
Sample records for binding takes place

  1. Taking place, screening place

    DEFF Research Database (Denmark)

    Hansen, Kim Toft; Waade, Anne Marit


    We introduce location studies as a new empirical approach to screen studies. Location studies represent an interdisciplinary perspective, including media, aesthetics and geography, and reflect a growing interest in places in a global media and consumption culture. The chapter analyses two recent......) with one being traditional and the other being commercial; both dramas include discussions of localities and social heritage, and both use local sports as a common metaphor for social cohesion; and both series have been partly funded by a local film Danish commissioner. However, The Legacy is shot...... to a large extent in studios, while Norskov is shot entirely on location. The study is based on interviews with producers, broadcasters, location scouts, production designers and writers, as well as quantitative and qualitative textual analyses of television drama series, the geographical places, and related...

  2. Space and Place: Recognizing Ties that Bind. (United States)

    Whiteford, Gary T.


    Suggests methods to test whether students have acquired a sense of place or spatial understanding. Knowledge of the concepts of map representation, the region, man/land notations, spatial relations, location, and scale are vital to geographic understanding. Concludes that geographic ideas should relate to particular maps. (Author/KC)

  3. Then Daddy Takes His Place in an Australian Landscape




    This writing accompanies a 62 minute, single channel, digital film work also titled Then Daddy Takes His Place in an Australian Landscape. The research considers themes of loss and disorientation in the above film and the film practice of Belgian filmmaker Chantal Akerman. Formally, the following writing interweaves critical engagements with Akerman’s films including No Home Movie (2015), Jeanne Dielman, 23 Commerce Quay, 1080 Brussels(1975), Là Bas (2006), with personal stories and reflecti...

  4. Mathematical modeling of phase interaction taking place in materials processing

    International Nuclear Information System (INIS)

    Zinigrad, M.


    The quality of metallic products depends on their composition and structure. The composition and the structure are determined by various physico-chemical and technological factors. One of the most important and complicated problems in the modern industry is to obtain materials with required composition, structure and properties. For example, deep refining is a difficult task by itself, but the problem of obtaining the material with the required specific level of refining is much more complicated. It will take a lot of time and will require a lot of expanses to solve this problem empirically and the result will be far from the optimal solution. The most effective way to solve such problems is to carry out research in two parallel direction. Comprehensive analysis of thermodynamics, kinetics and mechanisms of the processes taking place at solid-liquid-gaseous phase interface and building of the clear well-based physico-chemical model of the above processes taking into account their interaction. Development of mathematical models of the specific technologies which would allow to optimize technological processes and to ensure obtaining of the required properties of the products by choosing the optimal composition of the raw materials. We apply the above unique methods. We developed unique methods of mathematical modeling of phase interaction at high temperatures. These methods allows us to build models taking into account: thermodynamic characteristics of the processes, influence of the initial composition and temperature on the equilibrium state of the reactions, kinetics of homogeneous and heterogeneous processes, influence of the temperature, composition, speed of the gas flows, hydrodynamic and thermal factors on the velocity of the chemical and diffusion processes. The models can be implemented in optimization of various metallurgical processes in manufacturing of steels and non-ferrous alloys as well as in materials refining, alloying with special additives

  5. Does olfactory specific satiety take place in a natural setting? (United States)

    Fernandez, P; Bensafi, M; Rouby, C; Giboreau, A


    Olfactory-specific satiety (OSS) is characterized by a specific decrease in the odor pleasantness of a food eaten to satiety or smelled without ingestion. The usual protocol for studying OSS takes place in laboratory, a setting rather removed from the real world. Here, we set out to examine OSS in a natural setting: during a meal in a restaurant. We hypothesized that an aroma contained in a food that is eaten at the beginning of a meal decreases the pleasantness of the flavor of a food with the same aroma eaten at the end of the meal. In the first experiment (Experiment 1), a test group received an appetizer flavored with a test aroma (anise) at the beginning of the meal. After the main dish, they received a dessert flavored with the same aroma. A control group received the same aromatized dessert, but after a non-aromatized appetizer. This experiment was replicated (Experiment 2) using verbena as the test aroma. For both experiments, results revealed that aroma pleasantness, but not intensity or familiarity, significantly decreased in the test groups vs. the control groups. These findings extend the concept of OSS to a realistic eating context. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Taking into account the binding effects in positronium

    International Nuclear Information System (INIS)

    Tyukhtyaev, Yu.N.


    In order to take into acount the binding of particles in quantum electrodynamics, the Coulomb Green function at all stages of constructing the quasipotential is used. For the first time in the quasipotential approach the contribution of the possitronium ground state splitting from the one-photon direct diagram is calculated up to the α 6 lnα terms

  7. Key European Grid event to take place in Geneva

    CERN Multimedia


    EGEE'06 is the main conference of the EGEE project, which is co-funded by the European Union and hosted by CERN. More than 90 partners all over Europe and beyond are working together in EGEE to provide researchers in both academia and industry with access to major computing resources, independent of their geographic location. The largest user community of the EGEE Grid is the High-Energy Physics community and in particular the LHC experiments, which are already making heavy use of the infrastructure to prepare for data taking. However, with the many new challenges faced by EGEE in its second phase that started in April this year, an even broader audience than at previous EGEE conferences is expected. In particular, a large number of related Grid projects will feature prominently in both plenary and parallel sessions during the 5 days of this event. Industry will also be well represented, highlighting the EGEE project's commitment to technology transfer to industry. CERN is the host of the conference, which i...

  8. 4th openlab Board of Sponsors Meeting takes place at CERN on July 6, 2005

    CERN Multimedia

    Patrice Loïez


    The 4th openlab Board of Sponsors Meeting is taking place at CERN, room 513, 1-024, the 6th July 2005. The meeting will open with an Executive Session in the presence of Dr. Robert Aymar, Director General of CERN

  9. Waste Disposal: Processes Taking Place (on the way) from the Repository to the Biosphere

    International Nuclear Information System (INIS)

    Put, M.


    The main objective of SCK-CEN's R and D programme on the processes taking place on the way from the repository to the biosphere is to provide reliable and defensible models and parameters on the migration of dissolved radionuclides and gases through the host formation (Boom Clay) and the backfill materials of a deep geological repository for high level radioactive waste. The programme and main achievements in this topical area in 1999 are summarised

  10. Diffusion mechanisms taking place at the early stages of cobalt deposition on Au(111)

    International Nuclear Information System (INIS)

    Oviedo, O A; Leiva, E P M; Mariscal, M M


    In the present work a detailed atomic-level analysis of some of the main diffusion mechanisms which take place during cobalt adatom deposition are studied within atom dynamics (AD) and the nudged elastic band (NEB) method. Our computer simulations reveal a very fast exchange between Co and Au atoms when the deposit is a single cobalt adatom. However, when the nucleus size increases, a decrease in the exchange probability is observed. Activation energies for different transitions are obtained using AD in combination with the NEB method


    Directory of Open Access Journals (Sweden)

    Birsen ÇİLEROĞLU


    Full Text Available Spor ts occupies the first place among most siginificant factors increasing quality of life . It has b ecome difficult to allocate proper time for sports in the course of heavy work pace and flow of life . Such circumstances have led people to increase minor sport activities which could be done during short times allocated from daily living, thus, orienting people‟s clothing preference towards sportswear . The feeling of easiness and comfort sportswear offer to individuals enhances further such preference . The feeling of comfort individuals feel in their clothing depends on the presence of physiologic and psy chologic coherence between their bodies and environment . Demand for sportswear allowing easy - movement increased upon rise in life dynamism and standards, it began to be preferred regarding comfort of use and to take its place in daily clothing, too, define d as “casual” clothing . Spor tswear being preferred very much ; has caused the firms making and producing fashion and clothing design to give place in their collections to sportswear category . Particularly, in firms where model and clothing varieties are pl enty and new model design is made in short intervals, named as, “fast fashion” , tendency towards sportswear is growing increasingly . The sale rates of sportswear, utilization rates of which are growing increasingly, has maximum value among total clothing s ales in E - business field, too. In this research, it has been aimed to determine the features of sportswear taking place in “fast fashion” clothing collections . In order to accomplish this aim, 2014 collections of four different brands taking place in natio nal and international markets have been examined through visual analysis method . In the examinations; sportswear styles of the brand, model and style differences between brands and states of using 2014 fashion trends have been taken into account. The data obtained at the end of the analyses made have been

  12. [Marketing approval and market surveillance of medical devices in Germany: Where does policy integration take place?]. (United States)

    Lang, Achim


    Since 2011 new regulatory measures regarding medical devices have been set up with the aim to eliminate obstacles to innovations and to find more coordinated ways to marketing authorisation and market surveillance. This essay investigates whether these new and existing coordination mechanisms build up to a Joined-up Government approach. The analysis shows that the regulatory process should be adjusted along several dimensions. First, many organisations lack awareness regarding their stakeholders and focus solely on their immediate organisational activities. Second, the regulatory process (marketing authorisation and market surveillance) is too fragmented for an effective communication to take place. Finally, the underlying strategy process is an ad-hoc approach lacking continuity and continued involvement of, in particular, the responsible federal ministries. Copyright © 2013. Published by Elsevier GmbH.

  13. What it Takes to Successfully Implement Technology for Aging in Place: Focus Groups With Stakeholders. (United States)

    Peek, Sebastiaan Theodorus Michaël; Wouters, Eveline J M; Luijkx, Katrien G; Vrijhoef, Hubertus J M


    There is a growing interest in empowering older adults to age in place by deploying various types of technology (ie, eHealth, ambient assisted living technology, smart home technology, and gerontechnology). However, initiatives aimed at implementing these technologies are complicated by the fact that multiple stakeholder groups are involved. Goals and motives of stakeholders may not always be transparent or aligned, yet research on convergent and divergent positions of stakeholders is scarce. To provide insight into the positions of stakeholder groups involved in the implementation of technology for aging in place by answering the following questions: What kind of technology do stakeholders see as relevant? What do stakeholders aim to achieve by implementing technology? What is needed to achieve successful implementations? Mono-disciplinary focus groups were conducted with participants (n=29) representing five groups of stakeholders: older adults (6/29, 21%), care professionals (7/29, 24%), managers within home care or social work organizations (5/29, 17%), technology designers and suppliers (6/29, 21%), and policy makers (5/29, 17%). Transcripts were analyzed using thematic analysis. Stakeholders considered 26 different types of technologies to be relevant for enabling independent living. Only 6 out of 26 (23%) types of technology were mentioned by all stakeholder groups. Care professionals mentioned fewer different types of technology than other groups. All stakeholder groups felt that the implementation of technology for aging in place can be considered a success when (1) older adults' needs and wishes are prioritized during development and deployment of the technology, (2) the technology is accepted by older adults, (3) the technology provides benefits to older adults, and (4) favorable prerequisites for the use of technology by older adults exist. While stakeholders seemed to have identical aims, several underlying differences emerged, for example, with regard

  14. Model of Wagons’ Placing-In and Taking-Out Problem in a Railway Station and Its Heuristic Algorithm

    Directory of Open Access Journals (Sweden)

    Chuijiang Guo


    Full Text Available Placing-in and taking-out wagons timely can decrease wagons’ dwell time in railway stations, improve the efficiency of railway transportation, and reduce the cost of goods transportation. We took the locomotive running times between goods operation sites as weights, so the wagons’ placing-in and taking-out problem could be regarded as a single machine scheduling problem, 1pijCmax, which could be transformed into the shortest circle problem in a Hamilton graph whose relaxation problem was an assignment problem. We used a Hungarian algorithm to calculate the optimal solution of the assignment problem. Then we applied a broken circle and connection method, whose computational complexity was O(n2, to find the available satisfactory order of wagons’ placing-in and taking-out. Complex problems, such as placing-in and transferring combined, taking-out and transferring combined, placing-in and taking-out combined, or placing-in, transferring, and taking-out combined, could also be resolved with the extended algorithm. A representative instance was given to illustrate the reliability and efficiency of our results.

  15. Should developing countries take on binding commitments in a climate agreement? A cost-benefit analysis

    International Nuclear Information System (INIS)

    Kallbekken, Steffen; Westskog, Hege


    This paper explores the costs and benefits for all parties to a future climate agreement of developing countries taking on binding commitments. Such commitments would allow developing countries to participate in emissions trading, which has significantly lower transaction costs than the present Clean Development Mechanism (CDM). Thus we analyse whether the efficiency gains obtained by participating in emissions trading can offset the economic risk (due to the fact that future emissions cannot be known) incurred by taking on binding commitments. We use a dynamic computable general equilibrium model to carry out the analysis. We find that the efficiency gains that can be obtained by developing countries might not be very large compared to the risks they incur. Developing countries might therefore have good reasons not to embrace ''cap and trade'' emissions trading. (author)

  16. Taking back place-names – from dusty library to digital life

    DEFF Research Database (Denmark)

    Knudsen, Bo Nissen

    Danish place-names have been under publication since 1922 in the scientific series Danmarks Stednavne (Place-Names of Denmark) but only recently the huge project of a digitization of the series has been undertaken. Around 120,000 name articles are now on their way to the web as part of the Digital...... atlas of the Danish historical-administrative geography. Digitization and presentation of a scientific place-names edition poses many interesting problems in itself, especially regarding the variation over time in both the selection of names and the build-up of scholarly knowledge. How are we to convey...... mobility of the book format into a digital context – by making the content available as an application for mobile devices such as smart phones and iPads? Adding geocodes to the name articles could open up the possibility of a digital place-name lexicon allowing the end user to move around in a place...

  17. DSC studies of retrogradation and amylose-lipid transition taking place in gamma-irradiated wheat starch

    International Nuclear Information System (INIS)

    Ciesla, K.; Gluszewski, W.; Eliasson, A.C.


    It has been already shown that degradation resulting from gamma irradiation induces a decrease in order of starch granules and influences gelatinisation taking place during heating of starch and flour suspensions. In presented paper, DSC (differential scanning calorimetry) studies were carried out for wheat starch, non-irradiated and irradiated using doses in the range from 5 to 30 kGy. The influence of the conditions applied during DSC measurements on the possibility to observe differences between the amylose-lipid complex transition and retrogradation taking place in the non-irradiated and particularly irradiated starch samples was checked. The better differentiation between the amylose-lipid complex transition taking place in particular samples accompanied by the better reproducity were obtained in the case of dense suspensions as compared to the watery suspensions as well as during the first analysis performed for the recrystallised gels

  18. What it takes to successfully implement technology for aging in place: focus groups with stakeholders

    NARCIS (Netherlands)

    Eveline J.M. Wouters; Katrien G. Luijkx; Hubertus J.M. Vrijhoef; Sebastiaan Theodorus Michaël Peek MSc


    BACKGROUND: There is a growing interest in empowering older adults to age in place by deploying various types of technology (ie, eHealth, ambient assisted living technology, smart home technology, and gerontechnology). However, initiatives aimed at implementing these technologies are complicated by

  19. Advice from Rural Elders: What It Takes to Age in Place (United States)

    Dye, Cheryl J.; Willoughby, Deborah F.; Battisto, Dina G.


    Older adults prefer to age in place (AIP), and there are psychological, physiological, and economic benefits in doing so. However, it is especially challenging to AIP in rural communities. AIP models have been tested in urban settings and age-segregated communities, but they are not appropriate for rural communities. This paper presents rural AIP…





    Sports occupies the first place among most siginificant factors increasing quality of life. It has become difficult to allocate proper time for sports in the course of heavy work pace and flow of life. Such circumstances have led people to increase minor sport activities which could be done during short times allocated from daily living, thus, orienting people’s clothing preference towards sportswear. The feeling of easiness and comfort sportswear offer to individuals enhances further such pr...

  1. Beyond stereotypes of adolescent risk taking: Placing the adolescent brain in developmental context

    Directory of Open Access Journals (Sweden)

    Daniel Romer


    Full Text Available Recent neuroscience models of adolescent brain development attribute the morbidity and mortality of this period to structural and functional imbalances between more fully developed limbic regions that subserve reward and emotion as opposed to those that enable cognitive control. We challenge this interpretation of adolescent development by distinguishing risk-taking that peaks during adolescence (sensation seeking and impulsive action from risk taking that declines monotonically from childhood to adulthood (impulsive choice and other decisions under known risk. Sensation seeking is primarily motivated by exploration of the environment under ambiguous risk contexts, while impulsive action, which is likely to be maladaptive, is more characteristic of a subset of youth with weak control over limbic motivation. Risk taking that declines monotonically from childhood to adulthood occurs primarily under conditions of known risks and reflects increases in executive function as well as aversion to risk based on increases in gist-based reasoning. We propose an alternative Life-span Wisdom Model that highlights the importance of experience gained through exploration during adolescence. We propose, therefore, that brain models that recognize the adaptive roles that cognition and experience play during adolescence provide a more complete and helpful picture of this period of development.


    Directory of Open Access Journals (Sweden)

    Esengül KÖSE


    Full Text Available In this study, 20 physicochemical parameters were measured mountly in 2007 and seasonaly in 2008 and 2009 on Akpınar Stream, which is located within the borders of Denizli and has 13 trout production facility. The data obtained were evaluated according to the fresh water fish directive which was agreed by the Commision of European Union (EC Directives and Water Pollution Control Regulation Criteria. We determined that, the measured parameters on the first station do not constitute any risk for Salmonids and Cyprinids according to EC Directives and in the second station, the valuesof biological oxygen demand and nitrite were high enough to adversely affect the health of fish. There is not a significant difference between two stations for the parameters of oxygen, nitrate, totalnitrogen, pH, chemical oxygen demand, acid binding capacity, total hardness and chlorine. The parametes of total suspended solids, ammonium, nitrite, secondary phosphate, total phosphorus, organicmatter, ammonia, biological oxygen demand, turbidity, temperature and flow rate were significantly high in second station (p<0.05. The reason of high levels of the parameters especially origin of organic pollution in the secod station is fish feces and feed wastes which directly given into the water. Settling ponds should be used properly and controls should be provided to increase for more healtyproduction.

  3. Understanding Where Americas Public Discussion Takes Place In Todays Society: Case Studies of Concealed Weapons Carry Reform (United States)


    arguing that concealed carry permit holders are a danger to public safety and that mass shootings are taking place by citizens who are legally armed.2...who worked at an abortion clinic that had recently been bombed and whose life had been threatened was denied a license to carry because he was not...populace. The new law laid out new prohibitions and penalties enforceable statewide. Additionally, the Preemption Act was necessary to set the legal

  4. Coronavirus and influenza virus proteolytic priming takes place in tetraspanin-enriched membrane microdomains. (United States)

    Earnest, James T; Hantak, Michael P; Park, Jung-Eun; Gallagher, Tom


    Coronaviruses (CoVs) and low-pathogenicity influenza A viruses (LP IAVs) depend on target cell proteases to cleave their viral glycoproteins and prime them for virus-cell membrane fusion. Several proteases cluster into tetraspanin-enriched microdomains (TEMs), suggesting that TEMs are preferred virus entry portals. Here we found that several CoV receptors and virus-priming proteases were indeed present in TEMs. Isolated TEMs, when mixed with CoV and LP IAV pseudoparticles, cleaved viral fusion proteins to fusion-primed fragments and potentiated viral transductions. That entering viruses utilize TEMs as a protease source was further confirmed using tetraspanin antibodies and tetraspanin short hairpin RNAs (shRNAs). Tetraspanin antibodies inhibited CoV and LP IAV infections, but their virus-blocking activities were overcome by expressing excess TEM-associated proteases. Similarly, cells with reduced levels of the tetraspanin CD9 resisted CoV pseudoparticle transductions but were made susceptible by overproducing TEM-associated proteases. These findings indicated that antibodies and CD9 depletions interfere with viral proteolytic priming in ways that are overcome by surplus proteases. TEMs appear to be exploited by some CoVs and LP IAVs for appropriate coengagement with cell receptors and proteases. Enveloped viruses use their surface glycoproteins to catalyze membrane fusion, an essential cell entry step. Host cell components prime these viral surface glycoproteins to catalyze membrane fusion at specific times and places during virus cell entry. Among these priming components are proteases, which cleave viral surface glycoproteins, unleashing them to refold in ways that catalyze virus-cell membrane fusions. For some enveloped viruses, these proteases are known to reside on target cell surfaces. This research focuses on coronavirus and influenza A virus cell entry and identifies TEMs as sites of viral proteolysis, thereby defining subcellular locations of virus

  5. Let us play: (unshackling liaisons, (unmasking games and (unhindered dialogue in the arena where theology takes place

    Directory of Open Access Journals (Sweden)

    Tanya van Wyk


    Full Text Available This contribution is a political-theological and hermeneutical reflection on the origin, nature, intention and contribution of a research theme identified within the dynamics of an institutional space, by taking a critical look at the �rules� and the �game� of university academia. Specific reference is made to institutional and faculty research themes, namely �reconciling diversity� and �Ecodomy � life in its fullness�. The institutional academic space is compared to a Hunger Games-style panopticon, with its �rules� and �play�. It is argued that these research themes can only make an authentic contribution if the �play� and �game�of the space in which these themes originate, are deconstructed. If this deconstruction can take place, there might be an authentic chance for unhindered dialogue towards the transformation of the academic space and the greater community it serves.

  6. Daring the Foolish to Take Darwin Tests: The Ethical Double Bind of Betting On Natural Hazards (United States)

    Halpern, J. B.


    While couched in the framework of concentrating minds betting on natural hazards carries an ethical cost. When children dare each other to do risky things parents know that when such dares are taken harm frequently occurs. Giving those who claim that there is no hazard financial reasons to avoid ameliorative actions or to double down in support of their public stance requires a moral calculation. Challenging the conclusions of those who accept such bets while denying danger will lead them to attempt to save face by increasing risk to themselves or others. Thus such wagers, whether person to person or on betting markets, require balancing between alerting the opposing party and others to the risks of not taking action, the associated scientific consensus and the possible harmful outcomes of the bets themselves. This talk will describe strategies for minimizing potential harm while maximizing the instructive component of climate bets. Best practices include having the bet rest on a technical issue that can be authoritatively resolved in a short time. Unfortunately the nature of natural hazard risks makes it difficult to meet all of these criteria, but those making such bets should be aware of the ethical double bind

  7. The albedo problem in the case of multiple synthetic scattering taking place in a plane-symmetric slab

    International Nuclear Information System (INIS)

    Shafiq, A.; Meyer, H.E. de; Grosjean, C.C.


    An approximate model based on an improved diffusion-type theory is established for treating multiple synthetic scattering in a homogeneous slab of finite thickness. As in the case of the exact treatment given in the preceding paper (Part I), it appears possible to transform the considered transport problem into an equivalent fictitious one involving multiple isotropic scattering, therefore permitting the application of an established corrected diffusion theory for treating isotropic scattering taking place in a convex homogeneous medium bounded by a vacuum in the presence of various types of sources. The approximate values of the reflection and transmission coefficients are compared with the rigorous values listed in Part I. In this way, the high accuracy of the approximation is clearly demonstrated. (author)

  8. DSC Studies of Retrogradation and Amylose-Lipid Complex Transition Taking Place in Gamma Irradiated Wheat Starch

    International Nuclear Information System (INIS)

    Ciesla, K.


    Degradation resulting from gamma irradiation induces decrease in order of starch granules and influences the processes occurring in starch-water system. Differential scanning calorimetry (DSC) was applied at present for studying the effect of radiation with doses of 5 - 30 kGy on amylose-lipid complex transition and retrogradation occurring in wheat starch gels. Influence of the conditions applied during DSC measurements and intermediate storage was tested on the possibility to observe radiation effect. Wheat starch was irradiated with 60 C o gamma rays in a gamma cell Issledovatiel placed in the Department of Radiation Chemistry, INCT. DSC measurements were performed for ca. 50% and ca. 20% gels during heating - cooling - heating cycles (up to 3 cycles) in the temperature range 10 - 150 degree at heating and cooling rates of 10, 5 and 2.5 degree min - 1. The Seiko DSC 6200 calorimeter was used. Decrease in amylose-lipid complex transition temperature was found already after irradiation of wheat starch with a dose of 5 kGy showing modificatin of the complex structure. The differences between the irradiated and the non-irradiated samples became the easier seen in the every foregoing heating or cooling cycle as compared to the preceeding one. It is because that thermal treatment causes decrease of transition temperature in all the irradiated samples, with no effect or increase of that temperature observed in the non-irradiated ones. Irradiation hinders retrogradation taking place in ca. 50% gels but facilitates retrogradation occurring in ca. 20 % gels. Moreover, the expanded differences between the amylose-lipid complex formed in the irradiated and non-irradiated gels result due to their recrystallisation. Storage of the gels induces decrease in the temperature of the complex transition as compared to the last cycle of the first analysis. That decrease was, however, more significant in the case of all the irradiated samples than in the case of the initial sample. In

  9. Where and How Do Aging Processes Take Place in Everyday Life? Answers From a New Materialist Perspective

    Directory of Open Access Journals (Sweden)

    Grit Höppner


    Full Text Available In the last decade, the focus of studies on age and aging has fundamentally changed from biological to symbolic, discursive, and cultural phenomena. Currently, the most studied topic in material gerontology is the materiality of age and aging in the context of everyday life. Scholars in this area have thus been making an important contribution to a material understanding of aging processes. As we understand them, however, both social constructivist and material gerontological concepts reach their limit when it comes to the questions of where and how aging processes actually take place in everyday life. In order to answer these two questions, we review social constructivist ideas with a particular focus on the “doing age” concept and material gerontological assumptions regarding human subjects, their material environments, and their relations. We then suggest rethinking bodily limitations and agencies addressed by scholars in the field of new materialism. The aim is to develop a new materialist-inspired understanding of aging processes that helps to reconstruct the material-discursive co-production of aging processes. These processes are deployed as mutual entanglements of materiality and meaning as well as of humans and non-human agency. This approach emphasizes the decentralization of the human actor and thus helps to map the material-discursive complexity of aging processes as relational co-products of humans and non-humans in everyday life.

  10. What does it take to make them stay? : how place satisfaction relates to willingness to stay of the creative class


    Annell, Jonas; Terman, Felix


    Swedish students in smaller university host cities leave in favor of more attractive places after having completed their studies. Failing to retain newly graduated students is a problem for university host cities as educated people are associated with the group referred to as the creative class. Members of the creative class are drivers of regional economic growth, and have historically proven to be important for creating and developing the well-being of cities. Different place attributes hav...

  11. Young People Take Their Rightful Places as Full and Contributing Members of a World Class Workforce: Philadelphia Youth Network Annual Report 2006 (United States)

    Philadelphia Youth Network, 2006


    The title of this year's annual report has particular meaning for all of the staff at the Philadelphia Youth Network. The phrase derives from Philadelphia Youth Network's (PYN's) new vision statement, developed as part of its recent strategic planning process, which reads: All of our city's young people take their rightful places as full and…

  12. NS [Nuclear Safety] update. Current safety and security activities and developments taking place in the Department of Nuclear Safety and Security, Issue no. 6, March 2008

    International Nuclear Information System (INIS)


    The current issue presents information about the following activities: 1) International Conference on Illicit Nuclear Trafficking which took place in November 2007 in Edinburgh. The principal aim of the conference was to examine the threat and context of illicit nuclear trafficking of radioactive material, specifically, what is being done to combat such trafficking and where more needs to be done. The conference was also to consider how the obligations and commitments of the legally binding and non-binding international instruments could be and are being implemented by various States. 2) INSAG Message on Nuclear Safety Infrastructure in which the INSAG Chairman Richard Meserve addressed nuclear safety in the current context and various issues that warrant special attention. 3) approved for publication the Safety Requirements publication on Safety of Nuclear Fuel Cycle Facilities. 4) The Asian Nuclear Safety Network (ANSN)

  13. Stuck between a ROC and a hard place? Barriers to the take up of green energy in the UK

    International Nuclear Information System (INIS)

    Diaz-Rainey, Ivan; Ashton, John K.


    This paper examines the UK mechanisms for ensuring future investment in renewable energy through consumer adoption of green energy tariffs and the Renewable Obligation Certificate (ROC) system. Using a national survey and focus groups the stated willingness by UK customers to pay a premium for renewable or green energy and actual take up of such tariffs is assessed. Substantial differences between willingness to pay for and the adoption of green energy tariffs are reported. This disparity is linked to a range of factors including consumer confusion, lack of supply, complexities of constructing 'green source' tariffs under the ROC system and a lack of customer trust. It is concluded that the re-definition of the green energy market in favour of 'green source' tariffs, greater direct compliance with the Renewable Obligation by addressing supply constraints, and efforts in providing clearer information and choices for consumers via a compulsory green energy accreditation scheme are required if willing consumers' are to contribute to investment in renewable energy

  14. The Investigation of Mobbing Events Taking Place at Higher Education Institutions in Turkey Considering the Reflections on Media

    Directory of Open Access Journals (Sweden)

    Çubukçu Zühal


    considering that they are published nationally, reference newspapers and belong to different publication groups. The data used in this study was taken from the archive of the three newspapers. When the archives of the newspapers was scanned, the word “mobbing” was taken as key word for the search. In qualitative researches, newspapers are considered to be public archive and used as reference documents. The data obtained was grouped depending on the newspapers which it was taken from, on the year of publication, on where they took place, on the gender of the victims and on who the sufferers are.

  15. Out of Place, Out of Mind: Schema-Driven False Memory Effects for Object-Location Bindings (United States)

    Lew, Adina R.; Howe, Mark L.


    Events consist of diverse elements, each processed in specialized neocortical networks, with temporal lobe memory systems binding these elements to form coherent event memories. We provide a novel theoretical analysis of an unexplored consequence of the independence of memory systems for elements and their bindings, 1 that raises the paradoxical…

  16. The Role of Endogenous D2 Receptor Levels in Morphine Addiction: A Correlative Study of Morphine Place Conditioning and In Vivo [3H]-Raclopride Binding

    Energy Technology Data Exchange (ETDEWEB)

    Khan, N.; Gatley, S.


    Dopamine is a neurotransmitter that has a wide array of effects on an individual’s mental state. It is vital in the regulation of motor skills and in generating the effects of substance abuse. This study examined the dopamine D2 receptors found in the striatum of the brain. The impetus for investigating this receptor lies in the perception that it plays an influential role in drug addiction. It has been conjectured on the basis of human PET studies that possession of low levels of D2 receptors will heighten an individual’s susceptibility to drug addiction. However, an alternative explanation of low D2 receptor levels in drug dependent individuals is that these levels are a consequence of drug abuse. To understand this phenomenon, the present study employed the paradigm of conditioned place preference (CPP). In CPP, individuals of an out-bred mouse strain are observed to spend time in environments where they had previously been exposed to a drug that is abused by humans. The drug chosen for our studies was morphine because it has been previously shown to generate a robust place preference in mice and is a prototypic abused drug in humans. D2 receptor levels were quantified using an in vivo binding study involving [3H]raclopride, a radioactive compound that binds to D2 receptors. The results showed a significant place preference for morphine following the conditioning procedure. Additionally, data from the binding analysis agreed with previous studies that the striatum contains high levels of D2 receptors. However, there was no consistent relationship between the extent of morphine CPP and D2 receptor levels as revealed by [3H]-RAC binding. This finding does not support the hypothesis that low levels of D2 receptors predispose a mouse to easy morphine conditioning. Further experiments are required to determine the ability to generalize our findings to other species and other drugs of abuse.

  17. When and Where Learning is Taking Place: Multisynaptic Changes in Strength During Different Behaviors Related to the Acquisition of an Operant Conditioning Task by Behaving Rats. (United States)

    Fernández-Lamo, Iván; Delgado-García, José M; Gruart, Agnès


    Although it is generally assumed that brain circuits are modified by new experiences, the question of which changes in synaptic efficacy take place in cortical and subcortical circuits across the learning process remains unanswered. Rats were trained in the acquisition of an operant conditioning in a Skinner box provided with light beams to detect animals' approaches to lever and feeder. Behaviors such as pressing the lever, eating, exploring, and grooming were also recorded. Animals were chronically implanted with stimulating and recording electrodes in hippocampal, prefrontal, and subcortical sites relevant to the task. Field synaptic potentials were evoked during the performance of the above-mentioned behaviors and before, during, and after the acquisition process. Afferent pathways to the hippocampus and the intrinsic hippocampal circuit were slightly modified in synaptic strength during the performance of those behaviors. In contrast, afferent and efferent circuits of the medial prefrontal cortex were significantly modified in synaptic strength across training sessions, mostly at the moment of the largest change in the learning curve. Performance of behaviors nondirectly related to the acquisition process (exploring, grooming) also evoked changes in synaptic strength across training. This study helps to understand when and where learning is being engraved in the brain. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  18. Binding energy and optical properties of an off-center hydrogenic donor impurity in a spherical quantum dot placed at the center of a cylindrical nano-wire

    International Nuclear Information System (INIS)

    Safarpour, Gh.; Barati, M.; Zamani, A.; Niknam, E.


    The binding energy as well as the linear, third-order nonlinear and total optical absorption coefficient and refractive index changes of an off-center hydrogenic donor impurity in an InAs spherical quantum dot placed at the center of a GaAs cylindrical nano-wire have been investigated. In this regard, the effective-mass approximation approach is considered and eigenvalues and corresponding eigenfunctions are calculated via the finite element method. The binding energy is plotted as a function of the dot size and impurity position along with optical properties as a function of photon energy. In this study two different directions have been considered for impurity position, along the nano-wire axis and perpendicular to it. It has been found that the binding energy, absorption coefficient and refractive index changes are impressively affected not only by the dot radius but also by the position of the impurity and its direction. Additionally, the optical saturation can be tuned by the direction of the impurity and incident optical intensity. -- Highlights: • We consider spherical quantum dot located at the center of a cylindrical nano-wire. • An off-center hydrogenic donor impurity is considered in the system. • Binding energy is affected by orientation of impurity and its distance from center. • Saturation depends on the orientation of impurity position. • By shifting impurity position, orientation and dot radius blue- and red-shifts appear

  19. Thin Places


    Lockwood, Sandra Elizabeth


    This inquiry into the three great quests of the twentieth century–the South Pole, Mount Everest, and the Moon–examines our motivations to venture into these sublime, yet life-taking places. The Thin Place was once the destination of the religious pilgrim seeking transcendence in an extreme environment. In our age, the Thin Place quest has morphed into a challenge to evolve beyond the confines of our own physiology; through human ingenuity and invention, we reach places not meant to accommod...

  20. Effect of health-promoting posters placed on the platforms of two train stations in Copenhagen, Denmark, on the choice between taking the stairs or the escalators

    DEFF Research Database (Denmark)

    Iversen, Mette Kathrine; Händel, M N; Nydal Jensen, Eva


    OBJECTIVE: The purpose of this study was to determine whether posters placed on the platforms of two train stations in Copenhagen, promoting use of the stairs, would encourage people to use the stairs rather than the adjacent escalator. An additional purpose was to see if the effect of the interv......OBJECTIVE: The purpose of this study was to determine whether posters placed on the platforms of two train stations in Copenhagen, promoting use of the stairs, would encourage people to use the stairs rather than the adjacent escalator. An additional purpose was to see if the effect...... of the intervention was maintained for a week after the poster was removed. MEASUREMENTS: The number of people using stairs and escalators at Copenhagen Central Station and Østerport Train Station in Copenhagen was recorded before and during posters promoting stair use were placed on the platforms, and a week after...... the posters were removed. Two years after the posters were removed, data were collected for 1 week at Østerport Train Station (long-term post-intervention). RESULTS: At Copenhagen Central Station, the overall stair use increased from 12% before the intervention to 16% (P

  1. NS [Nuclear Safety] update. Current safety and security activities and developments taking place in the Department of Nuclear Safety and Security, Issue no. 8, September 2008

    International Nuclear Information System (INIS)


    The current issue presents information about the following activities: 1) International Workshops on Denial of Shipments raise awareness of suppliers, recipients, regulators, carriers/consignors and international organizations of the problems relating to denials of radioactive shipments to determine effective measures to prevent or reduce the instances of shipment denials and delays. 2) Communication and knowledge Management in the Department of Nuclear Safety and Security (NS). 3) Nuclear Security at the Beijing Olympics - an excellent example of the IAEA's work in protecting large scale public events. 4) The Incident and Emergency Centre's Participation in the ConvEx 3 Exercise, 9-10 July 2008, which took place at the Laguna Verde nuclear power plant in Mexico. During the 43 hour long exercise, the Incident and Emergency Centre (IEC) was fully activated. Staff members participating in the exercise represented different departments within the IAEA and the diversity of their knowledge and experience ensured an effective response

  2. NS [Nuclear Safety] update. Current safety and security activities and developments taking place in the Department of Nuclear Safety and Security. Issue no. 2, January 2007

    International Nuclear Information System (INIS)


    This newsletter reports on the training of cardiologists in radiation protection, IAEA's safety review services and the operational safety assessment review team (OSART), the international conference on management of spent fuel and the recent INSAG (International Nuclear Safety Group) publications. The IAEA has begun a major international initiative to train interventional cardiologists in radiation protection. Starting with the first course in May 2004, so far 6 regional and 3 national training courses have been conducted with the participation of over 400 health professionals putting the IAEA in a leading role in this area. A programme of two days' training has been developed, covering possible and observed radiation effects among patients and staff, international standards, dose management techniques, examples of good and bad practice and examples indicating prevention of possible injuries as a result of good practice in radiation protection. The training material is freely available on CD and will be placed on the Radiological Protection of Patients website at

  3. Place-focused physical activity research, human agency, and social justice in public health: taking agency seriously in studies of the built environment. (United States)

    Blacksher, Erika; Lovasi, Gina S


    Built environment characteristics have been linked to health outcomes and health disparities. However, the effects of an environment on behavior may depend on human perception, interpretation, motivation, and other forms of human agency. We draw on epidemiological and ethical concepts to articulate a critique of research on the built environment and physical activity. We identify problematic assumptions and enumerate both scientific and ethical reasons to incorporate subjective perspectives and public engagement strategies into built environment research and interventions. We maintain that taking agency seriously is essential to the pursuit of health equity and the broader demands of social justice in public health, an important consideration as studies of the built environment and physical activity increasingly focus on socially disadvantaged communities. Attention to how people understand their environment and navigate competing demands can improve the scientific value of ongoing efforts to promote active living and health, while also better fulfilling our ethical obligations to the individuals and communities whose health we strive to protect. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Leaf processing behaviour in Atta leafcutter ants: 90% of leaf cutting takes place inside the nest, and ants select pieces that require less cutting. (United States)

    Garrett, Ryan W; Carlson, Katherine A; Goggans, Matthew Scott; Nesson, Michael H; Shepard, Christopher A; Schofield, Robert M S


    Leafcutter ants cut trimmings from plants, carry them to their underground nests and cut them into smaller pieces before inoculating them with a fungus that serves as a primary food source for the colony. Cutting is energetically costly, so the amount of cutting is important in understanding foraging energetics. Estimates of the cutting density, metres of cutting per square metre of leaf, were made from samples of transported leaf cuttings and of fungal substrate from field colonies of Atta cephalotes and Atta colombica. To investigate cutting inside the nest, we made leaf-processing observations of our laboratory colony, A. cephalotes. We did not observe the commonly reported reduction of the leaf fragments into a pulp, which would greatly increase the energy cost of processing. Video clips of processing behaviours, including behaviours that have not previously been described, are linked. An estimated 2.9 (±0.3) km of cutting with mandibles was required to reduce a square metre of leaf to fungal substrate. Only about 12% (±1%) of this cutting took place outside of the nest. The cutting density and energy cost is lower for leaf material with higher ratios of perimeter to area, so we tested for, and found that the laboratory ants had a preference for leaves that were pre-cut into smaller pieces. Estimates suggest that the energy required to transport and cut up the leaf material is comparable to the metabolic energy available from the fungus grown on the leaves, and so conservation of energy is likely to be a particularly strong selective pressure for leafcutter ants.

  5. Hypoxia and inactivity related physiological changes precede or take place in absence of significant rearrangements in bacterial community structure: The PlanHab randomized trial pilot study.

    Directory of Open Access Journals (Sweden)

    Robert Šket

    Full Text Available We explored the assembly of intestinal microbiota in healthy male participants during the randomized crossover design of run-in (5 day and experimental phases (21-day normoxic bed rest (NBR, hypoxic bed rest (HBR and hypoxic ambulation (HAmb in a strictly controlled laboratory environment, with balanced fluid and dietary intakes, controlled circadian rhythm, microbial ambiental burden and 24/7 medical surveillance. The fraction of inspired O2 (FiO2 and partial pressure of inspired O2 (PiO2 were 0.209 and 133.1 ± 0.3 mmHg for NBR and 0.141 ± 0.004 and 90.0 ± 0.4 mmHg for both hypoxic variants (HBR and HAmb; ~4000 m simulated altitude, respectively. A number of parameters linked to intestinal environment such as defecation frequency, intestinal electrical conductivity (IEC, sterol and polyphenol content and diversity, indole, aromaticity and spectral characteristics of dissolved organic matter (DOM were measured (64 variables. The structure and diversity of bacterial microbial community was assessed using 16S rRNA amplicon sequencing. Inactivity negatively affected frequency of defecation and in combination with hypoxia increased IEC (p < 0.05. In contrast, sterol and polyphenol diversity and content, various characteristics of DOM and aromatic compounds, the structure and diversity of bacterial microbial community were not significantly affected over time. A new in-house PlanHab database was established to integrate all measured variables on host physiology, diet, experiment, immune and metabolic markers (n = 231. The observed progressive decrease in defecation frequency and concomitant increase in IEC suggested that the transition from healthy physiological state towards the developed symptoms of low magnitude obesity-related syndromes was dose dependent on the extent of time spent in inactivity and preceded or took place in absence of significant rearrangements in bacterial microbial community. Species B. thetaiotamicron, B. fragilis, B

  6. Designated Places (United States)

    California Natural Resource Agency — Census 2000 Place Names provides a seamless statewide GIS layer of places, including census designated places (CDP), consolidated cities, and incorporated places,...

  7. Taking climate to the market

    International Nuclear Information System (INIS)

    Boyle, S.


    Since the 1997 Kyoto Protocol set binding targets for greenhouse gas reductions, there has been a rapid increase in interest in emissions trading. This is based on the premise that reduction options may be cheaper in countries such as those of eastern Europe and the developing world, than in others such as the USA and Norway. As long as real emission reductions take place, and given that climate change is a global problem, setting up an emissions trading market should provide a much cheaper option than reductions applied solely at a national level. The real prospects for a viable market, what it will look like, and the deals already taking place are examined. (UK)

  8. Major growth in coke production takes place

    International Nuclear Information System (INIS)

    Swain, E.J.


    U.S. petroleum coke production has increased 64% during the 10-year period from 1980 to 1990. This dramatic rise makes it timely to discuss the history and future of U.S. coking capacity, production, and processing. The article covers the properties and uses of the various grades of petroleum coke, as well as pricing and market trends

  9. Connecting people to place

    NARCIS (Netherlands)

    Horlings, L.G.


    The article describes a process of preparing a research design on place-shaping, as outcome of a process of co-design between academic actors and non-academic actors in Brazil, South Africa and The Netherlands, taking place in the context of the project TRANSPLACE. The joint research design

  10. Children's Places

    DEFF Research Database (Denmark)

    Using a cross-cultural approach the book investigates children's places in different societies. "Children's Places" examines the ways in which children and adults, from their different vantage-points in society, negotiate proper places of children in both social and spatial terms. It looks at some...

  11. Raman spectroscopy in investigations of mechanism of binding of human serum albumin to molecular probe fluorescein

    International Nuclear Information System (INIS)

    Vlasova, I M; Saletsky, A M


    The mechanism of binding of molecular probe fluorescein to molecules of human serum albumin was studied by the Raman spectroscopy method. The position of binding Center on human serum albumin molecule for fluorescein is determined. The amino acid residues of albumin molecule, participating in binding of fluorescein at different pH values of solution, are established. The conformation rearrangements of globules of human serum albumin, taking place at binding of fluorescein at different pH values of solution, are registered

  12. Women take the island: nation, profession, place Women take the island: nation, profession, place

    Directory of Open Access Journals (Sweden)

    Ruth Morse


    Full Text Available The Tempest has been one of Shakespeare’s most adapted plays. Its stage history is concomitantly a history of the British theatre, from regularized comedy to semi-opera to pantomime to opera. It has had other lives, too, from its position in romantic ideas of Shakespeare’s biography and his so-called farewell to the stage, to a supporting role as witness for the nineteenth-century Darwinians’ idea of the missing link, to a veritable efflorescence of walk-on parts, cameos, and star vehicles in twentieth-century psychoanalytic and social arguments about European expansion.2 The play has given us individual poems and paintings, not to speak of screen-plays for several film adaptations. The Tempest has been one of Shakespeare’s most adapted plays. Its stage history is concomitantly a history of the British theatre, from regularized comedy to semi-opera to pantomime to opera. It has had other lives, too, from its position in romantic ideas of Shakespeare’s biography and his so-called farewell to the stage, to a supporting role as witness for the nineteenth-century Darwinians’ idea of the missing link, to a veritable efflorescence of walk-on parts, cameos, and star vehicles in twentieth-century psychoanalytic and social arguments about European expansion.2 The play has given us individual poems and paintings, not to speak of screen-plays for several film adaptations.

  13. Place Branding

    DEFF Research Database (Denmark)

    Medway, Dominic; Swanson, Kathryn; Neirotti, Lisa Delpy


    Purpose: – The purpose of this paper is to report on a special session entitled “Place branding: Are we wasting our time?”, held at the American Marketing Association’s Summer Marketing Educators’ conference in 2014. Design/methodology/approach: – The report details the outcome of an Oxford......: – The outcome of the debate points towards a need for place brands to develop as more inclusive and organic entities, in which case it may be best for place practitioners to avoid creating and imposing a place brand and instead help shape it from the views of stakeholder constituencies. This shifts the notion...... of place branding towards an activity centred on “curation”. Originality/value: – The use of a competitive debating format as a means for exploring academic ideas and concepts in the place management field....

  14. Better Place

    DEFF Research Database (Denmark)

    Rask, Morten; Bakke, Nikolas; Lindhøj, Jan

    Better Place is trying to reshape the automotive industry by shifting transportation from a dependency on oil to a reliance on environmentally friendly renewable energy. Better Place is developing an extensive infrastructure system that will utilise overcapacity in the production of wind power...... among others and that will drive the global transportation industry to becoming driven by electric vehicles (EVs). Better Place does this by selling its customers 'mileage' and a car without a battery. The case highlights the internationalisation process of Better Place from an international business...... perspective in order to encourage a discussion and debate about how Better Place can make their grand vision a reality in the future by overcoming the obstacles that historically have been challenging the rise of the EV industry. The case includes a historical background of the EV industry by using Denmark...

  15. Healthy Places

    Centers for Disease Control (CDC) Podcasts

    Every person has a stake in environmental public health. As the environment deteriorates, so does the physical and mental health of the people within it. Healthy places are those designed and built to improve the quality of life for all people who live, work, worship, learn, and play within their borders -- where every person is free to make choices amid a variety of healthy, available, accessible, and affordable options. The CDC recognizes significant health issues and places that are vital in developing the Healthy Places program and provides examples in this report.

  16. Place (National) (United States)

    Department of Transportation — This map layer includes cities and towns in the United States, Puerto Rico, and the U.S. Virgin Islands (NTAD). A city or town is a place with a recorded population,...

  17. Taking antacids (United States)

    Heartburn - antacids; Reflux - antacids; GERD - antacids ... Antacids are a good treatment for heartburn that occurs once in a while. Take antacids about 1 hour after eating or when you have heartburn. If you are taking ...

  18. Healthy Places

    Centers for Disease Control (CDC) Podcasts


    Every person has a stake in environmental public health. As the environment deteriorates, so does the physical and mental health of the people within it. Healthy places are those designed and built to improve the quality of life for all people who live, work, worship, learn, and play within their borders -- where every person is free to make choices amid a variety of healthy, available, accessible, and affordable options. The CDC recognizes significant health issues and places that are vital in developing the Healthy Places program and provides examples in this report.  Created: 4/10/2007 by CDC National Center for Environmental Health.   Date Released: 4/13/2007.

  19. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    Energy Technology Data Exchange (ETDEWEB)

    Gangi Setty, Thanuja [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Cho, Christine [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Govindappa, Sowmya [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Apicella, Michael A. [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Ramaswamy, S., E-mail: [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India)


    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.

  20. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    International Nuclear Information System (INIS)

    Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.


    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states

  1. Designed Places

    DEFF Research Database (Denmark)

    Stender, Marie

    The 2008 financial crisis has left traces in the built environment of Copenhagen like many other places: Building projects are left unfinished or their function or finish is changed due to new economic circumstances. An ethnographic exploration of these traces exposes central aspects of what is a......, and when the ceilings leak water, the residents suspect it to be a consequence of the crisis. The paper discusses how market forces interact with the material surroundings we inhabit and explores the relationship between controlled and uncontrollable in the design of places....

  2. Carboplatin binding to histidine

    Energy Technology Data Exchange (ETDEWEB)

    Tanley, Simon W. M. [University of Manchester, Brunswick Street, Manchester M13 9PL (United Kingdom); Diederichs, Kay [University of Konstanz, D-78457 Konstanz (Germany); Kroon-Batenburg, Loes M. J. [Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Levy, Colin [University of Manchester, 131 Princess Street, Manchester M1 7DN (United Kingdom); Schreurs, Antoine M. M. [Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Helliwell, John R., E-mail: [University of Manchester, Brunswick Street, Manchester M13 9PL (United Kingdom)


    An X-ray crystal structure showing the binding of purely carboplatin to histidine in a model protein has finally been obtained. This required extensive crystallization trials and various novel crystal structure analyses. Carboplatin is a second-generation platinum anticancer agent used for the treatment of a variety of cancers. Previous X-ray crystallographic studies of carboplatin binding to histidine (in hen egg-white lysozyme; HEWL) showed the partial conversion of carboplatin to cisplatin owing to the high NaCl concentration used in the crystallization conditions. HEWL co-crystallizations with carboplatin in NaBr conditions have now been carried out to confirm whether carboplatin converts to the bromine form and whether this takes place in a similar way to the partial conversion of carboplatin to cisplatin observed previously in NaCl conditions. Here, it is reported that a partial chemical transformation takes place but to a transplatin form. Thus, to attempt to resolve purely carboplatin binding at histidine, this study utilized co-crystallization of HEWL with carboplatin without NaCl to eliminate the partial chemical conversion of carboplatin. Tetragonal HEWL crystals co-crystallized with carboplatin were successfully obtained in four different conditions, each at a different pH value. The structural results obtained show carboplatin bound to either one or both of the N atoms of His15 of HEWL, and this particular variation was dependent on the concentration of anions in the crystallization mixture and the elapsed time, as well as the pH used. The structural details of the bound carboplatin molecule also differed between them. Overall, the most detailed crystal structure showed the majority of the carboplatin atoms bound to the platinum centre; however, the four-carbon ring structure of the cyclobutanedicarboxylate moiety (CBDC) remained elusive. The potential impact of the results for the administration of carboplatin as an anticancer agent are described.

  3. Secret Places. (United States)

    Ridolfi, Kerry


    Argues that children are as deep as the ocean, with secret places inside of them waiting to be opened. Notes that it is powerful for students to learn they can make sense of the world through words, and describes inviting them into poetry as they read poetry, create poetry packets, and write and revise poems. (SR)

  4. Envisioning place

    DEFF Research Database (Denmark)

    Schmidt, Garbi; Glick Schiller, Nina


    together, the articles contribute to an emerging relational social science by approaching urban sociabilities through four interrelated parameters: (1) a concept of place-making situated within trajectories of differential and multiscalar power; (2) a discursive analysis of narratives and silences...

  5. Places Connected:

    DEFF Research Database (Denmark)

    Hansen, Annette Skovsted

    This paper argues that development assistance contributed to the globalization of the 20th century by financing truly global networks of people. By focusing on the networks financed by development assistance bound by the national histories of Denmark and Japan, I illustrate how the people who...... experiences of place, however, when it is often the same people who experience many different places? Along with many other so-called donors in the 1950s, Denmark and Japan chose to invest in the education of own and other nationals involved in development and thereby financed personal connections between...... individuals throughout the world. Development assistance , where there are two or three links only between a Bangladeshi farmer, a street child in Sao Paolo and the President of the United States, the Queen of Denmark, or a suburban house wife in Japan, who has never left the Osaka area, but mothered a United...

  6. Places available**

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) C++ for Particle Physicists : 17 – 21.11.03 (6 X 3-hour lectures) Programmation automate Schneider TSX Premium – niveau 2 : 18 – 21.11.03 (4 jours) JAVA 2 Enterprise Edition – Part 1 : WEB Applications : 20 & ...

  7. Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Places available The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses : Introduction à Outlook : 19.8.2004 (1 journée) Outlook (short course I) : E-mail : 31.8.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes : 31.8.2004 (2 hours, afternoon) Instructor-led WBTechT Study or Follow-up for Microsoft Applications : 7.9.2004 (morning) Outlook (short course III) : Meetings and Delegation : 7.9.2004 (2 hours, afternoon) Introduction ...

  8. Places disponibles*/Places available **

    CERN Multimedia


    Des places sont disponibles dans les cours suivants : Places are available in the following course : Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 20 - 22.1.03 (3 days) Introduction to PVSS : 27.1.03 (Afternoon) free course but registration necessary Basic PVSS : 28 - 30.1.03 (3 days) MAGNE-03 - Magnétisme pour l'électrotechnique : 28 - 30.1.03 (3 jours) MAGNE-03 - Magnetism for Technical Electronics : 11 - 13.2.03 (3 days) AutoCAD 2002 - niveau 1 : 24, 25.2 et 3, 4.3.03 (4 jours) AutoCAD 2002 - niveau 2 : 10 & 11.3.03 (2 jours) C++ for Particle Physicists : 10 - 14.3.03 (6 X 3 hour lectures) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) * Etant donné le délai d'impression du Bulletin, ces places peuvent ne plus être disponibles au moment de sa parution. Veuillez consulter notre site Web pour avoir la dernière mise à jour. ** The number of places available may vary. Please check our Web site to find out the current availability. Si vous désirez ...

  9. Taking Stock. (United States)

    Merriam, Sharan B.


    A complete theory of adult learning must take into consideration the learner, learning process, and context. Andragogy, self-directed learning, consciousness, critical theory, feminism, transformational learning, and situated cognition contribute to understanding of this complex phenomenon. (SK)

  10. Planned place of birth

    DEFF Research Database (Denmark)

    Overgaard, Charlotte; Coxon, Kirstie; Stewart, Mary

    Title Planned place of birth: issues of choice, access and equity. Outline In Northern European countries, giving birth is generally safe for healthy women with uncomplicated pregnancies, and their babies. However, place of birth can affect women’s outcomes and experiences of birth. Whilst tertiary...... countries, maternity care is provided free to women, through public financing of health care; universal access to care is therefore secured. Nevertheless, different models of care exist, and debates about the appropriateness of providing maternity care in different settings take place in both countries...... in Denmark Coxon K et al: Planned place of birth in England: perceptions of accessing obstetric units, midwife led units and home birth amongst women and their partners. How these papers interrelate These papers draw upon recent research in maternity care, undertaken in Denmark and in England. In both...

  11. Places available**

    CERN Multimedia

    Places are available in the following courses: Hands-on Introduction to Python Programming: 11-13.08.2003 (3 days) Introduction to the CERN Engineering Data Management System (EDMS): 26.08.2003 (1 day) The CERN Engineering Data Management System (EDMS) for Engineers: 27.08.2003 (1 day) CLEAN-2002 : Travailler en salle blanche : 4.09.2003 (une demi-journée) AutoCAD 2002 - Level 1: 4, 5, 15, 16.09.2003 (2 x 2 days) AutoCAD Mechanical 6 PowerPack : 17, 18, 25, 26.09.2003 et 2, 3.10.2003 (3 x 2 journées, français) AutoCAD 2002 - niveau 1 : 23, 24, 30.09.2003 et 1.10.2003 (2 x 2 journées) Introduction to the CERN Engineering Data Management System (EDMS): 23.09.2003 (1 day) The CERN Engineering Data Management System (EDMS) for Local Administrators: 24-25.09.2003 (2 days) AutoCAD 2002 - niveau 2 : 8 et 10.10.2003 (2 journées) CLEAN-2002: Working in a Cleanroom: 23.10.2003 (half day, p.m.) ** The number of places available may vary. Please check our Web site to find out the current availabili...

  12. Places available**

    CERN Multimedia


    Places are available in the following courses: Hands-on Introduction to Python Programming: 11-13.08.2003(3 days) Introduction to the CERN Engineering Data Management System (EDMS): 26.08.2003 (1 day) The CERN Engineering Data Management System (EDMS) for Engineers: 27.08.2003 (1 day) CLEAN-2002 : Travailler en salle blanche : 4.09.2003 (une demi-journée) AutoCAD 2002 - Level 1: 4, 5, 15, 16.09.2003 (2 x 2 days) AutoCAD Mechanical 6 PowerPack : 17, 18, 25, 26.09.2003 et 2, 3.10.2003 (3 x 2 journées, français) AutoCAD 2002 - niveau 1 : 23, 24, 30.09.2003 et 1.10.2003 (2 x 2 journées) Introduction to the CERN Engineering Data Management System (EDMS): 23.09.2003 (1 day) The CERN Engineering Data Management System (EDMS) for Local Administrators: 24-25.09.2003 (2 days) AutoCAD 2002 - niveau 2 : 8 et 10.10.2003 (2 journées) CLEAN-2002: Working in a Cleanroom: 23.10.2003 (half day, p.m.) ** The number of places available may vary. Please ch...

  13. Media places

    DEFF Research Database (Denmark)

    Linde, Per; Messeter, Jörn

    The impact that ubiquitous wireless network technologies and mobile phones have on our experience of the modern cityscape, has been a driving force in many research projects in recent years. The agendas differ in relation to perspectives, but it seems safe to claim that such technologies are no l......The impact that ubiquitous wireless network technologies and mobile phones have on our experience of the modern cityscape, has been a driving force in many research projects in recent years. The agendas differ in relation to perspectives, but it seems safe to claim that such technologies...... construction of place in the urban setting. The concept of Hertzian space, put forth by Anthony Dunne and others (Dunne, 1999) also carries a dimension of how spaces of wireless communication may be problematized, and how we can criticize cultural phenomena taken for granted through innovative technology. From...... this perspective wireless technology can also be a way of temporarily appropriating places within the city space for a variety of different groups, at times questioning hierarchical structures of ownership of public spaces. These spaces can be said to be hybrid spaces, bringing forth the fundamental question...

  14. Places available**

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval Tel. ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: MATLAB Fundamentals and Programming Techniques (ML01) : 2 & 3.12.03 (2 days) Oracle 8i : SQL : 3 - 5.12.03 (3 days) The EDMS MTF in practice : 5.12.03 (afternoon, free of charge) Modeling Dynamic Systems with Simulink (SL01) : 8 & 9.12.03 (2 days) Signal Processing with MATLAB (SG01) : 11 & 12.12.03 (2 days) The JAVA Programming Language - l...

  15. Places available**

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: MATLAB Fundamentals and Programming Techniques (ML01) :2 & 3.12.03 (2 days) Oracle 8i : SQL : 3 - 5.12.03 (3 days) The EDMS MTF in practice : 5.12.03 (afternoon, free of charge) Modeling Dynamic Systems with Simulink (SL01) : 8 & 9.12.03 (2 days) Signal Processing with MATLAB (SG01) : 11 & ...

  16. Places available**

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.TECHNICAL TRAINING Monique Duval tel. 74924 ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1 : 9 & 10.1.2004 (2 days) The JAVA Programming Language Level 2 : 11 to 13.1.2004 (3 days) LabVIEW base 1 : 25 - 27.2.2004 (3 jours) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Particle Physicists : 8 - 12.3.2004 ( 6 X 4-hour sessions) LabVIEW Basics 1 : 22 - 24.3.20...

  17. Places available**

    CERN Document Server


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1 :9 & 10.1.2004 (2 days) The JAVA Programming Language Level 2 : 11 to 13.1.2004 (3 days) Hands-on Introduction to Python Programming : 16 - 18.2.2004 (3 days - free of charge) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Particle Physicists : 8 - 12.3.2004...

  18. Places available**

    CERN Document Server


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval Tel. 74924 ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: JAVA 2 Enterprise Edition - Part 1 : WEB Applications : 20 & 21.11.03(2 days) FrontPage 2000 - niveau 1 : 20 & 21.11.03 (2 jours) Oracle 8i : SQL : 3 - 5.12.03 (3 days) Oracle 8i : Programming with PL/SQL : 8 - 10.12.03 (3 days) The JAVA Programming Language - leve...

  19. Places available**

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Project Planning with MS-Project : 15 & 22.1.2004 (2 days) Joint PVSS JCOP Framework Course : 2 sessions : 2 - 6.2.2004 and 16 - 20-2-2004 (5 days) Hands-on Introduction to Python Programming : 16 - 18.2.2004 (3 days - free of charge) C++ for Particle Physicists : 8 - 12.3.2004 ( 6 X 4-hour sessions)

  20. Places available **

    CERN Multimedia


    Des places sont disponibles dans les cours suivants : Places are available in the following courses : WorldFIP 2003 pour utilisateurs : 11-14.2.03 (4 jours) DISP-2003 ? Spring I Term : Introduction to Digital Signal Processing : 20, 27.2, 6, 13, 20, 27.3, 3.4.03 (7 X 2-hour lectures) AXEL-2003 - Introduction to Accelerators : 24-28.2.03 (10 X 1-hour lectures) AutoCAD 2002 - niveau 1 : 24, 25.2 & 3, 4.3.03 (4 jours) Introduction à Windows 2000 au CERN : 25.2.03 (1/2 journée) LabView base 2/LabView Basics 2 : 10 & 11.3.03 (2 jours/2 days) langue à définir/Language to be decided C++ for Particle Physicists : 10 ? 14.3.03 (6 X 3-hour lectures) Introduction to PVSS : 10.3.03 (half day, afternoon) Basic PVSS : 11 - 13.3.03 (3 days) LabView avancé /LabView Advanced : 12 - 14.3.03 (3 jours/3days) Langue à définir/language to be decided AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) PVSS - JCOP Framework Tutorial : 14.3.03 (1 day) MAGNE-03 - Magnetism for Technical Ele...

  1. Places available **

    CERN Multimedia


    Des places sont disponibles dans les cours suivants : Places are available in the following courses : Introduction à Windows 2000 au CERN : 25.2.03 (1/2 journée) LabView base 2/LabView Basics 2 : 10 & 11.3.03 (2 jours/2 days) langue à définir/Language to be decided C++ for Particle Physicists : 10 - 14.3.03 (6 X 3-hour lectures) Introduction to PVSS : 10.3.03 (half day, afternoon) Basic PVSS : 11 - 13.3.03 (3 days) LabView avancé /LabView Advanced : 12 - 14.3.03 (3 jours/3days) Langue à définir/Language to be decided AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) PVSS - JCOP Framework Tutorial : 14.3.03 (1 day) CLEAN-2002 : Working in a cleanroom : 2.4.03 (half-day, afternoon, free course, registration required) LabView base 1/LabView Basics 1 : 9 - 11.4.03 (3 jours/3 days) Langue à définir/Language to be decided DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (...

  2. Places available **

    CERN Multimedia


    Des places sont disponibles dans les cours suivants : Places are available in the following courses : DISP-2003 - Spring I Term : Introduction to Digital Signal Processing : 20, 27.2, 6, 13, 20, 27.3, 3.4.03 (7 X 2-hour lectures) AXEL-2003 - Introduction to Accelerators : 24 - 28.2.03 (10 X 1-hour lectures) AutoCAD 2002 - niveau 1 : 24, 25.2 & 3, 4.3.03 (4 jours) Introduction à Windows 2000 au CERN : 25.2.03 (1/2 journée) LabView base 2/LabView Basics 2 : 10 & 11.3.03 (2 jours/2 days) langue à définir/Language to be decided C++ for Particle Physicists : 10 - 14.3.03 (6 X 3-hour lectures) Introduction to PVSS : 10.3.03 (half day, afternoon) Basic PVSS : 11 - 13.3.03 (3 days) LabView avancé /LabView Advanced : 12 - 14.3.03 (3 jours/3days) Langue à définir/language to be decided AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) PVSS - JCOP Framework Tutorial : 14.3.03 (1 day) CLEAN-2002 : Working in a cleanroom : 2.4.03 (half-day, afternoon, free course, regis...

  3. Places available **

    CERN Multimedia


    Des places sont disponibles dans les cours suivants : Places are available in the following courses : C++ for Particle Physicists : 10 - 14.3.03 (6 X 3-hour lectures) Introduction to PVSS : 10.3.03 (half day, afternoon) Basic PVSS : 11 - 13.3.03 (3 days) PVSS - JCOP Framework Tutorial : 14.3.03 (1 day) CLEAN-2002 : Working in a cleanroom : 2.4.03 (half-day, afternoon, free course, registration required) LabView base 1/LabView Basics 1 : 9 - 11.4.03 (3 jours/3 days) Langue à définir/language to be decided DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03 (6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 11 & 12.3.03 / 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16...

  4. Places available**

    CERN Multimedia


    Places are available in the following courses: Conception de PCB rapides dans le flot Cadence : 11.6.03 (matin) EXCEL 2000 - level 1 : 12 & 13.6.03 (2 days) Introduction to PVSS : 16.6.03 (p.m.) Basic PVSS : 17 - 19.6.03 (3 days) Réalisation de PCB rapides dans le flot Cadence : 17.6.03 (matin) PVSS - JCOP Framework Tutorial : 20.6.03 (1 day) Programmation automate Schneider : Programmation automate Schneider TSX Premium - 2ème niveau : 24 - 27.6.03 (4 jours) - audience : toute personne qui veux maitriser la mise en uvre et la programmation des fonctions spécialisées d'un automate TSX Premium - objectifs : maitriser la mise en uvre et la programmation des fonctions spécialisées d'un automate TSX Premium Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6.03 - 4, 5 & 7.11.03 (session de 3 jours) ** The number of places available may vary. Please check our Web site to find out the current availability. If you wish to participate in one of these courses, pl...

  5. Places available**

    CERN Multimedia


    If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses : EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 23.10.03 (half day) The EDMS-MTF in practice (free of charge) :  28 -  30.10.03 (6 half-day sessions) AutoCAD 2002 - Level 1 : 3, 4, 12, 13.11.03 (4 days) LabVIEW TestStand ver. 3 : 4 & 5.11.03 (2 days) Introduction to Pspice : 4.11.03 p.m. (half-day) Hands-on Introduction to Python Programm...


    CERN Multimedia

    Enseignement Technique; Tél. 74924; Technical Training; Monique Duval; Tel. 74924


    Places available Places are available in the following courses:   LabView hands-on 13.11.00 4 hours LabView Basics 1 14 - 16.11.00 3 days Nouveautés de WORD 19 et 20.10.00 2 jours ACCESS 1er niveau 30 - 31.10.00 2 jours Advanced aspects of the C language 2 - 3.11.00 2 days Introduction to Oracle SQL and PL/SQL 13 - 17.11.00 5 days C++ for Particle Physicists 20 - 24.11.00 6 lectures Develop PL/SQL Program Units 20 - 22.11.00 3 days Oracle Application Server Develop Web-Based Applications with PL/SQL 27 - 28.11.00 2 days Programmation TSX Premium 1 28.11 - 1.12.00 4 jours Programmation TSX Premium 2 12 - 15.12.00 4 jours If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : or fill in an “application for training” form available from your Divisional Secretariat or from your DTO (Divisional Training Offi...

  7. Place identity and place scale: the impact of place salience.


    Bernardo, Fátima; Palma-Oliveira, José-Manuel


    Research about place, place identity and attachment supports the idea that bonds with places may differ depending on the place scale. Based on the view that identity is context-dependent, this paper brings to the table the impact of manipulating the salience of place on the intensity of place identity and place attachment reported. A study was designed to examine place identity and place attachment in two groups of residents (permanent and temporary) at three different scales (nei...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: Introduction to Databases :  3 - 4.7.01 (2 days) The JAVA programming language Level 2 : 4 - 6.7.01 (3 days) Enterprise JavaBeans :  9 - 11.7.01 (3 days) Design Patterns :  10 - 12.7.01 (3 days) C++ for Particle Physicists :  23 - 27.7.01 (6 3-hour lectures) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: Introduction to Perl 5 : 2 - 3.7.01 (2 days) Introduction to Databases :  3 - 4.7.01 (2 days) JAVA programming language Level 2 : 4 - 6.7.01 (3 days) Enterprise JavaBeans :  9 - 11.7.01 (3 days) Design Patterns :  10 - 12.7.01 (3 days) C++ for Particle Physicists :  23 - 27.7.01 (6 3-hour lectures) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: CLEAN-2002 : Travailler en salle blanche (cours gratuit) : 13.08.2002 (matin) Introduction to the CERN Enginnering Data Management System :  27.8.02  (1 day) The CERN Engineering Data Management System for Advanced Users :  28.8.02  (1 day) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval Tel.74924    


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: C++ Programming Level 2 - Traps & Pitfalls:  16 - 19.7.02 (4 days) Frontpage 2000 - level 1 :  22 - 23.7.02  (2 days) Introduction à Windows 2000 au CERN : 24.7.02 (après-midi) CLEAN-2002 : Travailler en salle blanche (cours gratuit) : 13.08.2002 (matin) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval Tel.74924

  12. Placing knowledge

    DEFF Research Database (Denmark)

    Adriansen, Hanne Kirstine; Valentin, Karen; Nielsen, Gritt B.

    ; on the other hand, the rationale for strengthening mobility through internationalisation is based on an imagination of the potentials of particular locations (academic institutions). Intrigued by this tension between universality and particularity in academic knowledge production, this paper presents...... preliminary findings from a project that study internationalisation of higher education as an agent in the interrelated processes of place-making and knowledge-making. The project is based on three case-studies. In this paper, focus is on PhD students’ change of research environment. This is used as a case......Internationalisation of higher education is premised by a seeming paradox: On the one hand, academic knowledge strives to be universal in the sense that it claims to produce generalizable, valid and reliable knowledge that can be used, critiqued, and redeveloped by academics from all over the world...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: December 2002   PCAD Schémas - Débutants :  5 & 6.12.02  (2 jours) PCAD PCB - Débutants :  9 - 11.12.02  (3 jours) FrontPage 2000 - level 1:  9 & 10.12.02  (2 days) Introduction à la CAO Cadence (cours gratuit) :  10 & 11.12.02  (2 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval Tel.74924

  14. Places available **

    CERN Multimedia


    Places are available in the following courses: PIPES-2003 - Pratique du Sertissage de tubes métalliques et multicouches : 26.8.03 (stage pratique) The CERN Engineering Data Management System (EDMS) for Engineers : 27.8.03 (1 day, free of charge) CLEAN-2002 : Travailler en salle blanche : 4.9.03 (une demi-journée, séminaire gratuit) The CERN Engineering Data Management System (EDMS) for Local Administrators : 24 & 25.9.03 (2 days, free of charge) Siemens SIMATIC Training : Programmation STEP7 - niveau 1 : 29 - 2.10.03 (4 jours) - ouverture des inscriptions fin août Programmation STEP7 - niveau 2 : 13 - 17.10.03 (5 jours) - ouverture des inscriptions fin août Réseau Simatic Net : 22 & 23.10.03 (2 jours) - ouverture des inscriptions fin août CLEAN-2002 : Working in a Cleanroom : 23.20.03 (half day, free of charge) These courses will be given in French or Englis...

  15. Places available**

    CERN Document Server


    Places are available in the following courses : FrontPage 2000 - niveau 1: 20 & 21.5.03 (2 jours) PIPES-2003 : Pratique du sertissage de tubes métalliques et multicouches: 21.5.03 (1 jour) Introduction à la CAO Cadence: de la saisie de schéma Concept-HDL au PCB : 20 & 22.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (E): 5, 6, 12, 13, 26, 27.6.03 (6 days) EXCEL 2000 - niveau 1: 10 & 11.6.03 (2 jours) Conception de PCB rapides dans le flot Cadence: 11.6.03 (matin) EXCEL 2000 - level 1: 12 & 13.6.03 (2 days) Introduction to PVSS: 16.6.03 (half-day, pm) Basic PVSS: 17 - 19.6.03 (3 days) Réalisation de PCB rapides dans le flot Cadence: 17.6.03 (matin) LabView DSC (language to be defined): 19 & 20.6.03 PVSS - JCOP Framework Tutorial: 20.6.03 (1 day) EXCEL 2000 - niveau 2: 24 & 25.6.03 (2 jours) Siemens SIMATIC Training: Introduction to STEP7: 3 & 4.6.03 (2 days) STEP7 Programming: 16 - 20.6.03 (5 days) Simatic Net Network: 26 & 27.6.03 (2 days) These courses will be given...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: LabView Hands-on (bilingue/bilingual - gratuit/free of charge) : 13.9.02 (a.m.) LabView DAQ Hands-on (bilingue/bilingual - gratuit/free of charge) : 13.9.02 (p.m.) AutoCAD 2002 - niveau 1 : 19, 20, 26, 27.9.02 (4 jours) LabView Base 1 : 23 - 25.9.02 (3 jours) LabView DAQ (E) : 26 - 27.9.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 30.9, 1, 2, 9, 10, 11.10.02 (6 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 10.10.02 (half-day, p.m.) AutoCAD 2002 - niveau 2 : 14 - 15.10.02 (2 jours) AutoCAD 2002 - Level 1 : 17, 18, 24, 25.10.02 (4 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Of...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: Introduction to Oracle 8i : SQL and PL/SQL:  7 - 11.10.02  (5 days) CLEAN-2002 : Working in a Cleanroom (free of charge):  10.10.02  (half-day, p.m.) AutoCAD 2002 - niveau 2 :  14 - 15.10.02  (2 jours) Introduction à DesignSpace :  16.10.02  (1 journée) Introduction to DesignSpace:  17.10.02  (1 day) AutoCAD 2002 - Level 1:  17, 18, 24, 25.10.02  (4 days) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11.02  (6 jours) Introduction à ANSYS/Introduction to ANSYS (langue à définir suivant demande/ Language to be chosen according to demand):  21 - 25.10.02  (5 jours/days) HREF-2002: Helium Refrigeration Techniques (English-French, bilingual) :  21 - 25.10.2002  (7 half days) HREF-2002: Techniques de la Réfri...

  18. Places available**

    CERN Document Server


    Places are available in the following courses : The CERN EDMS for Local Administrators : 24 & 25.9.03 (2 days, free of charge) HeREF-2003 : Techniques de la réfrigération Hélium (cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom : 23.10.03 (half day, free of charge) AutoCAD 2002 - Level 1 : 3, 4, 12, 13.11.03 (4 days) AutoCAD 2002 - niveau 2 : 10 & 11.11.03 (2 jours) ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) AutoCAD Mechanical 6 PowerPack (E) : 17, 18, 24, 25.11 & 1, 2.12.03 (6...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: Introduction à DesignSpace :  16.10.02  (1 journée) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11.02  (6 jours) Introduction à ANSYS 21 - 25.10.02  (5 jours/days) HREF-2002: Helium Refrigeration Techniques (English-French, bilingual) :  21 - 25.10.2002  (7 half days) LabVIEW Basics 1 (English):  21 - 23.10.02  (3 days) LabVIEW Basics 2 (English):  24 & 25.10.02  (2 days) Oracle 8i : Access the Database with Java:  7 & 8.11.02  (2 days) AutoCAD 2002 - niveau 2 :  7 & 8.11.02  (2 jours) AutoCAD 2002 - Level 1:  14, 15, 21, 22.11.02  (4 days) LabVIEW - Advanced (English) :  18 - 20.11.2002  (3 days) AutoCAD 2002 - niveau 1 :  19, 20, 25, 26.11.02 (4 jours) Oracle iDS Designer: First Class:&...

  20. Places available**

    CERN Document Server


    Places are available in the following courses: CLEAN-2002 : Travailler en salle blanche (séminaire gratuit) : 4.9.03 (une demi-journée) The CERN EDMS for Local Administrators (free of charge) : 24 & 25.9.03 (2 days) HeREF-2003 : Techniques de la réfrigération Hélium (cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 23.10.03 (half day) AutoCAD Mechanical 6 PowerPack (E) : 23, 24, 30, 31.10 & 12, 13.11.03 (6 days) AutoCAD 2002 - niveau 2 : 10 & 11.11.03 (2 jours)...

  1. Places available**

    CERN Multimedia


    Places are available in the following courses: The CERN EDMS for Local Administrators : 24 & 25.9.03 (2 days, free of charge) HeREF-2003 : Techniques de la réfrigération Hélium cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom : 23.10.03 (half day, free of charge) AutoCAD 2002 - Level 1 : 3, 4, 12, 13.11.03 (4 days) AutoCAD 2002 - niveau 2 : 10 & 11.11.03 (2 jours) ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) AutoCAD Mechanical 6 PowerPack (E) : 17, 18, 24, 25.11 & 1, 2.12.03 (6 days) FrontPage 2000 - niveau 1 : 20 & 21.11.03 (2 jours) MAGNE-03 : Magnétisme pour l'électrotechnique : 25 - 27.11.03 (3 jours) ...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: LabView hands-on (bilingue/bilingual): 5.11.02 (matin/morning) LabView DAQ hands-on (bilingue/bilingual):  5.11.02  (après-midi afternoon) Introduction au PC et Windows 2000 au CERN:  6 & 7.11.02  (2 jours) Oracle 8i : Access the Database with Java:  7 & 8.11.02  (2 days) AutoCAD 2002 - niveau 2:  7 & 8.11.02  (2 jours) Introduction to PVSS (free of charge):  11.11.2002 pm  (1/2 day) Basic PVSS:  12 - 14.11.02  (3 days) EXCEL 2000 - niveau 1:  12 & 13.11.02  (2 jours) CLEAN-2002: Working in a Cleanroom (English, free of charge):  13.11.2002  (afternoon) LabView Base 1 :  13 - 15.11.02  (3 jours) AutoCAD 2002 - Level 1:  14, 15, 21, 22.11.2002  (4 days) LabVIEW - Advanced:  18 - 20.11.02  (3 days) Auto...

  3. Places available**

    CERN Multimedia


    Places are available in the following courses: PIPES-2003 - Pratique du sertissage de tubes métalliques et multicouches :26.8.03(stage pratique) The CERN EDMS for Engineers (free of charge) : 27.8.03 (1 day) CLEAN-2002 : Travailler en salle blanche (séminaire gratuit) : 4.9.03(une demi-journée) The CERN EDMS for Local Administrators (free of charge) : 24 & 25.9.03 (2 days) HeREF-2003 : Techniques de la réfrigération Hélium (cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 23.10.03 (half day) AutoCAD Mechanical 6 PowerPack (E) : 23, 24, 30, 31.10 & 12, 13.11.03 (6 days) AutoCAD 2002 - niveau 2...

  4. Places available**

    CERN Multimedia


    Places are available in the following courses: The CERN EDMS for Local Administrators (free of charge) : 24 & 25.9.03 (2 days) HeREF-2003 : Techniques de la réfrigération Hélium (cours en français avec support en anglais) : 6 - 10.10.2003 (7 demi-journées) The Java Programming Language Level 1 : 6 - 7.10.2003 (2 days) Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) AutoCAD 2002 - niveau 1 : 20, 21, 27, 28.10.03 (4 jours) CLEAN-2002 : Working in a Cleanroom (free of charge) : 23.10.03 (half day) AutoCAD Mechanical 6 PowerPack (E) : 23, 24, 30, 31.10 & 12, 13.11.03 (6 days) AutoCAD 2002 - niveau 2 : 10 & 11.11.03 (2 jours) ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) FrontPage 2000 - niveau 1 : 20...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: October 2002   Introduction to the CERN Engineering Data Management System (free of charge):  29.10.2002  (1 day) The CERN EDMS for Advanced users (free of charge):  30.10.2002  (1 day) November 2002   LabView hands-on (bilingue/bilingual): 5.11.02 (matin/morning) LabView DAQ hands-on (bilingue/bilingual):  5.11.02  (après-midi afternoon) Introduction au PC et Windows 2000 au CERN :  6 & 7.11.02  (2 jours) Oracle 8i : Access the Database with Java:  7 & 8.11.02  (2 days) AutoCAD 2002 - niveau 2 :  7 & 8.11.02  (2 jours) Introduction to PVSS (free of charge):  11.11.2002 pm  (1/2 day) Basic PVSS:  12 - 14.11.02  (3 days) EXCEL 2000 - niveau 1 :  12 & 13.11.02  (2 jours) CLEAN-2002: Working in a Cleanroom (English, free ...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: Introduction to Oracle 8i : SQL and PL/SQL:  7 - 11.10.02  (5 days) CLEAN-2002 : Working in a Cleanroom (free of charge):  10.10.02  (half-day, p.m.) LabView Hands-on (bilingue/bilingual) : 10.10.02 (matin/morning) LabView DAQ Hands-on (bilingue/bilingual)  10.10.02 (après-midi /afternoon) Introduction à DesignSpace :  16.10.02  (1 journée) Introduction to DesignSpace:  17.10.02  (1 day) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11.02  (6 jours) Introduction à ANSYS/Introduction to ANSYS (langue à définir suivant demande/ Language to be chosen according to demand):  21 - 25.10.02  (5 jours/days) HREF-2002: Helium Refrigeration Techniques (English-French, bilingual) :  21 - 25.10.2002  (7 half days) HREF-2002: Techniques de la...


    CERN Multimedia

    Technical Training; Tel 74924


    Places are available in the following courses: LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 - 25.1.02 (4 jours) MS-Project 2000 : 24 & 25.01.02 (2 jours) Introduction au PC et à Windows 2000 au CERN : 29 - 30.1.02 (2 jours) LabView Base 1 : 4 - 6.2.02 (3 jours) LabView DAQ (E) : 7 & 8.02.02 (2 days) Hands-on Object-Oriented Design & Programming with Java : 11 - 13.02.02 (3 days) C++ for Particle Physicists : 11 - 15.3.2002 (6 * 3 hour lectures) Cours sur la migration AutoCAD : AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO ...


    CERN Multimedia

    Enseignement Technique; Tél. 74924; Technical Training; Monique Duval; Tel. 74924


    Places are available in the following courses : Premiers pas avec votre PC 12 - 15.9.00 (4 demi-journées) WORD 20, 21 et 26, 27.9.2000 (4 jours) JAVA programming level 1 25 - 26.9.2000 (2 days) Gaz inflammables 1 26.9.2000 (1 journée) Advanced aspects of PERL 5 6.10.2000 (1 day) Initiation au WWW 10 - 12.10.00 (3 demi-journées) WORD : importer et manipuler des images 16.10.2000 (1 journée) FileMaker 17, 18 et 24, 25.10.00 (4 jours) Nouveautés de WORD 19 et 20.10.2000 (2 jours) ACCESS 1er niveau 30 - 31.10.00 (2 jours)Introduction à PowerPoint 6.11.00 (1 journée)Nouveautés d’EXCEL 7.11.2000(4 demi-journées)Excel 13, 14 et 20, 21.11.00 (4 jours) LabView hands-on 13.11.2000(4 hours)LabView Basics 1 14 - 16.11.2000 (3 days) MS-Project 1er niveau 14-17.11.00 (4 demi-journées) If you wish to participate in one of these courses, please discuss with your supervisor and apply elec...


    CERN Multimedia



    Places are available in the following courses: MS-Project 1er niveau : 20 - 23.2.01 (4 matins) Architecture d'automatisme : 20 - 21.2.01 (2 jours) Introduction à PowerPoint : 26.2.01 (1 journée) Programmation TSX Premium 1 (Schneider) : 26.2 - 2.3.01 (5 jours) Premiers pas avec votre PC : 27.2 - 2.3.01 (4 matins) C++ for Particle Physicists : 5 - 9.3.01 (6*3 hour lectures) EXCEL : 6, 7 et 13, 14.3.01 (4 jours) The JAVA programming language level 2 :  12 - 14.3.01 (3 days) Nouveautés de FileMaker :  20 - 23.03.01 (4 matins) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt.


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 - 25.1.02 (4 jours) MS-Project 2000 : 22, 24 & 25.01.02 (3 jours) Introduction au PC et à Windows 2000 au CERN : 29 - 30.1.02 (2 jours) LabView Base 1 : 4 - 6.2.02 (3 jours) LabView DAQ  (E) :  7 & 8.02.02 (2 days) Hands-on Object-Oriented Design & Programming with Java :  11 - 13.02.02 (3 days) PVSS basics :  11 - 15.2.02 (5 days) Introduction à Windows 2000 : 18.2.02 (1 demi-journée) Introduction to the CERN Engineering Data Management System :  20.2.02 (1 day) The CERN Engineering Data Management System for Advanced users :  21.2.02  (1 day) C++ for Particle Physicists :  11 - 15.3.2002  (6 * 3 hour lectures) Cours sur la migration AutoCAD : AutoCAD : Mise à...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: LabVIEW - Basics 1 :  10 - 12.12.01 (3 days) Introduction to XML :  12 & 13.12.01 (2 days) Introduction au PC et Windows 2000 : 12 & 14.12.01 (2 jours) LabVIEW - Basics 2 :  13 - 14.12.01 (2 days) Habilitation électrique : superviseurs : 17.12.2001 (1/2 journée) MS-Project 2000 : 10 & 11.01.02 (2 jours) EXCEL 2000 - niveau 2 : 15 - 16.1.02 (2 jours) Sécurité dans les installations cryogéniques: 15-17.1.2002 (2 demi-journées) C++ Programming Level 2 - Traps and Pitfalls :  15 - 18.1.2002  (4 days) ELEC-2002 Winter Term: Readout and system electronics for Physics  15.1.2002 - 7.2.2002 (8 half- days) Nouveautés de WORD 2000 : 18.1.02 (1/2 journée) LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 -...


    CERN Multimedia

    Enseignement Technique; Tel. 74924


    Places are available in the following courses: MS-Project 2000 : 10 & 11.01.02 (2 jours) EXCEL 2000 - niveau 2 : 15 - 16.1.02 (2 jours) Sécurité dans les installations cryogéniques: 15-17.1.2002 (2 demi-journées) C++ Programming Level 2 - Traps and Pitfalls :  15 - 18.1.2002  (4 days) ELEC-2002 Winter Term: Readout and system electronics for Physics  15.1.2002 - 7.2.2002 (8 half- days) Nouveautés de WORD 2000 : 18.1.02 (1/2 journée) LabView hands-on : 21.01.02 (1/2 journée) LabView DAQ hands-on : 21.01.02 (1/2 journée) FileMaker Pro : 22 - 25.1.02 (4 jours) MS-Project 2000 : 24 & 25.01.02 (2 jours) Introduction au PC et à Windows 2000 au CERN : 29 - 30.1.02 (2 jours) LabView Base 1 : 4 - 6.2.02 (3 jours) LabView DAQ  (E) :  7 & 8.02.02 (2 days) Hands-on Object-Oriented Design & Programming with Java :&nbs...

  13. Places available**

    CERN Multimedia


    Places are available in the following courses : CLEAN-2002 : Working in a cleanroom (free course, registration required) : 2.4.03 (half-day, afternoon) LabView base 1/LabView Basics 1 (Langue à définir/ language to be decided) : 9 - 11.4.03 (3 jours/3 days) DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03(6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : 3 sessions sont programmées pour 2003 : 25...

  14. Places available **

    CERN Multimedia


    Places are available in the following courses : CLEAN-2002 : Working in a cleanroom (free course, registration required): 11.4.03 (half-day, afternoon, ) LabView Basics 2 : 10 - 11.4.03 (3 days) DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03 (6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6....

  15. Places available**

    CERN Multimedia


    Places are available in the following courses : DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) LabView DAQ (language to be defined) : 8 & 9.5.03 AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03 (6 jours) AutoCAD 2002 - niveau 2 : 3 & 4.6.03 (2 jours) LabView DSC (language to be defined) : 19 & 20.6.03 Siemens SIMATIC Training : Introduction to STEP7 : 3 & 4.6.03 (2 days) STEP7 Programming : 16 - 20.6.03 (5 days) Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 (sessions of 2 days) These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6.03 - 4, 5 & 7.11.03 (session de 3 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description ...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: Habilitation électrique : recyclage HT/BT : 11 - 15.3.2002  (2 * 2 heures) PVSS Basics :  8 - 12.4.02  (5 days) ELEC-2002 : Spring Term :  9, 11, 16, 18, 23, 25, 30.4.02 (7 * 2.5 hours) LabVIEW base 1 : 22 - 24.4.02 (3 jours) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) LabVIEW Basics 2 : 13 & 14.5.02 (2 days) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) Cours sur la migration AutoCAD :   AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applica...

  17. Places available**

    CERN Multimedia


    Places are available in the following courses : CLEAN-2002 : Working in a cleanroom (free course, registration required): 11.4.03 (half-day, afternoon, ) LabView Basics 2 : 10 - 11.4.03 (3 days) DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03(6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6...

  18. Places available**

    CERN Multimedia


    Places are available in the following courses : DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) Programmation de pilotes périphériques : 5 - 8.5.03 (4 jours) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) LabView DAQ (language to be defined) : 8 & 9.5.03 AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.0 (6 jours) FrontPage 2000 - niveau 1 : 20 & 21.5.03 (2 jours) AutoCAD 2002 - niveau 2 : 3 & 4.6.03 (2 jours) EXCEL 2000 - niveau 1 : 10 & 11.6.03 (2 jours) EXCEL 2000 - level 1 : 12 & 13.6.03 (2 days) PowerPoint 2000 (F) : 17 & 18.6.03 (2 jours) FrontPage 2000 - niveau 2 : 19 & 20.6.03 (2 jours) LabView DSC (langue à décider/language to be defined) : 19 & 20.6.03 EXCEL 2000 - niveau 2 : 24 & 25.6.03 (2 jours) Siemens SIMATIC Training : Introduction to STEP7 : 3 & 4.6.03 (2 days) STEP7 Programming : 16 - 20.6.03 (5 days) Simatic Net Network : 26 & 27.6.03 ...

  19. Places available**

    CERN Multimedia


    Places are available in the following courses : CLEAN-2002 : Working in a cleanroom (free course, registration required): 11.4.03 (half-day, afternoon) LabView Basics 2 : 10 - 11.4.03 (3 days) DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures) AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) Oracle iDS Reports : Build Internet Reports : 5 - 9.5.03 (5 days) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03(6 jours) Formation Siemens SIMATIC /Siemens SIMATIC Training : Introduction à STEP7 /Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) Programmation STEP7/STEP7 Programming : 16 - 20.6.03 (5 jours/5 days) Réseau Simatic Net /Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité : Etre TSO au CERN : Prochaines sessions : 24, 25 & 27.6.03 - 4, 5 & 7....

  20. Places available**

    CERN Multimedia


    Places are available in the following courses : Introduction to PVSS : 10.3.03 (half-day, afternoon) CLEAN-2002 : Working in a cleanroom : 2.4.03 (half-day, afternoon, free course, registration required) LabView Basics 1 : 9 - 11.4.03 (3 days) Language to be decided. DISP-2003 - Spring II Term : Advanced Digital Signal Processing : 30.4, 7, 14, 21.5.03 (4 X 2-hour lectures). AutoCAD 2002 - niveau 1 : 29, 30.4 et 7, 8.5.03 (4 jours) AutoCAD 2002 - niveau 2 : 5 & 6.5.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 20, 21, 27 & 28.5.03 (6 jours) Siemens SIMATIC Training: Introduction to STEP7 : 3 & 4.6.03 (2 days) STEP7 Programming : 31.3 - 4.4.03 / 16 - 20.6.03 (5 days) Simatic Net Network : 15 & 16.4.03 / 26 & 27.6.03 These courses will be given in French or English following the requests. Cours de sécurité: Etre TSO au CERN : 3 sessions sont programmées pour 2003 : 25, 26 & 28.3.03 - 24, 25 & 27.6.03 - 4, 5 & 7.11.03 (sessions de 3 jours) ** The number o...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: November 2002   Hands-on Object-Oriented Design and Programming with C++:  19 - 21.11.02  (3 days)  December 2002   LabVIEW - DSC (English) :  2 - 3.12.02  (2 days) AutoCAD 2002 - niveau 2 :  2 & 3.12.02  (2 jours) FileMaker (Français) :  2 - 5.12.02  (4 jours) PCAD Schémas - Débutants :  5 & 6.12.02  (2 jours) PCAD PCB - Débutants :  9 - 11.12.02  (3 jours) FrontPage 2000 - level 1:  9 & 10.12.02  (2 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisiona...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: November 2002   Java Programming Language level 1 :  28 & 29.11.02  (2 days) December 2002   LabVIEW - DSC (English) :  2 - 3.12.02  (2 days) FileMaker (Français) :  2 - 5.12.02  (4 jours) PCAD Schémas - Débutants :  5 & 6.12.02  (2 jours) PCAD PCB - Débutants :  9 - 11.12.02  (3 jours) FrontPage 2000 - level 1:  9 & 10.12.02  (2 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at : Technical Training or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training M...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: November 2002   Introduction to PVSS (free of charge): 11.11.02  (afternoon) EXCEL 2000 - niveau 1 :  12 & 13.11.02  (2 jours) CLEAN-2002: Working in a Cleanroom (English, free of charge):  13.11.2002  (afternoon) AutoCAD 2002 - niveau 1 :  14, 15, 21, 22.11.02  (4 jours) Hands-on Object-Oriented Design and Programming with C++:  19 - 21.11.02  (3 days)  EXCEL 2000 - niveau 2 :  25 & 26.11.02  (2 jours) FrontPage 2000 - niveau 1 :  27 & 28.11.02  (2 jours) December 2002   LabVIEW - DSC (English) :  2 - 3.12.02  (2 days) AutoCAD 2002 - niveau 2 :  2 & 3.12.02  (2 jours) FileMaker (Français) :  2 - 5.12.02  (4 jours) PCAD Schémas - Débutants :  5 & 6.12.02 ...


    CERN Multimedia

    Technical training; Tel. 74924


    Places are available in the following courses: PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) Automates et réseaux de terrain : 3 - 4.10.2001 (2 jours) PCAD Schémas - débutants : 4 - 5.10.01 (2 jours) PCAD PCB - débutants : 8 - 10.10.01 (3 jours) Programmation TSX Premium 1 : 15 - 19.10.01 (5 jours) Programmation TSX Premium 1 : 22 - 26.10.01 (5 jours) Programming TSX Premium 2: 19 - 23.11.01 (5 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Autocad Migration support courses: a detailed calendar will be published shortly for this series of sessions which will start on 15.10.2001. Registration is already open AutoCAD : Mise à jour AutoCAD r-14 vers 2002 (2 jours) AutoCAD Mechanical PowerPack 6 basé sur AutoCAD 2002 (5 jours) The following LabView courses will be given in either English or French according to demand LabVIEW - Base 1 / LabVIEW - Basics 1 : 10 - 12.9.01 (3 jours / 3 days)...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: PVSS Basics : 20 - 24.8.01 (5 days) PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) PCAD Schémas - débutants : 4 - 5.10.01 (2 jours) PCAD PCB - débutants : 8 - 10.10.01 (3 jours) Programming TSX Premium 1: 15 - 19.10.01 (5 days) Programmation TSX Premium 1 : 22 - 26.10.01 (5 jours) Programming TSX Premium 2: 19 - 23.11.01 (5 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) The following LabView courses will be given in either English or French according to demand LabVIEW - Base 1 / LabVIEW - Basics 1 : 10 - 12.9.01 (3 jours / 3 days) LabVIEW - DAQ / LabVIEW - DAQ : 13 - 14.9.01 (2 jours / 2 days) LabVIEW - Base 1 / LabVIEW - Basics 1 : 15 - 17.10.01 (3 jours / 3 days) LabVIEW - Base 2 / LabVIEW - Basics 2 : 18 - 19.10.01 (2 jours / 2 days) LabVIEW - Base 1 / LabVIEW - Basics 1 : 12 - 14.11.01 (3 jours / 3 days) LabVIEW - DAQ / LabVIEW - DAQ : 15 - 16.11.01 (2 jours / 2...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: November 2002   LabView hands-on (bilingue/bilingual): 5.11.02 (matin/morning) LabView DAQ hands-on (bilingue/bilingual):  5.11.02  (après-midi afternoon) PCAD Schémas - Débutants :  5 & 6.11.02  (2 jours) PCAD PCB - Débutants :  9 - 11.11.02  (3 jours) Introduction au PC et Windows 2000 au CERN :  6 & 7.11.02  (2 jours) Oracle 8i : Access the Database with Java :  7 & 8.11.02  (2 days) Introduction to PVSS (free of charge):  11.11.2002 pm  (1/2 day) Basic PVSS:  12 - 14.11.02  (3 days) EXCEL 2000 - niveau 1 :  12 & 13.11.02  (2 jours) CLEAN-2002: Working in a Cleanroom (English, free of charge):  13.11.2002  (afternoon) LabView Base 1 :  13 - 15.11.02  (3 jours) AutoCAD 2002 - niveau 1 :  14, 15, 21, 22.11.02  (4 jours) LabVIEW - Advanced:  18 - 20.11.02  (3 days) Hands-on Object-Oriented Design and Programming with C++ :  19 - 21.11.02  (3 days)  LabVIEW - Basics 2:  21 - 22.11.02 ...

  7. Places available**

    CERN Multimedia


    Places are available in the following courses : EXCEL 2000 - niveau 1 : 10 & 11.6.03 (2 jours) Conception de PCB rapides dans le flot Cadence : 11.6.03 (matin) EXCEL 2000 - level 1 : 12 & 13.6.03 (2 days) Introduction to PVSS : 16.6.03 (p.m.) Basic PVSS : 17 - 19.6.03 (3 days) Réalisation de PCB rapides dans le flot Cadence : 17.6.03 (matin) PVSS - JCOP Framework Tutorial : 20.6.03 (1 day) EXCEL 2000 - niveau 2 : 24 & 25.6.03 (2 jours) Siemens SIMATIC Training : Introduction to STEP7 : 3 & 4.6.03 (2 jours/2 days) STEP7 Programming : 16 - 20.6.03 (5 jours/5 days) Simatic Net Network : 26 & 27.6.03 (2 jours/2 days) These courses will be given in French or English following the requests. Programmation automate Schneider : Programmation automate Schneider TSX Premium - 1er niveau : 10 - 13.6.03 (4 jours) - audience : toute personne qui veux maitriser la msie en uvre et la programmation d'un automate TSX Premium - objectifs : maitriser la mise en uvre et la programmation d'un autom...

  8. Places available**

    CERN Multimedia


    Places are available in the following courses : FrontPage 2000 - niveau 1 : 20 & 21.5.03 (2 jours) PIPES-2003 : Pratique du sertissage de tubes métalliques et multicouches : 21.5.03 (1 jour) Introduction à la CAO Cadence : de la saisie de schéma Concept-HDL au PCB : 20 & 22.5.03 (2 jours) AutoCAD 2002 - niveau 2 : 3 & 4.6.03 (2 jours) AutoCAD Mechanical 6 PowerPack (F) : 5, 6, 12, 13, 26, 27.6.03 (6 jours) EXCEL 2000 - niveau 1 : 10 & 11.6.03 (2 jours) Conception de PCB rapides dans le flot Cadence : 11.6.03 (matin) EXCEL 2000 - level 1 : 12 & 13.6.03 (2 days) PowerPoint 2000 (F) : 17 & 18.6.03 (2 jours) Réalisation de PCB rapides dans le flot Cadence : 17.6.03 (matin) FrontPage 2000 - niveau 2 : 19 & 20.6.03 (2 jours) LabView DSC (langue à décider/language to be defined) : 19 & 20.6.03 EXCEL 2000 - niveau 2 : 24 & 25.6.03 (2 jours) Siemens SIMATIC Training: Introduction to STEP7 : 3 & 4.6.03 (2 days) STEP7 Programming : 16 - 20.6.03 (5 days) Simatic...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: PVSS Basics : 20 - 24.8.01 (5 days) PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) PCAD Schémas - débutants : 4 - 5.10.01 (2 jours) PCAD PCB - débutants : 8 - 10.10.01 (3 jours) Programming TSX Premium 1: 15 - 19.10.01 (5 days) Programmation TSX Premium 1 : 22 - 26.10.01 (5 jours) Programming TSX Premium 2: 19 - 23.11.01 (5 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) The following LabView courses will be given in either English or French according to demand LabVIEW - Base 1 / LabVIEW - Basics 1 : 10 - 12.9.01 (3 jours / 3 days) LabVIEW - DAQ / LabVIEW - DAQ : 13 - 14.9.01 (2 jours / 2 days) LabVIEW - Base 1 / LabVIEW - Basics 1 : 15 - 17.10.01 (3 jours / 3 days) LabVIEW - Base 2 / LabVIEW - Basics 2 : 18 - 19.10.01 (2 jours / 2 days) LabVIEW - Base 1 / LabVIEW - Basics 1 : 12 - 14.11.01 (3 jours / 3 days) LabVIEW - DAQ / LabVIEW - DAQ : 15 - 16.11.01 (2 jours / 2...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: Introduction à Windows 2000 au CERN : 2 sessions de _ journée les 24 et 25.9.01 PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) PowerPoint 2000 : 1 et 2.10.01 (2 jours) EXCEL 2000 - niveau 1 : 3 et 4.10.01 (2 jours) Automates et réseaux de terrain : 3 - 4.10.2001 (2 jours) PCAD Schémas - débutants : 4 - 5.10.01 (2 jours) Introduction à Outlook : 5.10.01 (1 journée) Frontpage 2000 - niveau 1 : 8 et 9.10.01 (2 jours) PCAD PCB - débutants : 8 - 10.10.01 (3 jours) C++ for Particle Physicists : 8 - 12.10.01 (6 3-hour lectures) MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) LabView Basics 1 :  15 - 17.10.01  (3 days) Programmation TSX Premium 1 : 15 - 19.10.01 (5 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) Programmation TSX Premium 1 : 22 - 26.10.01...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: Cadence Board Design tools : Upgrading to release 14 :  3 1-day sessions on 9, 10 & 11.10.01 MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) LabView Base 2 : 18 & 19.10.01 (2 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) Contract Follow-up (F) :  30.10.01 (1/2 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) The Java programming language Level 1: 8 - 9.11.01 (2 days) LabView Base 1 : 12 - 14.11.01 (3 jours) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2 days) Programming TSX Premium 1 :  19 - 23.11.01  (5 days) Introduction to C Programming :  21- 23.11.01 (3 days) The Java programming language Level 2:  26 - 28.11.01 (...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: Introduction à Windows 2000 au CERN : 2 sessions de _ journée les 24 et 25.9.01 PROFIBUS : 25 - 26.9.01 (2 jours) PROFIBUS : 27 - 28.9.01 (2 days) EXCEL 2000 - niveau 1 : 3 et 4.10.01 (2 jours) Automates et réseaux de terrain : 3 - 4.10.2001 (2 jours) Introduction à Outlook : 5.10.01 (1 journée) Frontpage 2000 - niveau 1 : 8 et 9.10.01 (2 jours) C++ for Particle Physicists : 8 - 12.10.01 (6 lectures) MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) Programmation TSX Premium 1 : 15 - 19.10.01 (5 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) Programmation TSX Premium 1 : 22 - 26.10.01 (5 jours) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) The Java programming language Level 1: 8 - 9.11.01 (2 days) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: EXCEL 2000 - niveau 1 : 3 et 4.10.01 (2 jours) Automates et réseaux de terrain : 3 - 4.10.2001 (2 jours) Introduction à Outlook : 5.10.01 (1 journée) C++ for Particle Physicists : 8 - 12.10.01 (6 lectures) Cadence Board Design tools : Upgrading to release 14 : 3 1-day sessions on 9, 10 & 11.10.01 MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) LabView Base 2 : 18 & 19.10.01 (2 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) The Java programming language Level 1: 8 - 9.11.01 (2 days) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2 days) Programming TSX Premium 1 :  19 - 23.11.01  (5 days) Introd...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: MS-Project 2000 - niveau 1 : 15 - 18.10.01 (4 demi-journées) LabView Base 2 : 18 & 19.10.01 (2 jours) WORD 2000 : importer et manipuler des images : 19.10.01 (1 journée) Contract Follow-up (F) : 30.10.01 (1/2 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) The Java programming language Level 1: 8 - 9.11.01 (2 days) LabView Base 1 : 12 - 14.11.01 (3 jours) Automates et réseaux de terrain : 13 & 14.11.01 (2 jours) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2 days) Programming TSX Premium 1 :  19 - 23.11.01  (5 days) Introduction to C Programming :  21- 23.11.01 (3 days) The Java programming language Level 2:  26 - 28.11.01 (3 days) Programmation TSX Premium 2 : 26 ...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: LabView Base 1 :  23 - 25.9.02  (3 jours) Object-Oriented Analysis & Design using UML:  25 - 27.9.02  (3 days) LabView DAQ (E):  26 - 27.9.02  (2 days) Introduction to Oracle 8i : SQL and PL/SQL:  7 - 11.10.02  (5 days) CLEAN-2002 : Working in a Cleanroom (free of charge):  10.10.02  (half-day, p.m.) AutoCAD 2002 - niveau 2 :  14 - 15.10.02  (2 jours) Introduction à DesignSpace :  16.10.02  (1 journée) Introduction to DesignSpace:  17.10.02  (1 day) AutoCAD 2002 - Level 1:  17, 18, 24, 25.10.02  (4 days) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11.02  (6 jours) Introduction à ANSYS/Introduction to ANSYS (langue à définir suivant demande/ Language to be chosen according to demand):...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: Java 2 Enterprise Edition - Part 2: Enterprise JavaBeans:  18 - 20.9.02  (3 days) AutoCAD 2002 - niveau 1 :  19, 20, 26, 27.9.02  (4 jours) LabView Base 1 :  23 - 25.9.02  (3 jours) Object-Oriented Analysis & Design using UML:  25 - 27.9.02  (3 days) LabView DAQ (E):  26 - 27.9.02  (2 days) Introduction to Oracle 8i : SQL and PL/SQL:  7 - 11.10.02  (5 days) CLEAN-2002 : Working in a Cleanroom (free of charge):  10.10.02  (half-day, p.m.) AutoCAD 2002 - niveau 2 :  14 - 15.10.02  (2 jours) Introduction à DesignSpace :  16.10.02  (1 journée) Introduction to DesignSpace:  17.10.02  (1 day) AutoCAD 2002 - Level 1:  17, 18, 24, 25.10.02  (4 days) AutoCAD Mechanical 6 PowerPack (F) :  21, 22, 23.10 et 4, 5, 6.11....


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: Automates et réseaux de terrain : 13 & 14.11.01 (3 jours) Introduction à Windows 2000 au CERN : 12 - 14.11.01 (1/2 journée) Introduction to Windows 2000 at CERN :  14.11.01  (half-day) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Sécurité dans les installations cryogéniques : 21 - 22.11.2001 (2 demi-journées) Introduction to C Programming :  21- 23.11.01 (3 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Contract Follow-up (F) : 26.11.01 (1/2 journée) Object-Oriented Analysis and Design :  27 - 30.11.2001  (4 days) Introduction to the CERN Engineering Data Management System :  30.11.2001 (1 day) Electromagnetic Compatibility (EMC): Introduction (bilingual) :  3.12.01 (half-day) Introduction to the CERN Engineering Data Management System : 07.12.2001...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: Contract Follow-up (F) : 30.10.01 (1/2 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) Nouveautés d'EXCEL : 5.11.01 (1/2 journée) Introduction a Windows 2000 au CERN : 6.11.01 (1/2 journée) The Java programming language Level 1: 8 - 9.11.01 (2 days) LabView Base 1 : 12 - 14.11.01 (3 jours) Automates et réseaux de terrain : 13 & 14.11.01 (2 jours) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to XML :  19 - 20.11.01 (2 days) Programming TSX Premium 1 :  19 - 23.11.01  (5 days) Introduction to C Programming :  21- 23.11.01 (3 days) The Java programming language Level 2:  26 - 28.11.01 (3 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Autocad Migration support courses: a detail...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: Contract Follow-up (F) : 30.10.01 (1/2 journée) The CERN Engineering Data Management System for Electronics Design :  30.10.01 (1 day) Nouveautés d'Excel 2000 : 5.11.01 (1/2 journée) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) Introduction à Windows 2000 au CERN : 6.11.01 (1/2 journée) The Java programming language Level 1: 8 - 9.11.01 (2 days) LabView Base 1 : 12 - 14.11.01 (3 jours) LabVIEW DAQ (F) : 15 & 16.11.01 (2 jours) Automates et réseaux de terrain : 13 & 14.11.01 (2 jours) Introduction to PERL 5 :  15 - 16.11.01  (2 days) LabVIEW - DAQ : 15 - 16.11.01 (2 jours) Introduction to XML :  19 - 20.11.01 (2 days) Introduction to C Programming :  21- 23.11.01 (3 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Object-Oriented Analysis and Design :  27 - 30.11.2001 (4 days) Hands...


    CERN Multimedia

    Technical Training; Tel. 74924


    Places are available in the following courses: Nouveautés d'EXCEL : 5.11.01 (1/2 journée) Introduction a Windows 2000 au CERN : 6.11.01 (1/2 journée) UNIX pour non-programmeurs : 5 - 7.11.01 (3 jours) Design Patterns :  7 - 8.11.01 (2 days) The Java programming language Level 1: 8 - 9.11.01 (2 days) Automates et réseaux de terrain : 13 & 14.11.01 (3 jours) Introduction à Windows 2000 au CERN : 12 - 14.11.01 (1/2 journée) Introduction to Windows 2000 at CERN :  14.11.01  (half-day) Introduction to PERL 5 :  15 - 16.11.01  (2 days) Introduction to C Programming :  21- 23.11.01 (3 days) Programmation TSX Premium 2 : 26 - 30.11.01 (5 jours) Contract Follow-up (F) : 26.11.01 (1/2 journée) Object-Oriented Analysis and Design :  27 - 30.11.2001  (4 days) Hands-on Object-Oriented Design and Programming with C++ :  11 - 13.12.2...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: ELEC-2002 : Spring Term :  9, 11, 16, 18, 23, 25, 30.4.02 (7 * 2.5 hours) Object-Oriented Analysis & Design: 16 - 19.4.02  (4 days) The CERN Engineering Data Management System for Advanced users:  16.4.02  (1 day) Migration from AutoCAD 14 towards AutoCAD Mechanical6 PowerPack:  17 - 19.4 and 2 &3.5.02  (5 days) AutoCAD - niveau 1 : 22, 23, 29, 30.4 et 6, 7.5.02 (6 jours) LabVIEW base 1 : 22 - 24.4.02 (3 jours) CLEAN 2002 : working in a cleanroom:  24.4.02  (half-day, pm) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) AutoCAD : Mise à jour AutoCAD r-14 vers 2002 : 25 & 26.4.02 (2 jours) Cotations selon les normes GPS de l'ISO : 29 - 30.4.02 (2 jours) Introduction to the CERN Engineering Data Management System:  7.5.02  (1 day) LabVIEW Basics 2 : 13 & 14.5.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 13-...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: Introduction to the CERN Engineering Data Management System:  7.5.02  (1 day) LabVIEW Basics 2: 13 & 14.5.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 13-14, 17, 21, 27-28.5.02 (6 jours) WorldFIP - Généralités : 14.5.2002 (1/2 journée) WorldFIP - Développer avec MicroFIP HANDLER : 14.5 - après-midi, 15.5.02 - matin (1 jour) WorldFIP - FullFIP FDM : FIP Device Manager (F) : 15.5 - après-midi, 16.5.02 - matin (1 jour) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) EXCEL 2000 - niveau 2 : 22 & 23.5.02 (2 jours) The CERN Engineering Data Management System for Advanced users:  30.5.02  (1 day) LabVIEW Basics 1:  3 - 5.6.02  (3 days) AutoCAD 2002 - condensé : 4 - 6.6.02 (3 jours) LabVIEW DAQ (E):  6 & 7.6.02  (2 days) AutoCAD 2002 - Level 1:  10 - ...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: The CERN Engineering Data Management System for Advanced users : 16.4.02  (1 day) Migration from AutoCAD 14 towards AutoCAD Mechanical6 PowerPack:  17 - 19.4 and 2 &3.5.02  (5 days) AutoCAD - niveau 1 : 22, 23, 29, 30.4 et 6, 7.5.02 (6 jours) LabVIEW base 1 : 22 - 24.4.02 (3 jours) CLEAN 2002 : working in a cleanroom:  24.4.02  (half-day, pm) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) AutoCAD : Mise à jour AutoCAD r-14 vers 2002 : 25 & 26.4.02 (2 jours) Cotations selon les normes GPS de l'ISO : 29 - 30.4.02 (2 jours) Introduction to the CERN Engineering Data Management System:  7.5.02  (1 day) LabVIEW Basics 2: 13 & 14.5.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 13-14, 17, 21, 27-28.5.02 (6 jours) WorldFIP - Généralités : 14.5.2002 (1/2 journée) WorldFIP - Développer avec Micr...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: LabVIEW Basics 2: 13 & 14.5.02 (2 days) WorldFIP - Généralités : 14.5.2002 (1/2 journée) WorldFIP - Développer avec MicroFIP HANDLER : 14.5 - après-midi, 15.5.02 - matin (1 jour) WorldFIP - FullFIP FDM : FIP Device Manager (F) : 15.5 - après-midi, 16.5.02 - matin (1 jour) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) EXCEL 2000 - niveau 2 : 22 & 23.5.02 (2 jours) The CERN Engineering Data Management System for Advanced users:  30.5.02  (1 day) LabVIEW Basics 1:  3 - 5.6.02  (3 days) AutoCAD 2002 - condensé : 4 - 6.6.02 (3 jours) LabVIEW DAQ (E):  6 & 7.6.02  (2 days) AutoCAD 2002 - Level 1:  10 - 12 and 24 - 26.6.02  (6 days) If you wish to participate in one of these courses, please discuss with your supervisor and apply electronically directly from the c...


    CERN Multimedia

    Monique Duval


    Places are available in the following courses: LabVIEW base 1 : 22 - 24.4.02 (3 jours) CLEAN 2002 : working in a cleanroom:  24.4.02  (half-day, pm) LabVIEW DSC (F) 25 & 26.4.02 (2 jours) AutoCAD : Mise à jour AutoCAD r-14 vers 2002 : 25 & 26.4.02 (2 jours) Cotations selon les normes GPS de l'ISO : 29 - 30.4.02 (2 jours) Introduction to the CERN Engineering Data Management System:  7.5.02  (1 day) LabVIEW Basics 2: 13 & 14.5.02 (2 days) AutoCAD Mechanical 6 PowerPack (F) : 13-14, 17, 21, 27-28.5.02 (6 jours) WorldFIP - Généralités : 14.5.2002 (1/2 journée) WorldFIP - Développer avec MicroFIP HANDLER : 14.5 - après-midi, 15.5.02 - matin (1 jour) WorldFIP - FullFIP FDM : FIP Device Manager (F) : 15.5 - après-midi, 16.5.02 - matin (1 jour) LabVIEW DAQ (F) : 15 & 16.5.02 (2 jours) EXCEL 2000 - niveau 2 : 22 & 23.5.02 (2 jours)...

  6. ‘We are a community [but] that takes a certain amount of energy’: Exploring shared visions, social action, and resilience in place-based community-led energy initiatives

    International Nuclear Information System (INIS)

    Parkhill, K.A.; Shirani, F.; Butler, C.; Henwood, K.L.; Groves, C.; Pidgeon, N.F.


    Highlights: • We engage with conceptual characteristics of 3 community-led energy case studies. • We examine data from interviews to explore the issues community energy groups face. • Shared visions, social action and social resilience are important to community energy. • Creating and maintaining shared visions, social action and social resilience is extremely challenging. - Abstract: In UK energy policy, community-led energy initiatives are increasingly being imbued with transformative power to facilitate low carbon transitions. The ways that such expectations for communities are manifesting in practice remains, however, relatively poorly understood. In particular, key conceptual developments in unpacking what constitutes ‘community’ that highlight the significance of ‘place’ along with important characteristics, such as shared visions, collective social action, and resilience, have yet to be comprehensively explored in the context of community-led energy initiatives. This paper uses an interpretive stance to engage with these conceptual ideas about community and provides insights into the nature of community and its meaning for developing energy-related initiatives and realising the wider goals of energy policy. The paper draws on data from in-depth qualitative, longitudinal interviews undertaken in two residential communities and one purely workplace-based community, which are engaged in community energy initiatives. We argue that there are difficulties and ambiguities in creating shared visions, achieving social action, and developing resilience that are related to the specificities of community in place, but that all three characteristics are likely to be important for the making of sustainable places

  7. Brand new authentic places

    DEFF Research Database (Denmark)

    Stender, Marie

    the relation and interplay between the two. This study strives to fill this gap by ethnographically tracing the process from design to occupancy including the role of branding as a means to create authenticity. The concept of authenticity is often associated with old houses and neighbourhoods, but also in new......How are places and material surroundings ascribed with meaning when new residential neighbourhoods are designed, branded and taken into use? Existing research on housing, neighbourhoods and urban design tends to take the perspective of either the architect or the user rather than to explore...... neighbourhoods stories of authenticity seems to be of great importance giving value and identity to place and people. By way of design and branding new places are implied with notions of the real, the original and the unique referring to e.g. its historical past, architectural uniqueness, sustainability or sense...

  8. Places disponibles/Places available

    CERN Multimedia


    Si vous désirez participer à l'un des cours suivants, veuillez en discuter avec votre superviseur et vous inscrire électroniquement en direct depuis les pages de description des cours dans le Web que vous trouvez à l'adresse : ou remplissez une « demande de formation » disponible auprès du Secrétariat de votre Division ou de votre DTO (Délégué divisionnaire à la formation). Les places seront attribuées dans l'ordre de réception des inscriptions. If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Off...

  9. An Electrostatic Funnel in the GABA-Binding Pathway.

    Directory of Open Access Journals (Sweden)

    Timothy S Carpenter


    Full Text Available The γ-aminobutyric acid type A receptor (GABAA-R is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a 'funnel' that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site.

  10. What is taking place in science classrooms?: A case study analysis of teaching and learning in seventh-grade science of one Alabama school and its impact on African American student learning (United States)

    Norman, Lashaunda Renea

    This qualitative case study investigated the teaching strategies that improve science learning of African American students. This research study further sought the extent the identified teaching strategies that are used to improve African American science learning reflect culturally responsive teaching. Best teaching strategies and culturally responsive teaching have been researched, but there has been minimal research on the impact that both have on science learning, with an emphasis on the African American population. Consequently, the Black-White achievement gap in science persists. The findings revealed the following teaching strategies have a positive impact on African American science learning: (a) lecture-discussion, (b) notetaking, (c) reading strategies, (d) graphic organizers, (e) hands-on activities, (f) laboratory experiences, and (g) cooperative learning. Culturally responsive teaching strategies were evident in the seventh-grade science classrooms observed. Seven themes emerged from this research data: (1) The participating teachers based their research-based teaching strategies used in the classroom on all of the students' learning styles, abilities, attitudes towards science, and motivational levels about learning science, with no emphasis on the African American student population; (2) The participating teachers taught the state content standards simultaneously using the same instructional model daily, incorporating other content areas when possible; (3) The participating African American students believed their seventh-grade science teachers used a variety of teaching strategies to ensure science learning took place, that science learning was fun, and that science learning was engaging; (4) The participating African American students genuinely liked their teacher; (5) The participating African American students revealed high self-efficacy; (6) The African American student participants' parents value education and moved to Success Middle School

  11. Take heart!

    CERN Multimedia

    Alizée Dauvergne


    Recently, ten new semi-automatic defibrillators were installed at various locations around CERN. This is a preventive measure intended to provide cardiac arrest victims with the best possible response. The first responder could be you!   The Director-General has welcomed the initiative of the Medical Service and Fire Brigade for the installation of ten new semi-automatic defibrillators. You have probably seen them on your way to the restaurant, for example:  brand new semi-automatic defibrillators, ready for an emergency. Housed in a white wall-mounted case, the bright red defibrillators are marked with a white heart symbol crossed by a lightning bolt (see photo). The defibrillator is designed so that anyone can use it. “Anyone can use it, you don’t need to be a health professional,” says Dr Reymond from CERN's Medical Service. Together with the CERN Fire Brigade, he is behind the initiative to have these units put in place. And with good reason, as the unit...

  12. Taking Leave?

    CERN Multimedia


    Planning a holiday? Then if you're a member of the personnel, you'll need to use the Laboratory's new leave system that will be put in place on 1 October. Leave allocations don't change - you are entitled to just as much holiday as before - but instead of being credited annually, your leave will be credited on a monthly basis, and this information will be communicated on your salary slip. The reason for the change is that with the various new leave schemes such as Recruitment by Saved Leave (RSL) and the Progressive Retirement Programme (PRP), a streamlined procedure was required for dealing with all kinds of leave. In the new system, each member of the personnel will have leave accounts to which leave will be credited monthly from the payroll and debited each time an absence is registered in the CERN Electronic Document Handling system (EDH). Leave balances will appear on monthly pay slips, and full details of leave transactions and balances will be available through EDH at all times. As the leave will be c...

  13. I could never take the place of your man

    DEFF Research Database (Denmark)

    Andersen, Poul Houman; Munksgaard, Kristin B.

    We explore the dynamic tensions between the strategic change intentions by business actors and the rigidities of routines in business networks. We capture strategic change acts using the recent advances in the literature on network pictures as way to understand the value creation logics of managers...... and we coin the term network picturing to describe this process. We develop a theoretical framework that links network pictures and the patterned processes of interaction in business network routines. Here, we argue that the resistance managers' meet in their change efforts is likely, even if the change...... efforts do not directly rival or contradict that of other actors in the exchange party in a resource-dependency sense, but may be caused simply by disrupting the existing business network. We use three case studies to illustrate and further explore the tensions between network picturing and network...

  14. How Does Photosynthesis Take Place in Our Oceans?


    Ghosh, Tonmoy; Mishra, Sandhya


    The food we eat ultimately comes from plants, either directly or indirectly. The importance of plants as the global kitchen can never be underestimated. Plants “eat” sunlight and carbon dioxide to produce their own food and food for the millions of other organisms dependent on them. A molecule, chlorophyll (Chl), is crucial for this process, since it absorbs sunlight. However, the way land plants produce their food is very different from the way plants in the oceans produce their food. Since ...

  15. When radionuclides take the place of vital elements

    International Nuclear Information System (INIS)

    Rouffignac, Ch. de; Poncy, J.L.; Martin, M.


    The radiosensitivity of the kidneys is a major factor restricting the applications of chemoradiotherapy. However, improved knowledge of the mechanisms involved has allowed new treatments to be developed that attenuate the effects of the irradiation or delay its consequences. Certain radioactive elements can behave in the body like calcium, and so exhibit a special affinity for bone structures. The skin is the first tissue that is damaged by external exposure to ionising radiation. The early and late responses to irradiation in this complex organ are still poorly understood. Thanks to DNA micro-arrays, the response of skin cells to irradiation, and in particular that of epidermal stem cells, can now be studied globally. (authors)

  16. Does the measurement take place when nobody observes it

    Energy Technology Data Exchange (ETDEWEB)

    Gurvitz, Shmuel [Department of Particle Physics and Astrophysics, Weizmann Institute of Science, Rehovot (Israel); Beijing Computational Science Research Center, Beijing (China)


    We consider non-selective continuous measurements of a particle tunneling to a reservoir of finite band-width (Λ). The particle is continuously monitored by frequent projective measurements (''quantum trajectory''), separated by a time-interval τ. A simple analytical expression for the decay rate has been obtained. For Markovian reservoirs (Λ → ∞), no effect of the measurements is found. Otherwise for a finite Λ, the decay rate always depends on the measurement time τ. This result is compared with alternative calculations, with no intermediate measurements, but when the measurement device is included in the Schroedinger evolution. We found that the detector affects the system by the decoherence rate (Γ{sub d}), related to the detector's signal. Although both treatments are different, the final results become very close for τ = 2/Γ{sub d}. This τ corresponds to the minimal time for which the detector's signal can be distinguished by an ''observer''. This indicates a fundamental role of information in quantum motion and can be used for the extension of the quantum trajectory method for non-Markovian environments. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  17. BP-Mobil partnership. The common network takes place

    International Nuclear Information System (INIS)



    After the partnership between BP and Mobil was signed, the program of transformation of the petrol stations network started in November 1996 in the UK and concern 3300 stations in Europe and 800 stations in France. About 9100 stations will be transformed by the end of 1998. BP France is the operator for petroleum products (petrol, fuel, bitumens, LPG..) with a 70% share holding (30% for Mobil) while Mobil is the major shareholder (51%) for the lubricants and special products activities. The chemical, aviation nd maritime activities are not concerned. Thanks to the fusion of their down-file activities in Europe, the benefits of the partnership should reach 600 to 700 million of US Dollars each year. However the restructuring cost should reach 740 millions of US Dollars in two years, which doubles the initial estimation. Short paper. (J.S.)

  18. Perspective Taking in Workplaces

    Directory of Open Access Journals (Sweden)

    Zappalà Salvatore


    Full Text Available Workplaces are often described as places in which individuals are motivated by their self-interests and in which negative events like time pressure, anxiety, conflict with co-workers, miscomprehensions, difficulties in solving problems, not-transmitted or not-exchanged information that lead to mistakes, and in some cases to injuries, stress or control, are part of everyday life (Dormann & Zapf, 2002; Schabracq, Winnubst and Cooper, 2003. Such situations are often the result of the limited comprehension of needs, skills, or information available to colleagues, supervisors, subordinates, clients or providers. However, workplaces are also places in which employees take care of clients, support colleagues and subordinates (Rhoades & Eisenberger, 2002, are enthusiastic about their job (Bakker et al., 2008, are motivated by leaders that encourage employees to transcend their own self-interests for the good of the group or the organization and provide them with the confidence to perform beyond expectations (Bass, 1997. Thus positive relationships at work are becoming a new interdisciplinary domain of inquiry (Dutton & Ragins, 2006. Within this positive relationships framework, in this paper we focus on a positive component of workplaces, and particularly on an individual cognitive and emotional process that has an important role in the workplace because it facilitates interpersonal relations and communications: it is the perspective taking process. In order to describe perspective taking, we will refer to some empirical studies and particularly to the review published by Parker, Atkins and Axtell in 2008 on the International Review of Industrial and Organizational Psychology.

  19. Substrate binding in the active site of cytochrome P450cam

    NARCIS (Netherlands)

    Swart, M.; Groenhof, A.R.; Ehlers, A.W.; Lammertsma, K.


    We have studied the binding of camphor in the active site of cytochrome P450cam with density functional theory (DFT) calculations. A strong hydrogen bond (>6 kcal/mol) to a tyrosine residue (Tyr96) is observed, that may account for the high specificity of the reaction taking place. The DFT

  20. Place Branding in Systems of Place

    DEFF Research Database (Denmark)

    Zenker, Sebastian; Andéhn, Mikael


    , this presents a challenge, since the role of a place in this system of geographical abstractions constitutes a piece of information more vital than any other in defining the place. Our understanding of places cannot be separated from their scale, and any effort at managing the reputation and meaning.......g. the European Union or Africa). Using the example of nation branding for Sudan and Slovenia, one can identify supranational places such as “sub-Saharan Africa” or “Eastern Europe”, carrying their own highly salient and often negative meaning in much of the Western world. We explore how association to a system...

  1. An N-terminal Region of Mot-2 Binds to p53 In Vitro

    Directory of Open Access Journals (Sweden)

    Sunil C. Kaul


    Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

  2. Continuing bonds and place. (United States)

    Jonsson, Annika; Walter, Tony


    Where do people feel closest to those they have lost? This article explores how continuing bonds with a deceased person can be rooted in a particular place or places. Some conceptual resources are sketched, namely continuing bonds, place attachment, ancestral places, home, reminder theory, and loss of place. The authors use these concepts to analyze interview material with seven Swedes and five Britons who often thought warmly of the deceased as residing in a particular place and often performing characteristic actions. The destruction of such a place, by contrast, could create a troubling, haunting absence, complicating the deceased's absent-presence.

  3. My Place Is Not Your Place

    DEFF Research Database (Denmark)

    Zenker, Sebastian; Beckmann, Suzanne C.


    Purpose – Cities increasingly compete with each other for attracting tourists, investors, companies, or residents. Marketers therefore focus on establishing the city as a brand, disregarding that the perception and knowledge of a city differ dramatically between the target audiences. Hence, place...... branding should emphasize much more the perceptions of the different target groups and develop strategies for advanced place brand management. The aim of this paper is to assess the important discrepancies between the city brand perceptions of different target groups with the help of network analysis......-ended-question survey with 334 participants. Findings – Structural differences for the city brand perceptions of two different target groups and the differences between perceptions of an external and internal target group are highlighted. The results and the managerial implications for place marketers are discussed...

  4. Place branding, embeddedness and endogenous rural development

    NARCIS (Netherlands)

    Donner, Mechthild; Horlings, Lummina; Fort, Fatiha; Vellema, Sietze


    This article deals with place branding on the regional scale, in the rural context of food and tourism networks in Europe. Place branding is linked to the concepts of endogenous rural development, territory and embeddedness, by analysing how the valorisation of specific rural assets takes shape.

  5. Populated Places of Iowa (United States)

    Iowa State University GIS Support and Research Facility — This coverage contains points that represent populated places, ie. cities, towns, villages or any other named place where people live. The coverage was developed...

  6. The importance of places and place branding

    NARCIS (Netherlands)

    Kovács, Z.; Musterd, S.; Musterd, S.; Kovács, Z.


    In the analytical part of this study, we highlight that, despite globalisation and growing uniformity, there is still an important role for place itself in the location decisions of economic players. Part III of this volume deals with this. Even though city-regions across the world have become

  7. A woman's rightful place? (United States)


    Rural development projects in sub-Saharan Africa tend not to succeed because they do not consider women's role and their significance, even though women constitute 70% of agricultural workers, 80% of food producers, 100% of people who prepare meals, and 60-90% do food marketing. Development specialists ignore women because they are not involved in political activities and in decision making. As long as women and women's contributions are not considered, rural development projects will remain inefficient and development will not take place. Thus, projects must include women as agents and beneficiaries of development in key sectors of the economy. Rural development specialists must also consider the effect male labor emigration has on rural women. For example, drought has forced many men to leave their villages, leaving a work force consisting of 95% women to fight desertification. All too often, women have no or limited land ownership rights, thereby keeping them from improving the land, e.g., planting perennial fruit crops. They also tend to be hired hands rather than food producers. They cannot obtain bank loans because they do not own land, and because they are often illiterate (over 90% female illiteracy in 28 African countries), they can neither understand nor complete bank loan forms. Rural development projects further alienate women by aiming training programs to men or by using male agricultural extension agents. Women react to this alienation by rejecting projects that do not benefit them and follow more profitable activities which sometimes interfere with projects. Thus, rural development programs need to invest in women to ensure viable and efficient sustainable development.

  8. Taking warfarin (Coumadin) (United States)

    ... page: // Taking warfarin (Coumadin) To use the sharing features on this ... form a clot or have bleeding problems. Taking Warfarin It is important that you take warfarin exactly ...

  9. Take Charge. Take the Test. PSA (:30)

    Centers for Disease Control (CDC) Podcasts

    As part of the Take Charge. Take the Test. campaign, this 30 second PSA encourages African American women to get tested for HIV. Locations for a free HIV test can be found by visiting or calling 1-800-CDC-INFO (1-800-232-4636).

  10. Place in Transition

    DEFF Research Database (Denmark)

    Mikkelsen, Jacob Bjerre; Lange, Ida Sofie Gøtzsche

    from the 'Everyday World'. Within mobilities studies, research has focused on different aspects and consequences of the post-oil society (see Dennis & Urry 2009, Urry 2013). This paper discusses the conception of place within the enclosed 'Oil World' with point of departure in relocation...... and redefinition of oil rigs from an urban design perspective. The paper constitutes a theoretical basis for future design scenarios - exemplified through visionary urban design proposals for a specific site in the city of Esbjerg, Denmark. Relocating rigs to an urban context initiates discussions of conception...... of 'Place' questioning the fixity of 'Place' (Jensen 2010). Scoped through a relational sense of place (Massey 1993) and the potential of exploring new relations between places (Burns & Kahn 2005), the paper challenges the notion of 'Place as God' (Hvattum 2010). These places in transition contest...

  11. Place, leisure, and well-being (United States)

    Daniel R. Williams; Michael E. Patterson


    The Population Health Model (PHM) (Hamilton and Bhatti 1996) brings much needed attention to the critical role of environmental and community variables in the promotion of physical and mental health. However, it appears to neglect two facets integral to what is otherwise a rich contextual approach to health promotion. One facet, place, is the binding theme of this book...

  12. Place-Specific Computing

    DEFF Research Database (Denmark)

    Messeter, Jörn


    An increased interest in the notion of place has evolved in interaction design based on the proliferation of wireless infrastructures, developments in digital media, and a ‘spatial turn’ in computing. In this article, place-specific computing is suggested as a genre of interaction design that add......An increased interest in the notion of place has evolved in interaction design based on the proliferation of wireless infrastructures, developments in digital media, and a ‘spatial turn’ in computing. In this article, place-specific computing is suggested as a genre of interaction design...... that addresses the shaping of interactions among people, place-specific resources and global socio-technical networks, mediated by digital technology, and influenced by the structuring conditions of place. The theoretical grounding for place-specific computing is located in the meeting between conceptions...... of place in human geography and recent research in interaction design focusing on embodied interaction. Central themes in this grounding revolve around place and its relation to embodiment and practice, as well as the social, cultural and material aspects conditioning the enactment of place. Selected...

  13. From sense of place to visualization of place: examining people-place relationships for insight on developing geovisualizations. (United States)

    Newell, Robert; Canessa, Rosaline


    Effective resource planning incorporates people-place relationships, allowing these efforts to be inclusive of the different local beliefs, interests, activities and needs. 'Geovisualizations' can serve as potentially powerful tools for facilitating 'place-conscious' resource planning, as they can be developed with high degrees of realism and accuracy, allowing people to recognize and relate to them as 'real places'. However, little research has been done on this potential, and the place-based applications of these visual tools are poorly understood. This study takes steps toward addressing this gap by exploring the relationship between sense of place and 'visualization of place'. Residents of the Capital Regional District of BC, Canada, were surveyed about their relationship with local coastal places, concerns for the coast, and how they mentally visualize these places. Factor analysis identified four sense of place dimensions - nature protection values, community and economic well-being values, place identity and place dependence, and four coastal concerns dimensions - ecological, private opportunities, public space and boating impacts. Visualization data were coded and treated as dependent variables in a series of logistic regressions that used sense of place and coastal concerns dimensions as predictors. Results indicated that different aspects of sense of place and (to a lesser degree) concerns for places influence the types of elements people include in their mental visualization of place. In addition, sense of place influenced the position and perspective people assume in these visualizations. These findings suggest that key visual elements and perspectives speak to different place relationships, which has implications for developing and using geovisualizations in terms of what elements should be included in tools and (if appropriate) depicted as affected by potential management or development scenarios.

  14. Management and communication courses – Places available

    CERN Multimedia


    There are places available in some management and communication courses taking place in the period January to March 2013.   For more information on the course, click on the course title, which will bring you to the training catalogue. You can then sign-up on-line. For advice, you can contact: Erwin Mosselmans, tel. 74125, Nathalie Dumeaux, tel. 78144, Courses in English (or bilingual) Session Duration Language Availability How to get, as a supervisor, the most out of the annual interview 21 January 1 day English 2 places Project Engineering 24 and 25 January 2 days English 6 places How to get, as a supervisor, the most out of the annual interview 31 January 1 day English 6 places Conflict Resolution for Managers 19 and 20 February 2 days English One more place Project Scheduling & Costing 6 and 7 March 2 days English 2 places Communicati...

  15. Take Charge. Take the Test. PSA (:30)

    Centers for Disease Control (CDC) Podcasts


    As part of the Take Charge. Take the Test. campaign, this 30 second PSA encourages African American women to get tested for HIV. Locations for a free HIV test can be found by visiting or calling 1-800-CDC-INFO (1-800-232-4636).  Created: 3/7/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/7/2012.

  16. The value of place (United States)

    Dentzau, Michael W.


    This commentary seeks to expand the dialogue on place-based science education presented in Katie Lynn Brkich's article, where the connections fifth grade students make between their formal earth science curriculum and their lived experiences are highlighted. The disconnect between the curriculum the students are offered and their immediate environment is clear, and we are presented with examples of how they strive to make connections between the content and what they are familiar with—namely their surroundings. "Place" is identified as a term with complex meanings and interpretations, even in the scope of place-based science education, and understanding how the term is used in any given scenario is essential to understanding the implications of place-based education. Is place used as a location, locale or a sense of place? To understand "place" is to acknowledge that for the individual, it is highly situational, cultural and personal. It is just such attributes that make place-based education appealing, and potentially powerful, pedagogically on one hand, yet complex for implementation on the other. The argument is posed that place is particularly important in the context of education about the environment, which in its simplest manifestation, connects formal science curriculum to resources that are local and tangible to students. The incorporation of place in such a framework seeks to bridge the gap between formal school science subjects and students' lived experiences, yet acknowledges the tensions that can arise between accommodating place meanings and the desire to acculturate students into the language of the scientific community. The disconnect between guiding policy frameworks and the reality of the Next Generation Science Standards is addressed opening an avenue for further discussion of the importance of socio-cultural frameworks of science learning in an ever increasing era of accountability.

  17. Technical training: places available

    CERN Multimedia

    HR Department


    CERN Technical Training: Open Courses (April - June 2007) The following course sessions are currently scheduled in the framework of the CERN Technical Training Programme 2007:   AutoCAD 2006 - niveau 1 (course in French): 25.4.- 26.4.2007 & 2.5. - 3.5.2007 (4 days in 2 modules, 5 places available) AutoCAD 2006 - niveau 1 (course in French): 27.6.- 28.6.2007 & 3.7. - 4.7.2007 (4 days in 2 modules, 5 places available) AutoCAD Mechanical 2006 (course in French) 21.6.-22.6.2007 (2 days, 8 places available) * NEW COURSE* Automate de securite S7 (course in French) 14.5.-16.5.2007 (3 days, 4 places available) * NEW COURSE* Automate de securite S7 (course in French): 9.5.-11.5.2007 (3 days, 4 places available) JCOP - Joint PVSS-JCOP Frameswork (course in English): 21.5.-25.5.2007 (5 days, 12 places available) JCOP - Finite State Machines in the JCOP Frameswork (course in English): 12.6.-14.6.2007 (3 days, 12 places available) LabVIEW Basics 1 (in English): 2.-4.5.2007 (3 days, 7 places ...

  18. A Sense of Place

    Directory of Open Access Journals (Sweden)

    Rachel Black


    Full Text Available People increasingly want to know where their food and wine comes from and who produces it. This is part of developing a taste of place, or what the French call terroir. The academic and industry debates surrounding the concept of terroir are explored, and the efforts of Massachusetts wine producers to define their sense of place are discussed.

  19. Place in transition

    DEFF Research Database (Denmark)

    Mikkelsen, Jacob Bjerre; Lange, Ida Sofie Gøtzsche


    World. This paper discusses the conception of place in the Oil World, with the relocation and transformation of oil rigs from an urban design perspective as its point of departure, using Esbjerg, Denmark, as a case study. Combining a theoretical understanding of places as relational with a design...

  20. The Case for Place (United States)

    Thomas, Lisa Carlucci


    Bookstores, record stores, libraries, Facebook: these places--both physical and virtual--demonstrate an established and essential purpose as centers of community, expertise, convenience, immediacy, and respect. Yet as digital, mobile, and social shifts continue to transform culture and interactions, these spaces and places transform, too.…

  1. Non-Place

    DEFF Research Database (Denmark)

    formulation. The anthology contains 17 articles engaged directly in the application, retrofitting and broadening of the concept of the non-place to a range of literary and media texts, as well as the merging of this concept to other theoretical concepts by e.g. Michel Foucault, Gilles Deleuze, Alain Badiou......We spend more and more of our everyday lives in what Marc Augé calls non-places – homogenous, but bland places of transit. This anthology addresses the representations of non-places in literature, culture and media, and critiques and re-actualizes Augé’s work twenty years after its initial...... Jutland, and many others. This anthology is the seventh publication in the IRGiC series and it springs from a research seminar held at Aalborg University in May 2013: “Non-Place in Literature, Media and Culture”....

  2. Place-Specific Computing

    DEFF Research Database (Denmark)

    Messeter, Jörn; Johansson, Michael

    project place- specific computing is explored through design oriented research. This article reports six pilot studies where design students have designed concepts for place-specific computing in Berlin (Germany), Cape Town (South Africa), Rome (Italy) and Malmö (Sweden). Background and arguments...... for place-specific computing as a genre of interaction design are described. A total number of 36 design concepts designed for 16 designated zones in the four cities are presented. An analysis of the design concepts is presented indicating potentials, possibilities and problems as directions for future......An increased interest in the notion of place has evolved in interaction design. Proliferation of wireless infrastructure, developments in digital media, and a ‘spatial turn’ in computing provides the base for place-specific computing as a suggested new genre of interaction design. In the REcult...

  3. Technical training - places available

    CERN Multimedia


    If you would like more information on a course, or for any other inquiry/suggestions, please contact Valeria Perez Reale, Learning Specialist, Technical Programme Coordinator (Tel.: 62424) Eva Stern and Elise Romero, Technical Training Administration (Tel.: 74924) HR Department »Electronics design Next Session Duration Language Availability Comprehensive VHDL for FPGA Design 08-Oct-12 to 12-Oct-12 5 days English 3 places available Foundations of Electromagnetism and Magnet Design (EMAG) 14-Nov-12 to 27-Nov-12 6 days English 20 places available Impacts de la suppression du plomb (RoHS) en électronique 26-Oct-12 to 26-Oct-12 8 hours French 15 places available Introduction to VHDL 10-Oct-12 to 11-Oct-12 2 days English 7 places available LabVIEW Real Time and FPGA 13-Nov-12 to 16-Nov-12 5 days French 5 places available »Mechanical design Next Se...

  4. Where is 'place' in Aging in place?

    DEFF Research Database (Denmark)

    Blaakilde, Anne Leonora


    is influenced by universalism, aiming at equality in terms of access to health services and care. However, these welfare provisions seem to be deeply embedded in methodological nationalism, since only citizens with residence within the borders of Denmark have the right to live in public nursing homes or receive......The aim of this article is to contribute a transnational perspective to the field of environmental gerontology and the concept of aging in place. Seniors from the northern hemisphere, among them Danish citizens, are increasingly adapting to transnational lives as they move to warmer climates...... in-home help. It is argued that we should consider public solutions to the problems faced by frail Danish citizens in transnational settings, enhancing their opportunities to live abroad....

  5. Taking iron supplements (United States)

    ... Taking iron supplements To use the sharing features on this page, ... levels. You may also need to take iron supplements as well to rebuild iron stores in your ...

  6. Context in place

    DEFF Research Database (Denmark)

    Nordentoft, Helle Merete; Thomsen, Rie

    specifically argue for a more grounded approach to the conception of context - a topographic approach - in which the physical setting - i.e. 'the place' becomes an inevitable part of analyses of guidance practices in order to understand participants' sense-making processes. In the paper we draw on two case...... studies on interdisciplinary clinical supervision and work place guidance in which there appears to be a mismatch between intended outcomes and actual events. The analyses demonstrate and support that 'the place' seems - to influence partipants' responses in the guidance sessions and, therefore, must...

  7. Management and communication courses – Places available

    CERN Multimedia


    There are places available in some management and communication courses taking place in the period April to June 2013.   For more information on the course, click on the course title, this will bring you to the training catalogue. You can then sign-up online. For advice, you can contact: - Erwin Mosselmans, tel. 74125, - Nathalie Dumeaux, tel. 78144, Courses in English (or bilingual) Sessions Duration Language Availability Managing stress 29 and 30 May 2 days English 3 places Making Presentations 30, 31 May & 25 June 3 days English 2 places Communicating Effectively - Residential course 4 to 6 June 3 days Bilingual 9 places Handling difficult conversations (Adapted from Dealing with Conflict) 7 and 14 June and 13 September 3 days English 6 places Voice and Nonverbal Behaviour in Speech Communication 17 and 18 June 1 day 4 hours English 7 plac...

  8. Reading in Place (United States)

    Price, Leah


    The digital age is rendering books more common, not less. It is true that there is nothing new about "furniture books": The trade in reading material has long been dwarfed by the market for coffee-table books, books that steakhouse chains buy by the yard, empty bindings that interior decorators use to accessorize the upholstery. As coffee-table…

  9. Technical training - Places available

    CERN Document Server


    If you would like more information on a course, or for any other inquiry/suggestions, please contact Valeria Perez Reale, Learning Specialist, Technical Programme Coordinator (Tel.: 62424) Eva Stern and Elise Romero, Technical Training Administration (Tel.: 74924)   Electronics design Next Session Duration Language Availability Certified LabVIEW Associate Developer (CLAD) 06-Dec-12 to 06-Dec-12 1 hour English One more place available Compatibilité électromagnetique (CEM): Applications 23-Nov-12 to 23-Nov-12 3.5 hours English 3 places available Compatibilité électromagnétique (CEM): Introduction 23-Nov-12 to 23-Nov-12 3 hours English 43 places available Effets des Radiations sur les composants et systèmes électroniques 11-Dec-12 to 12-Dec-12 1 day 4 hours French 9 places available LabVIEW for beginners ...

  10. History, Criticism and Place

    DEFF Research Database (Denmark)

    Hinds, Mat; Carter, Adrian; Malpas, Jeff


    Rory Spence and Richard Leplastrier shared a conversation and friendship that lasted 20years until Spence's death in 2004. The discussions focused largely upon issues of place, distilled through the practice of Leplastrier....

  11. Marine Place Names (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains the geographic place names for features in the U.S territorial waters and outer continental shelf. These names can be used to find or define a...

  12. Self-Placing Concrete


    ECT Team, Purdue


    Certain concrete pours have areas where the congestion of reinforcing bars make placement of concrete almost impossible. Using conventional placing and vibration techniques, the resulting concrete can have considerable honeycombing due to the development of voids. Self-placing concrete is a possible solution to the problem. Also known as self-compactable concrete, self-consolidating concrete, flowable concrete, and non-vibration concrete. These concretes eliminate the need for vibration in a ...

  13. 'A Place to Sit'

    DEFF Research Database (Denmark)

    Hvejsel, Marie Frier; Klok, Julie Skovgaard; Bøhnke, Mia Marker

    Published in 2014 on the occasion of the third 'A Place to Sit' exhibition as a reflection upon three years of teaching tectonic method in architecture using the furniture scale as a learning basis.......Published in 2014 on the occasion of the third 'A Place to Sit' exhibition as a reflection upon three years of teaching tectonic method in architecture using the furniture scale as a learning basis....

  14. Technical training - Places available

    CERN Multimedia


    If you would like more information on a course, or for any other inquiry/suggestions, please contact Valeria Perez Reale, Learning Specialist, Technical Programme Coordinator (Tel.: 62424) Eva Stern and Elise Romero, Technical Training Administration (Tel.: 74924) HR Department Electronic Design Next Session Duration Language Availability Comprehensive VHDL for FPGA Design 08-Oct-12 to 12-Oct-12 5 days English 4 places Electrostatique / Protection ESD 28-Sep-12 to 28-Sep-12 3 hours French 25 places Impacts de la suppression du plomb (RoHS) en électronique 26-Oct-12 to 26-Oct-12 8 hours French 14 places Introduction to VHDL 10-Oct-12 to 11-Oct-12 2 days English 9 places LabVIEW Real Time and FPGA 13-Nov-12 to 16-Nov-12 5 days French 5 places LabVIEW for Experts 24-Sep-12 to 28-Sep-12 5 days English 6 places LabVIEW for beginners 15-Oct-12 to 17-...

  15. Polar bear hemoglobin and human Hb A0: same 2,3-diphosphoglycerate binding site but asymmetry of the binding? (United States)

    Pomponi, Massimo; Bertonati, Claudia; Patamia, Maria; Marta, Maurizio; Derocher, Andrew E; Lydersen, Christian; Kovacs, Kit M; Wiig, Oystein; Bårdgard, Astrid J


    Polar bear (Ursus maritimus) hemoglobin (Hb) shows a low response to 2,3-diphosphoglycerate (2,3-DPG), compared to human Hb A0, even though these proteins have the same 2,3-DPG-binding site. In addition, polar bear Hb shows a high response to chloride and an alkaline Bohr effect (deltalog P50/deltapH) that is significantly greater than that of human Hb A0. The difference in sequence Pro (Hb A0)-->Gly (polar bear Hb) at position A2 in the A helix seems to be critical for reduced binding of 2,3-DPG. Our results also show that the A2 position may influence not only the flexibility of the A helix, but that differences in flexibility of the first turn of the A helix may affect the unloading of oxygen for the intrinsic ligand affinities of the alpha and beta chains. However, preferential binding to either chain can only take place if there is appreciable asymmetric binding of the phosphoric effector. Regarding this point, 31P NMR data suggest a loss of symmetry of the 2,3-DPG-binding site in the deoxyHb-2,3-DPG complex.

  16. (Re)tasting places

    DEFF Research Database (Denmark)

    Hedegaard, Liselotte


    What does geographical origin mean? It is an expression that associates food and wine with a specific place, an association embedded in the concept ‘terroir’ that refers to the complex interaction between a physical environment and local craftsmanship. It is a claim protected through labelling......-schemes and a claim that adds value to the place-related foods. However, viewing the connection between food and place as a question of proving a relationship or as a matter of protecting commercial claims does not seem to provide a satisfactory account for the status of geographically designated foods as being...... particularly attractive Central to the interest of this paper is to approach an understanding of geographical origin as a point of reference for taste. In terms of being sensory experience, taste is subjective. It is difficult to describe verbally and yet at the same time it is a trigger of the memory of past...

  17. Stress at Work Place


    Mohammad A. Shahrour


    One of hardest forms of stresses to avoid is that work place or job stress Job stress refers to stress experienced by an individual at or because of issues at their work place The term work related stress has many meanings and it causes different levels of anxiety. Not all challenges at work can be called stress as some of these challenges drive employees upward, and empower them to learn new skills or push them to work harder to achieve a certain goal. So, this type of challenges cannot be c...

  18. Ageing in communal place

    DEFF Research Database (Denmark)

    Aarhus, Rikke; Ballegaard, Stinne Aaløkke; Grönvall, Erik


    In this paper we adopt the position that design of social media for the elderly and virtual senior communities may be informed by studying `real´senior communities. Since current research efforts target the role of social media and virtual communities for supporting seniors ageing in place, i.......e. in their homes, housing communities seems a natural place to begin this enquiry. We conducted observations and informal interviews in six different senior dwellings. In this paper we present the key findings from these visits related to social interaction and the formation of communities and explicate how...

  19. Technical training - Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 16.5.2006 (May-November course sessions) Technical Training: Places available The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language ACROBAT 7.0 : Utilisation de fichiers PDF 8 8.05.06 F WORD 2003 - niveau 2 : ECDL 16 22-23.05.06 23-24.05.06 F Comprehensive VHDL for FPGA Design 40 29.05-2.06.06 E C++ Programming Part 2 - Advanced C++ and its Traps and Pitfalls 32 30.05-2.06.06 E ACROBAT 7.0 : Utilisation de fichiers PDF 24 7-9.06.06 E AutoCAD Mechanical 2006 16 13-14.06.06 F CERN EDMS for Local Administrators 16 13-14.06.06 E LabVIEW Base 2 32 27.06-5.07.06 F C++ Programming Part 3 - Templates and the STL (Standard Template Library) 16 27-28.06.06 E C++ Programming Part 4 - Exceptions 8 29.06.06 E FrontPage 2003 - niveau 1 16 29-...

  20. The Value of Place (United States)

    Dentzau, Michael W.


    This commentary seeks to expand the dialogue on place-based science education presented in Katie Lynn Brkich's article, where the connections fifth grade students make between their formal earth science curriculum and their lived experiences are highlighted. The disconnect between the curriculum the students are offered and their immediate…

  1. The power of place. (United States)

    Lock, Lin R; Gibb, Heather J


    to describe the power that 'place' holds over the postnatal-care experiences of women. a study informed by phenomenology within a feminist framework was undertaken to examine the experiences of women electing early postnatal discharge. Three extended conversations with each woman participating in the study were audiotaped and transcribed. Journal notes made by the researcher added to the audiotaped data. Thematic analysis revealed major structures of experience. data were obtained from conversations with women in their respective homes. five women, parity 1-3, living in the Sydney metropolitan area and birthing in their local hospitals participated in the study. four major constructs of experience were revealed through analysis and include spatiality, corporeality, temporality and relationality. In this paper, components of spatiality expressed through the power place exerts in matters of physical environment,control, confidence, safety, time, talk and the heart of the matter are presented. the experiences of women entering the foreign place of hospital to birth their children were those of alienation and disempowerment while the familiar territory of home offered stronger feelings of security and support. failing to recognise the impact of place on the experiences of postnatal women reduces the likelihood that midwives will be able to offer sensitive and appropriate care.

  2. Ageing in Communal Place

    DEFF Research Database (Denmark)

    Aarhus, Rikke; Ballegaard, Stinne Aaløkke; Grönvall, Erik


    In this paper we adopt the position that design of social media for the elderly and virtual senior communities may be informed by studying ‘real’ senior communities. Since current research efforts target the role of social media and virtual communities for supporting seniors ageing in place, i...

  3. Technical training - Places available

    CERN Multimedia


    * Etant donné le délai d'impression du Bulletin, ces places peuvent ne plus être disponibles au moment de sa parution. Veuillez consulter notre site Web pour avoir la dernière mise à jour. ** The number of places available may vary. Please check our Web site to find out the current availability. Des places sont disponibles dans les cours suivants : Places are available in the following courses: Hands-on Introduction to Python Programming 12 – 14.11.03 (3 days) ACCESS 2000 – niveau 1 13 & 14.11.03 (2 jours) C++ for Particle Physicists 17 – 21.11.03 (6 x 3-hour lectures) Programmation automate Schneider TSX Premium – niveau 2  18 – 21.11.03 (4 jours) Planification de projet avec MS-Project/Project Planning with MS-Project (gratuit/free of charge – langue à définir/language to be defined) : 18 & 25.11.03 (2 jours/2 days) JAVA 2 Enterprise Edition – Part 1 : WEB...

  4. How to take statins (United States)

    ... allergies. You are taking other medicines. You have diabetes. You have liver disease. You should not take statins if you ... with your provider about the possible risks for: Liver damage Severe ... High blood sugar, or type 2 diabetes Memory loss Confusion

  5. Note Taking and Recall (United States)

    Fisher, Judith L.; Harris, Mary B.


    To study the effect of note taking and opportunity for review on subsequent recall, 88 college students were randomly assigned to five treatment groups utilizing different note taking and review combinations. No treatment effects were found, although quality of notes was positively correlated with free recall an multiple-choice measures.…

  6. Settings: In a Variety of Place. . . (United States)

    Cairo, Peter; And Others

    This document consists of the fourth section of a book of readings on issues related to adult career development. The four chapters in this fourth section focus on settings in which adult career development counseling may take place. "Career Planning and Development in Organizations" (Peter Cairo) discusses several concepts and definitions…

  7. Experiencing the enchantment of place and mobility

    DEFF Research Database (Denmark)

    Bærenholdt, Jørgen Ole


    in several layers of reality. To better understand experiences taking place in intersections between realities, J.R.R. Tolkien’s concept of how real enchantment produces a Secondary World suggests that we see fantasy as real, and this proposition is compared to Georg Simmel’s more modernist suggestion......Experiences of place and mobility play central roles not only in what was traditionally understood as tourism, but also in the broader practices of travelling and visiting sites and sights. On the one hand, such experiences are performed to an extent where it is difficult to isolate the sites...... and movements experienced per se, since visitors and travellers take part in ‘doing’ places and mobility. On the other, experience sites and routes stand out with specific traces and characteristics affording some – and not other – experiences. This paper discusses conceptual understandings that may help...

  8. Parks, People and Places

    DEFF Research Database (Denmark)

    Molin, Julie Frøik

    This thesis suggests, by applying a ‘place’ perspective, that involving users in operational management of green spaces holds potentials for enhancing ‘place attachment’ of urban inhabitants. As this can also build their commitment to decision making on their local living environment, green space...... maintenance becomes a potentially important setting for governance processes. Through a number of qualitative case studies, based on semi-structured interviews with municipal and community actors in Denmark and England, this dissertation explores the status and potentials of applying a place-based governance...... approach to green space maintenance. To guide the exploration a theoretical framework was developed inductively, structured around concepts of environmental governance in combination with strategic approaches to green space management. The framework is operationalised by analyses of the governance...

  9. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The Joint PVSS JCOP Framework: 14 - 18.6.2004 (5 days) EXCEL 2003 - niveau 2 : 17 & 18.6.2004 (2 jours) MAGNE-04 : Magnétisme pour l'électrotechnique : 6 au 8.7.2004 (3 jours) Technical Training Monique Duval - Tel.74924

  10. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 30.5.2006 (June-November course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue ACROBAT 7.0 : Utilisation de fichiers PDF 8 6.06.06 F Introduction à InDesign 16 7-8.06.06 F Python: Hands-on Introduction 24 7-9.06.06 E LabVIEW Base 2 16 22-23.06.06 F FileMaker - niveau 1 16 26-27.06.06 F C++ Programming Part 3 - Templates and the STL (Standard Template Library) 16 27-28.06.06 E C++ Programming Part 4 - Exceptions 8 29.06.06 E FrontPage 2003 - niveau 1 16 29-30.06.06 F Manipulation des images 4 6.07.06 F Introduction to Databases and Database Design 16 11-12.07.06 E ACCESS 2003 - Level 1: ECDL 16 13-14.07.06 E-F Design Patterns 16 25-26.07.06 E Introduction à Dreamweaver MX 16 ...

  11. Technical training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 13.6.2006 (June-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue LabVIEW Base 2 16 22-23.06.06 F FileMaker - niveau 1 16 26-27.06.06 F C++ Programming Part 3 - Templates and the STL (Standard Template Library) 16 27-28.06.06 E C++ Programming Part 4 - Exceptions 8 29.06.06 E FrontPage 2003 - niveau 1 16 29-30.06.06 F Manipulation des images 4 6.07.06 F Introduction to Databases and Database Design 16 11-12.07.06 E ACCESS 2003 - Level 1: ECDL 16 13-14.07.06 E-F Design Patterns 16 25-26.07.06 E Introduction à Dreamweaver MX 16 26-27.07.06 F ANSYS DesignModeler 16 29-30.08.06 F LabVIEW Basics 1 24 4-6.09.06 E ANSYS Workbench 32 12-15.09.06 F AutoCAD Mechanical 20...

  12. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 9.5.2006 (May-October course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: find out the curren Hours Date Language LabVIEW Application Development 24 15-17.05.06 E LabVIEW Advanced Programming 16 18-19.05.06 E PERL 5: Advanced Aspects 8 18.05.06 E Technique du vide 16 18-19.05.06 F FileMaker - niveau 2 16 11-12.05.06 F WORD 2003 - niveau 2 : ECDL 16 22-23.05.06 F Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE 16 23-24.05.06 F Comprehensive VHDL for FPGA Design 40 29.05-2.06.06 E C++ Programming Part 2 - Advanced C++ and its Traps and Pitfalls 32 30.05-2.06.06 E Python: Hands-on Introduction 24 7-9.06.06 E AutoCAD Mechanical 2006 16 13-14.06.06 F CERN EDMS for Local Administrators 16 13-14.06.06...

  13. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 27.6.2006 (July-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue Manipulation des images 4 6.07.06 F Introduction to Databases and Database Design 16 11-12.07.06 E ACCESS 2003 - Level 1: ECDL 16 13-14.07.06 E-F Design Patterns 16 25-26.07.06 E CERN EDMS for Local Administrators 16 1-2.08.06 E ANSYS DesignModeler 16 29-30.08.06 F CERN EDMS - Introduction 8 5.09.06 E CERN EDMS MTF en pratique 4 6.09.06 F LabVIEW Basics 1 24 4-6.09.06 E ANSYS Workbench 32 12-15.09.06 F AutoCAD Mechanical 2006 16 12-13.09.06 F CERN EDMS for Engineers 8 12.09.06 E Software Engineering in the Small and the Large 16 12-13.09.06 E AutoCAD 2006 - niveau 1 32 14-21.09.06 F LabVIEW Basics 2 ...

  14. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 11.7.2006 (July-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue Design Patterns 16 25-26.07.06 E CERN EDMS for Local Administrators 16 1-2.08.06 E ANSYS DesignModeler 16 29-30.08.06 F CERN EDMS – Introduction 8 5.09.06 E CERN EDMS MTF en pratique 4 6.09.06 F LabVIEW Basics 1 24 4-6.09.06 E ANSYS Workbench 32 12-15.09.06 F AutoCAD Mechanical 2006 16 12-13.09.06 F CERN EDMS for Engineers 8 12.09.06 E Software Engineering in the Small and the Large 16 12-13.09.06 E LabVIEW Basics 2 16 14-15.09.06 E LabVIEW: Working efficiently with LabWIEW 8 8 18.09.06 E PCAD Schémas ? Introduction 16 21-22.09.06 F PCAD PCB - Introduction  24 27-29.09.06 F C++ for Particle Physicists ...

  15. Technical Training: Places available

    CERN Multimedia


    Places available as of 21.3.2006 (March-October course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: find out the curren Hours Date Language ACROBAT 7.0 : Utilisation de fichiers PDF 8 8.05.06 F Project Planning with MS-Project 16 9.05-6.06.06 E STEP7: niveau 1 32 9-12.05.06 E-F Oracle: Programming with PL/SQL 24 10-12.05.06 E FileMaker - niveau 2 16 11-12.05.06 F LabVIEW Application Development 24 15-17.05.06 E LabVIEW Advanced Programming 16 18-19.05.06 E PERL 5: Advanced Aspects 8 18.05.06 E Technique du vide 16 18-19.05.06 F WORD 2003 - niveau 2 : ECDL 16 22-23.05.06 F Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE 16 23-24.05.06 F Comprehensive VHDL for FPGA Design 40 29.05-2.06.06 E C++ Programming Part 2 - Advanced C++ and its T...

  16. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 19.7.2006 (August-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue CERN EDMS for Local Administrators 16 1-2.08.06 E ANSYS DesignModeler 16 29-30.08.06 F OUTLOOK 2003 (Short Course I) - E-mail 3 1.09.06 E/F OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Notes 3 1.09.06 E/F CERN EDMS - Introduction 8 5.09.06 E CERN EDMS MTF en pratique 4 6.09.06 F LabVIEW Basics 1 24 11-13.09.06 E ANSYS Workbench 32 12-15.09.06 F CERN EDMS for Engineers 8 12.09.06 E Software Engineering in the Small and the Large 16 12-13.09.06 E LabVIEW Basics 2 16 14-15.09.06 E EXCEL 2003 (Short Course I) - HowTo... Work with formulae 3 15.09.06 E/F WORD 2003 (Short Course III) - HowTo... Work with long docu...

  17. Technical Training: Places available

    CERN Multimedia

    DAvide Vitè


    Places available as of 25.7.2006 (August-December course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Titre Heure Date Langue CERN EDMS for Local Administrators 16 1-2.08.06 E ANSYS DesignModeler 16 29-30.08.06 F EXCEL 2003 - niveau 1 : ECDL 16 30-31.08.06 F OUTLOOK 2003 (Short Course I) - E-mail 3 1.09.06 E/F OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Notes 3 1.09.06 E/F CERN EDMS - Introduction 8 5.09.06 E CERN EDMS MTF en pratique 4 6.09.06 F ANSYS Workbench 32 12-15.09.06 F CERN EDMS for Engineers 8 12.09.06 E Software Engineering in the Small and the Large 16 12-13.09.06 E LabVIEW Basics 2 16 14-15.09.06 E WORD 2003 (Short Course III) - HowTo... Work with long documents 3 15.09.06 E/F EXCEL 2003 (Short Course I) - HowTo... Wor...

  18. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 7.2.2006 (February-May course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language WORD 2003 (Short Course II) - HowTo... Mail merge 3 09-02-06 E-F ACCESS 2003 - Level 1: ECDL M5 16 13 to 14-02-06 E-F OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Notes 3 16-02-06 E-F WORD 2003 (Short Course III) - HowTo... Work with long documents 3 16-02-06 E-F CERN EDMS - Introduction 8 21.02.06 E OUTLOOK 2003 (Short Course III) - Meetings and Delegation 3 27-02-06 E-F WORD 2003 (Short Course IV) - HowTo... Work with master document 3 27-02-06 E-F JAVA: Level 2 32 28-02-06 to 03-03-06 E Manipulation des images 4 28.02.06 F ACCESS 2003 - Level 2: ECDL AM5 16 02 to 03-03-06 E-F FrontPage 2003 - niveau 2 16 02 to 03-03-06 F C++ for Particle Physicists 20 06 to 10-03-06 E FileMaker - niv...

  19. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 21.3.2006 (March-October course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language FrontPage 2003 - niveau 1 16 27-28.03.06 F Oracle Forms Developer 10g: Move to the Web 16 27-28.03.06 E ACCESS 2003 - Level 2: ECDL AM5 16 3-4.03.06 E-F JAVA 2 Enterprise Edition - Part 1: Web Applications 16 3-4.04.06 E JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans 24 5-7.04.06 E AutoCAD Mechanical 2006 16 11-12.04.06 F FrontPage 2003 - niveau 2 16 24-25.04.06 F C++ Programming Part 1 - Introduction to Object-Oriented Design and Programming 24 25-27.04.06 E AutoCAD 2006 - niveau 1 32 27.04-4.05.06 F Oracle: SQL 24 3-5.05.06 E EXCEL 2003 (Short Course I) - HowTo... Work with formulae 3 4.05.06 (am) E-F EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing 3 4...

  20. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 7.2.2006 (February-May course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language WORD 2003 (Short Course II) - HowTo... Mail merge 3 13.03.06 E-F EXCEL 2003 (Short Course III) - HowTo... Pivot tables 3 20.03.06 E-F EXCEL 2003 (Short Course IV) - HowTo....Link cells, worksheets and workbooks 3 20.03.06 E-F Object-Oriented Analysis and Design using UML 24 21-23.03.06 E EXCEL 2003 - niveau 1 16 22-23.03.06 F FrontPage 2003 - niveau 1 16 27-28.03.06 F Oracle Forms Developer 10g: Move to the Web 16 27-28.03.06 E Oracle JDeveloper 10g: Build Applications with ADF 24 29-31.03.06 E ACCESS 2003 - Level 2: ECDL AM5 16 3-4.03.06 E-F JAVA 2 Enterprise Edition - Part 1: Web Applications 16 3-4.04.06 E JCOP: Control System Integration using JCOP Tools 24 4-6.04.06 E JAVA 2 Enterprise Edition...

  1. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Places available as of 7.2.2006 (February-May course sessions) The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language WORD 2003 (Short Course IV) - HowTo... Work with master document 3 27.02.06 E-F JAVA: Level 2 32 28.02-3.03.06 E Manipulation des images 4 28.02.06 F ACCESS 2003 - Level 2: ECDL AM5 16 2-3.03.06 E-F C++ for Particle Physicists 20 6-10.03.06 E PowerPoint 2003 8 9.03.06 F JCOP: Control System Integration using JCOP Tools 24 14-16.03.06 E EXCEL 2003 (Short Course III) - HowTo... Pivot tables 3 20.03.06 E-F EXCEL 2003 (Short Course IV) - HowTo....Link cells, worksheets and workbooks 3 20.03.06 E-F JCOP: Finite State Machines in the JCOP Framework 24 21-23.03.06 E Object-Oriented Analysis and Design using UML 24 21-23.03.06 E FrontPage 2003 - niveau 1 16 27-28.03.06 F JCOP: Joint PVSS-JCOP Fram...

  2. 1. On note taking. (United States)

    Plaut, Alfred B J


    In this paper the author explores the theoretical and technical issues relating to taking notes of analytic sessions, using an introspective approach. The paper discusses the lack of a consistent approach to note taking amongst analysts and sets out to demonstrate that systematic note taking can be helpful to the analyst. The author describes his discovery that an initial phase where as much data was recorded as possible did not prove to be reliably helpful in clinical work and initially actively interfered with recall in subsequent sessions. The impact of the nature of the analytic session itself and the focus of the analyst's interest on recall is discussed. The author then describes how he modified his note taking technique to classify information from sessions into four categories which enabled the analyst to select which information to record in notes. The characteristics of memory and its constructive nature are discussed in relation to the problems that arise in making accurate notes of analytic sessions.

  3. Emerging place image

    DEFF Research Database (Denmark)

    Ooi, Can-Seng; Peji´c Kristensen, Tatjana; Lomanová Pedersen, Zdenka


    and perceptions.This paper introduces the concept of the orientalist tourist gaze, and demonstrates howorientalism may manifest in tourism. Data on how these two countries are imagined werecollected in Denmark.Keywords: destination identity, host society-guest interaction, impact of tourism, orientalism......Tourism offers an arena through which a place identity is imagined, negotiated and contained.This paper compares the Czech Republic and Slovakia, and show how these countriesconstruct and assert their identities through tourism. They both share a common history asCzechoslovakia, however...

  4. Tourism Sociabilities and Place

    DEFF Research Database (Denmark)

    Bødker, Mads; Browning, David


    Proposing new design opportunities, this paper challenges received notions of tourism, arguing that tourism is fundamentally social and concerned with making place. This turn makes tourism not only a convenient testing ground for technology concepts, but increasingly also for more sensitive...... renderings of, and interventions in, tourism as a relational and social practice. Using examples from commercial, arts, and design projects, and providing excerpts from our own fieldwork and design workshops with tourists and locals, this paper outlines three challenges through a conceptual lens that we see...... as productive for appropriate interaction design of tourism technologies....

  5. Signs in Place

    DEFF Research Database (Denmark)

    Hamid, Salmiah Binti Abdul; Jensen, Ole B.; Silva, Victor

    Travelling in unfamiliar areas is usually very interesting, however it can also be stressful. People travel or move around in an urban space according to their needs, and the environment can also influence the way people move about from one place to another. If a person gets lost, a map or GPS can...... and geosemiotic studies with regards to the road traffic signs used in urban spaces. The paper ends with a discussion on how people choreograph their movement in their everyday life from two different perspectives: above vs. below....

  6. Signs In Place

    DEFF Research Database (Denmark)

    Hamid, Salmiah Binti Abdul; Jensen, Ole B.; Silva, Victor


    Travelling in unfamiliar areas is usually very interesting; however, it can also be stressful. People travel or move around in an urban space according to their needs, and the environment can influence the way people move about from one place to another. If a person gets lost, a map or GPS can...... and geosemiotic studies with regards to the road traffic signs used in urban spaces. The paper ends with a discussion on how people choreograph their movement in their everyday life from two different perspectives: above vs. below...

  7. Tackling the take-or-pay problem

    International Nuclear Information System (INIS)

    Jackson, Kim.


    Centrica, the gas sales, trading and services company previously part of British Gas plc, has renegotiated a number of its take-or-pay contracts with North Sea gas producers since the end of 1996. The contracts - a legacy of the British Gas monopoly era - had placed an increasing financial burden on the company as it was effectively forced to pay above-market prices for gas which it did not always want to take, while trying to remain competitive in a market where an ever growing number of independent gas suppliers were offering low-cost supplies. The author looks at how Centrica has tackled its take-or-pay problem. (author)

  8. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: C++ for Particle Physicists : 8 - 12.3.2004 (6 X 4-hour sessions) Introduction to the CERN EDMS : 9.3.2004 (1 day, free of charge) The EDMS MTF in Practice : 10.3.2004 (morning, free of charge) CLEAN-2002: Working in a Cleanroom : 10.3.2004 (afternoon, free of charge) The CERN EDMS for Engineers : 11.3.2004 (1 day, free of charge) LabVIEW hands-on (E):...

  9. Technical Training: Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW base 1 : 25 - 27.2.2004(3 jours) Instructor-led WBTechT study or follow-up for Microsoft applications : 26.2.2004 (morning) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Particle Physicists : 8 - 12.3.2004 (6 X 4-hour sessions) LabVIEW hands-on (E) : 16.3.2004 (afternoon) LabVIEW Basics 1 : 22 - 24.3.2004 ...

  10. Technical Training: Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Instructor-led WBTechT study for Microsoft applications :12.2.2004 (morning) Instructor-led WBTechT study or follow-up for Microsoft applications : 19.2.2004 (morning) LabVIEW TestStand I (E) : 23 & 24.2.2004 (2 days) LabVIEW base 1 : 25 - 27.2.2004 (3 jours) Instructor-led WBTechT study or follow-up for Microsoft applications : 19.2.2004 (morning) CLEAN-2002 ...

  11. Technical Training: Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Instructor-led WBTechT study or follow-up for Microsoft applications : 19.2.2004 (morning) LabVIEW TestStand I (E) : 23 & 24.2.2004 (2 days) LabVIEW base 1 : 25 - 27.2.2004 (3 jours) Instructor-led WBTechT study or follow-up for Microsoft applications : 26.2.2004 (morning) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Pa...

  12. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Hands-on Object-Oriented Design and Programming with C++ : 22 - 24.3.2005 (3 days) FileMaker - niveau 2 : 4 & 5.4.2005 (2 jours) EMAG-2004 - Electromagnetic Design and Mathematical Optimization in Magnet Technology: 4- 14.4.2005 (8 x 3h) EXCEL 2003 - niveau 2 : 11 & 12.4.2005 (2 jours) LabVIEW Intermediate 1: 11 - 13.4.2005 (3 days) ACCESS 2003 - Level 2 - ECDL AM5: 13 & 14.4.2005 (2 days) LabVIEW Intermediate 2: 14 & 15.4.2005 (2 days) PowerPoint 2003 (F) : 18.4.2005 (1 jour) Joint PVSS JCOP Framework : 25 - 29.4.2005 (5 days) WORD 2003 - niveau 1 : 2 & 3.5.2005 (2 jours) ELEC-2005 - Summer Term: System electronics for physics - Issues : 10, 12, 17, 19, 24, 26 & 31.5.2005 (7 x 2h lectures) AutoCAD 2002 - niveau 1 : 11, 12, 18 & 19.5.2005 (4 jour...

  13. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Outlook (short course I) : E-mail : 31.8.2004 (2 hours, morning) Introduction à Outlook : Outlook (short course II) : Calendar, Tasks and Notes : 31.8.2004 (2 hours, afternoon) Instructor-led WBTechT Study or Follow-up for Microsoft Applications : 7.9.2004 (morning) Outlook (short course III) : Meetings and Delegation : 7.9.2004 (2 hours, afternoon) Introduction au VHDL et utilisation du simulateur ...

  14. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Joint PVSS JCOP Framework : 9 - 13.8.2004 (5 days) Introduction à Outlook : 19.8.2004 (1 jour) Outlook (Short Course I): E-mail: 31.8.2004 (2 hours, morning) Outlook (Short Course II): Calendar, Tasks and Notes: 31.8.2004 (2 hours, afternoon) Instructor-led WBTechT Study or Follow-up for Microsoft Applications: 7.9.2004 (morning) Outlook (Short Course III): Meetings and Delegation: 7.9.2004 (2 hours, afternoon) I...

  15. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Joint PVSS JCOP Framework : 9 - 13.8.2004 (5 days) Introduction à Outlook : 19.8.2004 (1 jour) Outlook (Short Course I): E-mail: 31.8.2004 (2 hours, morning) Outlook (Short Course II): Calendar, Tasks and Notes: 31.8.2004 (2 hours, afternoon) Hands-on Introduction to Python Programming: 1 - 3.9.2004 (3 days - free course) Instructor-led WBTechT Study or Follow-up for Microsoft Applications: 7.9.20...

  16. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Introduction à ANSYS : 23 - 26.11.2004 (4 jours) FileMaker - niveau 1 : 23 - 26.11.2004 (4 jours) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) Explicit Dynamics with ANSYS/LS-Dyna : 7 - 9.12.2004 (3 days) Introduction to PERL 5 : 8 & 9.12.2004 (2 days) PCAD Schémas - Débutants : 9 & 10.12.2004 (2 jours) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) Introduction to the CERN EDMS : 18.1.2005 (1 day - free course) The CERN EDMS for Local Administrators : 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) CLEAN-2002 : Travaill...

  17. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Explicit Dynamics with ANSYS/LS-Dyna : 7 - 9.12.2004 (3 days) Introduction to PERL 5 : 8 & 9.12.2004 (2 days) PCAD Schémas - Débutants : 9 & 10.12.2004 (2 jours) Advanced aspects of PERL 5: 10.12.2004 (1 day) PCAD PCB – Débutants : 13 - 15.12.2004 (3 jours) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) Introduction to the CERN EDMS : 18.1.2005 (1 day - free course) The CERN EDMS for Local Administrators : 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) CLEAN-2002 : Travailler en salle propre : 25.1.2005 (après-midi, cours gratuit) Compatibilit&eac...

  18. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: FileMaker - niveau 1 : 23 - 26.11.2004 (4 jours) Explicit Dynamics with ANSYS/LS-Dyna : 7 - 9.12.2004 (3 days) Introduction to PERL 5 : 8 & 9.12.2004 (2 days) PCAD Schémas - Débutants : 9 & 10.12.2004 (2 jours) Advanced aspects of PERL 5: 10.12.2004 (1 day) PCAD PCB – Débutants : 13 - 15.12.2004 (3 jours) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) Introduction to the CERN EDMS : 18.1.2005 (1 day - free course) The CERN EDMS for Local Administrators : 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) CLEAN-2002 : Travailler en salle propre : 25.1.2005 ...

  19. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) Word 2003 - niveau 1 : 22 & 23.11.2004 (2 jours) Introduction à ANSYS : 23 - 26.11.2004 (4 jours) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) Explicit Dynamics with ANSYS/LS-Dyna : 7 - 9.12.2004 (2 days) PCAD Schémas - Débutants : 9 & 10.12.2004 (2 jours) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) CLEAN-2002 : Travailler en salle propre : 25.1.2005 (après-midi, cours gratuit) Compatibilité électromagnétique (CEM) : installation et remèdes : 25 - 27.1.2005 (3 jours) Finite State Machines in the JCOP Fr ...

  20. Technical Training: Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: C++ for Particle Physicists : 8 - 12.3.2004 (6 X 4-hour sessions) Introduction to the CERN EDMS : 9.3.2004 (1 day, free of charge) The EDMS MTF in Practice : 10.3.2004 (morning, free of charge) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon, free of charge) The CERN EDMS for Engineers : 11.3.2004 (1 day, free of charge) LabVIEW...

  1. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.09.2004 (4 jours) Introduction to the CERN EDMS : 22.6.2004 (1 day) The CERN EDMS for local administrators : 23 & 24.6.2004 (2 days) MAGNE-04 : Magnétisme pour l'électrotechnique : 6 - 8.7.2004 (3 jours) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) ENSEIGNEMENT TECHNIQUE TECHNICAL TRAINING...

  2. Technical Training: Places available

    CERN Document Server

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Joint PVSS JCOP Programming : 9 - 13.8.2004 (5 days) Hands-on Introduction to Python Programming: 1 - 3.9.2004 (3 days - free course) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) Joint PVSS JCOP Programming : 13 - 17.9.2004 (5 days) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.9.2004 (4 jours) Programmation STEP7 niveau 1 : 14-17.9.2004 (4...

  3. Technical Training: Places available**

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1 : 9 & 10.1.2004 (2 days) LabVIEW TestStand I (E) : 23 & 24.2.2004 (2 days) LabVIEW base 1 : 25 - 27.2.2004 (3 jours) CLEAN-2002 : Working in a Cleanroom : 10.3.2004 (afternoon - free of charge) C++ for Particle Physicists : 8 - 12.3.2004 ( 6 X 4-hour sessions) LabVIEW hands-on (E) 16.3...

  4. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Hands-on Introduction to Python Programming: 1 - 3.9.2004 (3 days - free course) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.9.2004 (4 jours) Programmation STEP7 niveau 1 : 14-17.9.2004 (4 jours) FrontPage 2003 - niveau 1 : 20 & 21.9.2004 (2 jours) Word 2003 - niveau 2 : 27 & 28.9.2004 (2 jours) Introduction à Wind...

  5. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Introduction to the CERN EDMS : 22.6.2004 (1 day) The CERN EDMS for local administrators : 23 & 24.6.2004 (2 days) Compatibilité électromagnétique (CEM) - Introduction / Electromagnetic Compatibility (EMC) - Introduction: 7.7.2004 (morning) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.9.2004 (4 jours) Programmation STEP...

  6. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) Word 2003 - niveau 1 : 22 & 23.11.2004 (2 jours) Introduction à ANSYS : 23 - 26.11.2004 (4 jours) CLEAN-2002 - Travailler en salle propre : 23.11.2004 (après-midi, cours gratuit) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) ENSEIGNEMENT ...

  7. Technical training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) Word 2003 - niveau 1 : 22 & 23.11.2004 (2 jours) Introduction à ANSYS : 23 - 26.11.2004 (4 jours) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) Introduction to PERL 5 : 8 & 9.12.2004 (2 days) Advanced aspects of PERL 5 : 10.12.2004 (1 day) The JAVA Programming Language Level 1 : 11 & 12.1.2005 (2 days) Introduction...

  8. Technical Training: Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Project Planning with MS-Project :6 & 13.5.2004 (2 days) Word 2003 - niveau 1 : 10 & 11.5.2004 (2 jours) Oracle 9i : SQL : 17 - 19.5.2004 (3 days) Word 2003 - niveau 2 : 24 & 25.5.2004 (2 jours) EXCEL 2003 - niveau 1: 27 & 28.5.2004 (2 jours) STEP7 Programming Level 1 : 1 - 4.6.2004 (4 days) Oracle 9i : Programming with PL/SQL : 2 - 4.6.2...

  9. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) WORD 2003 (Short Course IV) - HowTo... Work with master document: 28.9.2005 (morning) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) Introduction à Dreamweaver MX :  3 - 4.10.2005 (2 jours) Utilisation des fichiers PDF avec Acrobat 7.0 :   4.10.2005 (1 journée) LaTeX par la pratique :   4 - 6.10.2005 (3 matinées) PowerPoint 2003 (F) :  7.10.2005 (1 journée) FileMaker - niveau 1 :  20 - 21.10.2005 (2 jours) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11....

  10. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    Le nombre de places disponibles peut varier. Veuillez consulter notre site Web pour avoir la dernière mise à jour. Des places sont disponibles dans les cours suivants :   Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) WORD 2003 (Short Course IV) - HowTo... Work with master document: 28.9.2005 (morning) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) Introduction à Dreamweaver MX :  3 - 4.10.2005 (2 jours) Utilisation des fichiers PDF avec Acrobat 7.0 :   4.10.2005 (1 journée) LaTeX par la pratique :   4 - 6.10.2005 (3 matinées) PowerPoint 2003 (F) :  7.10.2005 (1 journée) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (...

  11. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) WORD 2003 (Short Course IV) - HowTo... Work with master document: 28.9.2005 (morning) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) Introduction à Dreamweaver MX :  3 - 4.10.2005 (2 jours) Utilisation des fichiers PDF avec Acrobat 7.0 :   4.10.2005 (1 journée) LaTeX par la pratique :   4 - 6.10.2005 (3 matinées) PowerPoint 2003 (F) :  7.10.2005 (1 journée) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with Auto...

  12. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework: 8 - 12.8.2005 (5 days) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks (AutoText, AutoFormat, AutoCorrect, Lists, Find/Replace): 25.8.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 25.8.2005 (afternoon) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 26.8.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents: 26.8.2005 (afternoon) FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1 : 5 - 7.9.2005 (3 days, dates to be confirmed) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) MAGNE-05 - Magn&...

  13. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1:  5 - 7.9.2005 (3 days) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) WORD 2003 (Short Course IV) - HowTo... Work with master document: 28.9.2005 (morning) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2...

  14. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework: 8 - 12.8.2005 (5 days) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks (AutoText, AutoFormat, AutoCorrect, Lists, Find/Replace): 25.8.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 25.8.2005 (afternoon) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 26.8.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents: 26.8.2005 (afternoon) FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1 : 5 - 7.9.2005 (3 days, dates to be confirmed) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) Finite State Machines in the JCOP Framew...

  15. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language AutoCAD Mechanical 2006 16 30 to 31-01-06 F DIAdem : base 24 01 to 03-02-06 F ACROBAT 7.0 : Utilisation de fichiers PDF 8 06-02-06 F Manipulation des images 4 08-02-06 F OUTLOOK 2003 (Short Course I) - E-mail 3 09-02-06 E-F WORD 2003 (Short Course II) - HowTo... Mail merge 3 09-02-06 E-F ACCESS 2003 - Level 1: ECDL M5 16 13 to 14-02-06 E-F JCOP: Control System Integration using JCOP Tools 24 14 to 16-02-06 E OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Notes 3 16-02-06 E-F WORD 2003 (Short Course III) - HowTo... Work with long documents 3 16-02-06 E-F FrontPage 2003 - niveau 1 16 23 to 24-02-06 F OUTLOOK 2003 (Short Course III) - Meetings and Delegation 3 27-02-06 E-F WORD 2003 (Short Course IV) - HowTo... Work with master document 3 27-02-06 E-F ...

  16. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Title Hours Date Language ACCESS 2003 - Level 2: ECDL AM5 16 19 to 20-01-06 E-F AutoCAD 2006 - niveau 1 32 19 to 25-01-06 F C++ Programming Advanced - Traps and Pitfalls 32 24 to 27-01-06 E STEP7 : Level 1 32 24 to 27-01-06 E LabVIEW Basics 2 16 26 to 27-01-06 E AutoCAD Mechanical 2006 16 30 to 31-01-06 F DIAdem : base 24 01 to 03-02-06 F FrontPage 2003 - niveau 1 16 02 to 03-02-06 F ACROBAT 7.0 : Utilisation de fichiers PDF 8 06-02-06 F Manipulation des images 4 08-02-06 F OUTLOOK 2003 (Short Course I) - E-mail 3 09-02-06 E-F WORD 2003 (Short Course II) - HowTo... Mail merge 3 09-02-06 E-F ACCESS 2003 - Level 1: ECDL M5 16 13 to 14-02-06 E-F JCOP: Control System Integration using JCOP Tools 24 14 to 16-02-06 E OUTLOOK 2003 (Short Course II) - Calendar, Tasks and Note...

  17. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: WORD 2003 (Short Course I) - HowTo... Work with AutoTasks (AutoText, AutoFormat, AutoCorrect, Lists, Find/Replace): 25.8.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 25.8.2005 (afternoon) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 26.8.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents: 26.8.2005 (afternoon) FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW base 1 : 5 - 7.9.2005 (3 jours) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechniq...

  18. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW Real-Time (F) : 7 - 9.6.2005 (3 jours) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) FrontPage 2003 - niveau 2 : 16 & 17.6.2005 (2 jours) Utilisation de fichiers PDF avec ACROBAT 6.0 : 20.6.2005 (1journée) Introduction to ANSYS: 21 - 24.6.2005 (4 days) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoCorrect, Find/Replace) : 4.7.2005 (afternoon) WORD 2003 (Short Course II) - HowTo... Mail merge: 5.7.2005 (afternoon) WORD 2003 (Short Course III) - HowTo... Work with long documents : 6.7.2005 (afternoon) ACCESS 2003 - Level 2 - ECDL AM5: 5 - 8.7.2005 (4 mornings) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 7.7.2005 (afternoon) EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing: 8.7.2005 (aftern...

  19. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW base 1 : 4 - 6.7.2005 (3 jours) LabVIEW Basics 2: 7 - 8.7.2005 (2 days) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.7.2005 (1 jour) FrontPage 2003 - niveau 1 : 6-7.7.2005 (2 jours) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoCorrect, Find/Replace) : 4.7.2005 (afternoon) WORD 2003 (Short Course II) - HowTo... Mail merge: 5.7.2005 (afternoon) WORD 2003 (Short Course III) - HowTo... Work with long documents : 6.7.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 6.7.2005 (morning) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 7.7.2005 (morning) OUTLOOK (Short Course III) - Meetings and Delegation: 8.7.2005 (morning) EXCEL 2003 (Short Course I) - HowTo... Work with formulae: 7.7.2005 (afternoon) EXCEL 2003 (Short Course II) - HowTo... Format y...

  20. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW Real-Time (F) : 7 - 9.6.2005 (3 jours) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) IT3T/1 - Read your mail and more with Outlook 2003 : 14.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/2 - Creating, managing and using distribution lists with Simba2 : 16.6.2005 (IT Technical Training Tutorial, free of charge) FrontPage 2003 - niveau 2 : 16 & 17.6.2005 (2 jours) Utilisation de fichiers PDF avec ACROBAT 6.0 : 20.6.2005 (1journée) Introduction to ANSYS: 21 - 24.6.2005 (4 days) IT3T/3 - Working remotely with Windows XP : 28.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/4 - Editing Websites with Frontpage 2003 : 30.6.2005 (IT Technical Training Tutorial, free of charge) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoC...

  1. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Hands-on Introduction to Python Programming: 28 - 30.6.2005 (3 days) Introduction to ANSYS: 28.6 - 1.7.2005 (4 days) IT3T/3 - Working remotely with Windows XP: 28.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/4 - Editing Websites with Frontpage 2003: 30.6.2005 (IT Technical Training Tutorial, free of charge) LabVIEW base 1 : 4 - 6.7.2005 (3 jours) LabVIEW Basics 2: 7 - 8.7.2005 (2 days) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.7.2005 (1 jour) FrontPage 2003 - niveau 1 : 6-7.7.2005 (2 jours) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoCorrect, Find/Replace) : 4.7.2005 (afternoon) WORD 2003 (Short Course II) - HowTo... Mail merge: 5.7.2005 (afternoon) WORD 2003 (Short Course III) - HowTo... Work with long documents : 6.7.2005 (afternoon) ACCES...

  2. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework: 8 - 12.8.2005 (5 days) FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1 : 5 - 7.9.2005 (3 days, dates to be confirmed) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) LabVIEW Application Development (Intermediate I): 5 - 7.12.2005 (3 days) LabVIEW Advanced Programming (Intermediate 2): 8 - 9.12.2005 (2 days) ENSEIGNEMENT TECHNIQUE TECHNICAL TRAINING Monique Duval 74924

  3. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1: 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) The CERN EDMS for Local Administrators: 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) LabVIEW base 1/basics 1 : 31.1 - 1.2.2005 (2 j size="2">LabVIEW base 2/basics 2 : 3 & 4.2.2005 (2 jours/2 days - langue à décider/language to be decided) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9.2.2005 (3 days) C++ Programming Advanced -Traps and Pitfalls: 8 - 11.2.2005 (4 days) Joint PVSS JCOP Framework: 14 - 18.2.2005 (5 days) JAVA 2 Enterprise Edition - Part 1: ...

  4. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) Utilisation des fichiers PDF avec Acrobat 7.0 :   4.10.2005 (1 journée) LaTeX par la pratique :   4 - 6.10.2005 (3 matinées) PowerPoint 2003 (F) :  7.10.2005 (1 journée) FileMaker - niveau 1 :  20 - 21.10.2005 (2 jours) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) Finite State Machines in the JCOP Framework : 25 - 27.10.2005 (3 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCO...

  5. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) Word 2003 - niveau 1 : 22 & 23.11.2004 (2 jours) Introduction à ANSYS : 23 - 26.11.2004 (4 jours) CLEAN-2002 - Travailler en salle propre : 23.11.2004 (après-midi, cours gratuit) Project Planning with MS-Project : 25.11 & 2.12.2004 (2 days) PCAD Sch&eac...

  6. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FileMaker - niveau 1 :  20 - 21.10.2005 (2 jours) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) Finite State Machines in the JCOP Framework : 25 - 27.10.2005 (3 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) WORD 2003 (Short Course I) - HowTo... Work with AutoTasks: 26.10.2005 (afternoon) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Joint PVSS JCOP Framework : 21 - 25.11.2005 (5 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11....

  7. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FileMaker - niveau 1 :  20 - 21.10.2005 (2 jours) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) Finite State Machines in the JCOP Framework : 25 - 27.10.2005 (3 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Joint PVSS JCOP Framework : 21 - 25.11.2005 (5 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents : ...

  8. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FrontPage 2003 - niveau 1 : 1 - 2.9.2005 (2 jours) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.9.2005 (1 jour) LabVIEW Basics 1:  5 â€" 7.9.2005 (3 days) Introduction à Windows XP au CERN : 12.9.2005 (1 demi-journée) FrontPage 2003 - niveau 2 : 15 - 16.9.2005 (2 jours) AutoCAD 2005 - niveau 1 : 22, 23, 28, 29.9.2005 (4 jours) Finite State Machines in the JCOP Framework:  26 - 28.9.2005 (3 days) MAGNE-05 - Magnétisme pour l'électrotechnique : 27 - 29.9.2005 (3 jours) Joint PVSS JCOP Framework : 3 - 7.10.2005 (5 days) ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) OU...

  9. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The JAVA Programming Language Level 1: 11 & 12.1.2005 (2 days) Introduction to XML : 13 & 14.1.2005 (2 days) ELEC-2005.:Winter term: Introduction to electronics in HEP: 18, 20, 25, 27.1, 1 & 3.2.2005 (6 x 2h lectures) The CERN EDMS for Local Administrators: 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (8 demi-journées) CLEAN-2002 : Travailler en salle propre : 25.1.2005 (après-midi, cours gratuit) Compatibilité électromagnétique (CEM) : installation et remèdes : 25 - 27.1.2005 (3 jours) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9...

  10. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: The CERN EDMS for Local Administrators: 19 & 20.1.2005 (2 days - free course) Programmation Unity-Pro pour utilisateurs de Schneider PL7-Pro : 24 - 28.1.2005 (9 demi-journées) LabVIEW base 1/basics 1 : 31.1 - 2.2.2005 (3 jours/3 days - langue à décider/language to be decided) LabVIEW base 2/basics 2 : 3 & 4.2.2005 (2 jours/2 days - langue à décider/language to be decided) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9.2.2005 (3 days) C++ Programming Advanced -Traps and Pitfalls: 8 - 11.2.2005 (4 days) Joint PVSS JCOP Framework: 14 - 18.2.2005 (5 days) JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) ELEC-2005 â...

  11. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW base 1/basics 1 : 31.1 - 2.2.2005 (3 jours/3 days - langue à décider/language to be decided) LabVIEW base 2/basics 2 : 3 & 4.2.2005 (2 jours/2 days - langue à décider/language to be decided) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9.2.2005 (3 days) C++ Programming Advanced -Traps and Pitfalls: 8 - 11.2.2005 (4 days) Joint PVSS JCOP Framework: 14 - 18.2.2005 (5 days) JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) FrontPage 2003 - niveau 1 : 21 & 22.2.2005 (2 jours) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology...

  12. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Joint PVSS JCOP Framework : 9 - 13.8.2004 (5 days) Outlook (I): E-mail : 31.8.2004 (2 hours, morning) Outlook (II): Calendar, Tasks and Notes : 31.8.2004 (2 hours, afternoon) Hands-on Introduction to Python Programming : 1 - 3.9.2004 (3 days - free course) Instructor-led WBTechT Study or Follow-up for Microsoft Applications : 7.9.2004 (morning) Outlook (III): Meetings and Delegation : 7.9.2004 (2 hours, afternoon) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) Joint PVSS JCOP Framework : 13 - 17.9.2004 (5 days) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.9.2004 (4 jours) Programmation STEP7 niveau 1 : 14 - 17.9.2004 (4 jours) FrontPage 2003 - niveau 1 : 20 & 21.9.2004 (2 jours) ANSYS: Thermal Analysis : 22 - 24.9.2004 (3 days) ANSYS: Advanced Topics : 27.9...

  13. Technical Training: Places available

    CERN Document Server

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Instructor-led WBTechT Study or Follow-up for Microsoft Applications : 7.9.2004 7.9.2004 Outlook (short course III) : Meetings and Delegation : 7.9.2004 (2 hours, afternoon) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 7 & 8.9.2004 (2 jours) Joint PVSS JCOP Framework : 13 - 17.9.2004 (5 days) Programmation STEP7 niveau 1 : 14-17.9.2004 (4 jours) ANSYS : Thermal Analysis : 22 - 24.9.2004 (3 days) LabVIEW Migration 6 à 7 : 23.9.2004 (one day) ANSYS : Advanced Topics : 27.9 - 1.10.2004 (5 days) Word 2003 - niveau 2 : 27 & 28.9.2004 (2 jours) LabVIEW - Basics 1 : 27 - 29.9.2004 (3 days) MAGNE-04 : Magnétisme pour l'électrotechnique : 28 - 30.9.2004 (3 jours) LabVIEW - Basics 2 : 30.9 & 1.10.2004 (2 days) Introduction à Windows XP au CERN : 4.10.2004 (matin) ...

  14. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Programmation STEP7 niveau 1 : 14-17.9.2004 (4 jours) ANSYS : Thermal Analysis : 22 - 24.9.2004 (3 days) LabVIEW Migration 6 à 7 : 23.9.2004 (one day) ANSYS : Advanced Topics : 27.9 - 1.10.2004 (5 days) Word 2003 - niveau 2 : 27 & 28.9.2004 (2 jours) LabVIEW - Basics 1 : 27 - 29.9.2004 (3 days) MAGNE-04 : Magnétisme pour l'électrotechnique : 28 - 30.9.2004 (3 jours) LabVIEW - Basics 2 : 30.9 & 1.10.2004 (2 days) Introduction à Windows XP au CERN : 4.10.2004 (matin) FrontPage 2003 - niveau 1 : 7 & 8.10.04 (2 jours) Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Introduction à ANSYS : 23 - 26.11.2004 (4 jours) ENSEIGNEMENT TECHNIQUE TECHNICAL TRAINING Monique Duval 74924...

  15. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Hands-on Introduction to Python Programming: 28 - 30.6.2005 (3 days) Introduction to ANSYS: 21 - 24.6.2005 (4 days) IT3T/3 - Working remotely with Windows XP: 28.6.2005 (IT Technical Training Tutorial, free of charge) IT3T/4 - Editing Websites with Frontpage 2003: 30.6.2005 (IT Technical Training Tutorial, free of charge) Utilisation des fichiers PDF avec ACROBAT 7.0 : 5.7.2005 (1 jour) FrontPage 2003 - niveau 1 : 6-7.7.2005 (2 jours) LabVIEW base 1 : 4 - 6.7.2005 (3 jours) LabVIEW Basics 2: 7 - 8.7.2005 (2 days) WORD 2003 (Short Course I) - HowTo... Work with repetitive tasks /AutoText, AutoFormat, AutoCorrect, Find/Replace) : 4.7.2005 (afternoon) WORD 2003 (Short Course II) - HowTo... Mail merge: 5.7.2005 (afternoon) WORD 2003 (Short Course III) - HowTo (4 mornings) EXCEL 2003 (Short Course I) - HowTo... Work ...

  16. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Oracle 9i : New features for developers : 14 - 16.6.2004 (3 days) The Joint PVSS JCOP Framework: 14 - 18.6.2004 (5 days) Introduction au VHDL et utilisation du simulateur NCVHDL de CADENCE : 15 & 16.6.2004 (2 jours) EXCEL 2003 - niveau 2 : 17 & 18.6.2004 (2 jours) MAGNE-04 : Magnétisme pour l'électrotechnique : 6 au 8.7.2004 (3 jours) AutoCAD 2002 - niveau 1 : 13, 14, 23, 24.09.2004 (4 jours) ENSEIGNEMEN...

  17. Technical Training: Places Available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval - Tel.74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Oracle 9i: SQL: 17 - 19.5.2004 (3 days) Word 2003 - niveau 2 : 24 & 25.5.2004 (2 jours) EXCEL 2003 - niveau 1 : 27 & 28.5.2004 (2 jours) STEP7 Programming Level 1: 1 - 4.6.2004 (4 days) Oracle 9i : Programming with PL/SQL: 2 - 4.6.2004 (3 days) CST Microwave Studio: 3 & 4.6.2004 (2 days) Oracle 9i : New f...

  18. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an 'application for training' form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. Technical Training Monique Duval - Tel.74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Word 2003 - niveau 2 : 24 & 25.5.2004 (2 jours) VisualEliteHDL : 25 & 26.5.2004 (2 days) EXCEL 2003 - niveau 1 : 27 & 28.5.2004 (2 jours) STEP7 Programming Level 1: 1 - 4.6.2004 (4 days) Oracle 9i : Programming with PL/SQL: 2 - 4.6.2004 (3 days) CST Microwave Studio: 3 & 4.6.2004 (2 days) Oracle 9...

  19. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Utilisation des fichiers PDF avec ACROBAT 6.0 : 1.3.2005 (1 journée) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 x 2.5-hour lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 x 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) AXEL-2005; Introduction to Particle Accelerators : 14- 18.3.2005 (10 x 1 h lectures) ACCESS 2003 - Level 1: ECDL M5: 15 - 16.3.2005 (2 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 2003 - niveau 2 : 21 & 22.3.2005 (2 jours) Hands-on Object-Oriented Design and Programming with C++ : 22 - 24.3.2005 (3 days) FileMaker - niveau 2 : 4 & 5.4.2005 (2 jours) EXCEL 2003 - niveau 2 : 11 & 12.4.2005 (2 jours) LabVIEW Intermediate 1: 11 - 13.4.2005...

  20. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) FrontPage 2003 - niveau 1 : 21 & 22.2.2005 (2 jours) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) Utilisation des fichiers PDF avec ACROBAT 6.0 : 1.3.2005 (1 journée) Hands-on Object-Oriented Design and Programming with C++ : 1 - 3.3.2005 (3 days) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 x 2.5-hour lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 x 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) ACCESS 2003 - Level 1 : 15 - 16.3.2005 (2 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 2003 - niveau 2 : 21 & 22.3.2005 (2 jours) FileMaker - ...


    Directory of Open Access Journals (Sweden)

    Tania Carson


    Full Text Available The current upsurge of interest in street art with its direct approach to the city emphasizes the need to readdress public arts’ role within the wider social and cultural context. As it becomes routine to incorporate art works into city planning and city life, art has become both ‘safe’ and ‘user‐friendly’. On the one hand, art is subsumed and immersed into the wider culture through leisure and entertainment policies, socially engaged public art projects, community art and urban design. On the other hand, there are those works which deliberately intend to unsettle or confront the viewer. In recent years the term intervention has been ascribed to unorthodox art works in the public sphere which are often illicit, or at least non‐complicit in the prevailing hegemony. These practices are disruptive due to their enactment outside traditional art spaces, often in the streets. By occupying the streets, places of democracy and disjunction, these interventions transform public space back into a place of overt cultural and political expression. They also deliberately involve the inhabitants of the city by utilizing everyday spaces in ways which offer an unmediated sense of the artwork.

  2. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FrontPage 2003 - niveau 1 : 9 & 10.5.2005 (2 jours) ELEC-2005 - Summer Term: System electronics for physics - Issues : 10, 12, 17, 19, 24, 26 & 31.5.2005 (7 x 2h lectures) AutoCAD 2005 - niveau 1 : 12, 13, 18, 19.5.2005 (4 jours) ACCESS 2003 - Level 1: ECDL M5 : 11 & 12.5.2005 (2 days) Object-Oriented Analysis and Design using UML: 17 - 19.5.2005 (3 days) Synplify Pro Training: 18.5.2005 (1 day) Finite State Machines in the JCOP Framework: 24 - 26.5.2005 (3 days) The Joint PVSS JCOP Framework: 30.5 - 3.6.2005 (5 days) Introduction à la CAO CADENCE : 31.5 - 1.6.2005 (2 jours) LabVIEW Real-Time (F) : 7 - 9.6.2005 (3 jours) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) FrontPage 2003 - niveau 2 : 16 & 17.6.2005 (2 jours) Utilisation de fichiers PDF avec ACROBAT 6.0 : 20.6.2005 (1journée) Intr...

  3. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FrontPage 2003 - niveau 1 : 9 & 10.5.2005 (2 jours) ELEC-2005 - Summer Term: System electronics for physics - Issues : 10, 12, 17, 19, 24, 26 & 31.5.2005 (7 x 2h lectures) AutoCAD 2005 - niveau 1 : 11, 12, 18, 19.5.2005 (4 jours) Object-Oriented Analysis and Design using UML: 17 - 19.5.2005 (3 days) Synplify Pro Training: 18.5.2005 (1 day) Finite State Machines in the JCOP Framework: 24 - 26.5.2005 (3 days) The Joint PVSS JCOP Framework: 30.5 - 3.6.2005 (5 days) Introduction à la CAO CADENCE : 31.5 - 1.6.2005 (2 jours) LabVIEW Real-Time (F) : 7 - 9.6.2005 (3 jours) LabVIEW Migration 6 to 7: 14.6.2005 (1 day) FrontPage 2003 - niveau 2 : 16 & 17.6.2005 (2 jours) Utilisation de fichiers PDF avec ACROBAT 6.0 : 20.6.2005 (1journée) Introductio...

  4. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: The Java Programming Language Level 1: 21 - 23.11.2005 (3 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents : 30.11.2005 (afternoon) FrontPage 2003 - niveau 2 : 5 - 6.12.2005 (2 jours) Introduction à ANSYS Classique : 6 - 9.12.2005 (4 jours) EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing: 7.12.2005 (morning) PCAD Schémas - Introduction : 8 - 9.12.2005 (2 jours) ACCESS 2003 - Level 2 - ECDL AM5: 14 - 15.12.2005 (2 days) LabVIEW Basics I:  23 - 25.1.2006 (3 days) C++ Programming Advanced - Traps and Pitfalls: 24 - 27.1.2006 (4 days) LabVIEW Basics II:  26 - 27.1.2006 (2 days) Joint PVSS-JCOP Framework: 30.1 - 3.2.2006 (5 days, free of charge) Finite State Machines in the JCOP Framework : ...

  5. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: FrontPage 2003 - niveau 2 : 5 - 6.12.2005 (2 jours) Introduction à ANSYS Classique : 6 - 9.12.2005 (4 jours) EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing: 7.12.2005 (morning) PCAD Schémas - Introduction : 8 - 9.12.2005 (2 jours) Finite State Machines in the JCOP Framework: 13 - 15.12.2005 (3 days) ACCESS 2003 - Level 2 - ECDL AM5: 14 - 15.12.2005 (2 days) PCAD PCB - Introduction : 14 - 16.12.2005 (3 jours) AutoCAD 2006 - niveau 1 : 19, 20, 24 & 25.1.2006 (4 jours) LabVIEW Basics I:  23 - 25.1.2006 (3 days) C++ Programming Advanced - Traps and Pitfalls: 24 - 27.1.2006 (4 days) STEP7 Programming Level 1: 24 - 27.1.2006 (4 days) LabVIEW Basics II:  26 - 27.1.2006 (2 days) AutoCAD Mechanical 2006 : 30 - 31.1.2006 (2 jours; suite du cours AutoCAD 2006 - niveau 1) Joint PVS...

  6. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: ACCESS 2003 - Level 1 - ECDL M5: 24 - 25.10.2005 (2 days) Finite State Machines in the JCOP Framework : 25 - 27.10.2005 (3 days) EXCEL 2003 (Short Course III) - HowTo... Pivot tables: 26.10.2005 (morning) Introduction to the CERN EDMS: 2.11.2005 (1 day, free of charge) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) The CERN EDMS for Engineers: 8.11.2005 (1 day, free of charge) The EDMS-MTF in practice: 9.11.2005 (morning, free of charge) The CERN EDMS for Local Administrators: 15-16.11.2005 (2 days, free of charge) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: ...

  7. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents: 30.11.2005 (afternoon) FrontPage 2003 - niveau 2 : 5 - 6.12.2005 (2 jours) Introduction à ANSYS Classique : 6 - 9.12.2005 (4 jours) EXCEL 2003 (Short Course II) - HowTo... Format your worksheet for printing: 7.12.2005 (morning) AutoCAD - mise à jour d’AutoCAD 2002 à AutoCAD 2006 : 8.12.2005 (1 journée - pour les utilisateurs d’AutoCAD 2002) PCAD Schémas - Introduction : 8 - 9.12.2005 (2 jours) Finite State Machines in the JCOP Framework: 13 - 15.12.2005 (3 days) PCAD PCB - Introduction : 14 - 16.12.2005 (3 jours) ACCESS 2003 - Level 2 - ECDL AM5: 14 - 15.12.2005 (2 days) AutoCAD 2006 - niveau 1 : 19, 20, 24 & 25.1.2006 (4 jours) LabVIEW Basics I:  23 - 25.1.2006...


    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW Basics 1 : 22 - 24.3.2004 (3 days) Oracle 9i : New Features for Developers : 22 - 24.3.2004 (3 days) Instructor-led WBTechT study or follow-up for Microsoft applications : 1.4.2004 (morning) FrontPage XP - niveau 1 : 5 & 6.4.2004 (2 jours) AutoCAD 2002 - niveau 1 : 19, 20.4 et 3, 4.5.2004 (4 jours) Oracle 8i/9i - Develop Web-based Applications with PL/SQL : 19 & 20.4.2004 (2 days) Introduction to ANSYS : 20 - 23.4.2004 (4 days) LabVIEW hands-on (E) : 20.4.2004 (afternoon, free of charge) FrontPage XP - niveau 2 : 26 & 27.4.2004 (2 jours) LabVIEW Base 2 : 6 & 7.5.2004 (2 jours) Word XP - niveau 1 : 10 & 11.5.2004 (2 jours) Word XP - niveau 2 : 24 & 25.5.2004 (2 jours) If you wish to participate in one of these courses, pleas...

  9. Technical Training: Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Instructor-led WBTechT study or follow-up for Microsoft applications : 1.4.2004 (morning) FrontPage XP - niveau 1 : 5 & 6.4.2004 (2 jours) AutoCAD 2002 - niveau 1 : 19, 20.4 et 3, 4.5.2004 (4 jours) Oracle 8i/9i - Develop Web-based Applications with PL/SQL : 19 & 20.4.2004 (2 days) Introduction to ANSYS : 20 - 23.4.2004 (4 day...

  10. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) FrontPage 2003 - niveau 1 : 21 & 22.2.2005 (2 jours) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) Utilisation des fichiers PDF avec ACROBAT 6.0 : 1.3.2005 (1 journée) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 X 2.30-hours lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 X 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 2003 - niveau 2 : 21 & 22.3.2005 (2 jours) FileMaker - niveau 2 : 4 & 5.4.2005 (2 jours) EXCEL 2003 - niveau 2 : 11 & 12.4.2005 (2 jours) LabVIEW intermediate 1: 11 - 13....

  11. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: LabVIEW base 2/basics 2 : 3 & 4.2.2005 (2 jours/2 days - langue à décider/language to be decided) Finite State Machines in the JCOP Framework: 1 - 3.2.2005 (3 days - free course) The JAVA Programming Language Level 2: 7 - 9.2.2005 (3 days) JAVA 2 Enterprise Edition - Part 1: WEB Applications: 21 & 22.2.2005 (2 days) FrontPage 2003 - niveau 1 : 21 & 22.2.2005 (2 jours) JAVA 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 23 - 25.2.2005 (3 days) ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 X 2.30-hours lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 X 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 20...

  12. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: ELEC-2005 - Spring Term: Integrated circuits and VLSI technology for physics: 1 - 17.3.2005 (6 x 2.5-hour lectures) C++ for Particle Physicists: 7 - 11.3.2005 (6 x 3-hour lectures) Joint PVSS JCOP Framework : 14 - 18.3.2005 (5 days) Oracle 9i: SQL: 14 -16.3.2005 (3 days) AXEL-2005; Introduction to Particle Accelerators : 14- 18.3.2005 (10 x 1 h lectures) ACCESS 2003 - Level 1: ECDL M5: 15 - 16.3.2005 (2 days) AutoCAD 2002 - niveau 1 : 15, 16, 21& 22.3.2005 (4 jours) FrontPage 2003 - niveau 2 : 21 & 22.3.2005 (2 jours) Hands-on Object-Oriented Design and Programming with C++ : 22 - 24.3.2005 (3 days) FileMaker - niveau 2 : 4 & 5.4.2005 (2 jours) Oracle 9i: Programming with PL/SQL: 4 - 6.4.2005 (3 days) EXCEL 2003 - niveau 2 : 11 & 12.4.2005 (2 jours) LabVIEW Intermedia...

  13. Technical Training: Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: FrontPage XP - niveau 2 : 26 & 27.4.2004 (2 jours) The Joint PVSS JCOP Framework : 26 - 30.4.2004 (5 days) Computational Electromagnetics with the ELEKTRA Module of OPERA-3D : 27 & 28.4.2004 (2 days) Hands-on Introduction to Python Programming : 3 - 5.5.2004 (3 days) LabVIEW Base 2 : 6 & 7.5.2004 (2 jours) Project Pla...

  14. Technical Training: Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Computational Electromagnetics with the ELEKTRA Module of OPERA-3D : 27 & 28.4.2004 (2 days) Hands-on Introduction to Python Programming : 3 - 5.5.2004 (3 days) LabVIEW Base 2 : 6 & 7.5.2004 (2 jours) Project Planning with MS-Project : 6 & 13.5.2004 (2 days) Word 2003 - niveau 1 : 10 & 11.5.2004 (2 jours) Oracle 9i : SQL : 10 - 12.5.2004 (3...

  15. Technical Training: Places available

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: AutoCAD 2002 - niveau 1 : 19, 20.4 et 3, 4.5.2004 (4 jours) Oracle 8i/9i - Develop Web-based Applications with PL/SQL : 19 & 20.4.2004 (2 days) Introduction to ANSYS : 20 - 23.4.2004 (4 days) LabVIEW Hands-on : 20.4.2004 (half-day, p.m.) FrontPage XP - niveau 2 : 26 & 27.4.2004 (2 jours) The Joint PVSS JCOP Framework : 26 -...

  16. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The CERN EDMS for Engineers : 6.10.2004 (1 day) FileMaker - niveau 1 : 18 & 19.10.2004 (2 jours) Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Excel 2003 - niveau 1 : 4 & 5.11.2004 (2 jours) LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions...

  17. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: LabVIEW - Basics 2 : 30.9 & 1.10.2004 (2 days) Introduction à Windows XP au CERN : 4.10.2004 (matin) The EDMS MTF in practice : 4.10.2004 (afternoon) The CERN EDMS for Engineers : 6.10.2004 (1 day) FrontPage 2003 - niveau 1 : 7 & 8.10.04 (2 jours) Hands-On Object Oriented Design and Programming with C++ : 9 - 12.11.2004 (3 days) FileMaker - niveau 1 : 18 & 19.10.2004 (2 jours) Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Excel 2003 - niveau 1 : 4 & 5.11.2004 (2 jours) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Outlook (Short Course III) : Meetings and Delegation : 9.11...

  18. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: FileMaker - niveau 1 : 18 & 19.10.2004 (2 jours) Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Excel 2003 - niveau 1 : 4 & 5.11.2004 (2 jours) LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) FrontPage 2003 - niveau 2 : 18 &a...

  19. Technical Training: Places available

    CERN Multimedia

    Monique Duval


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Outlook (short course I) : E-mail : 22.10.2004 (2 hours, morning) Outlook (short course II) : Calendar, Tasks and Notes: 22.10.2004 (2 hours, afternoon) Excel 2003 - niveau 1 : 4 & 5.11.2004 (2 jours) LabVIEW Intermediate I : 8 - 10.11.2004 (3 days) Instructor-led WTechT Study or Follow-up for Microsoft Applications : 9.11.2004 (morning) Hands-On Object Oriented Design and Programming with C++ : 9 - 11.11.2004 (3 days) Outlook (Short Course III) : Meetings and Delegation : 9.11.2004 (2 hours, afternoon) LabVIEW Intermediate II : 11 & 12.11.2004 (2 days) AutoCAD 2002 - niveau 1 : 11, 12, 18, 19.11.2004 (4 jours) C++ for Particle Physicists : 15 - 19.11.2004 (6 X 3 hours sessions) FrontPage 2003 - niveau 2 : 18 & 19.11.2004 (2 jours) Word 2003 - niveau 1 : 22 &a...

  20. TECHNICAL TRAINING: Places available**

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval tel. 74924 ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: Hands-on Introduction to Python Programming : 12 - 14.11.03(3 days) ACCESS 2000 - niveau 1 : 13 & 14.11.03 (2 jours) C++ for Particle Physicists : 17 - 21.11.03 (6 X 3-hour lectures) Programmation automate Schneider TSX Premium - niveau 2 : 18 - 21.11.03 (4 jours) Project Planning with MS-Project  (free of charg...

  1. TECHNICAL TRAINING: Places available**

    CERN Multimedia


    If you wish to participate in one of the following courses, please discuss with your supervisor and apply electronically directly from the course description pages that can be found on the Web at: or fill in an "application for training" form available from your Divisional Secretariat or from your DTO (Divisional Training Officer). Applications will be accepted in the order of their receipt. TECHNICAL TRAINING Monique Duval Tel. 74924 ** The number of places available may vary. Please check our Web site to find out the current availability. Places are available in the following courses: The EDMS-MTF in practice (free of charge) : 28 -  30.10.03 (6 half-day sessions) AutoCAD 2002 – Level 1 : 3, 4, 12, 13.11.03 (4 days) LabVIEW TestStand ver. 3 : 4 & 5.11.03 (2 days) Introduction to PSpice : 4.11.03 p.m. (half-day) Hands-on Introduction to Python Programming : 12 – 14.11.03 (3 days) ACCESS ...

  2. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: ELEC-2005 Autumn Term - Electronics applications in HEP experiments: 8.11 - 8.12.2005 (10 x 2h lectures) The CERN EDMS for Local Administrators: 15-16.11.2005 (2 days, free of charge) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Hands-On Object Oriented Design and Programming with C++ : 16 - 18.11.2005 (3 days) The CERN EDMS for Engineers: 17.11.2005 (1 day, free of charge) The Java Programming Language Level 1: 21 - 23.11.2005 (3 days) Hands-on Introduction to Python Programming: 28 - 30.11.2005 (3 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents : 30.11.2005 (afternoon) FrontPage 2003 - niveau 2 : 5 - 6.12.2005 (2 jours) LabVIEW Application Development (Intermediate 1): 5 - 7.12.2005 (3 d...

  3. Technical Training: Places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) ELEC-2005 Autumn Term - Electronics applications in HEP experiments: 8.11 - 8.12.2005 (10 x 2h lectures) The EDMS-MTF in practice: 9.11.2005 (morning, free of charge) The CERN EDMS for Local Administrators: 15-16.11.2005 (2 days, free of charge) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Hands-On Object Oriented Design and Programming with C++ : 16 - 18.11.2005 (3 days) The CERN EDMS for Engineers: 17.11.2005 (1 day, free of charge) The Java Programming Language Level 1: 21 - 23.11.2005 (3 days) Hands-on Introduction to Python Programming: 28 - 30.11.2005 (3 days) OUTLOOK (Short Course III) - Meetings and Delegation: 30.11.2005 (morning) WORD 2003 (Short Course III) - HowTo... Work with long documents : 30.11.2005 (afternoon) Fron...

  4. Technical training: places available

    CERN Multimedia

    Davide Vitè


    The number of places available may vary. Please check our Web site to find out the current availability. Places are available on the following courses: Introduction to the CERN EDMS: 2.11.2005 (1 day, free of charge) OUTLOOK (Short Course I) - E-mail: 2.11.2005 (morning) WORD 2003 (Short Course II) - HowTo... Mail merge: 2.11.2005 (afternoon) FrontPage 2003 - niveau 1 :  3 - 4.11.2005 (2 jours) AutoCAD 2006 - niveau 1 : 3, 4, 9, 10.11.2005 (4 jours) Joint PVSS JCOP Framework : 7 - 11.11.2005 (5 days) The CERN EDMS for Engineers: 8.11.2005 (1 day, free of charge) The EDMS-MTF in practice: 9.11.2005 (morning, free of charge) The CERN EDMS for Local Administrators: 15-16.11.2005 (2 days, free of charge) OUTLOOK (Short Course II) - Calendar, Tasks and Notes: 16.11.2005 (morning) Hands-On Object Oriented Design and Programming with C++ : 16 - 18.11.2005 (3 days) The Java Programming Language Level 1: 21 - 23.11.2005 (3 days) Hands-on Introduction to Python Prog...


    Energy Technology Data Exchange (ETDEWEB)



    Much of the earth's pollution involves compounds of the metallic elements, including actinides, strontium, cesium, technetium, and RCRA metals. Metal ions bind to molecules called ligands, which are the molecular tools that can manipulate the metal ions under most conditions. This DOE-EMSP sponsored program strives (1) to provide the foundations for using the most powerful ligands in transformational separations technologies and (2) to produce seminal examples of their applications to separations appropriate to the DOE EM mission. These ultra tight-binding ligands can capture metal ions in the most competitive of circumstances (from mineralized sites, lesser ligands, and even extremely dilute solutions), but they react so slowly that they are useless in traditional separations methodologies. Two attacks on this problem are underway. The first accommodates to the challenging molecular lethargy by developing a seminal slow separations methodology termed the soil poultice. The second designs ligands that are only tight-binding while wrapped around the targeted metal ion, but can be put in place by switch-binding and removed by switch-release. We envision a kind of molecular switching process to accelerate the union between metal ion and tight-binding ligand. Molecular switching processes are suggested for overcoming the slow natural equilibration rate with which ultra tight-binding ligands combine with metal ions. Ligands that bind relatively weakly combine with metal ions rapidly, so the trick is to convert a ligand from a weak, rapidly binding species to a powerful, slow releasing ligand--during the binding of the ligand to the metal ion. Such switch-binding ligands must react with themselves, and the reaction must take place under the influence of the metal ion. For example, our generation 1 ligands showed that a well-designed linear ligand with ends that readily combine, forms a cyclic molecule when it wraps around a metal ion. Our generation 2 ligands are

  6. Teachable Moment: Google Earth Takes Us There (United States)

    Williams, Ann; Davinroy, Thomas C.


    In the current educational climate, where clearly articulated learning objectives are required, it is clear that the spontaneous teachable moment still has its place. Authors Ann Williams and Thomas Davinroy think that instructors from almost any discipline can employ Google Earth as a tool to take advantage of teachable moments through the…

  7. Healthy Places for Healthy People (United States)

    Describes the Healthy Places for Healthy People technical assistance program that helps communities create walkable, healthy, economically vibrant places by engaging with local health care facility partners

  8. In-place HEPA filter penetration test

    International Nuclear Information System (INIS)

    Bergman, W.; Wilson, K.; Elliott, J.; Bettencourt, B.; Slawski, J.W.


    We have demonstrated the feasibility of conducting penetration tests on high efficiency particulate air (HEPA) filters as installed in nuclear ventilation systems. The in-place penetration test, which is designed to yield equivalent penetration measurements as the standard DOP efficiency test, is based on measuring the aerosol penetration of the filter installation as a function of particle size using a portable laser particle counter. This in-place penetration test is compared to the current in-place leak test using light scattering photometers for single HEPA filter installations and for HEPA filter plenums using the shroud method. Test results show the in-place penetration test is more sensitive than the in-place leak test, has a similar operating procedure, but takes longer to conduct. Additional tests are required to confirm that the in-place penetration test yields identical results as the standard dioctyl phthalate (DOP) penetration test for HEPA filters with controlled leaks in the filter and gasket and duct by-pass leaks. Further development of the procedure is also required to reduce the test time before the in- place penetration test is practical

  9. In-place HEPA filter penetration test

    Energy Technology Data Exchange (ETDEWEB)

    Bergman, W.; Wilson, K.; Elliott, J. [Lawrence Livermore National Lab., CA (United States)] [and others


    We have demonstrated the feasibility of conducting penetration tests on high efficiency particulate air (HEPA) filters as installed in nuclear ventilation systems. The in-place penetration test, which is designed to yield equivalent penetration measurements as the standard DOP efficiency test, is based on measuring the aerosol penetration of the filter installation as a function of particle size using a portable laser particle counter. This in-place penetration test is compared to the current in-place leak test using light scattering photometers for single HEPA filter installations and for HEPA filter plenums using the shroud method. Test results show the in-place penetration test is more sensitive than the in-place leak test, has a similar operating procedure, but takes longer to conduct. Additional tests are required to confirm that the in-place penetration test yields identical results as the standard dioctyl phthalate (DOP) penetration test for HEPA filters with controlled leaks in the filter and gasket and duct by-pass leaks. Further development of the procedure is also required to reduce the test time before the in-place penetration test is practical. 14 refs., 14 figs., 3 tabs.

  10. Strangers in Familiar Places

    DEFF Research Database (Denmark)

    Muhr, Sara Louise


    Employees working across multiple cultures are exposed to a vast number of different norms and values, and consequentially work is often a struggle to retain a coherent sense of self. However, when international workers travel, they also encounter more bland spaces where familiarity and similarity...... are important. These spaces appear culturally generic to the Western traveler, but are highly Westernized to bring comfort to Western employees traveling in foreign cultures. This paper argues that these spaces are important in cross-cultural identity work in the sense that international workers – professional...... strangers – need these places to belong and relate to familiarity and to regain a sense of identity. Drawing on an illustrative empirical vignette of an international consultant, I demonstrate how culturally generic spaces can be used in identity work of an international relations consultant....

  11. "Same Room, Safe Place". (United States)

    Keene Woods, Nikki


    There are many different professional stances on safe sleep and then there is the reality of caring for a newborn. There is a debate among professionals regarding safe sleep recommendations. The continum of recommendations vary from the American Academy of Pediatrics (AAP) Safe Sleep Guidelines to the bed-sharing recommendations from the Mother-Baby Behavioral Sleep Laboratory. The lack of consistent and uniform safe sleep recommendations from health professionals has been confusing for families but has more recently raised a real professional ethical dilemma. Despite years of focused safe sleep community education and interventions, sleep-related infant deaths are on the rise in many communities. This commentary calls for a united safe sleep message from all health professionals to improve health for mothers and infants most at-risk, "Same Room, Safe Place."

  12. Pushing Personhood into Place

    DEFF Research Database (Denmark)

    Bidwell, Nicola J.; Winschiers-Theophilus, Heike; Kapuire, Gereon K.


    for generations; but technology-use can inadvertently displace knowledge for communities with knowledge traditions that differ from those of technology-design. Devices which are sensitive to users' locations, combined with platforms for social networking and user-generated-content, offer intriguing opportunities...... hope our reflections will inspire others to examine the spatial, temporal and social affordances of technologies within the bonds of rural communities in digitally-sparse 'under-developed' settings....... about personhood, community and place. We adopt a critical attitude towards assumptions about spatial, temporal and social logics and literacies to promote a design sensitivity to local experiences of locations. This motivates us to emphasize connections, not points, and the bodily absorption...

  13. Linking place and mind

    DEFF Research Database (Denmark)

    Jensen, Marie Møller


    the notion of social value into exemplar theory extends the value of this originally cognitive theory to social domains. It is suggested that the association of social value and particular local, linguistic forms may contribute to the salience of these forms among local speakers. The empirical work reported...... here takes the form of a questionnaire study, which aims to uncover Tyneside inhabitants' awareness of forms as well as their affiliation with the local community. Results showed differences in frequency perceptions between participants themselves and others which indicate that speakers can identify...... local forms as such, but that the variety is stigmatized. The strength of local affiliation correlated with participants' own language use and it is suggested that this can be accounted for by employing a social personae explanation, where speakers use certain salient forms to index local belonging...

  14. Rapid inventory taking system

    International Nuclear Information System (INIS)

    Marsden, P.S.S.F.


    A data processing system designed to facilitate inventory taking is described. The process depends upon the earliest possible application of computer techniques and the elimination of manual operations. Data is recorded in optical character recognition (OCR) 'A' form and read by a hand held wand reader. Limited validation checks are applied before recording on mini-tape cassettes. 5 refs

  15. Simulating Price-Taking (United States)

    Engelhardt, Lucas M.


    In this article, the author presents a price-takers' market simulation geared toward principles-level students. This simulation demonstrates that price-taking behavior is a natural result of the conditions that create perfect competition. In trials, there is a significant degree of price convergence in just three or four rounds. Students find this…

  16. Take Three: Seasonal Flu

    Centers for Disease Control (CDC) Podcasts


    In this podcast, Dr. Joe Bresee describes how to keep from getting seasonal flu and spreading it to others by taking these three steps.  Created: 9/29/2010 by National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 9/29/2010.

  17. Taking minutes of meetings

    CERN Document Server

    Gutmann, Joanna


    aking Minutes of Meetings guides you through the entire process behind minute taking: arranging the meeting; writing the agenda; creating the optimum environment; structuring the meeting and writing notes up accurately. The minute-taker is one of the most important and powerful people in a meeting and you can use this opportunity to develop your knowledge, broaden your horizons and build credibility within the organization. Taking Minutes of Meetings is an easy to read 'dip-in, dip-out' guide which shows you how to confidently arrange meetings and produce minutes. It provides hands-on advice about the sections of a meeting as well as tips on how to create an agenda, personal preparation, best practice advice on taking notes and how to improve your accuracy. Brand new chapters of this 4th edition include guidance on using technology to maximize effectiveness and practical help with taking minutes for a variety of different types of meetings. The creating success series of books... With over one million copi...

  18. Take action: influence diversity. (United States)

    Gomez, Norma J


    Increased diversity brings strength to nursing and ANNA. Being a more diverse association will require all of us working together. There is an old proverb that says: "one hand cannot cover the sky; it takes many hands." ANNA needs every one of its members to be a part of the diversity initiative.

  19. Technical Training - Places available

    CERN Multimedia

    Monique Duval


    Places are available in the following courses: HeREF-2003 : Techniques de la réfrigération Hélium :  6 - 10.10.2003  (7 demi-journées, cours en français avec support en anglais)  The Java Programming Language Level 1:  6 - 7.10.2003  (2 days) Java 2 Enterprise Edition - Part 2: Enterprise JavaBeans: 8 - 10.10.2003  (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 :  20 & 22.10.03  (2 jours) AutoCAD 2002 - niveau 1 :  20, 21, 27, 28.10.03  (4 jours) CLEAN-2002 : Working in a Cleanroom: 23.10.03  (half day, free of charge) Plannification de projet avec MS-Project/ Project Scheduling with MS-Project : 2 sessions:  23.10 & 4.11.03  (2 jours/2 days and 18 &25.11.03 langue à définir/language to be defined) AutoCAD 2002 - Level 1:  3, 4, 12, 13.11.03  (4 days) Introduction to Pspice:  4.11.03p.m.  (half-day) AutoCAD 2002 - niveau 2 :  10 & 11.11.03  (2 jours) ACCESS 2000 - niveau 1 :  13 & 14.11.03  (2 jours) A...

  20. Taking of history

    DEFF Research Database (Denmark)

    Langebæk, Rikke


    the smartest student. So the more familiar a student can become with these situations the better. Since september 2006, veterinary students at Faculty of Life Sciences, University of Copenhagen, have received training in the discipline of history taking, using innovative educational methods: Online......, the students won’t be intimidated by the situation, as they are already familiar with the ‘client’. The ‘client’/teacher must be able to perform as different types of clients to make the sessions more interesting, colourful and fun. During these Live Role sessions, the students will get help and good advice......Learning how to take a history is an extremely important discipline in the education of veterinary students. In our opinion the fact that this discipline is often neglected in traditional teaching is a big mistake. The mere thought of facing a real client can be almost paralysing to even...

  1. Take the "C" Train (United States)

    Lawton, Rebecca


    In this essay, the author recalls several of her experiences in which she successfully pulled her boats out of river holes by throwing herself to the water as a sea-anchor. She learned this trick from her senior guides at a spring training. Her guides told her, "When you're stuck in a hole, take the "C" train."" "Meaning?" The author asked her…

  2. Social Perspective Taking (United States)


    groups” and engage in less stereotype-driven fear and hostility resulting in reduced impulsive and aggressive behavior (Richardson, Green , & Lago...and the physical world. London: Routledge & Kegan Paul. Batson, C. D. (1991). The altruism question: Towards a social-psychological answer...others. New York: The Guilford Press. Richardson, D. R., Green , L. R., & Lago, T. (1998). The relationship between perspective- taking and

  3. Place attachment, place identity and aesthetic appraisal of urban landscape

    Directory of Open Access Journals (Sweden)

    Jaśkiewicz Michał


    Full Text Available As the aesthetic of the Polish cities became a topic of wider discussions, it is important to detect the potential role of human-place relations. Two studies (N = 185 & N = 196 were conducted to explore the relationship between place attachment, place identity and appraisal of urban landscape. Satisfaction with urban aesthetic was predicted by two dimensions of place attachment (place inherited and place discovered, local identity (on the trend level and national-conservative identity. Place discovered and European identity were also predictors of visual pollution sensitivity. Place discovered is considered as more active type of attachment that permits both a positive bias concerning the aesthetics of one’s city, and a stronger criticism of the elements that can potentially violate the place’s landscape.

  4. Using Critical Path Analysis (CPA) in Place Marketing process


    Metaxas, Theodore; Deffner, Alex


    The article awards the use of CPA as a methodological tool in Place Marketing implementation. Taking into account that Place Marketing is a strategic process based on ‘project’ meaning with particular actions in specific time horizon, the article proposed that CPΑ has the capacity to satisfy this hypothesis. For this reason, the article creates a hypothetical scenario of CPA in four phases, planning, programming, implementation and feedback, taking as a case study the city of Rostock in Germa...

  5. Take nothing for granted

    International Nuclear Information System (INIS)

    Turner, R.


    An overview of Western Canada Sedimentary Basin (WCSB) natural gas supply, past, present and future, was presented. Reserves are considered as being more than adequate to meet supply requirements. In the long term, it is expected that there will be sufficient gas to fill all existing and currently planned pipelines serving the WCSB. Nevertheless, it does not pay to take anything for granted. One of the challenges facing the natural gas industry in an integrated North American market is to maintain a balance between deliverability and take-away capacity. Competition between fuels is also a factor that complicates matters. Measures taken by TransCanada Pipelines to prepare for the expected heightened competition were reviewed. Chief among them is the recent TransCanada/Nova merger which is expected to increase efficiency, decrease costs, provide a solid platform for continued growth, create customer-driven energy solutions and enable the new entity to successfully compete in an integrated North American market. The accord reached between CAPP, NOVA, SEPAC and TransCanada Pipelines and the status of the new Alberta tolls are further examples of measures taken by TransCanada Pipelines to prepare for all contingencies by leaving nothing to chance

  6. Place branding, embeddedness and endogenous rural development : Four European cases

    NARCIS (Netherlands)

    Donner, Mechthild; Horlings, Lummina; Fort, Fatiha; Vellema, Sietze


    This article deals with place branding on the regional scale, in the rural context of food and tourism networks in Europe. Place branding is linked to the concepts of endogenous rural development, territory and embeddedness, by analysing how the valorisation of specific rural assets takes shape. The

  7. Place branding, embeddedness and endogenous rural development : Four European cases

    NARCIS (Netherlands)

    Donner, Mechthild; Horlings, Lummina; Fort, Fatiha; Vellema, Sietze

    This article deals with place branding on the regional scale, in the rural context of food and tourism networks in Europe. Place branding is linked to the concepts of endogenous rural development, territory and embeddedness, by analysing how the valorisation of specific rural assets takes shape. The

  8. Feature binding and attention in working memory: a resolution of previous contradictory findings. (United States)

    Allen, Richard J; Hitch, Graham J; Mate, Judit; Baddeley, Alan D


    We aimed to resolve an apparent contradiction between previous experiments from different laboratories, using dual-task methodology to compare effects of a concurrent executive load on immediate recognition memory for colours or shapes of items or their colour-shape combinations. Results of two experiments confirmed previous evidence that an irrelevant attentional load interferes equally with memory for features and memory for feature bindings. Detailed analyses suggested that previous contradictory evidence arose from limitations in the way recognition memory was measured. The present findings are inconsistent with an earlier suggestion that feature binding takes place within a multimodal episodic buffer Baddeley, ( 2000 ) and support a subsequent account in which binding takes place automatically prior to information entering the episodic buffer Baddeley, Allen, & Hitch, ( 2011 ). Methodologically, the results suggest that different measures of recognition memory performance (A', d', corrected recognition) give a converging picture of main effects, but are less consistent in detecting interactions. We suggest that this limitation on the reliability of measuring recognition should be taken into account in future research so as to avoid problems of replication that turn out to be more apparent than real.

  9. Sense of place and place identity: review of neuroscientific evidence. (United States)

    Lengen, Charis; Kistemann, Thomas


    The aim of this review is to bring the phenomenological sense of place approach together with current results from neuroscience. We searched in neuroscientific literature for ten dimensions which were beforehand identified to be important in a phenomenological sense of place/place identity model: behaviour, body, emotion, attention, perception, memory, orientation, spirituality, meaning/value and culture/sociality. Neuroscience has identified many neurobiological correlates of phenomenological observations concerning sense of place. The human brain comprises specific and specialised structures and processes to perceive, memorise, link, assess and use spatial information. Specific parts (hippocampus, entorhinal, parahippocampal and parietal cortex), subregions (parahippocampal place area, lingual landmark area), and cells (place cells, grid cells, border cells, head direction cells) have been identified, their specific function could be understood and their interaction traced. Neuroscience has provided evidence that place constitutes a distinct dimension in neuronal processing. This reinforces the phenomenological argumentation of human geography and environmental psychology. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Taking Care of Your Hair (United States)

    ... Educators Search English Español Taking Care of Your Hair KidsHealth / For Teens / Taking Care of Your Hair ... role in how healthy it looks. Caring for Hair How you take care of your hair depends ...

  11. Introduction to Interregional Place Branding

    DEFF Research Database (Denmark)

    Zenker, Sebastian; Jacobsen, Björn P.


    Place branding is an inherently difficult venture, since places are complex systems of geographical abstractions, each one understood in relation and contrast to other geographical entities. Even at the smallest size – a district, town, or city – a place is quite complex, but it becomes even more...

  12. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.


    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  13. Taking action against violence. (United States)

    Kunz, K


    Significant increase in violent crimes in recent years forced Icelandic men to take action against violence. Television was seen as a major contributory factor in increasing violence. Surveys indicate that 10-15 years after television broadcasting commences in a particular society, the incidence of crime can be expected to double. While the majority of the individuals arrested for violent crimes are men, being male does not necessarily mean being violent. The Men's Committee of the Icelandic Equal Rights Council initiated a week-long information and education campaign under the theme "Men Against Violence". This campaign involved several events including an art exhibit, speeches on violence in families, treatment sought by those who are likely to resort to violence, booklet distribution among students in secondary schools, and a mass media campaign to raise public awareness on this pressing problem.

  14. Taking Design Games Seriously

    DEFF Research Database (Denmark)

    Eriksen, Mette Agger; Brandt, Eva; Mattelmäki, Tuuli


    Using design games at Participatory Design (PD) events is well acknowledged as a fruitful way of staging participation. As PD researchers, we have many such experiences, and we have argued that design games connect participants and promote equalizing power relations. However, in this paper, we...... will (self) critically re-connect and reflect on how people (humans) and materials (non-humans) continually participate and intertwine in various power relations in design game situations. The analysis is of detailed situated actions with one of our recent games, UrbanTransition. Core concepts mainly from...... Bruno Latour’s work on Actor-Network-Theory are applied. The aim is to take design games seriously by e.g. exploring how assemblages of humans and non-humans are intertwined in tacitly-but-tactically staging participation, and opening up for or hindering negotiations and decision-making, thus starting...

  15. No place for their children:

    DEFF Research Database (Denmark)

    Nielsen, Helene Pristed


    Drawing on a combination of theories on gender and place and work after globalisation, this article addresses how gender, place, employment-related mobility and flexible work conditions affect generational ties to place. Interviews with persons whose working life histories (by choice or circumsta......Drawing on a combination of theories on gender and place and work after globalisation, this article addresses how gender, place, employment-related mobility and flexible work conditions affect generational ties to place. Interviews with persons whose working life histories (by choice...... or circumstance) include flexible hours and high levels of mobility reveal explicit hopes that their children will have more stable working lives – and expectations that this will mean that they shall have to leave the local area. The article documents how the local place is an important component...

  16. Reframing place promotion, place marketing, and place branding - moving beyond conceptual confusion

    NARCIS (Netherlands)

    Boisen, Martin; Terlouw, Kees; Groote, Peter; Couwenberg, Oscar


    The literature and practice of place promotion, place marketing and place branding lack a common understanding of what these three concepts mean and through what kind of policies they can be implemented. Although scholars have provided several theoretical frameworks and definitions, both scholars

  17. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1. (United States)

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul


    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  18. Medicaid: taking stock. (United States)

    Davidson, S M


    In the last few years, Medicaid has attracted more than casual attention, one reflection of which is the fact that JHPPL has published five papers on the program in its last few issues. This paper, a sixth, takes a broader view of the program than is typically the case. After a critique of the five recent articles, I discuss several questions raised by them and reach the following conclusions: First, the states do not invest enough in producing program data suitable for policy analysis and research. One lesson: Better data and analysis can help the states to avoid expensive mistakes. Second, those policy analyses that have been offered fail to give sufficient attention to the political dimension of policy. That is one reason why policy choices produce unexpected effects. Third, since Medicaid is a relatively small player in the vast medical care market, incentives adopted by Medicaid officials throughout the country rarely have the desired effects. Finally, as long as Medicaid remains the principal mechanism to provide access to health care for the poor, it must be made as efficient and effective as possible. Yet, for both political and economic reasons, Medicaid can never be what its original planners had hoped, the vehicle for providing the poor with reliable access to mainstream medical care.

  19. Taking the plunge

    CERN Multimedia


    On 8 and 15 October, 58 people took the plunge and headed to the Varembé swimming pool in Geneva for their first taste of scuba diving at one of the CERN scuba club’s free trial dives. Club president Alberto Pace, left, taking a new recruit on his first dive. The CERN scuba club was making waves down at the Varembe swimming pool on Wednesday 15 October. Thirty-six people turned up to the club’s second free trial dive. "It was fantastic," said Jörg, one of the new recruits, after his first ever dive. "I’ve always wanted to try diving and this was a free lesson, so I thought I would come and have a go." Fourteen of the club’s fully qualified instructors were there to give one-on-one tuition. After a first dive in the normal pool the new divers moved into the deep pool. Some took to the water like fish, and at one point an impromptu game of aqua-Frisbee broke out, five metres below the surface. Richard Catherall, who organi...

  20. Sample-taking apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Tanov, Y I; Ismailov, R A; Orazov, A


    The invention refers to the equipment for testing water-bearing levels in loose rocks. Its purpose is to simultaneously remove with the rock sample a separate fluid sample from the assigned interval. The sample-taking apparatus contains a core lifter which can be submerged into the casting string with housing and front endpiece in the form of a rod with a piston which covers the cavity of the core lifter, as well as mechanism for fixing and moving the endpiece within the core lifter cavity. The device differs from the known similar devices because the upper part of the housing of the core lifter is equipped with a filter and mobile casting which covers the filter. In this case the casing is connected to the endpiece rod and the endpiece is installed with the possibility of movement which is limited with fixing in the upper position and in the extreme upper position it divides the core lifter cavity into two parts, filter settling tank and core-receiving cavity.

  1. Decision taking as a service

    NARCIS (Netherlands)

    Bergstra, J.A.


    Decision taking can be performed as a service to other parties and it is amenable to outtasking rather than to outsourcing. Outtasking decision taking is compatible with selfsourcing of decision making activities carried out in preparation of decision taking. Decision taking as a service (DTaaS) is

  2. Adjusting to New Places: International Student Adjustment and Place Attachment (United States)

    Terrazas-Carrillo, Elizabeth C.; Hong, Ji Y.; Pace, Terry M.


    Using data obtained from in-depth semistructured interviews, we examined international students' attachments to place in the local American Midwestern community where they have attended college for at least 2 years. The results of this study suggest that participants engage in a process of renegotiation of meanings attached to new places in ways…

  3. Census 2000 Places (cen00pl02) (United States)

    California Natural Resource Agency — Census 2000 Place Names provides a seamless statewide GIS layer of places, including census designated places (CDP), consolidated cities, and incorporated places,...

  4. How Robust Is the Mechanism of Folding-Upon-Binding for an Intrinsically Disordered Protein? (United States)

    Bonetti, Daniela; Troilo, Francesca; Brunori, Maurizio; Longhi, Sonia; Gianni, Stefano


    The mechanism of interaction of an intrinsically disordered protein (IDP) with its physiological partner is characterized by a disorder-to-order transition in which a recognition and a binding step take place. Even if the mechanism is quite complex, IDPs tend to bind their partner in a cooperative manner such that it is generally possible to detect experimentally only the disordered unbound state and the structured complex. The interaction between the disordered C-terminal domain of the measles virus nucleoprotein (N TAIL ) and the X domain (XD) of the viral phosphoprotein allows us to detect and quantify the two distinct steps of the overall reaction. Here, we analyze the robustness of the folding of N TAIL upon binding to XD by measuring the effect on both the folding and binding steps of N TAIL when the structure of XD is modified. Because it has been shown that wild-type XD is structurally heterogeneous, populating an on-pathway intermediate under native conditions, we investigated the binding to 11 different site-directed variants of N TAIL of one particular variant of XD (I504A XD) that populates only the native state. Data reveal that the recognition and the folding steps are both affected by the structure of XD, indicating a highly malleable pathway. The experimental results are briefly discussed in the light of previous experiments on other IDPs. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  5. Sacred places in global big cities

    DEFF Research Database (Denmark)

    Greve, Anni

    the relation between the sacred and the profane, and about the role of the sacred in modern societies. The question is if the development of modern societies has implied the gradual abolishment of religious beliefs, rituals and rites, or has it on the contrary implied the installment of new forms of religious...... beliefs and sacred places, which are cultivated through regular rituals and rites, just as some traditional societies have cultivated for instance totemism. This paper will take its point of departure in Durkheim’s study of The Elementary Forms of Religious Life from 1912. Then it will turn......The question of sacred places in modern societies involves an analytical perspective, which is not very prevalent in sociology, namely the anthropological or even better: the ethnological perspective. With this theme we have entered a veritable dispute, or controversy, in sociology about...

  6. Enacting a Place-Responsive Research Methodology: Walking Interviews with Educators (United States)

    Lynch, Jonathan; Mannion, Greg


    Place-based and place-responsive approaches to outdoor learning and education are developing in many countries but there is dearth of theoretically-supported methodologies to take a more explicit account of place in research in these areas. In response, this article outlines one theoretical framing for place-responsive methodologies for…

  7. Place prioritization for biodiversity content

    Indian Academy of Sciences (India)

    The prioritization of places on the basis of biodiversity content is part of any systematic biodiversity conservation planning process. The place prioritization procedure implemented in the ResNet software package is described. This procedure is primarily based on the principles of rarity and complementarity. Application of the ...

  8. Mapping and measuring place attachment

    DEFF Research Database (Denmark)

    Brown, Greg; Raymond, Christopher Mark; Corcoran, Jonathan


    The concept of place attachment has been studied extensively across multiple disciplines but only recently with empirical measurement using public participation GIS (PPGIS) and related crowd-sourcing mapping methods. This research trialed a spatially explicit method for identifying place attachme...

  9. Place leadership, governance and power

    Directory of Open Access Journals (Sweden)

    Sotarauta Markku


    Full Text Available There is an emerging consensus that place leadership is the missing piece in the local and regional development puzzle. In this context, leadership is a hidden form of agency, shadowed by such visible forms of influence as structures and formal institutions, as well as development programs and plans. This article argues that one of the most central issues in a study of place leadership is to analyse the relationships between governance, power and place leadership. The governance arrangements are undoubtedly important, as they dictate the kind of resources and positions provided to regional development work, and thus they also enable, as well as constrain, the many efforts of regional champions to exercise power in complex development processes. It is argued here that revealing how place leadership is enacted in different places and times would allow us to flesh out novel aspects about the eternal questions of how and why some places are able to adapt strategically to ever-changing social, economic and environmental circumstances while others fail to do so. Additionally, deeper investigations of place leadership would hopefully allow us to provide policymakers and practitioners with added insight on the ways to make regional development policies and practices not only more strategic but also effective. This paper elaborates the conceptual link between place leadership, governance and power.

  10. Taking Care of Your Skin (United States)

    ... Educators Search English Español Taking Care of Your Skin KidsHealth / For Kids / Taking Care of Your Skin ... you're in. Why Be Nice to Your Skin? Like the heart, stomach, and brain, your skin ...

  11. Taking Care of Pressure Sores (United States)

    ... Tract Infections: Indwelling (Foley) Catheter Taking Care of Pressure Sores [Download this pamphlet: "Taking Care of Pressure Sores" - ( ... may not show up right away. Stages of pressure sores and how to care for them: STAGE ONE ...

  12. Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex* (United States)

    Douglas, Max E.


    Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly (“G1-like”) and high affinity recruitment when CMG assembly takes place (“S-phase-like”). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. PMID:26719337

  13. Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex. (United States)

    Douglas, Max E; Diffley, John F X


    Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly ("G1-like") and high affinity recruitment when CMG assembly takes place ("S-phase-like"). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Coping Rarely Takes Place in a Social Vacuum: Exploring Dyadic Coping in Coach-Athlete Relationships


    Staff, H; Didymus, FF; Backhouse, S


    Objectives: Despite widespread acceptance that coping is an interpersonal phenomenon, sport psychology research has focused largely on athletes' and coaches’ ways of coping individually. The aim of this study was to qualitatively explore coping from an interpersonal perspective (i.e., dyadic coping) in coach-athlete relationships. Methodology and methods: Antecedents and outcomes of dyadic coping were discussed with five coach-athlete dyads. We conducted individual interviews with athletes an...

  15. Ambulatory care pavilion takes its place out front by solving multiple needs. (United States)

    Saukaitis, C A


    In sum, this structure exemplifies the fact that high-tech tertiary care medical centers can be user-friendly to the ambulatory health care consumer by serving their routine needs conveniently and efficiently. Says Gerald Miller, president of Crozer-Chester: "The ambulatory care pavilion has enabled Crozer to successfully and efficiently merge physicians' offices with institutional-based services and inpatient services. We are pleased with how the pavilion positions our medical center for the next century.

  16. Subsurface nitrate reduction under wetlands takes place in narrow superficial zones

    DEFF Research Database (Denmark)

    dos Santos Ribas, Osmar; Calderer, M.; Marti, Vicens


    This study aims to investigate the depth distribution of the Nitrate Reduction Potential (NRP) on a natural and a re-established wetland. The obtained NRP provides a valuable data of the driving factors affecting denitrification, the Dissimilatory Nitrate Reduction to Ammonium (DNRA) process and ...... that wetlands can be restored satisfactorily.......This study aims to investigate the depth distribution of the Nitrate Reduction Potential (NRP) on a natural and a re-established wetland. The obtained NRP provides a valuable data of the driving factors affecting denitrification, the Dissimilatory Nitrate Reduction to Ammonium (DNRA) process...... and the performance of a re-established wetland. Intact soil cores were collected and divided in slices for the determination of Organic Matter (OM) through Loss of Ignition (LOI) as well as Dissolved Organic Carbon (DOC) and NRP spiking nitrate in batch tests. The Nitrate Reduction (NR) was fitted as a pseudo...

  17. Taking Stock, Placing Orders: A Historiographic Essay on the Business History of the Newspaper. (United States)

    Smith, Carol; Dyer, Carolyn Stewart

    This historiographic essay discusses and seeks to begin to address the need for a business history of the newspaper. The paper's first section clarifies the terms "business history,""economic history,""political history," and "history of economics," (which the paper suggests have been used interchangeably in…

  18. Implementation of European Directive on Optical Radiation Safety takes place in May 2010

    NARCIS (Netherlands)

    Wieringa, F.P.


    At the latest by May 10th 2010, Directive 2006/25/EC regarding the exposure of workers to risks arising from artificial optical radiation must be implemented by all EU-member states, thus legally adopting ICNIRP limit values for ultraviolet, visible and infrared radiation. For IUVA-members the

  19. Necroptosis takes place in human immunodeficiency virus type-1 (HIV-1-infected CD4+ T lymphocytes.

    Directory of Open Access Journals (Sweden)

    Ting Pan

    Full Text Available Human immunodeficiency virus type 1 (HIV-1 infection is characterized by progressive depletion of CD4+ T lymphocytes and dysfunction of the immune system. The numbers of CD4+ T lymphocytes in the human body are maintained constantly by homeostatic mechanisms that failed during HIV-1 infection, resulting in progressive loss of CD4+ T cells mainly via apoptosis. Recently, a non-apoptotic form of necrotic programmed cell death, named necroptosis, has been investigated in many biological and pathological processes. We then determine whether HIV-1-infected cells also undergo necroptosis. In this report, we demonstrate that HIV-1 not only induces apoptosis, but also mediates necroptosis in the infected primary CD4+ T lymphocytes and CD4+ T-cell lines. Necroptosis-dependent cytopathic effects are significantly increased in HIV-1-infected Jurkat cells that is lack of Fas-associated protein-containing death domain (FADD, indicating that necroptosis occurs as an alternative cell death mechanism in the absence of apoptosis. Unlike apoptosis, necroptosis mainly occurs in HIV-infected cells and spares bystander damage. Treatment with necrostatin-1(Nec-1, a RIP1 inhibitor that specifically blocks the necroptosis pathway, potently restrains HIV-1-induced cytopathic effect and interestingly, inhibits the formation of HIV-induced syncytia in CD4+ T-cell lines. This suggests that syncytia formation is mediated, at least partially, by necroptosis-related processes. Furthermore, we also found that the HIV-1 infection-augmented tumor necrosis factor-alpha (TNF-α plays a key role in inducing necroptosis and HIV-1 Envelope and Tat proteins function as its co-factors. Taken together,necroptosis can function as an alternative cell death pathway in lieu of apoptosis during HIV-1 infection, thereby also contributing to HIV-1-induced cytopathic effects. Our results reveal that in addition to apoptosis, necroptosis also plays an important role in HIV-1-induced pathogenesis.

  20. Characterization and performances of DOSION, a dosimetry equipment dedicated to radiobiology experiments taking place at GANIL

    Energy Technology Data Exchange (ETDEWEB)

    Boissonnat, Guillaume, E-mail: [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France); Fontbonne, Jean-Marc [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France); Balanzat, Emmanuel [CIMAP (CEA/DSM-CNRS/INP-ENSICAEN-UNICAEN), Bd Henri Becquerel, 14076 Caen (France); Boumard, Frederic; Carniol, Benjamin [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France); Cassimi, Amine [CIMAP (CEA/DSM-CNRS/INP-ENSICAEN-UNICAEN), Bd Henri Becquerel, 14076 Caen (France); Colin, Jean; Cussol, Daniel; Etasse, David; Fontbonne, Cathy [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France); Frelin, Anne-Marie [GANIL (CEA/DSM-CNRS/IN2P3), Bd Henri Becquerel, 14076 Caen (France); Hommet, Jean; Salvador, Samuel [LPC (Normandie Univ-ENSICAEN-UNICAEN-CNRS/IN2P3), 6 Bd Maréchal Juin, 14050 Caen (France)


    Currently, radiobiology experiments using heavy ions at GANIL (Grand Accélérateur National d′Ions Lourds) are conducted under the supervision of the CIMAP (Center for research on Ions, MAterials and Photonics). In this context, a new beam monitoring equipment named DOSION has been developed. It allows to perform measurements of accurate fluence and dose maps in near real time for each biological sample irradiated. In this paper, we present the detection system, its design, performances, calibration protocol and measurements performed during radiobiology experiments. This setup is currently available for any radiobiology experiments if one wishes to correlate one's own sample analysis to state-of-the-art dosimetric references.

  1. Ac hopping conduction at extreme disorder takes place on the percolating cluster

    DEFF Research Database (Denmark)

    Schrøder, Thomas; Dyre, J. C.


    Simulations of the random barrier model show that ac currents at extreme disorder are carried almost entirely by the percolating cluster slightly above threshold; thus contributions from isolated low activation-energy clusters are negligible. The effective medium approximation in conjunction...

  2. Concholepas hemocyanin biosynthesis takes place in the hepatopancreas, with hemocytes being involved in its metabolism. (United States)

    Manubens, Augusto; Salazar, Fabián; Haussmann, Denise; Figueroa, Jaime; Del Campo, Miguel; Pinto, Jonathan Martínez; Huaquín, Laura; Venegas, Alejandro; Becker, María Inés


    Hemocyanins are copper-containing glycoproteins in some molluscs and arthropods, and their best-known function is O(2) transport. We studied the site of their biosynthesis in the gastropod Concholepas concholepas by using immunological and molecular genetic approaches. We performed immunohistochemical staining of various organs, including the mantle, branchia, and hepatopancreas, and detected C. concholepas hemocyanin (CCH) molecules in circulating and tissue-associated hemocytes by electron microscopy. To characterize the hemocytes, we purified them from hemolymph. We identified three types of granular cells. The most abundant type was a phagocyte-like cell with small cytoplasmic granules. The second type contained large electron-dense granules. The third type had vacuoles containing hemocyanin molecules suggesting that synthesis or catabolism occurred inside these cells. Our failure to detect cch-mRNA in hemocytes by reverse transcription with the polymerase chain reaction (RT-PCR) led us to propose that hemocytes instead played a role in CCH metabolism. This hypothesis was supported by colloidal gold staining showing hemocyanin molecules in electron-dense granules inside hemocytes. RT-PCR analysis, complemented by in situ hybridization analyses with single-stranded antisense RNAs as specific probes, demonstrated the presence of cch-mRNA in the hepatopancreas; this was consistent with the specific hybridization signal and confirmed the hepatopancreas as the site of CCH synthesis. Finally, we investigated the possibility that CCH catabolism in hemocytes was involved in the host immune response and in the generation of secondary metabolites such as antimicrobial peptides and phenoloxidase.

  3. Activation pathways taking place at molecular copper precatalysts for the oxygen evolution reaction

    NARCIS (Netherlands)

    van der Ham, C.J.M.; Işık, F.; Verhoeven, T.W.G.M.; Niemantsverdriet, J.W.; Hetterscheid, D.G.H.


    The activation processes of [CuII(bdmpza)2] in the water oxidation reaction were investigated using cyclic voltammetry and chronoamperometry. Two different paths wherein CuO is formed were distinguished. [CuII(bdmpza)2] can be oxidized at high potentials to form CuO, which was observed by a slight

  4. Simulations: A Safe Place to Take Risks in Discussing Cultural Differences. (United States)

    Pedersen, Paul


    Describes examples of simulations and strategies for teaching about psychology that were developed in Indonesia and Malaysia to incorporate and address controversies related to cultural differences. A model that simulates the influence of a client's cultural context in counseling is explained, and developing stereotyped synthetic cultures is…

  5. Mismatch negativity to acoustical illusion of beat: how and where the change detection takes place? (United States)

    Chakalov, Ivan; Paraskevopoulos, Evangelos; Wollbrink, Andreas; Pantev, Christo


    In case of binaural presentation of two tones with slightly different frequencies the structures of brainstem can no longer follow the interaural time differences (ITD) resulting in an illusionary perception of beat corresponding to frequency difference between the two prime tones. Hence, the beat-frequency does not exist in the prime tones presented to either ear. This study used binaural beats to explore the nature of acoustic deviance detection in humans by means of magnetoencephalography (MEG). Recent research suggests that the auditory change detection is a multistage process. To test this, we employed 26 Hz-binaural beats in a classical oddball paradigm. However, the prime tones (250 Hz and 276 Hz) were switched between the ears in the case of the deviant-beat. Consequently, when the deviant is presented, the cochleae and auditory nerves receive a "new afferent", although the standards and the deviants are heard identical (26 Hz-beats). This allowed us to explore the contribution of auditory periphery to change detection process, and furthermore, to evaluate its influence on beats-related auditory steady-state responses (ASSRs). LORETA-source current density estimates of the evoked fields in a typical mismatch negativity time-window (MMN) and the subsequent difference-ASSRs were determined and compared. The results revealed an MMN generated by a complex neural network including the right parietal lobe and the left middle frontal gyrus. Furthermore, difference-ASSR was generated in the paracentral gyrus. Additionally, psychophysical measures showed no perceptual difference between the standard- and deviant-beats when isolated by noise. These results suggest that the auditory periphery has an important contribution to novelty detection already at sub-cortical level. Overall, the present findings support the notion of hierarchically organized acoustic novelty detection system. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Hyper-local, directions-based ranking of places

    DEFF Research Database (Denmark)

    Venetis, Petros; Gonzalez, Hector; Jensen, Christian S.


    they are numerous and contain precise locations. Specifically, the paper proposes a framework that takes a user location and a collection of near-by places as arguments, producing a ranking of the places. The framework enables a range of aspects of directions queries to be exploited for the ranking of places......, including the frequency with which places have been referred to in directions queries. Next, the paper proposes an algorithm and accompanying data structures capable of ranking places in response to hyper-local web queries. Finally, an empirical study with very large directions query logs offers insight...... into the potential of directions queries for the ranking of places and suggests that the proposed algorithm is suitable for use in real web search engines....


    Lifescience Database Archive (English)

    Full Text Available m of GT-1 may be achieved through direct interaction between TFIIA and GT-1; Binding of GT-1-like factors to the PR-1a promoter influ...ences the level of SA-inducible gene expression; GT-1; light; TATA; TFIIA; TBP; HR;

  8. Main: AS1CAMV [PLACE

    Lifescience Database Archive (English)

    Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

  9. Strategies for Aging in Place

    Directory of Open Access Journals (Sweden)

    Suzanne Dupuis-Blanchard


    Full Text Available For healthy and independent older adults, aging in place can be seen as identical to any other adult living at home. Little is known about how frail seniors, particularly those who speak a minority language, manage the challenges of aging in place. The present qualitative descriptive study explores the strategies that Canadian French-speaking seniors have put in place to counter their loss of independence and promote their ability to stay in their home. Semistructured individual interviews were conducted with 39 older adults and transcribed, followed by content analysis to identify common themes related to study objectives. Six themes emerged in response to strategies described for aging in place. Findings reveal the limited extent to which language issues were perceived as a barrier by participants. In conclusion, the results of this study provide us with fruitful insights to guide community nursing practice, future research, and public policy.

  10. An Austere Place of Refuge

    Czech Academy of Sciences Publication Activity Database

    Feinberg, Joseph Grim

    -, February 15 (2016), s. 1-8 Institutional support: RVO:67985955 Keywords : refugee crisis * neoliberalism * extreme right Subject RIV: AA - Philosophy ; Religion

  11. Communication course – places available

    CERN Multimedia


    Please note that there are some places available in the following communication course starting in November. For more information on the course, click on the course title, this will bring you to the training catalogue. You can then sign-up on line. For advice, you can contact Kerstin Fuhrmeister (70896) or Course Next session Duration Language Availability Gestion de temps 22 November 3 days French 8 places  

  12. Total iron binding capacity (United States)

    ... page: // Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  13. Naturalness and Place in River Rehabilitation

    Directory of Open Access Journals (Sweden)

    Kirstie Fryirs


    Full Text Available An authentic approach to river rehabilitation emphasizes concerns for the natural values of a given place. As landscape considerations fashion the physical template upon which biotic associations take place, various geomorphic issues must be addressed in framing rehabilitation activities that strive to improve river health. An open-ended approach to river classification promotes applications that appreciate the values of a given river, rather than pigeonholing reality. As the geomorphic structure of some rivers is naturally simple, promoting heterogeneity as a basis for management may not always be appropriate. Efforts to protect unique attributes of river systems must be balanced with procedures that look after common features. Concerns for ecosystem functionality must relate to the behavioral regime of a given river, remembering that some rivers are inherently sensitive to disturbance. Responses to human disturbance must be viewed in relation to natural variability, recognizing how spatial relationships in a catchment, and responses to past disturbances, fashion the operation of contemporary fluxes. These fluxes, in turn, influence what is achievable in the rehabilitation of a given reach. Given the inherently adjusting and evolutionary nature of river systems, notional endpoints do not provide an appropriate basis upon which to promote concepts of naturalness and place in the rehabilitation process. These themes are drawn together to promote rehabilitation practices that relate to the natural values of each river system, in preference to applications of "cookbook" measures that build upon textbook geomorphology.



    Myers, Misha


    The practice-as-research project Homing Place proposes a transferable percipient-led methodology of performance and research activated by ambulant and conversive mechanisms as the culmination of this research. The thesis is comprised of a range of activity that represents a moment and way of writing practice. Three artworks that comprise part of the practical component of this thesis--- way from home, Take me to a place and Yodel Rodeo-- each involved participation and contribu...

  15. Upcoming training sessions (up to end October) - Places available

    CERN Multimedia


    Please find below a list of training sessions scheduled to take place up to the end of October with places available.   Safety and Language courses are not included here, you will find an up-to-date list in the Training Catalogue. If you need a course which is not featured  in the catalogue, please contact one of the following: your supervisor, your Departmental Training Officer or the relevant learning specialist.  

  16. Last piece of ATLAS takes the plunge

    CERN Multimedia


    On Friday 29 February the second small wheel was lowered 100 metres underground into the ATLAS cavern in front of a captivated audience. Although called the "small wheels" they are small in name only - each wheel is 9.3 metres in diameter and weighs 100 tonnes including the massive shielding elements. This piece completes ATLAS’ muon spectrometer, which has the ability to accurately track particles to the width of a human hair. The first piece of ATLAS was installed in 2003 and, five years later, this small wheel is the final large piece of the detector to take the subterranean voyage to its final resting place.

  17. Patterns of place promotion, place marketing and/or place branding in Dutch municipalities

    NARCIS (Netherlands)

    Boisen, Martin; Groote, Peter; Terlouw, Kees; Couwenberg, Oscar

    This paper analyses the different degrees to which place promotion, marketing and branding policies are institutionalised, based on a relatively straightforward and generally applicable methodology in order to stimulate international comparative research in the field. A consensus has emerged over

  18. Take Charge. Take the Test. "You Know" PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    As part of the Take Charge. Take the Test. campaign, this 60 second PSA encourages African American women to get tested for HIV. Locations for a free HIV test can be found by visiting or calling 1-800-CDC-INFO (1-800-232-4636).

  19. ENSEIGNEMENT TECHNIQUE TECHNICAL TRAINING Places disponibles*/Places available **

    CERN Multimedia


    * Etant donné le délai d'impression du Bulletin, ces places peuvent ne plus être disponibles au moment de sa parution. Veuillez consulter notre site Web pour avoir la dernière mise à jour. ** The number of places available may vary. Please check our Web site to find out the current availability. Des places sont disponibles dans les cours suivants : Places are available in the following courses : Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 8 - 10.10.2003 (3 days) FileMaker - niveau 1 : 9 & 10.10.03 (2 jours) EXCEL 2000 - niveau 1 : 20 & 22.10.03 (2 jours) CLEAN-2002 : Working in a Cleanroom : 23.10.03 (half day, free of charge) Plannification de projet avec MS-Project/Project Scheduling with MS-Project : 2 sessions : 23.10 & 4.11.03 and 18 &25.11.03 (2 jours/2 days - langue à définir/language to be defined) AutoCAD 2002 – Level 1 : 3, 4, 12, 13.11.03 (4 days) Introduction to Pspice : 4.11...

  20. Places disponibles*/Places available ** - French version only

    CERN Multimedia


    Des places sont disponibles dans les cours suivants : Places are available in the following course : Java 2 Enterprise Edition - Part 2 : Enterprise JavaBeans : 20 - 22.1.03 (3 days) Introduction to PVSS : 27.1.03 (Afternoon) free course but registration necessary Basic PVSS : 28 - 30.1.03 (3 days) MAGNE-03 - Magnétisme pour l'électrotechnique : 28 - 30.1.03 (3 jours) Introduction to the CERN Engineering Data Management System : 28.1.03 (1 day) MAGNE-03 - Magnetism for Technical Electronics : 11 - 13.2.03 (3 days) AutoCAD 2002 - niveau 1 : 24, 25.2 et 3, 4.3.03 (4 jours) AutoCAD 2002 - niveau 2 : 27 & 28.2.03 (2 jours) C++ for Particle Physicists : 10 - 14.3.03 (6 X 3 hour lectures) AutoCAD Mechanical 6 PowerPack (F) : 12, 13, 17, 18, 24 & 25.3.03 (6 jours) * Etant donné le délai d'impression du Bulletin, ces places peuvent ne plus être disponibles au moment de sa parution. Veuillez consulter notre site Web pour avoir la dernière mise à jour. ** The number of places available may va...

  1. The Path Is Place: Skateboarding, Graffiti and Performances of Place (United States)

    Ong, Adelina


    This article reflects on two performances of place involving graffiti and skateboarding: the first looks at a graffiti intervention by SKL0, an urban artist in Singapore, and the second examines the "Long Live Southbank" ("LLSB") campaign to resist the relocation of Southbank's Undercroft, an appropriated skate space in London.…

  2. Without Place, Is It Real?

    Directory of Open Access Journals (Sweden)

    Joseph F Donnermeyer


    Full Text Available This article reviews Matthews’ (2014 Realist Criminology as an opportunity to address larger shortcomings within critical criminology, which is the failure to develop an alternative theory of crime and place to the mainstream theories of social disorganisation and collective efficacy. It uses rural criminological work related to violence against women and substance use, production and trafficking to illustrate the importance of place for development of a realist criminology that can consider localised expressions of power and inequality, and the multiplicity of networks and roles by which people can simultaneously be involved in both conforming and deviant/criminal behaviours. The article also suggests that a critical theory of crime and place would be useful to the synthesis and re-interpretation of criminological literature that is either theory-less or lacks a critical perspective.

  3. Note Taking for Geography Students. (United States)

    Kneale, Pauline E.


    Addresses geography students' questions about why, when, and how to take notes. Outlines a step-by-step process for taking notes from written sources and from class lectures. Discusses what types of notes are appropriate for various types of sources. Suggests some ideas for making notes useful for individual learning styles. (DSK)

  4. It takes two to tango: defining an essential second active site in pyridoxal 5'-phosphate synthase.

    Directory of Open Access Journals (Sweden)

    Cyril Moccand

    Full Text Available The prevalent de novo biosynthetic pathway of vitamin B6 involves only two enzymes (Pdx1 and Pdx2 that form an ornate multisubunit complex functioning as a glutamine amidotransferase. The synthase subunit, Pdx1, utilizes ribose 5-phosphate and glyceraldehyde 3-phosphate, as well as ammonia derived from the glutaminase activity of Pdx2 to directly form the cofactor vitamer, pyridoxal 5'-phosphate. Given the fact that a single enzyme performs the majority of the chemistry behind this reaction, a complicated mechanism is anticipated. Recently, the individual steps along the reaction co-ordinate are beginning to be unraveled. In particular, the binding of the pentose substrate and the first steps of the reaction have been elucidated but it is not known if the latter part of the chemistry, involving the triose sugar, takes place in the same or a disparate site. Here, we demonstrate through the use of enzyme assays, enzyme kinetics, and mutagenesis studies that indeed a second site is involved in binding the triose sugar and moreover, is the location of the final vitamin product, pyridoxal 5'-phosphate. Furthermore, we show that product release is triggered by the presence of a PLP-dependent enzyme. Finally, we provide evidence that a single arginine residue of the C terminus of Pdx1 is responsible for coordinating co-operativity in this elaborate protein machinery.

  5. The place branding of Qatar

    NARCIS (Netherlands)

    de Jong, Maaike


    Destination branding has become popular. Countries brand themselves to draw visitors and competent expatriates and to create economic diversification. The brand emphasises the uniqueness of the place; it frames the culture and sells its way of life. In the perspective of tourism, this research

  6. Play Memories and Place Identity. (United States)

    Sandberg, Anette


    This retrospective study examined play memories from childhood to adulthood of 478 university students between ages 20 and 62 as exhibited in drawings of play memories and questionnaire responses. The study focused on the role of the physical environment and place identity in play memories and individual identity development. Findings showed that…

  7. Capturing a Sense of Place. (United States)

    Riley, Cheryl K.


    Outdoor educators can help students, program participants, and colleagues find a special place in nature that enables them to cherish nature's gifts, its healing power, and its ability to bring inner peace. Becoming emotionally connected with nature promotes development of an environmental ethic and a sense of stewardship for the land. (LP)

  8. The Social Attachment to Place (United States)

    Dahl, Michael S.; Sorenson, Olav


    Many theories either implicitly or explicitly assume that individuals readily move to places that improve their financial well-being. Other forces, however, offset these tendencies; for example, people often wish to remain close to family and friends. We introduce a methodology for determining how individuals weigh these countervailing forces, and…

  9. A Place on the Shelf (United States)

    Thomas, Devon


    If we read to discover new worlds, we also read to find ourselves. For gays and lesbians, this act of discovery can be problematic: literature has so often excluded them. In the last decades, as gays and lesbians have grown increasingly vocal in the effort to secure their rightful place in society, a broad range of fiction has emerged that…


    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul


    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  11. Management and communication courses – Places available

    CERN Multimedia


    Please note that there are some places available on the following management and communication courses starting in September or October.   For more information on the course, click on the course title, which will take you to the training catalogue. You can then sign up on line.  .tftable {color:#333333;width:100%;border-width: 1px;border-color: #a9a9a9;border-collapse: collapse;} .tftable th {background-color:#cdcdcd;border-width: 1px;padding: 8px;border-style: solid;border-color: #a9a9a9;text-align:left;} .tftable tr {background-color:#ffffff;} .tftable td {border-width: 1px;padding: 8px;border-style: solid;border-color: #a9a9a9;} Course Next session Duration Language Availability Managing Time 15 September 9 October 7 November 20 hours English 2 Managing Stress 6 October 7 October 16 hours English 5  

  12. Take Charge. Take the Test. "You Know" PSA (:60)

    Centers for Disease Control (CDC) Podcasts


    As part of the Take Charge. Take the Test. campaign, this 60 second PSA encourages African American women to get tested for HIV. Locations for a free HIV test can be found by visiting or calling 1-800-CDC-INFO (1-800-232-4636).  Created: 3/7/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/7/2012.

  13. Thrown Together: Incorporating Place and Sustainability into Early Literacy Education (United States)

    Schmidt, Catarina


    The development of language and literacy abilities of young multilingual children is important to their future educational engagement and success in school. In this study, the value of taking account of place and sustainability in early literacy education is considered. This research provides ideas for practice-based research on early literacy in…

  14. Places available - Technical training (up to the end of 2015)

    CERN Multimedia


    Please find below all the upcoming courses (until December) that are currently missing participants, required for the courses to take place.     *Click on the picture*   For more details about a course and to register, please go to the Training Catalogue.

  15. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri


    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  16. Place visitation, place avoidance, and attitudinal ambivalence: new concepts for place research in urban recreation settings (United States)

    David B. Klenosky; Christine A. Vogt; Herbert W. Schroeder; Cherie LeBlanc Fisher


    This paper draws on recent developments in research on consumer behavior and attitudes to better understand the range of behaviors and attitudes inherent in a diverse urban area. Using a mail survey of Chicago-area residents, we collected data (1) to examine residents' past visitation behavior and recommendations of places to visit and to avoid for a range of...

  17. REMINDER: Alcohol and the work place

    CERN Multimedia


    The CERN Medical Service has observed an increase in the number of personnel suffering from alcohol-related problems in recent years, in spite of the implementation of stricter regulations concerning the consumption of alcohol on the site. The causes of alcohol-related problems are often complex and many-faceted. A family history of alcohol abuse can be a cofactor in excessive drinking. The effects on a person's work are not negligible and should not be ignored. "Alcohol and the work place" is the third part of a campaign designed to raise awareness of the risks of alcohol consumption, which has already dealt with "alcohol and health" and "alcohol and road safety". Our campaign this year will be rounded off by three information sessions in which a representative of the ISPA (Swiss Institute for the Prevention of Alcoholism) will participate. The last of these sessions will take place in: the Main Building Auditorium on Wednesday, 8 December 2004 from 14:00 to 15:30. Sessions are open to everyone. For m...

  18. Building Place Identity through Heritage


    Alexandra PACESCU; Vlad THIERY


    In an increasingly globalized world, the fading specificity is producing homogeneous images that make cities more and more difficult to tell apart. The market economy tends to commodify each and every aspect of urban life, even those belonging to the cultural realm. As a consequence, a need for differentiators arises, which can be best embodied by the local heritage. The present paper is trying to establish a link between the concept of Place Identity, seen from a marketing point of view, ...

  19. Economic inequality increases risk taking. (United States)

    Payne, B Keith; Brown-Iannuzzi, Jazmin L; Hannay, Jason W


    Rising income inequality is a global trend. Increased income inequality has been associated with higher rates of crime, greater consumer debt, and poorer health outcomes. The mechanisms linking inequality to poor outcomes among individuals are poorly understood. This research tested a behavioral account linking inequality to individual decision making. In three experiments ( n = 811), we found that higher inequality in the outcomes of an economic game led participants to take greater risks to try to achieve higher outcomes. This effect of unequal distributions on risk taking was driven by upward social comparisons. Next, we estimated economic risk taking in daily life using large-scale data from internet searches. Risk taking was higher in states with greater income inequality, an effect driven by inequality at the upper end of the income distribution. Results suggest that inequality may promote poor outcomes, in part, by increasing risky behavior.

  20. Should You Take Dietary Supplements? (United States)

    ... 2013 Print this issue Should You Take Dietary Supplements? A Look at Vitamins, Minerals, Botanicals and More ... Gut in Check Wise Choices Safe Use of Supplements Tell all of your health care providers about ...

  1. Conceptualizing Multicultural Perspective Taking Skills

    National Research Council Canada - National Science Library

    Rentsch, Joan R; Gunderson, Allison; Goodwin, Gerald F; Abbe, Allison


    .... The ability to take the perspective of individuals within the context of their culture enables Army leaders to understand other cultures at a level finer than that afforded by simply using global...

  2. Your Place or Mine? Reading Art, Place and Culture

    DEFF Research Database (Denmark)

    Brander, Birgitte Gade; Reisberg, Mira; Greenwood, David


    and force colleges of education into the position of creating programs that demonstrate compliance with governing codes. Educational practices are usually developed and become entrenched without a clear articulation of the theories on which they are founded. Critical pedagogy is committed to the exploration...... and development of a culture of schooling that supports the nature of self-conscious critique. Like critical pedagogues, place-based educators are centrally concerned with cultural context of teaching and learning and the role of schooling in shaping and reconstructing society. In drawing on the local environment...

  3. The T-Cell Receptor Can Bind to the Peptide-Bound Major Histocompatibility Complex and Uncomplexed β2-Microglobulin through Distinct Binding Sites

    DEFF Research Database (Denmark)

    Merkle, Patrick S.; Irving, Melita; Hongjian, Song


    from molecular dynamics simulations. Using a biological assay based on TCR gene-engineered primary human T cells, we did not observe a significant effect of β2m on T-cell cytotoxicity, suggesting an alternate role for β2m binding. Overall, we show that binding of β2m to the TCR occurs in vitro and......T-Cell receptor (TCR)-mediated recognition of the peptide-bound major histocompatibility complex (pMHC) initiates an adaptive immune response against antigen-presenting target cells. The recognition events take place at the TCR-pMHC interface, and their effects on TCR conformation and dynamics...... are controversial. Here, we have measured the time-resolved hydrogen/deuterium exchange (HDX) of a soluble TCR in the presence and absence of its cognate pMHC by mass spectrometry to delineate the impact of pMHC binding on solution-phase structural dynamics in the TCR. Our results demonstrate that while TCR...

  4. Melanin-binding radiopharmaceuticals

    International Nuclear Information System (INIS)

    Packer, S.; Fairchild, R.G.; Watts, K.P.; Greenberg, D.; Hannon, S.J.


    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed

  5. Competitive protein binding assay

    International Nuclear Information System (INIS)

    Kaneko, Toshio; Oka, Hiroshi


    The measurement of cyclic GMP (cGMP) by competitive protein binding assay was described and discussed. The principle of binding assay was represented briefly. Procedures of our method by binding protein consisted of preparation of cGMP binding protein, selection of 3 H-cyclic GMP on market, and measurement procedures. In our method, binding protein was isolated from the chrysalis of silk worm. This method was discussed from the points of incubation medium, specificity of binding protein, the separation of bound cGMP from free cGMP, and treatment of tissue from which cGMP was extracted. cGMP existing in the tissue was only one tenth or one scores of cGMP, and in addition, cGMP competed with cGMP in binding with binding protein. Therefore, Murad's technique was applied to the isolation of cGMP. This method provided the measurement with sufficient accuracy; the contamination by cAMP was within several per cent. (Kanao, N.)

  6. Time- and place dependent tariffs

    International Nuclear Information System (INIS)

    Wangensteen, I.; Feilberg, N.; Hornnes, K.S.


    To study the variation of the marginal losses in the Norwegian regional and distribution networks, a stylized radial network and an existing network example were analyzed as described in this report. The main conclusion is that the marginal-cost (the marginal losses) varies with time and place in a way that is little reflected in the energy components of the transfer- and distribution tariffs. The difference between the actual marginal-cost at a given time at a given place and the transport price that confronts an actor through the tariffs is so large that one must ask if there is any point in basing a price on marginal-cost as long as today's calculation methods are used. The problem varies somewhat between the network levels. In the distribution network the range of variation is large within the same voltage level/tariff level. If the situation improves, a time differentiation is still required. A further improvement can be obtained by a place differentiation, for example by differentiation between densely and sparsely populated areas. However, this is difficult to realize. In the central network the problem is the same, but it is easier technically and administratively to arrive at a more correct arrangement. In practice there are no great problems in differentiating the price down to individual bus bars. This would relate input and output tariffs more correctly and logically. If time differentiation is intended to capture load variations, it seems that certain improvements are possible in the present classification. It appears that spring and autumn should stand apart as one period. Furthermore, the marginal loss tariff should be based on the water supply situation at the beginning of the tariff period. 10 refs., 13 figs., 17 tabs

  7. Place, Non-Place, Multi-Place and the (Non)Possibilities of Identity: Philosophical, Social, and Communicational Aspects


    Basia Nikiforova


    Michel Foucault in the text “Of Other Spaces: Utopias and Heterotopias” wrote that “the present epoch will perhaps be above all the epoch of space”. Space, place, and territories are social productions. Territory is a polysemic concept. Place is “events” created by territories, fluid areas of control produced by territorial negotiation (horizontal dynamics) and negotiations between places (vertical dynamics). Space produces places and is produced by places. Moreover, space, place and territor...

  8. Endogenously generated plasmin at the vascular wall injury site amplifies lysine binding site-dependent plasminogen accumulation in microthrombi.

    Directory of Open Access Journals (Sweden)

    Tomasz Brzoska

    Full Text Available The fibrinolytic system plays a pivotal role in the regulation of hemostasis; however, it remains unclear how and when the system is triggered to induce thrombolysis. Using intra-vital confocal fluorescence microscopy, we investigated the process of plasminogen binding to laser-induced platelet-rich microthrombi generated in the mesenteric vein of transgenic mice expressing green fluorescent protein (GFP. The accumulation of GFP-expressing platelets as well as exogenously infused Alexa Fluor 568-labeled Glu-plasminogen (Glu-plg on the injured vessel wall was assessed by measuring the increase in the corresponding fluorescence intensities. Glu-plg accumulated in a time-dependent manner in the center of the microthrombus, where phosphatidylserine is exposed on platelet surfaces and fibrin formation takes place. The rates of binding of Glu-plg in the presence of ε-aminocaproic acid and carboxypeptidase B, as well as the rates of binding of mini-plasminogen lacking kringle domains 1-4 and lysine binding sites, were significantly lower than that of Glu-plg alone, suggesting that the binding was dependent on lysine binding sites. Furthermore, aprotinin significantly suppressed the accumulation of Glu-plg, suggesting that endogenously generated plasmin activity is a prerequisite for the accumulation. In spite of the endogenous generation of plasmin and accumulation of Glu-plg in the center of microthrombi, the microthrombi did not change in size during the 2-hour observation period. When human tissue plasminogen activator was administered intravenously, Glu-plg further accumulated and the microthrombi were lysed. Glu-plg appeared to accumulate in the center of microthrombi in the early phase of microthrombus formation, and plasmin activity and lysine binding sites were required for this accumulation.

  9. Teaching Kids with Learning Disabilities to Take Public Transit (United States)

    Schoenfeld, Jane


    Taking public transit can make anyone nervous, especially in a large or medium-sized city where there are many different bus lines going many different places. The author's daughter, Anna, has multiple learning disabilities and may never learn to drive, but she wants to be as independent as possible so the author taught her to ride the bus. This…

  10. Taking Possession: Rituals, Space and Authority

    Directory of Open Access Journals (Sweden)

    Jennifer Mara DeSilva


    Full Text Available In early modern Europe authority over communities, both people and spaces, was visualized through ritual gestures and processions. Communities gathered to witness ceremonial entries that drew on accepted forms of gestures and speech identifying individuals and articulating their place in the urban power relationship. Ceremonial entries by rulers, ambassadors, bishops, and other office-holders drew on ritual acts projecting messages of possession in order to establish reputations of prestige and authority. This introductory essay draws on cultural anthropology and recent historiography to build a framework for understanding rituals of possession that went beyond the tradition triumphal entry to incorporate substitutes, new modes of prestigious display, and attend to conflicts. By “taking possession” of communities, offices, and spaces using accepted ritual forms, early moderns initiated conversations about authority and power that were far more flexible in their scope, practice, and participants than expected.

  11. 76 FR 54433 - Takes of Marine Mammals Incidental to Specified Activities; Taking Marine Mammals Incidental to a... (United States)


    ... from the 10- airgun array and a single airgun at shallow, intermediate, and deep water depths. The 180... signals and transfer the data to the on- board processing system. In addition, at least 72 sonobuoys will... the survey effort (55%) will occur in water 100-1,000 m (328-3,281 ft) deep, 32% will take place in...

  12. The Concept of Place and Sense of Place In Architectural Studies


    Mina Najafi; Mustafa Kamal Bin Mohd Shariff


    Place is a where dimension formed by people-s relationship with physical settings, individual and group activities, and meanings. 'Place Attachment', 'Place Identity'and 'Sense of Place' are some concepts that could describe the quality of people-s relationships with a place. The concept of Sense of place is used in studying human-place bonding, attachment and place meaning. Sense of Place usually is defined as an overarching impression encompassing the general ways in wh...

  13. Take-all or nothing

    NARCIS (Netherlands)

    Hernández-Restrepo, M.; Groenewald, J.Z.; Elliott, M.L.; Canning, G.; McMillan, V.E.; Crous, P.W.


    Take-all disease of Poaceae is caused by Gaeumannomyces graminis (Magnaporthaceae). Four varieties are recognised in G. graminis based on ascospore size, hyphopodial morphology and host preference. The aim of the present study was to clarify boundaries among species and varieties in

  14. Take-all or nothing

    NARCIS (Netherlands)

    Hernández-Restrepo, M.; Groenewald, J.Z.; Elliott, M.L.; Canning, G.; McMillan, V.E.; Crous, P.W.


    Take-all disease of Poaceae is caused by Gaeumannomyces graminis (Magnaporthaceae). Four varieties are recognised in G. graminis based on ascospore size, hyphopodial morphology and host preference. The aim of the present study was to clarify boundaries among species and varieties in Gaeumannomyces

  15. Take Charge of Your Career (United States)

    Brown, Marshall A.


    Today's work world is full of uncertainty. Every day, people hear about another organization going out of business, downsizing, or rightsizing. To prepare for these uncertain times, one must take charge of their own career. This article presents some tips for surviving in today's world of work: (1) Be self-managing; (2) Know what you…

  16. Taking Care After A Concussion

    Centers for Disease Control (CDC) Podcasts


    This podcast describes how to take care of yourself after a concussion, including proper recognition and response recommendations.  Created: 3/17/2010 by National Center for Injury Prevention and Control (NCIPC).   Date Released: 3/17/2010.

  17. It takes a global village

    NARCIS (Netherlands)

    Damhof, Loes; DeWitt, Janine; Wolfensberger, Marca


    Connected through a screen, two classes that are an ocean apart take the same course and do the same assignments. Our course “ The Global Village” is a globally networked learning environment (Starke-Meyerring and Wilson, 2008) where students from two different universities work and learn together

  18. Four Takes on Tough Times (United States)

    Rebell, Michael A.; Odden, Allan; Rolle, Anthony; Guthrie, James W.


    Educational Leadership talks with four experts in the fields of education policy and finance about how schools can weather the current financial crisis. Michael A. Rebell focuses on the recession and students' rights; Allan Odden suggests five steps schools can take to improve in tough times; Anthony Rolle describes the tension between equity and…

  19. Taking Care of our Trails (United States)

    our Trails Obeying Environmental Laws Protecting Wildlife Environmental Sustainability Sustainability Protection » Trails Taking Care of our Trails Continued access and use of Los Alamos National Laboratory trails is contingent upon being good stewards of these federal lands. June 7, 2017 Hikers walk along the

  20. Setting Places at the Table

    Directory of Open Access Journals (Sweden)

    James R. Briscoe


    Full Text Available A recent survey by the National Endowment for the Arts found that only 2% of Americans listen to “Classical” music with regularity, and fewer practice or play art or historic music even once in a year. The rotating kaleidoscope of new technologies, repertories, interpretation, and cultural values can become not an ultimate bewilderment, a nail in the coffin of art and historic music, but a powerful tool for revitalizing how it engages persons of all age groups and how it can broaden its understanding. The table of musical places we set can respond to the narrative we carefully conceive for any condition at hand, for the student or scholar or layperson we address, for an intentional kaleidoscope of presentations. Such an attitude might let the other 98% discover art and historic music and see their lives mirrored and bettered.

  1. Dictionary of Alaska place names (United States)

    Orth, Donald J.


    This work is an alphabetical list of the geographic names that are now applied and have been applied to places and features of the Alaska landscape. Principal names, compiled from modem maps and charts and printed in boldface type, generally reflect present-day local usage. They conform to the principles of the U.S. Board on Geographic Names for establishing standard names for use on Government maps and in other Government publications. Each name entry gives the present-day spelling along with variant spellings and names; identifies the feature named; presents the origin and history of the name; and, where possible, gives the meaning of an Eskimo, Aleut, Indian, or foreign name. Variant, obsolete, and doubtful names are alphabetically listed and are cross referenced, where necessary, to the principal entries.

  2. When perspective taking increases taking: reactive egoism in social interaction. (United States)

    Epley, Nicholas; Caruso, Eugene; Bazerman, Max H


    Group members often reason egocentrically, believing that they deserve more than their fair share of group resources. Leading people to consider other members' thoughts and perspectives can reduce these egocentric (self-centered) judgments such that people claim that it is fair for them to take less; however, the consideration of others' thoughts and perspectives actually increases egoistic (selfish) behavior such that people actually take more of available resources. A series of experiments demonstrates this pattern in competitive contexts in which considering others' perspectives activates egoistic theories of their likely behavior, leading people to counter by behaving more egoistically themselves. This reactive egoism is attenuated in cooperative contexts. Discussion focuses on the implications of reactive egoism in social interaction and on strategies for alleviating its potentially deleterious effects.

  3. Turn and jump: how time & place fell apart

    CERN Document Server

    Mansfield, Howard


    Before Thomas Edison, light and fire were thought to be one and the same. Turns out, they were separate things altogether. This book takes a similar relationship, that of time and place, and shows how they, too, were once inseparable. Time keeping was once a local affair, when small towns set their own pace according to the rising and setting of the sun. Then, in 1883, the expanding railroads necessitated the creation of Standard Time zones, and communities became linked by a universal time. Here Howard Mansfield explores how our sudden interconnectedness, both physically, as through the railroad, and through inventions like the telegraph, changed our concept of time and place forever.

  4. SHBG (Sex Hormone Binding Globulin) (United States)

    ... Links Patient Resources For Health Professionals Subscribe Search Sex Hormone Binding Globulin (SHBG) Send Us Your Feedback ... As Testosterone-estrogen Binding Globulin TeBG Formal Name Sex Hormone Binding Globulin This article was last reviewed ...

  5. DNA-binding proteins essential for protein-primed bacteriophage ø29 DNA replication

    Directory of Open Access Journals (Sweden)

    Margarita Salas


    and localization of the TP at the bacterial nucleoid, where viral DNA replication takes place. The biochemical properties of the Φ29 DBP and SSB and their function in the initiation and elongation of Φ29 DNA replication, respectively, will be described.

  6. Take Five for Customer Service

    Directory of Open Access Journals (Sweden)

    Laura J. Ax-Fultz


    Full Text Available Businesses leverage excellent customer service to improve profitability. Although not profit-driven, libraries should leverage excellent customer service to achieve their unique missions. Evaluating and improving customer service practices will help a library determine if it is successfully serving its customers. The library should review three areas to improve customer service: the physical space of the library, how library employees work with library policies, and the communication skills of the library staff. By using the Take Five model, the library can make immediate, no-cost changes or plan for future improvements by taking just five minutes, every day, to assess specific areas. Over a few weeks or months, these small changes will result in better customer service.

  7. Interferences in place attachment: implications for wilderness (United States)

    Erin K. Sharpe; Alan W. Ewert


    Previous research on place attachment has tended to focus on attachment formation, with relatively little attention given to factors that disrupt or interfere with formed place attachments. Interferences to attachments are a worthy research area for two reasons: 1) The factors of place attachment are often more salient when being disrupted, and 2) place attachment...

  8. Place branding and nonstandard regionalization in Europe

    NARCIS (Netherlands)

    Boisen, Martin


    Place branding might, could, and maybe even should play a central role in urban and regional governance. The vantage point of this chapter is that every place is a brand and that the processes of nonstandard regionalization that can be witnessed all over Europe create new places and, thus, new place

  9. Alcohol and the work place

    CERN Multimedia


    The CERN Medical Service has observed an increase in the number of personnel suffering from alcohol-related problems in recent years, in spite of the implementation of stricter regulations concerning the consumption of alcohol on the site. The causes of alcohol-related problems are often complex and many-faceted. A family history of alcohol abuse can be a cofactor in excessive drinking. The effects on a person's work are not negligible and should not be ignored. "Alcohol and the work place" is the third part of a campaign designed to raise awareness of the risks of alcohol consumption, which has already dealt with "alcohol and health" and "alcohol and road safety".Many employers have taken steps to confront the problem, and CERN launched a campaign to help its employees suffering from alcohol-related problems over ten years ago. A standing SCC sub-group on the prevention of alcoholism has been set up and Operational Circular No. 8, which defines the role and responsibilities of all parties concerned in the m...

  10. Put waste in its place

    CERN Multimedia


    It doesn’t take much of an effort to sort waste, but what a difference it can make - to the environment, of course, but also to CERN’s incineration bill. A variety of containers are provided to allow waste to be sorted before disposal, thereby making recycling easier. Everyone knows that sorting waste reduces pollution. By recycling or recovering waste materials, we can reduce the amount of waste that ends up in an incinerator or land-fill, while giving the used material a second life. That reduces the consumption of raw materials and natural resources—and of budget resources. CERN pays lower bill: disposing of a tonne of waste by incineration costs 230 Swiss francs, while a tonne of paper only costs 10 francs to dispose of. The problem is that much of the waste is not properly sorted. "In 2008, out of more than 1600 tonnes of waste we had to incinerate 600 tonnes, which is an enormous figure!" says Martine Auerbach, wh...

  11. Islamic Identity Versus City/place Branding


    Mandour, M. Alaa


    Is a brand a product, a service, or a company? Is it a logo, a marketing strategy or an attitude? As globalization intensifies, places increasingly compete with other places for attention, influence, markets, investments, businesses, visitors, residents, talent and events. And competition is no longer restricted to the well-known places down the road, over the hill or across the water. Places now compete with cities, regions and countries halfway around the world. Places are increasingly gett...

  12. Digital technology to enable aging in place. (United States)

    Kim, Kwang-Il; Gollamudi, Shreya S; Steinhubl, Steven


    Aging, both of individuals and populations, presents challenges and opportunities. The multitude of morbidities and disabilities that are a too common component of aging represent significant challenges to individuals, their families and to healthcare systems. Aging in place is the ability to safely and comfortably maintain an independent and high quality of life in one's own home and community and is a highly desirable goal of most individuals with the additional benefit of significantly impacting the impending enormous healthcare burden. In order to make this possible, new care models that take advantage of novel technologies for tracking important physiologic and safety parameters need to be developed and implemented. By thoughtfully doing so, it can be possible to seamlessly provide preventative interventions when and as needed, detect the earliest signs of aggravation of chronic conditions, or identify and respond to any emergency situations, such as falls or cardiac arrest. In contrast to current approaches, caring for elderly individuals in their homes based on a digital technology infrastructure could be effective and cost-saving. In this review, we provide an overview of the characteristics of potential digital solutions applicable to creative aging along with the existing evidence supporting their ability to improve care, increase quality of life, and substantially decrease the emotional and financial costs associated with aging. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Place-Identity in a School Setting: Effects of the Place Image (United States)

    Marcouyeux, Aurore; Fleury-Bahi, Ghozlane


    Studies on place identity show positive relationships between the evaluation of a place and mechanisms involved in place identification. However, individuals also identify with places of low social prestige (places that bear a negative social image). Few authors investigate the nature of place identity processes in this case. The goal of this…

  14. Size and type of places, geographical region, satisfaction with life, age, sex and place attachment

    Directory of Open Access Journals (Sweden)

    Mandal Alan


    Full Text Available The topic of the article concerns the issue of place attachment and its determinants. An analysis of place attachment was performed in terms of place identity and place dependence (Williams, Vaske, 2003. Moreover, links between place attachment and selected geographical (size and type of place, geographical region, demographic (age, sex and psychological (satisfaction with life variables were investigated.

  15. Oh, the Places They Went: SBOs Share Their Career Paths (United States)

    George, Patricia


    "Oh the Places You'll Go!" That Dr. Seuss book is a standard gift for graduates as they are sent out into the world-whether it's off to college or into the world of work. "You can steer yourself any direction you choose." What direction did school business officials take to get where they are today? The most recent…


    DEFF Research Database (Denmark)


    Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases.......Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases....

  17. Essential qualities of children’s favorite places (United States)

    Prakoso, S.


    This paper builds on an existential-phenomenology framework to better understand the essential qualities of children’s favorite places. Based on grounded theory, this study focused on the everyday life experiences of 25 children (14 girls and 11 boys), aged 9–12 years and living in Jakarta, whose housing environments reflected various spatial qualities. The results showed that all children reported having one or more favorite places. Despite differences in type, scale, form, and location of children’s favorite places, each existential place was a supportive urban space conceived, perceived, and lived through the meaning and symbolic use given to it by a child. The essential qualities of children’s favorite places were accessibility, a location within route from home to other destinations (such as a friend’s house or school), and a space providing a sense of comfort, security, and social affiliation, as well as experiences that were restorative, personal, sensory, and materialistic. This study may have implications for the design of urban places that foster the formation of children’s favorite spaces by taking into account these essential qualities of children’s lived-existential spaces.

  18. Effects of temperature on the p53-DNA binding interactions and their dynamical behavior: comparing the wild type to the R248Q mutant.

    Directory of Open Access Journals (Sweden)

    Khaled Barakat

    Full Text Available BACKGROUND: The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298-306 K. METHODOLOGY/PRINCIPAL FINDINGS: This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. CONCLUSIONS: The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure.

  19. Taking homophobia’s measure

    Directory of Open Access Journals (Sweden)

    Mary Lou Lou Rasmussen


    Full Text Available My focus in this article is on the topic of homophobia and its place in the sexuality education classroom in Australia and the United States (US. This paper draws on research in anthropology law and, on studies of gender and sexuality in an attempt to complicate predominantly psychological understandings of homophobia that may underscore the popular use of scales to measure homophobic attitudes in pre-service and in-service teachers. These interdisciplinary approaches to homophobia provide the basis for a critical reading of some contemporary pedagogical approaches to anti-homophobia education in diverse education contexts.

  20. Upcoming training sessions (up to end October) - Places available

    CERN Multimedia


    Please find below a list of training sessions scheduled to take place up to the end of October with places available.   Safety and Language courses are not included here, you will find an up-to-date list in the Training Catalogue. If you need a course which is not featured  in the catalogue, please contact one of the following: your supervisor, your Departmental Training Officer or the relevant learning specialist. Leadership Training           Training Course Title Next Session Language Duration Available places Needed to maintain the session Driving for Impact and Influence 13-Sep-2016 to 14-Sep-2016 French 2 days 4 0 Essentials of People Management for CERN Supervisors (Adapted from CDP for CERN Supervisors) 22-Sep-2016 to 23-Sep-2016, 18-Nov-2016, 17-Jan-2017 to 18-Jan-2017 English 5 days 5 0 Eléments essentiels de la gestion du personnel pour les superviseurs (adapt&a...

  1. Single protein omission reconstitution studies of tetracycline binding to the 30S subunit of Escherichia coli ribosomes

    International Nuclear Information System (INIS)

    Buck, M.; Cooperman, B.S.


    In previous work the authors showed that on photolysis of Escherichia coli ribosomes in the presence of [ 3 H]tetracycline (TC) the major protein labeled is S7, and they presented strong evidence that such labeling takes place from a high-affinity site related to the inhibitory action of TC. In this work they use single protein omission reconstitution (SPORE) experiments to identify those proteins that are important for high-affinity TC binding to the 30S subunit, as measured by both cosedimentation and filter binding assays. With respect to both sedimentation coefficients and relative Phe-tRNA Phe binding, the properties of the SPORE particles they obtain parallel very closely those measured earlier, with the exception of the SPORE particle lacking S13. A total of five proteins, S3, S7, S8, S14, and S19, are shown to be important for TC binding, with the largest effects seen on omission of proteins S7 and S14. Determination of the protein compositions of the corresponding SPORE particles demonstrates that the observed effects are, for the most part, directly attributable to the omission of the given protein rather than reflecting an indirect effect of omitting one protein on the uptake of another. A large body of evidence supports the notion that four of these proteins, S3, S7, S14, and S19, are included, along with 16S rRNA bases 920-1,396, in one of the major domains of the 30S subunit. The results support the conclusion that the structure of this domain is important for the binding of TC and that, within this domain, TC binds directly to S7

  2. Slavia takes the Czech path

    International Nuclear Information System (INIS)

    Haluza, I.


    Biodiesel was the main reason Slavia Capital bought the oil processing company, Palma Tumys, Bratislava last year. The biofuels added to fuel produced from oil are one of the core products of this investment group. But today Slavia is profiting more from the production of edible oils and margarine produced by the Palma Group. It has benefited from the global increase in food prices. But Palma is also profiting from the experience and contacts of its new Czech managers appointed by the new owner. They have found a place in Czech stores for Slovak oils and margarines. In the past the company only used to supply its products to Czech bakers. And they even found a place for biodiesel. Petr Zejdlik is Czech and is the chairman of the board of Palma Group. Matej Valtr, is also Czech and is responsible for managing company strategies. They replaced the former owners, original Slovak privatizers who used to manage the company and did not do badly. They managed to keep one of the biggest Slovak food processing companies in good shape and in profit and j with stable revenues of around 90 mil. EUR. But finally they gave in to international competition from Bunge, Cargill and Archer Daniels Midland and sold the company to a financially strong investor. (author)

  3. Inventing and naming America:  Place and Place Names in Vladimir Nabokov’s Lolita

    Directory of Open Access Journals (Sweden)

    Monica Manolescu-Oancea


    Full Text Available In the afterword to Lolita, Nabokov claimed that in this book he had to invent both Lolita and America after having invented Europe in his previous fiction. This paper focuses precisely on the various ways in which Nabokov “invented” America in his best-known novel. This invention is first of all the result of the author’s evolving stance on the complexity of what he called “average ‘reality’” in his works. Through a survey of Nabokov’s statements on the choice and role of place in the forewords to his Russian works and in his critical texts, I show that Lolita is indeed considered by Nabokov to be a “recreation” of American reality, to a much greater extent than his Russian works had been recreations of a given milieu. I take the metaphor of the “crazy quilt” mentioned in Lolita to suggest complexity, chromatic exuberance, hybridity. The invention of America is also the result of a process of naming. Place names will be examined, not only those which make up Quilty’s “cryptogrammic paperchase”, but also Humbert’s choice of place names. The problem of referentiality is discussed and the way recent criticism has dealt with it. Finally, the interplay between one and many is emphasized, the way in which the diversity of the “crazy quilt” is counterbalanced by the uniqueness of the mastermind having produced it. The American motto “From many make one” could be reinterpreted as “From one make many”.

  4. Binding behaviour of uranium in sediment samples across Thane Creek Area

    International Nuclear Information System (INIS)

    Maity, Sukanta; Sandeep, P.; Dusane, C.B.; Sahu, S.K.; Pandit, G.G.


    Natural and artificial radionuclides have received much attention in the past decades for the protection and management of the marine environment and for better understanding of oceanographic and sedimentological processes. Pathways that could supply significant amounts of natural radionuclides in the marine environment are: river runoff (effluents discharges to river and from coastal locations), direct groundwater discharge and wind-blown particles. The shore and bottom sediments accumulate radionuclides by sorption from seawater or by sedimentation of suspended radioactive solids. The radionuclides that remain associated with sediments are influenced greatly by the chemical, biochemical and microbiological changes that take place in the environment. In general, radionuclide properties in environmental media depend on the form in which each species is bound with the reactivity of that species, rather than on the total concentrations, so there is considerable interest in understanding uranium binding behavior in sediments in different conditions

  5. On Broca, brain, and binding: a new framework

    NARCIS (Netherlands)

    Hagoort, P.


    In speaking and comprehending language, word information is retrieved from memory and combined into larger units (unification). Unification operations take place in parallel at the semantic, syntactic and phonological levels of processing. This article proposes a new framework that connects

  6. Disclosure of key stereoelectronic factors for efficient H2 binding and cleavage in the active site of [NiFe]-hydrogenases. (United States)

    Bruschi, Maurizio; Tiberti, Matteo; Guerra, Alessandro; De Gioia, Luca


    A comparative analysis of a series of DFT models of [NiFe]-hydrogenases, ranging from minimal NiFe clusters to very large systems including both the first and second coordination sphere of the bimetallic cofactor, was carried out with the aim of unraveling which stereoelectronic properties of the active site of [NiFe]-hydrogenases are crucial for efficient H2 binding and cleavage. H2 binding to the Ni-SIa redox state is energetically favored (by 4.0 kcal mol(-1)) only when H2 binds to Ni, the NiFe metal cluster is in a low spin state, and the Ni cysteine ligands have a peculiar seesaw coordination geometry, which in the enzyme is stabilized by the protein environment. The influence of the Ni coordination geometry on the H2 binding affinity was then quantitatively evaluated and rationalized analyzing frontier molecular orbitals and populations. Several plausible reaction pathways leading to H2 cleavage were also studied. It turned out that a two-step pathway, where H2 cleavage takes place on the Ni-SIa redox state of the enzyme, is characterized by very low reaction barriers and favorable reaction energies. More importantly, the seesaw coordination geometry of Ni was found to be a key feature for facile H2 cleavage. The discovery of the crucial influence of the Ni coordination geometry on H2 binding and activation in the active site of [NiFe]-hydrogenases could be exploited in the design of novel biomimetic synthetic catalysts.

  7. Reference: SITE3SORPS1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SITE3SORPS1 Villain P, Clabault G, Mache R, Zhou DX S1F binding site is related to ...but different from the light-responsive GT-1 binding site and differentially represses the spinach rps1 prom

  8. Modulation of DNA binding by gene-specific transcription factors. (United States)

    Schleif, Robert F


    The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

  9. Territorial stigmatisation and the negotiation of place

    DEFF Research Database (Denmark)

    Hansen, Kim Toft; Christensen, Jørgen Riber


    The article addresses the negotiated meaning of notorious places through a consideration of a recent tendency in Danish TV documentaries where marginalized, often peripheral, places are portrayed and debated. Based partly on sociological research about territorial stigmatisation, partly on location...

  10. The art of history taking. (United States)

    Trieger, N; Goldblatt, L


    The art of history taking involves the ability to recognize the interrelationship between the details of the medical history and the patient's personal history. For the oral surgeon, this provides important insights into how the patient has reacted to illness in the past as well as how he is most likely to react to current treatment. Specific problems have been reviewed as well as suggested interview techniques to guide the oral surgeon in his management of his patient's reactions. No one expects the doctor to be an iconoclast. He cannot be all things to all patients. He should recognize a problem, acknowledge it as a problem, and be flexible enough to deal with it or refer the patient to someone who can. This kind of understanding will enable the oral surgeon to fulfill his role with appreciation from his patients and an inner sense of professional and personal achievement.

  11. Take Control of PDFpen 5

    CERN Document Server

    Cohen, Michael


    After a whirlwind history and overview of PDF, you'll take a tour through PDFpen's tools and navigation. With those basics taken care of, you'll learn how to: Scan a document to PDF and make the text editable with OCRCombine pages from multiple files into a single PDFTurn a Web site into a multi-page PDFAdd or remove pages from a PDFAdd a hand-written signature to a PDFAdd page and URL links to a PDFMake a clickable table of contents for a PDFUse professional editing marks on a PDFEdit text within a PDF that was received in emailLeave comments on a PDF documentRemove sensitive or confidential

  12. Taking the Copenhagen Process apart

    DEFF Research Database (Denmark)

    Cort, Pia

    that the Copenhagen Process has legitimately extended vocational education and training policy formation to include the EU and its new institutional settings established through the Open Method of Coordination. Furthermore, vocational education and training is being reconfigured within a neoliberal Lifelong Learning......The aim of this thesis is to analyse the EU vocational education and training policy process (The Copenhagen Process) from a critical perspective based on the policy analysis methodology, “What’s the Problem Represented to Be?” (WPR) developed by Professor Carol Bacchi. The main research question...... “How can the European vocational education and training policy process - the Copenhagen Process - be understood from a WPR perspective? “ is addressed in six articles which take apart the Copenhagen Process and deal with specific WPR questions and specific aspects of the Copenhagen Process...

  13. The Politics of Takings Clauses

    Directory of Open Access Journals (Sweden)

    Mila Versteeg


    Full Text Available A long-standing consensus exists that the arbitrary or excessive expropriation of private property by a country hurts its economic growth. Although constitutions can play an important role in protecting private property, remarkably little is known about how they actually restrict the power of eminent domain and whether such restrictions are associated with reduced de facto expropriation risks. The main finding of this essay is that no observable relationship exists between de jure constitutional restrictions on the power of eminent domain and de facto expropriation risks. This finding suggests that the effectiveness of takings clauses might depend on the politics surrounding their adoption.

  14. Sampling vs. taking some - 59349

    International Nuclear Information System (INIS)

    Francois-Bongarcon, D.


    Collecting a sample is a delicate task that is Not naively equivalent to simply 'taking some of the material'. The question examined is: 'What is it exactly?' The problem of sampling in general, and for nuclear decontamination in particular, is properly defined. A theory is presented (Gy's Theory of Sampling, a.k.a. TOS) that brings all the answers and allows us to put them to work. The author draws form his lifelong experience in research, teaching and practical applications in this domain to emphasize the critical odds (i.e. risks) of not taking sampling explicitly into account when assessing grades and concentrations. The evolution of the acceptance of this theory in the nuclear industry is finally illustrated, and a hopeful glimpse into the future concludes the presentation. Equally interesting, however, besides what has already been achieved at the CEA along these years, is the realization of what could not be done with TOS, and therefore had to be treated in some other ways - e.g. using mapping tools (geostatistical). It is one the great side-advantages of using a consistent theory that it warns you, before it is too late, that what you are trying to do will not work: TOS, indeed, much like its Geo-statistics sister, besides preventing many a disaster, can provide pragmatic lessons in scientific humility that are best not being left ignored. In conclusion, there are great tools out there, such as TOS, that are well worth investing into, and that our community should be much more attuned to. (author)

  15. Physical hazards (noise, heat, vibration, illumination) - control at work place, methods and strategies

    International Nuclear Information System (INIS)

    Bose, M.; Srivastava, P.; Ganesh, G.


    The industrial work is getting modernized more day by day leading to more physical hazard. It is forcing the line management stressed upon in relation to the work place physical hazard. In order to keep the work place free from physical hazard it is required to use proper tool like work place assessment, measuring the parameters and analyze the end result which force us to take proper control measures to check and eliminate the physical hazard. (author)

  16. Sense of Place in Environmental Education (United States)

    Kudryavtsev, Alex; Stedman, Richard C.; Krasny, Marianne E.


    Although environmental education research has embraced the idea of sense of place, it has rarely taken into account environmental psychology-based sense of place literature whose theory and empirical studies can enhance related studies in the education context. This article contributes to research on sense of place in environmental education from…

  17. Sequential memory: Binding dynamics (United States)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail


    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  18. Cellulose binding domain proteins (United States)

    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc; Doi, Roy


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  19. Binding and Bulgarian

    NARCIS (Netherlands)

    Schürcks-Grozeva, Lilia Lubomirova


    In haar proefschrift analyseert Lilia Schürcks de anaforische verschijnselen in de Bulgaarse taal. Het gaat dan om wederkerende aspecten, uitgedrukt bij woorden als ‘zich’ en ‘elkaar’. De situatie in het Bulgaars blijkt moeilijk in te passen in de klassieke Binding Theory van Noam Chomsky. Bron: RUG

  20. Place attachment: processen van binding aan wijken in relatie tot wijkvernieuwing nader bekeken

    NARCIS (Netherlands)

    Havermans, D.W.Q.


    Op 15 september jl. protesteerden enkele bewoners van de wijk Oude Westen in Rotterdam tegen de voorgenomen plannen om een aantal woningen te slopen in de wijk. Tijdens een rondgang door de wijk met de raadscommissie Fysieke Infrastructuur en Buitenruimte gaven de bewoners aan, met name de eigenaren



    Pradeep Kumar Puram; Mukesh Kaparthi; Aditya Krishna Haas Rayaprolu


    The fun of using the Internet has become sour due to the various scams taking place day in and day out, all around the world. Internet users are being trapped around every corner and their credit card information is being siphoned, all due to the presence of these online scams. This paper looks in depth into a few of these scams, and explores a solution to counter this menace.

  2. Binding in haptics: integration of "what" and "where" information in working memory for active touch.

    Directory of Open Access Journals (Sweden)

    Franco Delogu

    Full Text Available Information about the identity and the location of perceptual objects can be automatically integrated in perception and working memory (WM. Contrasting results in visual and auditory WM studies indicate that the characteristics of feature-to-location binding can vary according to the sensory modality of the input. The present study provides first evidence of binding between "what" and "where" information in WM for haptic stimuli. In an old-new recognition task, blindfolded participants were presented in their peripersonal space with sequences of three haptic stimuli varying in texture and location. They were then required to judge if a single probe stimulus was previously included in the sequence. Recall was measured both in a condition in which both texture and location were relevant for the task (Experiment 1 and in two conditions where only one feature had to be recalled (Experiment 2. Results showed that when both features were task-relevant, even if the association of location and texture was neither necessary nor required to perform the task, participants exhibited a recall advantage in conditions in which the location and the texture of the target probe was kept unaltered between encoding and recall. By contrast, when only one feature was task-relevant, the concurrent feature did not influence the recall of the target feature. We conclude that attention to feature binding is not necessary for the emergence of feature integration in haptic WM. For binding to take place, however, it is necessary to encode and maintain in memory both the identity and the location of items.

  3. Efficient and dynamic nuclear localization of green fluorescent protein via RNA binding

    Energy Technology Data Exchange (ETDEWEB)

    Kitamura, Akira; Nakayama, Yusaku; Kinjo, Masataka, E-mail:


    Classical nuclear localization signal (NLS) sequences have been used for artificial localization of green fluorescent protein (GFP) in the nucleus as a positioning marker or for measurement of the nuclear-cytoplasmic shuttling rate in living cells. However, the detailed mechanism of nuclear retention of GFP-NLS remains unclear. Here, we show that a candidate mechanism for the strong nuclear retention of GFP-NLS is via the RNA-binding ability of the NLS sequence. GFP tagged with a classical NLS derived from Simian virus 40 (GFP-NLS{sup SV40}) localized not only in the nucleoplasm, but also to the nucleolus, the nuclear subdomain in which ribosome biogenesis takes place. GFP-NLS{sup SV40} in the nucleolus was mobile, and intriguingly, the diffusion coefficient, which indicates the speed of diffusing molecules, was 1.5-fold slower than in the nucleoplasm. Fluorescence correlation spectroscopy (FCS) analysis showed that GFP-NLS{sup SV40} formed oligomers via RNA binding, the estimated molecular weight of which was larger than the limit for passive nuclear export into the cytoplasm. These findings suggest that the nuclear localization of GFP-NLS{sup SV40} likely results from oligomerization mediated via RNA binding. The analytical technique used here can be applied for elucidating the details of other nuclear localization mechanisms, including those of several types of nuclear proteins. In addition, GFP-NLS{sup SV40} can be used as an excellent marker for studying both the nucleoplasm and nucleolus in living cells. - Highlights: • Nuclear localization signal-tagged GFP (GFP-NLS) showed clear nuclear localization. • The GFP-NLS dynamically localized not only in the nucleoplasm, but also to the nucleolus. • The nuclear localization of GFP-NLS results from transient oligomerization mediated via RNA binding. • Our NLS-tagging procedure is ideal for use in artificial sequestration of proteins in the nucleus.

  4. Efficient and dynamic nuclear localization of green fluorescent protein via RNA binding

    International Nuclear Information System (INIS)

    Kitamura, Akira; Nakayama, Yusaku; Kinjo, Masataka


    Classical nuclear localization signal (NLS) sequences have been used for artificial localization of green fluorescent protein (GFP) in the nucleus as a positioning marker or for measurement of the nuclear-cytoplasmic shuttling rate in living cells. However, the detailed mechanism of nuclear retention of GFP-NLS remains unclear. Here, we show that a candidate mechanism for the strong nuclear retention of GFP-NLS is via the RNA-binding ability of the NLS sequence. GFP tagged with a classical NLS derived from Simian virus 40 (GFP-NLS SV40 ) localized not only in the nucleoplasm, but also to the nucleolus, the nuclear subdomain in which ribosome biogenesis takes place. GFP-NLS SV40 in the nucleolus was mobile, and intriguingly, the diffusion coefficient, which indicates the speed of diffusing molecules, was 1.5-fold slower than in the nucleoplasm. Fluorescence correlation spectroscopy (FCS) analysis showed that GFP-NLS SV40 formed oligomers via RNA binding, the estimated molecular weight of which was larger than the limit for passive nuclear export into the cytoplasm. These findings suggest that the nuclear localization of GFP-NLS SV40 likely results from oligomerization mediated via RNA binding. The analytical technique used here can be applied for elucidating the details of other nuclear localization mechanisms, including those of several types of nuclear proteins. In addition, GFP-NLS SV40 can be used as an excellent marker for studying both the nucleoplasm and nucleolus in living cells. - Highlights: • Nuclear localization signal-tagged GFP (GFP-NLS) showed clear nuclear localization. • The GFP-NLS dynamically localized not only in the nucleoplasm, but also to the nucleolus. • The nuclear localization of GFP-NLS results from transient oligomerization mediated via RNA binding. • Our NLS-tagging procedure is ideal for use in artificial sequestration of proteins in the nucleus


    Directory of Open Access Journals (Sweden)

    M. Alaa Mandour


    Full Text Available Is a brand a product, a service, or a company? Is it a logo, a marketing strategy or an attitude? As globalization intensifies, places increasingly compete with other places for attention, influence, markets, investments, businesses, visitors, residents, talent and events. And competition is no longer restricted to the well-known places down the road, over the hill or across the water. Places now compete with cities, regions and countries halfway around the world. Places are increasingly getting caught off guard by unpredicted and apparently rapid shifts in competition and abruptly lose their historic purpose or their competitive edge, be it economic, social or cultural. Culture fills our cities, regions, nations and even our rural landscapes with spiritual content. Our places are an expression of who we are and what we value and they are ruthless in projecting the bad alongside the good. In its widest sense culture includes art, design, education, science, religion and sport. In the context of place branding it is the manifestation of our beliefs, values, customs and behaviors. Merging culture to brand within our city tissue is an essential part of the morphology within its spaces. This paper is trying to discuss the contribution of Islamic culture to a place brand; Relationship between culture and identity, image, visual identity etc. in the context of place branding; Impact of culture on brand equity; Developing cultural brand assets to brand places and how should we value and evaluate culture in the context of place branding?  Also will try to find answers to the following: Do we have a precise understanding of how Islamic culture adds value to or devalues a place? Do we have a methodology for capturing the value of our Islamic culture to places? And, can this culture be developed with the intent to create better places and place brands?   

  6. Hadron therapy takes off in Europe

    CERN Multimedia

    CERN Bulletin


    A joint meeting of ULICE, ENLIGHT and PARTNER recently took place in Marburg (Germany). The three initiatives are shaping both the present and the future of hadron therapy in Europe, where new cutting-edge facilities have started to fight cancer with beams of protons and carbon ions.   A pictorial representation of a raster scan on a tumour. (Photo courtesy of HIT/GSI/Siemens.) Thanks to a very active multidisciplinary community consisting of physicists, biologists, radiobiologists, engineers, IT specialists and medical doctors, hadron therapy is taking off in Europe. Indeed, after a few decades during which the innovative technique was mainly used experimentally in Japan, the US and a couple of pioneering laboratory-based facilities in Europe, today an increasing number of hospitals are being equipped with synchrotrons and dedicated treatment rooms. “Asia and Europe are at the forefront of research and use of carbon ions in the treatment of some rare and radio-resistant t...

  7. Taking CERN physics to South Asia

    CERN Multimedia

    Abha Eli Phoboo


    CERN physicists travelled to South Asia last month to bring a plethora of particle physics events to schools, universities and public venues. The initiative was the first of its kind in the region, and brought CERN particle physics to a new audience in Nepal and India.   Kathmandu University students take part in an ATLAS virtual visit. On 19 December 2014, students from Kathmandu University and Tribhuvan University, Nepal and 16 schools in Punjab, India took part in a joint virtual visit to ATLAS. The visit, which was the first of its kind in South Asia, followed a two-day Masterclass in particle physics that took place simultaneously in the two countries. The Masterclass was organised as a part of Physics Without Frontiers, an International Centre for Theoretical Physics project in partnership with CERN. Besides the Masterclass, physics workshops led by ATLAS physicists Kate Shaw, Joerg Stelzer and Suyog Shrestha were held for high school students and science teachers in three different d...

  8. Take part in a Django Girls training!

    CERN Multimedia


    Women are often under-represented in IT. And yet, at any age and whatever their level and background, it is a field that can arouse much interest.    To overcome this under-representation, the R0SEH1PSters community organises Django workshops targeted at women to introduce them to the world of coding and technology by teaching them how to successfully create a blog application and deploy it to the internet. And who knows, a spark of interest in the newly-discovered IT world may develop into a shine! The aim of Django Girls is also to increase the diversity within the industry. The mentors are mainly female volunteers who bring their passion to the workshop and are part of the awesome atmosphere attendees can feel during each event. Workshops have been organised worldwide regularly since 2014. Hosted by IdeaSquare and supported by the CERN IT department and the Diversity team, the Geneva workshop will take place in the evening on Friday evening, 26 February, and al...

  9. Use of 13NMR to delineate the mode of association or binding of 13C-labeled pollutants with humic materials

    International Nuclear Information System (INIS)

    Bortiatynski, J.M.; Minard, R.D.; Hatcher, P.G.


    13 C NMR has recently been shown to be a powerful technique for the examination of the covalent binding of pollutants to humic materials when the latter are enriched with 13 C. Enhanced signals are observed for the carbons that are highly enriched with 13 C while the remaining signals due to naturally abundant 13 C form unlabeled pollutant carbons or humic substances are at the baseline noise level. If covalent bonding and/or non covalent associations take place at or near the site of the 13 C label(s), the nature of the bonding or association can be discerned and the adsorption coefficients can be calculated. In this paper, the authors present the results of such binding studies which demonstrate the great potential of this technique

  10. Road safety: take it seriously

    CERN Multimedia

    Antonella Del Rosso


    Around 50 road accidents happen every year at CERN. Cyclists, drivers and pedestrians must pay attention to their behaviour at all times to ensure that this doesn’t become an even more serious problem. Even if the Laboratory’s sites are not exactly downtown Shanghai, all road users need to make a little effort. So let’s do it!   Life at CERN: let’s stick to accumulating scientific data rather than road accidents! (Cartoon by Cian O'Luanaigh) Despite a dedicated Safety Code in force since 1990, “traffic-calming” measures put in place last year, several reminders in the Bulletin and frequent safety campaigns, the number of accidents, particularly those involving cyclists, has remained high since 2008. Luckily, no-one has been seriously injured but it is more and more frequent to experience near misses or actual accidents, whether in a car or on a bike. Incivilities, excessive speeding (also for bikes!) and answering ...

  11. Branding the Destination Versus the Place

    DEFF Research Database (Denmark)

    Zenker, Sebastian; Braun, Erik; Petersen, Sibylle


    This article contributes to a broader understanding of how the branding of places affects both residents and tourists. While branding often relies on simplified messages, the effectiveness of such strategies for complex brands remains questionable. Residents in particular possess a confounded...... knowledge of the place and could disagree with simplified destination brands. To test the role of brand complexity for residents and tourists, we conducted two empirical studies (N = 765; N = 385), showing that, for residents, positive place attitude (i.e., place satisfaction, identification, and attachment......) and place behaviour (i.e., positive word-of-mouth) increase with a higher brand complexity. The second study shows that the positive relationship of brand complexity is stronger for residents than for tourists, supporting the conclusion that brand complexity is relevant for place brands, but that the place...

  12. Take care of your mouse!

    CERN Multimedia

    IT Department


    “Stop --- Think --- Click" is the basic recommendation for securely browsing the Internet and for securely reading e-mails. Users who have followed this recommendation in the past were less likely to have their computer infected or their computing account compromised. We would like to thank all those who donated their mouse to the CERN Animal Shelter for Computer Mice ( For those who still use a mouse, please stay vigilant and  alert: do not click on links whose origin you do not trust or which look like gibberish. Do not install untrusted software or plug-ins, since software from untrusted sources may infect or compromise your computer, or violate copyrights. Finally, take particular care with e-mails: Do not open unexpected or suspicious e-mails or attachments. Delete them if they do not concern you or if they appear strange. If in doubt, or if you have questions, please do not hesitate to contact

  13. Taking SESAME to the classroom

    CERN Multimedia


    The 2014 High School Teacher Programme (HST) is well under way, and this year it has a distinct Middle Eastern flavour, with eight teachers from the region among the 54 taking part.   Established in the late 1990s, HST is a three-week residential programme in English designed to give teachers a taste of frontier research and promote the teaching of modern physics in high schools. Along with the more than 30 other teacher schools given in the native language of the participants, HST aims to help teachers bring modern physics to the classroom and motivate their students to study science at upper secondary school and university. As part of the HST programme, teachers form working groups to develop lessons based on CERN science. This year, however, with eight teachers coming from Israel, Palestine, Iran and Jordan, all of which are members of SESAME, the international laboratory for Synchrotron-Light for Experimental Science Applications in the Middle East, one group is working on a dif...

  14. Procedure for taking physical inventories

    International Nuclear Information System (INIS)



    This session is intended to apprise one of the various aspects of procedures and routines that Exxon Nuclear uses with respect to its nuclear materials physical inventory program. The presentation describes how plant physical inventories are planned and taken. The description includes the planning and preparation for taking the inventory, the clean-out procedures for converting in-process material to measurable items, the administrative procedures for establishing independent inventory teams and for inventorying each inventory area, the verification procedures used to include previously measured tamper-safed items in the inventory, and lastly, procedures used to reconcile the inventory and calculate MUF (materials unaccounted for). The purpose of the session is to enable participants to: (1) understand the planning and pre-inventorty procedures and their importance; (2) understand the need for and the required intensity of clean-out procedures; (3) understand how inventory teams are formed, and how the inventory is conducted; (4) understand the distinction between inventory previously measured tamper-safed items and other materials not so characterized; (5) understand the reconciliation procedures; and (6) calculate a MUF given the book and inventory results

  15. Cluster II quartet take the stage together (United States)


    This is the only occasion on which all four of ESA's Cluster II spacecraft will be on display together in Europe. Four Spacecraft, One Mission The unique event takes place near the end of the lengthy assembly and test programme, during which each individual spacecraft is being assembled in sequence, one after the other. Two have already completed their assembly and systems testing and are about to be stored in special containers at IABG prior to shipment to the Baikonur launch site in Kazakhstan next spring. In the case of the other two, flight models 5 and 8, installation of the science payloads has finished, but their exhaustive series of environmental tests at IABG have yet to begin. Following delivery to the launch site next April, the satellites will be launched in pairs in June and July 2000. Two Soyuz rockets, each with a newly designed Fregat upper stage, are being provided by the Russian-French Starsem company. This will be the first time ESA satellites have been launched from the former Soviet Union. Cluster II is a replacement for the original Cluster mission, which was lost during the maiden launch of Ariane 5 in June 1996. ESA, given the mission's importance in its overall strategy in the area of the Sun-Earth connection, decided to rebuild this unique project. ESA member states supported that proposal. On 3 April 1997, the Agency's Science Programme Committee agreed. Cluster II was born. European Teamwork Scientific institutions and industrial enterprises in almost all the 14 ESA member states and the United States are taking part in the Cluster II project. Construction of the eight Cluster / Cluster II spacecraft has been a major undertaking for European industry. Built into each 1200 kg satellite are six propellant tanks, two pressure tanks, eight thrusters, 80 metres of pipework, about 5 km of wiring, 380 connectors and more than 14 000 electrical contacts. All the spacecraft were assembled in the giant clean room at the Friedrichshafen plant of

  16. Tactile modulation of hippocampal place fields. (United States)

    Gener, Thomas; Perez-Mendez, Lorena; Sanchez-Vives, Maria V


    Neural correlates of spatial representation can be found in the activity of the hippocampal place cells. These neurons are characterized by firing whenever the animal is located in a particular area of the space, the place field. Place fields are modulated by sensory cues, such as visual, auditory, or olfactory cues, being the influence of visual inputs the most thoroughly studied. Tactile information gathered by the whiskers has a prominent representation in the rat cerebral cortex. However, the influence of whisker-detected tactile cues on place fields remains an open question. Here we studied place fields in an enriched tactile environment where the remaining sensory cues were occluded. First, place cells were recorded before and after blockade of tactile transmission by means of lidocaine applied on the whisker pad. Following tactile deprivation, the majority of place cells decreased their firing rate and their place fields expanded. We next rotated the tactile cues and 90% of place fields rotated with them. Our results demonstrate that tactile information is integrated into place cells at least in a tactile-enriched arena and when other sensory cues are not available. Copyright © 2013 Wiley Periodicals, Inc.

  17. Attachment to the physical dimension of places. (United States)

    Hidalgo, M Carmen; Hernández, Bernardo


    Social relationships had been important in explanation and prediction of attachment to places. Although some have asserted the importance of physical aspects of the environment in the formation of attachment ties to a place, the social environment is required for the formation of bonds to a place, although strong emphasis on the social aspect has been questioned and the importance of the physical environment noted. The present objective in two studies was to test whether college students (ns = 30 and 27) show a preference for a place they know, independently of the social interactions developed in them. Results confirmed the hypothesis, i.e., after a very brief stay in a certain place with nobody else there, these college students preferred that place to another with which they had not had previous contact.

  18. Management and communication courses – Places available

    CERN Multimedia


    Please note that there are some places available in the following management and communication courses starting in September or October. For more information on the course, click on the course title, which will bring you to the training catalogue. You can then sign-up on line. For advice, you can contact Erwin Mosselmans (Tel.: 74125). HR Department Course Next Session Duration Language Availability Personal Awareness & Impact 10-11-12 September 3 days Bilingual 1 place Personal Awareness & Impact 17-18-19 September 3 days 2 places Procurement and Contract Management Training on Supplies 27 September 1 day 3 places Procurement and Contract Management Training on Industrial Services 12 October 1 day 5 places Core Development Package  Essentials of People Management for CERN Supervisors 01-02 October 23-24 January 2013 7-8 March 2013 6 days English 7 places Conflict Resolution for Ma...

  19. Rethinking the Measurement of Place Brands

    DEFF Research Database (Denmark)

    Zenker, Sebastian; Braun, Erik


    in the form of free brand associations of target customers with qualitative methods; in the form of attributes with quantitative methods like standardized questionnaires; and with mixed methods that combine qualitative research with quantitative methods. Two mixed methods, namely the network analysis......Place brand managers often disregard the complexity of place brands, as do their counterparts in the academic arena: they repeatedly use simple explorative descriptions of certain place brands, rather than a precise measurement. Thus, this chapter aims to identify and discuss measurement approaches...... that could prove useful in place branding. Therefore, we will define the brand and examine various options regarding what to measure in place branding. Finally, we will discuss the different approaches of brand measurement for their use in place branding, namely the approaches to measuring the brand...

  20. The Coronal Place; Why is It Special?

    Directory of Open Access Journals (Sweden)

    Azhar Alkazwini


    Full Text Available To prove the existence of arguments about the exact place that can bear the term ‘coronal’, it would be enough to check the explanatory dictionary’s entry. There are different arguments regarding the exact place of coronal. In this paper, some of the linguistic evidence regarding the coronal place shall be mentioned. Then, I shall discuss the classes of coronal that lend support to the fact that coronal place is believed to be special, and that is by discussing the different typologies of coronal consonants and giving their description.

  1. In Search of Place Brand Identity

    DEFF Research Database (Denmark)

    Kvistgaard, Hans-Peter; Blichfeldt, Bodil Stilling; Hird, John


    Place branding relates both to brand identity (what the place is) and brand image (what the place is/should be in the eyes of external audiences). Brand identity can be perceived as the set of values and attributes that those responsible for marketing and development of a place wish to reinforce...... that arise when trying to establish destination brand identity by means of more inclusive, bottom-up approaches. Drawing on both literature studies and the authors’ active involvement in destination branding across more than 50 Danish destinations, particularly the paper discusses how to decide who to give...

  2. Designing for Active Place Presence at Home

    DEFF Research Database (Denmark)

    Ylirisku, Salu; Jylhä, Antti; Lehtiö, Anu


    Technological support for augmenting the relationship that people establish with remote places has been studied fairly little as the primary focus in telepresence studies is the connection between people. This paper addresses the design challenge for supporting ‘active place presence’ at home...... to be considered when designing for active place presence at home........ A prototype, Hole in Space, was created to explore the design challenge. A longitudinal study of how an urban couple appropriated the prototype was conducted over the duration of seven months. The paper elaborates on how the Web-mediated design influenced place presence and outlines several aspects that need...

  3. Place-Based Education: What Is Its Place in the Social Studies Classroom? (United States)

    Resor, Cynthia Williams


    Place-based education is a growing trend in education. This article defines place-based education and briefly examines its use across the disciplines. So as to better understand the wider concept, meanings of the geographical term "place" are analyzed. Place-based education in a social studies classroom is examined using two hypothetical…

  4. Place Attachment in the Bible : The role of attachment to sacred places in religious life

    NARCIS (Netherlands)

    Counted, Agina Victor; Watts, Fraser


    This paper examines the role of place attachment in religious life by analyzing various significant place events in the Bible, using analysis of biblical discourse. The paper looks at various biblical places, and explores the implications of approaching these sacred settings in terms of place

  5. Place, Non-Place, Multi-Place and the (NonPossibilities of Identity: Philosophical, Social, and Communicational Aspects

    Directory of Open Access Journals (Sweden)

    Basia Nikiforova


    Full Text Available Michel Foucault in the text “Of Other Spaces: Utopias and Heterotopias” wrote that “the present epoch will perhaps be above all the epoch of space”. Space, place, and territories are social productions. Territory is a polysemic concept. Place is “events” created by territories, fluid areas of control produced by territorial negotiation (horizontal dynamics and negotiations between places (vertical dynamics. Space produces places and is produced by places. Moreover, space, place and territories can be seen as the waves of territorialization and deterritorialization in an endless process. It is a form of seizure in the world, an a priori for Immanuel Kant, an ontological need for Martin Heidegger. Territory is a space, governed by a set of rules, named “code”. Territorialization is then synonymous of a certain codification, or the symbolical organization of space. Places are created by territorializational dynamics. They are the sum of “events”. The place and its territory is not “natural”, but it is a cultural artifact, a social product linked to desire, power and identity. The changes of the functions of places (what Foucault called heterotopy are an important subject of contemporary studies. There are also many new temporary uses of these spaces and different emerging functions, including new forms of control, access, surveillance, new forms of openness and closeness (passwords, access profiles, etc.. Informational territory creates new heterotopias, new functions for places and a redefinition of social and communicational practices. It is not the end of a concrete place and its territory, but rather, a new meaning, sense, and a function for these spaces. The contemporary meaning of place and space has a visible tendency in creating ambivalence of sacrum and profanum, which means the secularization of the sacred and the sacralization of the secular. One of the sides of this tendency is sacralizing market and marketing


    Directory of Open Access Journals (Sweden)



    Full Text Available In this paper I have tried to present the place and importance of the discipline of Enterprise Economy among economic disciplines. Thus, in the first part we have showed the opinions of various authors from Romania on the interference of this discipline in the economic field with great implications through the 5 functions of the company to be presented. The second part of the thesis highlights the enterprise within modern economy and thus all the effects that increasingly complex and dynamic economic processes have upon the functions of the enterprise, the effective management of activities within the major functions of the enterprise: production, commercial, financial-accounting and human resources. Far from being just an analytic approach, this paper reveals the fact that the economy of enterprise is a theoretical and practical discipline with the aim of synthesizing basic knowledge of economic processes that take place at the microeconomic level.

  7. Personal development and communication courses – Places available

    CERN Multimedia


    There are places available in some personal development and communication courses taking place between February and June 2014.   For more information on the course, click on the course title to access the training catalogue. You can then sign-up online. For advice, you can contact: Erwin Mosselmans, tel. 74125, Nathalie Dumeaux, tel. 78144, Kerstin Fuhrmeister, tel.70896, Personal Development & Communication Training Session dates Duration Language Availability Communicating Effectively 18 – 19 March & 15 – 16 April 2 English 2 Gestion de temps Module 1 – 10 February 2014 (am) Module 2 – 21 March 2014  (am) Module 3 – 5 May 2014 (am) 1.5 French 12 Managing time Module 1 – 10 February 2014 (pm) Module 2 – 21 March 2014  (pm) Module 3 – 5 May 2014 (pm) 1.5...

  8. Personal development and communication courses – Places available

    CERN Multimedia


    There are places available in some personal development and communication courses taking place between February and June 2014.   For more information on the course, click on the course title to access the training catalogue. You can then sign-up online. For advice, you can contact: Erwin Mosselmans, tel. 74125, Nathalie Dumeaux, tel. 78144, Kerstin Fuhrmeister, tel.70896, Personal Development & Communication Training Session dates Duration Language Availability Communicating Effectively 18 – 19 March & 15 – 16 April 2 English 2 Gestion de temps Module 1 – 10 February 2014 (am) Module 2 – 21 March 2014  (am) Module 3 – 5 May 2014 (am) 1.5 French 12 Managing time Module 1 – 10 February 2014 (pm) Module 2 – 21 March 2014  (pm) Module 3 – 5 May 2014 (pm) 1.5 ...

  9. Place Attachment in the Bible: The Role of Attachment to Sacred Places in Religious Life


    Counted, Victor; Watts, Fraser


    This paper examines the role of place attachment in religious life by analyzing various significant place events in the Bible, using analysis of biblical discourse. The paper looks at various biblical places, and explores the implications of approaching these sacred settings in terms of place attachment theory. In the Old Testament we focus on Mount Sinai, Canaan, and Jerusalem, and in the New Testament on Galilee, Jerusalem, and on view that Christianity, to some extent, transcends place att...

  10. Conformational stability of the epidermal growth factor (EGF) receptor as influenced by glycosylation, dimerization and EGF hormone binding. (United States)

    Taylor, Eric S; Pol-Fachin, Laercio; Lins, Roberto D; Lower, Steven K


    The epidermal growth factor receptor (EGFR) is an important transmembrane glycoprotein kinase involved the initiation or perpetuation of signal transduction cascades within cells. These processes occur after EGFR binds to a ligand [epidermal growth factor (EGF)], thus inducing its dimerization and tyrosine autophosphorylation. Previous publications have highlighted the importance of glycosylation and dimerization for promoting proper function of the receptor and conformation in membranes; however, the effects of these associations on the protein conformational stability have not yet been described. Molecular dynamics simulations were performed to characterize the conformational preferences of the monomeric and dimeric forms of the EGFR extracellular domain upon binding to EGF in the presence and absence of N-glycan moieties. Structural stability analyses revealed that EGF provides the most conformational stability to EGFR, followed by glycosylation and dimerization, respectively. The findings also support that EGF-EGFR binding takes place through a large-scale induced-fitting mechanism. Proteins 2017; 85:561-570. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.


    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  12. Place Branding and Strategic Spatial Planning Instrument

    NARCIS (Netherlands)

    da Silva Oliveira, Eduardo


    Purpose – The purpose of this paper is to bring two literatures into dialogue. The first, is the place branding literature that aims to assert the diversity and complexity of places in pursuit of various economic, political or socio-psychological objectives. The second, is the strategic spatial

  13. Mapping sense(s) of place

    DEFF Research Database (Denmark)

    Skovse, Astrid Ravn; Hovy, Dirk; Johannsen, Anders Trærup


    , the question of how to tap into this constitutes a methodological challenge to researchers (Latham 2003, Hall 2009). This paper presents an experimental method aimed at eliciting data on sense of place and everyday mobility in a feasible and low-tech manner through the use of mental maps and mobility maps...... for answering questions about the relationship between places, speakers and linguistic practice....

  14. Sjogren's Syndrome: A Place to Begin

    Medline Plus

    Full Text Available ... Sjögren's Living with Sjögren's Survey Sjögren’s Clinical Trial Locations Clinical Trials – What’s Involved Video: A Place to ... Information Living with Sjögren's Survey Sjögren’s Clinical Trial Locations Clinical Trials – What’s Involved Video: A Place to ...

  15. 45 CFR 1703.301 - Meeting place. (United States)


    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Meeting place. 1703.301 Section 1703.301 Public... INFORMATION SCIENCE GOVERNMENT IN THE SUNSHINE ACT Conduct of Meetings § 1703.301 Meeting place. Meetings will be held in meeting rooms designated in the public announcement. Whenever the number of observers is...

  16. 5 CFR 1206.11 - Meeting place. (United States)


    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Meeting place. 1206.11 Section 1206.11 Administrative Personnel MERIT SYSTEMS PROTECTION BOARD ORGANIZATION AND PROCEDURES OPEN MEETINGS Conduct of Meetings § 1206.11 Meeting place. The Board will hold open meetings in meeting rooms designated in the...

  17. 45 CFR 99.13 - Place. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Place. 99.13 Section 99.13 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PROCEDURE FOR HEARINGS FOR THE CHILD CARE AND DEVELOPMENT FUND Preliminary Matters-Notice and Parties § 99.13 Place. The hearing shall be held in the city...

  18. Sjogren's Syndrome: A Place to Begin

    Medline Plus

    Full Text Available ... Trials – What’s Involved Video: A Place to Begin Family & Friends Information Sjögren’s FAQs Glossary Sjögren’s Tip > Dry ... Trials – What’s Involved Video: A Place to Begin Family & Friends Information Sjögren’s FAQs Glossary Sjögren’s Tip Survival ...

  19. Agency as Place in Teacher Education (United States)

    Miller, Grant R.; Patrizio, Kami M.


    We build upon the conceptualizations of agency in teacher education presented in the three previous articles in this issue to address the question of "where" agency occurs in the context of globalization. We rely on theories of place and place-based education to illuminate the paradoxical dimensions of the global commons, raising…

  20. The role of time in place attachment (United States)

    David Smaldone


    Quantitative studies have found that the length of association is an important variable affecting place attachment (Kaltenborn 1998, Moore & Graefe 1994, Patterson & Williams 1991, Vorkinn & Riese 2001). These studies, however, have provided less insight into how and why time is involved in the process of forming place attachment, as well as the meanings...