the transcription factors characterized in each of these pathogenic fungal species will be addressed. Particular focus is given to their mechanisms of activation, regulatory targets and phenotypic outcome. The review further provides an evaluation on the conservation of transcriptional circuits among different fungal pathogens, highlighting the pathways that translate common or divergent traits among these species in what concerns their drug resistance, virulence and host immune evasion features. It becomes evident that the regulation of transcriptional networks is complex and presents significant variations among different fungal pathogens. Only the oxidative stress regulators Yap1 and Skn7 are conserved among all studied species; while some transcription factors, involved in nutrient homeostasis, pH adaptation, drug resistance and morphological switching are present in several, though not all species. Interestingly, in some cases not very homologous transcription factors display orthologous functions, whereas some homologous proteins have diverged in terms of their function in different species. A few cases of species specific transcription factors are also observed.

  2. A Population Biology Perspective on the Stepwise Infection Process of the Bacterial Pathogen Pasteuria ramosa in Daphnia.

    Science.gov (United States)

    Ebert, Dieter; Duneau, David; Hall, Matthew D; Luijckx, Pepijn; Andras, Jason P; Du Pasquier, Louis; Ben-Ami, Frida

    2016-01-01

    The infection process of many diseases can be divided into series of steps, each one required to successfully complete the parasite's life and transmission cycle. This approach often reveals that the complex phenomenon of infection is composed of a series of more simple mechanisms. Here we demonstrate that a population biology approach, which takes into consideration the natural genetic and environmental variation at each step, can greatly aid our understanding of the evolutionary processes shaping disease traits. We focus in this review on the biology of the bacterial parasite Pasteuria ramosa and its aquatic crustacean host Daphnia, a model system for the evolutionary ecology of infectious disease. Our analysis reveals tremendous differences in the degree to which the environment, host genetics, parasite genetics and their interactions contribute to the expression of disease traits at each of seven different steps. This allows us to predict which steps may respond most readily to selection and which steps are evolutionarily constrained by an absence of variation. We show that the ability of Pasteuria to attach to the host's cuticle (attachment step) stands out as being strongly influenced by the interaction of host and parasite genotypes, but not by environmental factors, making it the prime candidate for coevolutionary interactions. Furthermore, the stepwise approach helps us understanding the evolution of resistance, virulence and host ranges. The population biological approach introduced here is a versatile tool that can be easily transferred to other systems of infectious disease. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Ecological theory as a foundation to control pathogenic invasion in aquaculture

    Science.gov (United States)

    De Schryver, Peter; Vadstein, Olav

    2014-01-01

    Detrimental host–pathogen interactions are a normal phenomenon in aquaculture animal production, and have been counteracted by prophylactic use of antibiotics. Especially, the youngest life stages of cultivated aquatic animals are susceptible to pathogen invasion, resulting in disease and mortality. To establish a more sustainable aquatic food production, there is a need for new microbial management strategies that focus on ‘join them' and not the traditional ‘beat them' approaches. We argue that ecological theory could serve as a foundation for developing sustainable microbial management methods that prevent pathogenic disease in larviculture. Management of the water microbiota in aquaculture systems according to ecological selection principles has been shown to decrease opportunistic pathogen pressure and to result in an improved performance of the cultured animals. We hypothesize that manipulation of the biodiversity of the gut microbiota can increase the host's resistance against pathogenic invasion and infection. However, substantial barriers need to be overcome before active management of the intestinal microbiota can effectively be applied in larviculture. PMID:24892581

  4. Complete genome sequence of Bacillus velezensis S3-1, a potential biological pesticide with plant pathogen inhibiting and plant promoting capabilities.

    Science.gov (United States)

    Jin, Qing; Jiang, Qiuyue; Zhao, Lei; Su, Cuizhu; Li, Songshuo; Si, Fangyi; Li, Shanshan; Zhou, Chenhao; Mu, Yonglin; Xiao, Ming

    2017-10-10

    Antagonistic soil microorganisms, which are non-toxic, harmless non-pollutants, can effectively reduce the density of pathogenic species by some ways. Bacillus velezensis strain S3-1 was isolated from the rhizosphere soil of cucumber, and was shown to inhibit plant pathogens, promote plant growth and efficiently colonize rhizosphere soils. The strain produced 13 kinds of lipopeptide antibiotics, belonging to the surfactin, iturin and fengycin families. Here, we presented the complete genome sequence of S3-1. The genome consists of one chromosome without plasmids and also contains the biosynthetic gene cluster that encodes difficidin, macrolactin, surfactin and fengycin. The genome contains 86 tRNA genes, 27 rRNA genes and 57 antibiotic-related genes. The complete genome sequence of B. velezensis S3-1 provides useful information to further detect the molecular mechanisms behind antifungal actions, and will facilitate its potential as a biological pesticide in the agricultural industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Systems Biology Analysis of Temporal In vivo Brucella melitensis and Bovine Transcriptomes Predicts host:Pathogen Protein–Protein Interactions

    Directory of Open Access Journals (Sweden)

    Carlos A. Rossetti

    2017-07-01

    Full Text Available To date, fewer than 200 gene-products have been identified as Brucella virulence factors, and most were characterized individually without considering how they are temporally and coordinately expressed or secreted during the infection process. Here, we describe and analyze the in vivo temporal transcriptional profile of Brucella melitensis during the initial 4 h interaction with cattle. Pathway analysis revealed an activation of the “Two component system” providing evidence that the in vivo Brucella sense and actively regulate their metabolism through the transition to an intracellular lifestyle. Contrarily, other Brucella pathways involved in virulence such as “ABC transporters” and “T4SS system” were repressed suggesting a silencing strategy to avoid stimulation of the host innate immune response very early in the infection process. Also, three flagellum-encoded loci (BMEII0150-0168, BMEII1080-1089, and BMEII1105-1114, the “flagellar assembly” pathway and the cell components “bacterial-type flagellum hook” and “bacterial-type flagellum” were repressed in the tissue-associated B. melitensis, while RopE1 sigma factor, a flagellar repressor, was activated throughout the experiment. These results support the idea that Brucella employ a stealthy strategy at the onset of the infection of susceptible hosts. Further, through systems-level in silico host:pathogen protein–protein interactions simulation and correlation of pathogen gene expression with the host gene perturbations, we identified unanticipated interactions such as VirB11::MAPK8IP1; BtaE::NFKBIA, and 22 kDa OMP precursor::BAD and MAP2K3. These findings are suggestive of new virulence factors and mechanisms responsible for Brucella evasion of the host's protective immune response and the capability to maintain a dormant state. The predicted protein–protein interactions and the points of disruption provide novel insights that will stimulate advanced hypothesis

  6. Synthetic biology and regulatory networks: where metabolic systems biology meets control engineering

    NARCIS (Netherlands)

    He, F.; Murabito, E.; Westerhoff, H.V.

    2016-01-01

    Metabolic pathways can be engineered to maximize the synthesis of various products of interest. With the advent of computational systems biology, this endeavour is usually carried out throughin silicotheoretical studies with the aim to guide and complement furtherin vitroandin vivoexperimental

  7. 76 FR 3076 - Availability of an Environmental Assessment for a Biological Control Agent for Air Potato

    Science.gov (United States)

    2011-01-19

    ...] Availability of an Environmental Assessment for a Biological Control Agent for Air Potato AGENCY: Animal and... environmental assessment (EA) relative to the control of air potato (Dioscorea bulbifera). The EA considers the... States for use as a biological control agent to reduce the severity of air potato infestations. We are...

  8. Modes of action for biological control of Botrytis cinerea by antagonistic bacteria

    Directory of Open Access Journals (Sweden)

    Rana HAIDAR

    2017-01-01

    Full Text Available The role of beneficial bacteria in biocontrol of plant diseases, particularly those caused by the necrotrophic fungus Botrytis cinerea, has been investigated by testing many bacteria under laboratory and field conditions. Bacteria may protect plants against B. cinerea by direct antagonistic interactions between biocontrol agents and this pathogen, as well as indirect effects through the induction of host resistance. This review focuses on various bacteria that act as biological control agents (BCAs of B. cinerea and their associated mechanisms. The modes of action (MoAs include: i synthesis of anti-fungal metabolites, such as antibiotics, cell wall-degrading enzymes and volatile organic compounds (VOCs; ii competition for nutrients and/or a niche; and iii induction of host resistance. The challenge for development of BCAs is to reduce the variability of efficiency and to prove persistence under a large range of conditions. We discuss the advantages and drawbacks of MoA for future applications of bacteria in the field and in post-harvest storage, as well as combination of different MoAs as a strategy to achieve a more regular efficacy.

  9. Control of Salmonella and other pathogenic and spoilage microorganisms in poultry by gamma and electron irradiation

    International Nuclear Information System (INIS)

    Singh, H.

    1992-07-01

    Salmonella contamination of chicken is a major public health concern, causing sickness and loss of productivity. Modern, concentrated production methods increase the difficulty of Salmonella control. The current and suggested treatments with chlorinated water or heat pasteurization are unsatisfactory. In pasteurization, the end product is partially cooked, and in the chlorine water wash the poultry skin gets bleached if too much chlorine is used. There is also a risk of formation of toxic chloro-organic compounds. Further, the chlorine water wash does not completely eliminate salmonella. Low-dose radiation treatment is much more effective for the control of Salmonella and has the additional benefit of preserving the freshness of the product. Irradiation of fresh chicken carcasses, pieces or deboned chicken meat with a dose of 2.5 kGy appears to be sufficient to eliminate naturally occurring Salmonella contamination, which is generally present in extremely low numbers on this continent (1 to 30 cells/100 g). For elimination of Salmonella in frozen chicken, doses higher than 2.5 kGy are required. There is a large range of D 10 - values for the different Salmonella serotypes that have been tested, with the highest being 0.72 kGy for S. oranienberg at 22 degrees C. Thus the 2.5-kGy dose would reduce the most radio-resistant Salmonella serotype by four orders of magnitude, and the most common serotypes (with D 10 - values of 0.3 to 0.4 kGy) by greater than six orders of magnitude. The 2.5-kGy dose also appears to be sufficient to eliminate other bacterial pathogens, such as Campylobactor jejuni and Yersinia enterocolitica. The microbiological shelf life of fresh chicken carcass or deboned chicken meat (6 to 11 d) is extended by a factor of 2 to 3 with irradiation to a dose of 2.5 kGy followed by storage between 1 and 4 degrees C. In radappertization (at a dose of ≥ 45 kGy at -30 degrees C), the shelf life of enzyme-inactivated chicken meat is extended to years, on

  10. Landscape epidemiology and control of pathogens with cryptic and long-distance dispersal: sudden oak death in northern Californian forests.

    Directory of Open Access Journals (Sweden)

    João A N Filipe

    2012-01-01

    Full Text Available Exotic pathogens and pests threaten ecosystem service, biodiversity, and crop security globally. If an invasive agent can disperse asymptomatically over long distances, multiple spatial and temporal scales interplay, making identification of effective strategies to regulate, monitor, and control disease extremely difficult. The management of outbreaks is also challenged by limited data on the actual area infested and the dynamics of spatial spread, due to financial, technological, or social constraints. We examine principles of landscape epidemiology important in designing policy to prevent or slow invasion by such organisms, and use Phytophthora ramorum, the cause of sudden oak death, to illustrate how shortfalls in their understanding can render management applications inappropriate. This pathogen has invaded forests in coastal California, USA, and an isolated but fast-growing epidemic focus in northern California (Humboldt County has the potential for extensive spread. The risk of spread is enhanced by the pathogen's generalist nature and survival. Additionally, the extent of cryptic infection is unknown due to limited surveying resources and access to private land. Here, we use an epidemiological model for transmission in heterogeneous landscapes and Bayesian Markov-chain-Monte-Carlo inference to estimate dispersal and life-cycle parameters of P. ramorum and forecast the distribution of infection and speed of the epidemic front in Humboldt County. We assess the viability of management options for containing the pathogen's northern spread and local impacts. Implementing a stand-alone host-free "barrier" had limited efficacy due to long-distance dispersal, but combining curative with preventive treatments ahead of the front reduced local damage and contained spread. While the large size of this focus makes effective control expensive, early synchronous treatment in newly-identified disease foci should be more cost-effective. We show how the

  11. Screening and Scoring of Antimicrobial and Biological Activities of Italian Vulnerary Plants against Major Oral Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Gianmaria F. Ferrazzano

    2013-01-01

    Full Text Available This study aims to evaluate the activity of Italian vulnerary plants against the most important oral pathogenic bacteria. This estimate was accomplished through a fivefold process: (a a review of ethnobotanical and microbiological data concerning the Italian vulnerary plants; (b the development of a scoring system to rank the plants; (c the comparative assessment of microbiological properties; (d the assessment of potential cytotoxic effects on keratinocyte-like cells and gingival fibroblasts in culture by XTT cell viability assay; (e clinical evaluation of the most suitable plant extract as antibacterial agent in a home-made mouthwash. The study assays hexane (H, ethanol (E, and water (W extracts from 72 plants. The agar diffusion method was used to evaluate the activity against Streptococcus mutans, Streptococcus sobrinus, Lactobacillus casei, and Actinomyces viscosus. Twenty-two plants showed appreciable activity. The extracts showing the strongest antibacterial power were those from Cotinus coggygria Scop., Equisetum hyemale L., Helichrysum litoreum Guss, Juniperus communis L., and Phyllitis scolopendrium (L. Newman subsp. scolopendrium. The potential cytotoxic effect of these extracts was assessed. On the basis of these observations, a mouth-rinse containing the ethanolic extract of H. litoreum has been tested in vivo, resulting in reduction of the salivary concentration of S. mutans.

  12. Screening and Scoring of Antimicrobial and Biological Activities of Italian Vulnerary Plants against Major Oral Pathogenic Bacteria

    Science.gov (United States)

    Ferrazzano, Gianmaria F.; Roberto, Lia; Catania, Maria Rosaria; Chiaviello, Angela; De Natale, Antonino; Roscetto, Emanuela; Pinto, Gabriele; Pollio, Antonino; Ingenito, Aniello; Palumbo, Giuseppe

    2013-01-01

    This study aims to evaluate the activity of Italian vulnerary plants against the most important oral pathogenic bacteria. This estimate was accomplished through a fivefold process: (a) a review of ethnobotanical and microbiological data concerning the Italian vulnerary plants; (b) the development of a scoring system to rank the plants; (c) the comparative assessment of microbiological properties; (d) the assessment of potential cytotoxic effects on keratinocyte-like cells and gingival fibroblasts in culture by XTT cell viability assay; (e) clinical evaluation of the most suitable plant extract as antibacterial agent in a home-made mouthwash. The study assays hexane (H), ethanol (E), and water (W) extracts from 72 plants. The agar diffusion method was used to evaluate the activity against Streptococcus mutans, Streptococcus sobrinus, Lactobacillus casei, and Actinomyces viscosus. Twenty-two plants showed appreciable activity. The extracts showing the strongest antibacterial power were those from Cotinus coggygria Scop., Equisetum hyemale L., Helichrysum litoreum Guss, Juniperus communis L., and Phyllitis scolopendrium (L.) Newman subsp. scolopendrium. The potential cytotoxic effect of these extracts was assessed. On the basis of these observations, a mouth-rinse containing the ethanolic extract of H. litoreum has been tested in vivo, resulting in reduction of the salivary concentration of S. mutans. PMID:24302963

  13. Augmentative biological control in the Mexican national fruit fly campaign

    Energy Technology Data Exchange (ETDEWEB)

    Montoya, P [Campana Nacional Moscas de la Fruta, DGSV-SAGARPA (Mexico); Cancino, J; Gutierrez, J M; Santiago, G [Campana Nacional Moscas de la Fruta, DGSV-SAGARPA (Mexico)

    2005-07-01

    Full text: Tephritid fruit flies are some of the most economically important species of insects worldwide. In Mexico, the native Anastrepha ludens, A. obliqua, A. serpentina and A. striata, are among the most important problems because of the great number of commercial fruits they attack. In an attempt to solve the Anastrepha fruit flies problems, the Mexican Government created the National Campaign against Fruit Flies in 1992. Using an area-wide approach and an integrated pest management framework, that included the use of environment-friendly strategies to suppress/eradicate fruit flies, the Mexican Campaign has integrated different technologies such as the application of specific toxic bait, the use of the Sterile Insect Technique (SIT), and the release of the endoparasitoid Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), which attacks preferably third instar larvae of fruit flies. Since 1995, the Moscafrut mass-rearing facility has the capacity to produce an average of 50 millions of parasitised pupae per week, with 65-70% of parasitoid emergence using irradiated A. ludens larvae as host. The mass-rearing procedures of D. longicaudata have been fully described by Cancino. Parasitised pupae are sent via commercial flights to several states of the country (i.e. Michoacan, Sinaloa, Nayarit, Tamaulipas), according to a yearly national plan. This plan derives from industry requirements and/or availability of biological material. In the target zones, parasitoids are released in specific periods and specific areas where the environmental, biological and social conditions are considered as adequate. Packing and release procedures of parasitoids follow those that Montoya et al used. The releases are focused on Anastrepha spp. host trees located in marginal areas (i.e backyard orchards), with the objective to prevent the migration of fruit fly populations into commercial orchards. The impact of parasitoids on fruit fly populations is evaluated through

  14. Patterns and controls on nitrogen cycling of biological soil crusts

    Science.gov (United States)

    Barger, Nichole N.; Zaady, Eli; Weber, Bettina; Garcia-Pichel, Ferran; Belnap, Jayne

    2016-01-01

    Biocrusts play a significant role in the nitrogen [N ] cycle within arid and semi-arid ecosystems, as they contribute major N inputs via biological fixation and dust capture, harbor internal N transformation processes, and direct N losses via N dissolved, gaseous and erosional loss processes (Fig. 1). Because soil N availability in arid and semi-arid ecosystems is generally low and may limit net primary production (NPP), especially during periods when adequate water is available, understanding the mechanisms and controls of N input and loss pathways in biocrusts is critically important to our broader understanding of N cycling in dryland environments. In particular, N cycling by biocrusts likely regulates short-term soil N availability to support vascular plant growth, as well as long-term N accumulation and maintenance of soil fertility. In this chapter, we review the influence of biocrust nutrient input, internal cycling, and loss pathways across a range of biomes. We examine linkages between N fixation capabilities of biocrust organisms and spatio-temporal patterns of soil N availability that may influence the longer-term productivity of dryland ecosystems. Lastly, biocrust influence on N loss pathways such as N gas loss, leakage of N compounds from biocrusts, and transfer in wind and water erosion are important to understand the maintenance of dryland soil fertility over longer time scales. Although great strides have been made in understanding the influence of biocrusts on ecosystem N cycling, there are important knowledge gaps in our understanding of the influence of biocrusts on ecosystem N cycling that should be the focus of future studies. Because work on the interaction of N cycling and biocrusts was reviewed in Belnap and Lange (2003), this chapter will focus primarily on research findings that have emerged over the last 15 years (2000-2015).

  15. Molecular mechanisms of nematode-nematophagous microbe interactions: basis for biological control of plant-parasitic nematodes.

    Science.gov (United States)

    Li, Juan; Zou, Chenggang; Xu, Jianping; Ji, Xinglai; Niu, Xuemei; Yang, Jinkui; Huang, Xiaowei; Zhang, Ke-Qin

    2015-01-01

    Plant-parasitic nematodes cause significant damage to a broad range of vegetables and agricultural crops throughout the world. As the natural enemies of nematodes, nematophagous microorganisms offer a promising approach to control the nematode pests. Some of these microorganisms produce traps to capture and kill the worms from the outside. Others act as internal parasites to produce toxins and virulence factors to kill the nematodes from within. Understanding the molecular basis of microbe-nematode interactions provides crucial insights for developing effective biological control agents against plant-parasitic nematodes. Here, we review recent advances in our understanding of the interactions between nematodes and nematophagous microorganisms, with a focus on the molecular mechanisms by which nematophagous microorganisms infect nematodes and on the nematode defense against pathogenic attacks. We conclude by discussing several key areas for future research and development, including potential approaches to apply our recent understandings to develop effective biocontrol strategies.

  16. Global Insight into Lysine Acetylation Events and Their Links to Biological Aspects in Beauveria bassiana, a Fungal Insect Pathogen

    Science.gov (United States)

    Wang, Zhi-Kang; Cai, Qing; Liu, Jin; Ying, Sheng-Hua; Feng, Ming-Guang

    2017-01-01

    Lysine acetylation (Kac) events in filamentous fungi are poorly explored. Here we show a lysine acetylome generated by LC-MS/MS analysis of immunoaffinity-based Kac peptides from normal hyphal cells of Beauveria bassiana, a fungal entomopathogen. The acetylome comprised 283 Kac proteins and 464 Kac sites. These proteins were enriched to eight molecular functions, 20 cellular components, 27 biological processes, 20 KEGG pathways and 12 subcellular localizations. All Kac sites were characterized as six Kac motifs, including a novel motif (KacW) for 26 Kac sites of 17 unknown proteins. Many Kac sites were predicted to be multifunctional, largely expanding the fungal Kac events. Biological importance of identified Kac sites was confirmed through functional analysis of Kac sites on Pmt1 and Pmt4, two O-mannosyltransferases. Singular site mutations (K88R and K482R) of Pmt1 resulted in impaired conidiation, attenuated virulence and decreased tolerance to oxidation and cell wall perturbation. These defects were close to or more severe than those caused by the deletion of pmt1. The Pmt4 K360R mutation facilitated colony growth under normal and stressful conditions and enhanced the fungal virulence. Our findings provide the first insight into the Kac events of B. bassiana and their links to the fungal potential against insect pests. PMID:28295016

  17. Biological control of Aspergillus flavus growth and subsequent ...

    African Journals Online (AJOL)

    ONOS

    2010-07-05

    Jul 5, 2010 ... 1School of Biological Sciences, Universiti Sains Malaysia, 11800 USM, Penang, Malaysia,. 2Department of Botany, Osmania University, Hyderabad, India. ... the biocontrol agents tested, culture filtrate of Rhodococcus ...

  18. Determinant Variables, Enteric Pathogen Burden, Gut Function and Immune-related Inflammatory Biomarkers Associated With Childhood Malnutrition: A Prospective Case-Control Study in Northeastern Brazil.

    Science.gov (United States)

    Lima, Aldo A M; Leite, Álvaro M; Di Moura, Alessandra; Lima, Noélia L; Soares, Alberto M; Abreu, Cláudia B; Filho, José Quirino; Mota, Rosa M S; Lima, Ila F N; Havt, Alexandre; Medeiros, Pedro H Q S; Prata, Mara M G; Guedes, Marjorie M; Cavalcante, Paloma A; Veras, Herlice N; Santos, Ana K S; Moore, Sean R; Pinkerton, Relana C; Houpt, Eric R; Guerrant, Richard L

    2017-12-01

    Malnutrition results in serious consequences for growth and cognitive development in children. We studied select child and maternal biologic factors, socioeconomic factors, enteric pathogenic burden and gut function biomarkers in 402 children 6-24 months of age in Northeastern Brazil. In this prospective case-control study, not being fed colostrum [odds ratio (OR): 3.29, 95% confidence interval (CI): 1.73-6.26], maternal age ≥18 years (OR: 1.88, 95% CI: 1.10-3.22) and no electric fan (OR: 2.46, 95% CI: 1.22-4.96) or bicycle (OR: 1.80, 95% CI: 1.10-2.95) in the household were positively associated, and higher birth weight (OR: 0.27, 95% CI: 0.19-0.38), larger head circumference (OR: 0.74, 95% CI: 0.66-0.82) and shortness of breath in the last 2 weeks (OR: 0.49, 95% CI: 0.27-0.90) were negatively associated with malnutrition. Subclinical enteric pathogen infections were common, and enteroaggregative Escherichia coli infections were more prevalent in malnourished children (P = 0.045). Biomarkers such as the lactulose-mannitol test, myeloperoxidase, neopterin and calprotectin were highly elevated in both malnourished and nourished children. Nourished children had a better systemic immune response than the malnourished children, as detected by elevated serum amyloid A-1 and soluble cluster of differentiation protein 14 biomarkers (P malnutrition in children. There was a substantial subclinical enteric pathogen burden, particularly with enteroaggregative E. coli, in malnourished children.

  19. WILD PIGS: BIOLOGY, DAMAGE, CONTROL TECHINQUES AND MANAGEMENT

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, John; Brisbin, I. Lehr

    2009-12-31

    about anything; and, they can live just about anywhere. On top of that, wild pigs are both very difficult to control and, with the possible exception of island ecosystems, almost impossible to eradicate (Dickson et al. 2001, Sweeney et al. 2003). The solution to the wild pig problem has not been readily apparent. The ultimate answer as to how to control these animals has not been found to date. In many ways, wild pigs are America's most successful large invasive species. All of which means that wild pigs are a veritable nightmare for land and resource managers trying to keep the numbers of these animals and the damage that they do under control. Since the more that one knows about an invasive species, the easier it is to deal with and hopefully control. For wild pigs then, it is better to 'know thy enemy' than to not, especially if one expects to be able to successfully control them. In an effort to better 'know thy enemy,' a two-day symposium was held in Augusta, Georgia, on April 21-22, 2004. This symposium was organized and sponsored by U.S.D.A. Forest Service-Savannah River (USFS-SR), U. S. Department of Energy-Savannah River Operations Office (DOE-SR), the Westinghouse Savannah River Company (WSRC), the South Carolina Chapter of the Soil & Water Conservation Society, and the Savannah River Ecology Laboratory (SREL). The goal of this symposium was to assemble researchers and land managers to first address various aspects of the biology and damage of wild pigs, and then review the control techniques and management of this invasive species. The result would then be a collected synopsis of what is known about wild pigs in the United States. Although the focus of the symposium was primarily directed toward federal agencies, presenters also included professionals from academic institutions, and private-sector control contractors and land managers. Most of the organizations associated with implementing this symposium were affiliated with the

  20. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  1. Molecular markers for improving control of soil-borne pathogen Fusarium oxysporum in sugar beet

    Science.gov (United States)

    Fusarium oxysporum f. sp. betae (FOB) is an important pathogen of sugar beet worldwide causing leaf yellowing and vascular discoloration. The use of tolerant varieties is one of the most effective methods for managing this disease. In this study, a large germplasm collection,comprised of 29 sugar be...

  2. Pathogen control at the intestinal mucosa - H2O2 to the rescue

    NARCIS (Netherlands)

    Knaus, U.G.; Hertzberger, R.; Pircalabioru, G.G.; Yousefi, S.P.M.; Branco dos Santos, F.

    2017-01-01

    Intestinal infections are a global challenge, connected to malnutrition and inadequate hygiene in developing countries, and to expanding antibiotic resistance in developed countries. In general, a healthy host is capable of fighting off gut pathogens or at least to recover from infections quickly.

  3. Survival of pathogenic enterohemorrhagic Escherichia coli (EHEC) and control with calcium oxide in frozen meat products.

    Science.gov (United States)

    Ro, Eun Young; Ko, Young Mi; Yoon, Ki Sun

    2015-08-01

    This study investigated both the level of microbial contamination and the presence of enterohemorrhagic Escherichia coli (EHEC) in frozen meat products, followed by the evaluation of its survival over 180 days under frozen temperature. We also examined the effect of calcium oxide on the populations of EHEC, E. coli O157:H7 and EPEC under both 10 °C and -18 °C storage conditions. Afterward, the morphological changes occurring in EHEC cells in response to freezer storage temperature and calcium oxide (CaO) treatments were examined using transmission electron microscopy. Among the frozen meat products tested, the highest contamination levels of total aerobic counts, coliforms and E. coli were observed in pork cutlets. Examination showed that 20% of the frozen meat products contained virulence genes, including verotoxin (VT) 1 and 2. Over 180 days of frozen storage and after 3 freeze-thaw cycles, the population of EHEC did not change regardless of the type of products or initial inoculated concentration, indicating the strong survival ability of EHEC. Subsequent testing revealed that the growth of three pathogenic E. coli strains was completely inhibited in meat patties prepared with 1% CaO, stored at 10 °C. However, the addition of 2% CaO was necessary to control the survival of EHEC, E. coli O157:H7 and EPEC in meat patties stored at -18 °C. CaO reduced the population of E. coli O157:H7 more effectively than the other EHEC and EPEC strains at both 10 °C and -18 °C. Transmission electron microscopy analysis revealed that exposed EHEC cells were resistant to the freezer storage temperature, although some cells incurred injury and death after several freeze-thaw cycles. Most of the cells exposed to CaO were found to have died or lost their cellular integrity and membranes, indicating that CaO has the potential to be used as a powerful antimicrobial agent for manufacturing frozen meat products. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Use of Gamma Rays to Control of Internal Parasites and Pathogenic Bacteria in Silver side Fish (Bissaria)

    International Nuclear Information System (INIS)

    Shawki, H.A.; El-Hanafy, A.E.A.; Shagar, G.I.A.

    2014-01-01

    The usefulness of Gamma irradiation to control of internal parasites and pathogenic bacteria found in silver side fish (Atherina) (Bissaria) was investigated. The detected parasites and the prevalence were adult Trematode (37.5%); Cestodes (95%) and Nematode (22.5%) for control silver side fish. The counts of detected microorganisms, (Total bacterial count; Psychrophilic bacteria; Mold and yeast; E.coli and Staphyloccous aureus ) were 4.89 ; 2.30; 2.32; 2.31 and 2.04 log 10 cfu/g for control silver side fish, respectively. Applied irradiation doses reduce the infected rate by Trematode, Cestodes and Nematode, furthermore, gamma irradiation with different doses (0.5, 1, 2, 4 and 5 kGy) reduce the microorganisms count of silver side fish (Bissaria) samples and the rate of decrement increase with the dose increase. Total bacterial count was not detected by using dose 5 kGy while Psychrophilic bacteria were completely eliminated using dose 1 kGy. On the other hand mold and yeast; E.coli and Staph aureus in silver side fish samples were not detected after subjected to gamma irradiation with dose 4 kGy. The results suggest that the applied doses completely elimination different internal parasites and pathogenic bacteria found in silver side fish. Thus, it could be conclude that the irradiation dose of 4 kGy can be effectively applied to ensure the safety of internal parasites and pathogenic bacteria found in silver side fish (Atherina) (Bissaria) with regards to these harmful parasites and pathogenic bacteria

  5. Roles of Forkhead-box Transcription Factors in Controlling Development, Pathogenicity, and Stress Response in Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Jaejin Park

    2014-06-01

    Full Text Available Although multiple transcription factors (TFs have been characterized via mutagenesis to understand their roles in controlling pathogenicity and infection-related development in Magnaporthe oryzae, the causal agent of rice blast, if and how forkhead-box (FOX TFs contribute to these processes remain to be characterized. Four putative FOX TF genes were identified in the genome of M. oryzae, and phylogenetic analysis suggested that two of them (MoFKH1 and MoHCM1 correspond to Ascomycota-specific members of the FOX TF family while the others (MoFOX1 and MoFOX2 are Pezizomycotina-specific members. Deletion of MoFKH1 (ΔMofkh1 resulted in reduced mycelial growth and conidial germination, abnormal septation and stress response, and reduced virulence. Similarly, ΔMohcm1 exhibited reduced mycelial growth and conidial germination. Conidia of ΔMofkh1 and ΔMohcm1 were more sensitive to one or both of the cell cycle inhibitors hydroxyurea and benomyl, suggesting their role in cell cycle control. On the other hand, loss of MoFOX1 (ΔMofox1 did not show any noticeable changes in development, pathogenicity, and stress response. Deletion of MoFOX2 was not successful even after repeated attempts. Taken together, these results suggested that MoFKH1 and Mo-HCM1 are important in fungal development and that MoFKH1 is further implicated in pathogenicity and stress response in M. oryzae.

  6. The role of ionizing radiation in biological control of agricultural pests

    International Nuclear Information System (INIS)

    Mansour, M.

    2011-01-01

    Although the commercial biological control industry is growing, it still represents only a small portion of the international market of pest control sales (about 3%). This low ratio is due to several factors including high cost of production of biological control agents and technical and regulatory difficulties that complicate the shipping procedures and create trade barriers. This article summarizes the role of ionizing radiation in supporting the use of biological control agents in insect pest control and concentrates on its role in the production, transport, distribution, and release of parasites and predators and the advantages that ionizing radiation can offer, in comparison with traditional techniques. (author)

  7. Biological Role of Paenilarvins, Iturin-Like Lipopeptide Secondary Metabolites Produced by the Honey Bee Pathogen Paenibacillus larvae.

    Science.gov (United States)

    Hertlein, Gillian; Seiffert, Marlene; Gensel, Sebastian; Garcia-Gonzalez, Eva; Ebeling, Julia; Skobalj, Ranko; Kuthning, Anja; Süssmuth, Roderich D; Genersch, Elke

    2016-01-01

    The Gram-positive bacterium Paenibacillus larvae (P. larvae) is the causative agent of a deadly honey bee brood disease called American Foulbrood (AFB). AFB is a notifiable epizootic in most countries and, hence, P. larvae is of considerable relevance for veterinarians and apiculturists alike. Over the last decade, much progress has been made in the understanding of the (patho)biology of P. larvae. Recently, several non-ribosomally produced peptides (NRP) and peptide/polyketide (NRP/PK) hybrids produced by P. larvae were identified. Among these NRPs were iturin-like lipopeptides, the paenilarvins A-C. Iturins are known to exhibit strong anti-fungal activity; for some iturins, cytotoxic activity towards mammalian erythrocytes and human cancer cell lines are described. We here present our results on the analysis of the natural function of the paenilarvins during pathogenesis of P. larvae infections. We demonstrated production of paenilarvins in infected larvae. However, we could neither demonstrate cytotoxicity of paenilarvins towards cultured insect cells nor towards larvae in feeding assays. Accordingly, exposure bioassays performed with larvae infected by wild-type P. larvae and a knockout mutant of P. larvae lacking production of paenilarvins did not substantiate a role for the paenilarvins as virulence factor. Further experiments are necessary to analyze the relevance of the paenilarvins' anti-fungal activity for P. larvae infections in the presence of fungal competitors in the larval midgut or cadaver.

  8. RNA-seq in kinetoplastids: A powerful tool for the understanding of the biology and host-pathogen interactions.

    Science.gov (United States)

    Patino, Luz Helena; Ramírez, Juan David

    2017-04-01

    The kinetoplastids include a large number of parasites responsible for serious diseases in humans and animals (Leishmania and Trypanosoma brucei) considered endemic in several regions of the world. These parasites are characterized by digenetic life cycles that undergo morphological and genetic changes that allow them to adapt to different microenvironments on their vertebrates and invertebrates hosts. Recent advances in ´omics´ technology, specifically transcriptomics have allowed to reveal aspects associated with such molecular changes. So far, different techniques have been used to evaluate the gene expression profile during the various stages of the life cycle of these parasites and during the host-parasite interactions. However, some of them have serious drawbacks that limit the precise study and full understanding of their transcriptomes. Therefore, recently has been implemented the latest technology (RNA-seq), which overcomes the drawbacks of traditional methods. In this review, studies that so far have used RNA-seq are presented and allowed to expand our knowledge regarding the biology of these parasites and their interactions with their hosts. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Radiochemical and biological control of metaiodobenzyl-guanidine (MIBG) labeled with 131I

    International Nuclear Information System (INIS)

    Barboza, M.R.F.F. de; Muramoto, E.; Colturato, M.T.; Silva Valente Goncalves, R. da; Pereira, N.P.S. de; Almeida, M.A.T.M. de; Silva, C.P.G. da.

    1988-07-01

    This study shows the standardization of the radiochemical control of MIBG - 131 I in eletrophoretic system and also the biological control in Wistar rat for a period of time, not longer than 60 minutes after tracer administration. (author) [pt

  10. Biological control of fusarium wilt of tomato by antagonist fungi and ...

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... Key words: Biological control, fusarium wilt, tomato, antagonist fungi, cyanobacteria. INTRODUCTION ... severely affected by wilt disease caused by F. oxysporum f. sp. ..... Changing options for the control of deciduous fruit.

  11. Biology, etiology, and control of virus diseases of banana and plantain.

    Science.gov (United States)

    Kumar, P Lava; Selvarajan, Ramasamy; Iskra-Caruana, Marie-Line; Chabannes, Matthieu; Hanna, Rachid

    2015-01-01

    Banana and plantain (Musa spp.), produced in 10.3 million ha in the tropics, are among the world's top 10 food crops. They are vegetatively propagated using suckers or tissue culture plants and grown almost as perennial plantations. These are prone to the accumulation of pests and pathogens, especially viruses which contribute to yield reduction and are also barriers to the international exchange of germplasm. The most economically important viruses of banana and plantain are Banana bunchy top virus (BBTV), a complex of banana streak viruses (BSVs) and Banana bract mosaic virus (BBrMV). BBTV is known to cause the most serious economic losses in the "Old World," contributing to a yield reduction of up to 100% and responsible for a dramatic reduction in cropping area. The BSVs exist as episomal and endogenous forms are known to be worldwide in distribution. In India and the Philippines, BBrMV is known to be economically important but recently the virus was discovered in Colombia and Costa Rica, thus signaling its spread into the "New World." Banana and plantain are also known to be susceptible to five other viruses of minor significance, such as Abaca mosaic virus, Abaca bunchy top virus, Banana mild mosaic virus, Banana virus X, and Cucumber mosaic virus. Studies over the past 100 years have contributed to important knowledge on disease biology, distribution, and spread. Research during the last 25 years have led to a better understanding of the virus-vector-host interactions, virus diversity, disease etiology, and epidemiology. In addition, new diagnostic tools were developed which were used for surveillance and the certification of planting material. Due to a lack of durable host resistance in the Musa spp., phytosanitary measures and the use of virus-free planting material are the major methods of virus control. The state of knowledge on BBTV, BBrMV, and BSVs, and other minor viruses, disease spread, and control are summarized in this review. © 2015 Elsevier Inc

  12. The status of biological control and recommendations for improving uptake for the future

    NARCIS (Netherlands)

    Barratt, B.I.P.; Moran, V.C.; Bigler, F.; Lenteren, van J.C.

    2018-01-01

    Classical and augmentative biological control of insect pests and weeds has enjoyed a long history of successes. However, biocontrol practices have not been as universally accepted or optimally utilised as they could be. An International Organisation for Biological Control (IOBC) initiative brought

  13. 21 CFR 310.4 - Biologics; products subject to license control.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Biologics; products subject to license control... to license control. (a) If a drug has an approved license under section 351 of the Public Health.... (b) To obtain marketing approval for radioactive biological products for human use, as defined in...

  14. Managing conflict over biological control: the case of strawberry guava in Hawaii

    Science.gov (United States)

    Tracy Johnson

    2016-01-01

    Biological control researchers commonly avoid targets with potential for high conflict, but for certain highly damaging invaders with no viable management alternatives, it may be necessary to consider biological control even when it is likely to generate conflict. Discussed here is a case study, strawberry guava (Psidium cattleianum Sabine...

  15. Electrokinetically-controlled RNA-DNA hybridization assay for foodborne pathogens

    International Nuclear Information System (INIS)

    Weng, X.; Jiang, H.; Li, D.

    2012-01-01

    We have developed a microfluidic chip for use in an RNA-DNA hybridization assay for foodborne pathogens. Automatic sequential reagent dispensing and washing was realized with a programmable DC voltage sequencer. Signal detection was achieved with a miniaturized optical detection module. Salmonella and Listeria monocytogenes bacteria in different concentrations were quantitatively determined by this RNA-DNA hybridization assay in the microfluidic chip. The detection limit for the Salmonella and Listeria monocytogenes bacteria is 10 3 to 10 4 CFU mL -1 . The method excels by a significant reduction in the consumption of sample and reagent, and a short assay time. This automatic-operating microfluidic RNA-DNA hybridization assay is promising for on-site pathogen detection. (author)

  16. Sigma E regulators control hemolytic activity and virulence in a shrimp pathogenic Vibrio harveyi.

    Directory of Open Access Journals (Sweden)

    Pimonsri Rattanama

    Full Text Available Members of the genus Vibrio are important marine and aquaculture pathogens. Hemolytic activity has been identified as a virulence factor in many pathogenic vibrios including V. cholerae, V. parahaemolyticus, V. alginolyticus, V. harveyi and V. vulnificus. We have used transposon mutagenesis to identify genes involved in the hemolytic activity of shrimp-pathogenic V. harveyi strain PSU3316. Out of 1,764 mutants screened, five mutants showed reduced hemolytic activity on sheep blood agar and exhibited virulence attenuation in shrimp (Litopenaeus vannamei. Mutants were identified by comparing transposon junction sequences to a draft of assembly of the PSU3316 genome. Surprisingly none of the disrupted open reading frames or gene neighborhoods contained genes annotated as hemolysins. The gene encoding RseB, a negative regulator of the sigma factor (σ(E, was interrupted in 2 out of 5 transposon mutants, in addition, the transcription factor CytR, a threonine synthetase, and an efflux-associated cytoplasmic protein were also identified. Knockout mutations introduced into the rpoE operon at the rseB gene exhibited low hemolytic activity in sheep blood agar, and were 3-to 7-fold attenuated for colonization in shrimp. Comparison of whole cell extracted proteins in the rseB mutant (PSU4030 to the wild-type by 2-D gel electrophoresis revealed 6 differentially expressed proteins, including two down-regulated porins (OmpC-like and OmpN and an upregulated protease (DegQ which have been associated with σ(E in other organisms. Our study is the first report linking hemolytic activity to the σ(E regulators in pathogenic Vibrio species and suggests expression of this virulence-linked phenotype is governed by multiple regulatory pathways within the V. harveyi.

  17. Control of foodborne pathogens on fresh-cut fruit by a novel strain of Pseudomonas graminis.

    Science.gov (United States)

    Alegre, Isabel; Viñas, Inmaculada; Usall, Josep; Teixidó, Neus; Figge, Marian J; Abadias, Maribel

    2013-06-01

    The consumption of fresh-cut fruit has substantially risen over the last few years, leading to an increase in the number of outbreaks associated with fruit. Moreover, consumers are currently demanding wholesome, fresh-like, safe foods without added chemicals. As a response, the aim of this study was to determine if the naturally occurring microorganisms on fruit are "competitive with" or "antagonistic to" potentially encountered pathogens. Of the 97 and 107 isolates tested by co-inoculation with Escherichia coli O157:H7, Salmonella and Listeria innocua on fresh-cut apple and peach, respectively, and stored at 20 °C, seven showed a strong antagonistic capacity (more than 1-log unit reduction). One of the isolates, CPA-7, achieved the best reduction values (from 2.8 to 5.9-log units) and was the only isolate able to inhibit E. coli O157:H7 at refrigeration temperatures on both fruits. Therefore, CPA-7 was selected for further assays. Dose-response assays showed that CPA-7 should be present in at least the same amount as the pathogen to adequately reduce the numbers of the pathogen. From the results obtained in in vitro assays, competition seemed to be CPA-7's mode of action against E. coli O157:H7. The CPA-7 strain was identified as Pseudomonas graminis. Thus, the results support the potential use of CPA-7 as a bioprotective agent against foodborne pathogens in minimally processed fruit. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. The role of bioactive substances in controlling foodborne pathogens derived from Metasequoia glyptostroboides Miki ex Hu.

    Science.gov (United States)

    Bajpai, Vivek K; Na, Minkyun; Kang, Sun Chul

    2010-07-01

    In an attempt to isolate bioactive substances, ethyl acetate cone extract of Metasequoia glyptostroboides was subjected to a column chromatographic analysis that resulted in isolation of an abietane type diterpenoid, taxoquinone. Its structure was elucidated by spectroscopic means. In further, taxoquinone showed potential antibacterial effect as diameters of zones of inhibition against foodborne pathogenic bacteria such as Listeria monocytogenes ATCC 19166, Salmonella typhimurium KCTC 2515, Salmonella enteritidis KCTC 2021, Escherichia coli ATCC 8739, E. coli O157:H7 ATCC 43888, Enterobacter aerogenes KCTC2190, Staphylococcus aureus ATCC 6538 and S. aureus KCTC 1916, which were found in the range of 10.6-15.8mm. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values of taxoquinone against the employed bacterial pathogens were found in the range of 62.5-250 and 125-500 microg/ml. Also the compound had strong antibacterial effect on the viable counts of the tested bacteria. Further, scanning electron microscopic study demonstrated potential detrimental effect of taxoquinone on the morphology of E. coli ATCC 8739. These findings indicate that bioactive compound taxoquinone present in M. glyptostroboides could be used as a promising antibacterial agent in food industry to inhibit the growth of certain important foodborne pathogens. 2010 Elsevier Ltd. All rights reserved.

  19. Lvr, a Signaling System That Controls Global Gene Regulation and Virulence in Pathogenic Leptospira

    Science.gov (United States)

    Adhikarla, Haritha; Wunder, Elsio A.; Mechaly, Ariel E.; Mehta, Sameet; Wang, Zheng; Santos, Luciane; Bisht, Vimla; Diggle, Peter; Murray, Gerald; Adler, Ben; Lopez, Francesc; Townsend, Jeffrey P.; Groisman, Eduardo; Picardeau, Mathieu; Buschiazzo, Alejandro; Ko, Albert I.

    2018-01-01

    Leptospirosis is an emerging zoonotic disease with more than 1 million cases annually. Currently there is lack of evidence for signaling pathways involved during the infection process of Leptospira. In our comprehensive genomic analysis of 20 Leptospira spp. we identified seven pathogen-specific Two-Component System (TCS) proteins. Disruption of two these TCS genes in pathogenic Leptospira strain resulted in loss-of-virulence in a hamster model of leptospirosis. Corresponding genes lvrA and lvrB (leptospira virulence regulator) are juxtaposed in an operon and are predicted to encode a hybrid histidine kinase and a hybrid response regulator, respectively. Transcriptome analysis of lvr mutant strains with disruption of one (lvrB) or both genes (lvrA/B) revealed global transcriptional regulation of 850 differentially expressed genes. Phosphotransfer assays demonstrated that LvrA phosphorylates LvrB and predicted further signaling downstream to one or more DNA-binding response regulators, suggesting that it is a branched pathway. Phylogenetic analyses indicated that lvrA and lvrB evolved independently within different ecological lineages in Leptospira via gene duplication. This study uncovers a novel-signaling pathway that regulates virulence in pathogenic Leptospira (Lvr), providing a framework to understand the molecular bases of regulation in this life-threatening bacterium. PMID:29600195

  20. Biological stability of drinking water : Controlling factors, methods, and challenges

    NARCIS (Netherlands)

    Prest, E.I.E.D.; Hammes, F.; Van Loosdrecht, M.C.M.; Vrouwenvelder, J.S.

    2016-01-01

    Biological stability of drinking water refers to the concept of providing consumers with drinking water of same microbial quality at the tap as produced at the water treatment facility. However, uncontrolled growth of bacteria can occur during distribution in water mains and premise plumbing, and

  1. Biological activities of Allium sativum and Zingiber officinale extracts on clinically important bacterial pathogens, their phytochemical and FT-IR spectroscopic analysis.

    Science.gov (United States)

    Awan, Uzma Azeem; Ali, Shaukat; Shahnawaz, Amna Mir; Shafique, Irsa; Zafar, Atiya; Khan, Muhammad Abdul Rauf; Ghous, Tahseen; Saleem, Azhar; Andleeb, Saiqa

    2017-05-01

    The spread of bacterial infectious diseases is a major public threat. Herbs and spices have offered an excellent, important and useful source of antimicrobial agents against many pathological infections. In the current study, the antimicrobial potency of fresh, naturally and commercial dried Allium sativum and Zingiber officinale extracts had been investigated against seven local clinical bacterial isolates such as Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, Staphylococcus aureus, Streptococcus pyogenes, Staphylococcus epidermidis, and Serratia marcesnces by the agar disc diffusion method. All tested pathogens except P. aeruginosa and E. coli were most susceptible to ethanolic and methanolic extracts of A. sativum. Similarly, chloroform and diethyl ether extracts of Z. officinale showed a greater zone of inhibition of tested pathogens except for P. aeruginosa and E. coli. We found that all extracts of A. sativum and Z. officinale have a strong antibacterial effect compared to recommended standard antibiotics through activity index. All results were evaluated statistically and a significant difference was recorded at Psativum and Z. officinale proposed the presence of various phytochemicals such as tannins, phenols, alkaloids, steroids and saponins. Retention factor of diverse phytochemicals provides a valuable clue regarding their polarity and the selection of solvents for separation of phytochemicals. Significant inhibition of S. aureus was also observed through TLC-Bioautography. FT-IR Spectrometry was also performed to characterize both natural and commercial extracts of A. sativum and Z. officinale to evaluate bioactive compounds. These findings provide new insights to use A. sativum and Z. officinale as potential plant sources for controlling pathogenic bacteria and potentially considered as cost-effective in the management of diseases and to the threat of drug resistance phenomenon.

  2. Toll-Like Receptors 2 and 4 Cooperate in the Control of the Emerging Pathogen Brucella microti.

    Science.gov (United States)

    Arias, Maykel A; Santiago, Llipsy; Costas-Ramon, Santiago; Jaime-Sánchez, Paula; Freudenberg, Marina; Jiménez De Bagüés, Maria P; Pardo, Julián

    2016-01-01

    Toll-like receptors (TLRs) recognize pathogen-derived molecules and play a critical role during the host innate and adaptive immune response. Brucella spp. are intracellular gram-negative bacteria including several virulent species, which cause a chronic zoonotic infection in a wide range of mammalian hosts known as brucellosis. A new Brucella species, Brucella microti , was recently isolated from wild rodents and found to be highly pathogenic in mice. Using this species-specific model, it was previously found that CD8 + T cells are required to control this infection. In order to find out the role of TLR-mediated responses in the control of this pathogen, the course of infection of B. microti was analyzed over 3 weeks in wild-type (WT) and TLR knock out (KO) mice including TLR2 -/- , TLR4 -/- , TLR9 -/- , TLR2×4 -/- and TLR2×4×9 -/- . WT and single TLR2, TLR4 and TLR9 KO mice similarly control infection in liver and spleen. In contrast, bacterial clearance was delayed in TLR2×4 -/- and TLR2×4×9 -/- mice at 7 and 14 days post-infection. This defect correlated with impaired maturation and pro-inflammatory cytokine production in B. microti -infected dendritic cells from TLR2×4 -/- and TLR2×4×9 -/- mice. Finally, it was found that Tc cells from TLR2×4 -/- and TLR2×4×9 -/- mice showed reduced ability to inhibit growth of B. microti in macrophages, suggesting the involvement of TLR2 and 4 in the generation of specific Tc cells. Our findings indicate that TLR2 and TLR4 are required to control B. microti infection in mice and that this effect could be related to its participation in the maturation of dendritic cells and the generation of specific CD8 + Tc cells.

  3. The control of H5 or H7 mildly pathogenic avian influenza: a role for inactivated vaccine.

    Science.gov (United States)

    Halvorson, David A

    2002-02-01

    Biosecurity is the first line of defence in the prevention and control of mildly pathogenic avian influenza (MPAI). Its use has been highly successful in keeping avian influenza (AI) out of commercial poultry worldwide. However, sometimes AI becomes introduced into poultry populations and, when that occurs, biosecurity again is the primary means of controlling the disease. There is agreement that routine serological monitoring, disease reporting, isolation or quarantine of affected flocks, application of strict measures to prevent the contamination of and movement of people and equipment, and changing flock schedules are necessities for controlling AI. There is disagreement as to the disposition of MPAI-infected flocks: some advocate their destruction and others advocate controlled marketing. Sometimes biosecurity is not enough to stop the spread of MPAI. In general, influenza virus requires a dense population of susceptible hosts to maintain itself. When there is a large population of susceptible poultry in an area, use of an inactivated AI vaccine can contribute to AI control by reducing the susceptibility of the population. Does use of inactivated vaccine assist, complicate or interfere with AI control and eradication? Yes, it assists MPAI control (which may reduce the risk of highly pathogenic AI (HPAI)) but, unless steps are taken to prevent it, vaccination may interfere with sero-epidemiology in the case of an HPAI outbreak. Does lack of vaccine assist, complicate or interfere with AI control and eradication? Yes, it assists in identification of sero-positive (convalescent) flocks in a HPAI eradication program, but it interferes with MPAI control (which in turn may increase the risk of emergence of HPAI).A number of hypothetical concerns have been raised about the use of inactivated AI vaccines. Infection of vaccinated flocks, serology complications and spreading of virus by vaccine crews are some of the hypothetical concerns. The discussion of these concerns

  4. Biological control of fruit-tree red spider mite

    NARCIS (Netherlands)

    Rabbinge, R.

    1976-01-01

    During the last decade, integrated pest control systems have been developed for several crops. One of the main fields of research in integrated control has been the control of orchard pests. Experience with modified spraying programmes in apple orchards, the increasing resistance of spider

  5. The biological control as a strategy to support nontraditional agricultural exports in Peru: An empirical analysis

    Directory of Open Access Journals (Sweden)

    Franklin Duarte Cueva

    2012-12-01

    Full Text Available The study is oriented to explore the general characteristics of agriculture, the biological control as a pest control mechanism and agro export industry. In this context, we try to promote the use of biological control as a strategy to support nontraditional exports related to products such as asparagus and fresh avocados grown in the La Libertad Department (Peru, through an agronomic and management approach. Biological control is the basis of integrated pest management (IPM and contributes to the conservation of agricultural ecosystems allowing to export companies reduce costs, fulfill international phytosanitary measures and supports the preservation of the environment and health. Thus, the Peruvian agro export companies could build a sustainable competitive advantage and seek a positioning as socially responsible firms. We analyze variables such as crop statistics, comparative costs between biological control and chemical control, main destination markets for asparagus and fresh avocados, international standards, among others.

  6. A host-specific biological control of grape crown gall by Agrobacterium vitis strain F2/5: its regulation and population dynamics.

    Science.gov (United States)

    Kaewnum, Supaporn; Zheng, Desen; Reid, Cheryl L; Johnson, Kameka L; Gee, Jodi C; Burr, Thomas J

    2013-05-01

    Nontumorigenic Agrobacterium vitis strain F2/5 is able to prevent crown gall caused by tumorigenic A. vitis on grape but not on other plant species such as tobacco. Mutations in a quorum-sensing transcription factor, aviR, and in caseinolytic protease (clp) component genes clpA and clpP1 resulted in reduced or loss of biological control. All mutants were complemented; however, restoration of biological control by complemented clpA and clpP1 mutants was dependent on the copy number of vector that was used as well as timing of application of the complemented mutants to grape wounds in relation to inoculation with pathogen. Mutations in other quorum-sensing and clp genes and in a gene associated with polyketide synthesis did not affect biological control. It was determined that, although F2/5 inhibits transformation by tumorigenic A. vitis strains on grape, it does not affect growth of the pathogen in wounded grape tissue over time.

  7. Enhancing biological control of basal stem rot disease (Ganoderma boninense) in oil palm plantations.

    Science.gov (United States)

    Susanto, A; Sudharto, P S; Purba, R Y

    2005-01-01

    Basal Stem Rot (BSR) disease caused by Ganoderma boninense is the most destructive disease in oil palm, especially in Indonesia and Malaysia. The available control measures for BSR disease such as cultural practices and mechanical and chemical treatment have not proved satisfactory due to the fact that Ganoderma has various resting stages such as melanised mycelium, basidiospores and pseudosclerotia. Alternative control measures to overcome the Ganoderma problem are focused on the use of biological control agents and planting resistant material. Present studies conducted at Indonesian Oil Palm Research Institute (IOPRI) are focused on enhancing the use of biological control agents for Ganoderma. These activities include screening biological agents from the oil palm rhizosphere in order to evaluate their effectiveness as biological agents in glasshouse and field trials, testing their antagonistic activities in large scale experiments and eradicating potential disease inoculum with biological agents. Several promising biological agents have been isolated, mainly Trichoderma harzianum, T. viride, Gliocladium viride, Pseudomonas fluorescens, and Bacillus sp. A glasshouse and field trial for Ganoderma control indicated that treatment with T. harzianum and G. viride was superior to Bacillus sp. A large scale trial showed that the disease incidence was lower in a field treated with biological agents than in untreated fields. In a short term programme, research activities at IOPRI are currently focusing on selecting fungi that can completely degrade plant material in order to eradicate inoculum. Digging holes around the palm bole and adding empty fruit bunches have been investigated as ways to stimulate biological agents.

  8. Evaluation of biological value and appraisal of polyphenols and glucosinolates from organic baby-leaf salads as antioxidants and antimicrobials against important human pathogenic bacteria.

    Science.gov (United States)

    Aires, Alfredo; Marques, Esperança; Carvalho, Rosa; Rosa, Eduardo A S; Saavedra, Maria J

    2013-04-19

    The present investigation has been carried out to investigate the biological role of four different types of baby-leaf salads and to study their potential as natural sources of antioxidants and antimicrobials against several isolates from important human pathogenic bacteria. Four single types of salads (green lettuce, red lettuce, rucola and watercress) and two mixtures [(1) red lettuce+green lettuce; (2) green lettuce + red lettuce + watercress + rucola] were assayed. The HPLC analysis revealed interesting levels of polyphenols and glucosinolates. The results showed a significant variation (p flavonoids); and cyanidin-3-glucoside (anthocyanins). Only three different glucosinolates were found: glucoraphanin; gluconasturtiin and 4-methoxy-glucobrassicin. A positive correlation was detected between polyphenol contents and antioxidant activity. Red lettuce and mixture 1 were the baby-leaf salads with the highest antioxidant potential. As for the antimicrobial activity, the results showed a selective effect of chemicals against Gram-positive and Gram-negative bacteria and Enterococcus faecalis and Staphylococcus aureus were the bacteria most affected by the phytochemicals. Based on the results achieved baby-leaf salads represent an important source of natural antioxidants and antimicrobial substances.

  9. Evaluation of Biological Value and Appraisal of Polyphenols and Glucosinolates from Organic Baby-Leaf Salads as Antioxidants and Antimicrobials against Important Human Pathogenic Bacteria

    Directory of Open Access Journals (Sweden)

    Maria J. Saavedra

    2013-04-01

    Full Text Available The present investigation has been carried out to investigate the biological role of four different types of baby-leaf salads and to study their potential as natural sources of antioxidants and antimicrobials against several isolates from important human pathogenic bacteria. Four single types of salads (green lettuce, red lettuce, rucola and watercress and two mixtures [(1 red lettuce+green lettuce; (2 green lettuce + red lettuce + watercress + rucola] were assayed. The HPLC analysis revealed interesting levels of polyphenols and glucosinolates. The results showed a significant variation (p < 0.05 of polyphenols and glucosinolates with plant material. Nine different types of polyphenols grouped in three major classes were found: gallic acid, chlorogenic acid, caffeic acid and dicaffeoyltartaric acid (phenolic acids; quercitin-3-O-rutinoside, quercitin-3-O-rhamnoside, luteolin-7-O-glucoside and isorhamnetin (flavonoids; and cyanidin-3-glucoside (anthocyanins. Only three different glucosinolates were found: glucoraphanin; gluconasturtiin and 4-methoxy-glucobrassicin. A positive correlation was detected between polyphenol contents and antioxidant activity. Red lettuce and mixture 1 were the baby-leaf salads with the highest antioxidant potential. As for the antimicrobial activity, the results showed a selective effect of chemicals against Gram-positive and Gram-negative bacteria and Enterococcus faecalis and Staphylococcus aureus were the bacteria most affected by the phytochemicals. Based on the results achieved baby-leaf salads represent an important source of natural antioxidants and antimicrobial substances.

  10. Insight into Alternative Approaches for Control of Avian Influenza in Poultry, with Emphasis on Highly Pathogenic H5N1

    Directory of Open Access Journals (Sweden)

    Hafez M. Hafez

    2012-11-01

    Full Text Available Highly pathogenic avian influenza virus (HPAIV of subtype H5N1 causes a devastating disease in poultry but when it accidentally infects humans it can cause death. Therefore, decrease the incidence of H5N1 in humans needs to focus on prevention and control of poultry infections. Conventional control strategies in poultry based on surveillance, stamping out, movement restriction and enforcement of biosecurity measures did not prevent the virus spreading, particularly in developing countries. Several challenges limit efficiency of the vaccines to prevent outbreaks of HPAIV H5N1 in endemic countries. Alternative and complementary approaches to reduce the current burden of H5N1 epidemics in poultry should be encouraged. The use of antiviral chemotherapy and natural compounds, avian-cytokines, RNA interference, genetic breeding and/or development of transgenic poultry warrant further evaluation as integrated intervention strategies for control of HPAIV H5N1 in poultry.

  11. Complete Host Range Testing on Common Reed with Potential Biological Control Agents and Investigation into Biological Control for Flowering Rush

    Science.gov (United States)

    2016-07-01

    CR-16-5 v Preface This report was prepared by Drs. Patrick Häfliger and Hariet Hinz, Centre for Agriculture and Bioscience International (CABI...through Cornell University, the Washington Department of Agriculture , the Washington Department of Ecology, the Washington Department of Natural...capacity during biological invasion in an aquatic plant Butomus umbellatus (Butomaceae). American Journal of Botany 92:495–502. Dieckmann, L. 1983

  12. [Bacillus thuringiensis: general aspects. An approach to its use in the biological control of lepidopteran insects behaving as agricultural pests].

    Science.gov (United States)

    Sauka, Diego H; Benintende, Graciela B

    2008-01-01

    Bacillus thuringiensis is the most widely applied biological pesticide used to control insects that affect agriculture and forestry and which transmit human and animal pathogens. During the past decades B. thuringiensis has been the subject of intensive research. These efforts have yielded considerable data about the relationships between the structure, mechanism of action, and genetics of their pesticidal crystal proteins. As a result, a coherent picture of these relationships has emerged. Other studies have focused on the ecological role of the B. thuringiensis crystal proteins and their performance in agricultural and other natural settings. With this knowledge as background and the help of biotechnological tools, researchers are now reporting promising results in the development of more useful toxins, recombinant bacteria, new formulations and transgenic plants that express pesticidal activity, in order to assure that these products are utilized with the best efficiency and benefit. This article is an attempt to integrate all these recent developments in the study of B. thuringiensis into a context of biological control of lepidopteran insect pest of agricultural importance.

  13. A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

    Science.gov (United States)

    Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

    2015-04-24

    disease that has become an important public health problem. Traditional serological methods are the gold standard for the detection of pathogenic strains of Leptospira. However, serological procedures are cumbersome, require more complex experimental techniques, and are based on a large number of international and domestic reference strains. Additionally, these experiments involve the immunization of animals with antigens from different serotypes to produce immune serum, and improper techniques may result in a rapid decrease in antibody titer, which would affect the final results. It is difficult to perform cumbersome detection procedures in a basic laboratory. Therefore, the use of conventional serological methods is limited, which significantly impacts daily leptospirosis epidemic surveillance, prevention, and control. Molecular biology methods, such as 16S rRNA and PCR-based methods, can be used to identify the pathogenic Leptospira. However, DNA extraction and gene sequencing methods are laborious and time consuming. Therefore, more rapid and reliable high-throughput identification methods are urgently needed for the clinical diagnosis of leptospirosis to improve epidemic control. Here, molecular fingerprinting technique was use to identify the pathogenicity. We constructed the reference spectra database and the super reference spectra of pathogenic and non-pathogenic Leptospira, which can rapidly identified Leptospira at the species level and the pathogenicity of these isolates can be simultaneously confirmed. Furthermore, the protein components of Leptospira pathogenicity were revealed. These findings thus provide a new way for Leptospira pathogenicity identification. Copyright © 2014. Published by Elsevier B.V.

  14. Anaerobic Digestion. Student Manual. Biological Treatment Process Control.

    Science.gov (United States)

    Carnegie, John W., Ed.

    This student manual contains the textual material for a four-lesson unit on anaerobic digestion control. Areas addressed include: (1) anaerobic sludge digestion (considering the nature of raw sludge, purposes of anaerobic digestion, the results of digestion, types of equipment, and other topics); (2) digester process control (considering feeding…

  15. First controlled vertical flight of a biologically inspired microrobot

    Energy Technology Data Exchange (ETDEWEB)

    Perez-Arancibia, Nestor O; Ma, Kevin Y; Greenberg, Jack D; Wood, Robert J [School of Engineering and Applied Sciences, Harvard University, Cambridge, MA 02138 (United States); Galloway, Kevin C, E-mail: nperez@seas.harvard.edu, E-mail: kevinma@seas.harvard.edu, E-mail: kevin.galloway@wyss.harvard.edu, E-mail: jdgreenb@seas.harvard.edu, E-mail: rjwood@eecs.harvard.edu [Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, MA 02115 (United States)

    2011-09-15

    In this paper, we present experimental results on altitude control of a flying microrobot. The problem is approached in two stages. In the first stage, system identification of two relevant subsystems composing the microrobot is performed, using a static flapping experimental setup. In the second stage, the information gathered through the static flapping experiments is employed to design the controller used in vertical flight. The design of the proposed controller relies on the idea of treating an exciting signal as a subsystem of the microrobot. The methods and results presented here are a key step toward achieving total autonomy of bio-inspired flying microrobots.

  16. First controlled vertical flight of a biologically inspired microrobot

    International Nuclear Information System (INIS)

    Perez-Arancibia, Nestor O; Ma, Kevin Y; Greenberg, Jack D; Wood, Robert J; Galloway, Kevin C

    2011-01-01

    In this paper, we present experimental results on altitude control of a flying microrobot. The problem is approached in two stages. In the first stage, system identification of two relevant subsystems composing the microrobot is performed, using a static flapping experimental setup. In the second stage, the information gathered through the static flapping experiments is employed to design the controller used in vertical flight. The design of the proposed controller relies on the idea of treating an exciting signal as a subsystem of the microrobot. The methods and results presented here are a key step toward achieving total autonomy of bio-inspired flying microrobots.

  17. Biological Control of Lettuce Drop and Host Plant Colonization by Rhizospheric and Endophytic Streptomycetes

    Science.gov (United States)

    Chen, Xiaoyulong; Pizzatti, Cristina; Bonaldi, Maria; Saracchi, Marco; Erlacher, Armin; Kunova, Andrea; Berg, Gabriele; Cortesi, Paolo

    2016-01-01

    Lettuce drop, caused by the soil borne pathogen Sclerotinia sclerotiorum, is one of the most common and serious diseases of lettuce worldwide. Increased concerns about the side effects of chemical pesticides have resulted in greater interest in developing biocontrol strategies against S. sclerotiorum. However, relatively little is known about the mechanisms of Streptomyces spp. as biological control agents against S. sclerotiorum on lettuce. Two Streptomyces isolates, S. exfoliatus FT05W and S. cyaneus ZEA17I, inhibit mycelial growth of Sclerotinia sclerotiorum by more than 75% in vitro. We evaluated their biocontrol activity against S. sclerotiorum in vivo, and compared them to Streptomyces lydicus WYEC 108, isolated from Actinovate®. When Streptomyces spp. (106 CFU/mL) were applied to S. sclerotiorum inoculated substrate in a growth chamber 1 week prior lettuce sowing, they significantly reduced the risk of lettuce drop disease, compared to the inoculated control. Interestingly, under field conditions, S. exfoliatus FT05W and S. cyaneus ZEA17I protected lettuce from drop by 40 and 10% respectively, whereas S. lydicus WYEC 108 did not show any protection. We further labeled S. exfoliatus FT05W and S. cyaneus ZEA17I with the enhanced GFP (EGFP) marker to investigate their rhizosphere competence and ability to colonize lettuce roots using confocal laser scanning microscopy (CLSM). The abundant colonization of young lettuce seedlings by both strains demonstrated Streptomyces' capability to interact with the host from early stages of seed germination and root development. Moreover, the two strains were detected also on 2-week-old roots, indicating their potential of long-term interactions with lettuce. Additionally, scanning electron microscopy (SEM) observations showed EGFP-S. exfoliatus FT05W endophytic colonization of lettuce root cortex tissues. Finally, we determined its viability and persistence in the rhizosphere and endorhiza up to 3 weeks by quantifying its

  18. Biological control of lettuce drop and host plant colonization by rhizospheric and endophytic streptomycetes

    Directory of Open Access Journals (Sweden)

    Xiaoyulong eChen

    2016-05-01

    Full Text Available Lettuce drop, caused by the soil borne pathogen Sclerotinia sclerotiorum, is one of the most common and serious diseases of lettuce worldwide. Increased concerns about the side effects of chemical pesticides have resulted in greater interest in developing biocontrol strategies against S. sclerotiorum. However, relatively little is known about the mechanisms of Streptomyces spp. as biological control agents against S. sclerotiorum on lettuce. Two Streptomyces isolates, S. exfoliatus FT05W and S. cyaneus ZEA17I, inhibit mycelial growth of Sclerotinia sclerotiorum by more than 75% in vitro. We evaluated their biocontrol activity against S. sclerotiorum in vivo, and compared them to Streptomyces lydicus WYEC 108, isolated from Actinovate®. When Streptomyces spp. (106 CFU/mL were applied to S. sclerotiorum inoculated substrate in a growth chamber one week prior lettuce sowing, they significantly reduced the risk of lettuce drop disease, compared to the inoculated control. Interestingly, under field conditions, S. exfoliatus FT05W and S. cyaneus ZEA17I protected lettuce from drop by 40% and 10% respectively, whereas S. lydicus WYEC 108 did not show any protection. We further labeled S. exfoliatus FT05W and S. cyaneus ZEA17I with the enhanced GFP (EGFP marker to investigate their rhizosphere competence and ability to colonize lettuce roots using confocal laser scanning microscopy (CLSM. The abundant colonization of young lettuce seedlings by both strains demonstrated Streptomyces’ capability to interact with the host from early stages of seed germination and root development. Moreover, the two strains were detected also on two-week-old roots, indicating their potential of long-term interactions with lettuce. Additionally, scanning electron microscopy (SEM observations showed EGFP-S. exfoliatus FT05W endophytic colonization of lettuce root cortex tissues. Finally, we determined its viability and persistence in the rhizosphere and endorhiza up to

  19. Biological control and management of the detoxication wastewater treatment technologies

    Directory of Open Access Journals (Sweden)

    Topalova Yana

    2007-01-01

    Full Text Available Detoxication technologies require the combination of theoretical and practical knowledge of xenobiotic biodegradation, wastewater treatment technologies, and management rules. The purpose of this complicated combination is to propose specialized strategies for detoxication, based on lab- and pilot-scale modeling. These strategies include preliminary created algorithms for preventing the risk of water pollution and sediments. The technologies and algorithms are essentially important outcome, applied in the textile, pharmaceutical, cosmetic, woodtreating, and oiltreating industries. In this paper four rehabilitation technologies for pretreatment of water contaminated by pentachlorophenol (PCP have been developed in the frame of the European and Bulgarian National projects. Emphasize is put on the biological systems and their potential of detoxication management. The light and transmission electron microscopy of the reconstructed activated sludges the microbial, kinetic and enzymological indicators are presented and approved as critical points in the biocontrol.

  20. SOME ASPECTS OF THE BIOLOGY AND CONTROL OF ...

    African Journals Online (AJOL)

    Key Words: Callosobruchus maculatus, developmental period, soya bean, Azadirachta indica, Citrus sinensis. ASPECTS DE LA BIOLOGIE ET DU CONTROLE DU CALLOSOBRUCHUS MACULATUS (F.) SUR LA CONSERVATION DES GRAINES DE SOJA DES VARIETES GLYCINE MAX (L.) MERR NOTE DE SYNTHESE

  1. Biological control of schistosome transmission in flowing water habitats.

    Science.gov (United States)

    Jobin, W R; Laracuente, A

    1979-09-01

    Marisa cornuarietis was evaluated in Puerto Rico for control of schistosome transmission in flowing water. A population of Biomphalaria glabrata and their schistosome infections disappeared after introduction of 20,000 M. cornuarietis to an endemic stream, while in nearby untreated streams the B. glabrata population remained stable and the schistosome prevalence increased. This method cost U.S. $0.10 per capita for over a year of protection, 5%-10% of the cost of chemical control.

  2. Targeting the Mitochondrial Respiratory Chain of Cryptococcus through Antifungal Chemosensitization: A Model for Control of Non-Fermentative Pathogens

    Directory of Open Access Journals (Sweden)

    Kathleen L. Chan

    2013-07-01

    Full Text Available Enhanced control of species of Cryptococcus, non-fermentative yeast pathogens, was achieved by chemosensitization through co-application of certain compounds with a conventional antimicrobial drug. The species of Cryptococcus tested showed higher sensitivity to mitochondrial respiratory chain (MRC inhibition compared to species of Candida. This higher sensitivity results from the inability of Cryptococcus to generate cellular energy through fermentation. To heighten disruption of cellular MRC, octyl gallate (OG or 2,3-dihydroxybenzaldehyde (2,3-DHBA, phenolic compounds inhibiting mitochondrial functions, were selected as chemosensitizers to pyraclostrobin (PCS; an inhibitor of complex III of MRC. The cryptococci were more susceptible to the chemosensitization (i.e., PCS + OG or 2,3-DHBA than the Candida with all Cryptococcus strains tested being sensitive to this chemosensitization. Alternatively, only few of the Candida strains showed sensitivity. OG possessed higher chemosensitizing potency than 2,3-DHBA, where the concentration of OG required with the drug to achieve chemosensitizing synergism was much lower than that required of 2,3-DHBA. Bioassays with gene deletion mutants of the model yeast Saccharomyces cerevisiae showed that OG or 2,3-DHBA affect different cellular targets. These assays revealed mitochondrial superoxide dismutase or glutathione homeostasis plays a relatively greater role in fungal tolerance to 2,3-DHBA or OG, respectively. These findings show that application of chemosensitizing compounds that augment MRC debilitation is a promising strategy to antifungal control against yeast pathogens.

  3. Screening of Fungi for Biological Control of a Triatomine Vector of Chagas Disease: Temperature and Trypanosome Infection as Factors.

    Directory of Open Access Journals (Sweden)

    Aline R M Garcia

    2016-11-01

    Full Text Available Entomopathogenic fungi have been investigated as an alternative tool for controlling various insects, including triatomine vectors of the protozoan Trypanosoma cruzi, the etiological agent of Chagas disease. Here we tested the pathogenicity and virulence of ten isolates of the fungi Metarhizium spp. and Beauveria bassiana against Rhodnius prolixus and found all of the isolates to be virulent. We used two isolates (URPE-11 Metarhizium anisopliae and ENT-1 Beauveria bassiana for further screening based on their prolific sporulation in vitro (an important property of fungal biopesticides. We characterized their virulences in a dose-response experiment and then examined virulence across a range of temperatures (21, 23, 27 and 30°C. We found isolate ENT-1 to maintain higher levels of virulence over these temperatures than URPE-11. We therefore used B. bassiana ENT-1 in the final experiment in which we examined the survival of insects parasitized with T. cruzi and then infected with this fungus (once again over a range of temperatures. Contrary to our expectations, the survival of insects challenged with the pathogenic fungus was greater when they had previously been infected with the parasite T. cruzi than when they had not (independent of temperature. We discuss these results in terms of aspects of the biologies of the three organisms. In practical terms, we concluded that, while we have fungal isolates of potential interest for development as biopesticides against R. prolixus, we have identified what could be a critical problem for this biological tool: the parasite T. cruzi appears to confer a measure of resistance to the insect against the potential biopesticide agent so use of this fungus as a biopesticide could lead to selection for vector competence.

  4. Differential physiological responses of dalmatian toadflax, Linaria dalmatica L. Miller, to injury from two insect biological control agents: Implications for decision-making in biological control

    Science.gov (United States)

    Robert K. D. Peterson; Sharlene E. Sing; David K. Weaver

    2005-01-01

    Successful biological control of invasive weeds with specialist herbivorous insects is predicated on the assumption that the injury stresses the weeds sufficiently to cause reductions in individual fitness. Because plant gas exchange directly impacts growth and fitness, characterizing how injury affects these primary processes may provide a key indicator of...

  5. Use of isotopes for research and control of vectors of animal diseases, host-pathogen relationships and the environmental impact of control procedures

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1979-08-15

    Full text: To cope with the world-wide problems of famine, malnutrition and environmental pollution it is imperative that all techniques and resources for the protection of animals and plants be utilized. As an example, nagana alone (animal trypanosomiasis) profoundly affects socioeconomic development in Africa. Its vector, the tsetse fly, is widespread and prevents agricultural development over much of the more than 7 million square kilometres where it is present. The need to control this disease has been emphasized by a mandate from the 1974 World Food Conference of the United Nations. If this disease alone could be eliminated, the cattle population could be increased by at least 120 million head with a resultant yearly increase in meat production of 1.5 million tons having a value totalling 750 million US dollars. The symposium was convened to discuss the various research and control aspects of nagana and related diseases and was the first of its kind to be convened by the sponsoring organizations The symposium amply demonstrated the value and usefulness of isotopes in the research and control of vectors of animal diseases, the elucidation of host-pathogen relationships and the degradation of pesticides. The symposium received an enthusiastic response, reflected in the large number of papers presented, which covered a variety of topics, including the sterile insect technique (SIT) as applied to tsetse flies. Several papers were presented covering its different aspects such as mass-rearing, sterility induction, ecology, behaviour and computer modelling. Other topics emphasized were pathogenesis and immunology of vector borne diseases such as trypanosomiasis, anaplasmosis, babesiosis and leishmaniasis. Also included were presentations on insect repellents and the biotransformation and degradation of labelled pesticides. The technical sessions began with 3 review papers, one on the FAO Animal Health Division's field research on tsetse flies, the second on the

  6. Use of isotopes for research and control of vectors of animal diseases, host-pathogen relationships and the environmental impact of control procedures

    International Nuclear Information System (INIS)

    1979-01-01

    Full text: To cope with the world-wide problems of famine, malnutrition and environmental pollution it is imperative that all techniques and resources for the protection of animals and plants be utilized. As an example, nagana alone (animal trypanosomiasis) profoundly affects socioeconomic development in Africa. Its vector, the tsetse fly, is widespread and prevents agricultural development over much of the more than 7 million square kilometres where it is present. The need to control this disease has been emphasized by a mandate from the 1974 World Food Conference of the United Nations. If this disease alone could be eliminated, the cattle population could be increased by at least 120 million head with a resultant yearly increase in meat production of 1.5 million tons having a value totalling 750 million US dollars. The symposium was convened to discuss the various research and control aspects of nagana and related diseases and was the first of its kind to be convened by the sponsoring organizations The symposium amply demonstrated the value and usefulness of isotopes in the research and control of vectors of animal diseases, the elucidation of host-pathogen relationships and the degradation of pesticides. The symposium received an enthusiastic response, reflected in the large number of papers presented, which covered a variety of topics, including the sterile insect technique (SIT) as applied to tsetse flies. Several papers were presented covering its different aspects such as mass-rearing, sterility induction, ecology, behaviour and computer modelling. Other topics emphasized were pathogenesis and immunology of vector borne diseases such as trypanosomiasis, anaplasmosis, babesiosis and leishmaniasis. Also included were presentations on insect repellents and the biotransformation and degradation of labelled pesticides. The technical sessions began with 3 review papers, one on the FAO Animal Health Division's field research on tsetse flies, the second on the

  7. Do biological-based strategies hold promise to biofouling control in MBRs?

    KAUST Repository

    Malaeb, Lilian; Le-Clech, Pierre; Vrouwenvelder, Johannes S.; Ayoub, George M.; Saikaly, Pascal

    2013-01-01

    . The reason for the slow advancement in successful control of biofouling is largely attributed to the complex interactions of involved biological compounds and the lack of representative-for-practice experimental approaches to evaluate potential effective

  8. Holarchical Systems and Emotional Holons : Biologically-Inspired System Designs for Control of Autonomous Aerial Vehicles

    Science.gov (United States)

    Ippolito, Corey; Plice, Laura; Pisanich, Greg

    2003-01-01

    The BEES (Bio-inspired Engineering for Exploration Systems) for Mars project at NASA Ames Research Center has the goal of developing bio-inspired flight control strategies to enable aerial explorers for Mars scientific investigations. This paper presents a summary of our ongoing research into biologically inspired system designs for control of unmanned autonomous aerial vehicle communities for Mars exploration. First, we present cooperative design considerations for robotic explorers based on the holarchical nature of biological systems and communities. Second, an outline of an architecture for cognitive decision making and control of individual robotic explorers is presented, modeled after the emotional nervous system of cognitive biological systems. Keywords: Holarchy, Biologically Inspired, Emotional UAV Flight Control

  9. Biological control of saltcedar (Tamarix spp.) by saltcedar leaf beetles (Diorhabda spp.): effects on small mammals

    Science.gov (United States)

    The spread of introduced saltcedar (Tamarix spp.) throughout many riparian systems across the western United States motivated the introduction of biological control agents that are specific to saltcedar, saltcedar leaf beetles (Diorhabda carinulata, D. elongata; Chrysomelidae). I monitored small mam...

  10. Parasitoids attacking emerald ash borers in western Pennsylvania and their potential use in biological control

    Science.gov (United States)

    J.J. Duan; R.W. Fuester; J. Wildonger; P.B. Taylor; S. Barth; S-E. Spichiger

    2009-01-01

    Current biological control programs against the emerald ash borer (EAB, Agrilus planipennis Fairmaire) have primarily focused on the introduction and releases of exotic parasitoids from China, home of the pest origin....

  11. Biological control of toxic cyanobacteria by mixotrophic predators: an experimental test of intraguild predation theory

    NARCIS (Netherlands)

    Wilken, S.; Verspagen, J.M.H.; Naus-Wiezer, S.M.H.; Van Donk, E.; Huisman, Jef

    2014-01-01

    Intraguild predators both feed on and compete with their intraguild prey. In theory, intraguild predators can therefore be very effective as biological control agents of intraguild prey species, especially in productive environments. We investigated this hypothesis using the mixotrophic chrysophyte

  12. Whole-genome sequencing of Bacillus subtilis XF-1 reveals mechanisms for biological control and multiple beneficial properties in plants.

    Science.gov (United States)

    Guo, Shengye; Li, Xingyu; He, Pengfei; Ho, Honhing; Wu, Yixin; He, Yueqiu

    2015-06-01

    Bacillus subtilis XF-1 is a gram-positive, plant-associated bacterium that stimulates plant growth and produces secondary metabolites that suppress soil-borne plant pathogens. In particular, it is especially highly efficient at controlling the clubroot disease of cruciferous crops. Its 4,061,186-bp genome contains an estimated 3853 protein-coding sequences and the 1155 genes of XF-1 are present in most genome-sequenced Bacillus strains: 3757 genes in B. subtilis 168, and 1164 in B. amyloliquefaciens FZB42. Analysis using the Cluster of Orthologous Groups database of proteins shows that 60 genes control bacterial mobility, 221 genes are related to cell wall and membrane biosynthesis, and more than 112 are genes associated with secondary metabolites. In addition, the genes contributed to the strain's plant colonization, bio-control and stimulation of plant growth. Sequencing of the genome is a fundamental step for developing a desired strain to serve as an efficient biological control agent and plant growth stimulator. Similar to other members of the taxon, XF-1 has a genome that contains giant gene clusters for the non-ribosomal synthesis of antifungal lipopeptides (surfactin and fengycin), the polyketides (macrolactin and bacillaene), the siderophore bacillibactin, and the dipeptide bacilysin. There are two synthesis pathways for volatile growth-promoting compounds. The expression of biosynthesized antibiotic peptides in XF-1 was revealed by matrix-assisted laser desorption/ionization-time of flight mass spectrometry.

  13. Interferon Lambda Genetics and Biology in Regulation of Viral Control

    Directory of Open Access Journals (Sweden)

    Emily A. Hemann

    2017-12-01

    Full Text Available Type III interferons, also known as interferon lambdas (IFNλs, are the most recent addition to the IFN family following their discovery in 2003. Initially, IFNλ was demonstrated to induce expression of interferon-stimulated genes and exert antiviral properties in a similar manner to type I IFNs. However, while IFNλ has been described to have largely overlapping expression and function with type I IFNs, it has become increasingly clear that type III IFNs also have distinct functions from type I IFNs. In contrast to type I IFNs, whose receptor is ubiquitously expressed, type III IFNs signal and function largely at barrier epithelial surfaces, such as the respiratory and gastrointestinal tracts, as well as the blood–brain barrier. In further support of unique functions for type III IFNs, single nucleotide polymorphisms in IFNL genes in humans are strongly associated with outcomes to viral infection. These biological linkages have also been more directly supported by studies in mice highlighting roles of IFNλ in promoting antiviral immune responses. In this review, we discuss the current understanding of type III IFNs, and how their functions are similar to, and different from, type I IFN in various immune cell subtypes and viral infections.

  14. The biological basis for the control of prenatal irradiation

    International Nuclear Information System (INIS)

    1988-01-01

    The embryo and fetus have been generally considered to be more sensitive than the adult to the detrimental effects of radiation exposure. In particular, recent re-evaluations of epidemiological data on human population exposed to radiation have suggested that there may be greater sensitivity than heretofore recognized to the induction of mental retardation and reduced intelligence by exposure during gestation. To assist national authorities in evaluating this problem and establishing appropriate protection measures for limiting the dose to the embryo and fetus and, thus, to pregnant or potentially pregnant women, the Nuclear Energy Agency has appointed a Group of Consultants to assemble and evaluate the biological data relevant to the protection of the human conceptus, and to make recommendations for achieving this in the operational practice. The Group has surveyed the human data dealing with the biologcal effects of radiation exposure at low doses, and has supplemented this with information derived from animal studies. The Group has also taken full account of the studies and recommendations issued in this area by other international organizations, primarily the United Nations Scientific Committee on the Effects of Atomic Radiation (UNSCEAR) and the International Commission on Radiological Protection (ICRP). This report is published under the responsibility of the Secretary General of the OECD, and does not commit Member governments of the Organization

  15. Biology and control of the raspberry crown borer (Lepidoptera: Sesiidae).

    Science.gov (United States)

    McKern, Jacquelyn A; Johnson, Donn T; Lewis, Barbara A

    2007-04-01

    This study explored the biology of raspberry crown borer, Pennisetia marginata (Harris) (Lepidoptera: Sesiidae), in Arkansas and the optimum timing for insecticide and nematode applications. The duration of P. marginata's life cycle was observed to be 1 yr in Arkansas. Insecticide trials revealed that bifenthrin, chlorpyrifos, imidacloprid, metaflumizone, and metofluthrin efficacy were comparable with that of azinphosmethyl, the only labeled insecticide for P. marginata in brambles until 2005. Applications on 23 October 2003 for plots treated with bifenthrin, chlorpyrifos, and azinphosmethyl resulted in >88% reduction in larvae per crown. Applications on 3 November 2004 of metaflumizone, metofluthrin, and bifenthrin resulted in >89% reduction in larvae per crown. Applications on 7 April 2005 for metofluthrin, imidacloprid, bifenthrin, metaflumizone, and benzoylphenyl urea resulted in >64% reduction in the number of larvae per crown. Applications on 6 May 2004 did not reduce larval numbers. The optimum timing for treatments was found to be between October and early April, before the larvae tunneled into the crowns of plants. Applying bifenthrin with as little as 468 liters water/ha (50 gal/acre) was found to be as effective against larvae as higher volumes of spray. Nematode applications were less successful than insecticides. Nematode applications of Steinernemafeltiae, Steinernema carpocapsae, and Heterorhabditis bacteriophora reduced larvae counts per plant by 46, 53, and 33%, respectively.

  16. Bacterial antagonists of fungal pathogens also control root-knot nematodes by induced systemic resistance of tomato plants.

    Directory of Open Access Journals (Sweden)

    Mohamed Adam

    Full Text Available The potential of bacterial antagonists of fungal pathogens to control the root-knot nematode Meloidogyne incognita was investigated under greenhouse conditions. Treatment of tomato seeds with several strains significantly reduced the numbers of galls and egg masses compared with the untreated control. Best performed Bacillus subtilis isolates Sb4-23, Mc5-Re2, and Mc2-Re2, which were further studied for their mode of action with regard to direct effects by bacterial metabolites or repellents, and plant mediated effects. Drenching of soil with culture supernatants significantly reduced the number of egg masses produced by M. incognita on tomato by up to 62% compared to the control without culture supernatant. Repellence of juveniles by the antagonists was shown in a linked twin-pot set-up, where a majority of juveniles penetrated roots on the side without inoculated antagonists. All tested biocontrol strains induced systemic resistance against M. incognita in tomato, as revealed in a split-root system where the bacteria and the nematodes were inoculated at spatially separated roots of the same plant. This reduced the production of egg masses by up to 51%, while inoculation of bacteria and nematodes in the same pot had only a minor additive effect on suppression of M. incognita compared to induced systemic resistance alone. Therefore, the plant mediated effect was the major reason for antagonism rather than direct mechanisms. In conclusion, the bacteria known for their antagonistic potential against fungal pathogens also suppressed M. incognita. Such "multi-purpose" bacteria might provide new options for control strategies, especially with respect to nematode-fungus disease complexes that cause synergistic yield losses.

  17. Bacterial antagonists of fungal pathogens also control root-knot nematodes by induced systemic resistance of tomato plants.

    Science.gov (United States)

    Adam, Mohamed; Heuer, Holger; Hallmann, Johannes

    2014-01-01

    The potential of bacterial antagonists of fungal pathogens to control the root-knot nematode Meloidogyne incognita was investigated under greenhouse conditions. Treatment of tomato seeds with several strains significantly reduced the numbers of galls and egg masses compared with the untreated control. Best performed Bacillus subtilis isolates Sb4-23, Mc5-Re2, and Mc2-Re2, which were further studied for their mode of action with regard to direct effects by bacterial metabolites or repellents, and plant mediated effects. Drenching of soil with culture supernatants significantly reduced the number of egg masses produced by M. incognita on tomato by up to 62% compared to the control without culture supernatant. Repellence of juveniles by the antagonists was shown in a linked twin-pot set-up, where a majority of juveniles penetrated roots on the side without inoculated antagonists. All tested biocontrol strains induced systemic resistance against M. incognita in tomato, as revealed in a split-root system where the bacteria and the nematodes were inoculated at spatially separated roots of the same plant. This reduced the production of egg masses by up to 51%, while inoculation of bacteria and nematodes in the same pot had only a minor additive effect on suppression of M. incognita compared to induced systemic resistance alone. Therefore, the plant mediated effect was the major reason for antagonism rather than direct mechanisms. In conclusion, the bacteria known for their antagonistic potential against fungal pathogens also suppressed M. incognita. Such "multi-purpose" bacteria might provide new options for control strategies, especially with respect to nematode-fungus disease complexes that cause synergistic yield losses.

  18. Anaerobic Digestion. Instructor's Guide. Biological Treatment Process Control.

    Science.gov (United States)

    Carnegie, John W., Ed.

    This instructor's guide contains materials needed to teach a four-lesson unit on anaerobic digestion control. These materials include: (1) unit overview; (2) lesson plans; (3) lecture outlines; (4) student worksheets for each lesson (with answers); and (5) two copies of a final quiz (with and without answers). Lesson 1 is a review of the theory of…

  19. Ecological risks of biological control agents: impacts on IPM

    NARCIS (Netherlands)

    Hokkanen, H.M.T.; Lenteren, van J.C.; Menzler-Hokkanen, I.

    2007-01-01

    Since the early days of integrated pest management a sound ecological foundation has been considered essential for the development of effective systems. From time to time, there have been attempts to evaluate the ways in which ecological theory is exploited in pest control, and to review the lessons

  20. Comparison between chemical and biological control of Fusarium ...

    African Journals Online (AJOL)

    ... College of Education, Jeddah, Saudi Arabia. The results revealed that treatment with the fungicide carbomar or T. harzianum as well as with B. subtilis, in presence of F. solani increased the % of healthy seedlings as well as their length , fresh and dry weight than in presence of F. solani alone but still less than the control.

  1. Identifying Ant-Mirid Spatial Interactions to Improve Biological Control in Cacao-Based Agroforestry System.

    Science.gov (United States)

    Bagny Beilhe, Leïla; Piou, Cyril; Tadu, Zéphirin; Babin, Régis

    2018-06-06

    The use of ants for biological control of insect pests was the first reported case of conservation biological control. Direct and indirect community interactions between ants and pests lead to differential spatial pattern. We investigated spatial interactions between mirids, the major cocoa pest in West Africa and numerically dominant ant species, using bivariate point pattern analysis to identify potential biological control agents. We assume that potential biological control agents should display negative spatial interactions with mirids considering their niche overlap. The mirid/ant data were collected in complex cacao-based agroforestry systems sampled in three agroecological areas over a forest-savannah gradient in Cameroon. Three species, Crematogaster striatula Emery (Hymenoptera: Formicidae), Crematogaster clariventris Mayr (Hymenoptera: Formicidae), and Oecophylla longinoda Latreille (Hymenoptera: Formicidae) with high predator and aggressive behaviors were identified as dominant and showed negative spatial relationships with mirids. The weaver ant, O. longinoda was identified as the only potential biological control agent, considering its ubiquity in the plots, the similarity in niche requirements, and the spatial segregation with mirids resulting probably from exclusion mechanisms. Combining bivariate point pattern analysis to good knowledge of insect ecology was an effective method to identify a potentially good biological control agent.

  2. A biologically inspired neural network controller for ballistic arm movements

    Directory of Open Access Journals (Sweden)

    Schmid Maurizio

    2007-09-01

    Full Text Available Abstract Background In humans, the implementation of multijoint tasks of the arm implies a highly complex integration of sensory information, sensorimotor transformations and motor planning. Computational models can be profitably used to better understand the mechanisms sub-serving motor control, thus providing useful perspectives and investigating different control hypotheses. To this purpose, the use of Artificial Neural Networks has been proposed to represent and interpret the movement of upper limb. In this paper, a neural network approach to the modelling of the motor control of a human arm during planar ballistic movements is presented. Methods The developed system is composed of three main computational blocks: 1 a parallel distributed learning scheme that aims at simulating the internal inverse model in the trajectory formation process; 2 a pulse generator, which is responsible for the creation of muscular synergies; and 3 a limb model based on two joints (two degrees of freedom and six muscle-like actuators, that can accommodate for the biomechanical parameters of the arm. The learning paradigm of the neural controller is based on a pure exploration of the working space with no feedback signal. Kinematics provided by the system have been compared with those obtained in literature from experimental data of humans. Results The model reproduces kinematics of arm movements, with bell-shaped wrist velocity profiles and approximately straight trajectories, and gives rise to the generation of synergies for the execution of movements. The model allows achieving amplitude and direction errors of respectively 0.52 cm and 0.2 radians. Curvature values are similar to those encountered in experimental measures with humans. The neural controller also manages environmental modifications such as the insertion of different force fields acting on the end-effector. Conclusion The proposed system has been shown to properly simulate the development of

  3. The COP9 signalosome controls jasmonic acid synthesis and plant responses to herbivory and pathogens.

    Science.gov (United States)

    Hind, Sarah R; Pulliam, Sarah E; Veronese, Paola; Shantharaj, Deepak; Nazir, Azka; Jacobs, Nekaiya S; Stratmann, Johannes W

    2011-02-01

    The COP9 signalosome (CSN) is a multi-protein complex that regulates the activities of cullin-RING E3 ubiquitin ligases (CRLs). CRLs ubiquitinate proteins in order to target them for proteasomal degradation. The CSN is required for proper plant development. Here we show that the CSN also has a profound effect on plant defense responses. Silencing of genes for CSN subunits in tomato plants resulted in a mild morphological phenotype and reduced expression of wound-responsive genes in response to mechanical wounding, attack by Manduca sexta larvae, and Prosystemin over-expression. In contrast, expression of pathogenesis-related genes was increased in a stimulus-independent manner in these plants. The reduced wound response in CSN-silenced plants corresponded with reduced synthesis of jasmonic acid (JA), but levels of salicylic acid (SA) were unaltered. As a consequence, these plants exhibited reduced resistance against herbivorous M. sexta larvae and the necrotrophic fungal pathogen Botrytis cinerea. In contrast, susceptibility to tobacco mosaic virus (TMV) was not altered in CSN-silenced plants. These data demonstrate that the CSN orchestrates not only plant development but also JA-dependent plant defense responses. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  4. UV-Heat Treatments for the Control of Foodborne Microbial Pathogens in Chicken Broth

    Directory of Open Access Journals (Sweden)

    M. Gouma

    2015-01-01

    Full Text Available This investigation established the process criteria for using UV-C light and mild heat (UV-H treatment to inactivate 5-Log10 cycles (performance criterion of common foodborne pathogen populations, Escherichia coli, Salmonella Typhimurium, Listeria monocytogenes, and Staphylococcus aureus, when inoculated in chicken broth. To define the target microorganism and the proper UV-H treatment conditions (including UV dose, treatment time, and temperature that would achieve the stated performance criterion, mathematical equations based on Geeraerd’s model were developed for each microorganism. For the sake of comparison, inactivation equations for heat treatments were also performed on the same chicken broth and for the same microorganisms. L. monocytogenes was the most UV-H resistant microorganism at all temperatures, requiring a UV dose between 6.10 J/mL (5.6 min and 2.26 J/mL (2.09 min to achieve 5-Log10 reductions. In comparison with UV treatments at room temperatures, the combination of UV and mild heat allowed both the UV dose and treatment time to be reduced by 30% and 63% at 55°C and 60°C, respectively. Compared to heat treatments, the UV-H process reduced the heating time for 5-Log10 reductions of all the investigated microorganisms in chicken broth from 20-fold to 2-fold when the operating temperature varied from 53 to 60°C.

  5. Mechanization and Control Concepts for Biologically Inspired Micro Aerial Vehicles

    Science.gov (United States)

    Raney, David L.; Slominski, Eric C.

    2003-01-01

    It is possible that MAV designs of the future will exploit flapping flight in order to perform missions that require extreme agility, such as rapid flight beneath a forest canopy or within the confines of a building. Many of nature's most agile flyers generate flapping motions through resonant excitation of an aeroelastically tailored structure: muscle tissue is used to excite a vibratory mode of their flexible wing structure that creates propulsion and lift. A number of MAV concepts have been proposed that would operate in a similar fashion. This paper describes an ongoing research activity in which mechanization and control concepts with application to resonant flapping MAVs are being explored. Structural approaches, mechanical design, sensing and wingbeat control concepts inspired by hummingbirds, bats and insects are examined. Experimental results from a testbed capable of generating vibratory wingbeat patterns that approximately match those exhibited by hummingbirds in hover, cruise, and reverse flight are presented.

  6. Biological Control of Mosquito Vectors: Past, Present, and Future

    Directory of Open Access Journals (Sweden)

    Giovanni Benelli

    2016-10-01

    Full Text Available Mosquitoes represent the major arthropod vectors of human disease worldwide transmitting malaria, lymphatic filariasis, and arboviruses such as dengue virus and Zika virus. Unfortunately, no treatment (in the form of vaccines or drugs is available for most of these diseases andvectorcontrolisstillthemainformofprevention. Thelimitationsoftraditionalinsecticide-based strategies, particularly the development of insecticide resistance, have resulted in significant efforts to develop alternative eco-friendly methods. Biocontrol strategies aim to be sustainable and target a range of different mosquito species to reduce the current reliance on insecticide-based mosquito control. In thisreview, weoutline non-insecticide basedstrategiesthat havebeenimplemented orare currently being tested. We also highlight the use of mosquito behavioural knowledge that can be exploited for control strategies.

  7. Computational Biomathematics: Toward Optimal Control of Complex Biological Systems

    Science.gov (United States)

    2016-09-26

    SECURITY CLASSIFICATION OF: 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND SUBTITLE 13. SUPPLEMENTARY NOTES 12. DISTRIBUTION AVAILIBILITY STATEMENT 6. AUTHORS...neighbor or bi-linear interpolation). The following paper is in preparation: Scaling methods and heuristic algorithms for agent-based models. Matt...The actual method of control used is in the form of heuristic algorithms. In general, these algorithms search through a virtually infinite set of

  8. 75 FR 28233 - Availability of an Environmental Assessment for a Biological Control Agent for Asian Citrus Psyllid

    Science.gov (United States)

    2010-05-20

    ...] Availability of an Environmental Assessment for a Biological Control Agent for Asian Citrus Psyllid AGENCY... radiata, into the continental United States for use as a biological control agent to reduce the severity... of an alternative biological control agent, an encyrtid wasp, (Diaphorencyrtus aligarhensis). However...

  9. 77 FR 46373 - Field Release of Aphelinus glycinis for the Biological Control of the Soybean Aphid in the...

    Science.gov (United States)

    2012-08-03

    ... Inspection Service [Docket No APHIS-2012-0061] Field Release of Aphelinus glycinis for the Biological Control... for the biological control of the soybean aphid, Aphis glycines, in the continental United States. We... glycinis for the Biological Control of the Soybean Aphid in the Continental United States'' (March 2012...

  10. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  11. Control of highly pathogenic avian influenza in Quang Tri province, Vietnam: voices from the human-animal interface.

    Science.gov (United States)

    Farrell, Penny C; Hunter, Cynthia; Truong, Bui; Bunning, Michel

    2015-01-01

    Highly pathogenic avian influenza (HPAI) is caused by the haemagglutinin 5, neuraminidase 1 (H5N1) influenza A virus. Around 80% of households in rural Vietnam raise poultry, which provides food security and nutrition to their households and beyond. Of these, around 15-20% are semi-commercial producers, producing at least 28% of the country's chicken. Through learning the experiences of these semi-commercial farmers, this study aimed to explore the local understandings and sociocultural aspects of HPAI's impact, particularly the aetiology, diagnosis, and the prevention and control methods in one Vietnamese rural province. This study was conducted in Quang Tri province, Vietnam. Quang Tri province has eight districts. Five of these districts were at high risk of HPAI during the study period, of which three were selected for the present study. Within these three districts, six communes were randomly selected for the study from the list of intervention communes in Quang Tri province. Six out of the 26 intervention communes in Quang Tri were therefore selected. Participants were randomly selected and recruited from lists of semi-commercial farmers, village animal health workers, village human health workers and local authorities so that the study population (representative population) included an amount of variability similar to that of the wider population. A key benefit of this village-level control program was the residential proximity of animal and human health professionals. Participants were well aware of the typical clinical signs for avian influenza and of the reporting process for suspect cases. However there was extensive room for improvement in Quang Tri province regarding access to the HPAI vaccine, essential medical equipment for animal use, and available financial support. This qualitative research study provided an important insight for in-country policy makers and international stakeholders. It is vital that there are continued efforts to prevent and

  12. New experimental approaches to the biology of flight control systems.

    Science.gov (United States)

    Taylor, Graham K; Bacic, Marko; Bomphrey, Richard J; Carruthers, Anna C; Gillies, James; Walker, Simon M; Thomas, Adrian L R

    2008-01-01

    Here we consider how new experimental approaches in biomechanics can be used to attain a systems-level understanding of the dynamics of animal flight control. Our aim in this paper is not to provide detailed results and analysis, but rather to tackle several conceptual and methodological issues that have stood in the way of experimentalists in achieving this goal, and to offer tools for overcoming these. We begin by discussing the interplay between analytical and empirical methods, emphasizing that the structure of the models we use to analyse flight control dictates the empirical measurements we must make in order to parameterize them. We then provide a conceptual overview of tethered-flight paradigms, comparing classical ;open-loop' and ;closed-loop' setups, and describe a flight simulator that we have recently developed for making flight dynamics measurements on tethered insects. Next, we provide a conceptual overview of free-flight paradigms, focusing on the need to use system identification techniques in order to analyse the data they provide, and describe two new techniques that we have developed for making flight dynamics measurements on freely flying birds. First, we describe a technique for obtaining inertial measurements of the orientation, angular velocity and acceleration of a steppe eagle Aquila nipalensis in wide-ranging free flight, together with synchronized measurements of wing and tail kinematics using onboard instrumentation and video cameras. Second, we describe a photogrammetric method to measure the 3D wing kinematics of the eagle during take-off and landing. In each case, we provide demonstration data to illustrate the kinds of information available from each method. We conclude by discussing the prospects for systems-level analyses of flight control using these techniques and others like them.

  13. Control of BTEX migration using a biologically enhanced permeable barrier

    International Nuclear Information System (INIS)

    Borden, R.C.; Goin, R.T.; Kao, C.M.

    1997-01-01

    A permeable barrier system, consisting of a line of closely spaced wells, was installed perpendicular to ground water flow to control the migration of a dissolved hydrocarbon plume. The wells were charged with concrete briquets that release oxygen and nitrate at a controlled rate, enhancing aerobic biodegradation in the downgradient aquifer. Laboratory batch reactor experiments were conducted to identify concrete mixtures that slowly released oxygen over an extended time period. A full-scale permeable barrier system using ORC was constructed at a gasoline-spill site. During the first 242 days of operation, total BTEX decreased from 17 to 3.4 mg/L and dissolved oxygen increased from 0.4 to 1.8 mg/L during transport through the barrier. Over time, BTEX treatment efficiencies declined, indicating the barrier system had become less effective in releasing oxygen and nutrients to the highly contaminated portion of the aquifer. Point dilution tests and sediment analyses performed at the conclusion of the project indicated that the aquifer in the vicinity of the remediation wells had been clogged by precipitation with iron minerals

  14. Can Flowering Greencover Crops Promote Biological Control in German Vineyards?

    Directory of Open Access Journals (Sweden)

    Christoph Hoffmann

    2017-11-01

    Full Text Available Greencover crops are widely recommended to provide predators and parasitoids with floral resources for improved pest control. We studied parasitism and predation of European grapevine moth (Lobesia botrana eggs and pupae as well as predatory mite abundances in an experimental vineyard with either one or two sowings of greencover crops compared to spontaneous vegetation. The co-occurrence between greencover flowering time and parasitoid activity differed greatly between the two study years. Parasitism was much higher when flowering and parasitoid activity coincided. While egg predation was enhanced by greencover crops, there were no significant benefits of greencover crops on parasitism of L. botrana eggs or pupae. Predatory mites did not show an as strong increase on grapevines in greencover crop plots as egg predation. Overall, our study demonstrates only limited pest control benefits of greencover crops. Given the strong within- and between year variation in natural enemy activity, studies across multiple years will be necessary to adequately describe the role of greencover crops for pest management and to identify the main predators of L. botrana eggs.

  15. The role and control of sludge age in biological nutrient removal activated sludge systems.

    Science.gov (United States)

    Ekama, G A

    2010-01-01

    The sludge age is the most fundamental and important parameter in the design, operation and control of biological nutrient removal (BNR) activated sludge (AS) systems. Generally, the better the effluent and waste sludge quality required from the system, the longer the sludge age, the larger the biological reactor and the more wastewater characteristics need to be known. Controlling the reactor concentration does not control sludge age, only the mass of sludge in the system. When nitrification is a requirement, sludge age control becomes a requirement and the secondary settling tanks can no longer serve the dual purpose of clarifier and waste activated sludge thickeners. The easiest and most practical way to control sludge age is with hydraulic control by wasting a defined proportion of the reactor volume daily. In AS plants with reactor concentration control, nitrification fails first. With hydraulic control of sludge age, nitrification will not fail, rather the plant fails by shedding solids over the secondary settling tank effluent weirs.

  16. Countering a bioterrorist introduction of pathogen-infected mosquitoes through mosquito control.

    Science.gov (United States)

    Tabachnick, Walter J; Harvey, William R; Becnel, James J; Clark, Gary G; Connelly, C Roxanne; Day, Jonathan F; Linser, Paul J; Linthicum, Kenneth J

    2011-06-01

    The release of infected mosquitoes or other arthropods by bioterrorists, i.e., arboterrorism, to cause disease and terror is a threat to the USA. A workshop to assess mosquito control response capabilities to mount rapid and effective responses to eliminate an arboterrorism attack provided recommendations to improve capabilities in the USA. It is essential that mosquito control professionals receive training in possible responses, and it is recommended that a Council for Emergency Mosquito Control be established in each state to coordinate training, state resources, and actions for use throughout the state.

  17. Foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Thomas Bintsis

    2017-06-01

    Full Text Available Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy. The characteristics of the most common pathogenic bacteria (Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium perfringens, Cronobacter sakazakii, Esherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Staphylococccus aureus, Vibrio spp. and Yersinia enterocolitica, viruses (Hepatitis A and Noroviruses and parasites (Cyclospora cayetanensis, Toxoplasma gondii and Trichinella spiralis, together with some important outbreaks, are reviewed. Food safety management systems based on to classical hazard-based approach has been proved to be inefficient, and risk-based food safety approach is now suggested from leading researchers and organizations. In this context, a food safety management system should be designed in a way to estimate the risks to human health from food consumption and to identify, select and implement mitigation strategies in order to control and reduce these risks. In addition, the application of suitable food safety education programs for all involved people in the production and consumption of foods is suggested.

  18. Investigating Biological Control Agents for Controlling Invasive Populations of the Mealybug Pseudococcus comstocki in France.

    Directory of Open Access Journals (Sweden)

    Thibaut Malausa

    Full Text Available Pseudococcus comstocki (Hemiptera: Pseudococcidae is a mealybug species native to Eastern Asia and present as an invasive pest in northern Italy and southern France since the start of the century. It infests apple and pear trees, grapevines and some ornamental trees. Biocontrol programmes against this pest proved successful in central Asia and North America in the second half of the 20th century. In this study, we investigated possible biocontrol agents against P. comstocki, with the aim of developing a biocontrol programme in France. We carried out systematic DNA-barcoding at each step in the search for a specialist parasitoid. First we characterised the French target populations of P. comstocki. We then identified the parasitoids attacking P. comstocki in France. Finally, we searched for foreign mealybug populations identified a priori as P. comstocki and surveyed their hymenopteran parasitoids. Three mealybug species (P. comstocki, P. viburni and P. cryptus were identified during the survey, together with at least 16 different parasitoid taxa. We selected candidate biological control agent populations for use against P. comstocki in France, from the species Allotropa burrelli (Hymenoptera: Platygastridae and Acerophagus malinus (Hymenoptera: Encyrtidae. The coupling of molecular and morphological characterisation for both pests and natural enemies facilitated the programme development and the rejection of unsuitable or generalist parasitoids.

  19. A proteomic approach provides new insights into the control of soil-borne plant pathogens by Bacillus species.

    Directory of Open Access Journals (Sweden)

    Omür Baysal

    Full Text Available Beneficial microorganisms (also known as biopesticides are considered to be one of the most promising methods for more rational and safe crop management practices. We used Bacillus strains EU07, QST713 and FZB24, and investigated their inhibitory effect on Fusarium. Bacterial cell cultures, cell-free supernatants and volatiles displayed varying degrees of suppressive effect. Proteomic analysis of secreted proteins from EU07 and FZB24 revealed the presence of lytic enzymes, cellulases, proteases, 1,4-β-glucanase and hydrolases, all of which contribute to degradation of the pathogen cell wall. Further proteomic investigations showed that proteins involved in metabolism, protein folding, protein degradation, translation, recognition and signal transduction cascade play an important role in the control of Fusarium oxysporum. Our findings provide new knowledge on the mechanism of action of Bacillus species and insight into biocontrol mechanisms.

  20. Food-borne pathogens

    International Nuclear Information System (INIS)

    Niemand, J.G.

    1985-01-01

    The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process

  1. Zika virus: History, emergence, biology, and prospects for control.

    Science.gov (United States)

    Weaver, Scott C; Costa, Federico; Garcia-Blanco, Mariano A; Ko, Albert I; Ribeiro, Guilherme S; Saade, George; Shi, Pei-Yong; Vasilakis, Nikos

    2016-06-01

    Zika virus (ZIKV), a previously obscure flavivirus closely related to dengue, West Nile, Japanese encephalitis and yellow fever viruses, has emerged explosively since 2007 to cause a series of epidemics in Micronesia, the South Pacific, and most recently the Americas. After its putative evolution in sub-Saharan Africa, ZIKV spread in the distant past to Asia and has probably emerged on multiple occasions into urban transmission cycles involving Aedes (Stegomyia) spp. mosquitoes and human amplification hosts, accompanied by a relatively mild dengue-like illness. The unprecedented numbers of people infected during recent outbreaks in the South Pacific and the Americas may have resulted in enough ZIKV infections to notice relatively rare congenital microcephaly and Guillain-Barré syndromes. Another hypothesis is that phenotypic changes in Asian lineage ZIKV strains led to these disease outcomes. Here, we review potential strategies to control the ongoing outbreak through vector-centric approaches as well as the prospects for the development of vaccines and therapeutics. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Biology and control of swamp dodder (Cuscuta gronovii)

    International Nuclear Information System (INIS)

    Bewick, T.A.

    1987-01-01

    A simple model predicting swamp dodder (Cuscuta gronovii Willd.) emergence was developed. The model states that 0.1% of the cranberry seedlings will emerge after 150 to 170 GDD have accumulated after the winter ice has melted on the cranberry beds, using 0 C as the low temperature threshold. Experiments in cranberry showed that pronamide [3,5-dichloro-(N-1,1-dimethyl-2-propynyl)benzamide] was effective in controlling swamp dodder when applied preemergence. Rates below 2.4 kg ai/ha appeared to be safe for cranberry plants and fruit. Experiments with 14 C glyphosate showed that the herbicide moved out of carrot leaves to the physiological sinks in the plant. In carrots parasitized by swamp dodder the dodder acted as one of the strongest sinks for photosynthates from the host. In cranberry glyphosate moved out of the leaves, but most remained in the stem to which the treated leaves were attached. The only physiological sinks that accumulated significant amounts of label were the stem apices. The concentration of the herbicide in this sink decreased with time. Swamp dodder stems were able to absorb glyphosate directly from solution

  3. A Systems Biology Approach to the Coordination of Defensive and Offensive Molecular Mechanisms in the Innate and Adaptive Host-Pathogen Interaction Networks.

    Science.gov (United States)

    Wu, Chia-Chou; Chen, Bor-Sen

    2016-01-01

    Infected zebrafish coordinates defensive and offensive molecular mechanisms in response to Candida albicans infections, and invasive C. albicans coordinates corresponding molecular mechanisms to interact with the host. However, knowledge of the ensuing infection-activated signaling networks in both host and pathogen and their interspecific crosstalk during the innate and adaptive phases of the infection processes remains incomplete. In the present study, dynamic network modeling, protein interaction databases, and dual transcriptome data from zebrafish and C. albicans during infection were used to infer infection-activated host-pathogen dynamic interaction networks. The consideration of host-pathogen dynamic interaction systems as innate and adaptive loops and subsequent comparisons of inferred innate and adaptive networks indicated previously unrecognized crosstalk between known pathways and suggested roles of immunological memory in the coordination of host defensive and offensive molecular mechanisms to achieve specific and powerful defense against pathogens. Moreover, pathogens enhance intraspecific crosstalk and abrogate host apoptosis to accommodate enhanced host defense mechanisms during the adaptive phase. Accordingly, links between physiological phenomena and changes in the coordination of defensive and offensive molecular mechanisms highlight the importance of host-pathogen molecular interaction networks, and consequent inferences of the host-pathogen relationship could be translated into biomedical applications.

  4. Assessing the status of biological control as a management tool for suppression of invasive alien plants in South Africa

    OpenAIRE

    Zachariades, Costas; Paterson, Iain D.; Strathie, Lorraine W.; Hill, Martin P.; van Wilgen, Brian W.

    2017-01-01

    Background: Biological control of invasive alien plants (IAPs) using introduced natural enemies contributes significantly to sustained, cost-effective management of natural resources in South Africa. The status of, and prospects for, biological control is therefore integral to National Status Reports (NSRs) on Biological Invasions, the first of which is due in 2017. Objectives: Our aim was to evaluate the status of, and prospects for, biological control of IAPs in South Africa. We discuss...

  5. Biologically inspired control of humanoid robot arms robust and adaptive approaches

    CERN Document Server

    Spiers, Adam; Herrmann, Guido

    2016-01-01

    This book investigates a biologically inspired method of robot arm control, developed with the objective of synthesising human-like motion dynamically, using nonlinear, robust and adaptive control techniques in practical robot systems. The control method caters to a rising interest in humanoid robots and the need for appropriate control schemes to match these systems. Unlike the classic kinematic schemes used in industrial manipulators, the dynamic approaches proposed here promote human-like motion with better exploitation of the robot’s physical structure. This also benefits human-robot interaction. The control schemes proposed in this book are inspired by a wealth of human-motion literature that indicates the drivers of motion to be dynamic, model-based and optimal. Such considerations lend themselves nicely to achievement via nonlinear control techniques without the necessity for extensive and complex biological models. The operational-space method of robot control forms the basis of many of the techniqu...

  6. Quantifying conservation biological control for management of Bemisia tabaci (Hemiptera: Aleyrodidae) in cotton

    Science.gov (United States)

    Conservation biological control can be an effective tactic for minimizing insect-induced damage to agricultural production. The most effective manner of applying CBC is through an Integrated Pest Management (IPM) strategy, combining many tactics including cultural controls, pest sampling, the use of...

  7. Hybridization between a native and introduced predator of Adelgidae: An unintended result of classical biological control

    Science.gov (United States)

    N.P. Havill; Gina Davis; David Mausel; Joanne Klein; Richard McDonald; Cera Jones; Melissa Fischer; Scott Salom; Adelgisa. Caccone

    2012-01-01

    Hybridization between introduced biological control agents and native species has the potential to impact native biodiversity and pest control efforts. This study reports progress towards predicting the outcome of hybridization between two beetle species, the introduced Laricobius nigrinus Fender and the native L. rubidus LeConte...

  8. Compatible biological and chemical control systems for Rhizoctonia solani in potato

    NARCIS (Netherlands)

    Boogert, van den P.H.J.F.; Luttikholt, A.J.G.

    2004-01-01

    A series of chemical and biological control agents were tested for compatibility with the Rhizoctonia-specific biocontrol fungus Verticillium biguttatum aimed at designing novel control strategies for black scurf (Rhizoctonia solani) and other tuber diseases in potato. The efficacy of chemicals,

  9. Candidate predators for biological control of the poultry red mite Dermanyssus gallinae

    NARCIS (Netherlands)

    Lesna, I.; Wolfs, P.; Faraji, F.; Roy, L.; Komdeur, J.; Sabelis, M.W.

    2009-01-01

    The poultry red mite, Dermanyssus gallinae, is currently a significant pest in the poultry industry in Europe. Biological control by the introduction of predatory mites is one of the various options for controlling poultry red mites. Here, we present the first results of an attempt to identify

  10. Candidate predators for biological control of the poultry red mite Dermanyssus gallinae

    NARCIS (Netherlands)

    Lesna, Izabela; Wolfs, Peter; Faraji, Farid; Roy, Lise; Komdeur, Jan; Sabelis, Maurice W.

    The poultry red mite, Dermanyssus gallinae, is currently a significant pest in the poultry industry in Europe. Biological control by the introduction of predatory mites is one of the various options for controlling poultry red mites. Here, we present the first results of an attempt to identify

  11. Control biológico del entrenamiento de resistencia. Biological control of endurance training.

    Directory of Open Access Journals (Sweden)

    González Gross, Marcela

    2006-01-01

    Full Text Available ResumenLa alta exigencia en los deportistas de elite hace cada vez más necesario controlar el proceso de adaptación al entrenamiento. El objetivo de esta revisión es analizar la información biológica de un análisis de sangre, al objeto de obtener información de la carga de entrenamiento en atletas de resistencia. La mayor parte de los parámetros sanguíneos han sido empleados, más que para determinar el proceso del entrenamiento, precisamente, para lo opuesto: el sobreentrenamiento. La concentración en plasma de sustratos metabólicos (glucosa y ácidos grasos no son parámetros que pueda utilizarse para controlar el entrenamiento, debido a las bajas especificidad y sensibilidad. No obstante, la concentración de determinados enzimas que intervienen en la utilización de los sustratos puede ser importante. Valores de creatín kinasa superiores a 200 U/l en una persona sana sugiere claramente que la carga de entrenamiento total de una determinada sesión ha sido elevada. La concentración en plasma de algún producto de degradación del catabolismo también puede señalar la adaptación del organismo al entrenamiento. La concentración de ácido láctico en plasma es la herramienta más común en la valoración de la carga de entrenamiento. La concentración de urea es un buen marcador biológico de la carga de entrenamiento. Valores superiores a 8 mmol/l en varones y de 6,5 mmol/l en mujeres, indican que el entrenamiento ha sido muy intenso. La determinación de otros productos (amonio o sustratos (glutamina se han utilizado para detectar el sobreentrenamiento.AbstractThe high exigency in the elite sportsmen does more necessary to control the process of training adaptation. The purpose of this review is to analyze the biological information of a blood analysis to obtain data of load training in endurance athletes. Most blood parameters has been used to evaluate the overtraining state instead of determining the training process. The

  12. EFSA Panel on Biological Hazards (BIOHAZ) Panel; Scientific Opinion on the risk posed by pathogens in food of non-animal origin. Part 1 (outbreak data analysis and risk ranking of food/pathogen combinations)

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    shelf life. Shortcomings in the approach using outbreak data were discussed. The top ranking food/pathogen combination was Salmonellaspp. and leafy greens eaten raw followed by (in equal rank) Salmonellaspp. and bulb and stem vegetables, Salmonellaspp. and tomatoes, Salmonellaspp. and melons...

  13. Randomized controlled clinical trial evaluating multiplex polymerase chain reaction for pathogen identification and therapy adaptation in critical care patients with pulmonary or abdominal sepsis.

    Science.gov (United States)

    Tafelski, Sascha; Nachtigall, Irit; Adam, Thomas; Bereswill, Stefan; Faust, Jana; Tamarkin, Andrey; Trefzer, Tanja; Deja, Maria; Idelevich, Evgeny A; Wernecke, Klaus-Dieter; Becker, Karsten; Spies, Claudia

    2015-06-01

    To determine whether a multiplex polymerase chain reaction (PCR)-based test could reduce the time required for initial pathogen identification in patients in an intensive care unit (ICU) setting. This double-blind, parallel-group randomized controlled trial** enrolled adults with suspected pulmonary or abdominal sepsis caused by an unknown pathogen. Both the intervention and control groups underwent the standard blood culture (BC) testing, but additional pathogen identification, based on the results of a LightCycler® SeptiFast PCR test, were provided in the intervention group. The study enrolled 37 patients in the control group and 41 in the intervention group. Baseline clinical and demographic characteristics were similar in both groups. The PCR-based test identified a pathogen in 10 out of 41 (24.4%) patients in the intervention group, with a mean duration from sampling to providing the information to the ICU of 15.9 h. In the control group, BC results were available after a significantly longer period (38.1 h). The LightCycler® SeptiFast PCR test demonstrated a significant reduction in the time required for initial pathogen identification, compared with standard BC. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  14. The challenges of implementing pathogen control strategies for fishes used in biomedical research

    Science.gov (United States)

    Lawrence, C.; Ennis, D.G.; Harper, C.; Kent, M.L.; Murray, K.; Sanders, G.E.

    2012-01-01

    Over the past several decades, a number of fish species, including the zebrafish, medaka, and platyfish/swordtail, have become important models for human health and disease. Despite the increasing prevalence of these and other fish species in research, methods for health maintenance and the management of diseases in laboratory populations of these animals are underdeveloped. There is a growing realization that this trend must change, especially as the use of these species expands beyond developmental biology and more towards experimental applications where the presence of underlying disease may affect the physiology animals used in experiments and potentially compromise research results. Therefore, there is a critical need to develop, improve, and implement strategies for managing health and disease in aquatic research facilities. The purpose of this review is to report the proceedings of a workshop entitled "Animal Health and Disease Management in Research Animals" that was recently held at the 5th Aquatic Animal Models for Human Disease in September 2010 at Corvallis, Oregon to discuss the challenges involved with moving the field forward on this front. ?? 2011 Elsevier Inc. All rights reserved.

  15. The Main Biological Hazards in Animal Biosafety Level 2 Facilities and Strategies for Control.

    Science.gov (United States)

    Li, Xiao Yan; Xue, Kang Ning; Jiang, Jin Sheng; Lu, Xuan Cheng

    2016-04-01

    Concern about the biological hazards involved in microbiological research, especially research involving laboratory animals, has increased in recent years. Working in an animal biosafety level 2 facility (ABSL-2), commonly used for research on infectious diseases, poses various biological hazards. Here, the regulations and standards related to laboratory biosafety in China are introduced, the potential biological hazards present in ABSL-2 facilities are analyzed, and a series of strategies to control the hazards are presented. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  16. labelling and quality control of some 99m Tc-radiopharmaceuticals of expected biological activity

    International Nuclear Information System (INIS)

    Abdallah, A.B.I.

    2009-01-01

    this thesis addresses the labelling and quality control of some 99m Tc-radiopharmaceuticals which could be used for infection imaging. this study focuses on the labelling of sarafloxation, gatifloxation and cefepine with technetium-99m and biological evaluation of these labeled complexes and biodistribution in both normal and inflamed mice. the thesis is organized into two chapters: chapter I :labelling of some antibiotics chapter II :biological evaluation.

  17. Pythium invasion of plant-based life support systems: biological control and sources

    Science.gov (United States)

    Jenkins, D. G.; Cook, K. L.; Garland, J. L.; Board, K. F.; Sager, J. C. (Principal Investigator)

    2000-01-01

    Invasion of plant-based life support systems by plant pathogens could cause plant disease and disruption of life support capability. Root rot caused by the fungus, Pythium, was observed during tests of prototype plant growth systems containing wheat at the Kennedy Space Center (KSC). We conducted experiments to determine if the presence of complex microbial communities in the plant root zone (rhizosphere) resisted invasion by the Pythium species isolated from the wheat root. Rhizosphere inocula of different complexity (as assayed by community-level physiological profile: CLPP) were developed using a dilution/extinction approach, followed by growth in hydroponic rhizosphere. Pythium growth on wheat roots and concomitant decreases in plant growth were inversely related to the complexity of the inocula during 20-day experiments in static hydroponic systems. Pythium was found on the seeds of several different wheat cultivars used in controlled environmental studies, but it is unclear if the seed-borne fungal strain(s) were identical to the pathogenic strain recovered from the KSC studies. Attempts to control pathogens and their effects in hydroponic life support systems should include early inoculation with complex microbial communities, which is consistent with ecological theory.

  18. Effect of plant extracts and a disinfectant on biological parameters and pathogenicity of the fungus Beauveria bassiana (Bals. Vuill. (Ascomycota: Cordycipitaceae

    Directory of Open Access Journals (Sweden)

    C. C. Martins

    Full Text Available Abstract The fungus Beauveria bassiana is naturally found in poultry houses and causes high rates of mortality in Alphitobius diaperinus. Laboratory and field experiments have shown the potential of this fungus as an insect control agent. However, in poultry houses, bacteria as Salmonella, can be found and have been studied alternative control methods for this pathogen. Thus, this study aimed to evaluate the effect of plant extracts and a disinfectant on the fungus Beauveria bassiana (strain Unioeste 4. Conidial viability, colony-forming unit (CFU counts, vegetative growth, conidia production, insecticidal activity of the fungus and compatibility were used as parameters in the evaluation of the effect of these products on the fungus. Alcoholic and aqueous extracts of jabuticaba (Myrciaria cauliflora (Mart., guava (Psidium guajava (L., and jambolan (Syzygium cumini (L., at concentrations of 10% as well as the commercial disinfectant, Peroxitane® 1512 AL, were evaluated at the recommended concentrations (RC, 1:200 (RC, 0.5 RC and 2 RC. There was a negative influence of alcoholic and aqueous extracts of jabuticaba, guava and three dilutions of Peroxitane on the viability of conidia. The CFUs and vegetative growth of the fungus were affected only by the Peroxitane (all dilutions. For conidial production, the aqueous extract of guava had a positive effect, increasing production, while the Peroxitane at the R and RC concentrations resulted in a negative influence. The mortality of A. diaperinus, caused by the fungus after exposure to these products, was 60% for the peracetic acid at 0.5 RC, and above 80% for the extracts. Thus, the results showed that all the extracts and Peroxitane at RC 0.5 are compatible with the fungus B. bassiana Unioeste 4, however only the extracts had a low impact on inoculum potential.

  19. Meat Science and Muscle Biology Symposium: Ecological and dietary impactors of foodborne pathogens and methods to reduce fecal shedding in cattle.

    Science.gov (United States)

    Callaway, T R; Edrington, T S; Nisbet, D J

    2014-04-01

    Pathogenic bacteria can live asymptomatically within and on cattle and can enter the food chain but also can be transmitted to humans by fecal or direct animal contact. Reducing pathogenic bacterial incidence and populations within live cattle represents an important step in improving food safety. A broad range of preslaughter intervention strategies are being developed, which can be loosely classified as 1) directly antipathogen strategies, 2) competitive enhancement strategies (that use the microbiome's competitive nature against pathogens), and 3) animal management strategies. Included within these broad categories are such diverse methods as vaccination against foodborne pathogens, probiotics and prebiotics, bacterial viruses (i.e., bacteriophages), sodium chlorate feeding, and dietary and management changes that specifically alter the microbiome. The simultaneous application of 1 or more preharvest strategies has the potential to reduce human foodborne illnesses by erecting multiple hurdles preventing entry into humans. However, economic factors that govern producer profitability must be kept in mind while improving food safety.

  20. Biologically Inspired Modular Neural Control for a Leg-Wheel Hybrid Robot

    DEFF Research Database (Denmark)

    Manoonpong, Poramate; Wörgötter, Florentin; Laksanacharoen, Pudit

    2014-01-01

    In this article we present modular neural control for a leg-wheel hybrid robot consisting of three legs with omnidirectional wheels. This neural control has four main modules having their functional origin in biological neural systems. A minimal recurrent control (MRC) module is for sensory signal...... processing and state memorization. Its outputs drive two front wheels while the rear wheel is controlled through a velocity regulating network (VRN) module. In parallel, a neural oscillator network module serves as a central pattern generator (CPG) controls leg movements for sidestepping. Stepping directions...... or they can serve as useful modules for other module-based neural control applications....

  1. Randomized controlled trial of toothbrushing to reduce ventilator-associated pneumonia pathogens and dental plaque in a critical care unit.

    Science.gov (United States)

    Needleman, Ian G; Hirsch, Nicholas P; Leemans, Michele; Moles, David R; Wilson, Michael; Ready, Derren R; Ismail, Salim; Ciric, Lena; Shaw, Michael J; Smith, Martin; Garner, Anne; Wilson, Sally

    2011-03-01

    To investigate the effect of a powered toothbrush on colonization of dental plaque by ventilator-associated pneumonia (VAP)-associated organisms and dental plaque removal. Parallel-arm, single-centre, examiner- and analyst-masked randomized controlled trial. Forty-six adults were recruited within 48 h of admission. Test intervention: powered toothbrush, control intervention: sponge toothette, both used four times per day for 2 min. Groups received 20 ml, 0.2% chlorhexidine mouthwash at each time point. The results showed a low prevalence of respiratory pathogens throughout with no statistically significant differences between groups. A highly statistically significantly greater reduction in dental plaque was produced by the powered toothbrush compared with the control treatment; mean plaque index at day 5, powered toothbrush 0.75 [95% confidence interval (CI) 0.53, 1.00], sponge toothette 1.35 (95% CI 0.95, 1.74), p=0.006. Total bacterial viable count was also highly statistically significantly lower in the test group at day 5; Log(10) mean total bacterial counts: powered toothbrush 5.12 (95% CI 4.60, 5.63), sponge toothette 6.61 (95% CI 5.93, 7.28), p=0.002. Powered toothbrushes are highly effective for plaque removal in intubated patients in a critical unit and should be tested for their potential to reduce VAP incidence and health complications. © 2011 John Wiley & Sons A/S.

  2. Multiresistant pathogens in geriatric nursing – infection control in residential facilities for geriatric nursing in Germany

    Directory of Open Access Journals (Sweden)

    Peters, Claudia

    2014-09-01

    Full Text Available [english] Background: The increase of multidrug-resistant organisms (MDROs causes problems in geriatric nursing homes. Older people are at increased a growing risk of infection due to multimorbidity and frequent stays in hospital. A high proportion of the elderly require residential care in geriatric nursing facilities, where hygiene requirements in nursing homes are similar to those in hospitals. For this reason we examined how well nursing homes are prepared for MDROs and how effectively protect their infection control residents and staff.Methods: A cross-sectional study was performed on infection control in residential geriatric nursing facilities in Germany 2012. The questionnaire recorded important parameters of hygiene, resident and staff protection and actions in case of existing MDROs.Results: The response was 54% in Hamburg and 27% in the rest of Germany. Nursing homes were generally well equipped for dealing with infection control: There were standards for MDROs and regular hygiene training for staff. The facilities provided adequate protective clothing, affected residents are usually isolated and hygienic laundry processing conducted. There are deficits in the communication of information on infected residents with hospitals and general practitioners. 54% of nursing homes performed risk assessments for staff infection precaution.Conclusion: There is a growing interest in MDROs and infection control will be a challenge in for residential geriatric nursing facilities in the future. This issue has also drawn increasing attention. Improvements could be achieved by improving communication between different participants in the health service, together with specific measures for staff protection at work.

  3. Antifungal activity of plant extracts with potential to control plant pathogens in pineapple

    Directory of Open Access Journals (Sweden)

    Maria Diana Cerqueira Sales

    2016-01-01

    Conclusions: The findings of the present study concluded that mother tinctures can effectively control phytopathogens. The mother tincture extract of Myroxylon balsamum showed antifungal activity and was used here for the first time for inhibition of phytopathogenic fungi. This study paves the way for the development of bioactive natural products with phytosanitary applications, with the added benefits of an environmentally safe and economically viable product.

  4. Modelling approach for biological control of insect pest by releasing infected pest

    International Nuclear Information System (INIS)

    Tan Yuanshun; Chen Lansun

    2009-01-01

    Models of biological control have a long history of theoretical development that have focused on the interactions between a predator and a prey. Here we have extended the classical epidemic model to include a continuous and impulsive pest control strategies by releasing the infected pests bred in laboratory. For the continuous model, the results imply that the susceptible pest goes to extinct if the threshold condition R 0 0 > 1, the positive equilibrium of continuous model is globally asymptotically stable. Similarly, the threshold condition which guarantees the global stability of the susceptible pest-eradication periodic solution is obtained for the model with impulsive control strategy. Consequently, based on the results obtained in this paper, the control strategies which maintain the pests below an acceptably low level are discussed by controlling the release rate and impulsive period. Finally, the biological implications of the results and the efficiency of two control strategies are also discussed

  5. Screening of wheat endophytes as biological control agents against Fusarium head blight using two different in vitro tests.

    Science.gov (United States)

    Comby, Morgane; Gacoin, Marie; Robineau, Mathilde; Rabenoelina, Fanja; Ptas, Sébastien; Dupont, Joëlle; Profizi, Camille; Baillieul, Fabienne

    2017-09-01

    In order to find biological control agents (BCAs) for the management of Fusarium head blight (FHB), a major disease on wheat crops worldwide, 86 microorganisms isolated from inner tissues of wheat plants were discriminated for their ability to inhibit the growth of Fusarium graminearum and Fusarium culmorum by in vitro dual culture assays. A group of 22 strains appeared very effective to inhibit F. graminearum (inhibition of 30-51%) and they were also globally effective in controlling F. culmorum (inhibition of 15-53%). Further evaluation of a subselection of strains by screening on detached spikelets in vitro confirmed three species, namely Phoma glomerata, Aureobasidium proteae and Sarocladium kiliense, that have not yet been reported for their efficacy against Fusarium spp., indicating that looking for BCAs toward FHB among wheat endophytes proved to be promising. The efficacy of some strains turned out different between both in vitro screening approaches, raising the importance of finding the most appropriate screening approach for the search of BCAs. This study pointed out the interest of the test on detached wheat spikelets that provided information about a potential pathogenicity, the growth capacity and efficacy of the endophyte strains on the targeted plant, before testing them on whole plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  6. Hybridization of an invasive shrub affects tolerance and resistance to defoliation by a biological control agent

    OpenAIRE

    Williams, Wyatt I; Friedman, Jonathan M; Gaskin, John F; Norton, Andrew P

    2014-01-01

    Evolution has contributed to the successful invasion of exotic plant species in their introduced ranges, but how evolution affects particular control strategies is still under evaluation. For instance, classical biological control, a common strategy involving the utilization of highly specific natural enemies to control exotic pests, may be negatively affected by host hybridization because of shifts in plant traits, such as root allocation or chemical constituents. We investigated introgressi...

  7. Natural biological control of pest mites in Brazilian sun coffee agroecosystems.

    Science.gov (United States)

    Teodoro, Adenir V; Sarmento, Renato A; Rêgo, Adriano S; da Graça S Maciel, Anilde

    2010-06-01

    Coffee is one of the leading commodities in tropical America. Although plantations are usually established under a canopy of trees in most producing countries in the region, Brazilian coffee is mostly produced under full sun conditions. Such simple, single-crop agroecosystems with intensive agrochemical inputs often suffer with pests like mites. Predatory mites of the family Phytoseiidae are the main natural enemies associated with pest mites in the field. However, these beneficial arthropods struggle to survive in intensive agroecosystems such as coffee monocultures due to unfavorable microclimatic conditions, widespread pesticide use, and lack of alternative food (pollen, nectar). Conservation biological control uses a range of management strategies to sustain and enhance populations of indigenous natural enemies such as predatory mites. We discuss here conservation biological control as a strategy to improve biological control of pest mites by native predatory mites in Brazilian coffee monocultures as well as some related patents.

  8. Isolation and characterization of Enterobacteriaceae species infesting post-harvest strawberries and their biological control using bacteriophages.

    Science.gov (United States)

    Kurtböke, D Ipek; Palk, A; Marker, A; Neuman, C; Moss, L; Streeter, K; Katouli, M

    2016-10-01

    Strawberry is a significantly consumed fruit worldwide, mostly without being subjected to disinfection processes. During the harvest and transfer from farm to consumers as well as where organic farming practises have been employed, the surface of the fruit may become contaminated by pathogenic bacteria. Post-harvest strawberry fruits in punnets available for public consumption were thus screened for the presence of enteric bacteria in the Sunshine Coast region of Queensland, Australia. Some of the tested samples (13 %) were found to carry such bacteria and even in greater numbers if organic amendments were used (69 %). The bacteria were found to belong in the genera of Escherichia, Enterobacter, Raoultella, Klebsiella, Pantoea, Shigella, Citrobacter and Cronobacter within the family Enterobacteriaceae. Some of the isolates were found to adhere to Caco-2 cells representing human gut epithelium as well as carrying virulence and toxin genes. Resistance mostly against sulphafurazole, cefoxitin, ampicillin and nitrofurantoin was found among 14 different antimicrobial agents tested including 100 % resistance to cefoxitin and ampicillin in the genus Pantoea. In the second phase of the study, bacteriophages were isolated against the isolates and were subsequently applied to post-harvest fruits. A significant (P ≤ 0.001) reduction in the number of enteric bacteria was observed when a high-titre polyvalent bacteriophage suspension (×10(12) PFU/mL) was applied to the fruit surface. Bacteriophages also decreased the adhesion of the Escherichia coli isolates to Caco-2 cells. Findings might indicate that biological control using bacteriophages might be of significant value for the industry targeting to reduce pathogenic loads of bacteria on the fruit.

  9. Prevalence of bloodstream pathogens is higher in neonatal encephalopathy cases vs. controls using a novel panel of real-time PCR assays.

    Science.gov (United States)

    Tann, Cally J; Nkurunziza, Peter; Nakakeeto, Margaret; Oweka, James; Kurinczuk, Jennifer J; Were, Jackson; Nyombi, Natasha; Hughes, Peter; Willey, Barbara A; Elliott, Alison M; Robertson, Nicola J; Klein, Nigel; Harris, Kathryn A

    2014-01-01

    In neonatal encephalopathy (NE), infectious co-morbidity is difficult to diagnose accurately, but may increase the vulnerability of the developing brain to hypoxia-ischemia. We developed a novel panel of species-specific real-time PCR assays to identify bloodstream pathogens amongst newborns with and without NE in Uganda. Multiplex real-time PCR assays for important neonatal bloodstream pathogens (gram positive and gram negative bacteria, cytomegalovirus (CMV), herpes simplex virus(HSV) and P. falciparum) were performed on whole blood taken from 202 encephalopathic and 101 control infants. Automated blood culture (BACTEC) was performed for all cases and unwell controls. Prevalence of pathogenic bacterial species amongst infants with NE was 3.6%, 6.9% and 8.9%, with culture, PCR and both tests in combination, respectively. More encephalopathic infants than controls had pathogenic bacterial species detected (8.9%vs2.0%, p = 0.028) using culture and PCR in combination. PCR detected bacteremia in 11 culture negative encephalopathic infants (3 Group B Streptococcus, 1 Group A Streptococcus, 1 Staphylococcus aureus and 6 Enterobacteriacae). Coagulase negative staphylococcus, frequently detected by PCR amongst case and control infants, was considered a contaminant. Prevalence of CMV, HSV and malaria amongst cases was low (1.5%, 0.5% and 0.5%, respectively). This real-time PCR panel detected more bacteremia than culture alone and provides a novel tool for detection of neonatal bloodstream pathogens that may be applied across a range of clinical situations and settings. Significantly more encephalopathic infants than controls had pathogenic bacterial species detected suggesting that infection may be an important risk factor for NE in this setting.

  10. Prevalence of bloodstream pathogens is higher in neonatal encephalopathy cases vs. controls using a novel panel of real-time PCR assays.

    Directory of Open Access Journals (Sweden)

    Cally J Tann

    Full Text Available In neonatal encephalopathy (NE, infectious co-morbidity is difficult to diagnose accurately, but may increase the vulnerability of the developing brain to hypoxia-ischemia. We developed a novel panel of species-specific real-time PCR assays to identify bloodstream pathogens amongst newborns with and without NE in Uganda.Multiplex real-time PCR assays for important neonatal bloodstream pathogens (gram positive and gram negative bacteria, cytomegalovirus (CMV, herpes simplex virus(HSV and P. falciparum were performed on whole blood taken from 202 encephalopathic and 101 control infants. Automated blood culture (BACTEC was performed for all cases and unwell controls.Prevalence of pathogenic bacterial species amongst infants with NE was 3.6%, 6.9% and 8.9%, with culture, PCR and both tests in combination, respectively. More encephalopathic infants than controls had pathogenic bacterial species detected (8.9%vs2.0%, p = 0.028 using culture and PCR in combination. PCR detected bacteremia in 11 culture negative encephalopathic infants (3 Group B Streptococcus, 1 Group A Streptococcus, 1 Staphylococcus aureus and 6 Enterobacteriacae. Coagulase negative staphylococcus, frequently detected by PCR amongst case and control infants, was considered a contaminant. Prevalence of CMV, HSV and malaria amongst cases was low (1.5%, 0.5% and 0.5%, respectively.This real-time PCR panel detected more bacteremia than culture alone and provides a novel tool for detection of neonatal bloodstream pathogens that may be applied across a range of clinical situations and settings. Significantly more encephalopathic infants than controls had pathogenic bacterial species detected suggesting that infection may be an important risk factor for NE in this setting.

  11. Using consumption rate to assess potential predators for biological control of white perch

    Directory of Open Access Journals (Sweden)

    Gosch N.J.C.

    2011-08-01

    Full Text Available Control of undesirable fishes is important in aquatic systems, and using predation as a tool for biological control is an attractive option to fishery biologists. However, determining the appropriate predators for biological control is critical for success. The objective of this study was to evaluate the utility of consumption rate as an index to determine the most effective predators for biological control of an invasive fish. Consumption rate values were calculated for nine potential predators that prey on white perch Morone americana in Branched Oak and Pawnee reservoirs, Nebraska. The consumption rate index provided a unique and insightful means of determining the potential effectiveness of each predator species in controlling white perch. Cumulative frequency distributions facilitated interpretation by providing a graphical presentation of consumption rates by all individuals within each predator species. Largemouth bass Micropterus salmoides, walleye Sander vitreus and sauger S. canadensis were the most efficient white perch predators in both reservoirs; however, previous attempts to increase biomass of these predators have failed suggesting that successful biological control is unlikely using existing predator species in these Nebraska reservoirs.

  12. Effect of biological activated carbon pre-treatment to control organic fouling in the microfiltration of biologically treated secondary effluent.

    Science.gov (United States)

    Pramanik, Biplob Kumar; Roddick, Felicity A; Fan, Linhua

    2014-10-15

    Biological activated carbon (BAC) filtration was investigated as a pre-treatment for reducing the organic fouling of a microfiltration membrane (0.1 μm polyvinylidene fluoride) in the treatment of a biologically treated secondary effluent (BTSE) from a municipal wastewater treatment plant. BAC treatment of the BTSE resulted in a marked improvement in permeate flux, which was attributed to the effective removal of organic foulants and particulates. Although the BAC removed significantly less dissolved organic carbon than the granular activated carbon (GAC) treatment which was used as a control for comparison, it led to a markedly greater flux. This was attributed to the effective removal of the very high molecular weight substances such as biopolymers by the BAC through biodegradation and adsorption of those molecules on the biofilm. Size exclusion chromatography showed the BAC treatment led to approximately 30% reduction in these substances, whereas the GAC did not greatly remove these molecules. The BAC treatment led to a greater reduction of loosely-attached and firmly-attached membrane surface foulant, and this was confirmed by attenuated total reflection-fourier transform infrared spectroscopy analysis. This study demonstrated the potential of BAC pre-treatment for reducing organic fouling and thus improving flux for the microfiltration of BTSE. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Microbial pathogens in raw pork, chicken, and beef: benefit estimates for control using irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, T.

    1985-12-01

    Various control procedures have been suggested for reducing foodborne infectious diseases. Receiving considerable attention is irradiation. This report estimates the medical and wage (or productivity) benefits associated with prevention of five human diseases transmitted by beef, pork, and chicken. (These diseases can also be transmitted by other vectors, such as eggs, milk, and pets. But these sources are not included in the analysis.) All of these foodborne infectious diseases - salmonellosis, campylobacteriosis, trichinosis, tapeworm, and toxoplasmosis - could be significantly reduced by irradiating meat and poultry. The Food and Drug Administration (FDA) has just approved irradiation of pork to prevent trichinosis (50FR 29658-59) and is considering approval of irradiation of chicken to kill Salmonella. 22 references.

  14. TiO2 nanocomposite for the controlled release of drugs against pathogens causing wound infections

    Science.gov (United States)

    Devanand Venkatasubbu, G.; Nagamuthu, S.; Anusuya, T.; Kumar, J.; Chelliah, Ramachandran; Rani Ramakrishnan, Sudha; Antony, Usha; Khan, Imran; Oh, Deog-Hwan

    2018-02-01

    Chitosan titanium dioxide nanocomposite has been used for wound healing. Titanium dioxide (TiO2) nanoparticles are synthesised and made in to nanocomposite along with chitosan. Curcumin nanoparticles are synthesised. Three different drugs with antimicrobial activity are incorporated into the chitosan/TiO2nanocomposite. Ciprofloxacin, amoxicillin and curcumin nanoparticles are incorporated within the chitosan/TiO2 nanoparticles. The nanoparticles and nanocomposite are characterized with XRD, FTIR, TEM and SEM. Drug loading was found to be around 45% for all the three drug molecules. The drug release profile shows a controlled release of drug molecules from the nanocomposite. Antibacterial studies shows a good inhibition of bacterial species by the nanocomposites.

  15. Microbial pathogens in raw pork, chicken, and beef: benefit estimates for control using irradiation

    International Nuclear Information System (INIS)

    Roberts, T.

    1985-01-01

    Various control procedures have been suggested for reducing foodborne infectious diseases. Receiving considerable attention is irradiation. This report estimates the medical and wage (or productivity) benefits associated with prevention of five human diseases transmitted by beef, pork, and chicken. (These diseases can also be transmitted by other vectors, such as eggs, milk, and pets. But these sources are not included in the analysis.) All of these foodborne infectious diseases - salmonellosis, campylobacteriosis, trichinosis, tapeworm, and toxoplasmosis - could be significantly reduced by irradiating meat and poultry. The Food and Drug Administration (FDA) has just approved irradiation of pork to prevent trichinosis (50FR 29658-59) and is considering approval of irradiation of chicken to kill Salmonella. 22 references

  16. Stringent Expression Control of Pathogenic R-body Production in Legume Symbiont Azorhizobium caulinodans

    Directory of Open Access Journals (Sweden)

    Jun-ichi Matsuoka

    2017-07-01

    Full Text Available R bodies are insoluble large polymers consisting of small proteins encoded by reb genes and are coiled into cylindrical structures in bacterial cells. They were first discovered in Caedibacter species, which are obligate endosymbionts of paramecia. Caedibacter confers a killer trait on the host paramecia. R-body-producing symbionts are released from their host paramecia and kill symbiont-free paramecia after ingestion. The roles of R bodies have not been explained in bacteria other than Caedibacter. Azorhizobium caulinodans ORS571, a microsymbiont of the legume Sesbania rostrata, carries a reb operon containing four reb genes that are regulated by the repressor PraR. Herein, deletion of the praR gene resulted in R-body formation and death of host plant cells. The rebR gene in the reb operon encodes an activator. Three PraR binding sites and a RebR binding site are present in the promoter region of the reb operon. Expression analyses using strains with mutations within the PraR binding site and/or the RebR binding site revealed that PraR and RebR directly control the expression of the reb operon and that PraR dominantly represses reb expression. Furthermore, we found that the reb operon is highly expressed at low temperatures and that 2-oxoglutarate induces the expression of the reb operon by inhibiting PraR binding to the reb promoter. We conclude that R bodies are toxic not only in paramecium symbiosis but also in relationships between other bacteria and eukaryotic cells and that R-body formation is controlled by environmental factors.

  17. Evaluation of impedance on biological Tissues using automatic control measurement system

    Energy Technology Data Exchange (ETDEWEB)

    Kil, Sang Hyeong; Shin, Dong Hoon; Lee, Seong Mo [Pusan National University, Yangsan (Korea, Republic of); Lee, Moo Seok; Kim, Sang Sik [Pusan National University, Busan (Korea, Republic of); Kim, Gun FDo; Lee, Jong Kyu [Pukyung National University, Busan (Korea, Republic of)

    2015-08-15

    Each biological tissue has endemic electrical characteristics owing to various differences such as those in cellular arrangement or organization form. The endemic electrical characteristics change when any biological change occurs. This work is a preliminary study surveying the changes in the electrical characteristics of biological tissue caused by radiation exposure. For protection against radiation hazards, therefore the electrical characteristics of living tissue were evaluated after development of the automatic control measurement system using LabVIEW. No alteration of biological tissues was observed before and after measurement of the electrical characteristics, and the biological tissues exhibited similar patterns. Through repeated measurements using the impedance/gain-phase analyzer, the coefficient of variation was determined as within 10%. The reproducibility impedance phase difference in electrical characteristics of the biological tissue did not change, and the tissue had resistance. The absolute value of impedance decreased constantly in proportion to the frequency. It has become possible to understand the electrical characteristics of biological tissues through the measurements made possible by the use of the developed.

  18. Evaluation of impedance on biological Tissues using automatic control measurement system

    International Nuclear Information System (INIS)

    Kil, Sang Hyeong; Shin, Dong Hoon; Lee, Seong Mo; Lee, Moo Seok; Kim, Sang Sik; Kim, Gun FDo; Lee, Jong Kyu

    2015-01-01

    Each biological tissue has endemic electrical characteristics owing to various differences such as those in cellular arrangement or organization form. The endemic electrical characteristics change when any biological change occurs. This work is a preliminary study surveying the changes in the electrical characteristics of biological tissue caused by radiation exposure. For protection against radiation hazards, therefore the electrical characteristics of living tissue were evaluated after development of the automatic control measurement system using LabVIEW. No alteration of biological tissues was observed before and after measurement of the electrical characteristics, and the biological tissues exhibited similar patterns. Through repeated measurements using the impedance/gain-phase analyzer, the coefficient of variation was determined as within 10%. The reproducibility impedance phase difference in electrical characteristics of the biological tissue did not change, and the tissue had resistance. The absolute value of impedance decreased constantly in proportion to the frequency. It has become possible to understand the electrical characteristics of biological tissues through the measurements made possible by the use of the developed.

  19. Controlled Synthesis of Gold Nanoparticles Using Aspergillus terreus IF0 and Its Antibacterial Potential against Gram Negative Pathogenic Bacteria

    International Nuclear Information System (INIS)

    Priyadarshini, E.; Pradhan, N.; Sukla, L.B.; Panda, P.K.; Pradhan, N.

    2014-01-01

    Biosynthesis of monodispersed nanoparticles, along with determination of potential responsible biomolecules, is the major bottleneck in the area of bio nano technology research. The present study focuses on an eco friendly, ambient temperature protocol for size controlled synthesis of gold nanoparticles, using the fungus Aspergillus terreus IF0. Gold nanoparticles were formed immediately, with the addition of chloroauric acid to the aqueous fungal extract. Synthesized nanoparticles were characterized by UV-Vis spectroscopy, TEM-EDX, and XRD analysis. Particle diameter and dispersity of nanoparticles were controlled by varying the ph of the fungal extract. At ph 10, the average size of the synthesized particles was in the range of 10–19 nm. Dialysis to obtain high and low molecular weight fraction followed by FTIR analysis revealed that biomolecules larger than 12 kDa and having –CH, –NH, and –SH functional groups were responsible for bioreduction and stabilization. In addition, the synthesized gold nanoparticles were found to be selectively bactericidal against the pathogenic gram negative bacteria, Escherichia coli.

  20. Biological control of Orobanche aegyptiaca by Fusarium oxysporum F. sp. Orobanchein northwest Iran.

    Science.gov (United States)

    Saremi, H; Okhovvat, S M

    2008-01-01

    Broomrape (Orobanche aegyptiaca) is one of the most serious weed pathogen on many plants all over the world, especially in northwest Iran. It causes damage on some plants particularly on tomato, cucumber and other dicotyledonous crops in zanjan province. Broomrape as weed, caused reductions in crop yield, adversely affected crop quality, and resulted in loss of cultivated land due to reduced crop alternatives. Since there were no any chemical methods and other proper technique to control this plant parasite we tried to find a good mechanism for its management in the fields. Our study showed there was a specific species, Fusarium oxysporum f. sp. orobonche that had infected Broomrapes naturally in the field. In point of fact the species was isolated from naturally infected Broomrape in studied Locations. Our surveys showed F. oxysporum f. sp. orobanche caused disease on orobanche spp. in different agricultural fields. Although there were other fungal species which can nearly manage the orobanche but it can be fungal pathogen to other plants. However the best fungal isolate can be F. oxysporum f. sp. orobanche since it may not be pathogen for other plants.

  1. Gamma irradiation in the control of pathogenic bacteria in refrigerated ground chicken meat

    Directory of Open Access Journals (Sweden)

    Spoto Marta Helena Filet

    2000-01-01

    Full Text Available This work evaluated the effect of gamma radiation on reducting the population of Staphylococcus aureus, Escherichia coli and Salmonella typhimurium in ground chicken breast stored under refrigeration. The experiment included a control and 4 doses of gamma radiation (2.0, 4.0, 6.0 and 8.0 kGy along with 5 periods of storage under refrigeration (1, 7, 14, 21 and 28 days. Samples of ground chicken breast were inoculated with Staphylococcus aureus (ATCC 14458, Escherichia coli (ATCC 11105 and Salmonella typhimurium (ATCC 0626, irradiated at temperatures between 4 and 8°C and stored under refrigeration (5°C for 28 days. The increased radiation dose and period of storage under refrigeration caused a reduction of Staphylococcus aureus, Escherichia coli and Salmonella typhimurium populations in the ground chicken breast. Mean radiation D values determined for Staphylococcus aureus and Escherichia coli were 0.41 and 0.72 kGy, respectively. Gamma irradiation was an effective treatment for chicken meat conservation because the radiation dose of 6.0 kGy kept the ground chicken breast within the microbiological limits established by the Brazilian legislation, for up to 28 days under refrigeration.

  2. Genetically Engineered Virulent Phage Banks in the Detection and Control of Emergent Pathogenic Bacteria

    Science.gov (United States)

    Blois, Hélène; Iris, François

    2010-01-01

    Natural outbreaks of multidrug-resistant microorganisms can cause widespread devastation, and several can be used or engineered as agents of bioterrorism. From a biosecurity standpoint, the capacity to detect and then efficiently control, within hours, the spread and the potential pathological effects of an emergent outbreak, for which there may be no effective antibiotics or vaccines, become key challenges that must be met. We turned to phage engineering as a potentially highly flexible and effective means to both detect and eradicate threats originating from emergent (uncharacterized) bacterial strains. To this end, we developed technologies allowing us to (1) concurrently modify multiple regions within the coding sequence of a gene while conserving intact the remainder of the gene, (2) reversibly interrupt the lytic cycle of an obligate virulent phage (T4) within its host, (3) carry out efficient insertion, by homologous recombination, of any number of engineered genes into the deactivated genomes of a T4 wild-type phage population, and (4) reactivate the lytic cycle, leading to the production of engineered infective virulent recombinant progeny. This allows the production of very large, genetically engineered lytic phage banks containing, in an E. coli host, a very wide spectrum of variants for any chosen phage-associated function, including phage host-range. Screening of such a bank should allow the rapid isolation of recombinant T4 particles capable of detecting (ie, diagnosing), infecting, and destroying hosts belonging to gram-negative bacterial species far removed from the original E. coli host. PMID:20569057

  3. Gamma irradiation in the control of pathogenic bacteria in refrigerated ground chicken meat

    International Nuclear Information System (INIS)

    Spoto, Marta Helena Fillet; Alcarde, Andre Ricardo; Gurgel, Maria Silvia do Amaral; Blumer, Lucimara; Walder, Julio Marcos Melges; Domarco, Rachel Elisabeth; Gallo, Claudio Rosa

    2000-01-01

    This work evaluated the effect of gamma radiation on reducing the population of Staphylococcus aureus, Escherichia coli nd Salmonella typhimurium in ground chicken breast stored under refrigeration. The experiment included a control and 4 doses of gamma radiation ( 2.0, 4.0, 6.0 and 8.0 kGy) along with 5 periods of storage under refrigeration ( 1, 7 14, 21 and 28 days). Samples of ground chicken breast were inoculated with Staphylococcus aureus (ATCC 14458), Escherichia coli (ATCC 11105) and Salmonella typhimurium (ATCC 0626), irradiated at temperatures between 4 and 8 deg C and stored under refrigeration (5 deg C) for 28 days. The increased radiation dose and period of storage under refrigeration caused a reduction of Staphylococcus aureus, Escherichia coli and Salmonella typhimurium populations in the ground chicken breast. Mean radiation D values determined for Staphylococcus aureus and Escherichia coli were 0.41 and 0.72 kGy, respectively. Gamma irradiation was an effective treatment for chicken meat conservation because the radiation dose of 6.0 kGy kept the ground chicken breast within the microbiological limits established by the Brazilian legislation for up to 28 days under refrigeration. (author)

  4. Processes for managing pathogens.

    Science.gov (United States)

    Godfree, Alan; Farrell, Joseph

    2005-01-01

    Wastewater contains human, animal, and plant pathogens capable of causing viral, bacterial, or parasitic infections. There are several routes whereby sewage pathogens may affect human health, including direct contact, contamination of food crops, zoonoses, and vectors. The range and numbers of pathogens in municipal wastewater vary with the level of endemic disease in the community, discharges from commercial activities, and seasonal factors. Regulations to control pathogen risk in the United States and Europe arising from land application of biosolids are based on the concept of multiple barriers to the prevention of transmission. The barriers are (i) treatment to reduce pathogen content and vector attraction, (ii) restrictions on crops grown on land to which biosolids have been applied, and (iii) minimum intervals following application and grazing or harvesting. Wastewater treatment reduces number of pathogens in the wastewater by concentrating them with the solids in the sludge. Although some treatment processes are designed specifically to inactivate pathogens, many are not, and the actual mechanisms of microbial inactivation are not fully understood for all processes. Vector attraction is reduced by stabilization (reduction of readily biodegradable material) and/or incorporation immediately following application. Concerns about health risks have renewed interest in the effects of treatment (on pathogens) and advanced treatment methods, and work performed in the United States suggests that Class A pathogen reduction can be achieved less expensively than previously thought. Effective pathogen risk management requires control to the complete chain of sludge treatment, biosolids handling and application, and post-application activities. This may be achieved by adherence to quality management systems based on hazard analysis critical control point (HACCP) principles.

  5. Biologically inspired control and modeling of (biorobotic systems and some applications of fractional calculus in mechanics

    Directory of Open Access Journals (Sweden)

    Lazarević Mihailo P.

    2013-01-01

    Full Text Available In this paper, the applications of biologically inspired modeling and control of (biomechanical (nonredundant mechanisms are presented, as well as newly obtained results of author in mechanics which are based on using fractional calculus. First, it is proposed to use biological analog-synergy due to existence of invariant features in the execution of functional motion. Second, the model of (biomechanical system may be obtained using another biological concept called distributed positioning (DP, which is based on the inertial properties and actuation of joints of considered mechanical system. In addition, it is proposed to use other biological principles such as: principle of minimum interaction, which takes a main role in hierarchical structure of control and self-adjusting principle (introduce local positive/negative feedback on control with great amplifying, which allows efficiently realization of control based on iterative natural learning. Also, new, recently obtained results of the author in the fields of stability, electroviscoelasticity, and control theory are presented which are based on using fractional calculus (FC. [Projekat Ministarstva nauke Republike Srbije, br. 35006

  6. The role of evolutionary biology in research and control of liver flukes in Southeast Asia.

    Science.gov (United States)

    Echaubard, Pierre; Sripa, Banchob; Mallory, Frank F; Wilcox, Bruce A

    2016-09-01

    Stimulated largely by the availability of new technology, biomedical research at the molecular-level and chemical-based control approaches arguably dominate the field of infectious diseases. Along with this, the proximate view of disease etiology predominates to the exclusion of the ultimate, evolutionary biology-based, causation perspective. Yet, historically and up to today, research in evolutionary biology has provided much of the foundation for understanding the mechanisms underlying disease transmission dynamics, virulence, and the design of effective integrated control strategies. Here we review the state of knowledge regarding the biology of Asian liver Fluke-host relationship, parasitology, phylodynamics, drug-based interventions and liver Fluke-related cancer etiology from an evolutionary biology perspective. We consider how evolutionary principles, mechanisms and research methods could help refine our understanding of clinical disease associated with infection by Liver Flukes as well as their transmission dynamics. We identify a series of questions for an evolutionary biology research agenda for the liver Fluke that should contribute to an increased understanding of liver Fluke-associated diseases. Finally, we describe an integrative evolutionary medicine approach to liver Fluke prevention and control highlighting the need to better contextualize interventions within a broader human health and sustainable development framework. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. The inception and evolution of a unique masters program in cancer biology, prevention and control.

    Science.gov (United States)

    Cousin, Carolyn; Blancato, Jan

    2010-09-01

    The University of the District of Columbia (UDC) and the Lombardi Comprehensive Cancer Center (LCCC), Georgetown University Medical Center established a Masters Degree Program in Cancer Biology, Prevention and Control at UDC that is jointly administered and taught by UDC and LCCC faculty. The goal of the Masters Degree Program is to educate students as master-level cancer professionals capable of conducting research and service in cancer biology, prevention, and control or to further advance the education of students to pursue doctoral studies. The Program's unique nature is reflected in its philosophy "the best cancer prevention and control researchers are those with a sound understanding of cancer biology". This program is a full-time, 2-year, 36-credit degree in which students take half of their coursework at UDC and half of their coursework at LCCC. During the second year, students are required to conduct research either at LCCC or UDC. Unlike most cancer biology programs, this unique Program emphasizes both cancer biology and cancer outreach training.

  8. Effect of oil gum massage therapy on common pathogenic oral microorganisms - A randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Nishu Singla

    2014-01-01

    Full Text Available Objectives: (i To assess reduction in Streptococcus mutans and Lactobacillus species count in saliva sample after ten minutes of oil gum massage therapy (massage of gingival tissues per day for three weeks with sesame oil, olive oil, and coconut oil in three different groups of subjects. (ii To compare the efficacy between three different oils and the "gold standard" chlorhexidine gel. (iii To assess reduction in gingival scores and plaque scores of study subjects. Materials and Methods: Study design - Single center, parallel design, and triple blind randomized clinical study with four treatment groups. Participants: 32 of the 40 study subjects working as housekeeping personnel at Kasturba Hospital, Manipal; aged 18-55 years completed the three-week study period. Interventions: Subjects were randomly assigned to massage their gingiva everyday for three weeks with sesame oil, olive oil, coconut oil (tests, and Chlorhexidine gel (control. Oral health status and paraffin stimulated saliva samples were obtained at baseline and after three weeks of oil gum massage therapy. Outcome measures: Microbial culture, plaque index, and gingival index. Statistical analysis: Paired t test and Kruskal Wallis test. Results: There was a significant reduction in mean Streptococcus mutans count, Lactobacillus count, plaque scores, and gingival scores in all four groups after the study. However, there was no significant difference found in percentage reduction of these variables between the four groups. Conclusion: These oils can be used as valuable preventive agents in maintaining and improving oral health in low socioeconomic status population. However, it is recommended that further research should be conducted in other populations with a larger sample and longer duration of follow-up period.

  9. Functional role of phenylacetic acid from metapleural gland secretions in controlling fungal pathogens in evolutionarily derived leaf-cutting ants

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Nash, David Richard; Higginbotham, Sarah

    2015-01-01

    Fungus-farming ant colonies vary four to five orders of magnitude in size. They employ compounds from actinomycete bacteria and exocrine glands as antimicrobial agents. Atta colonies have millions of ants and are particularly relevant for understanding hygienic strategies as they have abandoned...... their ancestors’ prime dependence on antibiotic-based biological control in favour of using metapleural gland (MG) chemical secretions. Atta MGs are unique in synthesizing large quantities of phenylacetic acid (PAA), a known but little investigated antimicrobial agent.We showthat particularly the smallestworkers...... derived leaf-cutting ants are less sensitive to PAA than strains from phylogenetically more basal fungus-farming ants, consistent with the dynamics of an evolutionary arms race between virulence and control for Escovopsis, but not Metarhizium. Atta ants form larger colonies with more extreme caste...

  10. Potential for widespread application of biological control of stored-product pests

    DEFF Research Database (Denmark)

    Hansen, Lise Stengaard

    2007-01-01

    Biological control of stored product pests has substantial potential in Europe". This is essentially the conclusion of the activities of a European working group funded by the COST system, an intergovernmental networking system. Working group 4 of COST action 842 (2000-2005) focussed on biologica...... for these situations will contribute to ensuring that stored food products are protected from insect and mite pests using techniques that are safe for consumers, workers and the environment.......Biological control of stored product pests has substantial potential in Europe". This is essentially the conclusion of the activities of a European working group funded by the COST system, an intergovernmental networking system. Working group 4 of COST action 842 (2000-2005) focussed on biological...

  11. Combating a global threat to a clonal crop: banana black sigatoka pathogen pseudocercospora fijiensis (synonym mycosphaerella fijiensis) genomes reveal clues for disease control

    Science.gov (United States)

    Mycosphaerella fijiensis is the fungal pathogen that causes black Sigatoka or leaf streak disease of banana. Control of this disease requires weekly applications of fungicides in most cultivation areas. Major problems for disease management are fungicide resistance and the lack of effective genes fo...

  12. Surface motility in Pseudomonas sp DSS73 is required for efficient biological containment of the root-pathogenic microfungi Rhizoctonia solani and Pythium ultimum

    DEFF Research Database (Denmark)

    Andersen, Jens Bo; Koch, Birgit; Nielsen, T.H.

    2003-01-01

    Pseudomonas sp. DSS73 was isolated from the rhizoplane of sugar beet seedlings. This strain exhibits antagonism towards the root-pathogenic microfungi Pythium ultimum and Rhizoctonia solani. Production of the cyclic lipopeptide amphisin in combination with expression of flagella enables the growing......-pathogenic microfungi is shown to arise from amphisin-dependent surface translocation and growth by which the bacterium can lay siege to the fungi. The synergistic effects of surface motility and synthesis of a battery of antifungal compounds efficiently contain and terminate growth of the microfungi....

  13. Fundamental host range of Leptoypha hospita (Hemiptera: Tingidae), a potential biological control agent of Chinese privet

    Science.gov (United States)

    Yanzhuo Zhang; James L. Hanula; Scott Horn; Cera Jones; S. Kristine Braman; Jianghua Sun

    2016-01-01

    Chinese privet, Ligustrum sinense Lour., is an invasive shrub within riparian areas of the southeastern United States. Biological control is considered the most suitable management option for Chinese privet. The potential host range of the lace bug, Leptoypha hospita Drake et...

  14. Biological control in agro-systems by means of the handling of entomophagous insects

    International Nuclear Information System (INIS)

    Nicholls, Clara Ines; Altieri, Miguel A

    1998-01-01

    From several decades ago the importance of natural enemies of the noxious organisms has been recognized. Unfortunately the introduction of the biological control has not had the desired dimension. The indiscriminate use of biocides products has altered the biodiversity of the agro-ecosystem. The parasitoids and predators have suffered the noxious effects of the plaguicides. These natural enemies of the plagues play a momentous paper in the regulation of noxious insects population. The predators of the insecta class register in diverse orders and the abundance of species is impressive. But the knowledge of their importance is only partial. In many countries the kindness of these organisms has not been specified and does not protect them. In the case of parasitoids something similar occurs. It is say that their biotic diversity is incalculable but very few species are exploited. In these two groups rest the classic biological control projects. The successes in projects of biological control are recognized and they are enlarging in several countries but more impulse is required. Due to demands of a sustainable agricultural production it should support the biological control of plagues. In this document general looks on the topic are expounded

  15. Leveraging culture collections for the discovery and development of microbial biological control agents

    Science.gov (United States)

    The incorporation of living microbial biological control agents into integrated pest management programs is highly desirable because it reduces the use of chemical insecticides harmful to livestock, humans and the environment. In addition, it provides an alternative means to combat resistance to che...

  16. The potential use of lures for thrips biological control in greenhouses: practice and theory

    NARCIS (Netherlands)

    Teulon, D.A.J.; Davidson, M.M.; Nielsen, M.C.; Perry, N.B.; Tol, van R.W.H.M.; Kogel, de W.J.

    2008-01-01

    Exploiting the response of thrips pest species to odours has long been a goal for improving thrips pest management including biological control. Applications of attractants could include improved monitoring, push-pull (in conjunction with a repellent odour), lure and kill, and lure and infect

  17. Conservation Biological Control of Pests in the Molecular Era: New Opportunities to Address Old Constraints

    Science.gov (United States)

    Gurr, Geoff M.; You, Minsheng

    2016-01-01

    Biological control has long been considered a potential alternative to pesticidal strategies for pest management but its impact and level of use globally remain modest and inconsistent. A rapidly expanding range of molecular – particularly DNA-related – techniques is currently revolutionizing many life sciences. This review identifies a series of constraints on the development and uptake of conservation biological control and considers the contemporary and likely future influence of molecular methods on these constraints. Molecular approaches are now often used to complement morphological taxonomic methods for the identification and study of biological control agents including microbes. A succession of molecular techniques has been applied to ‘who eats whom’ questions in food-web ecology. Polymerase chain reaction (PCR) approaches have largely superseded immunological approaches such as enzyme-linked immunosorbent assay (ELISA) and now – in turn – are being overtaken by next generation sequencing (NGS)-based approaches that offer unparalleled power at a rapidly diminishing cost. There is scope also to use molecular techniques to manipulate biological control agents, which will be accelerated with the advent of gene editing tools, the CRISPR/Cas9 system in particular. Gene editing tools also offer unparalleled power to both elucidate and manipulate plant defense mechanisms including those that involve natural enemy attraction to attacked plants. Rapid advances in technology will allow the development of still more novel pest management options for which uptake is likely to be limited chiefly by regulatory hurdles. PMID:26793225

  18. Low doses of ionizing radiation: Biological effects and regulatory control. Contributed papers

    International Nuclear Information System (INIS)

    1997-11-01

    The International Atomic Energy Agency and the World Health Organization, in cooperation with the United Nations Scientific Committee on the Effects of Atomic Radiation, organized an international conference on Low Doses of Ionizing Radiation: Biological Effects and Regulatory Control, held in seville, Spain, from 17 to 21 November 1997. This technical document contains concise papers submitted to the conference

  19. Low doses of ionizing radiation: Biological effects and regulatory control. Contributed papers

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-11-01

    The International Atomic Energy Agency and the World Health Organization, in cooperation with the United Nations Scientific Committee on the Effects of Atomic Radiation, organized an international conference on Low Doses of Ionizing Radiation: Biological Effects and Regulatory Control, held in seville, Spain, from 17 to 21 November 1997. This technical document contains concise papers submitted to the conference. Refs, figs, tabs.

  20. Economic evaluation of the successful biological control of Azolla filiculoides in South Africa

    CSIR Research Space (South Africa)

    McConnachie, AJ

    2003-09-01

    Full Text Available that it was no longer considered a problem in South Africa. The results reflect the dynamics of biological control on site-specific survey information, and place higher benefit–cost ratios achieved in other national level studies in a better context. It also raises...

  1. The effect of initial density and parasitoid intergenerational survival rate on classical biological control

    International Nuclear Information System (INIS)

    Xiao Yanni; Tang Sanyi

    2008-01-01

    Models of biological control have a long history of theoretical development that have focused on the interaction of a parasitoid and its host. The host-parasitoid systems have identified several important and general factors affecting the long-term dynamics of interacting populations. However, much less is known about how the initial densities of host-parasitoid populations affect the biological control as well as the stability of host-parasitoid systems. To do this, the classical Nicholson-Bailey model with host self-regulation and parasitoid intergenerational survival rate is used to uncover the effect of initial densities on the successful biological control. The results indicate that the simplest Nicholson-Bailey model has various coexistence with a wide range of parameters, including boundary attractors where the parasitoid population is absent and interior attractors where host-parasitoid coexists. The final stable states of host-parasitoid populations depend on their initial densities as well as their ratios, and those results are confirmed by basins of attraction of initial densities. The results also indicate that the parasitoid intergenerational survival rate increases the stability of the host-parasitoid systems. Therefore, the present research can help us to further understand the dynamical behavior of host-parasitoid interactions, to improve the classical biological control and to make management decisions

  2. The Erythraeoidea (Trombidiformes: Prostigmata) as Biological Control Agents, with Special Reference to the Genus Balaustium

    NARCIS (Netherlands)

    Muñoz-Cárdenas, K.; Fuentes-Quintero, L.S.; Rueda-Ramirez, D.; Rodríguez, C.D.; Cantor, R.F.; Carrillo, D.; de Moraes, G.J.; Peña, J.E.

    2015-01-01

    Erythraeoidea is a widely distributed group with great potential for practical use in biological control programs, but whose study has been limited due to the complex life cycle that often includes alteration in feeding behaviour and habitat. Several associations of these mites to different species

  3. Potentials of biological control of plant diseases in the tropics | Ofor ...

    African Journals Online (AJOL)

    This paper highlights the various categories of biological control, which are employed in an Integrated Disease Management (IDM) scheme. These include conservation, classical biocontrol and augmentation. Also, the various types of biocontrol agents/agencies which are currently in use in various parts of the world like, ...

  4. Use of pupal parasitoids as biological control agents of filth flies on equine facilities

    Science.gov (United States)

    House flies, Musca domestica L., and stable flies, Stomoxys calcitrans (L.), (Diptera: Muscidae), are common pests on horse farms. The use of pupal parasitoids as biological control agents for filth flies is becoming more popular on equine facilities; however, there is a lack of information on the e...

  5. Prospects for biological soil-borne disease control: application of indigenous versus synthetic microbiomes

    Science.gov (United States)

    Biological disease control of soil-borne plant diseases has traditionally employed the biopesticide approach whereby single strains or strain mixtures are introduced into production systems through inundative/inoculative release. The approach has significant barriers that have long been recognized,...

  6. Nuclear polyhedrosis virus as a biological control agent for Malacosoma americanum (Lepidoptera: Lasiocampidae)

    Science.gov (United States)

    R.A. Progar; M.J. Rinella; D. Fekedulegn; L. Butler

    2010-01-01

    In addition to damaging trees, the eastern tent caterpillar is implicated in early fetal loss and late-term abortion in horses. In a field study, we evaluated the potential biological control of the caterpillar using eastern tent caterpillar nuclear polyhedrosis virus (ETNPV), a naturally occurring virus that is nearly species-specific. Egg masses were hatched and...

  7. Assessing risks and benefits of floral supplements in conservation biological control

    NARCIS (Netherlands)

    Winkler, K.; Wackers, F.L.; Termorshuizen, A.J.; Lenteren, van J.C.

    2010-01-01

    The use of flowering field margins is often proposed as a method to support biological control in agro-ecosystems. In addition to beneficial insects, many herbivores depend on floral food as well. The indiscriminate use of flowering species in field margins can therefore lead to higher pest numbers.

  8. Host range of Secusio extensa (Lepidoptera: Arctiidae), and potential for biological control of Senecio madagascariensis (Asteraceae)

    Science.gov (United States)

    M. M. Ramadan; K. T. Murai; T. Johnson

    2010-01-01

    Secusio extensa (Lepidoptera: Arctiidae) was evaluated as a potential biological control agent for Madagascar fireweed, Senecio madagascariensis (Asteraceae), which has invaded over 400 000 acres of rangeland in the Hawaiian Islands and is toxic to cattle and horses. The moth was introduced from southeastern Madagascar...

  9. 41 CFR 101-42.1102-5 - Drugs, biologicals, and reagents other than controlled substances.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Drugs, biologicals, and reagents other than controlled substances. 101-42.1102-5 Section 101-42.1102-5 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS...

  10. Using matrix population models to inform biological control management of the wheat stem sawfly, Cephus cinctus

    Science.gov (United States)

    Demographic models are a powerful means of identifying vulnerable life stages of pest species and assessing the potential effectiveness of various management approaches in reducing pest population growth and spread. In a biological control context, such models can be used to focus foreign explorati...

  11. Biological control of Alternaria radicina in seed production of carrots with Ulocladium atrum

    NARCIS (Netherlands)

    Köhl, J.; Langerak, C.J.; Meekes, E.T.M.; Molhoek, W.M.L.

    2004-01-01

    Black rot of carrots is caused by seed-borne Alternaria radicina. Biological control of seed infestation by treatments applied to plants in flower during seed production with the fungal antagonist Ulocladium atrum was investigated in laboratory and field experiments resulting in a reduction of seed

  12. External rostral characters for differentiation of sexes in the biological control agent Mecinus janthinus (Coleoptera: Curculionidae)

    Science.gov (United States)

    Marjolein Schat; Sharlene E. Sing; Robert K. D. Peterson

    2007-01-01

    The stem-boring weevil, Mecinus janthinus (Germar), is a promising, well established classical biological control agent for the exotic invasive weed Dalmatian toadflax (Linaria dalmatica (L.) Mill.) (Scrophulariaceae). In this paper we present readily apparent rostral characters that can be used for sex differentiation of live stem-boring weevils at low magnification....

  13. Status of biological control projects on terrestrial invasive alien weeds in California

    Science.gov (United States)

    In cooperation with foreign scientists, we are currently developing new classical biological control agents for five species of invasive alien terrestrial weeds. Cape-Ivy. A gall-forming fly, Parafreutreta regalis, and a stem-boring moth, Digitivalva delaireae, have been favorably reviewed by TAG...

  14. Effects of biological control agents and exotic plant invasion on deer mouse populations

    Science.gov (United States)

    Yvette K. Ortega; Dean E. Pearson; Kevin S. McKelvey

    2004-01-01

    Exotic insects are commonly introduced as biological control agents to reduce densities of invasive exotic plants. Although current biocontrol programs for weeds take precautions to minimize ecological risks, little attention is paid to the potential nontarget effects of introduced food subsidies on native consumers. Previous research demonstrated that two gall flies (...

  15. Releases of natural enemies in Hawaii since 1980 for classical biological control of weeds

    Science.gov (United States)

    P. Conant; J. N. Garcia; M. T. Johnson; W. T. Nagamine; C. K. Hirayama; G. P. Markin; R. L. Hill

    2013-01-01

    A comprehensive review of biological control of weeds in Hawaii was last published in 1992, covering 74 natural enemy species released from 1902 through 1980. The present review summarizes releases of 21 natural enemies targeting seven invasive weeds from 1981 to 2010. These projects were carried out by Hawaii Department of Agriculture (HDOA), USDA Forest Service (USFS...

  16. Potential biological control agents for management of cogongrass (Cyperales: Poaceae) in the southeastern USA

    Science.gov (United States)

    Cogongrass, Imperata cylindrica (L.) Palisot de Beauvois (Cyperales: Poaceae), is a noxious invasive weed in the southeastern USA. Surveys for potential biological control agents of cogongrass were conducted in Asia and East Africa from 2013 to 2016. Several insect herbivores were found that may hav...

  17. Ex-ante analysis of economic returns from biological control of coconut mite in Tanzania

    NARCIS (Netherlands)

    Oleke, J.M.; Manyong, V.; Mignouna, D.; Isinika, A.; Mutabazi, K.; Hanna, R.; Sabelis, M.

    2013-01-01

    The coconut mite, Aceria guerreronis Keifer, has been identified as one of the pests that pose a threat to the coconut industry in Benin. The study presents the simulation results of the economic benefits of the biological control of coconut mites in Benin using a standard economic surplus model. In

  18. Genome sequences of three strains of Aspergillus flavus for the biological control of Aflatoxin

    Science.gov (United States)

    The genomes of three strains of Aspergillus flavus with demonstrated utility for the biological control of aflatoxin were sequenced. These sequences were assembled with MIRA and annotated with Augustus using A. flavus strain 3357 (NCBI EQ963472) as a reference. Each strain had a genome of 36.3 to ...

  19. Effective landscape scale management of Cirsium arvense (Canada thistle) utilizing biological control

    Science.gov (United States)

    G. P. Markin; D. Larson

    2013-01-01

    The stem mining weevil, Ceutorhynchus litura Fabricius, the gall forming fly, Urophora cardui L., and the seedhead weevil, Larinus planus Fabricius, were established as biological control agents on an 1800 hectare multiple-habitat wildlife refuge in northwestern Oregon in the mid-1990s. At the time, Canada thistle was the most wide spread, aggressive, and difficult...

  20. Status of biological control of the shrub gorse (Ulex europaeus) on the Island of Hawaii

    Science.gov (United States)

    G. P. Markin; P. Conant

    2013-01-01

    On the island of Hawaii, gorse (Ulex europaeus L.) is limited to an isolated core infestation of approximately 2000 hectares with scattered plants and small patches in the surrounding 10,000 hectares. Between 1985 and 2000, seven biological control agents were introduced, five of which successfully established. By 2000, their combined impact had reduced the yearly...