WorldWideScience

Sample records for binding takes place

  1. Taking place, screening place

    DEFF Research Database (Denmark)

    Hansen, Kim Toft; Waade, Anne Marit

    2019-01-01

    We introduce location studies as a new empirical approach to screen studies. Location studies represent an interdisciplinary perspective, including media, aesthetics and geography, and reflect a growing interest in places in a global media and consumption culture. The chapter analyses two recent......) with one being traditional and the other being commercial; both dramas include discussions of localities and social heritage, and both use local sports as a common metaphor for social cohesion; and both series have been partly funded by a local film Danish commissioner. However, The Legacy is shot...... to a large extent in studios, while Norskov is shot entirely on location. The study is based on interviews with producers, broadcasters, location scouts, production designers and writers, as well as quantitative and qualitative textual analyses of television drama series, the geographical places, and related...

  2. Is channeling of fission tracks taking place?

    CERN Document Server

    Yada, K

    1999-01-01

    A single crystal of natural zircon which is sliced to have (010) basal plane and thinned by ion thinning is electron microscopically observed after slow neutron irradiation to ascertain whether channeling of the nuclear fission fragments is taking place or not. A fairly large number of the induced fission tracks are recognized at low magnification images where a considerable number of them are parallel to low-index lattice planes such as 100, 001, 101, 301, 103 though their directions changed some time up to several degrees. High resolution images of fission tracks often show a variety of zigzag passing of the tracks along low-index lattice planes in atomistic level. The rate of the tracks which are parallel to these low-index lattice planes is fairly high as about 45%, which strongly suggests that channeling of the fission tracks is taking place.

  3. Mathematical modeling of phase interaction taking place in materials processing

    International Nuclear Information System (INIS)

    Zinigrad, M.

    2002-01-01

    The quality of metallic products depends on their composition and structure. The composition and the structure are determined by various physico-chemical and technological factors. One of the most important and complicated problems in the modern industry is to obtain materials with required composition, structure and properties. For example, deep refining is a difficult task by itself, but the problem of obtaining the material with the required specific level of refining is much more complicated. It will take a lot of time and will require a lot of expanses to solve this problem empirically and the result will be far from the optimal solution. The most effective way to solve such problems is to carry out research in two parallel direction. Comprehensive analysis of thermodynamics, kinetics and mechanisms of the processes taking place at solid-liquid-gaseous phase interface and building of the clear well-based physico-chemical model of the above processes taking into account their interaction. Development of mathematical models of the specific technologies which would allow to optimize technological processes and to ensure obtaining of the required properties of the products by choosing the optimal composition of the raw materials. We apply the above unique methods. We developed unique methods of mathematical modeling of phase interaction at high temperatures. These methods allows us to build models taking into account: thermodynamic characteristics of the processes, influence of the initial composition and temperature on the equilibrium state of the reactions, kinetics of homogeneous and heterogeneous processes, influence of the temperature, composition, speed of the gas flows, hydrodynamic and thermal factors on the velocity of the chemical and diffusion processes. The models can be implemented in optimization of various metallurgical processes in manufacturing of steels and non-ferrous alloys as well as in materials refining, alloying with special additives

  4. Taking into account the binding effects in positronium

    International Nuclear Information System (INIS)

    Tyukhtyaev, Yu.N.

    1978-01-01

    In order to take into acount the binding of particles in quantum electrodynamics, the Coulomb Green function at all stages of constructing the quasipotential is used. For the first time in the quasipotential approach the contribution of the possitronium ground state splitting from the one-photon direct diagram is calculated up to the α 6 lnα terms

  5. 49 CFR 40.221 - Where does an alcohol test take place?

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Where does an alcohol test take place? 40.221... WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Testing Sites, Forms, Equipment and Supplies Used in Alcohol Testing § 40.221 Where does an alcohol test take place? (a) A DOT alcohol test must take place at an...

  6. Key European Grid event to take place in Geneva

    CERN Multimedia

    2006-01-01

    EGEE'06 is the main conference of the EGEE project, which is co-funded by the European Union and hosted by CERN. More than 90 partners all over Europe and beyond are working together in EGEE to provide researchers in both academia and industry with access to major computing resources, independent of their geographic location. The largest user community of the EGEE Grid is the High-Energy Physics community and in particular the LHC experiments, which are already making heavy use of the infrastructure to prepare for data taking. However, with the many new challenges faced by EGEE in its second phase that started in April this year, an even broader audience than at previous EGEE conferences is expected. In particular, a large number of related Grid projects will feature prominently in both plenary and parallel sessions during the 5 days of this event. Industry will also be well represented, highlighting the EGEE project's commitment to technology transfer to industry. CERN is the host of the conference, which i...

  7. The Poetic Word in the Taking-Place of Language: Aesthetics, Ethics, and Politics

    Directory of Open Access Journals (Sweden)

    Maria Rosa Duarte de Oliveira

    2016-09-01

    Full Text Available This work aims to investigate the nature and function of the poetic word from its relation with aesthetics, ethics, and politics. We are stirred to know the ways poetic language, inscribed within language, may appear as a gesture of resistance and subversion. This is due to its investments both in non-representation and in the presentation of an (almost rising being in a hic et nunc of its presence in the "taking place" of language. Contemporary philosophers, such as Alain Badiou and Giorgio Agamben, suggest possible answers to this question through the operation of negativity that takes place in language so as to make it uninformative. Barthes also seems to follow the same path by lingering on the emptiness of the appearance of "this is" in the poetic form of haiku, which prevents any further interpretation. We expect that these ways of thinking the poetic may offer literary criticism new investigative parameters.

  8. Waste Disposal: Processes Taking Place (on the way) from the Repository to the Biosphere

    International Nuclear Information System (INIS)

    Put, M.

    2000-01-01

    The main objective of SCK-CEN's R and D programme on the processes taking place on the way from the repository to the biosphere is to provide reliable and defensible models and parameters on the migration of dissolved radionuclides and gases through the host formation (Boom Clay) and the backfill materials of a deep geological repository for high level radioactive waste. The programme and main achievements in this topical area in 1999 are summarised

  9. DETERMINING THE FEATURES OF SPORTSWEAR TAKING PLACE IN FAST FASHION COLLECTIONS

    Directory of Open Access Journals (Sweden)

    Birsen ÇİLEROĞLU

    2014-07-01

    Full Text Available Spor ts occupies the first place among most siginificant factors increasing quality of life . It has b ecome difficult to allocate proper time for sports in the course of heavy work pace and flow of life . Such circumstances have led people to increase minor sport activities which could be done during short times allocated from daily living, thus, orienting people‟s clothing preference towards sportswear . The feeling of easiness and comfort sportswear offer to individuals enhances further such preference . The feeling of comfort individuals feel in their clothing depends on the presence of physiologic and psy chologic coherence between their bodies and environment . Demand for sportswear allowing easy - movement increased upon rise in life dynamism and standards, it began to be preferred regarding comfort of use and to take its place in daily clothing, too, define d as “casual” clothing . Spor tswear being preferred very much ; has caused the firms making and producing fashion and clothing design to give place in their collections to sportswear category . Particularly, in firms where model and clothing varieties are pl enty and new model design is made in short intervals, named as, “fast fashion” , tendency towards sportswear is growing increasingly . The sale rates of sportswear, utilization rates of which are growing increasingly, has maximum value among total clothing s ales in E - business field, too. In this research, it has been aimed to determine the features of sportswear taking place in “fast fashion” clothing collections . In order to accomplish this aim, 2014 collections of four different brands taking place in natio nal and international markets have been examined through visual analysis method . In the examinations; sportswear styles of the brand, model and style differences between brands and states of using 2014 fashion trends have been taken into account. The data obtained at the end of the analyses made have been

  10. Questions and Answers Regarding Actions to Take When Ending Shelter-in-Place

    Energy Technology Data Exchange (ETDEWEB)

    Shumpert, B.

    2003-12-30

    Shelter-in-place has found increasing acceptance as an effective protective action option for communities participating in the Chemical Stockpile Emergency Preparedness Program. Studies have confirmed that it can provide optimum protection under certain accident conditions. However, emergency managers and planners, as well as the public, continue to be troubled by the need to end sheltering when the plume has passed in order to avoid sustained exposure to the small amount of agent that has penetrated the shelter. One of the concerns posed by this necessity is uncertainty regarding what hazards will then be faced in the environment outside the shelter and what actions can be taken to avoid those hazards. This report attempts to address those uncertainties. It recognizes that there is an extremely low probability that the environment outside the shelter will be contaminated with chemical agent residue. However, as people comply with an official recommendation to leave their shelters, they probably can't be certain that the environment is free from contamination. Therefore, this report identifies and explains specific and simple actions they can take to avoid the possibility of exposure to chemical agent hazards outside their shelters. It addresses such issues as the actions people should take upon ending shelter-in-place, what clothing they should wear, how they should handle animals, and what they should do about food in their homes and produce in their gardens.

  11. [Marketing approval and market surveillance of medical devices in Germany: Where does policy integration take place?].

    Science.gov (United States)

    Lang, Achim

    2014-01-01

    Since 2011 new regulatory measures regarding medical devices have been set up with the aim to eliminate obstacles to innovations and to find more coordinated ways to marketing authorisation and market surveillance. This essay investigates whether these new and existing coordination mechanisms build up to a Joined-up Government approach. The analysis shows that the regulatory process should be adjusted along several dimensions. First, many organisations lack awareness regarding their stakeholders and focus solely on their immediate organisational activities. Second, the regulatory process (marketing authorisation and market surveillance) is too fragmented for an effective communication to take place. Finally, the underlying strategy process is an ad-hoc approach lacking continuity and continued involvement of, in particular, the responsible federal ministries. Copyright © 2013. Published by Elsevier GmbH.

  12. RELIGIOUS TRANSFORMATION OF SENI DODOD TAKING PLACE AT MEKAR WANGI VILLAGE SOUTH BANTEN

    Directory of Open Access Journals (Sweden)

    Yuliawan Kasmahidayat

    2012-11-01

    Full Text Available Religious transformation of Seni Dodod taking place at Mekar Wangi Village, SaketiDistrict, Pandeglang Regency, South Banten, Banten Province enriches the analysis of thecommunity cultural pattern based on the art characteristics born and developing in thecommunity. In relation to that, this study describes the cultural phenomenon of religioustransformation as the ideological basis of the pre-modern, modern and postmodern communities.Multidisciplinary qualitative method was employed in this study and the data needed werecollected by in-depth interview, participatory observation and documentation techniques. Thefindings show that the Seni Dodod has the belief or the religion adhered to by the people living atMekar Wangi Village as its religious background. Such a belief affects the relation patternbetween the individuals and their community, nature and God. This is used as the reference inwhat is done in the agricultural process, making Seni Dodod a cult and realizatrion. When thecultural transformation process was taking place, it was found that there was a point of contactbetween traditional arts and modern arts outside the domain of Seni Dodod . Nowadays newcompositions of Seni Dodod have been created functioning as instruments of wedding andkhitanan rituals (khitanan = a feast celebrating a circumcision. The process of acculturation wasformally performed at school by using its compositions as the learning material of art andculture. Its application in its original form and composition was informally inherited throughSeni Dodod studios, the youth and villagers. Its religious meaningfulness was reflected from thecountry life performed by the people living at Mekar Wangi village. Such meaningfulness wasbased on that given by the leaders of pondok pesantren (Muslem boarding school and on theexplanation clarifying, showing, separating and elaborating seven clauses of Al-Qur’an. Themeaningfulness provided resulted in intactness of movements, the

  13. Makro- and micromorphological evidence of processes taking place during Albeluvisol development in S Norway

    Science.gov (United States)

    Sauer, Daniela; Schülli-Maurer, Isabelle; Sperstad, Ragnhild; Sørensen, Rolf

    2014-05-01

    We studied two soil chronosequences in S Norway to identify processes involved in Albeluvisol formation. For this purpose, field observation of vertical and horizontal sections of soil profiles, soil chemical and mineralogical analyses were carried out, and in particular, micromorphological analysis was applied. The study area is located at the western and eastern side of the Oslofjord, S Norway, in the counties Vestfold and Østfold. This region is characterized by continuous glacio-isostatic uplift over the entire Holocene. Hence, the age of the land surface continuously increases from the coast towards higher elevations. Twelve soil profiles in loamy marine sediments were studied. Based on macro- and micromorphological observations and analytical data progressive soil formation is characterized as follows: As soon as the land surface is raised above sea level, five major processes are initiated: 1) development of deep desiccation cracks, forming a polygonal pattern; 2) compaction, taking place as soon as the coarse pores have been drained; 3) pyrite oxidation and release of sulfuric acid; 4) carbonate dissolution by acids from pyrite and iron oxidation resulting in rapid decarbonatization of the originally calcareous sediments; 5) precipitation of iron hypocoatings and coatings in the capillary fringe Soon after these very early processes have taken place, limited water permeability of the fine-textured sediments leads to horizon differentiation into Ah, Eg and Btg horizons within less than 2.1 ka. Eg horizons become lighter in colour with time. Also illuvial clay is already observed in the 2.1 ka-old soil. Soil pH in the upper part of the E horizon of this soil is already too low for significant clay mobilization. Clay illuviation is still active in all soils studied, but the upper boundary of the zone where pH favours clay mobilization is at 20-50 cm depth. Progressive clay illuviation over time is recorded in increasing thickness of clay coatings and

  14. What it Takes to Successfully Implement Technology for Aging in Place: Focus Groups With Stakeholders.

    Science.gov (United States)

    Peek, Sebastiaan Theodorus Michaël; Wouters, Eveline J M; Luijkx, Katrien G; Vrijhoef, Hubertus J M

    2016-05-03

    There is a growing interest in empowering older adults to age in place by deploying various types of technology (ie, eHealth, ambient assisted living technology, smart home technology, and gerontechnology). However, initiatives aimed at implementing these technologies are complicated by the fact that multiple stakeholder groups are involved. Goals and motives of stakeholders may not always be transparent or aligned, yet research on convergent and divergent positions of stakeholders is scarce. To provide insight into the positions of stakeholder groups involved in the implementation of technology for aging in place by answering the following questions: What kind of technology do stakeholders see as relevant? What do stakeholders aim to achieve by implementing technology? What is needed to achieve successful implementations? Mono-disciplinary focus groups were conducted with participants (n=29) representing five groups of stakeholders: older adults (6/29, 21%), care professionals (7/29, 24%), managers within home care or social work organizations (5/29, 17%), technology designers and suppliers (6/29, 21%), and policy makers (5/29, 17%). Transcripts were analyzed using thematic analysis. Stakeholders considered 26 different types of technologies to be relevant for enabling independent living. Only 6 out of 26 (23%) types of technology were mentioned by all stakeholder groups. Care professionals mentioned fewer different types of technology than other groups. All stakeholder groups felt that the implementation of technology for aging in place can be considered a success when (1) older adults' needs and wishes are prioritized during development and deployment of the technology, (2) the technology is accepted by older adults, (3) the technology provides benefits to older adults, and (4) favorable prerequisites for the use of technology by older adults exist. While stakeholders seemed to have identical aims, several underlying differences emerged, for example, with regard

  15. Model of Wagons’ Placing-In and Taking-Out Problem in a Railway Station and Its Heuristic Algorithm

    Directory of Open Access Journals (Sweden)

    Chuijiang Guo

    2014-01-01

    Full Text Available Placing-in and taking-out wagons timely can decrease wagons’ dwell time in railway stations, improve the efficiency of railway transportation, and reduce the cost of goods transportation. We took the locomotive running times between goods operation sites as weights, so the wagons’ placing-in and taking-out problem could be regarded as a single machine scheduling problem, 1pijCmax, which could be transformed into the shortest circle problem in a Hamilton graph whose relaxation problem was an assignment problem. We used a Hungarian algorithm to calculate the optimal solution of the assignment problem. Then we applied a broken circle and connection method, whose computational complexity was O(n2, to find the available satisfactory order of wagons’ placing-in and taking-out. Complex problems, such as placing-in and transferring combined, taking-out and transferring combined, placing-in and taking-out combined, or placing-in, transferring, and taking-out combined, could also be resolved with the extended algorithm. A representative instance was given to illustrate the reliability and efficiency of our results.

  16. OECD Global Science Forum's Astronomy Workshop to take place in Munich

    Science.gov (United States)

    2003-11-01

    members of the national astronomical community. The International Astronomical Union (IAU) and the European Southern Observatory (ESO) are explicitly represented. Experts from the world-wide astronomy community have been invited to set the stage and provide input for the discussions. The choice by Germany and the OECD to make Munich the venue of this Global Science Forum Workshop is no coincidence. It is a recognition of the important role played by many institutions in the Munich region in the field of Astronomy and Astrophysics. They include the Ludwig-Maximilians-Universität where the Workshop will take place, the Max-Planck-Institut für Astrophysik, the Max-Planck Institut für Extraterrestrische Physik and the European Southern Observatory. These institutions are all participating in large programmes and projects in astronomy. ESO, for its part, is at the leading edge of world astronomy with its flagship facility, the Very Large Telescope in Paranal (Chile) and the newly started ALMA project at Chajnantor (Chile), being carried out in partnership between Europe and North America. Public Talks (Munich) on December 1, 2003 As a prelude to the Workshop, two public keynote presentations will take place on December 1 at the Deutsches Museum in Munich at 18:00 CET. The speakers are Malcolm Longair, Jacksonian Professor of Natural Philosophy and Head of Laboratory, Cavendish Laboratory, Cambridge (UK) and Martin Harwit, Professor Emeritus of Astronomy, Cornell University, and former Director of the National Air and Space Museum, Washington, DC (USA). The talks will be given in English and the entry to this public event is free. Professor Longair will speak on "Astrophysics and Cosmology in the Twenty-First Century" and Professor Harwit will speak on "The Growth of Understanding of our Universe". You can find more informaton on the Public Talks web page.

  17. Taking back place-names – from dusty library to digital life

    DEFF Research Database (Denmark)

    Knudsen, Bo Nissen

    mobility of the book format into a digital context – by making the content available as an application for mobile devices such as smart phones and iPads? Adding geocodes to the name articles could open up the possibility of a digital place-name lexicon allowing the end user to move around in a place......Danish place-names have been under publication since 1922 in the scientific series Danmarks Stednavne (Place-Names of Denmark) but only recently the huge project of a digitization of the series has been undertaken. Around 120,000 name articles are now on their way to the web as part of the Digital...... atlas of the Danish historical-administrative geography. Digitization and presentation of a scientific place-names edition poses many interesting problems in itself, especially regarding the variation over time in both the selection of names and the build-up of scholarly knowledge. How are we to convey...

  18. Should developing countries take on binding commitments in a climate agreement? A cost-benefit analysis

    International Nuclear Information System (INIS)

    Kallbekken, Steffen; Westskog, Hege

    2003-01-01

    This paper explores the costs and benefits for all parties to a future climate agreement of developing countries taking on binding commitments. Such commitments would allow developing countries to participate in emissions trading, which has significantly lower transaction costs than the present Clean Development Mechanism (CDM). Thus we analyse whether the efficiency gains obtained by participating in emissions trading can offset the economic risk (due to the fact that future emissions cannot be known) incurred by taking on binding commitments. We use a dynamic computable general equilibrium model to carry out the analysis. We find that the efficiency gains that can be obtained by developing countries might not be very large compared to the risks they incur. Developing countries might therefore have good reasons not to embrace ''cap and trade'' emissions trading. (author)

  19. DSC studies of retrogradation and amylose-lipid transition taking place in gamma-irradiated wheat starch

    International Nuclear Information System (INIS)

    Ciesla, K.; Gluszewski, W.; Eliasson, A.C.

    2006-01-01

    It has been already shown that degradation resulting from gamma irradiation induces a decrease in order of starch granules and influences gelatinisation taking place during heating of starch and flour suspensions. In presented paper, DSC (differential scanning calorimetry) studies were carried out for wheat starch, non-irradiated and irradiated using doses in the range from 5 to 30 kGy. The influence of the conditions applied during DSC measurements on the possibility to observe differences between the amylose-lipid complex transition and retrogradation taking place in the non-irradiated and particularly irradiated starch samples was checked. The better differentiation between the amylose-lipid complex transition taking place in particular samples accompanied by the better reproducity were obtained in the case of dense suspensions as compared to the watery suspensions as well as during the first analysis performed for the recrystallised gels

  20. Sex differences in dopamine binding and modafinil conditioned place preference in mice.

    Science.gov (United States)

    Bernardi, Rick E; Broccoli, Laura; Spanagel, Rainer; Hansson, Anita C

    2015-10-01

    Studies in humans and rodents have demonstrated under certain conditions some reinforcing properties of modafinil, a drug being examined clinically for its potential to treat psychostimulant abuse. However, the majority of rodent studies examining the abuse potential of modafinil have used high doses that may not be clinically relevant. In fact, recent work has indicated that doses similar to those administered to humans are not reinforcing in mice. The current study examined sex differences in the ability of low-dose modafinil (0.75mg/kg, IP) to induce a conditioned place preference in mice, and assessed sex-dependent alterations in dopamine D1, D2 and DAT binding sites in reward-related regions in naïve and modafinil-treated mice. Low-dose modafinil failed to induce a conditioned place preference in male mice, while female mice demonstrated a significant modafinil place preference. Several dopamine binding differences were also detected in naïve and modafinil-treated mice, including sex differences in D1 and D2 availability in reward-related regions, and are discussed in relation to sex-dependent differences in the reinforcing effects of modafinil and psychostimulants in general. These findings implicate sex differences in the reinforcing properties of modafinil in mice, and indicate that clinical evaluation of the sex dependence of the reinforcing properties of modafinil in humans is warranted. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. An Experimental Investigation of the Process of Isotope Exchange that Takes Place when Heavy Water Is Exposed to the Atmosphere

    Science.gov (United States)

    Deeney, F. A.; O'Leary, J. P.

    2009-01-01

    We have used the recently developed method for rapid measurement of maximum density temperature to determine the rate at which hydrogen and deuterium isotope exchange takes place when a sample of heavy water is exposed to the atmosphere. We also provide a simple explanation for the observed linear rate of transition. (Contains 2 figures.)

  2. Advice from Rural Elders: What It Takes to Age in Place

    Science.gov (United States)

    Dye, Cheryl J.; Willoughby, Deborah F.; Battisto, Dina G.

    2011-01-01

    Older adults prefer to age in place (AIP), and there are psychological, physiological, and economic benefits in doing so. However, it is especially challenging to AIP in rural communities. AIP models have been tested in urban settings and age-segregated communities, but they are not appropriate for rural communities. This paper presents rural AIP…

  3. DETERMINING THE FEATURES OF SPORTSWEAR TAKING PLACE IN FAST FASHION COLLECTIONS

    OpenAIRE

    ÇİLEROĞLU, Birsen; KIVILCIMLAR, İnci

    2015-01-01

    Sports occupies the first place among most siginificant factors increasing quality of life. It has become difficult to allocate proper time for sports in the course of heavy work pace and flow of life. Such circumstances have led people to increase minor sport activities which could be done during short times allocated from daily living, thus, orienting people’s clothing preference towards sportswear. The feeling of easiness and comfort sportswear offer to individuals enhances further such pr...

  4. AN EVALUATION OF WATER QALITY OF AKPINAR STREAM (DENİZLİ WHERE TROUT PRODUCTION TAKES PLACE

    Directory of Open Access Journals (Sweden)

    Esengül KÖSE

    2012-08-01

    Full Text Available In this study, 20 physicochemical parameters were measured mountly in 2007 and seasonaly in 2008 and 2009 on Akpınar Stream, which is located within the borders of Denizli and has 13 trout production facility. The data obtained were evaluated according to the fresh water fish directive which was agreed by the Commision of European Union (EC Directives and Water Pollution Control Regulation Criteria. We determined that, the measured parameters on the first station do not constitute any risk for Salmonids and Cyprinids according to EC Directives and in the second station, the valuesof biological oxygen demand and nitrite were high enough to adversely affect the health of fish. There is not a significant difference between two stations for the parameters of oxygen, nitrate, totalnitrogen, pH, chemical oxygen demand, acid binding capacity, total hardness and chlorine. The parametes of total suspended solids, ammonium, nitrite, secondary phosphate, total phosphorus, organicmatter, ammonia, biological oxygen demand, turbidity, temperature and flow rate were significantly high in second station (p<0.05. The reason of high levels of the parameters especially origin of organic pollution in the secod station is fish feces and feed wastes which directly given into the water. Settling ponds should be used properly and controls should be provided to increase for more healtyproduction.

  5. Daring the Foolish to Take Darwin Tests: The Ethical Double Bind of Betting On Natural Hazards

    Science.gov (United States)

    Halpern, J. B.

    2017-12-01

    While couched in the framework of concentrating minds betting on natural hazards carries an ethical cost. When children dare each other to do risky things parents know that when such dares are taken harm frequently occurs. Giving those who claim that there is no hazard financial reasons to avoid ameliorative actions or to double down in support of their public stance requires a moral calculation. Challenging the conclusions of those who accept such bets while denying danger will lead them to attempt to save face by increasing risk to themselves or others. Thus such wagers, whether person to person or on betting markets, require balancing between alerting the opposing party and others to the risks of not taking action, the associated scientific consensus and the possible harmful outcomes of the bets themselves. This talk will describe strategies for minimizing potential harm while maximizing the instructive component of climate bets. Best practices include having the bet rest on a technical issue that can be authoritatively resolved in a short time. Unfortunately the nature of natural hazard risks makes it difficult to meet all of these criteria, but those making such bets should be aware of the ethical double bind

  6. The albedo problem in the case of multiple synthetic scattering taking place in a plane-symmetric slab

    International Nuclear Information System (INIS)

    Shafiq, A.; Meyer, H.E. de; Grosjean, C.C.

    1985-01-01

    An approximate model based on an improved diffusion-type theory is established for treating multiple synthetic scattering in a homogeneous slab of finite thickness. As in the case of the exact treatment given in the preceding paper (Part I), it appears possible to transform the considered transport problem into an equivalent fictitious one involving multiple isotropic scattering, therefore permitting the application of an established corrected diffusion theory for treating isotropic scattering taking place in a convex homogeneous medium bounded by a vacuum in the presence of various types of sources. The approximate values of the reflection and transmission coefficients are compared with the rigorous values listed in Part I. In this way, the high accuracy of the approximation is clearly demonstrated. (author)

  7. DSC Studies of Retrogradation and Amylose-Lipid Complex Transition Taking Place in Gamma Irradiated Wheat Starch

    International Nuclear Information System (INIS)

    Ciesla, K.

    2006-01-01

    Degradation resulting from gamma irradiation induces decrease in order of starch granules and influences the processes occurring in starch-water system. Differential scanning calorimetry (DSC) was applied at present for studying the effect of radiation with doses of 5 - 30 kGy on amylose-lipid complex transition and retrogradation occurring in wheat starch gels. Influence of the conditions applied during DSC measurements and intermediate storage was tested on the possibility to observe radiation effect. Wheat starch was irradiated with 60 C o gamma rays in a gamma cell Issledovatiel placed in the Department of Radiation Chemistry, INCT. DSC measurements were performed for ca. 50% and ca. 20% gels during heating - cooling - heating cycles (up to 3 cycles) in the temperature range 10 - 150 degree at heating and cooling rates of 10, 5 and 2.5 degree min - 1. The Seiko DSC 6200 calorimeter was used. Decrease in amylose-lipid complex transition temperature was found already after irradiation of wheat starch with a dose of 5 kGy showing modificatin of the complex structure. The differences between the irradiated and the non-irradiated samples became the easier seen in the every foregoing heating or cooling cycle as compared to the preceeding one. It is because that thermal treatment causes decrease of transition temperature in all the irradiated samples, with no effect or increase of that temperature observed in the non-irradiated ones. Irradiation hinders retrogradation taking place in ca. 50% gels but facilitates retrogradation occurring in ca. 20 % gels. Moreover, the expanded differences between the amylose-lipid complex formed in the irradiated and non-irradiated gels result due to their recrystallisation. Storage of the gels induces decrease in the temperature of the complex transition as compared to the last cycle of the first analysis. That decrease was, however, more significant in the case of all the irradiated samples than in the case of the initial sample. In

  8. Where and How Do Aging Processes Take Place in Everyday Life? Answers From a New Materialist Perspective

    Directory of Open Access Journals (Sweden)

    Grit Höppner

    2018-04-01

    Full Text Available In the last decade, the focus of studies on age and aging has fundamentally changed from biological to symbolic, discursive, and cultural phenomena. Currently, the most studied topic in material gerontology is the materiality of age and aging in the context of everyday life. Scholars in this area have thus been making an important contribution to a material understanding of aging processes. As we understand them, however, both social constructivist and material gerontological concepts reach their limit when it comes to the questions of where and how aging processes actually take place in everyday life. In order to answer these two questions, we review social constructivist ideas with a particular focus on the “doing age” concept and material gerontological assumptions regarding human subjects, their material environments, and their relations. We then suggest rethinking bodily limitations and agencies addressed by scholars in the field of new materialism. The aim is to develop a new materialist-inspired understanding of aging processes that helps to reconstruct the material-discursive co-production of aging processes. These processes are deployed as mutual entanglements of materiality and meaning as well as of humans and non-human agency. This approach emphasizes the decentralization of the human actor and thus helps to map the material-discursive complexity of aging processes as relational co-products of humans and non-humans in everyday life.

  9. Demethylation of c-MYB binding site mediates upregulation of Bdnf IV in cocaine-conditioned place preference.

    Science.gov (United States)

    Tian, Weiping; Wang, Jiesi; Zhang, Ke; Teng, Huajing; Li, Chong; Szyf, Moshe; Sun, Zhong Sheng; Zhao, Mei

    2016-02-25

    Abnormal BDNF signaling contributes to the structural and behavioral plasticity induced by drugs of abuse. However, the mechanisms regulating expression of Bdnf in drug addiction remain elusive. In the present study, using the conditioned place preference (CPP) model, we showed that expression of Bdnf IV is upregulated in the nucleus accumbens (NAc) of conditioned animals while Bdnf I is upregulated in cocaine-treated mice irrespective of conditioning. The methylation level of a putative c-MYB binding site in the promoter region of Bdnf IV was significantly decreased in the NAc under cocaine CPP conditioning but remained unchanged without conditioning, concurrently with increased binding of c-MYB to this site. Exon IV promoter/luciferase reporter assays revealed that transactivation of Bdnf by c-MYB was blocked by methylation of this c-MYB binding site. Administration of methionine, a precursor of SAM, inhibited cocaine CPP, reversed demethylation of c-MYB binding site and induction of Bdnf IV expression by cocaine CPP. Our results imply that Bdnf IV demethylation at c-MYB binding site is involved in cocaine-triggered seeking behavior, whereas Bdnf I responds to the immediate pharmacological effects of cocaine.

  10. What does it take to make them stay? : how place satisfaction relates to willingness to stay of the creative class

    OpenAIRE

    Annell, Jonas; Terman, Felix

    2017-01-01

    Swedish students in smaller university host cities leave in favor of more attractive places after having completed their studies. Failing to retain newly graduated students is a problem for university host cities as educated people are associated with the group referred to as the creative class. Members of the creative class are drivers of regional economic growth, and have historically proven to be important for creating and developing the well-being of cities. Different place attributes hav...

  11. NS [Nuclear Safety] update. Current safety and security activities and developments taking place in the Department of Nuclear Safety and Security, Issue no. 6, March 2008

    International Nuclear Information System (INIS)

    2008-03-01

    The current issue presents information about the following activities: 1) International Conference on Illicit Nuclear Trafficking which took place in November 2007 in Edinburgh. The principal aim of the conference was to examine the threat and context of illicit nuclear trafficking of radioactive material, specifically, what is being done to combat such trafficking and where more needs to be done. The conference was also to consider how the obligations and commitments of the legally binding and non-binding international instruments could be and are being implemented by various States. 2) INSAG Message on Nuclear Safety Infrastructure in which the INSAG Chairman Richard Meserve addressed nuclear safety in the current context and various issues that warrant special attention. 3) approved for publication the Safety Requirements publication on Safety of Nuclear Fuel Cycle Facilities. 4) The Asian Nuclear Safety Network (ANSN)

  12. Stuck between a ROC and a hard place? Barriers to the take up of green energy in the UK

    International Nuclear Information System (INIS)

    Diaz-Rainey, Ivan; Ashton, John K.

    2008-01-01

    This paper examines the UK mechanisms for ensuring future investment in renewable energy through consumer adoption of green energy tariffs and the Renewable Obligation Certificate (ROC) system. Using a national survey and focus groups the stated willingness by UK customers to pay a premium for renewable or green energy and actual take up of such tariffs is assessed. Substantial differences between willingness to pay for and the adoption of green energy tariffs are reported. This disparity is linked to a range of factors including consumer confusion, lack of supply, complexities of constructing 'green source' tariffs under the ROC system and a lack of customer trust. It is concluded that the re-definition of the green energy market in favour of 'green source' tariffs, greater direct compliance with the Renewable Obligation by addressing supply constraints, and efforts in providing clearer information and choices for consumers via a compulsory green energy accreditation scheme are required if willing consumers' are to contribute to investment in renewable energy

  13. The Investigation of Mobbing Events Taking Place at Higher Education Institutions in Turkey Considering the Reflections on Media

    Directory of Open Access Journals (Sweden)

    Çubukçu Zühal

    2015-08-01

    considering that they are published nationally, reference newspapers and belong to different publication groups. The data used in this study was taken from the archive of the three newspapers. When the archives of the newspapers was scanned, the word “mobbing” was taken as key word for the search. In qualitative researches, newspapers are considered to be public archive and used as reference documents. The data obtained was grouped depending on the newspapers which it was taken from, on the year of publication, on where they took place, on the gender of the victims and on who the sufferers are.

  14. Out of Place, Out of Mind: Schema-Driven False Memory Effects for Object-Location Bindings

    Science.gov (United States)

    Lew, Adina R.; Howe, Mark L.

    2017-01-01

    Events consist of diverse elements, each processed in specialized neocortical networks, with temporal lobe memory systems binding these elements to form coherent event memories. We provide a novel theoretical analysis of an unexplored consequence of the independence of memory systems for elements and their bindings, 1 that raises the paradoxical…

  15. When and Where Learning is Taking Place: Multisynaptic Changes in Strength During Different Behaviors Related to the Acquisition of an Operant Conditioning Task by Behaving Rats.

    Science.gov (United States)

    Fernández-Lamo, Iván; Delgado-García, José M; Gruart, Agnès

    2018-03-01

    Although it is generally assumed that brain circuits are modified by new experiences, the question of which changes in synaptic efficacy take place in cortical and subcortical circuits across the learning process remains unanswered. Rats were trained in the acquisition of an operant conditioning in a Skinner box provided with light beams to detect animals' approaches to lever and feeder. Behaviors such as pressing the lever, eating, exploring, and grooming were also recorded. Animals were chronically implanted with stimulating and recording electrodes in hippocampal, prefrontal, and subcortical sites relevant to the task. Field synaptic potentials were evoked during the performance of the above-mentioned behaviors and before, during, and after the acquisition process. Afferent pathways to the hippocampus and the intrinsic hippocampal circuit were slightly modified in synaptic strength during the performance of those behaviors. In contrast, afferent and efferent circuits of the medial prefrontal cortex were significantly modified in synaptic strength across training sessions, mostly at the moment of the largest change in the learning curve. Performance of behaviors nondirectly related to the acquisition process (exploring, grooming) also evoked changes in synaptic strength across training. This study helps to understand when and where learning is being engraved in the brain. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. The Role of Endogenous D2 Receptor Levels in Morphine Addiction: A Correlative Study of Morphine Place Conditioning and In Vivo [3H]-Raclopride Binding

    Energy Technology Data Exchange (ETDEWEB)

    Khan, N.; Gatley, S.

    2004-01-01

    Dopamine is a neurotransmitter that has a wide array of effects on an individual’s mental state. It is vital in the regulation of motor skills and in generating the effects of substance abuse. This study examined the dopamine D2 receptors found in the striatum of the brain. The impetus for investigating this receptor lies in the perception that it plays an influential role in drug addiction. It has been conjectured on the basis of human PET studies that possession of low levels of D2 receptors will heighten an individual’s susceptibility to drug addiction. However, an alternative explanation of low D2 receptor levels in drug dependent individuals is that these levels are a consequence of drug abuse. To understand this phenomenon, the present study employed the paradigm of conditioned place preference (CPP). In CPP, individuals of an out-bred mouse strain are observed to spend time in environments where they had previously been exposed to a drug that is abused by humans. The drug chosen for our studies was morphine because it has been previously shown to generate a robust place preference in mice and is a prototypic abused drug in humans. D2 receptor levels were quantified using an in vivo binding study involving [3H]raclopride, a radioactive compound that binds to D2 receptors. The results showed a significant place preference for morphine following the conditioning procedure. Additionally, data from the binding analysis agreed with previous studies that the striatum contains high levels of D2 receptors. However, there was no consistent relationship between the extent of morphine CPP and D2 receptor levels as revealed by [3H]-RAC binding. This finding does not support the hypothesis that low levels of D2 receptors predispose a mouse to easy morphine conditioning. Further experiments are required to determine the ability to generalize our findings to other species and other drugs of abuse.

  17. Binding energy and optical properties of an off-center hydrogenic donor impurity in a spherical quantum dot placed at the center of a cylindrical nano-wire

    International Nuclear Information System (INIS)

    Safarpour, Gh.; Barati, M.; Zamani, A.; Niknam, E.

    2014-01-01

    The binding energy as well as the linear, third-order nonlinear and total optical absorption coefficient and refractive index changes of an off-center hydrogenic donor impurity in an InAs spherical quantum dot placed at the center of a GaAs cylindrical nano-wire have been investigated. In this regard, the effective-mass approximation approach is considered and eigenvalues and corresponding eigenfunctions are calculated via the finite element method. The binding energy is plotted as a function of the dot size and impurity position along with optical properties as a function of photon energy. In this study two different directions have been considered for impurity position, along the nano-wire axis and perpendicular to it. It has been found that the binding energy, absorption coefficient and refractive index changes are impressively affected not only by the dot radius but also by the position of the impurity and its direction. Additionally, the optical saturation can be tuned by the direction of the impurity and incident optical intensity. -- Highlights: • We consider spherical quantum dot located at the center of a cylindrical nano-wire. • An off-center hydrogenic donor impurity is considered in the system. • Binding energy is affected by orientation of impurity and its distance from center. • Saturation depends on the orientation of impurity position. • By shifting impurity position, orientation and dot radius blue- and red-shifts appear

  18. Avoidance of plants unsuitable for the symbiotic fungus in leaf-cutting ants: Learning can take place entirely at the colony dump.

    Directory of Open Access Journals (Sweden)

    Andrés Arenas

    Full Text Available Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden.

  19. Avoidance of plants unsuitable for the symbiotic fungus in leaf-cutting ants: Learning can take place entirely at the colony dump.

    Science.gov (United States)

    Arenas, Andrés; Roces, Flavio

    2017-01-01

    Plants initially accepted by foraging leaf-cutting ants are later avoided if they prove unsuitable for their symbiotic fungus. Plant avoidance is mediated by the waste produced in the fungus garden soon after the incorporation of the unsuitable leaves, as foragers can learn plant odors and cues from the damaged fungus that are both present in the recently produced waste particles. We asked whether avoidance learning of plants unsuitable for the symbiotic fungus can take place entirely at the colony dump. In order to investigate whether cues available in the waste chamber induce plant avoidance in naïve subcolonies, we exchanged the waste produced by subcolonies fed either fungicide-treated privet leaves or untreated leaves and measured the acceptance of untreated privet leaves before and after the exchange of waste. Second, we evaluated whether foragers could perceive the avoidance cues directly at the dump by quantifying the visits of labeled foragers to the waste chamber. Finally, we asked whether foragers learn to specifically avoid untreated leaves of a plant after a confinement over 3 hours in the dump of subcolonies that were previously fed fungicide-treated leaves of that species. After the exchange of the waste chambers, workers from subcolonies that had access to waste from fungicide-treated privet leaves learned to avoid that plant. One-third of the labeled foragers visited the dump. Furthermore, naïve foragers learned to avoid a specific, previously unsuitable plant if exposed solely to cues of the dump during confinement. We suggest that cues at the dump enable foragers to predict the unsuitable effects of plants even if they had never been experienced in the fungus garden.

  20. Thin Places

    OpenAIRE

    Lockwood, Sandra Elizabeth

    2013-01-01

    This inquiry into the three great quests of the twentieth century–the South Pole, Mount Everest, and the Moon–examines our motivations to venture into these sublime, yet life-taking places. The Thin Place was once the destination of the religious pilgrim seeking transcendence in an extreme environment. In our age, the Thin Place quest has morphed into a challenge to evolve beyond the confines of our own physiology; through human ingenuity and invention, we reach places not meant to accommod...

  1. Effect of health-promoting posters placed on the platforms of two train stations in Copenhagen, Denmark, on the choice between taking the stairs or the escalators

    DEFF Research Database (Denmark)

    Iversen, Mette Kathrine; Händel, M N; Nydal Jensen, Eva

    2007-01-01

    OBJECTIVE: The purpose of this study was to determine whether posters placed on the platforms of two train stations in Copenhagen, promoting use of the stairs, would encourage people to use the stairs rather than the adjacent escalator. An additional purpose was to see if the effect...

  2. NS [Nuclear Safety] update. Current safety and security activities and developments taking place in the Department of Nuclear Safety and Security, Issue no. 8, September 2008

    International Nuclear Information System (INIS)

    2008-09-01

    The current issue presents information about the following activities: 1) International Workshops on Denial of Shipments raise awareness of suppliers, recipients, regulators, carriers/consignors and international organizations of the problems relating to denials of radioactive shipments to determine effective measures to prevent or reduce the instances of shipment denials and delays. 2) Communication and knowledge Management in the Department of Nuclear Safety and Security (NS). 3) Nuclear Security at the Beijing Olympics - an excellent example of the IAEA's work in protecting large scale public events. 4) The Incident and Emergency Centre's Participation in the ConvEx 3 Exercise, 9-10 July 2008, which took place at the Laguna Verde nuclear power plant in Mexico. During the 43 hour long exercise, the Incident and Emergency Centre (IEC) was fully activated. Staff members participating in the exercise represented different departments within the IAEA and the diversity of their knowledge and experience ensured an effective response

  3. NS [Nuclear Safety] update. Current safety and security activities and developments taking place in the Department of Nuclear Safety and Security. Issue no. 2, January 2007

    International Nuclear Information System (INIS)

    2006-08-01

    This newsletter reports on the training of cardiologists in radiation protection, IAEA's safety review services and the operational safety assessment review team (OSART), the international conference on management of spent fuel and the recent INSAG (International Nuclear Safety Group) publications. The IAEA has begun a major international initiative to train interventional cardiologists in radiation protection. Starting with the first course in May 2004, so far 6 regional and 3 national training courses have been conducted with the participation of over 400 health professionals putting the IAEA in a leading role in this area. A programme of two days' training has been developed, covering possible and observed radiation effects among patients and staff, international standards, dose management techniques, examples of good and bad practice and examples indicating prevention of possible injuries as a result of good practice in radiation protection. The training material is freely available on CD and will be placed on the Radiological Protection of Patients website at http://rpop.iaea.org/

  4. Leaf processing behaviour in Atta leafcutter ants: 90% of leaf cutting takes place inside the nest, and ants select pieces that require less cutting.

    Science.gov (United States)

    Garrett, Ryan W; Carlson, Katherine A; Goggans, Matthew Scott; Nesson, Michael H; Shepard, Christopher A; Schofield, Robert M S

    2016-01-01

    Leafcutter ants cut trimmings from plants, carry them to their underground nests and cut them into smaller pieces before inoculating them with a fungus that serves as a primary food source for the colony. Cutting is energetically costly, so the amount of cutting is important in understanding foraging energetics. Estimates of the cutting density, metres of cutting per square metre of leaf, were made from samples of transported leaf cuttings and of fungal substrate from field colonies of Atta cephalotes and Atta colombica. To investigate cutting inside the nest, we made leaf-processing observations of our laboratory colony, A. cephalotes. We did not observe the commonly reported reduction of the leaf fragments into a pulp, which would greatly increase the energy cost of processing. Video clips of processing behaviours, including behaviours that have not previously been described, are linked. An estimated 2.9 (±0.3) km of cutting with mandibles was required to reduce a square metre of leaf to fungal substrate. Only about 12% (±1%) of this cutting took place outside of the nest. The cutting density and energy cost is lower for leaf material with higher ratios of perimeter to area, so we tested for, and found that the laboratory ants had a preference for leaves that were pre-cut into smaller pieces. Estimates suggest that the energy required to transport and cut up the leaf material is comparable to the metabolic energy available from the fungus grown on the leaves, and so conservation of energy is likely to be a particularly strong selective pressure for leafcutter ants.

  5. Hypoxia and inactivity related physiological changes precede or take place in absence of significant rearrangements in bacterial community structure: The PlanHab randomized trial pilot study.

    Directory of Open Access Journals (Sweden)

    Robert Šket

    Full Text Available We explored the assembly of intestinal microbiota in healthy male participants during the randomized crossover design of run-in (5 day and experimental phases (21-day normoxic bed rest (NBR, hypoxic bed rest (HBR and hypoxic ambulation (HAmb in a strictly controlled laboratory environment, with balanced fluid and dietary intakes, controlled circadian rhythm, microbial ambiental burden and 24/7 medical surveillance. The fraction of inspired O2 (FiO2 and partial pressure of inspired O2 (PiO2 were 0.209 and 133.1 ± 0.3 mmHg for NBR and 0.141 ± 0.004 and 90.0 ± 0.4 mmHg for both hypoxic variants (HBR and HAmb; ~4000 m simulated altitude, respectively. A number of parameters linked to intestinal environment such as defecation frequency, intestinal electrical conductivity (IEC, sterol and polyphenol content and diversity, indole, aromaticity and spectral characteristics of dissolved organic matter (DOM were measured (64 variables. The structure and diversity of bacterial microbial community was assessed using 16S rRNA amplicon sequencing. Inactivity negatively affected frequency of defecation and in combination with hypoxia increased IEC (p < 0.05. In contrast, sterol and polyphenol diversity and content, various characteristics of DOM and aromatic compounds, the structure and diversity of bacterial microbial community were not significantly affected over time. A new in-house PlanHab database was established to integrate all measured variables on host physiology, diet, experiment, immune and metabolic markers (n = 231. The observed progressive decrease in defecation frequency and concomitant increase in IEC suggested that the transition from healthy physiological state towards the developed symptoms of low magnitude obesity-related syndromes was dose dependent on the extent of time spent in inactivity and preceded or took place in absence of significant rearrangements in bacterial microbial community. Species B. thetaiotamicron, B. fragilis, B

  6. Designated Places

    Data.gov (United States)

    California Department of Resources — Census 2000 Place Names provides a seamless statewide GIS layer of places, including census designated places (CDP), consolidated cities, and incorporated places,...

  7. A population pharmacokinetic model taking into account protein binding for the sustained-release granule formulation of valproic acid in children with epilepsy.

    Science.gov (United States)

    Rodrigues, Christelle; Chhun, Stéphanie; Chiron, Catherine; Dulac, Olivier; Rey, Elisabeth; Pons, Gérard; Jullien, Vincent

    2018-03-21

    The objective of this work was to develop a population pharmacokinetic model for a prolonged-release granule formulation of valproic acid (VPA) in children with epilepsy and to determine the doses providing a VPA trough concentration (C trough ) within the target range (50-100 mg/L). Ninety-eight children (1-17.6 years, 325 plasma samples) were included in the study. The model was built with NONMEM 7.3. The probability to obtain C trough between 50 and 100 mg/L was determined by the Monte Carlo simulations for doses of 20, 30, 40, and 60 mg/kg/day and body weights between 10 and 70 kg. A one compartment model, with first-order absorption and flip-flop parameterization and linear elimination, but taking protein binding into account, was used to describe the data. Typical values for unbound VPA clearance and distribution volume were 6.24 L/h/70 kg and 130 L/h/70 kg respectively. Both parameters were related to body weight via allometric models. The highest probability to obtain a C trough within the target range for 10-kg children was obtained with a 40 mg/kg daily dose, whereas daily doses of 30 and 20 mg/kg were found appropriate for 20 to 30- and ≥ 40-kg children respectively. However, for these same doses, the exposure to unbound VPA could differ by 40%. If the present study supports the current dose recommendations of 20-30 mg/kg/day, except for children under 20 kg, who may need higher doses, it also highlights the need for further research on the pharmacokinetics/pharmacodynamic profile of unbound VPA.

  8. Water binding in legume seeds

    Science.gov (United States)

    Vertucci, C. W.; Leopold, A. C.

    1987-01-01

    The physical status of water in seeds has a pivotal role in determining the physiological reactions that can take place in the dry state. Using water sorption isotherms from cotyledon and axis tissue of five leguminous seeds, the strength of water binding and the numbers of binding sites have been estimated using van't Hoff analyses and the D'Arcy/Watt equation. These parameters of water sorption are calculated for each of the three regions of water binding and for a range of temperatures. Water sorption characteristics are reflective of the chemical composition of the biological materials as well as the temperature at which hydration takes place. Changes in the sorption characteristics with temperature and hydration level may suggest hydration-induced structural changes in cellular components.

  9. Connecting people to place

    NARCIS (Netherlands)

    Horlings, L.G.

    2016-01-01

    The article describes a process of preparing a research design on place-shaping, as outcome of a process of co-design between academic actors and non-academic actors in Brazil, South Africa and The Netherlands, taking place in the context of the project TRANSPLACE. The joint research design

  10. Women take the island: nation, profession, place Women take the island: nation, profession, place

    Directory of Open Access Journals (Sweden)

    Ruth Morse

    2008-04-01

    Full Text Available The Tempest has been one of Shakespeare’s most adapted plays. Its stage history is concomitantly a history of the British theatre, from regularized comedy to semi-opera to pantomime to opera. It has had other lives, too, from its position in romantic ideas of Shakespeare’s biography and his so-called farewell to the stage, to a supporting role as witness for the nineteenth-century Darwinians’ idea of the missing link, to a veritable efflorescence of walk-on parts, cameos, and star vehicles in twentieth-century psychoanalytic and social arguments about European expansion.2 The play has given us individual poems and paintings, not to speak of screen-plays for several film adaptations. The Tempest has been one of Shakespeare’s most adapted plays. Its stage history is concomitantly a history of the British theatre, from regularized comedy to semi-opera to pantomime to opera. It has had other lives, too, from its position in romantic ideas of Shakespeare’s biography and his so-called farewell to the stage, to a supporting role as witness for the nineteenth-century Darwinians’ idea of the missing link, to a veritable efflorescence of walk-on parts, cameos, and star vehicles in twentieth-century psychoanalytic and social arguments about European expansion.2 The play has given us individual poems and paintings, not to speak of screen-plays for several film adaptations.

  11. Places Connected:

    DEFF Research Database (Denmark)

    Hansen, Annette Skovsted

    experiences of place, however, when it is often the same people who experience many different places? Along with many other so-called donors in the 1950s, Denmark and Japan chose to invest in the education of own and other nationals involved in development and thereby financed personal connections between...

  12. Better Place

    DEFF Research Database (Denmark)

    Rask, Morten; Bakke, Nikolas; Lindhøj, Jan

    Better Place is trying to reshape the automotive industry by shifting transportation from a dependency on oil to a reliance on environmentally friendly renewable energy. Better Place is developing an extensive infrastructure system that will utilise overcapacity in the production of wind power...... among others and that will drive the global transportation industry to becoming driven by electric vehicles (EVs). Better Place does this by selling its customers 'mileage' and a car without a battery. The case highlights the internationalisation process of Better Place from an international business...... perspective in order to encourage a discussion and debate about how Better Place can make their grand vision a reality in the future by overcoming the obstacles that historically have been challenging the rise of the EV industry. The case includes a historical background of the EV industry by using Denmark...

  13. Place Branding

    DEFF Research Database (Denmark)

    Medway, Dominic; Swanson, Kathryn; Neirotti, Lisa Delpy

    2015-01-01

    Purpose: – The purpose of this paper is to report on a special session entitled “Place branding: Are we wasting our time?”, held at the American Marketing Association’s Summer Marketing Educators’ conference in 2014. Design/methodology/approach: – The report details the outcome of an Oxford-style...... of place branding towards an activity centred on “curation”. Originality/value: – The use of a competitive debating format as a means for exploring academic ideas and concepts in the place management field.......Purpose: – The purpose of this paper is to report on a special session entitled “Place branding: Are we wasting our time?”, held at the American Marketing Association’s Summer Marketing Educators’ conference in 2014. Design/methodology/approach: – The report details the outcome of an Oxford......: – The outcome of the debate points towards a need for place brands to develop as more inclusive and organic entities, in which case it may be best for place practitioners to avoid creating and imposing a place brand and instead help shape it from the views of stakeholder constituencies. This shifts the notion...

  14. Place (National)

    Data.gov (United States)

    Department of Transportation — This map layer includes cities and towns in the United States, Puerto Rico, and the U.S. Virgin Islands (NTAD). A city or town is a place with a recorded population,...

  15. Healthy Places

    Centers for Disease Control (CDC) Podcasts

    2007-04-10

    Every person has a stake in environmental public health. As the environment deteriorates, so does the physical and mental health of the people within it. Healthy places are those designed and built to improve the quality of life for all people who live, work, worship, learn, and play within their borders -- where every person is free to make choices amid a variety of healthy, available, accessible, and affordable options. The CDC recognizes significant health issues and places that are vital in developing the Healthy Places program and provides examples in this report.  Created: 4/10/2007 by CDC National Center for Environmental Health.   Date Released: 4/13/2007.

  16. Carboplatin binding to histidine

    Energy Technology Data Exchange (ETDEWEB)

    Tanley, Simon W. M. [University of Manchester, Brunswick Street, Manchester M13 9PL (United Kingdom); Diederichs, Kay [University of Konstanz, D-78457 Konstanz (Germany); Kroon-Batenburg, Loes M. J. [Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Levy, Colin [University of Manchester, 131 Princess Street, Manchester M1 7DN (United Kingdom); Schreurs, Antoine M. M. [Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Helliwell, John R., E-mail: john.helliwell@manchester.ac.uk [University of Manchester, Brunswick Street, Manchester M13 9PL (United Kingdom)

    2014-08-29

    An X-ray crystal structure showing the binding of purely carboplatin to histidine in a model protein has finally been obtained. This required extensive crystallization trials and various novel crystal structure analyses. Carboplatin is a second-generation platinum anticancer agent used for the treatment of a variety of cancers. Previous X-ray crystallographic studies of carboplatin binding to histidine (in hen egg-white lysozyme; HEWL) showed the partial conversion of carboplatin to cisplatin owing to the high NaCl concentration used in the crystallization conditions. HEWL co-crystallizations with carboplatin in NaBr conditions have now been carried out to confirm whether carboplatin converts to the bromine form and whether this takes place in a similar way to the partial conversion of carboplatin to cisplatin observed previously in NaCl conditions. Here, it is reported that a partial chemical transformation takes place but to a transplatin form. Thus, to attempt to resolve purely carboplatin binding at histidine, this study utilized co-crystallization of HEWL with carboplatin without NaCl to eliminate the partial chemical conversion of carboplatin. Tetragonal HEWL crystals co-crystallized with carboplatin were successfully obtained in four different conditions, each at a different pH value. The structural results obtained show carboplatin bound to either one or both of the N atoms of His15 of HEWL, and this particular variation was dependent on the concentration of anions in the crystallization mixture and the elapsed time, as well as the pH used. The structural details of the bound carboplatin molecule also differed between them. Overall, the most detailed crystal structure showed the majority of the carboplatin atoms bound to the platinum centre; however, the four-carbon ring structure of the cyclobutanedicarboxylate moiety (CBDC) remained elusive. The potential impact of the results for the administration of carboplatin as an anticancer agent are described.

  17. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    International Nuclear Information System (INIS)

    Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.

    2014-01-01

    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states

  18. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    Energy Technology Data Exchange (ETDEWEB)

    Gangi Setty, Thanuja [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Cho, Christine [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Govindappa, Sowmya [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Apicella, Michael A. [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Ramaswamy, S., E-mail: ramas@instem.res.in [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India)

    2014-07-01

    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.

  19. Secret Places.

    Science.gov (United States)

    Ridolfi, Kerry

    1997-01-01

    Argues that children are as deep as the ocean, with secret places inside of them waiting to be opened. Notes that it is powerful for students to learn they can make sense of the world through words, and describes inviting them into poetry as they read poetry, create poetry packets, and write and revise poems. (SR)

  20. Places available**

    CERN Multimedia

    2003-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) C++ for Particle Physicists : 17 – 21.11.03 (6 X 3-hour lectures) Programmation automate Schneider TSX Premium – niveau 2 : 18 – 21.11.03 (4 jours) JAVA 2 Enterprise Edition – Part 1 : WEB Applications : 20 & ...

  1. Places available

    CERN Multimedia

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Places available The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses : Introduction à Outlook : 19.8.2004 (1 journée) Outlook (short course I) : E-mail : 31.8.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes : 31.8.2004 (2 hours, afternoon) Instructor-led WBTechT Study or Follow-up for Microsoft Applications : 7.9.2004 (morning) Outlook (short course III) : Meetings and Delegation : 7.9.2004 (2 hours, afternoon) Introduction ...

  2. Places disponibles/Places available

    CERN Multimedia

    2004-01-01

    Etant donné le délai d'impression du Bulletin, ces places peuvent ne plus être disponibles au moment de sa parution. Veuillez consulter notre site Web pour avoir la dernière mise à jour. The number of places available may vary. Please check our Web site to find out the current availability. Des places sont disponibles dans les cours suivants : / Places are available in the following courses : Introduction à Outlook : 19.8.2004 (1 journée) Outlook (short course I) : E-mail : 31.8.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes : 31.8.2004 (2 hours, afternoon) Instructor-led WBTechT Study or Follow-up for Microsoft Applications : 7.9.2004 (morning) Outlook (short course III) : Meetings and Delegation : 7.9.2004 (2 hours, afternoon) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) Joint PVSS JCOP Framework : 13 - 17.9.2004 (5 days) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.9.2004 (4 jours) Programmation S...

  3. Envisioning place

    DEFF Research Database (Denmark)

    Schmidt, Garbi; Glick Schiller, Nina

    2016-01-01

    together, the articles contribute to an emerging relational social science by approaching urban sociabilities through four interrelated parameters: (1) a concept of place-making situated within trajectories of differential and multiscalar power; (2) a discursive analysis of narratives and silences......, including those about diversity and cultural difference, formulated by actors within different scales of power; (3) an analysis of how different temporalities make visible or invisible the presence, agency and interconnection of various actors engaged in city-making; and (4) a re-engagement with the notion...

  4. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74460

    2001-01-01

    Places are available in the following courses: Nouveautés de FileMaker : 20 - 23.03.01 (4 matins) Contract Follow-up : 9.4.01 (3 heures) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.

  5. Designed Places

    DEFF Research Database (Denmark)

    Stender, Marie

    like the forces of nature. Based on a fieldwork in three new housing developments in Copenhagen, this paper aims to bring the financial crisis ‘down to earth’ by examining the material shapes it has taken in the spaces of everyday life. The ethnographic cases in question are places that are somewhat...... over-designed: Not only the places’ architecture and built environment but also their identity, image and social life has been carefully planned for. At the same time their design and architectural layout bear witness to a seemingly longing for that which is unplanned and beyond design, thus staging...

  6. Places available **

    CERN Multimedia

    2003-01-01

    Des places sont disponibles dans les cours suivants : Places are available in the following courses : WorldFIP 2003 pour utilisateurs : 11-14.2.03 (4 jours) DISP-2003 ? Spring I Term : Introduction to Digital Signal Processing : 20, 27.2, 6, 13, 20, 27.3, 3.4.03 (7 X 2-hour lectures) AXEL-2003 - Introduction to Accelerators : 24-28.2.03 (10 X 1-hour lectures) AutoCAD 2002 - niveau 1 : 24, 25.2 & 3, 4.3.03 (4 jours) Introduction à Windows 2000 au CERN : 25.2.03 (1/2 journée) LabView base 2/LabView Basics 2 : 10 & 11.3.03 (2 jours/2 days) langue à définir/Language to be decided C++ for Particle Physicists : 10 ? 14.3.03 (6 X 3-hour lectures) Introduction to PVSS : 10.3.03 (half day, afternoon) Basic PVSS : 11 - 13.3.03 (3 days) LabView avancé /LabView Advanced : 12 - 14.3.03 (3 jours/3days) Langue à définir/language to be decided AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) PVSS - JCOP Framework Tutorial : 14.3.03 (1 day) MAGNE-03 - Magnetism for Technical Ele...

  7. Places available **

    CERN Multimedia

    2003-01-01

    Des places sont disponibles dans les cours suivants : Places are available in the following courses : Introduction à Windows 2000 au CERN : 25.2.03 (1/2 journée) LabView base 2/LabView Basics 2 : 10 & 11.3.03 (2 jours/2 days) langue à définir/Language to be decided C++ for Particle Physicists : 10 - 14.3.03 (6 X 3-hour lectures) Introduction to PVSS : 10.3.03 (half day, afternoon) Basic PVSS : 11 - 13.3.03 (3 days) LabView avancé /LabView Advanced : 12 - 14.3.03 (3 jours/3days) Langue à définir/Language to be decided AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) PVSS - JCOP Framework Tutorial : 14.3.03 (1 day) CLEAN-2002 : Working in a cleanroom : 2.4.03 (half-day, afternoon, free course, registration required) LabView base 1/LabView Basics 1 : 9 - 11.4.03 (3 jours/3 days) Langue à définir/Language to be decided DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (...

  8. Places available **

    CERN Multimedia

    2003-01-01

    Des places sont disponibles dans les cours suivants : Places are available in the following courses : DISP-2003 - Spring I Term : Introduction to Digital Signal Processing : 20, 27.2, 6, 13, 20, 27.3, 3.4.03 (7 X 2-hour lectures) AXEL-2003 - Introduction to Accelerators : 24 - 28.2.03 (10 X 1-hour lectures) AutoCAD 2002 - niveau 1 : 24, 25.2 & 3, 4.3.03 (4 jours) Introduction à Windows 2000 au CERN : 25.2.03 (1/2 journée) LabView base 2/LabView Basics 2 : 10 & 11.3.03 (2 jours/2 days) langue à définir/Language to be decided C++ for Particle Physicists : 10 - 14.3.03 (6 X 3-hour lectures) Introduction to PVSS : 10.3.03 (half day, afternoon) Basic PVSS : 11 - 13.3.03 (3 days) LabView avancé /LabView Advanced : 12 - 14.3.03 (3 jours/3days) Langue à définir/language to be decided AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) PVSS - JCOP Framework Tutorial : 14.3.03 (1 day) CLEAN-2002 : Working in a cleanroom : 2.4.03 (half-day, afternoon, free course, regis...

  9. Places available **

    CERN Multimedia

    2003-01-01

    Des places sont disponibles dans les cours suivants : Places are available in the following courses : C++ for Particle Physicists : 10 - 14.3.03 (6 X 3-hour lectures) Introduction to PVSS : 10.3.03 (half day, afternoon) Basic PVSS : 11 - 13.3.03 (3 days) PVSS - JCOP Framework Tutorial : 14.3.03 (1 day) CLEAN-2002 : Working in a cleanroom : 2.4.03 (half-day, afternoon, free course, registration required) LabView base 1/LabView Basics 1 : 9 - 11.4.03 (3 jours/3 days) Langue à définir/language to be decided DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03 (6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 11 & 12.3.03 / 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16...

  10. Places available**

    CERN Document Server

    2003-01-01

    If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses : EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 23.10.03 (half day) The EDMS-MTF in practice (free of charge) :  28 -  30.10.03 (6 half-day sessions) AutoCAD 2002 - Level 1 : 3, 4, 12, 13.11.03 (4 days) LabVIEW TestStand ver. 3 : 4 & 5.11.03 (2 days) Introduction to Pspice : 4.11.03 p.m. (half-day) Hands-on Introduction to Python Programm...

  11. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses: Conception de PCB rapides dans le flot Cadence : 11.6.03 (matin) EXCEL 2000 - level 1 : 12 & 13.6.03 (2 days) Introduction to PVSS : 16.6.03 (p.m.) Basic PVSS : 17 - 19.6.03 (3 days) Réalisation de PCB rapides dans le flot Cadence : 17.6.03 (matin) PVSS - JCOP Framework Tutorial : 20.6.03 (1 day) Programmation automate Schneider : Programmation automate Schneider TSX Premium - 2ème niveau : 24 - 27.6.03 (4 jours) - audience : toute personne qui veux maitriser la mise en uvre et la programmation des fonctions spécialisées d'un automate TSX Premium - objectifs : maitriser la mise en uvre et la programmation des fonctions spécialisées d'un automate TSX Premium Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6.03 - 4, 5 & 7.11.03 (session de 3 jours) ** The number of places available may vary. Please check our Web site to find out the current availability. If you wish to participate in one of these courses, pl...

  12. Places available **

    CERN Multimedia

    2003-01-01

    Des places sont disponibles dans les cours suivants : Places are available in the following course : Introduction to the CERN Engineering Data Management System : 28.1.03 (1 day) AutoCAD 2002 - niveau 1 : 24, 25.2 et 3, 4.3.03 (4 jours) AutoCAD 2002 - niveau 2 : 27 & 28.2.03 (2 jours) C++ for Particle Physicists : 10 - 14.3.03 (6 X 3 hour lectures) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) CLEAN-2002 : Working in a cleanroom : 25.3.03 (half-day, afternoon, free course, registration required) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 11 & 12.3.03 / 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 Ces cours seront donnés en français ou anglais en fonction des demandes / These courses will be given in French or English following the requests. * Etant do...

  13. Places available**

    CERN Multimedia

    2003-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: MATLAB Fundamentals and Programming Techniques (ML01) :2 & 3.12.03 (2 days) Oracle 8i : SQL : 3 - 5.12.03 (3 days) The EDMS MTF in practice : 5.12.03 (afternoon, free of charge) Modeling Dynamic Systems with Simulink (SL01) : 8 & 9.12.03 (2 days) Signal Processing with MATLAB (SG01) : 11 & ...

  14. Places available**

    CERN Multimedia

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1 : 9 & 10.1.2004 (2 days) The JAVA Programming Language Level 2 : 11 to 13.1.2004 (3 days) LabVIEW base 1 : 25 - 27.2.2004 (3 jours) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Particle Physicists : 8 - 12.3.2004 ( 6 X 4-hour sessions) LabVIEW Basics 1 : 22 - 24.3.20...

  15. Places available**

    CERN Document Server

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1 :9 & 10.1.2004 (2 days) The JAVA Programming Language Level 2 : 11 to 13.1.2004 (3 days) Hands-on Introduction to Python Programming : 16 - 18.2.2004 (3 days - free of charge) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Particle Physicists : 8 - 12.3.2004...

  16. Places available**

    CERN Document Server

    2003-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval Tel. 74924technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: MATLAB Fundamentals and Programming Techniques (ML01) : 2 & 3.12.03 (2 days) Oracle 8i : SQL : 3 - 5.12.03 (3 days) The EDMS MTF in practice : 5.12.03 (afternoon, free of charge) Modeling Dynamic Systems with Simulink (SL01) : 8 & 9.12.03 (2 days) Signal Processing with MATLAB (SG01) : 11 & 12.12.03 (2 days) The JAVA Programming Language - l...

  17. Places available**

    CERN Document Server

    2003-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Project Planning with MS-Project : 15 & 22.1.2004 (2 days) Joint PVSS JCOP Framework Course : 2 sessions : 2 - 6.2.2004 and 16 - 20-2-2004 (5 days) Hands-on Introduction to Python Programming : 16 - 18.2.2004 (3 days - free of charge) C++ for Particle Physicists : 8 - 12.3.2004 ( 6 X 4-hour sessions)

  18. Places available**

    CERN Document Server

    2003-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval Tel. 74924 technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: JAVA 2 Enterprise Edition - Part 1 : WEB Applications : 20 & 21.11.03(2 days) FrontPage 2000 - niveau 1 : 20 & 21.11.03 (2 jours) Oracle 8i : SQL : 3 - 5.12.03 (3 days) Oracle 8i : Programming with PL/SQL : 8 - 10.12.03 (3 days) The JAVA Programming Language - leve...

  19. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Utilisation du simulateur Simplorer : 30.5 - 1.6.01 (3 jours) Contract Follow-up : 11.6.01 (1/2 journée) LabView hands-on : 11.6.01 F ou E (1/2 journée) LabView Base 1 : 12 - 14.6.01 (3 jours) Habilitation électrique : superviseurs: 2 sessions d'une demi-journée les 12 et 19.6.01 If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.

  20. PLACES AVAILABLE

    CERN Multimedia

    TECHNICAL TRAINING; Tel. 74460

    2001-01-01

    Places are available in the following courses: The JAVA programming language level 1: 8 - 9.2.01 (2 days) AutoCAD 2D niveau 1 : 12 - 16.2.01 (5 jours) The JAVA programming language level 2: 19 - 21.2.01 (3 days) C++ for Particle Physicists: 5 - 9.3.01 (20 hrs on 5 days) Contract Follow-up : 12.3.01 (3 heures) The JAVA programming language level 2: 12 - 14.3.01 (3 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.

  1. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: December 2002   PCAD Schémas - Débutants :  5 & 6.12.02  (2 jours) PCAD PCB - Débutants :  9 - 11.12.02  (3 jours) FrontPage 2000 - level 1:  9 & 10.12.02  (2 days) Introduction à la CAO Cadence (cours gratuit) :  10 & 11.12.02  (2 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval Tel.74924 monique.duval@cern.ch

  2. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: CLEAN-2002 : Travailler en salle blanche (cours gratuit) : 13.08.2002 (matin) Introduction to the CERN Enginnering Data Management System :  27.8.02  (1 day) The CERN Engineering Data Management System for Advanced Users :  28.8.02  (1 day) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval Tel.74924 monique.duval@cern.ch    

  3. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: C++ Programming Level 2 - Traps & Pitfalls:  16 - 19.7.02 (4 days) Frontpage 2000 - level 1 :  22 - 23.7.02  (2 days) Introduction à Windows 2000 au CERN : 24.7.02 (après-midi) CLEAN-2002 : Travailler en salle blanche (cours gratuit) : 13.08.2002 (matin) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval Tel.74924 monique.duval@cern.ch

  4. Placing knowledge

    DEFF Research Database (Denmark)

    Adriansen, Hanne Kirstine; Valentin, Karen; Nielsen, Gritt B.

    Internationalisation of higher education is premised by a seeming paradox: On the one hand, academic knowledge strives to be universal in the sense that it claims to produce generalizable, valid and reliable knowledge that can be used, critiqued, and redeveloped by academics from all over the world......; on the other hand, the rationale for strengthening mobility through internationalisation is based on an imagination of the potentials of particular locations (academic institutions). Intrigued by this tension between universality and particularity in academic knowledge production, this paper presents...... preliminary findings from a project that study internationalisation of higher education as an agent in the interrelated processes of place-making and knowledge-making. The project is based on three case-studies. In this paper, focus is on PhD students’ change of research environment. This is used as a case...

  5. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Introduction to Perl 5 : 2 - 3.7.01 (2 days) Introduction to Databases :  3 - 4.7.01 (2 days) JAVA programming language Level 2 : 4 - 6.7.01 (3 days) Enterprise JavaBeans :  9 - 11.7.01 (3 days) Design Patterns :  10 - 12.7.01 (3 days) C++ for Particle Physicists :  23 - 27.7.01 (6 3-hour lectures) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.

  6. PLACES AVAIABLE

    CERN Multimedia

    TECHNICAL TRAINING; Tel. 74460

    2001-01-01

    Places are available in the following courses: The Java programming language (Level 1) : 8 - 9.2.01 (2 days) Architecture d'automatisme : 20 - 21.2.01 (2 jours) Programmation TSX Premium 1 (Schneider) : 26.2 - 2.3.01 (5 jours) C++ for Particle Physicists : 5 - 9.3.01 (6*3 hour lectures) The Java programming language (Level 2) : 12 - 14.3.2001 (3 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.

  7. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Introduction to Databases :  3 - 4.7.01 (2 days) The JAVA programming language Level 2 : 4 - 6.7.01 (3 days) Enterprise JavaBeans :  9 - 11.7.01 (3 days) Design Patterns :  10 - 12.7.01 (3 days) C++ for Particle Physicists :  23 - 27.7.01 (6 3-hour lectures) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.

  8. ‘We are a community [but] that takes a certain amount of energy’: Exploring shared visions, social action, and resilience in place-based community-led energy initiatives

    International Nuclear Information System (INIS)

    Parkhill, K.A.; Shirani, F.; Butler, C.; Henwood, K.L.; Groves, C.; Pidgeon, N.F.

    2015-01-01

    Highlights: • We engage with conceptual characteristics of 3 community-led energy case studies. • We examine data from interviews to explore the issues community energy groups face. • Shared visions, social action and social resilience are important to community energy. • Creating and maintaining shared visions, social action and social resilience is extremely challenging. - Abstract: In UK energy policy, community-led energy initiatives are increasingly being imbued with transformative power to facilitate low carbon transitions. The ways that such expectations for communities are manifesting in practice remains, however, relatively poorly understood. In particular, key conceptual developments in unpacking what constitutes ‘community’ that highlight the significance of ‘place’ along with important characteristics, such as shared visions, collective social action, and resilience, have yet to be comprehensively explored in the context of community-led energy initiatives. This paper uses an interpretive stance to engage with these conceptual ideas about community and provides insights into the nature of community and its meaning for developing energy-related initiatives and realising the wider goals of energy policy. The paper draws on data from in-depth qualitative, longitudinal interviews undertaken in two residential communities and one purely workplace-based community, which are engaged in community energy initiatives. We argue that there are difficulties and ambiguities in creating shared visions, achieving social action, and developing resilience that are related to the specificities of community in place, but that all three characteristics are likely to be important for the making of sustainable places

  9. Places disponibles*/Places available **

    CERN Multimedia

    2003-01-01

    Des places sont disponibles dans les cours suivants : Places are available in the following course : WorldFIP 2003 pour utilisateurs : 11 - 14.2.03 (4 jours) AutoCAD 2002 - niveau 1 : 24, 25.2 & 3, 4.3.03 (4 jours) Introduction à Windows 2000 au CERN : 25.2.03 (1/2 journée) AutoCAD 2002 - niveau 2 : 27 & 28.2.03 (2 jours) C++ for Particle Physicists : 10 - 14.3.03 (6 X 3 hour lectures) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) CLEAN-2002 : Working in a cleanroom : 2.4.03 (half-day, afternoon, free course, registration required) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 11 & 12.3.03 / 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 Ces cours seront donnés en français ou anglais en fonction des demandes / These courses will be given in French o...

  10. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: LabVIEW base 1 : 22 - 24.4.02 (3 jours) CLEAN 2002 : working in a cleanroom:  24.4.02  (half-day, pm) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) AutoCAD : Mise à jour AutoCAD r-14 vers 2002 : 25 & 26.4.02 (2 jours) Cotations selon les normes GPS de l'ISO : 29 - 30.4.02 (2 jours) Introduction to the CERN Engineering Data Management System:  7.5.02  (1 day) LabVIEW Basics 2: 13 & 14.5.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 13-14, 17, 21, 27-28.5.02 (6 jours) WorldFIP - Généralités : 14.5.2002 (1/2 journée) WorldFIP - Développer avec MicroFIP HANDLER : 14.5 - après-midi, 15.5.02 - matin (1 jour) WorldFIP - FullFIP FDM : FIP Device Manager (F) : 15.5 - après-midi, 16.5.02 - matin (1 jour) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) EXCEL 2000 - niveau 2 : 22 & 23.5.02 (2 jours)...

  11. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: The CERN Engineering Data Management System for Advanced users : 16.4.02  (1 day) Migration from AutoCAD 14 towards AutoCAD Mechanical6 PowerPack:  17 - 19.4 and 2 &3.5.02  (5 days) AutoCAD - niveau 1 : 22, 23, 29, 30.4 et 6, 7.5.02 (6 jours) LabVIEW base 1 : 22 - 24.4.02 (3 jours) CLEAN 2002 : working in a cleanroom:  24.4.02  (half-day, pm) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) AutoCAD : Mise à jour AutoCAD r-14 vers 2002 : 25 & 26.4.02 (2 jours) Cotations selon les normes GPS de l'ISO : 29 - 30.4.02 (2 jours) Introduction to the CERN Engineering Data Management System:  7.5.02  (1 day) LabVIEW Basics 2: 13 & 14.5.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 13-14, 17, 21, 27-28.5.02 (6 jours) WorldFIP - Généralités : 14.5.2002 (1/2 journée) WorldFIP - Développer avec Micr...

  12. PLACES AVAILABLE

    CERN Document Server

    Monique Duval

    2002-01-01

    Places are available in the following courses: ELEC-2002 : Spring Term :  9, 11, 16, 18, 23, 25, 30.4.02 (7 * 2.5 hours) Object-Oriented Analysis & Design: 16 - 19.4.02  (4 days) The CERN Engineering Data Management System for Advanced users:  16.4.02  (1 day) Migration from AutoCAD 14 towards AutoCAD Mechanical6 PowerPack:  17 - 19.4 and 2 &3.5.02  (5 days) AutoCAD - niveau 1 : 22, 23, 29, 30.4 et 6, 7.5.02 (6 jours) LabVIEW base 1 : 22 - 24.4.02 (3 jours) CLEAN 2002 : working in a cleanroom:  24.4.02  (half-day, pm) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) AutoCAD : Mise à jour AutoCAD r-14 vers 2002 : 25 & 26.4.02 (2 jours) Cotations selon les normes GPS de l'ISO : 29 - 30.4.02 (2 jours) Introduction to the CERN Engineering Data Management System:  7.5.02  (1 day) LabVIEW Basics 2 : 13 & 14.5.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 13-...

  13. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses : CLEAN-2002 : Working in a cleanroom (free course, registration required) : 2.4.03 (half-day, afternoon) LabView base 1/LabView Basics 1 (Langue à définir/ language to be decided) : 9 - 11.4.03 (3 jours/3 days) DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03(6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : 3 sessions sont programmées pour 2003 : 25...

  14. Places available **

    CERN Multimedia

    2003-01-01

    Places are available in the following courses : CLEAN-2002 : Working in a cleanroom (free course, registration required): 11.4.03 (half-day, afternoon, ) LabView Basics 2 : 10 - 11.4.03 (3 days) DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03 (6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6....

  15. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses : DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) LabView DAQ (language to be defined) : 8 & 9.5.03 AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03 (6 jours) AutoCAD 2002 - niveau 2 : 3 & 4.6.03 (2 jours) LabView DSC (language to be defined) : 19 & 20.6.03 Siemens SIMATIC Training : Introduction to STEP7 : 3 & 4.6.03 (2 days) STEP7 Programming : 16 - 20.6.03 (5 days) Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 (sessions of 2 days) These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6.03 - 4, 5 & 7.11.03 (session de 3 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description ...

  16. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: Habilitation électrique : recyclage HT/BT : 11 - 15.3.2002  (2 * 2 heures) PVSS Basics :  8 - 12.4.02  (5 days) ELEC-2002 : Spring Term :  9, 11, 16, 18, 23, 25, 30.4.02 (7 * 2.5 hours) LabVIEW base 1 : 22 - 24.4.02 (3 jours) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) LabVIEW Basics 2 : 13 & 14.5.02 (2 days) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) Cours sur la migration AutoCAD :   AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applica...

  17. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses : CLEAN-2002 : Working in a cleanroom (free course, registration required): 11.4.03 (half-day, afternoon, ) LabView Basics 2 : 10 - 11.4.03 (3 days) DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03(6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6...

  18. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses : DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) Programmation de pilotes périphériques : 5 - 8.5.03 (4 jours) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) LabView DAQ (language to be defined) : 8 & 9.5.03 AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.0 (6 jours) FrontPage 2000 - niveau 1 : 20 & 21.5.03 (2 jours) AutoCAD 2002 - niveau 2 : 3 & 4.6.03 (2 jours) EXCEL 2000 - niveau 1 : 10 & 11.6.03 (2 jours) EXCEL 2000 - level 1 : 12 & 13.6.03 (2 days) PowerPoint 2000 (F) : 17 & 18.6.03 (2 jours) FrontPage 2000 - niveau 2 : 19 & 20.6.03 (2 jours) LabView DSC (langue à décider/language to be defined) : 19 & 20.6.03 EXCEL 2000 - niveau 2 : 24 & 25.6.03 (2 jours) Siemens SIMATIC Training : Introduction to STEP7 : 3 & 4.6.03 (2 days) STEP7 Programming : 16 - 20.6.03 (5 days) Simatic Net Network : 26 & 27.6.03 ...

  19. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses : CLEAN-2002 : Working in a cleanroom (free course, registration required): 11.4.03 (half-day, afternoon) LabView Basics 2 : 10 - 11.4.03 (3 days) DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03(6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6.03 - 4, 5 & 7....

  20. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses : Introduction to PVSS : 10.3.03 (half-day, afternoon) CLEAN-2002 : Working in a cleanroom : 2.4.03 (half-day, afternoon, free course, registration required) LabView Basics 1 : 9 - 11.4.03 (3 days) Language to be decided. DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures). AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03 (6 jours) Siemens SIMATIC Training: Introduction to STEP7 : 3 & 4.6.03 (2 days) STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 days) Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité: Etre TSO au CERN : 3 sessions sont programmées pour 2003 : 25, 26 & 28.3.03 - 24, 25 & 27.6.03 - 4, 5 & 7.11.03 (sessions de 3 jours) ** The number o...

  1. PLACES AVAILABLE

    CERN Document Server

    Monique Duval

    2002-01-01

    Places are available in the following courses: LabVIEW Basics 2: 13 & 14.5.02 (2 days) WorldFIP - Généralités : 14.5.2002 (1/2 journée) WorldFIP - Développer avec MicroFIP HANDLER : 14.5 - après-midi, 15.5.02 - matin (1 jour) WorldFIP - FullFIP FDM : FIP Device Manager (F) : 15.5 - après-midi, 16.5.02 - matin (1 jour) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) EXCEL 2000 - niveau 2 : 22 & 23.5.02 (2 jours) The CERN Engineering Data Management System for Advanced users:  30.5.02  (1 day) LabVIEW Basics 1:  3 - 5.6.02  (3 days) AutoCAD 2002 - condensé : 4 - 6.6.02 (3 jours) LabVIEW DAQ (E):  6 & 7.6.02  (2 days) AutoCAD 2002 - Level 1:  10 - 12 and 24 - 26.6.02  (6 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the c...

  2. PLACES AVAILABLE

    CERN Document Server

    Monique Duval

    2002-01-01

    Places are available in the following courses: Introduction to the CERN Engineering Data Management System:  7.5.02  (1 day) LabVIEW Basics 2: 13 & 14.5.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 13-14, 17, 21, 27-28.5.02 (6 jours) WorldFIP - Généralités : 14.5.2002 (1/2 journée) WorldFIP - Développer avec MicroFIP HANDLER : 14.5 - après-midi, 15.5.02 - matin (1 jour) WorldFIP - FullFIP FDM : FIP Device Manager (F) : 15.5 - après-midi, 16.5.02 - matin (1 jour) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) EXCEL 2000 - niveau 2 : 22 & 23.5.02 (2 jours) The CERN Engineering Data Management System for Advanced users:  30.5.02  (1 day) LabVIEW Basics 1:  3 - 5.6.02  (3 days) AutoCAD 2002 - condensé : 4 - 6.6.02 (3 jours) LabVIEW DAQ (E):  6 & 7.6.02  (2 days) AutoCAD 2002 - Level 1:  10 - ...

  3. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: ELEC-2002 : Spring Term :  9, 11, 16, 18, 23, 25, 30.4.02 (7 * 2.5 hours) Object-Oriented Analysis & Design: 16 - 19.4.02  (4 days) The CERN Engineering Data Management System for Advanced users:  16.4.02  (1 day) Migration from AutoCAD 14 towards AutoCAD Mechanical6 PowerPack:  17 - 19.4 and 2 &3.5.02  (5 days) AutoCAD - niveau 1 : 22, 23, 29, 30.4 et 6, 7.5.02 (6 jours) LabVIEW base 1 : 22 - 24.4.02 (3 jours) CLEAN 2002 : working in a cleanroom:  24.4.02  (half-day, pm) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) AutoCAD : Mise à jour AutoCAD r-14 vers 2002 : 25 & 26.4.02 (2 jours) LabVIEW Basics 2 : 13 & 14.5.02 (2 days) EXCEL 2000 - niveau 1 : 15 & 16.5.02 (2 jours) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) EXCEL 2000 - niveau 2 : 22 & 23.5.02 (2 jours) LabVIEW Basics 1:  3 - 5.6.02&a...

  4. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel.74924

    2001-01-01

    Places are available in the following courses: Habilitation électrique : superviseurs : 5.12.01 (1/2 journée) LabVIEW - Basics 1 :  10 - 12.12.01 (3 days) Introduction au PC et Windows 2000 : 12 & 14.12.01 (2 jours) LabVIEW - Basics 2 :  13 - 14.12.01 (2 days) Habilitation électrique : superviseurs : 17.12.2001 (1/2 journée) EXCEL 2000 - niveau 2 : 15 - 16.1.02 (2 jours) Sécurité dans les installations cryogéniques: 15-17.1.2002 (2 demi-journées) C++ Programming Level 2 - Traps and Pitfalls :  15 - 18.1.2002  (4 days) ELEC-2002 Winter Term: Readout and system electronics for Physics  15.1.2002 - 7.2.2002 (8 half- days) Nouveautés de WORD 2000 : 18.1.02 (1/2 journée) LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 - 25.1.02 (4 jours) Frontpage...

  5. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: C++ for Particle Physicists :  11 - 15.3.2002  (6 * 3 hour lectures) Programming the Web for Control Applications : 11, 12, 18, 19.3.2002  (4 * 2 hour lectures) Habilitation électrique : recyclage HT/BT (Français) : 13 - 14.3.2002 (2 * 2 heures) Introduction à la CAO CADENCE : 19 & 20.3.02 (2 jours) LabVIEW base 1 : 22 - 24.4.02 (3 jours) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) LabVIEW Basics 2 : 13 & 14.5.02 (2 days) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) Cours sur la migration AutoCAD :   AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fil...

  6. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: Introduction au PC et à Windows 2000 au CERN : 29 - 30.1.02 (2 jours) LabView Base 1 : 4 - 6.2.02 (3 jours) LabView DAQ  (F) : 7 & 8.2.02 (2 jours) Hands-on Object-Oriented Design & Programming with Java :  11 - 13.02.02 (3 days) PVSS basics :  18 - 22.2.02 (5 days) Introduction à Windows 2000 : 18.2.02 (1 demi-journée) Introduction to the CERN Engineering Data Management System :  20.2.02 (1 day) The CERN Engineering Data Management System for Advanced users :  21.2.02  (1 day) C++ for Particle Physicists :  11 - 15.3.2002  (6 * 3 hour lectures) Cours sur la migration AutoCAD : AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electr...

  7. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: PVSS Basics :  8 - 12.4.02  (5 days) AutoCAD : Mise à jour AutoCAD r-14 vers 2002 : 25 & 26.4.02 (2 jours) ELEC-2002 : Spring Term :  9, 11, 16, 18, 23, 25, 30.4.02 (7 * 2.5 hours) Object-Oriented Analysis & Design: 16 - 19.4.02  (4 days) Migration from AutoCAD 14 towards AutoCAD Mechanical6 PowerPack:  17 - 19.4 and 2 &3.5.02  (5 days) LabVIEW base 1 : 22 - 24.4.02 (3 jours) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) LabVIEW Basics 2 : 13 & 14.5.02 (2 days) EXCEL 2000 - niveau 2 : 22 & 23.5.02 (2 jours) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) LabVIEW Basics 1:  3 - 5.6.02  (3 days) LabVIEW DAQ (E):  6 & 7.6.02  (2 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that...

  8. PLACES AVAILABLE

    CERN Multimedia

    Monique DUVAL

    2002-01-01

    Places are available in the following courses: LabView Basics 1 :  4 - 6.3.02  (3 days) CLEAN-2002 : Working in a Clean Room :  7.3.2002  (half day) LabView Base 2 : 11 & 12.3.02 (2 jours) C++ for Particle Physicists :  11 - 15.3.2002  (6 * 3 hour lectures) Programming the Web for Control Applications : 11, 12, 18, 19.3.2002  (4 * 2 hour lectures) Habilitation électrique : recyclage HT/BT (Français) : 13 - 14.3.2002 (2 * 2 heures) LabView Advanced :  13 - 15.3.02 (3 days) Introduction to the CERN Engineering Data Management System (EDMS) :  20.3.2002  (1 day) The CERN (EDMS) for Advanced Users :  21.3.2002  (1 day) LabVIEW DSC : 25 - 26.4.2002 (2 jours) LabVIEW DAQ : 15 - 16.5.2002 (2 jours) Cours sur la migration AutoCAD :   AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé ...

  9. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: PVSS Basics : 20 - 24.8.01 (5 days) PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) PCAD Schémas - débutants : 4 - 5.10.01 (2 jours) PCAD PCB - débutants : 8 - 10.10.01 (3 jours) Programming TSX Premium 1: 15 - 19.10.01 (5 days) Programmation TSX Premium 1 : 22 - 26.10.01 (5 jours) Programming TSX Premium 2: 19 - 23.11.01 (5 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) The following LabView courses will be given in either English or French according to demand LabVIEW - Base 1 / LabVIEW - Basics 1 : 10 - 12.9.01 (3 jours / 3 days) LabVIEW - DAQ / LabVIEW - DAQ : 13 - 14.9.01 (2 jours / 2 days) LabVIEW - Base 1 / LabVIEW - Basics 1 : 15 - 17.10.01 (3 jours / 3 days) LabVIEW - Base 2 / LabVIEW - Basics 2 : 18 - 19.10.01 (2 jours / 2 days) LabVIEW - Base 1 / LabVIEW - Basics 1 : 12 - 14.11.01 (3 jours / 3 days) LabVIEW - DAQ / LabVIEW - DAQ : 15 - 16.11.01 (2 jours / 2...

  10. PLACES AVAILABLE

    CERN Multimedia

    Technical training; Tel. 74924

    2001-01-01

    Places are available in the following courses: PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) Automates et réseaux de terrain : 3 - 4.10.2001 (2 jours) PCAD Schémas - débutants : 4 - 5.10.01 (2 jours) PCAD PCB - débutants : 8 - 10.10.01 (3 jours) Programmation TSX Premium 1 : 15 - 19.10.01 (5 jours) Programmation TSX Premium 1 : 22 - 26.10.01 (5 jours) Programming TSX Premium 2: 19 - 23.11.01 (5 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Autocad Migration support courses: a detailed calendar will be published shortly for this series of sessions which will start on 15.10.2001. Registration is already open AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) The following LabView courses will be given in either English or French according to demand LabVIEW - Base 1 / LabVIEW - Basics 1 : 10 - 12.9.01 (3 jours / 3 days)...

  11. PLACES AVAILABLES

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: PVSS Basics : 20 - 24.8.01 (5 days) PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) PCAD Schémas - débutants : 4 - 5.10.01 (2 jours) PCAD PCB - débutants : 8 - 10.10.01 (3 jours) Programming TSX Premium 1: 15 - 19.10.01 (5 days) Programmation TSX Premium 1 : 22 - 26.10.01 (5 jours) Programming TSX Premium 2: 19 - 23.11.01 (5 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) The following LabView courses will be given in either English or French according to demand LabVIEW - Base 1 / LabVIEW - Basics 1 : 10 - 12.9.01 (3 jours / 3 days) LabVIEW - DAQ / LabVIEW - DAQ : 13 - 14.9.01 (2 jours / 2 days) LabVIEW - Base 1 / LabVIEW - Basics 1 : 15 - 17.10.01 (3 jours / 3 days) LabVIEW - Base 2 / LabVIEW - Basics 2 : 18 - 19.10.01 (2 jours / 2 days) LabVIEW - Base 1 / LabVIEW - Basics 1 : 12 - 14.11.01 (3 jours / 3 days) LabVIEW - DAQ / LabVIEW - DAQ : 15 - 16.11.01 (2 jours / 2...

  12. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: PVSS basics :  18 - 22.2.02 (5 days) Introduction à la CAO CADENCE : 20 & 21.2.02 (2 jours) LabView Basics 1 :  4 - 6.3.02  (3 days) Introduction au VHDL et utilisation du simulateur de CADENCE : 6 & 7.3.02 (2 jours) LabView Base 2 : 11 & 12.3.02 (2 jours) C++ for Particle Physicists :  11 - 15.3.2002  (6 * 3 hour lectures) LabView Advanced :  13 - 15.3.02 (3 days) Cours sur la migration AutoCAD :   AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO...

  13. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: LabView DAQ  (F) : 7 & 8.2.02 (2 jours) Hands-on Object-Oriented Design & Programming with Java :  11 - 13.02.02 (3 days) PVSS basics :  18 - 22.2.02 (5 days) Introduction à Windows 2000 : 18.2.02 (1 demi-journée) Introduction to the CERN Engineering Data Management System :  20.2.02 (1 day) Introduction à la CAO CADENCE : 20 & 21.2.02 (2 jours) The CERN Engineering Data Management System for Advanced users :  21.2.02  (1 day) LabView Basics 1 :  4 - 6.3.02  (3 days) Introduction au VHDL et utilisation du simulateur de CADENCE : 6 & 7.3.02 (2 jours) LabView Base 2 : 11 & 12.3.02 (2 jours) C++ for Particle Physicists :  11 - 15.3.2002  (6 * 3 hour lectures) LabView Advanced :  13 - 15.3.02 (3 days) Cours sur la migration AutoCAD :   AutoCAD : Mise à...

  14. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: Introduction à la CAO CADENCE : 20 & 21.2.02 (2 jours) LabView Basics 1 :  4 - 6.3.02  (3 days) Introduction au VHDL et utilisation du simulateur de CADENCE : 6 & 7.3.02 (2 jours) CLEAN-2002 : Working in a Clean Room :  7.3.2002  (1 day) LabView Base 2 : 11 & 12.3.02 (2 jours) C++ for Particle Physicists :  11 - 15.3.2002  (6 * 3 hour lectures) LabView Advanced :  13 - 15.3.02 (3 days) Cours sur la migration AutoCAD :   AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisiona...

  15. Media places

    DEFF Research Database (Denmark)

    Linde, Per; Messeter, Jörn

    The impact that ubiquitous wireless network technologies and mobile phones have on our experience of the modern cityscape, has been a driving force in many research projects in recent years. The agendas differ in relation to perspectives, but it seems safe to claim that such technologies are no l......The impact that ubiquitous wireless network technologies and mobile phones have on our experience of the modern cityscape, has been a driving force in many research projects in recent years. The agendas differ in relation to perspectives, but it seems safe to claim that such technologies...... are no longer neutral layers in urban living, but rather an integrated part of the materialities of architecture and urban planning, the social dimensions of city life and emerging new cultural frameworks. Arguably, we have reached a point at which digital designs may be regarded as elements of our everyday...... of how meaning can emerge in the interplay between people, artifacts and place. This paper will present the early and ongoing work in the project “Media places”, which is part of the research platform for new media at Malmö University; MEDEA. The intention is to introduce conceptual foundations...

  16. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Introduction to C Programming :  21- 23.11.01 (3 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Contract Follow-up (F) : 26.11.01 (1/2 journée) Habilitation électrique : électriciens network : 27 - 29.11.2001 (3 jours) Object-Oriented Analysis and Design :  27 - 30.11.2001  (4 days) Introduction to the CERN Engineering Data Management System :  30.11.2001 (1 day) Electromagnetic Compatibility (EMC): Introduction (bilingual) :  3.12.01 (half-day) Introduction to the CERN Engineering Data Management System : 07.12.2001 (1 day) LabVIEW - Basics 1 :  10 - 12.12.01 (3 days) LabVIEW - Basics 2 :  13 - 14.12.01 (2 days) EXCEL 2000 - niveau 2 : 15 - 16.1.02 (2 jours) C++ Programming Level 2 - Traps and Pitfalls :  15 - 18.1.2002  (4 days) Nouveautés de WORD 2000 : 18.1.02 (1/2 journée) FileMaker P...

  17. PLACES AVAILABLES

    CERN Multimedia

    Technical Training; Tel. 74924

    2000-01-01

    Places are available in the following courses:   C++ for Particle Physicists 20 - 24.11.00 6 lectures CANbus 20.11.00 1 journée CANopen 21 et 22.11.00 2 jours Sécutiré dans les installations cryogéniques 21 et 22.11.00 2 demi-journées The JAVA programming language level 2 27 ­ 29.11.00 3 days Contract Follow-up 27.11.00 3 heures 1/2 Cryogénie (introduction) 4 ­ 8.12.00 ANSYS Introduction : langue a décider suivant majorité 5 ­ 7.12.00 3 jours EXCEL 7, 8, 13 et 14.12.00 4 jours Contract Follow-up 15.12.00 3 heures 1/2 If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an “application for training” form available from your Divisional Secretariat or from your DTO (Divisional Training Officer)....

  18. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74460

    2001-01-01

    Places are available in the following courses: LabView Base 1 : 27-29.3.01 (3 jours) Contract Follow-up : 9.4.01 (3 heures) Introduction à PowerPoint : 24.4.01 (1 journée) Publier sur le Web : 25-27.4.01 (3 demi-journées) Programmation TSX Premium 2 : 15-16.5.01 (5 jours) LabView Base 2 : 27-29.3.01 (2 jours) Hands-on Object-oriented Analysis, Design & Programming with C++ :  23-27.4.01 (5 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.

  19. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74460

    2001-01-01

    Places are available in the following courses: The JAVA programming language level 1 : 22 - 23.1.01 (2 days) Introduction to Databases : 23 - 24.1.01 (2 days) EXCEL : 24 - 25.1.01  et 1 - 2.2.01 (4 jours) Advanced and Modern Databases : 25 - 26.01.01 (2 days) UNIX pour non-programmeurs : 31.1 - 2.2.01 (3 jours) JAVA for non-programmers : 5 - 7.2.01 (3 days) Publier sur le Web :  6 - 8.2.01 (3 demi-journées) Contract Follow-up : 12.2.01 (3 heures) Introduction to Oracle SQL and PL/SQL : 12 - 16.2.01 (5 days) The JAVA programming language level 2 : 19 - 21.2.01 (3 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order...

  20. PLACES AVAILABLE

    CERN Multimedia

    TECHNICAL TRAINING; Tel. 74460

    2001-01-01

    Places are available in the following courses: Introduction to Databases : 23 - 24.1.01 (2 days) Advanced and Modern Databases : 25 - 26.01.01 (2 days) UNIX pour non-programmeurs : 31.1 - 2.2.01 (3 jours) JAVA for non-programmers : 5 - 7.2.01 (3 days) Contract Follow-up : 12.2.01 (3 heures) Introduction to Oracle SQL and PL/SQL : 12 - 16.2.01 (5 days) AutoCAD 2D niveau I : 12 - 16.2.02 (5 jours) The JAVA programming language level 2 : 19 - 21.2.2001 (3 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.

  1. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Contract Follow-up (F) : 30.10.01 (1/2 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) Nouveautés d'EXCEL : 5.11.01 (1/2 journée) Introduction a Windows 2000 au CERN : 6.11.01 (1/2 journée) The Java programming language Level 1: 8 - 9.11.01 (2 days) LabView Base 1 : 12 - 14.11.01 (3 jours) Automates et réseaux de terrain : 13 & 14.11.01 (2 jours) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2 days) Programming TSX Premium 1 :  19 - 23.11.01  (5 days) Introduction to C Programming :  21- 23.11.01 (3 days) The Java programming language Level 2:  26 - 28.11.01 (3 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Autocad Migration support courses: a detail...

  2. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Nouveautés d'EXCEL : 5.11.01 (1/2 journée) Introduction a Windows 2000 au CERN : 6.11.01 (1/2 journée) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) Design Patterns :  7 - 8.11.01 (2 days) The Java programming language Level 1: 8 - 9.11.01 (2 days) Automates et réseaux de terrain : 13 & 14.11.01 (3 jours) Introduction à Windows 2000 au CERN : 12 - 14.11.01 (1/2 journée) Introduction to Windows 2000 at CERN :  14.11.01  (half-day) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to C Programming :  21- 23.11.01 (3 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Contract Follow-up (F) : 26.11.01 (1/2 journée) Object-Oriented Analysis and Design :  27 - 30.11.2001  (4 days) Hands-on Object-Oriented Design and Programming with C++ :  11 - 13.12.2...

  3. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Contract Follow-up (F) : 30.10.01 (1/2 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) Nouveautés d'Excel 2000 : 5.11.01 (1/2 journée) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) Introduction à Windows 2000 au CERN : 6.11.01 (1/2 journée) The Java programming language Level 1: 8 - 9.11.01 (2 days) LabView Base 1 : 12 - 14.11.01 (3 jours) LabVIEW DAQ (F) : 15 & 16.11.01 (2 jours) Automates et réseaux de terrain : 13 & 14.11.01 (2 jours) Introduction to PERL 5 :  15 - 16.11.01  (2 days) LabVIEW - DAQ : 15 - 16.11.01 (2 jours) Introduction to XML :  19 - 20.11.01 (2 days) Introduction to C Programming :  21- 23.11.01 (3 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Object-Oriented Analysis and Design :  27 - 30.11.2001 (4 days) Hands...

  4. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Automates et réseaux de terrain : 13 & 14.11.01 (3 jours) Introduction à Windows 2000 au CERN : 12 - 14.11.01 (1/2 journée) Introduction to Windows 2000 at CERN :  14.11.01  (half-day) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Sécurité dans les installations cryogéniques : 21 - 22.11.2001 (2 demi-journées) Introduction to C Programming :  21- 23.11.01 (3 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Contract Follow-up (F) : 26.11.01 (1/2 journée) Object-Oriented Analysis and Design :  27 - 30.11.2001  (4 days) Introduction to the CERN Engineering Data Management System :  30.11.2001 (1 day) Electromagnetic Compatibility (EMC): Introduction (bilingual) :  3.12.01 (half-day) Introduction to the CERN Engineering Data Management System : 07.12.2001...

  5. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Utilisation du simulateur Simplorer : 30.5 - 1.6.01 (3 jours) JAVA programming language level 1: 11-12.6.01 (2 days) LabView hands-on F ou E : 11.6.01 (1/2 journée) Comprehensive VHDL for EPLD/FPGA Design : 11 - 15.6.01 (5 days) Introduction au Langage C : 13 - 15.6.01 (3 jours) LabView Base 1 : 12 - 14.6.01 (3 jours) Habilitation électrique : superviseurs : 2 sessions d'une demi-journée les 12 et 19.6.01 Migration de LabVIEW 5 vers LabVIEW 6i Migration from LabVIEW 5 to LabVIEW 6I :  15.6.01 (1/2 journée/half-day) Introduction to Perl 5 : 2 - 3.7.01 (2 days) JAVA programming language level 2 : 4 - 6.7.01 (3 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from ...

  6. PLACES AVAILABLE

    CERN Multimedia

    Technical Traininf; Tel. 74924

    2001-01-01

    Places are available in the following courses: Electromagnetic Compatibility (EMC): Introduction (bilingual) :  3.12.01 (half-day) Habilitation électrique : superviseurs : 5.12.01 (1/2 journée) Introduction to the CERN Engineering Data Management System : 07.12.2001 (1 day) LabVIEW - Basics 1 :  10 - 12.12.01 (3 days) Introduction au PC et Windows 2000 : 12 & 14.12.01 (2 jours) LabVIEW - Basics 2 :  13 - 14.12.01 (2 days) Habilitation électrique : superviseurs : 17.12.2001 (1/2 journée) EXCEL 2000 - niveau 2 : 15 - 16.1.02 (2 jours) C++ Programming Level 2 - Traps and Pitfalls :  15 - 18.1.2002  (4 days) Nouveautés de WORD 2000 : 18.1.02 (1/2 journée) LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 - 25.1.02 (4 jours) Introduction au PC et à Windows 2000 au CERN : 29 - 30.1....

  7. Places available**

    CERN Document Server

    2003-01-01

    Places are available in the following courses : EXCEL 2000 - niveau 1 : 10 & 11.6.03 (2 jours) Conception de PCB rapides dans le flot Cadence : 11.6.03 (matin) EXCEL 2000 - level 1 : 12 & 13.6.03 (2 days) Introduction to PVSS : 16.6.03 (p.m.) Basic PVSS : 17 - 19.6.03 (3 days) Réalisation de PCB rapides dans le flot Cadence : 17.6.03 (matin) PVSS - JCOP Framework Tutorial : 20.6.03 (1 day) EXCEL 2000 - niveau 2 : 24 & 25.6.03 (2 jours) Siemens SIMATIC Training : Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) STEP7 Programming : 16 - 20.6.03 (5 jours/5 days) Simatic Net Network : 26 & 27.6.03 (2 jours/2 days) These courses will be given in French or English following the requests. Programmation automate Schneider : Programmation automate Schneider TSX Premium - 1er niveau : 10 - 13.6.03 (4 jours) - audience : toute personne qui veux maitriser la msie en uvre et la programmation d'un automate TSX Premium - objectifs : maitriser la mise en uvre et la programmation d'un autom...

  8. Places available **

    CERN Document Server

    2003-01-01

    Places are available in the following courses: PIPES-2003 - Pratique du Sertissage de tubes métalliques et multicouches : 26.8.03 (stage pratique) The CERN Engineering Data Management System (EDMS) for Engineers : 27.8.03 (1 day, free of charge) CLEAN-2002 : Travailler en salle blanche : 4.9.03 (une demi-journée, séminaire gratuit) The CERN Engineering Data Management System (EDMS) for Local Administrators : 24 & 25.9.03 (2 days, free of charge) Siemens SIMATIC Training : Programmation STEP7 - niveau 1 : 29 - 2.10.03 (4 jours) - ouverture des inscriptions fin août Programmation STEP7 - niveau 2 : 13 - 17.10.03 (5 jours) - ouverture des inscriptions fin août Réseau Simatic Net : 22 & 23.10.03 (2 jours) - ouverture des inscriptions fin août CLEAN-2002 : Working in a Cleanroom : 23.20.03 (half day, free of charge) These courses will be given in French or Englis...

  9. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses : FrontPage 2000 - niveau 1 : 20 & 21.5.03 (2 jours) PIPES-2003 : Pratique du sertissage de tubes métalliques et multicouches : 21.5.03 (1 jour) Introduction à la CAO Cadence : de la saisie de schéma Concept-HDL au PCB : 20 & 22.5.03 (2 jours) AutoCAD 2002 - niveau 2 : 3 & 4.6.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 5, 6, 12, 13, 26, 27.6.03 (6 jours) EXCEL 2000 - niveau 1 : 10 & 11.6.03 (2 jours) Conception de PCB rapides dans le flot Cadence : 11.6.03 (matin) EXCEL 2000 - level 1 : 12 & 13.6.03 (2 days) PowerPoint 2000 (F) : 17 & 18.6.03 (2 jours) Réalisation de PCB rapides dans le flot Cadence : 17.6.03 (matin) FrontPage 2000 - niveau 2 : 19 & 20.6.03 (2 jours) LabView DSC (langue à décider/language to be defined) : 19 & 20.6.03 EXCEL 2000 - niveau 2 : 24 & 25.6.03 (2 jours) Siemens SIMATIC Training: Introduction to STEP7 : 3 & 4.6.03 (2 days) STEP7 Programming : 16 - 20.6.03 (5 days) Simatic...

  10. Places available**

    CERN Document Server

    2003-01-01

    Places are available in the following courses : FrontPage 2000 - niveau 1: 20 & 21.5.03 (2 jours) PIPES-2003 : Pratique du sertissage de tubes métalliques et multicouches: 21.5.03 (1 jour) Introduction à la CAO Cadence: de la saisie de schéma Concept-HDL au PCB : 20 & 22.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (E): 5, 6, 12, 13, 26, 27.6.03 (6 days) EXCEL 2000 - niveau 1: 10 & 11.6.03 (2 jours) Conception de PCB rapides dans le flot Cadence: 11.6.03 (matin) EXCEL 2000 - level 1: 12 & 13.6.03 (2 days) Introduction to PVSS: 16.6.03 (half-day, pm) Basic PVSS: 17 - 19.6.03 (3 days) Réalisation de PCB rapides dans le flot Cadence: 17.6.03 (matin) LabView DSC (language to be defined): 19 & 20.6.03 PVSS - JCOP Framework Tutorial: 20.6.03 (1 day) EXCEL 2000 - niveau 2: 24 & 25.6.03 (2 jours) Siemens SIMATIC Training: Introduction to STEP7: 3 & 4.6.03 (2 days) STEP7 Programming: 16 - 20.6.03 (5 days) Simatic Net Network: 26 & 27.6.03 (2 days) These courses will be given...

  11. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: November 2002   Java Programming Language level 1 :  28 & 29.11.02  (2 days) December 2002   LabVIEW - DSC (English) :  2 - 3.12.02  (2 days) FileMaker (Français) :  2 - 5.12.02  (4 jours) PCAD Schémas - Débutants :  5 & 6.12.02  (2 jours) PCAD PCB - Débutants :  9 - 11.12.02  (3 jours) FrontPage 2000 - level 1:  9 & 10.12.02  (2 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training M...

  12. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: LabView Hands-on (bilingue/bilingual - gratuit/free of charge) : 13.9.02 (a.m.) LabView DAQ Hands-on (bilingue/bilingual - gratuit/free of charge) : 13.9.02 (p.m.) AutoCAD 2002 - niveau 1 : 19, 20, 26, 27.9.02 (4 jours) LabView Base 1 : 23 - 25.9.02 (3 jours) LabView DAQ (E) : 26 - 27.9.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 30.9, 1, 2, 9, 10, 11.10.02 (6 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 10.10.02 (half-day, p.m.) AutoCAD 2002 - niveau 2 : 14 - 15.10.02 (2 jours) AutoCAD 2002 - Level 1 : 17, 18, 24, 25.10.02 (4 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Of...

  13. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: Introduction to Oracle 8i : SQL and PL/SQL:  7 - 11.10.02  (5 days) CLEAN-2002 : Working in a Cleanroom (free of charge):  10.10.02  (half-day, p.m.) AutoCAD 2002 - niveau 2 :  14 - 15.10.02  (2 jours) Introduction à DesignSpace :  16.10.02  (1 journée) Introduction to DesignSpace:  17.10.02  (1 day) AutoCAD 2002 - Level 1:  17, 18, 24, 25.10.02  (4 days) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11.02  (6 jours) Introduction à ANSYS/Introduction to ANSYS (langue à définir suivant demande/ Language to be chosen according to demand):  21 - 25.10.02  (5 jours/days) HREF-2002: Helium Refrigeration Techniques (English-French, bilingual) :  21 - 25.10.2002  (7 half days) HREF-2002: Techniques de la Réfri...

  14. Places available**

    CERN Document Server

    2003-01-01

    Places are available in the following courses : The CERN EDMS for Local Administrators : 24 & 25.9.03 (2 days, free of charge) HeREF-2003 : Techniques de la réfrigération Hélium (cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom : 23.10.03 (half day, free of charge) AutoCAD 2002 - Level 1 : 3, 4, 12, 13.11.03 (4 days) AutoCAD 2002 - niveau 2 : 10 & 11.11.03 (2 jours) ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) AutoCAD Mechanical 6 PowerPack (E) : 17, 18, 24, 25.11 & 1, 2.12.03 (6...

  15. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: Introduction à DesignSpace :  16.10.02  (1 journée) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11.02  (6 jours) Introduction à ANSYS 21 - 25.10.02  (5 jours/days) HREF-2002: Helium Refrigeration Techniques (English-French, bilingual) :  21 - 25.10.2002  (7 half days) LabVIEW Basics 1 (English):  21 - 23.10.02  (3 days) LabVIEW Basics 2 (English):  24 & 25.10.02  (2 days) Oracle 8i : Access the Database with Java:  7 & 8.11.02  (2 days) AutoCAD 2002 - niveau 2 :  7 & 8.11.02  (2 jours) AutoCAD 2002 - Level 1:  14, 15, 21, 22.11.02  (4 days) LabVIEW - Advanced (English) :  18 - 20.11.2002  (3 days) AutoCAD 2002 - niveau 1 :  19, 20, 25, 26.11.02 (4 jours) Oracle iDS Designer: First Class:&...

  16. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: Java 2 Enterprise Edition - Part 2: Enterprise JavaBeans:  18 - 20.9.02  (3 days) AutoCAD 2002 - niveau 1 :  19, 20, 26, 27.9.02  (4 jours) LabView Base 1 :  23 - 25.9.02  (3 jours) Object-Oriented Analysis & Design using UML:  25 - 27.9.02  (3 days) LabView DAQ (E):  26 - 27.9.02  (2 days) Introduction to Oracle 8i : SQL and PL/SQL:  7 - 11.10.02  (5 days) CLEAN-2002 : Working in a Cleanroom (free of charge):  10.10.02  (half-day, p.m.) AutoCAD 2002 - niveau 2 :  14 - 15.10.02  (2 jours) Introduction à DesignSpace :  16.10.02  (1 journée) Introduction to DesignSpace:  17.10.02  (1 day) AutoCAD 2002 - Level 1:  17, 18, 24, 25.10.02  (4 days) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11....

  17. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: November 2002   LabView hands-on (bilingue/bilingual): 5.11.02 (matin/morning) LabView DAQ hands-on (bilingue/bilingual):  5.11.02  (après-midi afternoon) PCAD Schémas - Débutants :  5 & 6.11.02  (2 jours) PCAD PCB - Débutants :  9 - 11.11.02  (3 jours) Introduction au PC et Windows 2000 au CERN :  6 & 7.11.02  (2 jours) Oracle 8i : Access the Database with Java :  7 & 8.11.02  (2 days) Introduction to PVSS (free of charge):  11.11.2002 pm  (1/2 day) Basic PVSS:  12 - 14.11.02  (3 days) EXCEL 2000 - niveau 1 :  12 & 13.11.02  (2 jours) CLEAN-2002: Working in a Cleanroom (English, free of charge):  13.11.2002  (afternoon) LabView Base 1 :  13 - 15.11.02  (3 jours) AutoCAD 2002 - niveau 1 :  14, 15, 21, 22.11.02  (4 jours) LabVIEW - Advanced:  18 - 20.11.02  (3 days) Hands-on Object-Oriented Design and Programming with C++ :  19 - 21.11.02  (3 days)  LabVIEW - Basics 2:  21 - 22.11.02 ...

  18. Places available**

    CERN Document Server

    2003-01-01

    Places are available in the following courses: CLEAN-2002 : Travailler en salle blanche (séminaire gratuit) : 4.9.03 (une demi-journée) The CERN EDMS for Local Administrators (free of charge) : 24 & 25.9.03 (2 days) HeREF-2003 : Techniques de la réfrigération Hélium (cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 23.10.03 (half day) AutoCAD Mechanical 6 PowerPack (E) : 23, 24, 30, 31.10 & 12, 13.11.03 (6 days) AutoCAD 2002 - niveau 2 : 10 & 11.11.03 (2 jours)...

  19. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses: The CERN EDMS for Local Administrators : 24 & 25.9.03 (2 days, free of charge) HeREF-2003 : Techniques de la réfrigération Hélium cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom : 23.10.03 (half day, free of charge) AutoCAD 2002 - Level 1 : 3, 4, 12, 13.11.03 (4 days) AutoCAD 2002 - niveau 2 : 10 & 11.11.03 (2 jours) ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) AutoCAD Mechanical 6 PowerPack (E) : 17, 18, 24, 25.11 & 1, 2.12.03 (6 days) FrontPage 2000 - niveau 1 : 20 & 21.11.03 (2 jours) MAGNE-03 : Magnétisme pour l'électrotechnique : 25 - 27.11.03 (3 jours) ...

  20. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: LabView hands-on (bilingue/bilingual): 5.11.02 (matin/morning) LabView DAQ hands-on (bilingue/bilingual):  5.11.02  (après-midi afternoon) Introduction au PC et Windows 2000 au CERN:  6 & 7.11.02  (2 jours) Oracle 8i : Access the Database with Java:  7 & 8.11.02  (2 days) AutoCAD 2002 - niveau 2:  7 & 8.11.02  (2 jours) Introduction to PVSS (free of charge):  11.11.2002 pm  (1/2 day) Basic PVSS:  12 - 14.11.02  (3 days) EXCEL 2000 - niveau 1:  12 & 13.11.02  (2 jours) CLEAN-2002: Working in a Cleanroom (English, free of charge):  13.11.2002  (afternoon) LabView Base 1 :  13 - 15.11.02  (3 jours) AutoCAD 2002 - Level 1:  14, 15, 21, 22.11.2002  (4 days) LabVIEW - Advanced:  18 - 20.11.02  (3 days) Auto...

  1. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses: PIPES-2003 - Pratique du sertissage de tubes métalliques et multicouches :26.8.03(stage pratique) The CERN EDMS for Engineers (free of charge) : 27.8.03 (1 day) CLEAN-2002 : Travailler en salle blanche (séminaire gratuit) : 4.9.03(une demi-journée) The CERN EDMS for Local Administrators (free of charge) : 24 & 25.9.03 (2 days) HeREF-2003 : Techniques de la réfrigération Hélium (cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 23.10.03 (half day) AutoCAD Mechanical 6 PowerPack (E) : 23, 24, 30, 31.10 & 12, 13.11.03 (6 days) AutoCAD 2002 - niveau 2...

  2. Places available**

    CERN Multimedia

    2003-01-01

    Places are available in the following courses: The CERN EDMS for Local Administrators (free of charge) : 24 & 25.9.03 (2 days) HeREF-2003 : Techniques de la réfrigération Hélium (cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 23.10.03 (half day) AutoCAD Mechanical 6 PowerPack (E) : 23, 24, 30, 31.10 & 12, 13.11.03 (6 days) AutoCAD 2002 - niveau 2 : 10 & 11.11.03 (2 jours) ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) FrontPage 2000 - niveau 1 : 20...

  3. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: October 2002   Introduction to the CERN Engineering Data Management System (free of charge):  29.10.2002  (1 day) The CERN EDMS for Advanced users (free of charge):  30.10.2002  (1 day) November 2002   LabView hands-on (bilingue/bilingual): 5.11.02 (matin/morning) LabView DAQ hands-on (bilingue/bilingual):  5.11.02  (après-midi afternoon) Introduction au PC et Windows 2000 au CERN :  6 & 7.11.02  (2 jours) Oracle 8i : Access the Database with Java:  7 & 8.11.02  (2 days) AutoCAD 2002 - niveau 2 :  7 & 8.11.02  (2 jours) Introduction to PVSS (free of charge):  11.11.2002 pm  (1/2 day) Basic PVSS:  12 - 14.11.02  (3 days) EXCEL 2000 - niveau 1 :  12 & 13.11.02  (2 jours) CLEAN-2002: Working in a Cleanroom (English, free ...

  4. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: Introduction to Oracle 8i : SQL and PL/SQL:  7 - 11.10.02  (5 days) CLEAN-2002 : Working in a Cleanroom (free of charge):  10.10.02  (half-day, p.m.) LabView Hands-on (bilingue/bilingual) : 10.10.02 (matin/morning) LabView DAQ Hands-on (bilingue/bilingual)  10.10.02 (après-midi /afternoon) Introduction à DesignSpace :  16.10.02  (1 journée) Introduction to DesignSpace:  17.10.02  (1 day) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11.02  (6 jours) Introduction à ANSYS/Introduction to ANSYS (langue à définir suivant demande/ Language to be chosen according to demand):  21 - 25.10.02  (5 jours/days) HREF-2002: Helium Refrigeration Techniques (English-French, bilingual) :  21 - 25.10.2002  (7 half days) HREF-2002: Techniques de la...

  5. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: November 2002   Hands-on Object-Oriented Design and Programming with C++:  19 - 21.11.02  (3 days)  December 2002   LabVIEW - DSC (English) :  2 - 3.12.02  (2 days) AutoCAD 2002 - niveau 2 :  2 & 3.12.02  (2 jours) FileMaker (Français) :  2 - 5.12.02  (4 jours) PCAD Schémas - Débutants :  5 & 6.12.02  (2 jours) PCAD PCB - Débutants :  9 - 11.12.02  (3 jours) FrontPage 2000 - level 1:  9 & 10.12.02  (2 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisiona...

  6. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: November 2002   Introduction to PVSS (free of charge): 11.11.02  (afternoon) EXCEL 2000 - niveau 1 :  12 & 13.11.02  (2 jours) CLEAN-2002: Working in a Cleanroom (English, free of charge):  13.11.2002  (afternoon) AutoCAD 2002 - niveau 1 :  14, 15, 21, 22.11.02  (4 jours) Hands-on Object-Oriented Design and Programming with C++:  19 - 21.11.02  (3 days)  EXCEL 2000 - niveau 2 :  25 & 26.11.02  (2 jours) FrontPage 2000 - niveau 1 :  27 & 28.11.02  (2 jours) December 2002   LabVIEW - DSC (English) :  2 - 3.12.02  (2 days) AutoCAD 2002 - niveau 2 :  2 & 3.12.02  (2 jours) FileMaker (Français) :  2 - 5.12.02  (4 jours) PCAD Schémas - Débutants :  5 & 6.12.02 ...

  7. PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2002-01-01

    Places are available in the following courses: LabView Base 1 :  23 - 25.9.02  (3 jours) Object-Oriented Analysis & Design using UML:  25 - 27.9.02  (3 days) LabView DAQ (E):  26 - 27.9.02  (2 days) Introduction to Oracle 8i : SQL and PL/SQL:  7 - 11.10.02  (5 days) CLEAN-2002 : Working in a Cleanroom (free of charge):  10.10.02  (half-day, p.m.) AutoCAD 2002 - niveau 2 :  14 - 15.10.02  (2 jours) Introduction à DesignSpace :  16.10.02  (1 journée) Introduction to DesignSpace:  17.10.02  (1 day) AutoCAD 2002 - Level 1:  17, 18, 24, 25.10.02  (4 days) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11.02  (6 jours) Introduction à ANSYS/Introduction to ANSYS (langue à définir suivant demande/ Language to be chosen according to demand):...

  8. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74460

    2001-01-01

    Places are available in the following courses: Introduction à PowerPoint : 26.2.01 (1 journée) Programmation TSX Premium 1 : 26.2 - 2.3.01 (5 jours) Premiers pas avec votre PC : 27.2 - 2.3.01 (4 matins) C++ for Particle Physicists :  5 - 9.3.01 (6*3 hour lectures) The CERN Engineering Data Management System for Electronic Design : 6.3.01 (1 day) The CERN Engineering Data Management System for Electronic Design : 7.3.01 (1 day) EXCEL : 6, 7 et 13, 14.3.01 (4 jours) The JAVA programming language level 2 : 12 - 14.3.01 (3 days) Nouveautés de FileMaker : 20 - 23.03.01 (4 matins) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be acc...

  9. PLACES AVAILABLE

    CERN Multimedia

    Enseignement Technique; Tél. 74924; Technical Training; Monique Duval; Tel. 74924

    2000-01-01

    Places are available in the following courses : Premiers pas avec votre PC 12 - 15.9.00 (4 demi-journées) WORD 20, 21 et 26, 27.9.2000 (4 jours) JAVA programming level 1 25 - 26.9.2000 (2 days) Gaz inflammables 1 26.9.2000 (1 journée) Advanced aspects of PERL 5 6.10.2000 (1 day) Initiation au WWW 10 - 12.10.00 (3 demi-journées) WORD : importer et manipuler des images 16.10.2000 (1 journée) FileMaker 17, 18 et 24, 25.10.00 (4 jours) Nouveautés de WORD 19 et 20.10.2000 (2 jours) ACCESS 1er niveau 30 - 31.10.00 (2 jours)Introduction à PowerPoint 6.11.00 (1 journée)Nouveautés d’EXCEL 7.11.2000(4 demi-journées)Excel 13, 14 et 20, 21.11.00 (4 jours) LabView hands-on 13.11.2000(4 hours)LabView Basics 1 14 - 16.11.2000 (3 days) MS-Project 1er niveau 14-17.11.00 (4 demi-journées) If you wish to participate in one of these courses, please discuss with your supervisor and apply elec...

  10. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) LabView Base 2 : 18 & 19.10.01 (2 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) Contract Follow-up (F) : 30.10.01 (1/2 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) The Java programming language Level 1: 8 - 9.11.01 (2 days) LabView Base 1 : 12 - 14.11.01 (3 jours) Automates et réseaux de terrain : 13 & 14.11.01 (2 jours) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2 days) Programming TSX Premium 1 :  19 - 23.11.01  (5 days) Introduction to C Programming :  21- 23.11.01 (3 days) The Java programming language Level 2:  26 - 28.11.01 (3 days) Programmation TSX Premium 2 : 26 ...

  11. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Introduction à Windows 2000 au CERN : 2 sessions de _ journée les 24 et 25.9.01 PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) PowerPoint 2000 : 1 et 2.10.01 (2 jours) EXCEL 2000 - niveau 1 : 3 et 4.10.01 (2 jours) Automates et réseaux de terrain : 3 - 4.10.2001 (2 jours) PCAD Schémas - débutants : 4 - 5.10.01 (2 jours) Introduction à Outlook : 5.10.01 (1 journée) Frontpage 2000 - niveau 1 : 8 et 9.10.01 (2 jours) PCAD PCB - débutants : 8 - 10.10.01 (3 jours) C++ for Particle Physicists : 8 - 12.10.01 (6 3-hour lectures) MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) LabView Basics 1 :  15 - 17.10.01  (3 days) Programmation TSX Premium 1 : 15 - 19.10.01 (5 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) Programmation TSX Premium 1 : 22 - 26.10.01...

  12. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: LabVIEW - Basics 1 :  10 - 12.12.01 (3 days) Introduction to XML :  12 & 13.12.01 (2 days) Introduction au PC et Windows 2000 : 12 & 14.12.01 (2 jours) LabVIEW - Basics 2 :  13 - 14.12.01 (2 days) Habilitation électrique : superviseurs : 17.12.2001 (1/2 journée) MS-Project 2000 : 10 & 11.01.02 (2 jours) EXCEL 2000 - niveau 2 : 15 - 16.1.02 (2 jours) Sécurité dans les installations cryogéniques: 15-17.1.2002 (2 demi-journées) C++ Programming Level 2 - Traps and Pitfalls :  15 - 18.1.2002  (4 days) ELEC-2002 Winter Term: Readout and system electronics for Physics  15.1.2002 - 7.2.2002 (8 half- days) Nouveautés de WORD 2000 : 18.1.02 (1/2 journée) LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 -...

  13. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Introduction à Windows 2000 au CERN : 2 sessions de _ journée les 24 et 25.9.01 PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) EXCEL 2000 - niveau 1 : 3 et 4.10.01 (2 jours) Automates et réseaux de terrain : 3 - 4.10.2001 (2 jours) Introduction à Outlook : 5.10.01 (1 journée) Frontpage 2000 - niveau 1 : 8 et 9.10.01 (2 jours) C++ for Particle Physicists : 8 - 12.10.01 (6 lectures) MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) Programmation TSX Premium 1 : 15 - 19.10.01 (5 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) Programmation TSX Premium 1 : 22 - 26.10.01 (5 jours) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) The Java programming language Level 1: 8 - 9.11.01 (2 days) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2...

  14. PLACES AVAILABLE

    CERN Multimedia

    TECHNICAL TRAINING; Tel. 74460

    2001-01-01

    Places are available in the following courses: MS-Project 1er niveau : 20 - 23.2.01 (4 matins) Architecture d'automatisme : 20 - 21.2.01 (2 jours) Introduction à PowerPoint : 26.2.01 (1 journée) Programmation TSX Premium 1 (Schneider) : 26.2 - 2.3.01 (5 jours) Premiers pas avec votre PC : 27.2 - 2.3.01 (4 matins) C++ for Particle Physicists : 5 - 9.3.01 (6*3 hour lectures) EXCEL : 6, 7 et 13, 14.3.01 (4 jours) The JAVA programming language level 2 :  12 - 14.3.01 (3 days) Nouveautés de FileMaker :  20 - 23.03.01 (4 matins) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.

  15. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel 74924

    2002-01-01

    Places are available in the following courses: LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 - 25.1.02 (4 jours) MS-Project 2000 : 24 & 25.01.02 (2 jours) Introduction au PC et à Windows 2000 au CERN : 29 - 30.1.02 (2 jours) LabView Base 1 : 4 - 6.2.02 (3 jours) LabView DAQ (E) : 7 & 8.02.02 (2 days) Hands-on Object-Oriented Design & Programming with Java : 11 - 13.02.02 (3 days) C++ for Particle Physicists : 11 - 15.3.2002 (6 * 3 hour lectures) Cours sur la migration AutoCAD : AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO ...

  16. PLACES AVAILABLE

    CERN Multimedia

    Enseignement Technique; Tel. 74924

    2001-01-01

    Places are available in the following courses: MS-Project 2000 : 10 & 11.01.02 (2 jours) EXCEL 2000 - niveau 2 : 15 - 16.1.02 (2 jours) Sécurité dans les installations cryogéniques: 15-17.1.2002 (2 demi-journées) C++ Programming Level 2 - Traps and Pitfalls :  15 - 18.1.2002  (4 days) ELEC-2002 Winter Term: Readout and system electronics for Physics  15.1.2002 - 7.2.2002 (8 half- days) Nouveautés de WORD 2000 : 18.1.02 (1/2 journée) LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 - 25.1.02 (4 jours) MS-Project 2000 : 24 & 25.01.02 (2 jours) Introduction au PC et à Windows 2000 au CERN : 29 - 30.1.02 (2 jours) LabView Base 1 : 4 - 6.2.02 (3 jours) LabView DAQ  (E) :  7 & 8.02.02 (2 days) Hands-on Object-Oriented Design & Programming with Java :&nbs...

  17. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: EXCEL 2000 - niveau 1 : 3 et 4.10.01 (2 jours) Automates et réseaux de terrain : 3 - 4.10.2001 (2 jours) Introduction à Outlook : 5.10.01 (1 journée) C++ for Particle Physicists : 8 - 12.10.01 (6 lectures) Cadence Board Design tools : Upgrading to release 14 : 3 1-day sessions on 9, 10 & 11.10.01 MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) LabView Base 2 : 18 & 19.10.01 (2 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) The Java programming language Level 1: 8 - 9.11.01 (2 days) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2 days) Programming TSX Premium 1 :  19 - 23.11.01  (5 days) Introd...

  18. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2002-01-01

    Places are available in the following courses: LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 - 25.1.02 (4 jours) MS-Project 2000 : 22, 24 & 25.01.02 (3 jours) Introduction au PC et à Windows 2000 au CERN : 29 - 30.1.02 (2 jours) LabView Base 1 : 4 - 6.2.02 (3 jours) LabView DAQ  (E) :  7 & 8.02.02 (2 days) Hands-on Object-Oriented Design & Programming with Java :  11 - 13.02.02 (3 days) PVSS basics :  11 - 15.2.02 (5 days) Introduction à Windows 2000 : 18.2.02 (1 demi-journée) Introduction to the CERN Engineering Data Management System :  20.2.02 (1 day) The CERN Engineering Data Management System for Advanced users :  21.2.02  (1 day) C++ for Particle Physicists :  11 - 15.3.2002  (6 * 3 hour lectures) Cours sur la migration AutoCAD : AutoCAD : Mise à...

  19. PLACES AVAILABLE

    CERN Multimedia

    Technical Training; Tel. 74924

    2001-01-01

    Places are available in the following courses: Cadence Board Design tools : Upgrading to release 14 :  3 1-day sessions on 9, 10 & 11.10.01 MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) LabView Base 2 : 18 & 19.10.01 (2 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) Contract Follow-up (F) :  30.10.01 (1/2 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) The Java programming language Level 1: 8 - 9.11.01 (2 days) LabView Base 1 : 12 - 14.11.01 (3 jours) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2 days) Programming TSX Premium 1 :  19 - 23.11.01  (5 days) Introduction to C Programming :  21- 23.11.01 (3 days) The Java programming language Level 2:  26 - 28.11.01 (...

  20. Places disponibles/Places available

    CERN Multimedia

    2004-01-01

    Si vous désirez participer à l'un des cours suivants, veuillez en discuter avec votre superviseur et vous inscrire électroniquement en direct depuis les pages de description des cours dans le Web que vous trouvez à l'adresse : http://www.cern.ch/Training/ ou remplissez une « demande de formation » disponible auprès du Secrétariat de votre Division ou de votre DTO (Délégué divisionnaire à la formation). Les places seront attribuées dans l'ordre de réception des inscriptions. If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Off...

  1. Head of household education level as a factor influencing whether delivery takes place in the presence of a skilled birth attendant in Busia, Uganda: a cross-sectional household study.

    Science.gov (United States)

    Vallières, Frédérique; Hansen, Alexandria; McAuliffe, Eilish; Cassidy, Emma Louise; Owora, Paul; Kappler, Sam; Gathuru, Evelyn

    2013-02-21

    Assistance during delivery by a skilled attendant is recommended as a means to reduce child and maternal mortality. Globally, higher levels of maternal education have been associated with better health behaviours at delivery. However, given that heads of households tend to be the decision makers regarding accessing healthcare, some educated mothers may find themselves prevented from accessing healthcare at the point of delivery. We examined the association between head of household education level and health seeking behaviours at delivery across a sample of 392 households. Chi-squared analysis and odds ratios were calculated to measure the strength of the relationship between no, some primary, or some secondary or higher education attained by the head of household and the presence or absence of a skilled birth attendant at that child's birth, and whether the birth took place at a health facility. Heads of household (n = 392) were predominantly male (93.4% [(90.9%, 95.8%), a = 0.05]). We found a significant difference in skilled birth attendance between heads of households with some primary education and heads of household with some secondary education or higher (χ2 (1) = 6.231, p birth attendant (OR = 1.5,[1.1,2.1]). The difference in health centre delivery between heads of household with a primary education and heads of household with a secondary or higher education was also significant (χ2 (1) = 7.519, p rates of health centre deliveries and utilization of services provided by skilled health workers might lie, in part, in increasing overall education levels of heads of households, specifically the education of male heads of households.

  2. Taking Leave?

    CERN Multimedia

    2000-01-01

    Planning a holiday? Then if you're a member of the personnel, you'll need to use the Laboratory's new leave system that will be put in place on 1 October. Leave allocations don't change - you are entitled to just as much holiday as before - but instead of being credited annually, your leave will be credited on a monthly basis, and this information will be communicated on your salary slip. The reason for the change is that with the various new leave schemes such as Recruitment by Saved Leave (RSL) and the Progressive Retirement Programme (PRP), a streamlined procedure was required for dealing with all kinds of leave. In the new system, each member of the personnel will have leave accounts to which leave will be credited monthly from the payroll and debited each time an absence is registered in the CERN Electronic Document Handling system (EDH). Leave balances will appear on monthly pay slips, and full details of leave transactions and balances will be available through EDH at all times. As the leave will be c...

  3. Take heart!

    CERN Multimedia

    Alizée Dauvergne

    2010-01-01

    Recently, ten new semi-automatic defibrillators were installed at various locations around CERN. This is a preventive measure intended to provide cardiac arrest victims with the best possible response. The first responder could be you!   The Director-General has welcomed the initiative of the Medical Service and Fire Brigade for the installation of ten new semi-automatic defibrillators. You have probably seen them on your way to the restaurant, for example:  brand new semi-automatic defibrillators, ready for an emergency. Housed in a white wall-mounted case, the bright red defibrillators are marked with a white heart symbol crossed by a lightning bolt (see photo). The defibrillator is designed so that anyone can use it. “Anyone can use it, you don’t need to be a health professional,” says Dr Reymond from CERN's Medical Service. Together with the CERN Fire Brigade, he is behind the initiative to have these units put in place. And with good reason, as the unit...

  4. What is taking place in science classrooms?: A case study analysis of teaching and learning in seventh-grade science of one Alabama school and its impact on African American student learning

    Science.gov (United States)

    Norman, Lashaunda Renea

    This qualitative case study investigated the teaching strategies that improve science learning of African American students. This research study further sought the extent the identified teaching strategies that are used to improve African American science learning reflect culturally responsive teaching. Best teaching strategies and culturally responsive teaching have been researched, but there has been minimal research on the impact that both have on science learning, with an emphasis on the African American population. Consequently, the Black-White achievement gap in science persists. The findings revealed the following teaching strategies have a positive impact on African American science learning: (a) lecture-discussion, (b) notetaking, (c) reading strategies, (d) graphic organizers, (e) hands-on activities, (f) laboratory experiences, and (g) cooperative learning. Culturally responsive teaching strategies were evident in the seventh-grade science classrooms observed. Seven themes emerged from this research data: (1) The participating teachers based their research-based teaching strategies used in the classroom on all of the students' learning styles, abilities, attitudes towards science, and motivational levels about learning science, with no emphasis on the African American student population; (2) The participating teachers taught the state content standards simultaneously using the same instructional model daily, incorporating other content areas when possible; (3) The participating African American students believed their seventh-grade science teachers used a variety of teaching strategies to ensure science learning took place, that science learning was fun, and that science learning was engaging; (4) The participating African American students genuinely liked their teacher; (5) The participating African American students revealed high self-efficacy; (6) The African American student participants' parents value education and moved to Success Middle School

  5. An Electrostatic Funnel in the GABA-Binding Pathway.

    Directory of Open Access Journals (Sweden)

    Timothy S Carpenter

    2016-04-01

    Full Text Available The γ-aminobutyric acid type A receptor (GABAA-R is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a 'funnel' that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site.

  6. Perspective Taking in Workplaces

    Directory of Open Access Journals (Sweden)

    Zappalà Salvatore

    2014-07-01

    Full Text Available Workplaces are often described as places in which individuals are motivated by their self-interests and in which negative events like time pressure, anxiety, conflict with co-workers, miscomprehensions, difficulties in solving problems, not-transmitted or not-exchanged information that lead to mistakes, and in some cases to injuries, stress or control, are part of everyday life (Dormann & Zapf, 2002; Schabracq, Winnubst and Cooper, 2003. Such situations are often the result of the limited comprehension of needs, skills, or information available to colleagues, supervisors, subordinates, clients or providers. However, workplaces are also places in which employees take care of clients, support colleagues and subordinates (Rhoades & Eisenberger, 2002, are enthusiastic about their job (Bakker et al., 2008, are motivated by leaders that encourage employees to transcend their own self-interests for the good of the group or the organization and provide them with the confidence to perform beyond expectations (Bass, 1997. Thus positive relationships at work are becoming a new interdisciplinary domain of inquiry (Dutton & Ragins, 2006. Within this positive relationships framework, in this paper we focus on a positive component of workplaces, and particularly on an individual cognitive and emotional process that has an important role in the workplace because it facilitates interpersonal relations and communications: it is the perspective taking process. In order to describe perspective taking, we will refer to some empirical studies and particularly to the review published by Parker, Atkins and Axtell in 2008 on the International Review of Industrial and Organizational Psychology.

  7. How Does Photosynthesis Take Place in Our Oceans?

    OpenAIRE

    Ghosh, Tonmoy; Mishra, Sandhya

    2017-01-01

    The food we eat ultimately comes from plants, either directly or indirectly. The importance of plants as the global kitchen can never be underestimated. Plants “eat” sunlight and carbon dioxide to produce their own food and food for the millions of other organisms dependent on them. A molecule, chlorophyll (Chl), is crucial for this process, since it absorbs sunlight. However, the way land plants produce their food is very different from the way plants in the oceans produce their food. Since ...

  8. BP-Mobil partnership. The common network takes place

    International Nuclear Information System (INIS)

    Anon.

    1997-01-01

    After the partnership between BP and Mobil was signed, the program of transformation of the petrol stations network started in November 1996 in the UK and concern 3300 stations in Europe and 800 stations in France. About 9100 stations will be transformed by the end of 1998. BP France is the operator for petroleum products (petrol, fuel, bitumens, LPG..) with a 70% share holding (30% for Mobil) while Mobil is the major shareholder (51%) for the lubricants and special products activities. The chemical, aviation nd maritime activities are not concerned. Thanks to the fusion of their down-file activities in Europe, the benefits of the partnership should reach 600 to 700 million of US Dollars each year. However the restructuring cost should reach 740 millions of US Dollars in two years, which doubles the initial estimation. Short paper. (J.S.)

  9. Using Personalized Education to Take the Place of Standardized Education

    Science.gov (United States)

    Gao, Pengyu

    2014-01-01

    Economic model has been greatly shifted from labor demanding to innovation demanding, which requires education system has to produce creative people. This paper illustrates how traditional education model accrued and developed based on satisfying the old economic model for labor demanding but did not meet the new social requirement for innovation…

  10. Does the measurement take place when nobody observes it

    Energy Technology Data Exchange (ETDEWEB)

    Gurvitz, Shmuel [Department of Particle Physics and Astrophysics, Weizmann Institute of Science, Rehovot (Israel); Beijing Computational Science Research Center, Beijing (China)

    2017-06-15

    We consider non-selective continuous measurements of a particle tunneling to a reservoir of finite band-width (Λ). The particle is continuously monitored by frequent projective measurements (''quantum trajectory''), separated by a time-interval τ. A simple analytical expression for the decay rate has been obtained. For Markovian reservoirs (Λ → ∞), no effect of the measurements is found. Otherwise for a finite Λ, the decay rate always depends on the measurement time τ. This result is compared with alternative calculations, with no intermediate measurements, but when the measurement device is included in the Schroedinger evolution. We found that the detector affects the system by the decoherence rate (Γ{sub d}), related to the detector's signal. Although both treatments are different, the final results become very close for τ = 2/Γ{sub d}. This τ corresponds to the minimal time for which the detector's signal can be distinguished by an ''observer''. This indicates a fundamental role of information in quantum motion and can be used for the extension of the quantum trajectory method for non-Markovian environments. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. I could never take the place of your man

    DEFF Research Database (Denmark)

    Andersen, Poul Houman; Munksgaard, Kristin B.

    We explore the dynamic tensions between the strategic change intentions by business actors and the rigidities of routines in business networks. We capture strategic change acts using the recent advances in the literature on network pictures as way to understand the value creation logics of manage...

  12. Substrate binding in the active site of cytochrome P450cam

    NARCIS (Netherlands)

    Swart, M.; Groenhof, A.R.; Ehlers, A.W.; Lammertsma, K.

    2005-01-01

    We have studied the binding of camphor in the active site of cytochrome P450cam with density functional theory (DFT) calculations. A strong hydrogen bond (>6 kcal/mol) to a tyrosine residue (Tyr96) is observed, that may account for the high specificity of the reaction taking place. The DFT

  13. Transience and Place: Exploring Tourists' Experiences of Place

    Directory of Open Access Journals (Sweden)

    Jens Kristian Steen Jacobsen

    1998-02-01

    Full Text Available This paper explores tourists' transient place experiences. The focus is on what is commonly called sightseeing, confined mainly to experiences of locations not previously visited. This type of travel experience, seeing actual places or objects for one's self and taking photographs, is regarded here as an important ritual in modernity. With reference to the concept of adventurer, the paper attempts to describe various aspects of novel travel experiences. For instance, ephemeral tourist sensations of place are compared to «love at first sight», a blissful experience of meeting with a place to which one feels strongly attracted. While transient encounters may also provide access to dreamlike place experiences, adventurous tourists are always in danger of being caught up in other roles, or of becoming embroiled in a new everyday life with accompanying routines. By way of conclusion, it is proposed that the restrictions on time inherent in today's holiday tours usually result in transient place experiences as the only alternative for those desiring to gain first-time impressions of several places or larger geographic areas.

  14. Place Branding in Systems of Place

    DEFF Research Database (Denmark)

    Zenker, Sebastian; Andéhn, Mikael

    2015-01-01

    be lost and its meaning relies on a reading of the brand by anyone receiving its message, the control that can be exerted over which meaning is attributed to a company brand appears almost absolute when compared to a place brand. A place is a brand often long before it is formally branded. A place brand.......g. the European Union or Africa). Using the example of nation branding for Sudan and Slovenia, one can identify supranational places such as “sub-Saharan Africa” or “Eastern Europe”, carrying their own highly salient and often negative meaning in much of the Western world. We explore how association to a system...... of place is thought to influence the prospects of branding campaigns and introduce and discuss how reassociation can serve as means of mitigation of negative supranational belongingness. In doing so, we discuss also the challenges of interregional branding in this regard, where perceptions of two (or more...

  15. An N-terminal Region of Mot-2 Binds to p53 In Vitro

    Directory of Open Access Journals (Sweden)

    Sunil C. Kaul

    2001-01-01

    Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

  16. Place branding, embeddedness and endogenous rural development

    NARCIS (Netherlands)

    Donner, Mechthild; Horlings, Lummina; Fort, Fatiha; Vellema, Sietze

    2017-01-01

    This article deals with place branding on the regional scale, in the rural context of food and tourism networks in Europe. Place branding is linked to the concepts of endogenous rural development, territory and embeddedness, by analysing how the valorisation of specific rural assets takes shape.

  17. Populated Places of Iowa

    Data.gov (United States)

    Iowa State University GIS Support and Research Facility — This coverage contains points that represent populated places, ie. cities, towns, villages or any other named place where people live. The coverage was developed...

  18. Ebishushani: people poses places

    NARCIS (Netherlands)

    Andrea Stultiens

    2014-01-01

    Ebifananyi II – People Poses Places Andrea Stultiens People Poses Places is the second part of Ebifananyi, a book series that visualises historical Ugandan photo collections. In People Poses Places we delve into the archive of the photographer Musa Katuramu. In the mid 1930s, teacher and carpenter

  19. Compensated takings and negotiated solutions

    International Nuclear Information System (INIS)

    Thompson, R.P.

    1993-01-01

    More than 30 year ago, the USA began protecting its environment with regulatory laws. However, this approach has progressed to the point where our economic health may have needlessly incurred long-term damage. The article explores the implications of a resurgent demand for legal guarantees for compensation when environmental regulations take individual property. What will happen when a price tag is attached to new or existing environmental laws? Some predict dire results; however, a more balanced and efficient policy may lie ahead. The discussion explores the implications of recent rulings, describes possible outcomes, and offers several alternatives to the traditional lobby-and-appeal tactics used in setting environmental policy. The authors conclude that as the concept of a regulatory taking is restored, more innovative negotiated solutions will take place between competing interests as they are given more equal legal footing

  20. Take Charge. Take the Test. PSA (:30)

    Centers for Disease Control (CDC) Podcasts

    2012-03-07

    As part of the Take Charge. Take the Test. campaign, this 30 second PSA encourages African American women to get tested for HIV. Locations for a free HIV test can be found by visiting hivtest.org/takecharge or calling 1-800-CDC-INFO (1-800-232-4636).  Created: 3/7/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/7/2012.

  1. Where is 'place' in Aging in place?

    DEFF Research Database (Denmark)

    Blaakilde, Anne Leonora

    2015-01-01

    The aim of this article is to contribute a transnational perspective to the field of environmental gerontology and the concept of aging in place. Seniors from the northern hemisphere, among them Danish citizens, are increasingly adapting to transnational lives as they move to warmer climates...

  2. The importance of places and place branding

    NARCIS (Netherlands)

    Kovács, Z.; Musterd, S.; Musterd, S.; Kovács, Z.

    2013-01-01

    In the analytical part of this study, we highlight that, despite globalisation and growing uniformity, there is still an important role for place itself in the location decisions of economic players. Part III of this volume deals with this. Even though city-regions across the world have become

  3. Place-Specific Computing

    DEFF Research Database (Denmark)

    Messeter, Jörn

    2009-01-01

    An increased interest in the notion of place has evolved in interaction design based on the proliferation of wireless infrastructures, developments in digital media, and a ‘spatial turn’ in computing. In this article, place-specific computing is suggested as a genre of interaction design...... that addresses the shaping of interactions among people, place-specific resources and global socio-technical networks, mediated by digital technology, and influenced by the structuring conditions of place. The theoretical grounding for place-specific computing is located in the meeting between conceptions...... examples of place-specific computing are presented from a series of pilot studies, conducted in close collaboration with design students in Malmö, Berlin, Cape Town and Rome, that generated 36 design concepts in the genre. Reflecting on these examples, issues in the design of place-specific computing...

  4. My Place Is Not Your Place

    DEFF Research Database (Denmark)

    Zenker, Sebastian; Beckmann, Suzanne C.

    2013-01-01

    Purpose – Cities increasingly compete with each other for attracting tourists, investors, companies, or residents. Marketers therefore focus on establishing the city as a brand, disregarding that the perception and knowledge of a city differ dramatically between the target audiences. Hence, place...... branding should emphasize much more the perceptions of the different target groups and develop strategies for advanced place brand management. The aim of this paper is to assess the important discrepancies between the city brand perceptions of different target groups with the help of network analysis....... Design/methodology/approach – In two empirical studies, the important discrepancies between the city brand perceptions of different target groups are assessed with the help of network analysis. Study 1 consists of 40 qualitative in-depth-interviews and study 2 uses an online qualitative open...

  5. Management and communication courses – Places available

    CERN Multimedia

    2012-01-01

    There are places available in some management and communication courses taking place in the period January to March 2013.   For more information on the course, click on the course title, which will bring you to the training catalogue. You can then sign-up on-line. For advice, you can contact: Erwin Mosselmans, tel. 74125, erwin.mosselmans@cern.ch Nathalie Dumeaux, tel. 78144, nathalie.dumeaux@cern.ch Courses in English (or bilingual) Session Duration Language Availability How to get, as a supervisor, the most out of the annual interview 21 January 1 day English 2 places Project Engineering 24 and 25 January 2 days English 6 places How to get, as a supervisor, the most out of the annual interview 31 January 1 day English 6 places Conflict Resolution for Managers 19 and 20 February 2 days English One more place Project Scheduling & Costing 6 and 7 March 2 days English 2 places Communicati...

  6. Place, leisure, and well-being

    Science.gov (United States)

    Daniel R. Williams; Michael E. Patterson

    2008-01-01

    The Population Health Model (PHM) (Hamilton and Bhatti 1996) brings much needed attention to the critical role of environmental and community variables in the promotion of physical and mental health. However, it appears to neglect two facets integral to what is otherwise a rich contextual approach to health promotion. One facet, place, is the binding theme of this book...

  7. Taking iron supplements

    Science.gov (United States)

    ... medlineplus.gov/ency/article/007478.htm Taking iron supplements To use the sharing features on this page, ... levels. You may also need to take iron supplements as well to rebuild iron stores in your ...

  8. Taking multiple medicines safely

    Science.gov (United States)

    ... medlineplus.gov/ency/patientinstructions/000883.htm Taking multiple medicines safely To use the sharing features on this ... directed. Why You May Need More Than One Medicine You may take more than one medicine to ...

  9. The value of place

    Science.gov (United States)

    Dentzau, Michael W.

    2014-03-01

    This commentary seeks to expand the dialogue on place-based science education presented in Katie Lynn Brkich's article, where the connections fifth grade students make between their formal earth science curriculum and their lived experiences are highlighted. The disconnect between the curriculum the students are offered and their immediate environment is clear, and we are presented with examples of how they strive to make connections between the content and what they are familiar with—namely their surroundings. "Place" is identified as a term with complex meanings and interpretations, even in the scope of place-based science education, and understanding how the term is used in any given scenario is essential to understanding the implications of place-based education. Is place used as a location, locale or a sense of place? To understand "place" is to acknowledge that for the individual, it is highly situational, cultural and personal. It is just such attributes that make place-based education appealing, and potentially powerful, pedagogically on one hand, yet complex for implementation on the other. The argument is posed that place is particularly important in the context of education about the environment, which in its simplest manifestation, connects formal science curriculum to resources that are local and tangible to students. The incorporation of place in such a framework seeks to bridge the gap between formal school science subjects and students' lived experiences, yet acknowledges the tensions that can arise between accommodating place meanings and the desire to acculturate students into the language of the scientific community. The disconnect between guiding policy frameworks and the reality of the Next Generation Science Standards is addressed opening an avenue for further discussion of the importance of socio-cultural frameworks of science learning in an ever increasing era of accountability.

  10. Technical training: places available

    CERN Multimedia

    HR Department

    2007-01-01

    CERN Technical Training: Open Courses (April - June 2007) The following course sessions are currently scheduled in the framework of the CERN Technical Training Programme 2007:   AutoCAD 2006 - niveau 1 (course in French): 25.4.- 26.4.2007 & 2.5. - 3.5.2007 (4 days in 2 modules, 5 places available) AutoCAD 2006 - niveau 1 (course in French): 27.6.- 28.6.2007 & 3.7. - 4.7.2007 (4 days in 2 modules, 5 places available) AutoCAD Mechanical 2006 (course in French) 21.6.-22.6.2007 (2 days, 8 places available) * NEW COURSE* Automate de securite S7 (course in French) 14.5.-16.5.2007 (3 days, 4 places available) * NEW COURSE* Automate de securite S7 (course in French): 9.5.-11.5.2007 (3 days, 4 places available) JCOP - Joint PVSS-JCOP Frameswork (course in English): 21.5.-25.5.2007 (5 days, 12 places available) JCOP - Finite State Machines in the JCOP Frameswork (course in English): 12.6.-14.6.2007 (3 days, 12 places available) LabVIEW Basics 1 (in English): 2.-4.5.2007 (3 days, 7 places ...

  11. Technical training - places available

    CERN Multimedia

    2012-01-01

    If you would like more information on a course, or for any other inquiry/suggestions, please contact Technical.Training@cern.ch Valeria Perez Reale, Learning Specialist, Technical Programme Coordinator (Tel.: 62424) Eva Stern and Elise Romero, Technical Training Administration (Tel.: 74924) HR Department »Electronics design Next Session Duration Language Availability Comprehensive VHDL for FPGA Design 08-Oct-12 to 12-Oct-12 5 days English 3 places available Foundations of Electromagnetism and Magnet Design (EMAG) 14-Nov-12 to 27-Nov-12 6 days English 20 places available Impacts de la suppression du plomb (RoHS) en électronique 26-Oct-12 to 26-Oct-12 8 hours French 15 places available Introduction to VHDL 10-Oct-12 to 11-Oct-12 2 days English 7 places available LabVIEW Real Time and FPGA 13-Nov-12 to 16-Nov-12 5 days French 5 places available »Mechanical design Next Se...

  12. Place-Specific Computing

    DEFF Research Database (Denmark)

    Messeter, Jörn; Johansson, Michael

    An increased interest in the notion of place has evolved in interaction design. Proliferation of wireless infrastructure, developments in digital media, and a ‘spatial turn’ in computing provides the base for place-specific computing as a suggested new genre of interaction design. In the REcult...... project place- specific computing is explored through design oriented research. This article reports six pilot studies where design students have designed concepts for place-specific computing in Berlin (Germany), Cape Town (South Africa), Rome (Italy) and Malmö (Sweden). Background and arguments...... for place-specific computing as a genre of interaction design are described. A total number of 36 design concepts designed for 16 designated zones in the four cities are presented. An analysis of the design concepts is presented indicating potentials, possibilities and problems as directions for future...

  13. Management and communication courses – Places available

    CERN Multimedia

    2013-01-01

    There are places available in some management and communication courses taking place in the period April to June 2013.   For more information on the course, click on the course title, this will bring you to the training catalogue. You can then sign-up online. For advice, you can contact: - Erwin Mosselmans, tel. 74125, erwin.mosselmans@cern.ch - Nathalie Dumeaux, tel. 78144, nathalie.dumeaux@cern.ch Courses in English (or bilingual) Sessions Duration Language Availability Managing stress 29 and 30 May 2 days English 3 places Making Presentations 30, 31 May & 25 June 3 days English 2 places Communicating Effectively - Residential course 4 to 6 June 3 days Bilingual 9 places Handling difficult conversations (Adapted from Dealing with Conflict) 7 and 14 June and 13 September 3 days English 6 places Voice and Nonverbal Behaviour in Speech Communication 17 and 18 June 1 day 4 hours English 7 plac...

  14. Connecting people to place : Sustainable place-shaping practices as transformative power.

    NARCIS (Netherlands)

    Horlings, Lummina

    2016-01-01

    The article describes a process of preparing a research design on place-shaping, as outcome of a process of co-design between academic actors and non-academic actors in Brazil, South Africa and The Netherlands, taking place in the context of the project TRANSPLACE. The joint research design

  15. Brand new authentic places

    DEFF Research Database (Denmark)

    Stender, Marie

    created and transformed by architects and designers, estate agents and, eventually, residents? Based on ethnographic fieldwork in 3-4 new residential neighbourhoods in the Copenhagen Region, the project will investigate how stories of authenticity give places meaning and identity. The project will unfold...... neighbourhoods stories of authenticity seems to be of great importance giving value and identity to place and people. By way of design and branding new places are implied with notions of the real, the original and the unique referring to e.g. its historical past, architectural uniqueness, sustainability or sense...

  16. Technical training - Places available

    CERN Multimedia

    2012-01-01

    If you would like more information on a course, or for any other inquiry/suggestions, please contact Technical.Training@cern.ch Valeria Perez Reale, Learning Specialist, Technical Programme Coordinator (Tel.: 62424) Eva Stern and Elise Romero, Technical Training Administration (Tel.: 74924)   Electronics design Next Session Duration Language Availability Certified LabVIEW Associate Developer (CLAD) 06-Dec-12 to 06-Dec-12 1 hour English One more place available Compatibilité électromagnetique (CEM): Applications 23-Nov-12 to 23-Nov-12 3.5 hours English 3 places available Compatibilité électromagnétique (CEM): Introduction 23-Nov-12 to 23-Nov-12 3 hours English 43 places available Effets des Radiations sur les composants et systèmes électroniques 11-Dec-12 to 12-Dec-12 1 day 4 hours French 9 places available LabVIEW for beginners ...

  17. History, Criticism and Place

    DEFF Research Database (Denmark)

    Hinds, Mat; Carter, Adrian; Malpas, Jeff

    2012-01-01

    Rory Spence and Richard Leplastrier shared a conversation and friendship that lasted 20years until Spence's death in 2004. The discussions focused largely upon issues of place, distilled through the practice of Leplastrier....

  18. Marine Place Names

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains the geographic place names for features in the U.S territorial waters and outer continental shelf. These names can be used to find or define a...

  19. Parks, People and Places

    DEFF Research Database (Denmark)

    Molin, Julie Frøik

    This thesis suggests, by applying a ‘place’ perspective, that involving users in operational management of green spaces holds potentials for enhancing ‘place attachment’ of urban inhabitants. As this can also build their commitment to decision making on their local living environment, green space...... maintenance becomes a potentially important setting for governance processes. Through a number of qualitative case studies, based on semi-structured interviews with municipal and community actors in Denmark and England, this dissertation explores the status and potentials of applying a place-based governance...... dimensions ‘actors’, ‘resources’ and ‘rules’. Moreover, the impacts of place-based governance processes on green space quality are examined via a review of previous scientific articles. The thesis concludes that place-based governance offers potential for bringing users and managers closer together, through...

  20. 'A Place to Sit'

    DEFF Research Database (Denmark)

    Hvejsel, Marie Frier; Klok, Julie Skovgaard; Bøhnke, Mia Marker

    Published in 2014 on the occasion of the third 'A Place to Sit' exhibition as a reflection upon three years of teaching tectonic method in architecture using the furniture scale as a learning basis.......Published in 2014 on the occasion of the third 'A Place to Sit' exhibition as a reflection upon three years of teaching tectonic method in architecture using the furniture scale as a learning basis....

  1. Self-Placing Concrete

    OpenAIRE

    ECT Team, Purdue

    2007-01-01

    Certain concrete pours have areas where the congestion of reinforcing bars make placement of concrete almost impossible. Using conventional placing and vibration techniques, the resulting concrete can have considerable honeycombing due to the development of voids. Self-placing concrete is a possible solution to the problem. Also known as self-compactable concrete, self-consolidating concrete, flowable concrete, and non-vibration concrete. These concretes eliminate the need for vibration in a ...

  2. Technical training - Places available

    CERN Multimedia

    2012-01-01

    If you would like more information on a course, or for any other inquiry/suggestions, please contact Technical.Training@cern.ch Valeria Perez Reale, Learning Specialist, Technical Programme Coordinator (Tel.: 62424) Eva Stern and Elise Romero, Technical Training Administration (Tel.: 74924) HR Department Electronic Design Next Session Duration Language Availability Comprehensive VHDL for FPGA Design 08-Oct-12 to 12-Oct-12 5 days English 4 places Electrostatique / Protection ESD 28-Sep-12 to 28-Sep-12 3 hours French 25 places Impacts de la suppression du plomb (RoHS) en électronique 26-Oct-12 to 26-Oct-12 8 hours French 14 places Introduction to VHDL 10-Oct-12 to 11-Oct-12 2 days English 9 places LabVIEW Real Time and FPGA 13-Nov-12 to 16-Nov-12 5 days French 5 places LabVIEW for Experts 24-Sep-12 to 28-Sep-12 5 days English 6 places LabVIEW for beginners 15-Oct-12 to 17-...

  3. Taking technological infrastructure seriously

    NARCIS (Netherlands)

    Mair, C.S.

    2017-01-01

    Taking Technological Infrastructure Seriously attempts to take stock of a sea-change in the way modern infrastructural resources are provided. Unlike traditional infrastructure, such as roads and electricity cables, where the State has largely been responsible for its provision, much of the key

  4. Mathematics of Risk Taking

    Indian Academy of Sciences (India)

    user

    Mathematics of Risk Taking. K B Athreya and M G Nadkarni. Keywords. Investor, risk taking, fair game, martingale, random walk, gam- bling, population. (left) K B Athreya is a visiting professor at IMI,. Mathematics Department,. IISc, Bangalore and is also a professor of mathematics and statistics at Iowa State. University ...

  5. Place Reference In Interaction

    Directory of Open Access Journals (Sweden)

    Enfield N.J.

    2017-12-01

    Full Text Available The language of place and space has been intensively studied in relation to grammatical characteristics, cross-linguistic variation, and cognition, as well as with regard to further questions central to social anthropology, psychology, and more. With this special issue, we focus on the pragmatic functions of references to places, as observed in informal social interaction. When people make reference to places in casual, everyday conversation, how do they do it, in what situations, and to what ends? We offer the first collection of findings from research on place reference in spontaneous, multi-party speech, with studies based on conversations recorded in the diverse geographic and cultural environments of outback Australia, highland New Guinea, island Indonesia and rural Mexico. The authors explore, from a range of angles, how and why people talk about place, for example, in regard to the vocabulary and grammar that a language has available to categorise space, and how people choose from among referential options in situated conversation to achieve communicative, social, and practical goals.

  6. Planned place of birth

    DEFF Research Database (Denmark)

    Overgaard, Charlotte; Coxon, Kirstie; Stewart, Mary

    in Denmark Coxon K et al: Planned place of birth in England: perceptions of accessing obstetric units, midwife led units and home birth amongst women and their partners. How these papers interrelate These papers draw upon recent research in maternity care, undertaken in Denmark and in England. In both......Title Planned place of birth: issues of choice, access and equity. Outline In Northern European countries, giving birth is generally safe for healthy women with uncomplicated pregnancies, and their babies. However, place of birth can affect women’s outcomes and experiences of birth. Whilst tertiary...... centres provide appropriate medical supervision to women with complex pregnancies, the likelihood of receiving interventions including surgical birth is increased for low risk women in these settings. In this symposium, we consider issues of choice, access and equitable care for women in the context...

  7. (Re)tasting places

    DEFF Research Database (Denmark)

    Hedegaard, Liselotte

    2015-01-01

    What does geographical origin mean? It is an expression that associates food and wine with a specific place, an association embedded in the concept ‘terroir’ that refers to the complex interaction between a physical environment and local craftsmanship. It is a claim protected through labelling......-schemes and a claim that adds value to the place-related foods. However, viewing the connection between food and place as a question of proving a relationship or as a matter of protecting commercial claims does not seem to provide a satisfactory account for the status of geographically designated foods as being...... particularly attractive Central to the interest of this paper is to approach an understanding of geographical origin as a point of reference for taste. In terms of being sensory experience, taste is subjective. It is difficult to describe verbally and yet at the same time it is a trigger of the memory of past...

  8. 1. On note taking.

    Science.gov (United States)

    Plaut, Alfred B J

    2005-02-01

    In this paper the author explores the theoretical and technical issues relating to taking notes of analytic sessions, using an introspective approach. The paper discusses the lack of a consistent approach to note taking amongst analysts and sets out to demonstrate that systematic note taking can be helpful to the analyst. The author describes his discovery that an initial phase where as much data was recorded as possible did not prove to be reliably helpful in clinical work and initially actively interfered with recall in subsequent sessions. The impact of the nature of the analytic session itself and the focus of the analyst's interest on recall is discussed. The author then describes how he modified his note taking technique to classify information from sessions into four categories which enabled the analyst to select which information to record in notes. The characteristics of memory and its constructive nature are discussed in relation to the problems that arise in making accurate notes of analytic sessions.

  9. Ageing in Communal Place

    DEFF Research Database (Denmark)

    Aarhus, Rikke; Ballegaard, Stinne Aaløkke; Grönvall, Erik

    2009-01-01

    In this paper we adopt the position that design of social media for the elderly and virtual senior communities may be informed by studying ‘real’ senior communities. Since current research efforts target the role of social media and virtual communities for supporting seniors ageing in place, i.e....

  10. Ageing in communal place

    DEFF Research Database (Denmark)

    Aarhus, Rikke; Ballegaard, Stinne Aaløkke; Grönvall, Erik

    2009-01-01

    In this paper we adopt the position that design of social media for the elderly and virtual senior communities may be informed by studying `real´senior communities. Since current research efforts target the role of social media and virtual communities for supporting seniors ageing in place, i.e. ...

  11. The power of place.

    Science.gov (United States)

    Lock, Lin R; Gibb, Heather J

    2003-06-01

    to describe the power that 'place' holds over the postnatal-care experiences of women. a study informed by phenomenology within a feminist framework was undertaken to examine the experiences of women electing early postnatal discharge. Three extended conversations with each woman participating in the study were audiotaped and transcribed. Journal notes made by the researcher added to the audiotaped data. Thematic analysis revealed major structures of experience. data were obtained from conversations with women in their respective homes. five women, parity 1-3, living in the Sydney metropolitan area and birthing in their local hospitals participated in the study. four major constructs of experience were revealed through analysis and include spatiality, corporeality, temporality and relationality. In this paper, components of spatiality expressed through the power place exerts in matters of physical environment,control, confidence, safety, time, talk and the heart of the matter are presented. the experiences of women entering the foreign place of hospital to birth their children were those of alienation and disempowerment while the familiar territory of home offered stronger feelings of security and support. failing to recognise the impact of place on the experiences of postnatal women reduces the likelihood that midwives will be able to offer sensitive and appropriate care.

  12. Designing Places for Learning.

    Science.gov (United States)

    Meek, Anne, Ed.

    This book presents information about the condition of schools around the United States. It also describes the link between architecture and academic success and offers suggestions for improving the design of existing and future school buildings. Eleven articles look at schools as places of deep meaning and show how that view can alter approaches…

  13. Technical training - Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 16.5.2006 (May-November course sessions) Technical Training: Places available The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language ACROBAT 7.0 : Utilisation de fichiers PDF 8 8.05.06 F WORD 2003 - niveau 2 : ECDL 16 22-23.05.06 23-24.05.06 F Comprehensive VHDL for FPGA Design 40 29.05-2.06.06 E C++ Programming Part 2 - Advanced C++ and its Traps and Pitfalls 32 30.05-2.06.06 E ACROBAT 7.0 : Utilisation de fichiers PDF 24 7-9.06.06 E AutoCAD Mechanical 2006 16 13-14.06.06 F CERN EDMS for Local Administrators 16 13-14.06.06 E LabVIEW Base 2 32 27.06-5.07.06 F C++ Programming Part 3 - Templates and the STL (Standard Template Library) 16 27-28.06.06 E C++ Programming Part 4 - Exceptions 8 29.06.06 E FrontPage 2003 - niveau 1 16 29-...

  14. Teaching With Historic Places.

    Science.gov (United States)

    Greenberg, Ronald M., Ed.

    1993-01-01

    Designed for social studies educators, this theme issue presents 11 articles about historic places that feature a variety of ideas for elementary and secondary lesson plans, curricula, and program development. The articles are: (1) "Where did History Happen?" (Beth M. Boland); (2) "Creating a Partnership" (Carol D. Shull); (3)…

  15. Place in Transition

    DEFF Research Database (Denmark)

    Mikkelsen, Jacob Bjerre; Lange, Ida Sofie Gøtzsche

    from the 'Everyday World'. Within mobilities studies, research has focused on different aspects and consequences of the post-oil society (see Dennis & Urry 2009, Urry 2013). This paper discusses the conception of place within the enclosed 'Oil World' with point of departure in relocation...

  16. Technical training - Places available

    CERN Multimedia

    2003-01-01

    * Etant donné le délai d'impression du Bulletin, ces places peuvent ne plus être disponibles au moment de sa parution. Veuillez consulter notre site Web pour avoir la dernière mise à jour. ** The number of places available may vary. Please check our Web site to find out the current availability. Des places sont disponibles dans les cours suivants : Places are available in the following courses: Hands-on Introduction to Python Programming 12 – 14.11.03 (3 days) ACCESS 2000 – niveau 1 13 & 14.11.03 (2 jours) C++ for Particle Physicists 17 – 21.11.03 (6 x 3-hour lectures) Programmation automate Schneider TSX Premium – niveau 2  18 – 21.11.03 (4 jours) Planification de projet avec MS-Project/Project Planning with MS-Project (gratuit/free of charge – langue à définir/language to be defined) : 18 & 25.11.03 (2 jours/2 days) JAVA 2 Enterprise Edition – Part 1 : WEB...

  17. Plasma jet takes off.

    OpenAIRE

    Frazer, L

    1999-01-01

    Thanks to a series of joint research projects by Los Alamos National Laboratory, Beta Squared of Allen, Texas, and the University of California at Los Angeles, there is now a more environmentally sound method for cleaning semiconductor chips that may also be effective in cleaning up chemical, bacterial, and nuclear contaminants. The Atmospheric Pressure Plasma Jet uses a type of ionized gas called plasma to clean up contaminants by binding to them and lifting them away. In contrast to the cor...

  18. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The Joint PVSS JCOP Framework: 14 - 18.6.2004 (5 days) EXCEL 2003 - niveau 2 : 17 & 18.6.2004 (2 jours) MAGNE-04 : Magnétisme pour l'électrotechnique : 6 au 8.7.2004 (3 jours) Technical Training Monique Duval - Tel.74924 technical.training@cern.ch

  19. Taking a Long and Global View

    DEFF Research Database (Denmark)

    Ougaard, Morten

    ‘the free development of each is the condition for the free development of all’. And the fourth element is the idea that the transition to this new and better society will take place through a revolution led by the industrial working class. These elements combine outstanding and path-breaking social...

  20. Teachable Moment: Google Earth Takes Us There

    Science.gov (United States)

    Williams, Ann; Davinroy, Thomas C.

    2015-01-01

    In the current educational climate, where clearly articulated learning objectives are required, it is clear that the spontaneous teachable moment still has its place. Authors Ann Williams and Thomas Davinroy think that instructors from almost any discipline can employ Google Earth as a tool to take advantage of teachable moments through the…

  1. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 9.5.2006 (May-October course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: find out the curren Hours Date Language LabVIEW Application Development 24 15-17.05.06 E LabVIEW Advanced Programming 16 18-19.05.06 E PERL 5: Advanced Aspects 8 18.05.06 E Technique du vide 16 18-19.05.06 F FileMaker - niveau 2 16 11-12.05.06 F WORD 2003 - niveau 2 : ECDL 16 22-23.05.06 F Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE 16 23-24.05.06 F Comprehensive VHDL for FPGA Design 40 29.05-2.06.06 E C++ Programming Part 2 - Advanced C++ and its Traps and Pitfalls 32 30.05-2.06.06 E Python: Hands-on Introduction 24 7-9.06.06 E AutoCAD Mechanical 2006 16 13-14.06.06 F CERN EDMS for Local Administrators 16 13-14.06.06...

  2. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 7.2.2006 (February-May course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language WORD 2003 (Short Course IV) - HowTo... Work with master document 3 27.02.06 E-F JAVA: Level 2 32 28.02-3.03.06 E Manipulation des images 4 28.02.06 F ACCESS 2003 - Level 2: ECDL AM5 16 2-3.03.06 E-F C++ for Particle Physicists 20 6-10.03.06 E PowerPoint 2003 8 9.03.06 F JCOP: Control System Integration using JCOP Tools 24 14-16.03.06 E EXCEL 2003 (Short Course III) - HowTo... Pivot tables 3 20.03.06 E-F EXCEL 2003 (Short Course IV) - HowTo....Link cells, worksheets and workbooks 3 20.03.06 E-F JCOP: Finite State Machines in the JCOP Framework 24 21-23.03.06 E Object-Oriented Analysis and Design using UML 24 21-23.03.06 E FrontPage 2003 - niveau 1 16 27-28.03.06 F JCOP: Joint PVSS-JCOP Fram...

  3. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 7.2.2006 (February-May course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language WORD 2003 (Short Course II) - HowTo... Mail merge 3 13.03.06 E-F EXCEL 2003 (Short Course III) - HowTo... Pivot tables 3 20.03.06 E-F EXCEL 2003 (Short Course IV) - HowTo....Link cells, worksheets and workbooks 3 20.03.06 E-F Object-Oriented Analysis and Design using UML 24 21-23.03.06 E EXCEL 2003 - niveau 1 16 22-23.03.06 F FrontPage 2003 - niveau 1 16 27-28.03.06 F Oracle Forms Developer 10g: Move to the Web 16 27-28.03.06 E Oracle JDeveloper 10g: Build Applications with ADF 24 29-31.03.06 E ACCESS 2003 - Level 2: ECDL AM5 16 3-4.03.06 E-F JAVA 2 Enterprise Edition - Part 1: Web Applications 16 3-4.04.06 E JCOP: Control System Integration using JCOP Tools 24 4-6.04.06 E JAVA 2 Enterprise Edition...

  4. Technical Training: Places available

    CERN Multimedia

    2006-01-01

    Places available as of 21.3.2006 (March-October course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: find out the curren Hours Date Language ACROBAT 7.0 : Utilisation de fichiers PDF 8 8.05.06 F Project Planning with MS-Project 16 9.05-6.06.06 E STEP7: niveau 1 32 9-12.05.06 E-F Oracle: Programming with PL/SQL 24 10-12.05.06 E FileMaker - niveau 2 16 11-12.05.06 F LabVIEW Application Development 24 15-17.05.06 E LabVIEW Advanced Programming 16 18-19.05.06 E PERL 5: Advanced Aspects 8 18.05.06 E Technique du vide 16 18-19.05.06 F WORD 2003 - niveau 2 : ECDL 16 22-23.05.06 F Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE 16 23-24.05.06 F Comprehensive VHDL for FPGA Design 40 29.05-2.06.06 E C++ Programming Part 2 - Advanced C++ and its T...

  5. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 30.5.2006 (June-November course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue ACROBAT 7.0 : Utilisation de fichiers PDF 8 6.06.06 F Introduction à InDesign 16 7-8.06.06 F Python: Hands-on Introduction 24 7-9.06.06 E LabVIEW Base 2 16 22-23.06.06 F FileMaker - niveau 1 16 26-27.06.06 F C++ Programming Part 3 - Templates and the STL (Standard Template Library) 16 27-28.06.06 E C++ Programming Part 4 - Exceptions 8 29.06.06 E FrontPage 2003 - niveau 1 16 29-30.06.06 F Manipulation des images 4 6.07.06 F Introduction to Databases and Database Design 16 11-12.07.06 E ACCESS 2003 - Level 1: ECDL 16 13-14.07.06 E-F Design Patterns 16 25-26.07.06 E Introduction à Dreamweaver MX 16 ...

  6. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 21.3.2006 (March-October course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language FrontPage 2003 - niveau 1 16 27-28.03.06 F Oracle Forms Developer 10g: Move to the Web 16 27-28.03.06 E ACCESS 2003 - Level 2: ECDL AM5 16 3-4.03.06 E-F JAVA 2 Enterprise Edition - Part 1: Web Applications 16 3-4.04.06 E JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans 24 5-7.04.06 E AutoCAD Mechanical 2006 16 11-12.04.06 F FrontPage 2003 - niveau 2 16 24-25.04.06 F C++ Programming Part 1 - Introduction to Object-Oriented Design and Programming 24 25-27.04.06 E AutoCAD 2006 - niveau 1 32 27.04-4.05.06 F Oracle: SQL 24 3-5.05.06 E EXCEL 2003 (Short Course I) - HowTo... Work with formulae 3 4.05.06 (am) E-F EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing 3 4...

  7. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 7.2.2006 (February-May course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language WORD 2003 (Short Course II) - HowTo... Mail merge 3 09-02-06 E-F ACCESS 2003 - Level 1: ECDL M5 16 13 to 14-02-06 E-F OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Notes 3 16-02-06 E-F WORD 2003 (Short Course III) - HowTo... Work with long documents 3 16-02-06 E-F CERN EDMS - Introduction 8 21.02.06 E OUTLOOK 2003 (Short Course III) - Meetings and Delegation 3 27-02-06 E-F WORD 2003 (Short Course IV) - HowTo... Work with master document 3 27-02-06 E-F JAVA: Level 2 32 28-02-06 to 03-03-06 E Manipulation des images 4 28.02.06 F ACCESS 2003 - Level 2: ECDL AM5 16 02 to 03-03-06 E-F FrontPage 2003 - niveau 2 16 02 to 03-03-06 F C++ for Particle Physicists 20 06 to 10-03-06 E FileMaker - niv...

  8. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 11.7.2006 (July-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue Design Patterns 16 25-26.07.06 E CERN EDMS for Local Administrators 16 1-2.08.06 E ANSYS DesignModeler 16 29-30.08.06 F CERN EDMS – Introduction 8 5.09.06 E CERN EDMS MTF en pratique 4 6.09.06 F LabVIEW Basics 1 24 4-6.09.06 E ANSYS Workbench 32 12-15.09.06 F AutoCAD Mechanical 2006 16 12-13.09.06 F CERN EDMS for Engineers 8 12.09.06 E Software Engineering in the Small and the Large 16 12-13.09.06 E LabVIEW Basics 2 16 14-15.09.06 E LabVIEW: Working efficiently with LabWIEW 8 8 18.09.06 E PCAD Schémas ? Introduction 16 21-22.09.06 F PCAD PCB - Introduction  24 27-29.09.06 F C++ for Particle Physicists ...

  9. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 27.6.2006 (July-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue Manipulation des images 4 6.07.06 F Introduction to Databases and Database Design 16 11-12.07.06 E ACCESS 2003 - Level 1: ECDL 16 13-14.07.06 E-F Design Patterns 16 25-26.07.06 E CERN EDMS for Local Administrators 16 1-2.08.06 E ANSYS DesignModeler 16 29-30.08.06 F CERN EDMS - Introduction 8 5.09.06 E CERN EDMS MTF en pratique 4 6.09.06 F LabVIEW Basics 1 24 4-6.09.06 E ANSYS Workbench 32 12-15.09.06 F AutoCAD Mechanical 2006 16 12-13.09.06 F CERN EDMS for Engineers 8 12.09.06 E Software Engineering in the Small and the Large 16 12-13.09.06 E AutoCAD 2006 - niveau 1 32 14-21.09.06 F LabVIEW Basics 2 ...

  10. Technical training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 13.6.2006 (June-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue LabVIEW Base 2 16 22-23.06.06 F FileMaker - niveau 1 16 26-27.06.06 F C++ Programming Part 3 - Templates and the STL (Standard Template Library) 16 27-28.06.06 E C++ Programming Part 4 - Exceptions 8 29.06.06 E FrontPage 2003 - niveau 1 16 29-30.06.06 F Manipulation des images 4 6.07.06 F Introduction to Databases and Database Design 16 11-12.07.06 E ACCESS 2003 - Level 1: ECDL 16 13-14.07.06 E-F Design Patterns 16 25-26.07.06 E Introduction à Dreamweaver MX 16 26-27.07.06 F ANSYS DesignModeler 16 29-30.08.06 F LabVIEW Basics 1 24 4-6.09.06 E ANSYS Workbench 32 12-15.09.06 F AutoCAD Mechanical 20...

  11. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    Places available as of 19.7.2006 (August-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue CERN EDMS for Local Administrators 16 1-2.08.06 E ANSYS DesignModeler 16 29-30.08.06 F OUTLOOK 2003 (Short Course I) - E-mail 3 1.09.06 E/F OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Notes 3 1.09.06 E/F CERN EDMS - Introduction 8 5.09.06 E CERN EDMS MTF en pratique 4 6.09.06 F LabVIEW Basics 1 24 11-13.09.06 E ANSYS Workbench 32 12-15.09.06 F CERN EDMS for Engineers 8 12.09.06 E Software Engineering in the Small and the Large 16 12-13.09.06 E LabVIEW Basics 2 16 14-15.09.06 E EXCEL 2003 (Short Course I) - HowTo... Work with formulae 3 15.09.06 E/F WORD 2003 (Short Course III) - HowTo... Work with long docu...

  12. Technical Training: Places available

    CERN Multimedia

    DAvide Vitè

    2006-01-01

    Places available as of 25.7.2006 (August-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue CERN EDMS for Local Administrators 16 1-2.08.06 E ANSYS DesignModeler 16 29-30.08.06 F EXCEL 2003 - niveau 1 : ECDL 16 30-31.08.06 F OUTLOOK 2003 (Short Course I) - E-mail 3 1.09.06 E/F OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Notes 3 1.09.06 E/F CERN EDMS - Introduction 8 5.09.06 E CERN EDMS MTF en pratique 4 6.09.06 F ANSYS Workbench 32 12-15.09.06 F CERN EDMS for Engineers 8 12.09.06 E Software Engineering in the Small and the Large 16 12-13.09.06 E LabVIEW Basics 2 16 14-15.09.06 E WORD 2003 (Short Course III) - HowTo... Work with long documents 3 15.09.06 E/F EXCEL 2003 (Short Course I) - HowTo... Wor...

  13. Favorite places: spatial and temporal dimensions of place attachment

    OpenAIRE

    Wood, Stephen

    2015-01-01

    From the editor: "Independent researcher Stephen Wood probes his interest in place attachment by examining two lived dialectics: the spatial tension between inward and outward aspects of place; and the temporal tension between repetitive and singular events relating to place."

  14. Take Three: Seasonal Flu

    Centers for Disease Control (CDC) Podcasts

    2010-09-29

    In this podcast, Dr. Joe Bresee describes how to keep from getting seasonal flu and spreading it to others by taking these three steps.  Created: 9/29/2010 by National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 9/29/2010.

  15. Mathematics of Risk Taking

    Indian Academy of Sciences (India)

    https://www.ias.ac.in/article/fulltext/reso/014/01/0066-0079. Keywords. Investor; risk taking; fair game; martingale; random walk; gambling; population. Author Affiliations. K B Athreya1 2 M G Nadkarni3. Department of Mathematics Iowa State University, Ames, Iowa; I M I, Department of Mathematics, Indian Institute of Science, ...

  16. Rapid inventory taking system

    International Nuclear Information System (INIS)

    Marsden, P.S.S.F.

    1980-01-01

    A data processing system designed to facilitate inventory taking is described. The process depends upon the earliest possible application of computer techniques and the elimination of manual operations. Data is recorded in optical character recognition (OCR) 'A' form and read by a hand held wand reader. Limited validation checks are applied before recording on mini-tape cassettes. 5 refs

  17. Simulating Price-Taking

    Science.gov (United States)

    Engelhardt, Lucas M.

    2015-01-01

    In this article, the author presents a price-takers' market simulation geared toward principles-level students. This simulation demonstrates that price-taking behavior is a natural result of the conditions that create perfect competition. In trials, there is a significant degree of price convergence in just three or four rounds. Students find this…

  18. Taking of history

    DEFF Research Database (Denmark)

    Langebæk, Rikke

    2007-01-01

    Learning how to take a history is an extremely important discipline in the education of veterinary students. In our opinion the fact that this discipline is often neglected in traditional teaching is a big mistake. The mere thought of facing a real client can be almost paralysing to even the smar......Learning how to take a history is an extremely important discipline in the education of veterinary students. In our opinion the fact that this discipline is often neglected in traditional teaching is a big mistake. The mere thought of facing a real client can be almost paralysing to even...... the smartest student. So the more familiar a student can become with these situations the better. Since september 2006, veterinary students at Faculty of Life Sciences, University of Copenhagen, have received training in the discipline of history taking, using innovative educational methods: Online...... The students prepare themselves for the course by going online at home the day before class. Here they find a narrated PowerPoint presentation containing : 1) The principles of history taking 2) Client diversities – and the obstacles one might have to face with these different types of clients Video In class...

  19. Taking minutes of meetings

    CERN Document Server

    Gutmann, Joanna

    2016-01-01

    aking Minutes of Meetings guides you through the entire process behind minute taking: arranging the meeting; writing the agenda; creating the optimum environment; structuring the meeting and writing notes up accurately. The minute-taker is one of the most important and powerful people in a meeting and you can use this opportunity to develop your knowledge, broaden your horizons and build credibility within the organization. Taking Minutes of Meetings is an easy to read 'dip-in, dip-out' guide which shows you how to confidently arrange meetings and produce minutes. It provides hands-on advice about the sections of a meeting as well as tips on how to create an agenda, personal preparation, best practice advice on taking notes and how to improve your accuracy. Brand new chapters of this 4th edition include guidance on using technology to maximize effectiveness and practical help with taking minutes for a variety of different types of meetings. The creating success series of books... With over one million copi...

  20. Matters of place : the making of place and identity

    OpenAIRE

    Daniels, Jen; Baldacchino, Godfrey; Vodden, Kelly; Vodden, Kelly; Baldacchino, Godfrey; Gibson, Ryan

    2015-01-01

    Place is a key factor influencing individual and social behaviour, modes of living, and well-being (Halseth et al., 2010). Place-based development frameworks address this empirical imperative by their sensitivity to the existing assets and challenges experienced in a place. Some scholars and development practitioners recognize that “competitive advantage” comes from assets and resources nested in place. Others are drawn to place and place-making in response to fears of homog...

  1. Experiencing the enchantment of place and mobility

    DEFF Research Database (Denmark)

    Bærenholdt, Jørgen Ole

    2016-01-01

    that experiences (Erlebnisse) are practised as living adventures, where intersecting worlds are not apart from each other. These practices are performed in restless mobilities among places, where the connections and hints between place and mobility are central in making absence-presence tensions produce......Experiences of place and mobility play central roles not only in what was traditionally understood as tourism, but also in the broader practices of travelling and visiting sites and sights. On the one hand, such experiences are performed to an extent where it is difficult to isolate the sites...... and movements experienced per se, since visitors and travellers take part in ‘doing’ places and mobility. On the other, experience sites and routes stand out with specific traces and characteristics affording some – and not other – experiences. This paper discusses conceptual understandings that may help...

  2. Thermal Treatment of Iron Oxide Stabilized APC Residues from Waste Incineration and the Effect on Heavy Metal Binding

    DEFF Research Database (Denmark)

    Sørensen, Mette Abildgaard; Stackpoole, M.; Bender-Koch, C.

    2000-01-01

    Iron oxide stabilized APC residues from MSWI were heat treated at 600°C and 900°C. The thermal treatments resulted in a change in product stability by forcing a transformation in the mineralogical structures of the products. The treatments, moreover, simulated somewhat the natural aging processes...... that would take place in a stabilized residue. Consequent changes in crystalline structure and heavy metal binding were examined....

  3. Emerging place image

    DEFF Research Database (Denmark)

    Ooi, Can-Seng; Peji´c Kristensen, Tatjana; Lomanová Pedersen, Zdenka

    2004-01-01

    and perceptions.This paper introduces the concept of the orientalist tourist gaze, and demonstrates howorientalism may manifest in tourism. Data on how these two countries are imagined werecollected in Denmark.Keywords: destination identity, host society-guest interaction, impact of tourism, orientalism......Tourism offers an arena through which a place identity is imagined, negotiated and contained.This paper compares the Czech Republic and Slovakia, and show how these countriesconstruct and assert their identities through tourism. They both share a common history asCzechoslovakia, however...

  4. Signs in Place

    DEFF Research Database (Denmark)

    Hamid, Salmiah Binti Abdul; Jensen, Ole B.; Silva, Victor

    Travelling in unfamiliar areas is usually very interesting, however it can also be stressful. People travel or move around in an urban space according to their needs, and the environment can also influence the way people move about from one place to another. If a person gets lost, a map or GPS can...... and geosemiotic studies with regards to the road traffic signs used in urban spaces. The paper ends with a discussion on how people choreograph their movement in their everyday life from two different perspectives: above vs. below....

  5. Signs In Place

    DEFF Research Database (Denmark)

    Hamid, Salmiah Binti Abdul; Jensen, Ole B.; Silva, Victor

    2012-01-01

    Travelling in unfamiliar areas is usually very interesting; however, it can also be stressful. People travel or move around in an urban space according to their needs, and the environment can influence the way people move about from one place to another. If a person gets lost, a map or GPS can...... and geosemiotic studies with regards to the road traffic signs used in urban spaces. The paper ends with a discussion on how people choreograph their movement in their everyday life from two different perspectives: above vs. below...

  6. Tourism Sociabilities and Place

    DEFF Research Database (Denmark)

    Bødker, Mads; Browning, David

    2013-01-01

    Proposing new design opportunities, this paper challenges received notions of tourism, arguing that tourism is fundamentally social and concerned with making place. This turn makes tourism not only a convenient testing ground for technology concepts, but increasingly also for more sensitive...... renderings of, and interventions in, tourism as a relational and social practice. Using examples from commercial, arts, and design projects, and providing excerpts from our own fieldwork and design workshops with tourists and locals, this paper outlines three challenges through a conceptual lens that we see...... as productive for appropriate interaction design of tourism technologies....

  7. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW Real-Time (F) : 7 - 9.6.2005 (3 jours) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) FrontPage 2003 - niveau 2 : 16 & 17.6.2005 (2 jours) Utilisation de fichiers PDF avec ACROBAT 6.0 : 20.6.2005 (1journée) Introduction to ANSYS: 21 - 24.6.2005 (4 days) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoCorrect, Find/Replace) : 4.7.2005 (afternoon) WORD 2003 (Short Course II) - HowTo... Mail merge: 5.7.2005 (afternoon) WORD 2003 (Short Course III) - HowTo... Work with long documents : 6.7.2005 (afternoon) ACCESS 2003 - Level 2 - ECDL AM5: 5 - 8.7.2005 (4 mornings) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 7.7.2005 (afternoon) EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing: 8.7.2005 (aftern...

  8. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW base 1 : 4 - 6.7.2005 (3 jours) LabVIEW Basics 2: 7 - 8.7.2005 (2 days) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.7.2005 (1 jour) FrontPage 2003 - niveau 1 : 6-7.7.2005 (2 jours) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoCorrect, Find/Replace) : 4.7.2005 (afternoon) WORD 2003 (Short Course II) - HowTo... Mail merge: 5.7.2005 (afternoon) WORD 2003 (Short Course III) - HowTo... Work with long documents : 6.7.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 6.7.2005 (morning) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 7.7.2005 (morning) OUTLOOK (Short Course III) - Meetings and Delegation: 8.7.2005 (morning) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 7.7.2005 (afternoon) EXCEL 2003 (Short Course II) - HowTo... Format y...

  9. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) FrontPage 2003 - niveau 1 : 21 & 22.2.2005 (2 jours) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) Utilisation des fichiers PDF avec ACROBAT 6.0 : 1.3.2005 (1 journée) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 X 2.30-hours lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 X 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 2003 - niveau 2 : 21 & 22.3.2005 (2 jours) FileMaker - niveau 2 : 4 & 5.4.2005 (2 jours) EXCEL 2003 - niveau 2 : 11 & 12.4.2005 (2 jours) LabVIEW intermediate 1: 11 - 13....

  10. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Utilisation des fichiers PDF avec ACROBAT 6.0 : 1.3.2005 (1 journée) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 x 2.5-hour lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 x 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) AXEL-2005; Introduction to Particle Accelerators : 14- 18.3.2005 (10 x 1 h lectures) ACCESS 2003 - Level 1: ECDL M5: 15 - 16.3.2005 (2 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 2003 - niveau 2 : 21 & 22.3.2005 (2 jours) Hands-on Object-Oriented Design and Programming with C++ : 22 - 24.3.2005 (3 days) FileMaker - niveau 2 : 4 & 5.4.2005 (2 jours) EXCEL 2003 - niveau 2 : 11 & 12.4.2005 (2 jours) LabVIEW Intermediate 1: 11 - 13.4.2005...

  11. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW Real-Time (F) : 7 - 9.6.2005 (3 jours) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) IT3T/1 - Read your mail and more with Outlook 2003 : 14.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/2 - Creating, managing and using distribution lists with Simba2 : 16.6.2005 (IT Technical Training Tutorial, free of charge) FrontPage 2003 - niveau 2 : 16 & 17.6.2005 (2 jours) Utilisation de fichiers PDF avec ACROBAT 6.0 : 20.6.2005 (1journée) Introduction to ANSYS: 21 - 24.6.2005 (4 days) IT3T/3 - Working remotely with Windows XP : 28.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/4 - Editing Websites with Frontpage 2003 : 30.6.2005 (IT Technical Training Tutorial, free of charge) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoC...

  12. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language ACCESS 2003 - Level 2: ECDL AM5 16 19 to 20-01-06 E-F AutoCAD 2006 - niveau 1 32 19 to 25-01-06 F C++ Programming Advanced - Traps and Pitfalls 32 24 to 27-01-06 E STEP7 : Level 1 32 24 to 27-01-06 E LabVIEW Basics 2 16 26 to 27-01-06 E AutoCAD Mechanical 2006 16 30 to 31-01-06 F DIAdem : base 24 01 to 03-02-06 F FrontPage 2003 - niveau 1 16 02 to 03-02-06 F ACROBAT 7.0 : Utilisation de fichiers PDF 8 06-02-06 F Manipulation des images 4 08-02-06 F OUTLOOK 2003 (Short Course I) - E-mail 3 09-02-06 E-F WORD 2003 (Short Course II) - HowTo... Mail merge 3 09-02-06 E-F ACCESS 2003 - Level 1: ECDL M5 16 13 to 14-02-06 E-F JCOP: Control System Integration using JCOP Tools 24 14 to 16-02-06 E OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Note...

  13. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) FrontPage 2003 - niveau 1 : 21 & 22.2.2005 (2 jours) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) Utilisation des fichiers PDF avec ACROBAT 6.0 : 1.3.2005 (1 journée) Hands-on Object-Oriented Design and Programming with C++ : 1 - 3.3.2005 (3 days) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 x 2.5-hour lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 x 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) ACCESS 2003 - Level 1 : 15 - 16.3.2005 (2 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 2003 - niveau 2 : 21 & 22.3.2005 (2 jours) FileMaker - ...

  14. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework: 8 - 12.8.2005 (5 days) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks (AutoText, AutoFormat, AutoCorrect, Lists, Find/Replace): 25.8.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 25.8.2005 (afternoon) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 26.8.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents: 26.8.2005 (afternoon) FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1 : 5 - 7.9.2005 (3 days, dates to be confirmed) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) MAGNE-05 - Magn&...

  15. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Hands-on Introduction to Python Programming: 28 - 30.6.2005 (3 days) Introduction to ANSYS: 28.6 - 1.7.2005 (4 days) IT3T/3 - Working remotely with Windows XP: 28.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/4 - Editing Websites with Frontpage 2003: 30.6.2005 (IT Technical Training Tutorial, free of charge) LabVIEW base 1 : 4 - 6.7.2005 (3 jours) LabVIEW Basics 2: 7 - 8.7.2005 (2 days) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.7.2005 (1 jour) FrontPage 2003 - niveau 1 : 6-7.7.2005 (2 jours) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoCorrect, Find/Replace) : 4.7.2005 (afternoon) WORD 2003 (Short Course II) - HowTo... Mail merge: 5.7.2005 (afternoon) WORD 2003 (Short Course III) - HowTo... Work with long documents : 6.7.2005 (afternoon) ACCES...

  16. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework: 8 - 12.8.2005 (5 days) FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1 : 5 - 7.9.2005 (3 days, dates to be confirmed) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) LabVIEW Application Development (Intermediate I): 5 - 7.12.2005 (3 days) LabVIEW Advanced Programming (Intermediate 2): 8 - 9.12.2005 (2 days) ENSEIGNEMENT TECHNIQUE TECHNICAL TRAINING Monique Duval 74924 technical.training@cern.ch

  17. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FrontPage 2003 - niveau 1 : 9 & 10.5.2005 (2 jours) ELEC-2005 - Summer Term: System electronics for physics - Issues : 10, 12, 17, 19, 24, 26 & 31.5.2005 (7 x 2h lectures) AutoCAD 2005 - niveau 1 : 12, 13, 18, 19.5.2005 (4 jours) ACCESS 2003 - Level 1: ECDL M5 : 11 & 12.5.2005 (2 days) Object-Oriented Analysis and Design using UML: 17 - 19.5.2005 (3 days) Synplify Pro Training: 18.5.2005 (1 day) Finite State Machines in the JCOP Framework: 24 - 26.5.2005 (3 days) The Joint PVSS JCOP Framework: 30.5 - 3.6.2005 (5 days) Introduction à la CAO CADENCE : 31.5 - 1.6.2005 (2 jours) LabVIEW Real-Time (F) : 7 - 9.6.2005 (3 jours) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) FrontPage 2003 - niveau 2 : 16 & 17.6.2005 (2 jours) Utilisation de fichiers PDF avec ACROBAT 6.0 : 20.6.2005 (1journée) Intr...

  18. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FrontPage 2003 - niveau 1 : 9 & 10.5.2005 (2 jours) ELEC-2005 - Summer Term: System electronics for physics - Issues : 10, 12, 17, 19, 24, 26 & 31.5.2005 (7 x 2h lectures) AutoCAD 2005 - niveau 1 : 11, 12, 18, 19.5.2005 (4 jours) Object-Oriented Analysis and Design using UML: 17 - 19.5.2005 (3 days) Synplify Pro Training: 18.5.2005 (1 day) Finite State Machines in the JCOP Framework: 24 - 26.5.2005 (3 days) The Joint PVSS JCOP Framework: 30.5 - 3.6.2005 (5 days) Introduction à la CAO CADENCE : 31.5 - 1.6.2005 (2 jours) LabVIEW Real-Time (F) : 7 - 9.6.2005 (3 jours) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) FrontPage 2003 - niveau 2 : 16 & 17.6.2005 (2 jours) Utilisation de fichiers PDF avec ACROBAT 6.0 : 20.6.2005 (1journée) Introductio...

  19. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Hands-on Introduction to Python Programming: 28 - 30.6.2005 (3 days) Introduction to ANSYS: 21 - 24.6.2005 (4 days) IT3T/3 - Working remotely with Windows XP: 28.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/4 - Editing Websites with Frontpage 2003: 30.6.2005 (IT Technical Training Tutorial, free of charge) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.7.2005 (1 jour) FrontPage 2003 - niveau 1 : 6-7.7.2005 (2 jours) LabVIEW base 1 : 4 - 6.7.2005 (3 jours) LabVIEW Basics 2: 7 - 8.7.2005 (2 days) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoCorrect, Find/Replace) : 4.7.2005 (afternoon) WORD 2003 (Short Course II) - HowTo... Mail merge: 5.7.2005 (afternoon) WORD 2003 (Short Course III) - HowTo (4 mornings) EXCEL 2003 (Short Course I) - HowTo... Work ...

  20. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2006-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language AutoCAD Mechanical 2006 16 30 to 31-01-06 F DIAdem : base 24 01 to 03-02-06 F ACROBAT 7.0 : Utilisation de fichiers PDF 8 06-02-06 F Manipulation des images 4 08-02-06 F OUTLOOK 2003 (Short Course I) - E-mail 3 09-02-06 E-F WORD 2003 (Short Course II) - HowTo... Mail merge 3 09-02-06 E-F ACCESS 2003 - Level 1: ECDL M5 16 13 to 14-02-06 E-F JCOP: Control System Integration using JCOP Tools 24 14 to 16-02-06 E OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Notes 3 16-02-06 E-F WORD 2003 (Short Course III) - HowTo... Work with long documents 3 16-02-06 E-F FrontPage 2003 - niveau 1 16 23 to 24-02-06 F OUTLOOK 2003 (Short Course III) - Meetings and Delegation 3 27-02-06 E-F WORD 2003 (Short Course IV) - HowTo... Work with master document 3 27-02-06 E-F ...

  1. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework: 8 - 12.8.2005 (5 days) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks (AutoText, AutoFormat, AutoCorrect, Lists, Find/Replace): 25.8.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 25.8.2005 (afternoon) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 26.8.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents: 26.8.2005 (afternoon) FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1 : 5 - 7.9.2005 (3 days, dates to be confirmed) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) Finite State Machines in the JCOP Framew...

  2. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1: 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) The CERN EDMS for Local Administrators: 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) LabVIEW base 1/basics 1 : 31.1 - 1.2.2005 (2 j size="2">LabVIEW base 2/basics 2 : 3 & 4.2.2005 (2 jours/2 days - langue à décider/language to be decided) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9.2.2005 (3 days) C++ Programming Advanced -Traps and Pitfalls: 8 - 11.2.2005 (4 days) Joint PVSS JCOP Framework: 14 - 18.2.2005 (5 days) JAVA 2 Enterprise Edition - Part 1: ...

  3. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1: 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) ELEC-2005.:Winter term: Introduction to electronics in HEP: 18, 20, 25, 27.1, 1 & 3.2.2005 (6 x 2h lectures) The CERN EDMS for Local Administrators: 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) CLEAN-2002 : Travailler en salle propre : 25.1.2005 (après-midi, cours gratuit) Compatibilité électromagnétique (CEM) : installation et remèdes : 25 - 27.1.2005 (3 jours) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9...

  4. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 x 2.5-hour lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 x 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) Oracle 9i: SQL: 14 -16.3.2005 (3 days) AXEL-2005; Introduction to Particle Accelerators : 14- 18.3.2005 (10 x 1 h lectures) ACCESS 2003 - Level 1: ECDL M5: 15 - 16.3.2005 (2 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 2003 - niveau 2 : 21 & 22.3.2005 (2 jours) Hands-on Object-Oriented Design and Programming with C++ : 22 - 24.3.2005 (3 days) FileMaker - niveau 2 : 4 & 5.4.2005 (2 jours) Oracle 9i: Programming with PL/SQL: 4 - 6.4.2005 (3 days) EXCEL 2003 - niveau 2 : 11 & 12.4.2005 (2 jours) LabVIEW Intermedia...

  5. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW Intermediate 1: 11 - 13.4.2005 (3 days) ACCESS 2003 - Level 2 - ECDL AM5: 13 & 14.4.2005 (2 days) LabVIEW Intermediate 2: 14 & 15.4.2005 (2 days) PowerPoint 2003 (F) : 25.4.2005 (1 jour) WORD 2003 - niveau 1 : 2 & 3.5.2005 (2 jours) FrontPage 2003 - niveau 1 : 9 & 10.5.2005 (2 jours) ANSYS Workbench (F) : 9 - 12.5.2005 (4 jours) ELEC-2005 - Summer Term: System electronics for physics - Issues : 10, 12, 17, 19, 24, 26 & 31.5.2005 (7 x 2h lectures) La technique du vide : 12 & 13.5.2005 (2 jours) Finite State Machines in the JCOP Framework: 24 - 26.5.2005 (3 days) The Joint PVSS JCOP Framework ; 30.5 - 3.6.2005 (5 days) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) Introduction to ANSYS: 21 - 24.6.2005 (4 days) ENSEIGNEMENT ...

  6. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: PowerPoint 2003 (F) : 25.4.2005 (1 jour) WORD 2003 - niveau 1 : 2 & 3.5.2005 (2 jours) FrontPage 2003 - niveau 1 : 9 & 10.5.2005 (2 jours) ANSYS Workbench (F) : 9 - 12.5.2005 (4 jours) ELEC-2005 - Summer Term: System electronics for physics - Issues : 10, 12, 17, 19, 24, 26 & 31.5.2005 (7 x 2h lectures) AutoCAD 2005 - niveau 1 : 11, 12, 18, 19.5.2005 (4 jours) ACCESS 2003 - Level 1: ECDL M5 : 11 & 12.5.2005 (2 days) La technique du vide : 12 & 13.5.2005 (2 jours) Finite State Machines in the JCOP Framework: 24 - 26.5.2005 (3 days) The Joint PVSS JCOP Framework: 30.5 - 3.6.2005 (5 days) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) Introduction to ANSYS: 21 - 24.6.2005 (4 days) ENSEIGNEMENT TECHNIQUE TECHNICAL TRAINING Monique Duval 74924 tech...

  7. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: ACCESS 2003 - Level 1: ECDL M5: 15 - 16.3.2005 (2 days) Hands-on Object-Oriented Design and Programming with C++ : 22 - 24.3.2005 (3 days) FileMaker - niveau 2 : 4 & 5.4.2005 (2 jours) Oracle 9i: Programming with PL/SQL: 4 - 6.4.2005 (3 days) EXCEL 2003 - niveau 2 : 11 & 12.4.2005 (2 jours) LabVIEW Intermediate 1: 11 - 13.4.2005 (3 days) ACCESS 2003 – Level 2 – ECDL AM5: 13 & 14.4.2005 (2 days) LabVIEW Intermediate 2: 14 & 15.4.2005 (2 days) PowerPoint 2003 (F) : 18.4.2005 (1 jour) Joint PVSS JCOP Framework : 25 – 29.4.2005 (5 days) ELEC-2005 - Summer Term: System electronics for physics - Issues : 10, 12, 17, 19, 24, 26 & 31.5.2005 (7 x 2h lectures) AutoCAD 2002 – niveau 1 : 11, 12, 18 & 19.5.2005 (4 jours) LabVIEW M...

  8. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW base 2/basics 2 : 3 & 4.2.2005 (2 jours/2 days - langue à décider/language to be decided) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9.2.2005 (3 days) JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) FrontPage 2003 - niveau 1 : 21 & 22.2.2005 (2 jours) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 X 2.30-hours lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 X 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 20...

  9. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Hands-on Object-Oriented Design and Programming with C++ : 22 - 24.3.2005 (3 days) FileMaker - niveau 2 : 4 & 5.4.2005 (2 jours) EMAG-2004 - Electromagnetic Design and Mathematical Optimization in Magnet Technology: 4- 14.4.2005 (8 x 3h) EXCEL 2003 - niveau 2 : 11 & 12.4.2005 (2 jours) LabVIEW Intermediate 1: 11 - 13.4.2005 (3 days) ACCESS 2003 - Level 2 - ECDL AM5: 13 & 14.4.2005 (2 days) LabVIEW Intermediate 2: 14 & 15.4.2005 (2 days) PowerPoint 2003 (F) : 18.4.2005 (1 jour) Joint PVSS JCOP Framework : 25 - 29.4.2005 (5 days) WORD 2003 - niveau 1 : 2 & 3.5.2005 (2 jours) ELEC-2005 - Summer Term: System electronics for physics - Issues : 10, 12, 17, 19, 24, 26 & 31.5.2005 (7 x 2h lectures) AutoCAD 2002 - niveau 1 : 11, 12, 18 & 19.5.2005 (4 jour...

  10. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW Migration 6 to 7: 14.6.2005 (1 day) IT3T/1 - Read your mail and more with Outlook 2003 : 14.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/2 - Creating, managing and using distribution lists with Simba2 : 16.6.2005 (IT Technical Training Tutorial, free of charge) FrontPage 2003 - niveau 2 : 16 & 17.6.2005 (2 jours) size="2">(1journée) Hands-on Introduction to Python Programming: 28 - 30.6.2005 (3 days) Introduction to ANSYS: 21 - 24.6.2005 (4 days) IT3T/3 - Working remotely with Windows XP: 28.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/4 - Editing Websites with Frontpage 2003: 30.6.2005 (IT Technical Training Tutorial, free of charge) LabVIEW base 1 : 4 - 6.7.2005 (3 jours) LabVIEW Basics 2: AutoCorrect, Find/Replace) : 4.7.2005 (afternoon) WORD 2003 (Shor...

  11. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Introduction à ANSYS : 23 - 26.11.2004 (4 jours) FileMaker - niveau 1 : 23 - 26.11.2004 (4 jours) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) Explicit Dynamics with ANSYS/LS-Dyna : 7 - 9.12.2004 (3 days) Introduction to PERL 5 : 8 & 9.12.2004 (2 days) PCAD Schémas - Débutants : 9 & 10.12.2004 (2 jours) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) Introduction to the CERN EDMS : 18.1.2005 (1 day - free course) The CERN EDMS for Local Administrators : 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) CLEAN-2002 : Travaill...

  12. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Explicit Dynamics with ANSYS/LS-Dyna : 7 - 9.12.2004 (3 days) Introduction to PERL 5 : 8 & 9.12.2004 (2 days) PCAD Schémas - Débutants : 9 & 10.12.2004 (2 jours) Advanced aspects of PERL 5: 10.12.2004 (1 day) PCAD PCB – Débutants : 13 - 15.12.2004 (3 jours) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) Introduction to the CERN EDMS : 18.1.2005 (1 day - free course) The CERN EDMS for Local Administrators : 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) CLEAN-2002 : Travailler en salle propre : 25.1.2005 (après-midi, cours gratuit) Compatibilit&eac...

  13. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) Word 2003 - niveau 1 : 22 & 23.11.2004 (2 jours) Introduction à ANSYS : 23 - 26.11.2004 (4 jours) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) Explicit Dynamics with ANSYS/LS-Dyna : 7 - 9.12.2004 (2 days) PCAD Schémas - Débutants : 9 & 10.12.2004 (2 jours) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) CLEAN-2002 : Travailler en salle propre : 25.1.2005 (après-midi, cours gratuit) Compatibilité électromagnétique (CEM) : installation et remèdes : 25 - 27.1.2005 (3 jours) Finite State Machines in the JCOP Fr ...

  14. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: FileMaker - niveau 1 : 23 - 26.11.2004 (4 jours) Explicit Dynamics with ANSYS/LS-Dyna : 7 - 9.12.2004 (3 days) Introduction to PERL 5 : 8 & 9.12.2004 (2 days) PCAD Schémas - Débutants : 9 & 10.12.2004 (2 jours) Advanced aspects of PERL 5: 10.12.2004 (1 day) PCAD PCB – Débutants : 13 - 15.12.2004 (3 jours) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) Introduction to the CERN EDMS : 18.1.2005 (1 day - free course) The CERN EDMS for Local Administrators : 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) CLEAN-2002 : Travailler en salle propre : 25.1.2005 ...

  15. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FileMaker - niveau 1 :  20 - 21.10.2005 (2 jours) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) Finite State Machines in the JCOP Framework : 25 - 27.10.2005 (3 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Joint PVSS JCOP Framework : 21 - 25.11.2005 (5 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents : ...

  16. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: The Java Programming Language Level 1: 21 - 23.11.2005 (3 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents : 30.11.2005 (afternoon) FrontPage 2003 - niveau 2 : 5 - 6.12.2005 (2 jours) Introduction à ANSYS Classique : 6 - 9.12.2005 (4 jours) EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing: 7.12.2005 (morning) PCAD Schémas - Introduction : 8 - 9.12.2005 (2 jours) ACCESS 2003 - Level 2 - ECDL AM5: 14 - 15.12.2005 (2 days) LabVIEW Basics I:  23 - 25.1.2006 (3 days) C++ Programming Advanced - Traps and Pitfalls: 24 - 27.1.2006 (4 days) LabVIEW Basics II:  26 - 27.1.2006 (2 days) Joint PVSS-JCOP Framework: 30.1 - 3.2.2006 (5 days, free of charge) Finite State Machines in the JCOP Framework : ...

  17. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) WORD 2003 (Short Course IV) - HowTo... Work with master document: 28.9.2005 (morning) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) Introduction à Dreamweaver MX :  3 - 4.10.2005 (2 jours) Utilisation des fichiers PDF avec Acrobat 7.0 :   4.10.2005 (1 journée) LaTeX par la pratique :   4 - 6.10.2005 (3 matinées) PowerPoint 2003 (F) :  7.10.2005 (1 journée) FileMaker - niveau 1 :  20 - 21.10.2005 (2 jours) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11....

  18. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) ELEC-2005 Autumn Term - Electronics applications in HEP experiments: 8.11 - 8.12.2005 (10 x 2h lectures) The EDMS-MTF in practice: 9.11.2005 (morning, free of charge) The CERN EDMS for Local Administrators: 15-16.11.2005 (2 days, free of charge) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Hands-On Object Oriented Design and Programming with C++ : 16 - 18.11.2005 (3 days) The CERN EDMS for Engineers: 17.11.2005 (1 day, free of charge) The Java Programming Language Level 1: 21 - 23.11.2005 (3 days) Hands-on Introduction to Python Programming: 28 - 30.11.2005 (3 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents : 30.11.2005 (afternoon) Fron...

  19. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents: 30.11.2005 (afternoon) FrontPage 2003 - niveau 2 : 5 - 6.12.2005 (2 jours) Introduction à ANSYS Classique : 6 - 9.12.2005 (4 jours) EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing: 7.12.2005 (morning) AutoCAD - mise à jour d’AutoCAD 2002 à AutoCAD 2006 : 8.12.2005 (1 journée - pour les utilisateurs d’AutoCAD 2002) PCAD Schémas - Introduction : 8 - 9.12.2005 (2 jours) Finite State Machines in the JCOP Framework: 13 - 15.12.2005 (3 days) PCAD PCB - Introduction : 14 - 16.12.2005 (3 jours) ACCESS 2003 - Level 2 - ECDL AM5: 14 - 15.12.2005 (2 days) AutoCAD 2006 - niveau 1 : 19, 20, 24 & 25.1.2006 (4 jours) LabVIEW Basics I:  23 - 25.1.2006...

  20. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FrontPage 2003 - niveau 2 : 5 - 6.12.2005 (2 jours) Introduction à ANSYS Classique : 6 - 9.12.2005 (4 jours) EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing: 7.12.2005 (morning) PCAD Schémas - Introduction : 8 - 9.12.2005 (2 jours) Finite State Machines in the JCOP Framework: 13 - 15.12.2005 (3 days) ACCESS 2003 - Level 2 - ECDL AM5: 14 - 15.12.2005 (2 days) PCAD PCB - Introduction : 14 - 16.12.2005 (3 jours) AutoCAD 2006 - niveau 1 : 19, 20, 24 & 25.1.2006 (4 jours) LabVIEW Basics I:  23 - 25.1.2006 (3 days) C++ Programming Advanced - Traps and Pitfalls: 24 - 27.1.2006 (4 days) STEP7 Programming Level 1: 24 - 27.1.2006 (4 days) LabVIEW Basics II:  26 - 27.1.2006 (2 days) AutoCAD Mechanical 2006 : 30 - 31.1.2006 (2 jours; suite du cours AutoCAD 2006 - niveau 1) Joint PVS...

  1. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) WORD 2003 (Short Course IV) - HowTo... Work with master document: 28.9.2005 (morning) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) Introduction à Dreamweaver MX :  3 - 4.10.2005 (2 jours) Utilisation des fichiers PDF avec Acrobat 7.0 :   4.10.2005 (1 journée) LaTeX par la pratique :   4 - 6.10.2005 (3 matinées) PowerPoint 2003 (F) :  7.10.2005 (1 journée) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with Auto...

  2. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1:  5 â€" 7.9.2005 (3 days) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) OU...

  3. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FileMaker - niveau 1 :  20 - 21.10.2005 (2 jours) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) Finite State Machines in the JCOP Framework : 25 - 27.10.2005 (3 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Joint PVSS JCOP Framework : 21 - 25.11.2005 (5 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11....

  4. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) Finite State Machines in the JCOP Framework : 25 - 27.10.2005 (3 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) Introduction to the CERN EDMS: 2.11.2005 (1 day, free of charge) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) The CERN EDMS for Engineers: 8.11.2005 (1 day, free of charge) The EDMS-MTF in practice: 9.11.2005 (morning, free of charge) The CERN EDMS for Local Administrators: 15-16.11.2005 (2 days, free of charge) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: ...

  5. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1:  5 - 7.9.2005 (3 days) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) WORD 2003 (Short Course IV) - HowTo... Work with master document: 28.9.2005 (morning) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2...

  6. Technical training: places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Introduction to the CERN EDMS: 2.11.2005 (1 day, free of charge) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) The CERN EDMS for Engineers: 8.11.2005 (1 day, free of charge) The EDMS-MTF in practice: 9.11.2005 (morning, free of charge) The CERN EDMS for Local Administrators: 15-16.11.2005 (2 days, free of charge) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Hands-On Object Oriented Design and Programming with C++ : 16 - 18.11.2005 (3 days) The Java Programming Language Level 1: 21 - 23.11.2005 (3 days) Hands-on Introduction to Python Prog...

  7. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) Utilisation des fichiers PDF avec Acrobat 7.0 :   4.10.2005 (1 journée) LaTeX par la pratique :   4 - 6.10.2005 (3 matinées) PowerPoint 2003 (F) :  7.10.2005 (1 journée) FileMaker - niveau 1 :  20 - 21.10.2005 (2 jours) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) Finite State Machines in the JCOP Framework : 25 - 27.10.2005 (3 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCO...

  8. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: ELEC-2005 Autumn Term - Electronics applications in HEP experiments: 8.11 - 8.12.2005 (10 x 2h lectures) The CERN EDMS for Local Administrators: 15-16.11.2005 (2 days, free of charge) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Hands-On Object Oriented Design and Programming with C++ : 16 - 18.11.2005 (3 days) The CERN EDMS for Engineers: 17.11.2005 (1 day, free of charge) The Java Programming Language Level 1: 21 - 23.11.2005 (3 days) Hands-on Introduction to Python Programming: 28 - 30.11.2005 (3 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents : 30.11.2005 (afternoon) FrontPage 2003 - niveau 2 : 5 - 6.12.2005 (2 jours) LabVIEW Application Development (Intermediate 1): 5 - 7.12.2005 (3 d...

  9. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: WORD 2003 (Short Course I) - HowTo... Work with AutoTasks (AutoText, AutoFormat, AutoCorrect, Lists, Find/Replace): 25.8.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 25.8.2005 (afternoon) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 26.8.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents: 26.8.2005 (afternoon) FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW base 1 : 5 - 7.9.2005 (3 jours) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechniq...

  10. Technical Training: Places available

    CERN Multimedia

    Davide Vitè

    2005-01-01

    Le nombre de places disponibles peut varier. Veuillez consulter notre site Web pour avoir la dernière mise à jour. Des places sont disponibles dans les cours suivants :   Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) WORD 2003 (Short Course IV) - HowTo... Work with master document: 28.9.2005 (morning) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) Introduction à Dreamweaver MX :  3 - 4.10.2005 (2 jours) Utilisation des fichiers PDF avec Acrobat 7.0 :   4.10.2005 (1 journée) LaTeX par la pratique :   4 - 6.10.2005 (3 matinées) PowerPoint 2003 (F) :  7.10.2005 (1 journée) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (...

  11. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Instructor-led WBTechT Study or Follow-up for Microsoft Applications : 7.9.2004 7.9.2004 Outlook (short course III) : Meetings and Delegation : 7.9.2004 (2 hours, afternoon) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) Joint PVSS JCOP Framework : 13 - 17.9.2004 (5 days) Programmation STEP7 niveau 1 : 14-17.9.2004 (4 jours) ANSYS : Thermal Analysis : 22 - 24.9.2004 (3 days) LabVIEW Migration 6 à 7 : 23.9.2004 (one day) ANSYS : Advanced Topics : 27.9 - 1.10.2004 (5 days) Word 2003 - niveau 2 : 27 & 28.9.2004 (2 jours) LabVIEW - Basics 1 : 27 - 29.9.2004 (3 days) MAGNE-04 : Magnétisme pour l'électrotechnique : 28 - 30.9.2004 (3 jours) LabVIEW - Basics 2 : 30.9 & 1.10.2004 (2 days) Introduction à Windows XP au CERN : 4.10.2004 (matin) ...

  12. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Joint PVSS JCOP Framework : 9 - 13.8.2004 (5 days) Outlook (I): E-mail : 31.8.2004 (2 hours, morning) Outlook (II): Calendar, Tasks and Notes : 31.8.2004 (2 hours, afternoon) Hands-on Introduction to Python Programming : 1 - 3.9.2004 (3 days - free course) Instructor-led WBTechT Study or Follow-up for Microsoft Applications : 7.9.2004 (morning) Outlook (III): Meetings and Delegation : 7.9.2004 (2 hours, afternoon) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) Joint PVSS JCOP Framework : 13 - 17.9.2004 (5 days) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.9.2004 (4 jours) Programmation STEP7 niveau 1 : 14 - 17.9.2004 (4 jours) FrontPage 2003 - niveau 1 : 20 & 21.9.2004 (2 jours) ANSYS: Thermal Analysis : 22 - 24.9.2004 (3 days) ANSYS: Advanced Topics : 27.9...

  13. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW - Basics 2 : 30.9 & 1.10.2004 (2 days) Introduction à Windows XP au CERN : 4.10.2004 (matin) The EDMS MTF in practice : 4.10.2004 (afternoon) The CERN EDMS for Engineers : 6.10.2004 (1 day) FrontPage 2003 - niveau 1 : 7 & 8.10.04 (2 jours) Hands-On Object Oriented Design and Programming with C++ : 9 - 12.11.2004 (3 days) FileMaker - niveau 1 : 18 & 19.10.2004 (2 jours) Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Excel 2003 - niveau 1 : 4 & 5.11.2004 (2 jours) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Outlook (Short Course III) : Meetings and Delegation : 9.11...

  14. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: ANSYS : Thermal Analysis : 22 - 24.9.2004 (3 days) LabVIEW Migration 6 à 7 : 23.9.2004 (one day) ANSYS : Advanced Topics : 27.9 - 1.10.2004 (5 days) Word 2003 - niveau 2 : 27 & 28.9.2004 (2 jours) LabVIEW - Basics 1 : 27 - 29.9.2004 (3 days) LabVIEW - Basics 2 : 30.9 & 1.10.2004 (2 days) Introduction à Windows XP au CERN : 4.10.2004 (matin) The EDMS MTF in practice : 4.10.2004 (afternoon) The CERN EDMS for Engineers : 6.10.2004 (1 day) FrontPage 2003 - niveau 1 : 7 & 8.10.04 (2 jours) Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Instructor-led WTechT Study or Fo...

  15. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The CERN EDMS for Engineers : 6.10.2004 (1 day) FileMaker - niveau 1 : 18 & 19.10.2004 (2 jours) Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Excel 2003 - niveau 1 : 4 & 5.11.2004 (2 jours) LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions...

  16. Technical Training: Places available

    CERN Multimedia

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: C++ for Particle Physicists : 8 - 12.3.2004 (6 X 4-hour sessions) Introduction to the CERN EDMS : 9.3.2004 (1 day, free of charge) The EDMS MTF in Practice : 10.3.2004 (morning, free of charge) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon, free of charge) The CERN EDMS for Engineers : 11.3.2004 (1 day, free of charge) LabVIEW...

  17. Technical Training: Places available

    CERN Document Server

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Instructor-led WBTechT study or follow-up for Microsoft applications : 1.4.2004 (morning) FrontPage XP - niveau 1 : 5 & 6.4.2004 (2 jours) AutoCAD 2002 - niveau 1 : 19, 20.4 et 3, 4.5.2004 (4 jours) Oracle 8i/9i - Develop Web-based Applications with PL/SQL : 19 & 20.4.2004 (2 days) Introduction to ANSYS : 20 - 23.4.2004 (4 day...

  18. Technical Training: Places available

    CERN Document Server

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW base 1 : 25 - 27.2.2004(3 jours) Instructor-led WBTechT study or follow-up for Microsoft applications : 26.2.2004 (morning) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Particle Physicists : 8 - 12.3.2004 (6 X 4-hour sessions) LabVIEW hands-on (E) : 16.3.2004 (afternoon) LabVIEW Basics 1 : 22 - 24.3.2004 ...

  19. TECHNICAL TRAINING: Places available**

    CERN Multimedia

    2003-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval Tel. 74924 technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The EDMS-MTF in practice (free of charge) : 28 -  30.10.03 (6 half-day sessions) AutoCAD 2002 – Level 1 : 3, 4, 12, 13.11.03 (4 days) LabVIEW TestStand ver. 3 : 4 & 5.11.03 (2 days) Introduction to PSpice : 4.11.03 p.m. (half-day) Hands-on Introduction to Python Programming : 12 – 14.11.03 (3 days) ACCESS ...

  20. Technical Training: Places available

    CERN Document Server

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Computational Electromagnetics with the ELEKTRA Module of OPERA-3D : 27 & 28.4.2004 (2 days) Hands-on Introduction to Python Programming : 3 - 5.5.2004 (3 days) LabVIEW Base 2 : 6 & 7.5.2004 (2 jours) Project Planning with MS-Project : 6 & 13.5.2004 (2 days) Word 2003 - niveau 1 : 10 & 11.5.2004 (2 jours) Oracle 9i : SQL : 10 - 12.5.2004 (3...

  1. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.09.2004 (4 jours) Introduction to the CERN EDMS : 22.6.2004 (1 day) The CERN EDMS for local administrators : 23 & 24.6.2004 (2 days) MAGNE-04 : Magnétisme pour l'électrotechnique : 6 - 8.7.2004 (3 jours) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) ENSEIGNEMENT TECHNIQUE TECHNICAL TRAINING...

  2. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Joint PVSS JCOP Framework : 9 - 13.8.2004 (5 days) Introduction à Outlook : 19.8.2004 (1 jour) Outlook (Short Course I): E-mail: 31.8.2004 (2 hours, morning) Outlook (Short Course II): Calendar, Tasks and Notes: 31.8.2004 (2 hours, afternoon) Instructor-led WBTechT Study or Follow-up for Microsoft Applications: 7.9.2004 (morning) Outlook (Short Course III): Meetings and Delegation: 7.9.2004 (2 hours, afternoon) I...

  3. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Outlook (short course I) : E-mail : 31.8.2004 (2 hours, morning) Introduction à Outlook : Outlook (short course II) : Calendar, Tasks and Notes : 31.8.2004 (2 hours, afternoon) Instructor-led WBTechT Study or Follow-up for Microsoft Applications : 7.9.2004 (morning) Outlook (short course III) : Meetings and Delegation : 7.9.2004 (2 hours, afternoon) Introduction au VHDL et utilisation du simulateur ...

  4. Technical Training: Places available

    CERN Document Server

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Joint PVSS JCOP Programming : 9 - 13.8.2004 (5 days) Hands-on Introduction to Python Programming: 1 - 3.9.2004 (3 days - free course) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) Joint PVSS JCOP Programming : 13 - 17.9.2004 (5 days) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.9.2004 (4 jours) Programmation STEP7 niveau 1 : 14-17.9.2004 (4...

  5. Technical Training: Places available

    CERN Multimedia

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Project Planning with MS-Project :6 & 13.5.2004 (2 days) Word 2003 - niveau 1 : 10 & 11.5.2004 (2 jours) Oracle 9i : SQL : 17 - 19.5.2004 (3 days) Word 2003 - niveau 2 : 24 & 25.5.2004 (2 jours) EXCEL 2003 - niveau 1: 27 & 28.5.2004 (2 jours) STEP7 Programming Level 1 : 1 - 4.6.2004 (4 days) Oracle 9i : Programming with PL/SQL : 2 - 4.6.2...

  6. Technical Training: Places available

    CERN Document Server

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Instructor-led WBTechT study for Microsoft applications :12.2.2004 (morning) Instructor-led WBTechT study or follow-up for Microsoft applications : 19.2.2004 (morning) LabVIEW TestStand I (E) : 23 & 24.2.2004 (2 days) LabVIEW base 1 : 25 - 27.2.2004 (3 jours) Instructor-led WBTechT study or follow-up for Microsoft applications : 19.2.2004 (morning) CLEAN-2002 ...

  7. Technical Training: Places available

    CERN Multimedia

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: AutoCAD 2002 - niveau 1 : 19, 20.4 et 3, 4.5.2004 (4 jours) Oracle 8i/9i - Develop Web-based Applications with PL/SQL : 19 & 20.4.2004 (2 days) Introduction to ANSYS : 20 - 23.4.2004 (4 days) LabVIEW Hands-on : 20.4.2004 (half-day, p.m.) FrontPage XP - niveau 2 : 26 & 27.4.2004 (2 jours) The Joint PVSS JCOP Framework : 26 -...

  8. Technical Training: Places available**

    CERN Multimedia

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1 : 9 & 10.1.2004 (2 days) LabVIEW TestStand I (E) : 23 & 24.2.2004 (2 days) LabVIEW base 1 : 25 - 27.2.2004 (3 jours) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Particle Physicists : 8 - 12.3.2004 ( 6 X 4-hour sessions) LabVIEW hands-on (E) 16.3...

  9. Technical Training: Places available

    CERN Document Server

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Instructor-led WBTechT study or follow-up for Microsoft applications : 19.2.2004 (morning) LabVIEW TestStand I (E) : 23 & 24.2.2004 (2 days) LabVIEW base 1 : 25 - 27.2.2004 (3 jours) Instructor-led WBTechT study or follow-up for Microsoft applications : 26.2.2004 (morning) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Pa...

  10. Technical Training: Places available

    CERN Document Server

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval - Tel.74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Word 2003 - niveau 2 : 24 & 25.5.2004 (2 jours) VisualEliteHDL : 25 & 26.5.2004 (2 days) EXCEL 2003 - niveau 1 : 27 & 28.5.2004 (2 jours) STEP7 Programming Level 1: 1 - 4.6.2004 (4 days) Oracle 9i : Programming with PL/SQL: 2 - 4.6.2004 (3 days) CST Microwave Studio: 3 & 4.6.2004 (2 days) Oracle 9...

  11. Technical Training: Places Available

    CERN Document Server

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval - Tel.74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Oracle 9i: SQL: 17 - 19.5.2004 (3 days) Word 2003 - niveau 2 : 24 & 25.5.2004 (2 jours) EXCEL 2003 - niveau 1 : 27 & 28.5.2004 (2 jours) STEP7 Programming Level 1: 1 - 4.6.2004 (4 days) Oracle 9i : Programming with PL/SQL: 2 - 4.6.2004 (3 days) CST Microwave Studio: 3 & 4.6.2004 (2 days) Oracle 9i : New f...

  12. Technical Training: Places available

    CERN Multimedia

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: FrontPage XP - niveau 2 : 26 & 27.4.2004 (2 jours) The Joint PVSS JCOP Framework : 26 - 30.4.2004 (5 days) Computational Electromagnetics with the ELEKTRA Module of OPERA-3D : 27 & 28.4.2004 (2 days) Hands-on Introduction to Python Programming : 3 - 5.5.2004 (3 days) LabVIEW Base 2 : 6 & 7.5.2004 (2 jours) Project Pla...

  13. TECHNICAL TRAINING: Places available**

    CERN Document Server

    2003-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Hands-on Introduction to Python Programming : 12 - 14.11.03(3 days) ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) C++ for Particle Physicists : 17 - 21.11.03 (6 X 3-hour lectures) Programmation automate Schneider TSX Premium - niveau 2 : 18 - 21.11.03 (4 jours) Project Planning with MS-Project  (free of charg...

  14. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Hands-on Introduction to Python Programming: 1 - 3.9.2004 (3 days - free course) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.9.2004 (4 jours) Programmation STEP7 niveau 1 : 14-17.9.2004 (4 jours) FrontPage 2003 - niveau 1 : 20 & 21.9.2004 (2 jours) Word 2003 - niveau 2 : 27 & 28.9.2004 (2 jours) Introduction à Wind...

  15. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 technical.training@cern.ch The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: C++ for Particle Physicists : 8 - 12.3.2004 (6 X 4-hour sessions) Introduction to the CERN EDMS : 9.3.2004 (1 day, free of charge) The EDMS MTF in Practice : 10.3.2004 (morning, free of charge) CLEAN-2002: Working in a Cleanroom : 10.3.2004 (afternoon, free of charge) The CERN EDMS for Engineers : 11.3.2004 (1 day, free of charge) LabVIEW hands-on (E):...

  16. Technical Training: Places available

    CERN Document Server

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Oracle 9i : New features for developers : 14 - 16.6.2004 (3 days) The Joint PVSS JCOP Framework: 14 - 18.6.2004 (5 days) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 15 & 16.6.2004 (2 jours) EXCEL 2003 - niveau 2 : 17 & 18.6.2004 (2 jours) MAGNE-04 : Magnétisme pour l'électrotechnique : 6 au 8.7.2004 (3 jours) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.09.2004 (4 jours) ENSEIGNEMEN...

  17. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Introduction to the CERN EDMS : 22.6.2004 (1 day) The CERN EDMS for local administrators : 23 & 24.6.2004 (2 days) Compatibilité électromagnétique (CEM) - Introduction / Electromagnetic Compatibility (EMC) - Introduction: 7.7.2004 (morning) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.9.2004 (4 jours) Programmation STEP...

  18. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: http://www.cern.ch/Training/ or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Joint PVSS JCOP Framework : 9 - 13.8.2004 (5 days) Introduction à Outlook : 19.8.2004 (1 jour) Outlook (Short Course I): E-mail: 31.8.2004 (2 hours, morning) Outlook (Short Course II): Calendar, Tasks and Notes: 31.8.2004 (2 hours, afternoon) Hands-on Introduction to Python Programming: 1 - 3.9.2004 (3 days - free course) Instructor-led WBTechT Study or Follow-up for Microsoft Applications: 7.9.20...

  19. TECHNICAL TRAINING: PLACES AVAILABLE

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW Basics 1 : 22 - 24.3.2004 (3 days) Oracle 9i : New Features for Developers : 22 - 24.3.2004 (3 days) Instructor-led WBTechT study or follow-up for Microsoft applications : 1.4.2004 (morning) FrontPage XP - niveau 1 : 5 & 6.4.2004 (2 jours) AutoCAD 2002 - niveau 1 : 19, 20.4 et 3, 4.5.2004 (4 jours) Oracle 8i/9i - Develop Web-based Applications with PL/SQL : 19 & 20.4.2004 (2 days) Introduction to ANSYS : 20 - 23.4.2004 (4 days) LabVIEW hands-on (E) : 20.4.2004 (afternoon, free of charge) FrontPage XP - niveau 2 : 26 & 27.4.2004 (2 jours) LabVIEW Base 2 : 6 & 7.5.2004 (2 jours) Word XP - niveau 1 : 10 & 11.5.2004 (2 jours) Word XP - niveau 2 : 24 & 25.5.2004 (2 jours) If you wish to participate in one of these courses, pleas...

  20. THE PLACES FOR PARTICIPATION

    Directory of Open Access Journals (Sweden)

    Tania Carson

    2007-09-01

    Full Text Available The current upsurge of interest in street art with its direct approach to the city emphasizes the need to readdress public arts’ role within the wider social and cultural context. As it becomes routine to incorporate art works into city planning and city life, art has become both ‘safe’ and ‘user‐friendly’. On the one hand, art is subsumed and immersed into the wider culture through leisure and entertainment policies, socially engaged public art projects, community art and urban design. On the other hand, there are those works which deliberately intend to unsettle or confront the viewer. In recent years the term intervention has been ascribed to unorthodox art works in the public sphere which are often illicit, or at least non‐complicit in the prevailing hegemony. These practices are disruptive due to their enactment outside traditional art spaces, often in the streets. By occupying the streets, places of democracy and disjunction, these interventions transform public space back into a place of overt cultural and political expression. They also deliberately involve the inhabitants of the city by utilizing everyday spaces in ways which offer an unmediated sense of the artwork.

  1. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW base 1/basics 1 : 31.1 - 2.2.2005 (3 jours/3 days - langue à décider/language to be decided) LabVIEW base 2/basics 2 : 3 & 4.2.2005 (2 jours/2 days - langue à décider/language to be decided) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9.2.2005 (3 days) C++ Programming Advanced -Traps and Pitfalls: 8 - 11.2.2005 (4 days) Joint PVSS JCOP Framework: 14 - 18.2.2005 (5 days) JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) FrontPage 2003 - niveau 1 : 21 & 22.2.2005 (2 jours) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology...

  2. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2005-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: The CERN EDMS for Local Administrators: 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (9 demi-journées) LabVIEW base 1/basics 1 : 31.1 - 2.2.2005 (3 jours/3 days - langue à décider/language to be decided) LabVIEW base 2/basics 2 : 3 & 4.2.2005 (2 jours/2 days - langue à décider/language to be decided) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9.2.2005 (3 days) C++ Programming Advanced -Traps and Pitfalls: 8 - 11.2.2005 (4 days) Joint PVSS JCOP Framework: 14 - 18.2.2005 (5 days) JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) ELEC-2005 â...

  3. Technical training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) Word 2003 - niveau 1 : 22 & 23.11.2004 (2 jours) Introduction à ANSYS : 23 - 26.11.2004 (4 jours) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) Introduction to PERL 5 : 8 & 9.12.2004 (2 days) Advanced aspects of PERL 5 : 10.12.2004 (1 day) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction...

  4. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Excel 2003 - niveau 1 : 4 & 5.11.2004 (2 jours) LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) FrontPage 2003 - niveau 2 : 18 & 19.11.2004 (2 jours) Word 2003 - niveau 1 : 22 &a...

  5. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) Word 2003 - niveau 1 : 22 & 23.11.2004 (2 jours) Introduction à ANSYS : 23 - 26.11.2004 (4 jours) CLEAN-2002 - Travailler en salle propre : 23.11.2004 (après-midi, cours gratuit) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) PCAD Sch&eac...

  6. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: FileMaker - niveau 1 : 18 & 19.10.2004 (2 jours) Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Excel 2003 - niveau 1 : 4 & 5.11.2004 (2 jours) LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) FrontPage 2003 - niveau 2 : 18 &a...

  7. Technical Training: Places available

    CERN Multimedia

    Monique Duval

    2004-01-01

    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) Word 2003 - niveau 1 : 22 & 23.11.2004 (2 jours) Introduction à ANSYS : 23 - 26.11.2004 (4 jours) CLEAN-2002 - Travailler en salle propre : 23.11.2004 (après-midi, cours gratuit) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) ENSEIGNEMENT ...

  8. In-place HEPA filter penetration test

    International Nuclear Information System (INIS)

    Bergman, W.; Wilson, K.; Elliott, J.; Bettencourt, B.; Slawski, J.W.

    1997-01-01

    We have demonstrated the feasibility of conducting penetration tests on high efficiency particulate air (HEPA) filters as installed in nuclear ventilation systems. The in-place penetration test, which is designed to yield equivalent penetration measurements as the standard DOP efficiency test, is based on measuring the aerosol penetration of the filter installation as a function of particle size using a portable laser particle counter. This in-place penetration test is compared to the current in-place leak test using light scattering photometers for single HEPA filter installations and for HEPA filter plenums using the shroud method. Test results show the in-place penetration test is more sensitive than the in-place leak test, has a similar operating procedure, but takes longer to conduct. Additional tests are required to confirm that the in-place penetration test yields identical results as the standard dioctyl phthalate (DOP) penetration test for HEPA filters with controlled leaks in the filter and gasket and duct by-pass leaks. Further development of the procedure is also required to reduce the test time before the in- place penetration test is practical

  9. Take the "C" Train

    Science.gov (United States)

    Lawton, Rebecca

    2008-01-01

    In this essay, the author recalls several of her experiences in which she successfully pulled her boats out of river holes by throwing herself to the water as a sea-anchor. She learned this trick from her senior guides at a spring training. Her guides told her, "When you're stuck in a hole, take the "C" train."" "Meaning?" The author asked her…

  10. Social Perspective Taking

    Science.gov (United States)

    2009-09-01

    having testicular cancer , they can and do attempt the perspective taking leap (Halpern, 2001). Individuals can strive to know themselves better by...science, social science, psychology , and anthropological literature in the areas of education, medicine, and cross-cultural interactions. 2. Identify...experts in the fields of social psychology , intercultural research, and medicine in order to determine the critical KSAs to be included in a training

  11. Healthy Places for Healthy People

    Science.gov (United States)

    Describes the Healthy Places for Healthy People technical assistance program that helps communities create walkable, healthy, economically vibrant places by engaging with local health care facility partners

  12. MANAGING TIGHT BINDING RECEPTORS FOR NEW SPEARATIONS TECHNOLOGIES

    Energy Technology Data Exchange (ETDEWEB)

    DARYLE H BUSCH RICHARD S GIVENS

    2004-12-10

    Much of the earth's pollution involves compounds of the metallic elements, including actinides, strontium, cesium, technetium, and RCRA metals. Metal ions bind to molecules called ligands, which are the molecular tools that can manipulate the metal ions under most conditions. This DOE-EMSP sponsored program strives (1) to provide the foundations for using the most powerful ligands in transformational separations technologies and (2) to produce seminal examples of their applications to separations appropriate to the DOE EM mission. These ultra tight-binding ligands can capture metal ions in the most competitive of circumstances (from mineralized sites, lesser ligands, and even extremely dilute solutions), but they react so slowly that they are useless in traditional separations methodologies. Two attacks on this problem are underway. The first accommodates to the challenging molecular lethargy by developing a seminal slow separations methodology termed the soil poultice. The second designs ligands that are only tight-binding while wrapped around the targeted metal ion, but can be put in place by switch-binding and removed by switch-release. We envision a kind of molecular switching process to accelerate the union between metal ion and tight-binding ligand. Molecular switching processes are suggested for overcoming the slow natural equilibration rate with which ultra tight-binding ligands combine with metal ions. Ligands that bind relatively weakly combine with metal ions rapidly, so the trick is to convert a ligand from a weak, rapidly binding species to a powerful, slow releasing ligand--during the binding of the ligand to the metal ion. Such switch-binding ligands must react with themselves, and the reaction must take place under the influence of the metal ion. For example, our generation 1 ligands showed that a well-designed linear ligand with ends that readily combine, forms a cyclic molecule when it wraps around a metal ion. Our generation 2 ligands are

  13. Strangers in Familiar Places

    DEFF Research Database (Denmark)

    Muhr, Sara Louise

    2012-01-01

    Employees working across multiple cultures are exposed to a vast number of different norms and values, and consequentially work is often a struggle to retain a coherent sense of self. However, when international workers travel, they also encounter more bland spaces where familiarity and similarity...... are important. These spaces appear culturally generic to the Western traveler, but are highly Westernized to bring comfort to Western employees traveling in foreign cultures. This paper argues that these spaces are important in cross-cultural identity work in the sense that international workers – professional...... strangers – need these places to belong and relate to familiarity and to regain a sense of identity. Drawing on an illustrative empirical vignette of an international consultant, I demonstrate how culturally generic spaces can be used in identity work of an international relations consultant....

  14. Pushing Personhood into Place

    DEFF Research Database (Denmark)

    Bidwell, Nicola J.; Winschiers-Theophilus, Heike; Kapuire, Gereon K.

    2011-01-01

    - recorded video and participants' interpretations and interactions with thumbnail photos from video, photography and writing materials. These themes use some classical anthropological 'tropes' and describe verbal and bodily interactions, relationships between bodies, artifacts and settings and concepts...... for generations; but technology-use can inadvertently displace knowledge for communities with knowledge traditions that differ from those of technology-design. Devices which are sensitive to users' locations, combined with platforms for social networking and user-generated-content, offer intriguing opportunities...... about personhood, community and place. We adopt a critical attitude towards assumptions about spatial, temporal and social logics and literacies to promote a design sensitivity to local experiences of locations. This motivates us to emphasize connections, not points, and the bodily absorption...

  15. Technical Training - Places available

    CERN Multimedia

    Monique Duval

    2003-01-01

    Places are available in the following courses: HeREF-2003 : Techniques de la réfrigération Hélium :  6 - 10.10.2003  (7 demi-journées, cours en français avec support en anglais)  The Java Programming Language Level 1:  6 - 7.10.2003  (2 days) Java 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 8 - 10.10.2003  (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 :  20 & 22.10.03  (2 jours) AutoCAD 2002 - niveau 1 :  20, 21, 27, 28.10.03  (4 jours) CLEAN-2002 : Working in a Cleanroom: 23.10.03  (half day, free of charge) Plannification de projet avec MS-Project/ Project Scheduling with MS-Project : 2 sessions:  23.10 & 4.11.03  (2 jours/2 days and 18 &25.11.03 langue à définir/language to be defined) AutoCAD 2002 - Level 1:  3, 4, 12, 13.11.03  (4 days) Introduction to Pspice:  4.11.03p.m.  (half-day) AutoCAD 2002 - niveau 2 :  10 & 11.11.03  (2 jours) ACCESS 2000 - niveau 1 :  13 & 14.11.03  (2 jours) A...

  16. Using Critical Path Analysis (CPA) in Place Marketing process

    OpenAIRE

    Metaxas, Theodore; Deffner, Alex

    2013-01-01

    The article awards the use of CPA as a methodological tool in Place Marketing implementation. Taking into account that Place Marketing is a strategic process based on ‘project’ meaning with particular actions in specific time horizon, the article proposed that CPΑ has the capacity to satisfy this hypothesis. For this reason, the article creates a hypothetical scenario of CPA in four phases, planning, programming, implementation and feedback, taking as a case study the city of Rostock in Germa...

  17. Observation of long-range tertiary interactions during ligand binding by the TPP riboswitch aptamer.

    Science.gov (United States)

    Duesterberg, Van K; Fischer-Hwang, Irena T; Perez, Christian F; Hogan, Daniel W; Block, Steven M

    2015-12-28

    The thiamine pyrophosphate (TPP) riboswitch is a cis-regulatory element in mRNA that modifies gene expression in response to TPP concentration. Its specificity is dependent upon conformational changes that take place within its aptamer domain. Here, the role of tertiary interactions in ligand binding was studied at the single-molecule level by combined force spectroscopy and Förster resonance energy transfer (smFRET), using an optical trap equipped for simultaneous smFRET. The 'Force-FRET' approach directly probes secondary and tertiary structural changes during folding, including events associated with binding. Concurrent transitions observed in smFRET signals and RNA extension revealed differences in helix-arm orientation between two previously-identified ligand-binding states that had been undetectable by spectroscopy alone. Our results show that the weaker binding state is able to bind to TPP, but is unable to form a tertiary docking interaction that completes the binding process. Long-range tertiary interactions stabilize global riboswitch structure and confer increased ligand specificity.

  18. Taking action against violence.

    Science.gov (United States)

    Kunz, K

    1996-05-01

    Significant increase in violent crimes in recent years forced Icelandic men to take action against violence. Television was seen as a major contributory factor in increasing violence. Surveys indicate that 10-15 years after television broadcasting commences in a particular society, the incidence of crime can be expected to double. While the majority of the individuals arrested for violent crimes are men, being male does not necessarily mean being violent. The Men's Committee of the Icelandic Equal Rights Council initiated a week-long information and education campaign under the theme "Men Against Violence". This campaign involved several events including an art exhibit, speeches on violence in families, treatment sought by those who are likely to resort to violence, booklet distribution among students in secondary schools, and a mass media campaign to raise public awareness on this pressing problem.

  19. Taking Design Games Seriously

    DEFF Research Database (Denmark)

    Eriksen, Mette Agger; Brandt, Eva; Mattelmäki, Tuuli

    2014-01-01

    Using design games at Participatory Design (PD) events is well acknowledged as a fruitful way of staging participation. As PD researchers, we have many such experiences, and we have argued that design games connect participants and promote equalizing power relations. However, in this paper, we...... will (self) critically re-connect and reflect on how people (humans) and materials (non-humans) continually participate and intertwine in various power relations in design game situations. The analysis is of detailed situated actions with one of our recent games, UrbanTransition. Core concepts mainly from...... Bruno Latour’s work on Actor-Network-Theory are applied. The aim is to take design games seriously by e.g. exploring how assemblages of humans and non-humans are intertwined in tacitly-but-tactically staging participation, and opening up for or hindering negotiations and decision-making, thus starting...

  20. Taking a Long View

    DEFF Research Database (Denmark)

    Ougaard, Morten

    The purpose of this paper is to discuss capitalism’s long-term prospects. To some extent I draw on material and arguments I have presented elsewhere (Ougaard, 2014; Ougaard, 2015a; Ougaard, 2015b); the present intention is to bring these elements together and combine them with other material...... to elaborate an argument about capitalism’s long term devel-opmental potential. On some points the argument resembles recent gloomy diagnoses for-warded by Wolfgang Streeck (Streeck, 2014a; Streeck, 2014b) and Andrew Gamble (Gamble, 2014), but is also offers an alternative to their interpretations by taking...... factors (CFs). The next step is, drawing on regulation theory, to relate the mobilization of such CFs to the successive stages of capitalist development after World War Two, up to the present crisis, and after this, in the final two sections I discuss the potential for mobilizing ‘surplus labour...

  1. Place attachment, place identity and aesthetic appraisal of urban landscape

    Directory of Open Access Journals (Sweden)

    Jaśkiewicz Michał

    2015-12-01

    Full Text Available As the aesthetic of the Polish cities became a topic of wider discussions, it is important to detect the potential role of human-place relations. Two studies (N = 185 & N = 196 were conducted to explore the relationship between place attachment, place identity and appraisal of urban landscape. Satisfaction with urban aesthetic was predicted by two dimensions of place attachment (place inherited and place discovered, local identity (on the trend level and national-conservative identity. Place discovered and European identity were also predictors of visual pollution sensitivity. Place discovered is considered as more active type of attachment that permits both a positive bias concerning the aesthetics of one’s city, and a stronger criticism of the elements that can potentially violate the place’s landscape.

  2. Introduction to Interregional Place Branding

    DEFF Research Database (Denmark)

    Zenker, Sebastian; Jacobsen, Björn P.

    2015-01-01

    Place branding is an inherently difficult venture, since places are complex systems of geographical abstractions, each one understood in relation and contrast to other geographical entities. Even at the smallest size – a district, town, or city – a place is quite complex, but it becomes even more...... with a high degree of complexity. In this chapter, we will define the place brand and examine different concepts to understand branding as they relate to places. In a next step, we will highlight the special character of interregional place branding. Finally, we will apply these concepts to a particular...

  3. Hijacking culture : The disconnection between place culture and place brands

    NARCIS (Netherlands)

    Kavaratzis, Mihalis; Ashworth, Gregory

    2015-01-01

    This article argues that the dominant understanding of culture within place branding is inadequate and leads to disconnection between local culture and the place brand. The article discusses significant tensions arising from an evident oversimplification of the relationship between place brands and

  4. Place branding, embeddedness and endogenous rural development : Four European cases

    NARCIS (Netherlands)

    Donner, Mechthild; Horlings, Lummina; Fort, Fatiha; Vellema, Sietze

    2017-01-01

    This article deals with place branding on the regional scale, in the rural context of food and tourism networks in Europe. Place branding is linked to the concepts of endogenous rural development, territory and embeddedness, by analysing how the valorisation of specific rural assets takes shape. The

  5. Decision taking as a service

    NARCIS (Netherlands)

    Bergstra, J.A.

    2012-01-01

    Decision taking can be performed as a service to other parties and it is amenable to outtasking rather than to outsourcing. Outtasking decision taking is compatible with selfsourcing of decision making activities carried out in preparation of decision taking. Decision taking as a service (DTaaS) is

  6. Taking the plunge

    CERN Multimedia

    2008-01-01

    On 8 and 15 October, 58 people took the plunge and headed to the Varembé swimming pool in Geneva for their first taste of scuba diving at one of the CERN scuba club’s free trial dives. Club president Alberto Pace, left, taking a new recruit on his first dive. The CERN scuba club was making waves down at the Varembe swimming pool on Wednesday 15 October. Thirty-six people turned up to the club’s second free trial dive. "It was fantastic," said Jörg, one of the new recruits, after his first ever dive. "I’ve always wanted to try diving and this was a free lesson, so I thought I would come and have a go." Fourteen of the club’s fully qualified instructors were there to give one-on-one tuition. After a first dive in the normal pool the new divers moved into the deep pool. Some took to the water like fish, and at one point an impromptu game of aqua-Frisbee broke out, five metres below the surface. Richard Catherall, who organi...

  7. Sense of place and place identity: review of neuroscientific evidence.

    Science.gov (United States)

    Lengen, Charis; Kistemann, Thomas

    2012-09-01

    The aim of this review is to bring the phenomenological sense of place approach together with current results from neuroscience. We searched in neuroscientific literature for ten dimensions which were beforehand identified to be important in a phenomenological sense of place/place identity model: behaviour, body, emotion, attention, perception, memory, orientation, spirituality, meaning/value and culture/sociality. Neuroscience has identified many neurobiological correlates of phenomenological observations concerning sense of place. The human brain comprises specific and specialised structures and processes to perceive, memorise, link, assess and use spatial information. Specific parts (hippocampus, entorhinal, parahippocampal and parietal cortex), subregions (parahippocampal place area, lingual landmark area), and cells (place cells, grid cells, border cells, head direction cells) have been identified, their specific function could be understood and their interaction traced. Neuroscience has provided evidence that place constitutes a distinct dimension in neuronal processing. This reinforces the phenomenological argumentation of human geography and environmental psychology. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Why It Takes Prevention, Not Detection, to Fight Bioterrorism

    Science.gov (United States)

    Janata, Jiri (Art)

    2005-01-01

    Following the events which took place on September 11, 2001, and the anthrax attacks which occurred after that date, US authorities became concerned with the idea that an assault with chemical or biological weapons could take place on American territory or in American ships or planes. A worrisome model for such an assault was the 1995 terrorist…

  9. Mechanism of uranium binding to cellular components of microorganisms. II

    International Nuclear Information System (INIS)

    Jilek, R.; Beranova, E.

    1986-01-01

    Knowledge is summed up of the mechanism of inhibition of carbohydrate metabolism by uranyl ions in yeast and bacteria. The inhibition was found of anaerobic fermentation of glucose by undisturbed yeast cells and by cell-free extract to take place at different uranyl concentrations. The course of time dependence of uranium intake by live yeast cells showed that this process is not controlled by diffusion. It is based on complex binding of uranyl to the cell surface. A more detailed study of the process has shown that even with full saturation of the cell surface with uranyl ions the anaerobic metabolism is only inhibited to 90%, the remaining 10% of the metabolism is apparently provided by a different mechanism. Other centres were discovered on the surface of the yeast cell which do not take part in the anaerobic intake of glucose but form complexes with the uranyl. Mg 2+ , Ca 2+ , Ba 2+ , Mn 2+ , Cu 2+ , Ni 2+ , Co 2+ , Fe 2+ and other bivalent cations can compete with uranyl binding to active cell centres. The most stable complex, however, is formed by the uranyl ion. A more detailed clarification of the chemical character of active centres of the cell surface was made by comparative studies of the stability of the uranyl complex with yeast cells and similar complexes of model compounds. The most stable complex bonds were found to exist in highly polymerated inorganic phosphates. (E.S.)

  10. 36 CFR 242.27 - Subsistence taking of fish.

    Science.gov (United States)

    2010-07-01

    ... of the pot. The twine may be knotted only at each end and at the attachment points on the galvanic..., species, or place of taking if necessary for conservation purposes); (iii) Each person who takes fish... the previous 5 years. A qualifying program must have instructors, enrolled students, minimum...

  11. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  12. Reframing place promotion, place marketing, and place branding - moving beyond conceptual confusion

    NARCIS (Netherlands)

    Boisen, Martin; Terlouw, Kees; Groote, Peter; Couwenberg, Oscar

    2017-01-01

    The literature and practice of place promotion, place marketing and place branding lack a common understanding of what these three concepts mean and through what kind of policies they can be implemented. Although scholars have provided several theoretical frameworks and definitions, both scholars

  13. Decision Taking versus Promise Issuing

    NARCIS (Netherlands)

    Bergstra, J.A.

    2013-01-01

    An alignment is developed between the terminology of outcome oriented decision taking and a terminology for promise issuing. Differences and correspondences are investigated between the concepts of decision and promise. For decision taking, two forms are distinguished: the external outcome

  14. Taking Care of Pressure Sores

    Science.gov (United States)

    ... Tract Infections: Indwelling (Foley) Catheter Taking Care of Pressure Sores [Download this pamphlet: "Taking Care of Pressure ... may not show up right away. Stages of pressure sores and how to care for them: STAGE ...

  15. Census 2000 Places (cen00pl02)

    Data.gov (United States)

    California Department of Resources — Census 2000 Place Names provides a seamless statewide GIS layer of places, including census designated places (CDP), consolidated cities, and incorporated places,...

  16. Adjusting to New Places: International Student Adjustment and Place Attachment

    Science.gov (United States)

    Terrazas-Carrillo, Elizabeth C.; Hong, Ji Y.; Pace, Terry M.

    2014-01-01

    Using data obtained from in-depth semistructured interviews, we examined international students' attachments to place in the local American Midwestern community where they have attended college for at least 2 years. The results of this study suggest that participants engage in a process of renegotiation of meanings attached to new places in ways…

  17. Dissecting the role of the ϕ29 terminal protein DNA binding residues in viral DNA replication.

    Science.gov (United States)

    Holguera, Isabel; Muñoz-Espín, Daniel; Salas, Margarita

    2015-03-11

    Phage ϕ29 DNA replication takes place by a protein-priming mechanism in which the viral DNA polymerase catalyses the covalent linkage of the initiating nucleotide to a specific serine residue of the terminal protein (TP). The N-terminal domain of the ϕ29 TP has been shown to bind to the host DNA in a sequence-independent manner and this binding is essential for the TP nucleoid localisation and for an efficient viral DNA replication in vivo. In the present work we have studied the involvement of the TP N-terminal domain residues responsible for DNA binding in the different stages of viral DNA replication by assaying the in vitro activity of purified TP N-terminal mutant proteins. The results show that mutation of TP residues involved in DNA binding affects the catalytic activity of the DNA polymerase in initiation, as the Km for the initiating nucleotide is increased when these mutant proteins are used as primers. Importantly, this initiation defect was relieved by using the ϕ29 double-stranded DNA binding protein p6 in the reaction, which decreased the Km of the DNA polymerase for dATP about 130-190 fold. Furthermore, the TP N-terminal domain was shown to be required both for a proper interaction with the DNA polymerase and for an efficient viral DNA amplification. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Thallium-201: Autoradiography in pigmented mice and melanin-binding in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Tjaelve, H.; Nilsson, M.; Larsson, B. (Uppsala Univ. (Sweden))

    1982-01-01

    Autoradiography with /sup 201/Tl/sup +/ in C57Bl mice showed a strong labelling of the eye melanin and of pigmented hair follicles. An analysis of the affinity of thallium for pigment from cow eyes indicated a binding to three groups of sites and showed a marked sensitivity to the addition of H/sup +/-ions. The results are consistent with the conception that a binding of thallium occurs to the free carboxyl groups of the melanin and that the structure of the polymer has a marked influence on the affinity. Similar results have previously been obtained with other cations. There was no indication that the strong in vivo affinity of thallium to melanin is due to a more firm binding than for other cations which do not localize on melanin in vivo. Instead, the ability of cations to pass the melanocyte membranes and reach the melanin granules is probably decisive for whether a melanin-binding will take place in vivo. Toxic effects on the eye and epilation are symptoms of thallium intoxication which may be related to its melanin-binding. The fate of /sup 201/Tl/sup +/ in some other tissues is also described and discussed.

  19. Attachments to the common-place

    DEFF Research Database (Denmark)

    Blok, Anders

    2015-01-01

    on Thévenot's notion of ‘commonality in the plural’, the article shows how a range of personal affinities to the architectural form of the kyō-machiya, positioned as an urban ‘common-place’, serves to coordinate across otherwise divergent interests. By taking seriously the role of attachments to common-places...... change. To understand the dynamic interplay of architecture and community-building in this case, the article stages a theoretical debate on the politics of shared attachments between three proponents of French pragmatic sociology: Bruno Latour, Antoine Hennion, and Laurent Thévenot. Drawing in particular...

  20. FTIR spectroscopy of flavin-binding photoreceptors.

    Science.gov (United States)

    Yamada, Daichi; Kandori, Hideki

    2014-01-01

    Light-induced difference Fourier transform infrared (FTIR) spectroscopy is a powerful, sensitive, and informative method to study structure-function relationships in photoreceptive proteins. Strong absorption of water in the IR region is always problematic in this method, but if water content in the sample is controlled during measurements, this method can provide useful information on a single protein-bound water molecule. We established three kinds of sample preparations: hydrated film, redissolved sample, and concentrated solution. Hydrated films were used for the measurements of LOV and BLUF domains, where accurate difference FTIR spectra were obtained in the whole mid-IR region (4,000-800 cm(-1)). Vibrations of S-H stretch of cysteine, O-H stretch of water, and O-H stretch of tyrosine provide important information on hydrogen bonds in these proteins. Redissolved samples were used for the measurements of (6-4) photolyase, in which enzymatic turnover takes place. From the illumination time-dependence of excess amount of substrate, it is possible to isolate the signal originating from the binding of enzyme to substrate. If proteins are less tolerant to drying, as for example cryptochromes of the DASH type, concentrated solution is used. Detailed methodological aspects in light-induced difference FTIR spectroscopy are reviewed by mainly focusing on our results.

  1. Mapping and measuring place attachment

    DEFF Research Database (Denmark)

    Brown, Greg; Raymond, Christopher Mark; Corcoran, Jonathan

    2015-01-01

    The concept of place attachment has been studied extensively across multiple disciplines but only recently with empirical measurement using public participation GIS (PPGIS) and related crowd-sourcing mapping methods. This research trialed a spatially explicit method for identifying place attachment...

  2. Place prioritization for biodiversity content

    Indian Academy of Sciences (India)

    The prioritization of places on the basis of biodiversity content is part of any systematic biodiversity conservation planning process. The place prioritization procedure implemented in the ResNet software package is described. This procedure is primarily based on the principles of rarity and complementarity. Application of the ...

  3. What Place Are You In?

    Science.gov (United States)

    Leary, Barbara Buckett

    1984-01-01

    The interaction place map, a mnemonic device which depicts the five most common places in which humans interact, can be used to teach social skills to elementary learning disabled students. Students can plot movement on the map as they move within an interaction. (CL)

  4. Characterization and performances of DOSION, a dosimetry equipment dedicated to radiobiology experiments taking place at GANIL

    Energy Technology Data Exchange (ETDEWEB)

    Boissonnat, Guillaume, E-mail: boissonnat@lpccaen.in2p3.fr [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France); Fontbonne, Jean-Marc [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France); Balanzat, Emmanuel [CIMAP (CEA/DSM-CNRS/INP-ENSICAEN-UNICAEN), Bd Henri Becquerel, 14076 Caen (France); Boumard, Frederic; Carniol, Benjamin [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France); Cassimi, Amine [CIMAP (CEA/DSM-CNRS/INP-ENSICAEN-UNICAEN), Bd Henri Becquerel, 14076 Caen (France); Colin, Jean; Cussol, Daniel; Etasse, David; Fontbonne, Cathy [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France); Frelin, Anne-Marie [GANIL (CEA/DSM-CNRS/IN2P3), Bd Henri Becquerel, 14076 Caen (France); Hommet, Jean; Salvador, Samuel [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France)

    2017-06-01

    Currently, radiobiology experiments using heavy ions at GANIL (Grand Accélérateur National d′Ions Lourds) are conducted under the supervision of the CIMAP (Center for research on Ions, MAterials and Photonics). In this context, a new beam monitoring equipment named DOSION has been developed. It allows to perform measurements of accurate fluence and dose maps in near real time for each biological sample irradiated. In this paper, we present the detection system, its design, performances, calibration protocol and measurements performed during radiobiology experiments. This setup is currently available for any radiobiology experiments if one wishes to correlate one's own sample analysis to state-of-the-art dosimetric references.

  5. Ac hopping conduction at extreme disorder takes place on the percolating cluster

    DEFF Research Database (Denmark)

    Schrøder, Thomas; Dyre, J. C.

    2008-01-01

    Simulations of the random barrier model show that ac currents at extreme disorder are carried almost entirely by the percolating cluster slightly above threshold; thus contributions from isolated low activation-energy clusters are negligible. The effective medium approximation in conjunction...... with the Alexander-Orbach conjecture lead to an excellent analytical fit to the universal ac conductivity with no nontrivial fitting parameters....

  6. Necroptosis takes place in human immunodeficiency virus type-1 (HIV-1-infected CD4+ T lymphocytes.

    Directory of Open Access Journals (Sweden)

    Ting Pan

    Full Text Available Human immunodeficiency virus type 1 (HIV-1 infection is characterized by progressive depletion of CD4+ T lymphocytes and dysfunction of the immune system. The numbers of CD4+ T lymphocytes in the human body are maintained constantly by homeostatic mechanisms that failed during HIV-1 infection, resulting in progressive loss of CD4+ T cells mainly via apoptosis. Recently, a non-apoptotic form of necrotic programmed cell death, named necroptosis, has been investigated in many biological and pathological processes. We then determine whether HIV-1-infected cells also undergo necroptosis. In this report, we demonstrate that HIV-1 not only induces apoptosis, but also mediates necroptosis in the infected primary CD4+ T lymphocytes and CD4+ T-cell lines. Necroptosis-dependent cytopathic effects are significantly increased in HIV-1-infected Jurkat cells that is lack of Fas-associated protein-containing death domain (FADD, indicating that necroptosis occurs as an alternative cell death mechanism in the absence of apoptosis. Unlike apoptosis, necroptosis mainly occurs in HIV-infected cells and spares bystander damage. Treatment with necrostatin-1(Nec-1, a RIP1 inhibitor that specifically blocks the necroptosis pathway, potently restrains HIV-1-induced cytopathic effect and interestingly, inhibits the formation of HIV-induced syncytia in CD4+ T-cell lines. This suggests that syncytia formation is mediated, at least partially, by necroptosis-related processes. Furthermore, we also found that the HIV-1 infection-augmented tumor necrosis factor-alpha (TNF-α plays a key role in inducing necroptosis and HIV-1 Envelope and Tat proteins function as its co-factors. Taken together,necroptosis can function as an alternative cell death pathway in lieu of apoptosis during HIV-1 infection, thereby also contributing to HIV-1-induced cytopathic effects. Our results reveal that in addition to apoptosis, necroptosis also plays an important role in HIV-1-induced pathogenesis.

  7. Mismatch negativity to acoustical illusion of beat: how and where the change detection takes place?

    Science.gov (United States)

    Chakalov, Ivan; Paraskevopoulos, Evangelos; Wollbrink, Andreas; Pantev, Christo

    2014-10-15

    In case of binaural presentation of two tones with slightly different frequencies the structures of brainstem can no longer follow the interaural time differences (ITD) resulting in an illusionary perception of beat corresponding to frequency difference between the two prime tones. Hence, the beat-frequency does not exist in the prime tones presented to either ear. This study used binaural beats to explore the nature of acoustic deviance detection in humans by means of magnetoencephalography (MEG). Recent research suggests that the auditory change detection is a multistage process. To test this, we employed 26 Hz-binaural beats in a classical oddball paradigm. However, the prime tones (250 Hz and 276 Hz) were switched between the ears in the case of the deviant-beat. Consequently, when the deviant is presented, the cochleae and auditory nerves receive a "new afferent", although the standards and the deviants are heard identical (26 Hz-beats). This allowed us to explore the contribution of auditory periphery to change detection process, and furthermore, to evaluate its influence on beats-related auditory steady-state responses (ASSRs). LORETA-source current density estimates of the evoked fields in a typical mismatch negativity time-window (MMN) and the subsequent difference-ASSRs were determined and compared. The results revealed an MMN generated by a complex neural network including the right parietal lobe and the left middle frontal gyrus. Furthermore, difference-ASSR was generated in the paracentral gyrus. Additionally, psychophysical measures showed no perceptual difference between the standard- and deviant-beats when isolated by noise. These results suggest that the auditory periphery has an important contribution to novelty detection already at sub-cortical level. Overall, the present findings support the notion of hierarchically organized acoustic novelty detection system. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Using a Very Big Rocket to take Very Small Satellites to Very Far Places

    Science.gov (United States)

    Cohen, Barbara

    2017-01-01

    Planetary science cubesats are being built. Insight (2018) will carry 2 cubesats to provide communication links to Mars. EM-1 (2019) will carry 13 cubesat-class missions to further smallsat science and exploration capabilities. Planetary science cubesats have more in common with large planetary science missions than LEO cubesats- need to work closely with people who have deep-space mission experience

  9. Concholepas hemocyanin biosynthesis takes place in the hepatopancreas, with hemocytes being involved in its metabolism.

    Science.gov (United States)

    Manubens, Augusto; Salazar, Fabián; Haussmann, Denise; Figueroa, Jaime; Del Campo, Miguel; Pinto, Jonathan Martínez; Huaquín, Laura; Venegas, Alejandro; Becker, María Inés

    2010-12-01

    Hemocyanins are copper-containing glycoproteins in some molluscs and arthropods, and their best-known function is O(2) transport. We studied the site of their biosynthesis in the gastropod Concholepas concholepas by using immunological and molecular genetic approaches. We performed immunohistochemical staining of various organs, including the mantle, branchia, and hepatopancreas, and detected C. concholepas hemocyanin (CCH) molecules in circulating and tissue-associated hemocytes by electron microscopy. To characterize the hemocytes, we purified them from hemolymph. We identified three types of granular cells. The most abundant type was a phagocyte-like cell with small cytoplasmic granules. The second type contained large electron-dense granules. The third type had vacuoles containing hemocyanin molecules suggesting that synthesis or catabolism occurred inside these cells. Our failure to detect cch-mRNA in hemocytes by reverse transcription with the polymerase chain reaction (RT-PCR) led us to propose that hemocytes instead played a role in CCH metabolism. This hypothesis was supported by colloidal gold staining showing hemocyanin molecules in electron-dense granules inside hemocytes. RT-PCR analysis, complemented by in situ hybridization analyses with single-stranded antisense RNAs as specific probes, demonstrated the presence of cch-mRNA in the hepatopancreas; this was consistent with the specific hybridization signal and confirmed the hepatopancreas as the site of CCH synthesis. Finally, we investigated the possibility that CCH catabolism in hemocytes was involved in the host immune response and in the generation of secondary metabolites such as antimicrobial peptides and phenoloxidase.

  10. The Eclipsing Binary Di Herculis: One Mystery Solved, But Another Takes Its Place

    Science.gov (United States)

    Zimmerman, Nicole; Guinan, E.; Maloney, F.

    2010-01-01

    The 8th-mag eclipsing binary DI Herculis has perplexed scientists for the past few decades due to its anomalously slow apsidal motion rate. DI Her consists of two main-sequence stars (B5V, B6V), with P(orb) = 10.55 days, and eccentricity(e= 0.489). Since the apsidal motion is dominated by General Relativity, the system is one of the few tests available for verifying the theory. Combining the expected classical (1.93°/100 yr) and relativistic (2.34°/100 yr) effects, the predicted apsidal motion rate is 4.27°/100 yr. Our recent determination of the apsidal motion yields 1.33°+/-0.25 /100 yr, based on eclipse timings from 1936-2008. Recently, Albrecht et al (2009, Nature 461) have apparently solved the apsidal motion anomaly of DI Her, finding that the axes of both stars are significantly inclined from the normal to the orbital plane. This was determined from the radial velocity curves and observing the Rossiter-McLaughlin effect during primary and secondary eclipses. Having significantly misaligned axes of rotation produces a perturbation that greatly reduces the classical apsidal motion effect, thus explaining the observed small apsidal motion rate. Even though this discovery apparently solves the problem, it raises new questions as to how the axes are so tilted. Additionally, tilted axes are expected to contribute to other orbital effects, such as changes in orbital inclination, which have not yet observed from the apparent constancy in eclipse depths over time. We have also searched for evidence of small periodic oscillations in the eclipse timings and found no evidence of a light travel time effect arising from a possible tertiary component. Further, we find evidence that the projected rotation axes of the stars may be precessing, since it appears that the value of V(rot)sini has increased over the past 30 years. This research was supported by NSF/RUI Grants AST05-07536/42.

  11. Simulations: A Safe Place to Take Risks in Discussing Cultural Differences.

    Science.gov (United States)

    Pedersen, Paul

    1995-01-01

    Describes examples of simulations and strategies for teaching about psychology that were developed in Indonesia and Malaysia to incorporate and address controversies related to cultural differences. A model that simulates the influence of a client's cultural context in counseling is explained, and developing stereotyped synthetic cultures is…

  12. Subsurface nitrate reduction under wetlands takes place in narrow superficial zones

    DEFF Research Database (Denmark)

    dos Santos Ribas, Osmar; Calderer, M.; Marti, Vicens

    2017-01-01

    and the performance of a re-established wetland. Intact soil cores were collected and divided in slices for the determination of Organic Matter (OM) through Loss of Ignition (LOI) as well as Dissolved Organic Carbon (DOC) and NRP spiking nitrate in batch tests. The Nitrate Reduction (NR) was fitted as a pseudo......This study aims to investigate the depth distribution of the Nitrate Reduction Potential (NRP) on a natural and a re-established wetland. The obtained NRP provides a valuable data of the driving factors affecting denitrification, the Dissimilatory Nitrate Reduction to Ammonium (DNRA) process...... with NRP, high amounts of DOC ensured enough quantity and quality of labile OM for NR. Besides, high concentration of LOI but a scarce abundance of DOC failed to drive NR. DNRA was only important in superficial samples with high contents of OM. Lastly, the high NRP of the re-established wetland confirms...

  13. Taking Stock, Placing Orders: A Historiographic Essay on the Business History of the Newspaper.

    Science.gov (United States)

    Smith, Carol; Dyer, Carolyn Stewart

    This historiographic essay discusses and seeks to begin to address the need for a business history of the newspaper. The paper's first section clarifies the terms "business history,""economic history,""political history," and "history of economics," (which the paper suggests have been used interchangeably in…

  14. Last piece of ATLAS takes the plunge

    CERN Document Server

    2008-01-01

    On Friday 29 February the second small wheel was lowered 100 metres underground into the ATLAS cavern in front of a captivated audience. Although called the "small wheels" they are small in name only - each wheel is 9.3 metres in diameter and weighs 100 tonnes including the massive shielding elements. This piece completes ATLAS’ muon spectrometer, which has the ability to accurately track particles to the width of a human hair. The first piece of ATLAS was installed in 2003 and, five years later, this small wheel is the final large piece of the detector to take the subterranean voyage to its final resting place.

  15. Mitotic binding of Esrrb marks key regulatory regions of the pluripotency network.

    Science.gov (United States)

    Festuccia, Nicola; Dubois, Agnès; Vandormael-Pournin, Sandrine; Gallego Tejeda, Elena; Mouren, Adrien; Bessonnard, Sylvain; Mueller, Florian; Proux, Caroline; Cohen-Tannoudji, Michel; Navarro, Pablo

    2016-11-01

    Pluripotent mouse embryonic stem cells maintain their identity throughout virtually infinite cell divisions. This phenomenon, referred to as self-renewal, depends on a network of sequence-specific transcription factors (TFs) and requires daughter cells to accurately reproduce the gene expression pattern of the mother. However, dramatic chromosomal changes take place in mitosis, generally leading to the eviction of TFs from chromatin. Here, we report that Esrrb, a major pluripotency TF, remains bound to key regulatory regions during mitosis. We show that mitotic Esrrb binding is highly dynamic, driven by specific recognition of its DNA-binding motif and is associated with early transcriptional activation of target genes after completion of mitosis. These results indicate that Esrrb may act as a mitotic bookmarking factor, opening another perspective to molecularly understand the role of sequence-specific TFs in the epigenetic control of self-renewal, pluripotency and genome reprogramming.

  16. Main: GT1CONSENSUS [PLACE

    Lifescience Database Archive (English)

    Full Text Available m of GT-1 may be achieved through direct interaction between TFIIA and GT-1; Binding of GT-1-like factors to the PR-1a promoter influ...ences the level of SA-inducible gene expression; GT-1; light; TATA; TFIIA; TBP; HR;

  17. Main: IRO2OS [PLACE

    Lifescience Database Archive (English)

    Full Text Available G-box plus G; Transcription factor OsIRO2 is induced exclusively by Fe deficiency; root; shoot; Fe; iron; Oryza sativa (rice) CACGTGG ... ...IRO2OS S000505 15-September-2006 (last modified) kehi OsIRO2-binding core sequence;

  18. Main: AS1CAMV [PLACE

    Lifescience Database Archive (English)

    Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

  19. Place recognition using batlike sonar.

    Science.gov (United States)

    Vanderelst, Dieter; Steckel, Jan; Boen, Andre; Peremans, Herbert; Holderied, Marc W

    2016-08-02

    Echolocating bats have excellent spatial memory and are able to navigate to salient locations using bio-sonar. Navigating and route-following require animals to recognize places. Currently, it is mostly unknown how bats recognize places using echolocation. In this paper, we propose template based place recognition might underlie sonar-based navigation in bats. Under this hypothesis, bats recognize places by remembering their echo signature - rather than their 3D layout. Using a large body of ensonification data collected in three different habitats, we test the viability of this hypothesis assessing two critical properties of the proposed echo signatures: (1) they can be uniquely classified and (2) they vary continuously across space. Based on the results presented, we conclude that the proposed echo signatures satisfy both criteria. We discuss how these two properties of the echo signatures can support navigation and building a cognitive map.

  20. Strategies for Aging in Place

    Directory of Open Access Journals (Sweden)

    Suzanne Dupuis-Blanchard

    2015-01-01

    Full Text Available For healthy and independent older adults, aging in place can be seen as identical to any other adult living at home. Little is known about how frail seniors, particularly those who speak a minority language, manage the challenges of aging in place. The present qualitative descriptive study explores the strategies that Canadian French-speaking seniors have put in place to counter their loss of independence and promote their ability to stay in their home. Semistructured individual interviews were conducted with 39 older adults and transcribed, followed by content analysis to identify common themes related to study objectives. Six themes emerged in response to strategies described for aging in place. Findings reveal the limited extent to which language issues were perceived as a barrier by participants. In conclusion, the results of this study provide us with fruitful insights to guide community nursing practice, future research, and public policy.

  1. An Austere Place of Refuge

    Czech Academy of Sciences Publication Activity Database

    Feinberg, Joseph Grim

    -, February 15 (2016), s. 1-8 Institutional support: RVO:67985955 Keywords : refugee crisis * neoliberalism * extreme right Subject RIV: AA - Philosophy ; Religion http://www.criticatac.ro/lefteast/an-austere-place-of-refuge/

  2. Upcoming training sessions (up to end October) - Places available

    CERN Multimedia

    2016-01-01

    Please find below a list of training sessions scheduled to take place up to the end of October with places available.   Safety and Language courses are not included here, you will find an up-to-date list in the Training Catalogue. If you need a course which is not featured  in the catalogue, please contact one of the following: your supervisor, your Departmental Training Officer or the relevant learning specialist.  

  3. The Place and Importance of Playgrounds in Child Development

    OpenAIRE

    Merve ÜNAL

    2009-01-01

    Education is an activity that is not restricted to the school areas, sometimes goes beyond the school walls. Similar to schools, various institutions or establishments like playgrounds, libraries, and museums also take place in educational and/or instructional process. Among these places, playgrounds can be regarded as critically important in terms of discharging children’s high energy, positive self (ego) development, exploring skills, self esteem and success of children, and also cognitive...

  4. HOMING PLACE: TOWARDS A PARTICIPATORY, AMBULANT AND CONVERSIVE METHODOLOGY

    OpenAIRE

    Myers, Misha

    2009-01-01

    The practice-as-research project Homing Place proposes a transferable percipient-led methodology of performance and research activated by ambulant and conversive mechanisms as the culmination of this research. The thesis is comprised of a range of activity that represents a moment and way of writing practice. Three artworks that comprise part of the practical component of this thesis--- way from home, Take me to a place and Yodel Rodeo-- each involved participation and contribu...

  5. Communication course – places available

    CERN Multimedia

    2012-01-01

    Please note that there are some places available in the following communication course starting in November. For more information on the course, click on the course title, this will bring you to the training catalogue. You can then sign-up on line. For advice, you can contact Kerstin Fuhrmeister (70896) or kerstin.fuhrmeister@cern.ch Course Next session Duration Language Availability Gestion de temps 22 November 3 days French 8 places  

  6. Marketing research and place image

    Directory of Open Access Journals (Sweden)

    Miroslav Foret

    2006-01-01

    Full Text Available The paper deals with some problems of the image and identity of two towns (Brno and Zlín as well as the whole country (Czech Republic. It starts with theoretical explanation of terms place image, identity and culture and its interrelated influences. Than own empirical marketing research of Brno image is presented and compared with theory of marketing communication, especially with the problems of place identity, unified visual style and logo.

  7. Naturalness and Place in River Rehabilitation

    Directory of Open Access Journals (Sweden)

    Kirstie Fryirs

    2009-06-01

    Full Text Available An authentic approach to river rehabilitation emphasizes concerns for the natural values of a given place. As landscape considerations fashion the physical template upon which biotic associations take place, various geomorphic issues must be addressed in framing rehabilitation activities that strive to improve river health. An open-ended approach to river classification promotes applications that appreciate the values of a given river, rather than pigeonholing reality. As the geomorphic structure of some rivers is naturally simple, promoting heterogeneity as a basis for management may not always be appropriate. Efforts to protect unique attributes of river systems must be balanced with procedures that look after common features. Concerns for ecosystem functionality must relate to the behavioral regime of a given river, remembering that some rivers are inherently sensitive to disturbance. Responses to human disturbance must be viewed in relation to natural variability, recognizing how spatial relationships in a catchment, and responses to past disturbances, fashion the operation of contemporary fluxes. These fluxes, in turn, influence what is achievable in the rehabilitation of a given reach. Given the inherently adjusting and evolutionary nature of river systems, notional endpoints do not provide an appropriate basis upon which to promote concepts of naturalness and place in the rehabilitation process. These themes are drawn together to promote rehabilitation practices that relate to the natural values of each river system, in preference to applications of "cookbook" measures that build upon textbook geomorphology.

  8. Note Taking for Geography Students.

    Science.gov (United States)

    Kneale, Pauline E.

    1998-01-01

    Addresses geography students' questions about why, when, and how to take notes. Outlines a step-by-step process for taking notes from written sources and from class lectures. Discusses what types of notes are appropriate for various types of sources. Suggests some ideas for making notes useful for individual learning styles. (DSK)

  9. Informatics perspectives on decision taking

    NARCIS (Netherlands)

    Bergstra, J.A.

    2011-01-01

    A decision is an act or event of decision taking. Decision making always includes decision taking, the latter not involving significant exchanges with non-deciding agents. A decision outcome is a piece of storable information constituting the result of a decision. Decision outcomes are typed, for

  10. Taking Chances in Romantic Relationships

    Science.gov (United States)

    Elliott, Lindsey; Knox, David

    2016-01-01

    A 64 item Internet questionnaire was completed by 381 undergraduates at a large southeastern university to assess taking chances in romantic relationships. Almost three fourths (72%) self-identified as being a "person willing to take chances in my love relationship." Engaging in unprotected sex, involvement in a "friends with…

  11. Total iron binding capacity

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003489.htm Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  12. Investigation of neohesperidin dihydrochalcone binding to human serum albumin by spectroscopic methods

    Energy Technology Data Exchange (ETDEWEB)

    Bozoğlan, Bahar Kancı; Tunç, Sibel, E-mail: stunc@akdeniz.edu.tr; Duman, Osman, E-mail: osmanduman@akdeniz.edu.tr

    2014-11-15

    In this study, the interaction of human serum albumin (HSA) with neohesperidin dihydrochalcone (NHD) was investigated by UV, fluorescence, synchronous fluorescence and circular dichroism spectroscopic methods. Experimental results confirmed the complex formation between HSA and NHD molecules under physiological conditions. NHD quenched the intrinsic fluorescence spectrum of HSA by static quenching mechanism. The binding constant of this system was calculated as 2.79×10{sup 4} M{sup −1} at 298.15 K. The stability of HSA–NHD complex illustrated a decrease with increasing temperature. The number of binding sites was found to be 1. Thermodynamic parameter values were calculated by using van’t Hoff equation. According to sign and magnitude of thermodynamic parameters (ΔH=−29.22 kJ mol{sup −1} and ΔS=−12.91 J mol{sup −1} K{sup −1}), hydrogen bonding and van der Waals forces were found as the effective interaction forces between HSA and NHD molecules. Synchronous fluorescence and circular dichroism spectroscopic methods proved the alteration of secondary structure of HSA in the presence of NHD. Site marker competitive experiments indicated that the binding of NHD to HSA took place in subdomain IIA region of protein. - Highlights: • Static quenching mechanism is effective in the interaction of HSA with NHD. • Hydrogen bonding and van der Waals forces play an important role in the binding process. • NHD causes a slight change in the conformational structure of HSA. • The binding site of NHD takes place in subdomain IIA region of HSA.

  13. Take Charge. Take the Test. "You Know" PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    2012-03-07

    As part of the Take Charge. Take the Test. campaign, this 60 second PSA encourages African American women to get tested for HIV. Locations for a free HIV test can be found by visiting hivtest.org/takecharge or calling 1-800-CDC-INFO (1-800-232-4636).  Created: 3/7/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/7/2012.

  14. Patterns of place promotion, place marketing and/or place branding in Dutch municipalities

    NARCIS (Netherlands)

    Boisen, Martin; Groote, Peter; Terlouw, Kees; Couwenberg, Oscar

    This paper analyses the different degrees to which place promotion, marketing and branding policies are institutionalised, based on a relatively straightforward and generally applicable methodology in order to stimulate international comparative research in the field. A consensus has emerged over

  15. It takes two to tango: defining an essential second active site in pyridoxal 5'-phosphate synthase.

    Directory of Open Access Journals (Sweden)

    Cyril Moccand

    Full Text Available The prevalent de novo biosynthetic pathway of vitamin B6 involves only two enzymes (Pdx1 and Pdx2 that form an ornate multisubunit complex functioning as a glutamine amidotransferase. The synthase subunit, Pdx1, utilizes ribose 5-phosphate and glyceraldehyde 3-phosphate, as well as ammonia derived from the glutaminase activity of Pdx2 to directly form the cofactor vitamer, pyridoxal 5'-phosphate. Given the fact that a single enzyme performs the majority of the chemistry behind this reaction, a complicated mechanism is anticipated. Recently, the individual steps along the reaction co-ordinate are beginning to be unraveled. In particular, the binding of the pentose substrate and the first steps of the reaction have been elucidated but it is not known if the latter part of the chemistry, involving the triose sugar, takes place in the same or a disparate site. Here, we demonstrate through the use of enzyme assays, enzyme kinetics, and mutagenesis studies that indeed a second site is involved in binding the triose sugar and moreover, is the location of the final vitamin product, pyridoxal 5'-phosphate. Furthermore, we show that product release is triggered by the presence of a PLP-dependent enzyme. Finally, we provide evidence that a single arginine residue of the C terminus of Pdx1 is responsible for coordinating co-operativity in this elaborate protein machinery.

  16. Worst places to practice medicine

    Directory of Open Access Journals (Sweden)

    Robbins RA

    2017-05-01

    Full Text Available No abstract available. Article truncated after 150 words. Medscape periodically publishes a “Best” and “Worst” places to practice medicine (1. We were struck by this year’s list because three of the five worst places to practice medicine are in the Southwest (Table 1. Table 1. Medscape’s “worst” places to practice medicine. 1. New Orleans, Louisiana; 2.\tPhoenix, Arizona; 3. Las Vegas, Nevada; 4. Albuquerque, New Mexico; 5. Tulsa, Oklahoma. While Minneapolis rated the best place to practice, only 2 cities from the Southwest made the top 25 “Best” list-Salt Lake City at 13th and Colorado Springs at 24th. Most of the top 25 are from the Midwest or Northeast. None from California made the best places list and only the only Southern location was Virginia Beach, Virginia. Rankings resulted from the combination of twelve 50-state rankings: medical board actions per doctor; malpractice lawsuits per doctor; office-based primary care physicians per population; physician income; employer-based insurance rate per population …

  17. ENSEIGNEMENT TECHNIQUE TECHNICAL TRAINING Places disponibles*/Places available **

    CERN Document Server

    2003-01-01

    * Etant donné le délai d'impression du Bulletin, ces places peuvent ne plus être disponibles au moment de sa parution. Veuillez consulter notre site Web pour avoir la dernière mise à jour. ** The number of places available may vary. Please check our Web site to find out the current availability. Des places sont disponibles dans les cours suivants : Places are available in the following courses : Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) CLEAN-2002 : Working in a Cleanroom : 23.10.03 (half day, free of charge) Plannification de projet avec MS-Project/Project Scheduling with MS-Project : 2 sessions : 23.10 & 4.11.03 and 18 &25.11.03 (2 jours/2 days - langue à définir/language to be defined) AutoCAD 2002 – Level 1 : 3, 4, 12, 13.11.03 (4 days) Introduction to Pspice : 4.11...

  18. The Path Is Place: Skateboarding, Graffiti and Performances of Place

    Science.gov (United States)

    Ong, Adelina

    2016-01-01

    This article reflects on two performances of place involving graffiti and skateboarding: the first looks at a graffiti intervention by SKL0, an urban artist in Singapore, and the second examines the "Long Live Southbank" ("LLSB") campaign to resist the relocation of Southbank's Undercroft, an appropriated skate space in London.…

  19. Feature binding in the feedback layers of area V2.

    Science.gov (United States)

    Shipp, Stewart; Adams, Daniel L; Moutoussis, Konstantinos; Zeki, Semir

    2009-10-01

    The visual features of an object are processed by multiple, functionally specialized areas of cerebral cortex. When several objects are seen simultaneously, what mechanism preserves the association of features that belong to a single item? We address this question-known as the "binding problem"-by examining combinatorial feature selectivity of neurons in area V2. In recording from anesthetized macaques, we estimate that dual selectivity for chromatic and spatiotemporal attributes is 50% more common (27% vs. 18% sampling frequency) in superficial and deep layer neurons receiving feedback connections from higher areas, compared with layer 4-3 neurons relaying ascending signals. The operation of feedback pathways is thought to mediate attentional modulation of activity that may achieve binding through acting to select one single object for higher representation and filtering out competing objects. We propose that dual-selective neurons perform a "bridging" function, mediating the transfer of feedback-induced bias between feature dimensions. The bias can be propagated through V2 output neurons (of unitary selectivity) to higher levels of specialized processing and so promote selection of the target object's representation among multiple feature maps. The bridging function would thus act to unify the outcome of parallel, object-selective processes taking place along segregated visual pathways.

  20. Without Place, Is It Real?

    Directory of Open Access Journals (Sweden)

    Joseph F Donnermeyer

    2016-09-01

    Full Text Available This article reviews Matthews’ (2014 Realist Criminology as an opportunity to address larger shortcomings within critical criminology, which is the failure to develop an alternative theory of crime and place to the mainstream theories of social disorganisation and collective efficacy. It uses rural criminological work related to violence against women and substance use, production and trafficking to illustrate the importance of place for development of a realist criminology that can consider localised expressions of power and inequality, and the multiplicity of networks and roles by which people can simultaneously be involved in both conforming and deviant/criminal behaviours. The article also suggests that a critical theory of crime and place would be useful to the synthesis and re-interpretation of criminological literature that is either theory-less or lacks a critical perspective.

  1. Should You Take Dietary Supplements?

    Science.gov (United States)

    ... 2013 Print this issue Should You Take Dietary Supplements? A Look at Vitamins, Minerals, Botanicals and More ... Gut in Check Wise Choices Safe Use of Supplements Tell all of your health care providers about ...

  2. Take Care with Pet Reptiles

    Science.gov (United States)

    ... Submit Button Past Emails Take Care with Pet Reptiles and Amphibians Language: English (US) Español (Spanish) Recommend ... pets and disease risks Safe Handling Tips for Reptiles and Amphibians Always wash your hands thoroughly after ...

  3. Taking Action for Healthy Kids.

    Science.gov (United States)

    Kidd, Jill E.

    2003-01-01

    Summarizes research on relationship between physical activity, good nutrition, and academic performance. Offers several recommendations for how schools can take action to improve the nutrition and fitness of students. (PKP)

  4. Informatics perspectives on decision taking

    OpenAIRE

    Bergstra, J.A.

    2011-01-01

    A decision is an act or event of decision taking. Decision making always includes decision taking, the latter not involving significant exchanges with non-deciding agents. A decision outcome is a piece of storable information constituting the result of a decision. Decision outcomes are typed, for instance: plan, command, assertion, or boolean reply to a question. A decision effect is any consequence of putting a decision outcome into effect. Decision outcomes must be expected by the decider t...

  5. Places available - Technical training (up to the end of 2015)

    CERN Multimedia

    2015-01-01

    Please find below all the upcoming courses (until December) that are currently missing participants, required for the courses to take place.     *Click on the picture*   For more details about a course and to register, please go to the Training Catalogue.

  6. Thrown Together: Incorporating Place and Sustainability into Early Literacy Education

    Science.gov (United States)

    Schmidt, Catarina

    2017-01-01

    The development of language and literacy abilities of young multilingual children is important to their future educational engagement and success in school. In this study, the value of taking account of place and sustainability in early literacy education is considered. This research provides ideas for practice-based research on early literacy in…

  7. After Dark in the Antipodes: Pedagogy, Place and Queer Phenomenology

    Science.gov (United States)

    Crowley, Vicki; Rasmussen, Mary Lou

    2010-01-01

    This paper pursues issues of pedagogy, place and queer phenomenology in the context of what might be meant by the term "after-queer" or "what falls outside queer" as we currently theorise, practice and locate queer. Inspired by Sara Ahmed's account of how bodies become oriented by the ways in which they take up time and space,…

  8. A Place on the Shelf

    Science.gov (United States)

    Thomas, Devon

    2007-01-01

    If we read to discover new worlds, we also read to find ourselves. For gays and lesbians, this act of discovery can be problematic: literature has so often excluded them. In the last decades, as gays and lesbians have grown increasingly vocal in the effort to secure their rightful place in society, a broad range of fiction has emerged that…

  9. No place for their children:

    DEFF Research Database (Denmark)

    Nielsen, Helene Pristed

    2018-01-01

    or circumstance) include flexible hours and high levels of mobility reveal explicit hopes that their children will have more stable working lives – and expectations that this will mean that they shall have to leave the local area. The article documents how the local place is an important component...

  10. Management and communication courses – Places available

    CERN Multimedia

    2014-01-01

    Please note that there are some places available on the following management and communication courses starting in September or October.   For more information on the course, click on the course title, which will take you to the training catalogue. You can then sign up on line.  .tftable {color:#333333;width:100%;border-width: 1px;border-color: #a9a9a9;border-collapse: collapse;} .tftable th {background-color:#cdcdcd;border-width: 1px;padding: 8px;border-style: solid;border-color: #a9a9a9;text-align:left;} .tftable tr {background-color:#ffffff;} .tftable td {border-width: 1px;padding: 8px;border-style: solid;border-color: #a9a9a9;} Course Next session Duration Language Availability Managing Time 15 September 9 October 7 November 20 hours English 2 Managing Stress 6 October 7 October 16 hours English 5  

  11. Perturbation method for calculating impurity binding energy in an ...

    Indian Academy of Sciences (India)

    Perturbation method is used to calculate the binding energy within the framework of effective mass approximation and taking into account the effect of dielectric mismatch between the dot and the barrier material. The ground-state binding energy of the donor is computed as a function of dot size for finite confinement.

  12. REMINDER: Alcohol and the work place

    CERN Multimedia

    2004-01-01

    The CERN Medical Service has observed an increase in the number of personnel suffering from alcohol-related problems in recent years, in spite of the implementation of stricter regulations concerning the consumption of alcohol on the site. The causes of alcohol-related problems are often complex and many-faceted. A family history of alcohol abuse can be a cofactor in excessive drinking. The effects on a person's work are not negligible and should not be ignored. "Alcohol and the work place" is the third part of a campaign designed to raise awareness of the risks of alcohol consumption, which has already dealt with "alcohol and health" and "alcohol and road safety". Our campaign this year will be rounded off by three information sessions in which a representative of the ISPA (Swiss Institute for the Prevention of Alcoholism) will participate. The last of these sessions will take place in: the Main Building Auditorium on Wednesday, 8 December 2004 from 14:00 to 15:30. Sessions are open to everyone. For m...

  13. Teaching Kids with Learning Disabilities to Take Public Transit

    Science.gov (United States)

    Schoenfeld, Jane

    2009-01-01

    Taking public transit can make anyone nervous, especially in a large or medium-sized city where there are many different bus lines going many different places. The author's daughter, Anna, has multiple learning disabilities and may never learn to drive, but she wants to be as independent as possible so the author taught her to ride the bus. This…

  14. Supercluster takes a walk on the wild side

    DEFF Research Database (Denmark)

    Nielsen, Jakob Blæsbjerg; Andersen, Mikael Rørdam; Mortensen, Uffe Hasbro

    2013-01-01

    In a recent Proc. Natl. Acad. Sci. USA paper by Wiemann et al., a gene supercluster for secondary metabolite production in Aspergillus fumigatus is genetically dissected. The analysis demonstrates that gene regulation takes place at different layers and that genes belonging to specific clusters a...

  15. The T-Cell Receptor Can Bind to the Peptide-Bound Major Histocompatibility Complex and Uncomplexed β2-Microglobulin through Distinct Binding Sites.

    Science.gov (United States)

    Merkle, Patrick S; Irving, Melita; Hongjian, Song; Ferber, Mathias; Jørgensen, Thomas J D; Scholten, Kirsten; Luescher, Immanuel; Coukos, George; Zoete, Vincent; Cuendet, Michel A; Michielin, Olivier; Rand, Kasper D

    2017-08-01

    T-Cell receptor (TCR)-mediated recognition of the peptide-bound major histocompatibility complex (pMHC) initiates an adaptive immune response against antigen-presenting target cells. The recognition events take place at the TCR-pMHC interface, and their effects on TCR conformation and dynamics are controversial. Here, we have measured the time-resolved hydrogen/deuterium exchange (HDX) of a soluble TCR in the presence and absence of its cognate pMHC by mass spectrometry to delineate the impact of pMHC binding on solution-phase structural dynamics in the TCR. Our results demonstrate that while TCR-pMHC complex formation significantly stabilizes distinct CDR loops of the TCR, it does not trigger structural changes in receptor segments remote from the binding interface. Intriguingly, our HDX measurements reveal that the TCR α-constant domain (C- and F-strand) directly interacts with the unbound MHC light chain, β 2 -microglobulin (β 2 m). Surface plasmon resonance measurements corroborated a binding event between TCR and β 2 m with a dissociation constant of 167 ± 20 μM. We propose a model structure for the TCR-β 2 m complex based on a refined protein-protein docking approach driven by HDX data and information from molecular dynamics simulations. Using a biological assay based on TCR gene-engineered primary human T cells, we did not observe a significant effect of β 2 m on T-cell cytotoxicity, suggesting an alternate role for β 2 m binding. Overall, we show that binding of β 2 m to the TCR occurs in vitro and, as such, not only should be considered in structure-function studies of the TCR-pMHC complex but also could play a hitherto unidentified role in T-cell function in vivo.

  16. Building Place Identity through Heritage

    OpenAIRE

    Alexandra PACESCU; Vlad THIERY

    2015-01-01

    In an increasingly globalized world, the fading specificity is producing homogeneous images that make cities more and more difficult to tell apart. The market economy tends to commodify each and every aspect of urban life, even those belonging to the cultural realm. As a consequence, a need for differentiators arises, which can be best embodied by the local heritage. The present paper is trying to establish a link between the concept of Place Identity, seen from a marketing point of view, ...

  17. Taking Possession: Rituals, Space and Authority

    Directory of Open Access Journals (Sweden)

    Jennifer Mara DeSilva

    2016-12-01

    Full Text Available In early modern Europe authority over communities, both people and spaces, was visualized through ritual gestures and processions. Communities gathered to witness ceremonial entries that drew on accepted forms of gestures and speech identifying individuals and articulating their place in the urban power relationship. Ceremonial entries by rulers, ambassadors, bishops, and other office-holders drew on ritual acts projecting messages of possession in order to establish reputations of prestige and authority. This introductory essay draws on cultural anthropology and recent historiography to build a framework for understanding rituals of possession that went beyond the tradition triumphal entry to incorporate substitutes, new modes of prestigious display, and attend to conflicts. By “taking possession” of communities, offices, and spaces using accepted ritual forms, early moderns initiated conversations about authority and power that were far more flexible in their scope, practice, and participants than expected.

  18. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri

    2012-07-01

    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  19. Taking Light For a Walk

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 11. Taking Light For a Walk. Anita R Warrier C Vijayan. General Article Volume 18 Issue 11 November 2013 pp 1015-1031. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/018/11/1015-1031 ...

  20. Taking Care After A Concussion

    Centers for Disease Control (CDC) Podcasts

    2010-03-17

    This podcast describes how to take care of yourself after a concussion, including proper recognition and response recommendations.  Created: 3/17/2010 by National Center for Injury Prevention and Control (NCIPC).   Date Released: 3/17/2010.

  1. Take-all or nothing

    NARCIS (Netherlands)

    Hernández-Restrepo, M.; Groenewald, J.Z.; Elliott, M.L.; Canning, G.; McMillan, V.E.; Crous, P.W.

    2016-01-01

    Take-all disease of Poaceae is caused by Gaeumannomyces graminis (Magnaporthaceae). Four varieties are recognised in G. graminis based on ascospore size, hyphopodial morphology and host preference. The aim of the present study was to clarify boundaries among species and varieties in

  2. Take-all or nothing

    NARCIS (Netherlands)

    Hernández-Restrepo, M.; Groenewald, J.Z.; Elliott, M.L.; Canning, G.; McMillan, V.E.; Crous, P.W.

    2016-01-01

    Take-all disease of Poaceae is caused by Gaeumannomyces graminis (Magnaporthaceae). Four varieties are recognised in G. graminis based on ascospore size, hyphopodial morphology and host preference. The aim of the present study was to clarify boundaries among species and varieties in Gaeumannomyces

  3. Sleep Deprivation and Advice Taking

    NARCIS (Netherlands)

    Hausser, J.A.; Leder, J.; Ketturat, C.; Dresler, M.; Faber, N.S.

    2016-01-01

    Judgements and decisions in many political, economic or medical contexts are often made while sleep deprived. Furthermore, in such contexts individuals are required to integrate information provided by - more or less qualified - advisors. We asked if sleep deprivation affects advice taking. We

  4. Take Charge of Your Career

    Science.gov (United States)

    Brown, Marshall A.

    2013-01-01

    Today's work world is full of uncertainty. Every day, people hear about another organization going out of business, downsizing, or rightsizing. To prepare for these uncertain times, one must take charge of their own career. This article presents some tips for surviving in today's world of work: (1) Be self-managing; (2) Know what you…

  5. DNS & Bind Cookbook

    CERN Document Server

    Liu, Cricket

    2011-01-01

    The DNS & BIND Cookbook presents solutions to the many problems faced by network administrators responsible for a name server. Following O'Reilly's popular problem-and-solution cookbook format, this title is an indispensable companion to DNS & BIND, 4th Edition, the definitive guide to the critical task of name server administration. The cookbook contains dozens of code recipes showing solutions to everyday problems, ranging from simple questions, like, "How do I get BIND?" to more advanced topics like providing name service for IPv6 addresses. It's full of BIND configuration files that yo

  6. PLACE OF NUTRITION IN YOGA

    OpenAIRE

    Desai, B.P.

    1990-01-01

    Nutrition plays a very vital role in our life. Yoga and Ayurveda had laid down the foundations of dietetics. The valuable guidelines regarding various food articles and diet for Yoga Sadhaka, to achieve maximum benefits, are given in traditional yoga texts like Hatha Pradipika and Gheranda Samhitha. Now is the time to evaluate the place of nutrition in Yoga and to study how the dietetic principles in yoga will help to eradicate the national problem of Mal-nutrition and poverty which is the pr...

  7. Your Place or Mine? Reading Art, Place and Culture

    DEFF Research Database (Denmark)

    Brander, Birgitte Gade; Reisberg, Mira; Greenwood, David

    2006-01-01

    and development of a culture of schooling that supports the nature of self-conscious critique. Like critical pedagogues, place-based educators are centrally concerned with cultural context of teaching and learning and the role of schooling in shaping and reconstructing society. In drawing on the local environment...... and force colleges of education into the position of creating programs that demonstrate compliance with governing codes. Educational practices are usually developed and become entrenched without a clear articulation of the theories on which they are founded. Critical pedagogy is committed to the exploration......, they also often focus explicitly on ecological contexts of community life, and thus seek to expand critical pedagogy's decidedly cultural focus to include the total ecological realm of human experience...

  8. DNS BIND Server Configuration

    Directory of Open Access Journals (Sweden)

    Radu MARSANU

    2011-01-01

    Full Text Available After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  9. DNS BIND Server Configuratio

    OpenAIRE

    Radu MARSANU

    2011-01-01

    After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  10. DNS BIND Server Configuration

    OpenAIRE

    Radu MARSANU

    2011-01-01

    After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  11. Melanin-binding radiopharmaceuticals

    Energy Technology Data Exchange (ETDEWEB)

    Packer, S; Fairchild, R G; Watts, K P; Greenberg, D; Hannon, S J

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed. (PSB)

  12. Melanin-binding radiopharmaceuticals

    International Nuclear Information System (INIS)

    Packer, S.; Fairchild, R.G.; Watts, K.P.; Greenberg, D.; Hannon, S.J.

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed

  13. Endogenously generated plasmin at the vascular wall injury site amplifies lysine binding site-dependent plasminogen accumulation in microthrombi.

    Directory of Open Access Journals (Sweden)

    Tomasz Brzoska

    Full Text Available The fibrinolytic system plays a pivotal role in the regulation of hemostasis; however, it remains unclear how and when the system is triggered to induce thrombolysis. Using intra-vital confocal fluorescence microscopy, we investigated the process of plasminogen binding to laser-induced platelet-rich microthrombi generated in the mesenteric vein of transgenic mice expressing green fluorescent protein (GFP. The accumulation of GFP-expressing platelets as well as exogenously infused Alexa Fluor 568-labeled Glu-plasminogen (Glu-plg on the injured vessel wall was assessed by measuring the increase in the corresponding fluorescence intensities. Glu-plg accumulated in a time-dependent manner in the center of the microthrombus, where phosphatidylserine is exposed on platelet surfaces and fibrin formation takes place. The rates of binding of Glu-plg in the presence of ε-aminocaproic acid and carboxypeptidase B, as well as the rates of binding of mini-plasminogen lacking kringle domains 1-4 and lysine binding sites, were significantly lower than that of Glu-plg alone, suggesting that the binding was dependent on lysine binding sites. Furthermore, aprotinin significantly suppressed the accumulation of Glu-plg, suggesting that endogenously generated plasmin activity is a prerequisite for the accumulation. In spite of the endogenous generation of plasmin and accumulation of Glu-plg in the center of microthrombi, the microthrombi did not change in size during the 2-hour observation period. When human tissue plasminogen activator was administered intravenously, Glu-plg further accumulated and the microthrombi were lysed. Glu-plg appeared to accumulate in the center of microthrombi in the early phase of microthrombus formation, and plasmin activity and lysine binding sites were required for this accumulation.

  14. Take Five for Customer Service

    Directory of Open Access Journals (Sweden)

    Laura J. Ax-Fultz

    2016-05-01

    Full Text Available Businesses leverage excellent customer service to improve profitability. Although not profit-driven, libraries should leverage excellent customer service to achieve their unique missions. Evaluating and improving customer service practices will help a library determine if it is successfully serving its customers. The library should review three areas to improve customer service: the physical space of the library, how library employees work with library policies, and the communication skills of the library staff. By using the Take Five model, the library can make immediate, no-cost changes or plan for future improvements by taking just five minutes, every day, to assess specific areas. Over a few weeks or months, these small changes will result in better customer service.

  15. Risk taking by singing males

    OpenAIRE

    A.P. Møller; J.T. Nielsen; L.Z. Garamzegi

    2008-01-01

    The distance at which an individual flees from a potential predator represents a measure of risk taking. If individuals are engaged in another activity that might affect fitness, trade-offs between the fitness benefits of flight and the other activity should determine the nearest distance of approach by a predator. In a comparative analysis of birds, flight distance represented a reliable measure of risk of predation by the sparrowhawk Accipiter nisus that increased with decreasing flight dis...

  16. Nasa takes photography into space

    CERN Document Server

    Ringstad, Arnold

    2017-01-01

    NASA Takes Photography into Space considers the work of NASA photographers as they began exploring space. Using many stunning, full-page photos, it examines the photography's contributions to NASA's overall mission, including how space exploration has pushed photography technology forward. Features include a glossary, references, websites, source notes, and an index. Aligned to Common Core Standards and correlated to state standards. Essential Library is an imprint of Abdo Publishing, a division of ABDO.

  17. Tropical birds take small risks

    OpenAIRE

    Anders Pape Møller; Wei Liang

    2013-01-01

    The life history of tropical birds differs from that of their temperate counterparts by late start of reproduction, small clutch sizes, and high rates of adult survival. Thus, tropical species should have greater residual reproductive value than temperate species. Therefore, tropical birds can be predicted to take smaller risks than closely related temperate birds in order not to jeopardize their prospects of survival, which is the single most important component of fitness, and which is grea...

  18. The Place and Importance of Playgrounds in Child Development

    Directory of Open Access Journals (Sweden)

    Merve ÜNAL

    2009-08-01

    Full Text Available Education is an activity that is not restricted to the school areas, sometimes goes beyond the school walls. Similar to schools, various institutions or establishments like playgrounds, libraries, and museums also take place in educational and/or instructional process. Among these places, playgrounds can be regarded as critically important in terms of discharging children’s high energy, positive self (ego development, exploring skills, self esteem and success of children, and also cognitive, physical and psychological development of children. We need playgrounds to enhance these skills and to provide an option for our children to learn new things. In this study we will argue importance and kinds of playgrounds

  19. Turn and jump: how time & place fell apart

    CERN Document Server

    Mansfield, Howard

    2013-01-01

    Before Thomas Edison, light and fire were thought to be one and the same. Turns out, they were separate things altogether. This book takes a similar relationship, that of time and place, and shows how they, too, were once inseparable. Time keeping was once a local affair, when small towns set their own pace according to the rising and setting of the sun. Then, in 1883, the expanding railroads necessitated the creation of Standard Time zones, and communities became linked by a universal time. Here Howard Mansfield explores how our sudden interconnectedness, both physically, as through the railroad, and through inventions like the telegraph, changed our concept of time and place forever.

  20. Engaging bodies and places online

    DEFF Research Database (Denmark)

    Jordt Jørgensen, Nanna; Rehder, Mads Middelboe

    In this paper, we suggest that embodied learning forms the backdrop for young people’s digitally mediated practices. In line with the early studies of Miller & Slater, we approach online engagements as ‘continuous with and embedded in other social spaces’, happening ‘within mundane social...... of online and offline aspects of everyday life.With theoretical point of departure in the philosophical writings of Maurice Merleau-Ponty (1908-1961), and phenomenologically oriented work on embodiment and place (Casey, 1999; Ehn & Löfgren, 2006, 2010; Frykman, 2012; Frykman & Gilje, 2003; Ingold, 2000......, 2011; Jackson, 1996; Miller, 2008, 2010; Winther, 2006), we discuss how everyday life experiences of young people transgress online-offline distinctions. The presentation focuses on an important concept of thought in the oeuvre of Merleau-Ponty, the sedimentation, and on how this notion has inspired...

  1. Dictionary of Alaska place names

    Science.gov (United States)

    Orth, Donald J.

    1971-01-01

    This work is an alphabetical list of the geographic names that are now applied and have been applied to places and features of the Alaska landscape. Principal names, compiled from modem maps and charts and printed in boldface type, generally reflect present-day local usage. They conform to the principles of the U.S. Board on Geographic Names for establishing standard names for use on Government maps and in other Government publications. Each name entry gives the present-day spelling along with variant spellings and names; identifies the feature named; presents the origin and history of the name; and, where possible, gives the meaning of an Eskimo, Aleut, Indian, or foreign name. Variant, obsolete, and doubtful names are alphabetically listed and are cross referenced, where necessary, to the principal entries.

  2. Taking homophobia’s measure

    Directory of Open Access Journals (Sweden)

    Mary Lou Lou Rasmussen

    2013-07-01

    Full Text Available My focus in this article is on the topic of homophobia and its place in the sexuality education classroom in Australia and the United States (US. This paper draws on research in anthropology law and, on studies of gender and sexuality in an attempt to complicate predominantly psychological understandings of homophobia that may underscore the popular use of scales to measure homophobic attitudes in pre-service and in-service teachers. These interdisciplinary approaches to homophobia provide the basis for a critical reading of some contemporary pedagogical approaches to anti-homophobia education in diverse education contexts.

  3. Domain Building or Risk Taking

    DEFF Research Database (Denmark)

    Hjort, Katrin; Abrahamsen, Marianne

    2012-01-01

    of the relations between gender, values and family obligation but reveals an interesting difference between two strategies for career development: Domain Building and Risk Taking. Both strategies are applied by both men and women. However, one of them seems to be the most effective with regard to achieve......The Nordic Countries are usually seen as the worlds must successful nations when it comes to gender equality, and the Scandinavian population in general appreciates values traditionally labeled feminine as caretaking and the quality of everyday life. However, the inequalities become obvious...

  4. Slavia takes the Czech path

    International Nuclear Information System (INIS)

    Haluza, I.

    2007-01-01

    Biodiesel was the main reason Slavia Capital bought the oil processing company, Palma Tumys, Bratislava last year. The biofuels added to fuel produced from oil are one of the core products of this investment group. But today Slavia is profiting more from the production of edible oils and margarine produced by the Palma Group. It has benefited from the global increase in food prices. But Palma is also profiting from the experience and contacts of its new Czech managers appointed by the new owner. They have found a place in Czech stores for Slovak oils and margarines. In the past the company only used to supply its products to Czech bakers. And they even found a place for biodiesel. Petr Zejdlik is Czech and is the chairman of the board of Palma Group. Matej Valtr, is also Czech and is responsible for managing company strategies. They replaced the former owners, original Slovak privatizers who used to manage the company and did not do badly. They managed to keep one of the biggest Slovak food processing companies in good shape and in profit and j with stable revenues of around 90 mil. EUR. But finally they gave in to international competition from Bunge, Cargill and Archer Daniels Midland and sold the company to a financially strong investor. (author)

  5. Place branding and nonstandard regionalization in Europe

    NARCIS (Netherlands)

    Boisen, Martin

    2015-01-01

    Place branding might, could, and maybe even should play a central role in urban and regional governance. The vantage point of this chapter is that every place is a brand and that the processes of nonstandard regionalization that can be witnessed all over Europe create new places and, thus, new place

  6. Going international? Risk taking by cryptomarket drug vendors.

    Science.gov (United States)

    Décary-Hétu, David; Paquet-Clouston, Masarah; Aldridge, Judith

    2016-09-01

    Since 2011, we have witnessed the rise of 'dark net' drug marketplaces known as cryptomarkets. Cryptomarkets operate on the same model as eBay as they provide a platform where authorized vendors can set up a virtual shop and place listings. Building on a growing body of literature that seeks to understand cryptomarket participants, this paper seeks to explain the decision of cryptomarket vendors to take on risk. We collected data on Silk Road 1 (SR1), the first cryptomarket launched in 2011. We propose a multilevel model that takes into account the characteristics of listings, vendors and their environment to explain the decision of vendors to take on risk. Our results demonstrate that all levels in the model significantly explain the decision to take on risk. Risk taking, operationalized as a willingness to ship drugs across international borders, was associated with the weights of drug packages mailed, the vendors' reputations and numbers of listings, the country-level perceived effectiveness of law enforcement according to experts, and the opportunities available to vendors as measured by the wealth and the drug expenditures of potential customers. Our results support some previous research findings on the factors explaining risk taking. We extend existing literature by emphasizing the relevance of the environment of drug dealers to predict risk taking. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Oh, the Places They Went: SBOs Share Their Career Paths

    Science.gov (United States)

    George, Patricia

    2013-01-01

    "Oh the Places You'll Go!" That Dr. Seuss book is a standard gift for graduates as they are sent out into the world-whether it's off to college or into the world of work. "You can steer yourself any direction you choose." What direction did school business officials take to get where they are today? The most recent…

  8. Digital technology to enable aging in place.

    Science.gov (United States)

    Kim, Kwang-Il; Gollamudi, Shreya S; Steinhubl, Steven

    2017-02-01

    Aging, both of individuals and populations, presents challenges and opportunities. The multitude of morbidities and disabilities that are a too common component of aging represent significant challenges to individuals, their families and to healthcare systems. Aging in place is the ability to safely and comfortably maintain an independent and high quality of life in one's own home and community and is a highly desirable goal of most individuals with the additional benefit of significantly impacting the impending enormous healthcare burden. In order to make this possible, new care models that take advantage of novel technologies for tracking important physiologic and safety parameters need to be developed and implemented. By thoughtfully doing so, it can be possible to seamlessly provide preventative interventions when and as needed, detect the earliest signs of aggravation of chronic conditions, or identify and respond to any emergency situations, such as falls or cardiac arrest. In contrast to current approaches, caring for elderly individuals in their homes based on a digital technology infrastructure could be effective and cost-saving. In this review, we provide an overview of the characteristics of potential digital solutions applicable to creative aging along with the existing evidence supporting their ability to improve care, increase quality of life, and substantially decrease the emotional and financial costs associated with aging. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Alcohol and the work place

    CERN Document Server

    2004-01-01

    The CERN Medical Service has observed an increase in the number of personnel suffering from alcohol-related problems in recent years, in spite of the implementation of stricter regulations concerning the consumption of alcohol on the site. The causes of alcohol-related problems are often complex and many-faceted. A family history of alcohol abuse can be a cofactor in excessive drinking. The effects on a person's work are not negligible and should not be ignored. "Alcohol and the work place" is the third part of a campaign designed to raise awareness of the risks of alcohol consumption, which has already dealt with "alcohol and health" and "alcohol and road safety".Many employers have taken steps to confront the problem, and CERN launched a campaign to help its employees suffering from alcohol-related problems over ten years ago. A standing SCC sub-group on the prevention of alcoholism has been set up and Operational Circular No. 8, which defines the role and responsibilities of all parties concerned in the m...

  10. Essential qualities of children’s favorite places

    Science.gov (United States)

    Prakoso, S.

    2018-03-01

    This paper builds on an existential-phenomenology framework to better understand the essential qualities of children’s favorite places. Based on grounded theory, this study focused on the everyday life experiences of 25 children (14 girls and 11 boys), aged 9–12 years and living in Jakarta, whose housing environments reflected various spatial qualities. The results showed that all children reported having one or more favorite places. Despite differences in type, scale, form, and location of children’s favorite places, each existential place was a supportive urban space conceived, perceived, and lived through the meaning and symbolic use given to it by a child. The essential qualities of children’s favorite places were accessibility, a location within route from home to other destinations (such as a friend’s house or school), and a space providing a sense of comfort, security, and social affiliation, as well as experiences that were restorative, personal, sensory, and materialistic. This study may have implications for the design of urban places that foster the formation of children’s favorite spaces by taking into account these essential qualities of children’s lived-existential spaces.

  11. Put waste in its place

    CERN Document Server

    2009-01-01

    It doesn’t take much of an effort to sort waste, but what a difference it can make - to the environment, of course, but also to CERN’s incineration bill. A variety of containers are provided to allow waste to be sorted before disposal, thereby making recycling easier. Everyone knows that sorting waste reduces pollution. By recycling or recovering waste materials, we can reduce the amount of waste that ends up in an incinerator or land-fill, while giving the used material a second life. That reduces the consumption of raw materials and natural resources—and of budget resources. CERN pays lower bill: disposing of a tonne of waste by incineration costs 230 Swiss francs, while a tonne of paper only costs 10 francs to dispose of. The problem is that much of the waste is not properly sorted. "In 2008, out of more than 1600 tonnes of waste we had to incinerate 600 tonnes, which is an enormous figure!" says Martine Auerbach, wh...

  12. Size and type of places, geographical region, satisfaction with life, age, sex and place attachment

    Directory of Open Access Journals (Sweden)

    Mandal Alan

    2016-04-01

    Full Text Available The topic of the article concerns the issue of place attachment and its determinants. An analysis of place attachment was performed in terms of place identity and place dependence (Williams, Vaske, 2003. Moreover, links between place attachment and selected geographical (size and type of place, geographical region, demographic (age, sex and psychological (satisfaction with life variables were investigated.

  13. Place-Identity in a School Setting: Effects of the Place Image

    Science.gov (United States)

    Marcouyeux, Aurore; Fleury-Bahi, Ghozlane

    2011-01-01

    Studies on place identity show positive relationships between the evaluation of a place and mechanisms involved in place identification. However, individuals also identify with places of low social prestige (places that bear a negative social image). Few authors investigate the nature of place identity processes in this case. The goal of this…

  14. Kinetic and binding effects in peptide substrate selectivity of matrix metalloproteinase-2: Molecular dynamics and QM/MM calculations.

    Science.gov (United States)

    Díaz, Natalia; Suárez, Dimas; Suárez, Ernesto

    2010-01-01

    Herein, we examine computationally the binding and hydrolysis reaction of the MMP-2 enzyme with two peptide substrates selected by the enzyme from a phage peptide library. Molecular dynamics simulations of the Michaelis complexes (25 ns) allow us to characterize the main enzyme/substrate contacts. Subsequently MM-PBSA calculations using independent trajectories for the complexes and the free substrates provide relative binding energies in good agreement with the experimental K(M) results. Computational alanine scanning analyses of the enzyme/substrate interaction energies confirm the relevance of the P(3), P(2), and P(1)' side chains for ligand binding. Finally, the hydrolysis of both peptides taking place at the MMP-2 active site is explored by means of hybrid quantum mechanical/molecular mechanics calculations. The computed reaction mechanisms result in rate-determining energy barriers being in consonance with the experimental k(cat) values. Overall, the computational protocol seems to capture the subtle differences in binding and catalysis experimentally observed for the two peptide substrates. Some implications of our results for the future design of novel and more specific MMP-2 inhibitors are also discussed. (c) 2009 Wiley-Liss, Inc.

  15. Taking the Copenhagen Process apart

    DEFF Research Database (Denmark)

    Cort, Pia

    discourse in which education and training in general is to contribute to the competitiveness of the EU in a global economy. Within this discourse, policy is de-politicized and naturalised as being neutral and evidence-based leading to the unreflective transfer of policies across countries.......The aim of this thesis is to analyse the EU vocational education and training policy process (The Copenhagen Process) from a critical perspective based on the policy analysis methodology, “What’s the Problem Represented to Be?” (WPR) developed by Professor Carol Bacchi. The main research question...... “How can the European vocational education and training policy process - the Copenhagen Process - be understood from a WPR perspective? “ is addressed in six articles which take apart the Copenhagen Process and deal with specific WPR questions and specific aspects of the Copenhagen Process...

  16. Take Control of PDFpen 5

    CERN Document Server

    Cohen, Michael

    2010-01-01

    After a whirlwind history and overview of PDF, you'll take a tour through PDFpen's tools and navigation. With those basics taken care of, you'll learn how to: Scan a document to PDF and make the text editable with OCRCombine pages from multiple files into a single PDFTurn a Web site into a multi-page PDFAdd or remove pages from a PDFAdd a hand-written signature to a PDFAdd page and URL links to a PDFMake a clickable table of contents for a PDFUse professional editing marks on a PDFEdit text within a PDF that was received in emailLeave comments on a PDF documentRemove sensitive or confidential

  17. The Politics of Takings Clauses

    Directory of Open Access Journals (Sweden)

    Mila Versteeg

    2015-12-01

    Full Text Available http://dx.doi.org/10.5007/2177-7055.2015v36n71p43 A long-standing consensus exists that the arbitrary or excessive expropriation of private property by a country hurts its economic growth. Although constitutions can play an important role in protecting private property, remarkably little is known about how they actually restrict the power of eminent domain and whether such restrictions are associated with reduced de facto expropriation risks. The main finding of this essay is that no observable relationship exists between de jure constitutional restrictions on the power of eminent domain and de facto expropriation risks. This finding suggests that the effectiveness of takings clauses might depend on the politics surrounding their adoption.

  18. Upcoming training sessions (up to end October) - Places available

    CERN Document Server

    2016-01-01

    Please find below a list of training sessions scheduled to take place up to the end of October with places available.   Safety and Language courses are not included here, you will find an up-to-date list in the Training Catalogue. If you need a course which is not featured  in the catalogue, please contact one of the following: your supervisor, your Departmental Training Officer or the relevant learning specialist. Leadership Training           Training Course Title Next Session Language Duration Available places Needed to maintain the session Driving for Impact and Influence 13-Sep-2016 to 14-Sep-2016 French 2 days 4 0 Essentials of People Management for CERN Supervisors (Adapted from CDP for CERN Supervisors) 22-Sep-2016 to 23-Sep-2016, 18-Nov-2016, 17-Jan-2017 to 18-Jan-2017 English 5 days 5 0 Eléments essentiels de la gestion du personnel pour les superviseurs (adapt&a...

  19. Sampling vs. taking some - 59349

    International Nuclear Information System (INIS)

    Francois-Bongarcon, D.

    2012-01-01

    Collecting a sample is a delicate task that is Not naively equivalent to simply 'taking some of the material'. The question examined is: 'What is it exactly?' The problem of sampling in general, and for nuclear decontamination in particular, is properly defined. A theory is presented (Gy's Theory of Sampling, a.k.a. TOS) that brings all the answers and allows us to put them to work. The author draws form his lifelong experience in research, teaching and practical applications in this domain to emphasize the critical odds (i.e. risks) of not taking sampling explicitly into account when assessing grades and concentrations. The evolution of the acceptance of this theory in the nuclear industry is finally illustrated, and a hopeful glimpse into the future concludes the presentation. Equally interesting, however, besides what has already been achieved at the CEA along these years, is the realization of what could not be done with TOS, and therefore had to be treated in some other ways - e.g. using mapping tools (geostatistical). It is one the great side-advantages of using a consistent theory that it warns you, before it is too late, that what you are trying to do will not work: TOS, indeed, much like its Geo-statistics sister, besides preventing many a disaster, can provide pragmatic lessons in scientific humility that are best not being left ignored. In conclusion, there are great tools out there, such as TOS, that are well worth investing into, and that our community should be much more attuned to. (author)

  20. Effects of temperature on the p53-DNA binding interactions and their dynamical behavior: comparing the wild type to the R248Q mutant.

    Directory of Open Access Journals (Sweden)

    Khaled Barakat

    Full Text Available BACKGROUND: The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298-306 K. METHODOLOGY/PRINCIPAL FINDINGS: This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. CONCLUSIONS: The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure.

  1. A place-based model of local activity spaces: individual place exposure and characteristics

    Science.gov (United States)

    Hasanzadeh, Kamyar; Laatikainen, Tiina; Kyttä, Marketta

    2018-01-01

    Researchers for long have hypothesized relationships between mobility, urban context, and health. Despite the ample amount of discussions, the empirical findings corroborating such associations remain to be marginal in the literature. It is growingly believed that the weakness of the observed associations can be largely explained by the common misspecification of the geographical context. Researchers coming from different fields have developed a wide range of methods for estimating the extents of these geographical contexts. In this article, we argue that no single approach yet has sufficiently been capable of capturing the complexity of human mobility patterns. Subsequently, we discuss that reaching a better understanding of individual activity spaces can be possible through a spatially sensitive estimation of place exposure. Following this discussion, we take an integrative person and place-based approach to create an individualized residential exposure model (IREM) to estimate the local activity spaces (LAS) of the individuals. This model is created using data collected through public participation GIS. Following a brief comparison of IREM with other commonly used LAS models, the article continues by presenting an empirical study of aging citizens in Helsinki area to demonstrate the usability of the proposed framework. In this study, we identify the main dimensions of LASs and seek their associations with socio-demographic characteristics of individuals and their location in the region. The promising results from comparisons and the interesting findings from the empirical part suggest both a methodological and conceptual improvement in capturing the complexity of local activity spaces.

  2. Phosphorylation Modulates Ameloblastin Self-assembly and Ca2+ Binding

    Directory of Open Access Journals (Sweden)

    Øystein Stakkestad

    2017-07-01

    Full Text Available Ameloblastin (AMBN, an important component of the self-assembled enamel extra cellular matrix, contains several in silico predicted phosphorylation sites. However, to what extent these sites actually are phosphorylated and the possible effects of such post-translational modifications are still largely unknown. Here we report on in vitro experiments aimed at investigating what sites in AMBN are phosphorylated by casein kinase 2 (CK2 and protein kinase A (PKA and the impact such phosphorylation has on self-assembly and calcium binding. All predicted sites in AMBN can be phosphorylated by CK2 and/or PKA. The experiments show that phosphorylation, especially in the exon 5 derived part of the molecule, is inversely correlated with AMBN self-assembly. These results support earlier findings suggesting that AMBN self-assembly is mostly dependent on the exon 5 encoded region of the AMBN gene. Phosphorylation was significantly more efficient when the AMBN molecules were in solution and not present as supramolecular assemblies, suggesting that post-translational modification of AMBN must take place before the enamel matrix molecules self-assemble inside the ameloblast cell. Moreover, phosphorylation of exon 5, and the consequent reduction in self-assembly, seem to reduce the calcium binding capacity of AMBN suggesting that post-translational modification of AMBN also can be involved in control of free Ca2+ during enamel extra cellular matrix biomineralization. Finally, it is speculated that phosphorylation can provide a functional crossroad for AMBN either to be phosphorylated and act as monomeric signal molecule during early odontogenesis and bone formation, or escape phosphorylation to be subsequently secreted as supramolecular assemblies that partake in enamel matrix structure and mineralization.

  3. Inventing and naming America:  Place and Place Names in Vladimir Nabokov’s Lolita

    Directory of Open Access Journals (Sweden)

    Monica Manolescu-Oancea

    2009-06-01

    Full Text Available In the afterword to Lolita, Nabokov claimed that in this book he had to invent both Lolita and America after having invented Europe in his previous fiction. This paper focuses precisely on the various ways in which Nabokov “invented” America in his best-known novel. This invention is first of all the result of the author’s evolving stance on the complexity of what he called “average ‘reality’” in his works. Through a survey of Nabokov’s statements on the choice and role of place in the forewords to his Russian works and in his critical texts, I show that Lolita is indeed considered by Nabokov to be a “recreation” of American reality, to a much greater extent than his Russian works had been recreations of a given milieu. I take the metaphor of the “crazy quilt” mentioned in Lolita to suggest complexity, chromatic exuberance, hybridity. The invention of America is also the result of a process of naming. Place names will be examined, not only those which make up Quilty’s “cryptogrammic paperchase”, but also Humbert’s choice of place names. The problem of referentiality is discussed and the way recent criticism has dealt with it. Finally, the interplay between one and many is emphasized, the way in which the diversity of the “crazy quilt” is counterbalanced by the uniqueness of the mastermind having produced it. The American motto “From many make one” could be reinterpreted as “From one make many”.

  4. Single protein omission reconstitution studies of tetracycline binding to the 30S subunit of Escherichia coli ribosomes

    International Nuclear Information System (INIS)

    Buck, M.; Cooperman, B.S.

    1990-01-01

    In previous work the authors showed that on photolysis of Escherichia coli ribosomes in the presence of [ 3 H]tetracycline (TC) the major protein labeled is S7, and they presented strong evidence that such labeling takes place from a high-affinity site related to the inhibitory action of TC. In this work they use single protein omission reconstitution (SPORE) experiments to identify those proteins that are important for high-affinity TC binding to the 30S subunit, as measured by both cosedimentation and filter binding assays. With respect to both sedimentation coefficients and relative Phe-tRNA Phe binding, the properties of the SPORE particles they obtain parallel very closely those measured earlier, with the exception of the SPORE particle lacking S13. A total of five proteins, S3, S7, S8, S14, and S19, are shown to be important for TC binding, with the largest effects seen on omission of proteins S7 and S14. Determination of the protein compositions of the corresponding SPORE particles demonstrates that the observed effects are, for the most part, directly attributable to the omission of the given protein rather than reflecting an indirect effect of omitting one protein on the uptake of another. A large body of evidence supports the notion that four of these proteins, S3, S7, S14, and S19, are included, along with 16S rRNA bases 920-1,396, in one of the major domains of the 30S subunit. The results support the conclusion that the structure of this domain is important for the binding of TC and that, within this domain, TC binds directly to S7

  5. CARBOHYDRATE-CONTAINING COMPOUNDS WHICH BIND TO CARBOHYDRATE BINDING RECEPTORS

    DEFF Research Database (Denmark)

    1995-01-01

    Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases.......Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases....

  6. Taking CERN physics to South Asia

    CERN Multimedia

    Abha Eli Phoboo

    2015-01-01

    CERN physicists travelled to South Asia last month to bring a plethora of particle physics events to schools, universities and public venues. The initiative was the first of its kind in the region, and brought CERN particle physics to a new audience in Nepal and India.   Kathmandu University students take part in an ATLAS virtual visit. On 19 December 2014, students from Kathmandu University and Tribhuvan University, Nepal and 16 schools in Punjab, India took part in a joint virtual visit to ATLAS. The visit, which was the first of its kind in South Asia, followed a two-day Masterclass in particle physics that took place simultaneously in the two countries. The Masterclass was organised as a part of Physics Without Frontiers, an International Centre for Theoretical Physics project in partnership with CERN. Besides the Masterclass, physics workshops led by ATLAS physicists Kate Shaw, Joerg Stelzer and Suyog Shrestha were held for high school students and science teachers in three different d...

  7. Take part in a Django Girls training!

    CERN Multimedia

    2016-01-01

    Women are often under-represented in IT. And yet, at any age and whatever their level and background, it is a field that can arouse much interest.    To overcome this under-representation, the R0SEH1PSters community organises Django workshops targeted at women to introduce them to the world of coding and technology by teaching them how to successfully create a blog application and deploy it to the internet. And who knows, a spark of interest in the newly-discovered IT world may develop into a shine! The aim of Django Girls is also to increase the diversity within the industry. The mentors are mainly female volunteers who bring their passion to the workshop and are part of the awesome atmosphere attendees can feel during each event. Workshops have been organised worldwide regularly since 2014. Hosted by IdeaSquare and supported by the CERN IT department and the Diversity team, the Geneva workshop will take place in the evening on Friday evening, 26 February, and al...

  8. Hadron therapy takes off in Europe

    CERN Multimedia

    CERN Bulletin

    2011-01-01

    A joint meeting of ULICE, ENLIGHT and PARTNER recently took place in Marburg (Germany). The three initiatives are shaping both the present and the future of hadron therapy in Europe, where new cutting-edge facilities have started to fight cancer with beams of protons and carbon ions.   A pictorial representation of a raster scan on a tumour. (Photo courtesy of HIT/GSI/Siemens.) Thanks to a very active multidisciplinary community consisting of physicists, biologists, radiobiologists, engineers, IT specialists and medical doctors, hadron therapy is taking off in Europe. Indeed, after a few decades during which the innovative technique was mainly used experimentally in Japan, the US and a couple of pioneering laboratory-based facilities in Europe, today an increasing number of hospitals are being equipped with synchrotrons and dedicated treatment rooms. “Asia and Europe are at the forefront of research and use of carbon ions in the treatment of some rare and radio-resistant t...

  9. The Conceptualization of God's Dwelling Place in 1 Kings 8: A Cognitive Approach.

    NARCIS (Netherlands)

    Kamp, A.H.

    2016-01-01

    The diversity of terms for God's dwelling place in 1 Kings 8 is generally ascribed to a number of text traditions in which different theological views of the temple and God's dwelling place dominate. Rather than taking a fragmented view, this study starts from the textual integrity of 1 Kings 8. It

  10. Alboserpin, a factor Xa inhibitor from the mosquito vector of yellow fever, binds heparin and membrane phospholipids and exhibits antithrombotic activity.

    Science.gov (United States)

    Calvo, Eric; Mizurini, Daniella M; Sá-Nunes, Anderson; Ribeiro, José M C; Andersen, John F; Mans, Ben J; Monteiro, Robson Q; Kotsyfakis, Michail; Francischetti, Ivo M B

    2011-08-12

    The molecular mechanism of factor Xa (FXa) inhibition by Alboserpin, the major salivary gland anticoagulant from the mosquito and yellow fever vector Aedes albopictus, has been characterized. cDNA of Alboserpin predicts a 45-kDa protein that belongs to the serpin family of protease inhibitors. Recombinant Alboserpin displays stoichiometric, competitive, reversible and tight binding to FXa (picomolar range). Binding is highly specific and is not detectable for FX, catalytic site-blocked FXa, thrombin, and 12 other enzymes. Alboserpin displays high affinity binding to heparin (K(D) ~ 20 nM), but no change in FXa inhibition was observed in the presence of the cofactor, implying that bridging mechanisms did not take place. Notably, Alboserpin was also found to interact with phosphatidylcholine and phosphatidylethanolamine but not with phosphatidylserine. Further, annexin V (in the absence of Ca(2+)) or heparin outcompetes Alboserpin for binding to phospholipid vesicles, suggesting a common binding site. Consistent with its activity, Alboserpin blocks prothrombinase activity and increases both prothrombin time and activated partial thromboplastin time in vitro or ex vivo. Furthermore, Alboserpin prevents thrombus formation provoked by ferric chloride injury of the carotid artery and increases bleeding in a dose-dependent manner. Alboserpin emerges as an atypical serpin that targets FXa and displays unique phospholipid specificity. It conceivably uses heparin and phosphatidylcholine/phosphatidylethanolamine as anchors to increase protein localization and effective concentration at sites of injury, cell activation, or inflammation.

  11. Road safety: take it seriously

    CERN Multimedia

    Antonella Del Rosso

    2015-01-01

    Around 50 road accidents happen every year at CERN. Cyclists, drivers and pedestrians must pay attention to their behaviour at all times to ensure that this doesn’t become an even more serious problem. Even if the Laboratory’s sites are not exactly downtown Shanghai, all road users need to make a little effort. So let’s do it!   Life at CERN: let’s stick to accumulating scientific data rather than road accidents! (Cartoon by Cian O'Luanaigh) Despite a dedicated Safety Code in force since 1990, “traffic-calming” measures put in place last year, several reminders in the Bulletin and frequent safety campaigns, the number of accidents, particularly those involving cyclists, has remained high since 2008. Luckily, no-one has been seriously injured but it is more and more frequent to experience near misses or actual accidents, whether in a car or on a bike. Incivilities, excessive speeding (also for bikes!) and answering ...

  12. Take care of your mouse!

    CERN Multimedia

    IT Department

    2011-01-01

    “Stop --- Think --- Click" is the basic recommendation for securely browsing the Internet and for securely reading e-mails. Users who have followed this recommendation in the past were less likely to have their computer infected or their computing account compromised. We would like to thank all those who donated their mouse to the CERN Animal Shelter for Computer Mice (http://cern.ch/c-a-s). For those who still use a mouse, please stay vigilant and  alert: do not click on links whose origin you do not trust or which look like gibberish. Do not install untrusted software or plug-ins, since software from untrusted sources may infect or compromise your computer, or violate copyrights. Finally, take particular care with e-mails: Do not open unexpected or suspicious e-mails or attachments. Delete them if they do not concern you or if they appear strange. If in doubt, or if you have questions, please do not hesitate to contact Computer.Security@cern.ch

  13. Taking SESAME to the classroom

    CERN Multimedia

    2014-01-01

    The 2014 High School Teacher Programme (HST) is well under way, and this year it has a distinct Middle Eastern flavour, with eight teachers from the region among the 54 taking part.   Established in the late 1990s, HST is a three-week residential programme in English designed to give teachers a taste of frontier research and promote the teaching of modern physics in high schools. Along with the more than 30 other teacher schools given in the native language of the participants, HST aims to help teachers bring modern physics to the classroom and motivate their students to study science at upper secondary school and university. As part of the HST programme, teachers form working groups to develop lessons based on CERN science. This year, however, with eight teachers coming from Israel, Palestine, Iran and Jordan, all of which are members of SESAME, the international laboratory for Synchrotron-Light for Experimental Science Applications in the Middle East, one group is working on a dif...

  14. Iodine binding in the endostyle of larvae Branchiostoma lanceolatum (Cephalochordata)

    Energy Technology Data Exchange (ETDEWEB)

    Fredriksson, G.; Ericson, L.E.; Olsson, R.

    1984-11-01

    The asymmetrical endostyle of Branchiostoma larvae contains two different zones of mucus-producing cells which metamorphose to the paired zones 2 and 4 respectively in the endostyle of the adult. In both the larva and the adult these zones are parts of the food-trapping mechanism. An endostyle zone, which has a position corresponding to that of the paired iodinating zones in the endostyle of the adult, binds iodine selectively. The ultrastructure and labeling pattern indicate that the labeled cells in the larval endostyle belong to functionally different types. In one region of the iodinating zone iodine is mainly bound extracellularly at the apical cell surface. Also in the second region grains are located at the apical cell surface as well as over the cytoplasm and extracellularly at the basal plasma membrane. It is possible that iodination takes place in the lumen close to cells in the first region and that the labeled product is taken up and eventually released by cells of the second region. Our observations show that this primitive endostyle already has iodinating capacity and may synthesize and release thyroid hormones.

  15. Binding biological motion and visual features in working memory.

    Science.gov (United States)

    Ding, Xiaowei; Zhao, Yangfan; Wu, Fan; Lu, Xiqian; Gao, Zaifeng; Shen, Mowei

    2015-06-01

    Working memory mechanisms for binding have been examined extensively in the last decade, yet few studies have explored bindings relating to human biological motion (BM). Human BM is the most salient and biologically significant kinetic information encountered in everyday life and is stored independently from other visual features (e.g., colors). The current study explored 3 critical issues of BM-related binding in working memory: (a) how many BM binding units can be retained in working memory, (b) whether involuntarily object-based binding occurs during BM binding, and (c) whether the maintenance of BM bindings in working memory requires attention above and beyond that needed to maintain the constituent dimensions. We isolated motion signals of human BM from non-BM sources by using point-light displays as to-be-memorized BM and presented the participants colored BM in a change detection task. We found that working memory capacity for BM-color bindings is rather low; only 1 or 2 BM-color bindings could be retained in working memory regardless of the presentation manners (Experiments 1-3). Furthermore, no object-based encoding took place for colored BM stimuli regardless of the processed dimensions (Experiments 4 and 5). Central executive attention contributes to the maintenance of BM-color bindings, yet maintaining BM bindings in working memory did not require more central attention than did maintaining the constituent dimensions in working memory (Experiment 6). Overall, these results suggest that keeping BM bindings in working memory is a fairly resource-demanding process, yet central executive attention does not play a special role in this cross-module binding. (c) 2015 APA, all rights reserved).

  16. Territorial stigmatisation and the negotiation of place

    DEFF Research Database (Denmark)

    Hansen, Kim Toft; Christensen, Jørgen Riber

    2018-01-01

    The article addresses the negotiated meaning of notorious places through a consideration of a recent tendency in Danish TV documentaries where marginalized, often peripheral, places are portrayed and debated. Based partly on sociological research about territorial stigmatisation, partly on location...

  17. Creating a natural place for children

    DEFF Research Database (Denmark)

    Gulløv, Eva

    2003-01-01

    The chapter explores perceptions and practices in Danish kindergartens. It is shown how these places for young children are characterised by considerable ambiguity, reflecting the complexs and contradictory ways in which societies define and practice places for children.......The chapter explores perceptions and practices in Danish kindergartens. It is shown how these places for young children are characterised by considerable ambiguity, reflecting the complexs and contradictory ways in which societies define and practice places for children....

  18. Rethinking the Measurement of Place Brands

    DEFF Research Database (Denmark)

    Zenker, Sebastian; Braun, Erik

    2015-01-01

    Place brand managers often disregard the complexity of place brands, as do their counterparts in the academic arena: they repeatedly use simple explorative descriptions of certain place brands, rather than a precise measurement. Thus, this chapter aims to identify and discuss measurement approach...

  19. Chemical Agents: Facts about Sheltering in Place

    Science.gov (United States)

    ... to shelter in place depending on where they live. How to prepare to shelter in place Choose a room in your house or apartment for the shelter. ... from outside. Go in the shelter-in-place room and shut the door. Turn on the radio. Keep a telephone close at hand, but don’t use it unless ...

  20. The need to rethink place branding

    NARCIS (Netherlands)

    Ashworth, Gregory J.; Kavaratzis, Mihalis; Warnaby, Gary

    2015-01-01

    This chapter argues for the need to rethink the theory and practice of place branding and in doing so, it outlines the rationale for this book. We propose four major questions that guide the rethinking undertaken here: (a) why is place branding important? (b) what builds place brands? (c) who builds

  1. Sense of Place in Environmental Education

    Science.gov (United States)

    Kudryavtsev, Alex; Stedman, Richard C.; Krasny, Marianne E.

    2012-01-01

    Although environmental education research has embraced the idea of sense of place, it has rarely taken into account environmental psychology-based sense of place literature whose theory and empirical studies can enhance related studies in the education context. This article contributes to research on sense of place in environmental education from…

  2. Is risk-taking in talented junior tennis players related to overuse injuries?

    NARCIS (Netherlands)

    Van der Sluis, A; Brink, M S; Pluim, B; Verhagen, E A; Elferink-Gemser, M T; Visscher, C

    2017-01-01

    Overuse injuries are a serious problem in junior tennis. Gaining insight in age-specific risk factors can contribute to prevention. The developmental cognitive processes that take place during adolescence make talented players more inclined to take risks. This may be even more pronounced in the high

  3. ISLAMIC IDENTITY VERSUS CITY/PLACE BRANDING

    Directory of Open Access Journals (Sweden)

    M. Alaa Mandour

    2012-09-01

    Full Text Available Is a brand a product, a service, or a company? Is it a logo, a marketing strategy or an attitude? As globalization intensifies, places increasingly compete with other places for attention, influence, markets, investments, businesses, visitors, residents, talent and events. And competition is no longer restricted to the well-known places down the road, over the hill or across the water. Places now compete with cities, regions and countries halfway around the world. Places are increasingly getting caught off guard by unpredicted and apparently rapid shifts in competition and abruptly lose their historic purpose or their competitive edge, be it economic, social or cultural. Culture fills our cities, regions, nations and even our rural landscapes with spiritual content. Our places are an expression of who we are and what we value and they are ruthless in projecting the bad alongside the good. In its widest sense culture includes art, design, education, science, religion and sport. In the context of place branding it is the manifestation of our beliefs, values, customs and behaviors. Merging culture to brand within our city tissue is an essential part of the morphology within its spaces. This paper is trying to discuss the contribution of Islamic culture to a place brand; Relationship between culture and identity, image, visual identity etc. in the context of place branding; Impact of culture on brand equity; Developing cultural brand assets to brand places and how should we value and evaluate culture in the context of place branding?  Also will try to find answers to the following: Do we have a precise understanding of how Islamic culture adds value to or devalues a place? Do we have a methodology for capturing the value of our Islamic culture to places? And, can this culture be developed with the intent to create better places and place brands?   

  4. It Takes More Than Ethics

    Directory of Open Access Journals (Sweden)

    Chris Simpson

    2001-05-01

    Full Text Available Recent positive developments in ethical outlook are explored, initially within the Information and Communication Technology (ICT profession, and then broadened into other disciplines and the community in general. To understand why there has been a growing ethical problem in the first place, ethical attitudes of university students, ICT exponents and people in other disciplines have been observed and noted. The search for practical ethical guidelines continues by questioning why, if professionalism indicates an adherence to a code of ethics that seeks high standards, do we still have trouble with the concept of ethics? Ethics differ from one group to another. Furthermore, ethics keep changing, as is evident in the latest codes, in which 'public good' now comes before the more inward-looking 'good of the profession'. So, how could an ethical code be more than an isolated, somewhat ineffective and temporary set of guidelines? How can it be freed of boundaries, of context and of time? How effective or relevant is the education of university students in practical ethics? How effective are the professional and ethical bodies? Some answers are proposed and along the way, together with some simple but powerful notions and tools, that facilitate ethical understanding in university education and in professional practice. It is then argued that as work is a part of life, then a similar range of ethical options would be available in every context of life, be it as a private individual, a society, an employee, a small business, a corporation or in whatever discipline or role. In each situation, a similar range of lifestyle choices exist, for example, wasteful (careless, indulgent (selfish, sustainable (prudent, long-term view (responsible or a perpetual view (meaningful and truly progressive. In other words, by agreeing to adopt 'the community ethics', one has taken on a dutiful role. For it to be more meaningful and more fruitful, life further demands such

  5. Binding in haptics: integration of "what" and "where" information in working memory for active touch.

    Directory of Open Access Journals (Sweden)

    Franco Delogu

    Full Text Available Information about the identity and the location of perceptual objects can be automatically integrated in perception and working memory (WM. Contrasting results in visual and auditory WM studies indicate that the characteristics of feature-to-location binding can vary according to the sensory modality of the input. The present study provides first evidence of binding between "what" and "where" information in WM for haptic stimuli. In an old-new recognition task, blindfolded participants were presented in their peripersonal space with sequences of three haptic stimuli varying in texture and location. They were then required to judge if a single probe stimulus was previously included in the sequence. Recall was measured both in a condition in which both texture and location were relevant for the task (Experiment 1 and in two conditions where only one feature had to be recalled (Experiment 2. Results showed that when both features were task-relevant, even if the association of location and texture was neither necessary nor required to perform the task, participants exhibited a recall advantage in conditions in which the location and the texture of the target probe was kept unaltered between encoding and recall. By contrast, when only one feature was task-relevant, the concurrent feature did not influence the recall of the target feature. We conclude that attention to feature binding is not necessary for the emergence of feature integration in haptic WM. For binding to take place, however, it is necessary to encode and maintain in memory both the identity and the location of items.

  6. The additive effect of turn-taking cues in human and synthetic voice

    OpenAIRE

    2010-01-01

    Abstract A previous line of research suggests that interlocutors identify appropriate places to speak by cues in the behaviour of the preceding speaker. If used in combination, these cues have an additive effect on listeners? turn-taking attempts. The present study further explores these findings by examining the effect of such turn-taking cues experimentally. The objective is to investigate the possibilities of generating turn-taking cues with a synthetic voice. Thus, in addition ...

  7. binding protein (HABP1)

    Indian Academy of Sciences (India)

    Unknown

    adsorbed on carbon coated copper grid (400 mesh) for. 5 min at room temperature. The grids were subsequently .... and inhibition by GAGs and DMA were determined on polystyrene wells of microtitre plates (Costar, ... for binding inhibition assays was carried out by mixing equal volumes of the conjugate and the inhibitor at ...

  8. Quarkeosynthesis Binding Energy

    Science.gov (United States)

    Webb, Bill

    2009-05-01

    Quarkeosynthesis shows that the binding energy of a nucleus is the difference between the relativistic kinetic energies of its threesome of Jumbo Quarks and that of its building block quarks from neutrons and protons. There is no involvement of a nuclear strong force or gluon material.

  9. Sequential memory: Binding dynamics

    Science.gov (United States)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail

    2015-10-01

    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  10. binding protein (HABP1)

    Indian Academy of Sciences (India)

    Unknown

    of HA in a concentration-dependent manner, suggesting its multiligand affinity amongst carbohydrates. rHABP1 shows differential affinity ... site is seen to correspond to the carbohydrate-binding site in E-selectin, which has similarity in the ... adsorbed on carbon coated copper grid (400 mesh) for. 5 min at room temperature.

  11. Does Sense of Place Still Exist?

    Directory of Open Access Journals (Sweden)

    Helena Ruotsala

    2008-09-01

    Full Text Available In this article my aim is to discuss place, locality and their role and changed significance in the ethnological studies. I argue that although the meaning and role of place have been changed, place still is an important concept in ethnology. Researches are now paying more attention to the changed nature of the concept, e.g. for the multivocality of places. The anthropological literature on space and place forms my theoretical framework, with which I study some empiric cases from my familiar environment, from Finnish Lapland and from Kola Peninsula. ‘Place’, in my examples the sieidi of Taatsi, Lake Seidjavr, the Pallas fells or the tourist centre Levi, can have a unique reality for each inhabitant and visitor. While the meanings may be shared with others, the views of the place are often likely to be competing, and contested in practice. According to Margaret Rodman (2004: 207, researchers should empower place by returning control over meanings of place to the rightful producers, and empower their own analysis of place by attending to the multiplicity of local voices found about place.

  12. When and How to Take Antibiotics

    Science.gov (United States)

    ... Contact Us General Background: When & How to take Antibiotics When should you take antibiotics? What is the proper dosage? How safe are antibiotics? How does a physician decide which antibiotic to ...

  13. Taking Aspirin to Protect Your Heart

    Science.gov (United States)

    Toolkit No. 23 Taking Aspirin to Protect Your Heart What can taking aspirin do for me? If you are at high risk for or if you have heart disease, taking a low dose aspirin every day may help. Aspirin can also help ...

  14. Management and communication courses – Places available

    CERN Multimedia

    2012-01-01

    Please note that there are some places available in the following management and communication courses starting in September or October. For more information on the course, click on the course title, which will bring you to the training catalogue. You can then sign-up on line. For advice, you can contact Erwin Mosselmans (Tel.: 74125). HR Department Course Next Session Duration Language Availability Personal Awareness & Impact 10-11-12 September 3 days Bilingual 1 place Personal Awareness & Impact 17-18-19 September 3 days 2 places Procurement and Contract Management Training on Supplies 27 September 1 day 3 places Procurement and Contract Management Training on Industrial Services 12 October 1 day 5 places Core Development Package  Essentials of People Management for CERN Supervisors 01-02 October 23-24 January 2013 7-8 March 2013 6 days English 7 places Conflict Resolution for Ma...

  15. Attachment to the physical dimension of places.

    Science.gov (United States)

    Hidalgo, M Carmen; Hernández, Bernardo

    2002-12-01

    Social relationships had been important in explanation and prediction of attachment to places. Although some have asserted the importance of physical aspects of the environment in the formation of attachment ties to a place, the social environment is required for the formation of bonds to a place, although strong emphasis on the social aspect has been questioned and the importance of the physical environment noted. The present objective in two studies was to test whether college students (ns = 30 and 27) show a preference for a place they know, independently of the social interactions developed in them. Results confirmed the hypothesis, i.e., after a very brief stay in a certain place with nobody else there, these college students preferred that place to another with which they had not had previous contact.

  16. Of resilient places: planning for urban resilience

    OpenAIRE

    Mehmood, Abid

    2016-01-01

    This paper argues that resilience of a place cannot necessarily be associated only with the level of its vulnerability to the environment or security. A place-based perspective to resilience helps understand the capacity of communities to withstand or adapt with change. Resilience of a place does not only refer to contingencies—such as formulating immediate responses to crisis situations or incidents such as earthquakes, floods or other disasters in vulnerable areas—but also considers long-te...

  17. Horizons of place in Utzon's Bayview Project

    DEFF Research Database (Denmark)

    Andersen, Michael Asgaard

    In this paper, the horizons of place are discussed in relation to the work of danish architect Jørn Utzon. As one of the most significant personalities of nordic architecture in the second half of the twentieth century, Utzon created a body of work that deals with place in profound and unexpected...... understandings of his work. In doing so, the paper aims at approaching architecture and phenomenology through tensional relationships in the places of Utzon's Bayview project....

  18. Personal development and communication courses – Places available

    CERN Multimedia

    2013-01-01

    There are places available in some personal development and communication courses taking place between February and June 2014.   For more information on the course, click on the course title to access the training catalogue. You can then sign-up online. For advice, you can contact: Erwin Mosselmans, tel. 74125, erwin.mosselmans@cern.ch Nathalie Dumeaux, tel. 78144, nathalie.dumeaux@cern.ch Kerstin Fuhrmeister, tel.70896, Kerstin.fuhrmeister@cern.ch Personal Development & Communication Training Session dates Duration Language Availability Communicating Effectively 18 – 19 March & 15 – 16 April 2 English 2 Gestion de temps Module 1 – 10 February 2014 (am) Module 2 – 21 March 2014  (am) Module 3 – 5 May 2014 (am) 1.5 French 12 Managing time Module 1 – 10 February 2014 (pm) Module 2 – 21 March 2014  (pm) Module 3 – 5 May 2014 (pm) 1.5...

  19. Personal development and communication courses – Places available

    CERN Multimedia

    2013-01-01

    There are places available in some personal development and communication courses taking place between February and June 2014.   For more information on the course, click on the course title to access the training catalogue. You can then sign-up online. For advice, you can contact: Erwin Mosselmans, tel. 74125, erwin.mosselmans@cern.ch Nathalie Dumeaux, tel. 78144, nathalie.dumeaux@cern.ch Kerstin Fuhrmeister, tel.70896, Kerstin.fuhrmeister@cern.ch Personal Development & Communication Training Session dates Duration Language Availability Communicating Effectively 18 – 19 March & 15 – 16 April 2 English 2 Gestion de temps Module 1 – 10 February 2014 (am) Module 2 – 21 March 2014  (am) Module 3 – 5 May 2014 (am) 1.5 French 12 Managing time Module 1 – 10 February 2014 (pm) Module 2 – 21 March 2014  (pm) Module 3 – 5 May 2014 (pm) 1.5 ...

  20. In Search of Place Brand Identity

    DEFF Research Database (Denmark)

    Kvistgaard, Hans-Peter; Blichfeldt, Bodil Stilling; Hird, John

    2015-01-01

    that arise when trying to establish destination brand identity by means of more inclusive, bottom-up approaches. Drawing on both literature studies and the authors’ active involvement in destination branding across more than 50 Danish destinations, particularly the paper discusses how to decide who to give......Place branding relates both to brand identity (what the place is) and brand image (what the place is/should be in the eyes of external audiences). Brand identity can be perceived as the set of values and attributes that those responsible for marketing and development of a place wish to reinforce...