WorldWideScience

Sample records for binding constant kb

  1. Thermodynamic binding constants for gallium transferrin

    Energy Technology Data Exchange (ETDEWEB)

    Harris, W.R.; Pecoraro, V.L.

    1983-01-18

    Gallium-67 is widely used as an imaging agent for tumors and inflammatory abscesses. It is well stablished that Ga/sup 3 +/ travels through the circulatory system bound to the serum iron transport protein transferrin and that this protein binding is an essential step in tumor localization. However, there have been conflicting reports on the magnitude of the gallium-transferrin binding constants. Therefore, thermodynamic binding constants for gallium complexation at the two specific metal binding sites of human serum transferrin at pH 7.4 and 5 mM NaHCO/sub 3/ have been determined by UV difference spectroscopy. The conditional constants calculated for 27 mM NaHCO/sub 3/ are log K/sub 1/* = 20.3 and log K/sub 2/* = 19.3. These results are discussed in relation to the thermodynamics of transferrin binding of Fe/sup 3 +/ and to previous reports on gallium binding. The strength of transferrin complexation is also compared to that of a series of low molecular weight ligands by using calculated pM values (pM = -log (Ga(H/sub 2/O)/sub 6/)) to express the effective binding strength at pH 7.4.

  2. Rate Constants and Mechanisms of Protein-Ligand Binding.

    Science.gov (United States)

    Pang, Xiaodong; Zhou, Huan-Xiang

    2017-05-22

    Whereas protein-ligand binding affinities have long-established prominence, binding rate constants and binding mechanisms have gained increasing attention in recent years. Both new computational methods and new experimental techniques have been developed to characterize the latter properties. It is now realized that binding mechanisms, like binding rate constants, can and should be quantitatively determined. In this review, we summarize studies and synthesize ideas on several topics in the hope of providing a coherent picture of and physical insight into binding kinetics. The topics include microscopic formulation of the kinetic problem and its reduction to simple rate equations; computation of binding rate constants; quantitative determination of binding mechanisms; and elucidation of physical factors that control binding rate constants and mechanisms.

  3. Interactions of poly(amidoamine) dendrimers with human serum albumin: binding constants and mechanisms.

    Science.gov (United States)

    Giri, Jyotsnendu; Diallo, Mamadou S; Simpson, André J; Liu, Yi; Goddard, William A; Kumar, Rajeev; Woods, Gwen C

    2011-05-24

    The interactions of nanomaterials with plasma proteins have a significant impact on their in vivo transport and fate in biological fluids. This article discusses the binding of human serum albumin (HSA) to poly(amidoamine) [PAMAM] dendrimers. We use protein-coated silica particles to measure the HSA binding constants (K(b)) of a homologous series of 19 PAMAM dendrimers in aqueous solutions at physiological pH (7.4) as a function of dendrimer generation, terminal group, and core chemistry. To gain insight into the mechanisms of HSA binding to PAMAM dendrimers, we combined (1)H NMR, saturation transfer difference (STD) NMR, and NMR diffusion ordered spectroscopy (DOSY) of dendrimer-HSA complexes with atomistic molecular dynamics (MD) simulations of dendrimer conformation in aqueous solutions. The binding measurements show that the HSA binding constants (K(b)) of PAMAM dendrimers depend on dendrimer size and terminal group chemistry. The NMR (1)H and DOSY experiments indicate that the interactions between HSA and PAMAM dendrimers are relatively weak. The (1)H NMR STD experiments and MD simulations suggest that the inner shell protons of the dendrimers groups interact more strongly with HSA proteins. These interactions, which are consistently observed for different dendrimer generations (G0-NH(2)vs G4-NH(2)) and terminal groups (G4-NH(2)vs G4-OH with amidoethanol groups), suggest that PAMAM dendrimers adopt backfolded configurations as they form weak complexes with HSA proteins in aqueous solutions at physiological pH (7.4).

  4. Simultaneous Determination of Binding Constants for Multiple Carbohydrate Hosts in Complex Mixtures

    DEFF Research Database (Denmark)

    Meier, Sebastian; Beeren, Sophie

    2014-01-01

    We describe a simple method for the simultaneous determination of association constants for a guest binding to seven different hosts in a mixture of more than 20 different oligosaccharides. If the binding parameters are known for one component in the mixture, a single NMR titration suffices...

  5. Antibody binding constants from Farr test and other radioimmunoassays. A theoretical and experimental analysis

    International Nuclear Information System (INIS)

    Engel, J.; Schalch, W.

    1980-01-01

    For the reaction of monovalently reacting antibody (116-700pIEF) with its antigen (streptococcal group A-variant polysaccharide), an apparent binding constant Ksub(a) was derived by the ammonium sulfate precipitation technique (Farr assay) which was 40 times larger than the true binding constant K = 10 6 M -1 determined by fluorescence titration and equilibrium dialysis. For monovalently reacting antibodies the time needed for re-equilibration of the binding reaction is short as compared to the time of ammonium sulfate incubation. A thermodynamic analysis was therefore performed for the case of complete equilibration of all components in solution and in the ammonium sulfate precipitate. It was found that in this limiting case Ksub(a)/K is equal to the ratio of the solubilities of the antibody and the antibody complex corrected by the activity coefficients of the components in the precipitate. For other antibody-antigen reactions in which the antibody reacts with both binding sites to the same antigen molecule, re-equilibration of the binding reaction in solution is much slower. For such systems a disturbance of the binding reaction by the precipitation is less likely and correct binding constants may be obtained by the Farr technique or other radioimmunoassays involving precipitation. (author)

  6. Binding constants of Southern rice black-streaked dwarf virus Coat Protein with ferulic acid derivatives

    Directory of Open Access Journals (Sweden)

    Longlu Ran

    2018-04-01

    Full Text Available The data present binding constants between ferulic acid derivatives and the Coat Protein (P10 by fluorescence titration in this article, which is hosted in the research article entitled “Interaction Research on an Antiviral Molecule that Targets the Coat Protein of Southern rice black-streaked dwarf virus’’ (Ran et al., 2017 [1]. The data include fluorescence quenching spectrum, Stern–Volmer quenching constants, and binding parameters. In this article, a more comprehensive data interpretation and analysis is explained.

  7. Palmitate and stearate binding to human serum albumin. Determination of relative binding constants

    DEFF Research Database (Denmark)

    Vorum, H; Fisker, K; Honoré, B

    1997-01-01

    Multiple binding equilibria of two apparently insoluble ligands, palmitate and stearate, to defatted human serum albumin were studied in a 66 mM sodium phosphate buffer (pH 7.4) at 37 degrees C, by determination of dialytic exchange rates of ligands among identical equilibrium solutions...

  8. Mathematical model for determining the binding constants between immunoglobulins, bivalent ligands, and monovalent ligands.

    Science.gov (United States)

    Mack, Eric T; Cummings, Linda; Perez-Castillejos, Raquel

    2011-02-01

    This paper analyzes the equilibria between immunoglobulins (R(2)), homo-bifunctional ligands (L(2)), monovalent ligands (I), and their complexes. We present a mathematical model that can be used to estimate the concentration of each species present in a mixture of R(2), L(2), and I, given the initial conditions defining the total concentration of R(2), L(2), I, and four dissociation constants (K(d)(inter), K(d)(intra), K(d)(mono), and α). This model is based on fewer assumptions than previous models and can be used to describe exactly a broad range of experimental conditions. A series of curves illustrates the dependence of the equilibria upon the total concentrations of receptors and ligands, and the dissociation constants. We provide a set of guidelines for the design and analysis of experiments with a focus on estimating the binding constants from experimental binding isotherms. Two analytical equations relate the conditions for maximum aggregation in this system to the binding constants. This model is a tool to quantify the binding of immunoglobulins to antigens and a guide to understanding and predicting the experimental data of assays and techniques that employ immunoglobulins.

  9. Prediction and dissection of widely-varying association rate constants of actin-binding proteins.

    Science.gov (United States)

    Pang, Xiaodong; Zhou, Kenneth H; Qin, Sanbo; Zhou, Huan-Xiang

    2012-01-01

    Actin is an abundant protein that constitutes a main component of the eukaryotic cytoskeleton. Its polymerization and depolymerization are regulated by a variety of actin-binding proteins. Their functions range from nucleation of actin polymerization to sequestering G-actin in 1∶1 complexes. The kinetics of forming these complexes, with rate constants varying at least three orders of magnitude, is critical to the distinct regulatory functions. Previously we have developed a transient-complex theory for computing protein association mechanisms and association rate constants. The transient complex refers to an intermediate in which the two associating proteins have near-native separation and relative orientation but have yet to form short-range specific interactions of the native complex. The association rate constant is predicted as k(a) = k(a0) e(-ΔG(el*)/k(B)T), where k(a0) is the basal rate constant for reaching the transient complex by free diffusion, and the Boltzmann factor captures the bias of long-range electrostatic interactions. Here we applied the transient-complex theory to study the association kinetics of seven actin-binding proteins with G-actin. These proteins exhibit three classes of association mechanisms, due to their different molecular shapes and flexibility. The 1000-fold k(a) variations among them can mostly be attributed to disparate electrostatic contributions. The basal rate constants also showed variations, resulting from the different shapes and sizes of the interfaces formed by the seven actin-binding proteins with G-actin. This study demonstrates the various ways that actin-binding proteins use physical properties to tune their association mechanisms and rate constants to suit distinct regulatory functions.

  10. Iron hexacyanide/cytochrome-C - intramolecular electron transfer and binding constants - (pulse radiolytic study). Progress report

    International Nuclear Information System (INIS)

    Ilan, Y.; Shafferman, A.

    Internal oxidation and reduction rates of horse cytochrome-c in the complexes, CII.Fe/sup III/(CN) -3 6 and CIII.Fe/sup II/(CN) -4 6 , are 4.6.10 4 s -1 and 3.3.10 2 s -1 , respectively. The binding sites of the iron hexacyanide ions on either CII or CIII are kinetically almost indistinguishable; binding constants range from 0.87.10 3 to 2.10 3 M -1 . The present pulse radiolytic kinetic data are compared with that from N.M.R, T-jump and equilibrium dialysis studies

  11. Computational Approaches to the Chemical Equilibrium Constant in Protein-ligand Binding.

    Science.gov (United States)

    Montalvo-Acosta, Joel José; Cecchini, Marco

    2016-12-01

    The physiological role played by protein-ligand recognition has motivated the development of several computational approaches to the ligand binding affinity. Some of them, termed rigorous, have a strong theoretical foundation but involve too much computation to be generally useful. Some others alleviate the computational burden by introducing strong approximations and/or empirical calibrations, which also limit their general use. Most importantly, there is no straightforward correlation between the predictive power and the level of approximation introduced. Here, we present a general framework for the quantitative interpretation of protein-ligand binding based on statistical mechanics. Within this framework, we re-derive self-consistently the fundamental equations of some popular approaches to the binding constant and pinpoint the inherent approximations. Our analysis represents a first step towards the development of variants with optimum accuracy/efficiency ratio for each stage of the drug discovery pipeline. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Calculation of elastic constants of BCC transition metals: tight-binding recursion method

    International Nuclear Information System (INIS)

    Masuda, K.; Hamada, N.; Terakura, K.

    1984-01-01

    The elastic constants of BCC transition metals (Fe, Nb, Mo and W) are calculated by using the tight-binding d band and the Born-Mayer repulsive potential. Introducing a small distortion characteristic to C 44 (or C') elastic deformation and calculating the energy change up to second order in the atomic displacement, the shear elastic constants C 44 and C' are determined. The elastic constants C 11 and C 12 are then calculated by using the relations B=1/3(C 11 + 2C 12 ) and C'=1/2(C 11 -C 12 ), where B is the bulk modulus. In general, the agreement between the present results and the experimental values is satisfactory. The characteristic elasticity behaviour, i.e. the strong Nsub(d) (number of d electrons) dependence of the observed anisotropy factor A=C 44 /C', will also be discussed. (author)

  13. Determining the binding mode and binding affinity constant of tyrosine kinase inhibitor PD153035 to DNA using optical tweezers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chih-Ming [School of Dental Technology, Taipei Medical University, Taipei 110, Taiwan (China); Research Center for Biomedical Implants and Microsurgery Devices, Taipei Medical University, Taipei 110, Taiwan (China); Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu 30043, Taiwan (China); Lee, Yuarn-Jang [Section of Infectious Diseases, Department of Internal Medicine, Taipei Medical University Hospital, Taipei 110, Taiwan (China); Wang, Wei-Ting [School of Dental Technology, Taipei Medical University, Taipei 110, Taiwan (China); Institute of Biomedical Materials and Engineering, Taipei Medical University, Taipei 110, Taiwan (China); Research Center for Biomedical Implants and Microsurgery Devices, Taipei Medical University, Taipei 110, Taiwan (China); Hsu, Chien-Ting [Institute of Biomedical Materials and Engineering, Taipei Medical University, Taipei 110, Taiwan (China); Research Center for Biomedical Implants and Microsurgery Devices, Taipei Medical University, Taipei 110, Taiwan (China); Tsai, Jing-Shin [School of Dental Technology, Taipei Medical University, Taipei 110, Taiwan (China); Institute of Biomedical Materials and Engineering, Taipei Medical University, Taipei 110, Taiwan (China); Research Center for Biomedical Implants and Microsurgery Devices, Taipei Medical University, Taipei 110, Taiwan (China); Wu, Chien-Ming [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu 30043, Taiwan (China); Ou, Keng-Liang [Institute of Biomedical Materials and Engineering, Taipei Medical University, Taipei 110, Taiwan (China); Research Center for Biomedical Implants and Microsurgery Devices, Taipei Medical University, Taipei 110, Taiwan (China); and others

    2011-01-07

    Research highlights: {yields} PD153035 is a DNA intercalator and intercalation occurs only under very low salt concentration. {yields} The minimum distance between adjacent bound PD153035 {approx} 11 bp. {yields} Binding affinity constant for PD153035 is 1.18({+-}0.09) x 10{sup 4} (1/M). {yields} The change of binding free energy of PD153035-DNA interaction is -5.49 kcal mol{sup -1} at 23 {+-} 0.5 {sup o}C. -- Abstract: Accurately predicting binding affinity constant (K{sub A}) is highly required to determine the binding energetics of the driving forces in drug-DNA interactions. Recently, PD153035, brominated anilinoquinazoline, has been reported to be not only a highly selective inhibitor of epidermal growth factor receptor but also a DNA intercalator. Here, we use a dual-trap optical tweezers to determining K{sub A} for PD153035, where K{sub A} is determined from the changes in B-form contour length (L) of PD153035-DNA complex. Here, L is fitted using a modified wormlike chain model. We found that a noticeable increment in L in 1 mM sodium cacodylate was exhibited. Furthermore, our results showed that K{sub A} = 1.18({+-}0.09) x 10{sup 4} (1/M) at 23 {+-} 0.5 {sup o}C and the minimum distance between adjacent bound PD153035 {approx} 11 bp. We anticipate that by using this approach we can determine the complete thermodynamic profiles due to the presence of DNA intercalators.

  14. Binding Of Ferrocyphen By Sds, Ctab And Triton X-100 In Water ...

    African Journals Online (AJOL)

    SDS), cetyltrimethylammonium bromide (CTAB) and Triton X-100 surfactants was studied spectrophotometrically in water-ethanol medium. The equilibrium binding constant (Kb) and the number of binding sites (n) per surfactant monomer were ...

  15. Signatures of van der Waals binding: A coupling-constant scaling analysis

    Science.gov (United States)

    Jiao, Yang; Schröder, Elsebeth; Hyldgaard, Per

    2018-02-01

    The van der Waals (vdW) density functional (vdW-DF) method [Rep. Prog. Phys. 78, 066501 (2015), 10.1088/0034-4885/78/6/066501] describes dispersion or vdW binding by tracking the effects of an electrodynamic coupling among pairs of electrons and their associated exchange-correlation holes. This is done in a nonlocal-correlation energy term Ecnl, which permits density functional theory calculation in the Kohn-Sham scheme. However, to map the nature of vdW forces in a fully interacting materials system, it is necessary to also account for associated kinetic-correlation energy effects. Here, we present a coupling-constant scaling analysis, which permits us to compute the kinetic-correlation energy Tcnl that is specific to the vdW-DF account of nonlocal correlations. We thus provide a more complete spatially resolved analysis of the electrodynamical-coupling nature of nonlocal-correlation binding, including vdW attraction, in both covalently and noncovalently bonded systems. We find that kinetic-correlation energy effects play a significant role in the account of vdW or dispersion interactions among molecules. Furthermore, our mapping shows that the total nonlocal-correlation binding is concentrated to pockets in the sparse electron distribution located between the material fragments.

  16. Binding Constant of Amines to Water/AOT/n-Hexene Reverse Micelles. Influence of the Chemical Structure

    Directory of Open Access Journals (Sweden)

    J. J. Silber

    2000-03-01

    Full Text Available The distribution of different amines between n-hexane bulk and the micellar pseudophase of AOT reverse micelles were measured by a fluorometric method. An independent method was used to corroborate the incorporation of the amines to the interface. The effect of the amine structure on the binding constant was analysed.

  17. Estimation of apparent binding constant of complexes of selected acyclic nucleoside phosphonates with beta-cyclodextrin by affinity capillary electrophoresis

    Czech Academy of Sciences Publication Activity Database

    Šolínová, Veronika; Mikysková, Hana; Kaiser, Martin Maxmilian; Janeba, Zlatko; Holý, Antonín; Kašička, Václav

    2016-01-01

    Roč. 37, č. 2 (2016), s. 239-247 ISSN 0173-0835 R&D Projects: GA ČR(CZ) GA13-17224S; GA ČR(CZ) GA15-01948S Institutional support: RVO:61388963 Keywords : acyclic nucleoside phosphonates * affinity capillary electrophoresis * binding constant * nucleotide analogs * beta-cyclodextrin Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.744, year: 2016

  18. Binding constants of membrane-anchored receptors and ligands: A general theory corroborated by Monte Carlo simulations.

    Science.gov (United States)

    Xu, Guang-Kui; Hu, Jinglei; Lipowsky, Reinhard; Weikl, Thomas R

    2015-12-28

    Adhesion processes of biological membranes that enclose cells and cellular organelles are essential for immune responses, tissue formation, and signaling. These processes depend sensitively on the binding constant K2D of the membrane-anchored receptor and ligand proteins that mediate adhesion, which is difficult to measure in the "two-dimensional" (2D) membrane environment of the proteins. An important problem therefore is to relate K2D to the binding constant K3D of soluble variants of the receptors and ligands that lack the membrane anchors and are free to diffuse in three dimensions (3D). In this article, we present a general theory for the binding constants K2D and K3D of rather stiff proteins whose main degrees of freedom are translation and rotation, along membranes and around anchor points "in 2D," or unconstrained "in 3D." The theory generalizes previous results by describing how K2D depends both on the average separation and thermal nanoscale roughness of the apposing membranes, and on the length and anchoring flexibility of the receptors and ligands. Our theoretical results for the ratio K2D/K3D of the binding constants agree with detailed results from Monte Carlo simulations without any data fitting, which indicates that the theory captures the essential features of the "dimensionality reduction" due to membrane anchoring. In our Monte Carlo simulations, we consider a novel coarse-grained model of biomembrane adhesion in which the membranes are represented as discretized elastic surfaces, and the receptors and ligands as anchored molecules that diffuse continuously along the membranes and rotate at their anchor points.

  19. Measurement of Nanomolar Dissociation Constants by Titration Calorimetry and Thermal Shift Assay – Radicicol Binding to Hsp90 and Ethoxzolamide Binding to CAII

    Directory of Open Access Journals (Sweden)

    Vilma Michailovienė

    2009-06-01

    Full Text Available The analysis of tight protein-ligand binding reactions by isothermal titration calorimetry (ITC and thermal shift assay (TSA is presented. The binding of radicicol to the N-terminal domain of human heat shock protein 90 (Hsp90aN and the binding of ethoxzolamide to human carbonic anhydrase (hCAII were too strong to be measured accurately by direct ITC titration and therefore were measured by displacement ITC and by observing the temperature-denaturation transitions of ligand-free and ligand-bound protein. Stabilization of both proteins by their ligands was profound, increasing the melting temperature by more than 10 ºC, depending on ligand concentration. Analysis of the melting temperature dependence on the protein and ligand concentrations yielded dissociation constants equal to 1 nM and 2 nM for Hsp90aN-radicicol and hCAII-ethoxzolamide, respectively. The ligand-free and ligand-bound protein fractions melt separately, and two melting transitions are observed. This phenomenon is especially pronounced when the ligand concentration is equal to about half the protein concentration. The analysis compares ITC and TSA data, accounts for two transitions and yields the ligand binding constant and the parameters of protein stability, including the Gibbs free energy and the enthalpy of unfolding.

  20. HUBUNGAN PELAYANAN KB IUD TERHADAP TINGKAT KEPUASAN AKSEPTOR KB IUD

    Directory of Open Access Journals (Sweden)

    Nevia Zulfatunnisa'

    2017-07-01

    Full Text Available Pelayanan keluarga berencana bertujuan untuk meningkatkan kesejahteraan ibu serta anak melalui pengendalian kelahiran dan pengendalian pertumbuhan penduduk. Hasil studi pendahuluan didapatkan data seluruh akseptor KB IUD tahun 2015 IUD 86 orang. Hasil yang didapatkan 15 akseptor merasa puas dan 5 akseptor tidak puas dengan pelayanan KB IUD meliputi : tanggapan bidan, privasi, sikap bidan, dan konseling yang diberikan. Tujuan penelitian ini Untuk mengetahui hubungan pelayanan KB IUD terhadap tingkat kepuasan akseptor KB IUD. Metode penelitian ini menggunakan deskriptif analitik dengan  pendekatan cross sectional. Populasi penelitian masyarakat Sangkrah yang menggunakan KB IUD dengan tekhnik sample menggunakan Non Random Sampling dengan metode quota sampling sejumlah 30 responden. Instrumen penelitian menggunakan quesioner. Analisa yang digunakan berupa spearman rank test pada signifikan 5%..Hasil penelitian didapatkan mayoritas pelayanan yang baik  sebanyak 63,3%, dan minoritas pelayanan yang kurang 20%, sedangkan pada mayoritas tingkat kepuasan yang puas sebanyak 36,8  % dan  minoritas tingkat kepuasan yang sangat tidak puas sebanyak  20 %. Pada analisa bivariet ini menunjukkan nilai ρ > α ( 0.650 > 0.364. [w1

  1. Constant domains influence binding of mouse–human chimeric antibodies to the capsular polypeptide of Bacillus anthracis

    Science.gov (United States)

    Hubbard, Mark A; Thorkildson, Peter; Kozel, Thomas R; AuCoin, David P

    2013-01-01

    Our laboratory previously described the binding characteristics of the murine IgG3 monoclonal antibody (MuAb) F26G3. This antibody binds the poly-glutamic acid capsule (PGA) of Bacillus anthracis, an essential virulence factor in the progression of anthrax. F26G3 IgG3 MuAb binds PGA with a relatively high functional affinity (10 nM), produces a distinct “rim” quellung reaction, and is protective in a murine model of pulmonary anthrax. This study engineered an IgG subclass family of F26G3 mouse–human chimeric antibodies (ChAb). The F26G3 ChAbs displayed 9- to 20-fold decreases in functional affinity, as compared with the parent IgG3 MuAb. Additionally, the quellung reactions that were produced by the ChAbs all differed from the parent IgG3 MuAb in that they appeared “puffy” in nature. This study demonstrates that human constant domains may influence multiple facets of antibody binding to microbial capsular antigens despite their spatial separation from the traditional antigen-binding site. PMID:23863605

  2. Constant domains influence binding of mouse-human chimeric antibodies to the capsular polypeptide of Bacillus anthracis.

    Science.gov (United States)

    Hubbard, Mark A; Thorkildson, Peter; Kozel, Thomas R; AuCoin, David P

    2013-08-15

    Our laboratory previously described the binding characteristics of the murine IgG3 monoclonal antibody (MuAb) F26G3. This antibody binds the poly-glutamic acid capsule (PGA) of Bacillus anthracis, an essential virulence factor in the progression of anthrax. F26G3 IgG3 MuAb binds PGA with a relatively high functional affinity (10 nM), produces a distinct "rim" quellung reaction, and is protective in a murine model of pulmonary anthrax. This study engineered an IgG subclass family of F26G3 mouse-human chimeric antibodies (ChAb). The F26G3 ChAbs displayed 9- to 20-fold decreases in functional affinity, as compared with the parent IgG3 MuAb. Additionally, the quellung reactions that were produced by the ChAbs all differed from the parent IgG3 MuAb in that they appeared "puffy" in nature. This study demonstrates that human constant domains may influence multiple facets of antibody binding to microbial capsular antigens despite their spatial separation from the traditional antigen-binding site.

  3. Improved estimation of receptor density and binding rate constants using a single tracer injection and displacement

    International Nuclear Information System (INIS)

    Syrota, A.; Delforge, J.; Mazoyer, B.M.

    1988-01-01

    The possibility of improving receptor model parameter estimation using a displacement experiment in which an excess of an unlabeled ligand (J) is injected after a delay (t D ) following injection of trace amounts of the β + - labeled ligand (J*) is investigated. The effects of varying t D and J/J* on parameter uncertainties are studied in the case of 11 C-MQNB binding to myocardial acetycholine receptor using parameters identified in a dog experiment

  4. SP-A binds alpha1-antitrypsin in vitro and reduces the association rate constant for neutrophil elastase

    Directory of Open Access Journals (Sweden)

    Carrabino Natalia

    2005-12-01

    Full Text Available Abstract Background α1-antitrypsin and surfactant protein-A (SP-A are major lung defense proteins. With the hypothesis that SP-A could bind α1-antitrypsin, we designed a series of in vitro experiments aimed at investigating the nature and consequences of such an interaction. Methods and results At an α1-antitrypsin:SP-A molar ratio of 1:1, the interaction resulted in a calcium-dependent decrease of 84.6% in the association rate constant of α1-antitrypsin for neutrophil elastase. The findings were similar when SP-A was coupled with the Z variant of α1-antitrypsin. The carbohydrate recognition domain of SP-A appeared to be a major determinant of the interaction, by recognizing α1-antitrypsin carbohydrate chains. However, binding of SP-A carbohydrate chains to the α1-antitrypsin amino acid backbone and interaction between carbohydrates of both proteins are also possible. Gel filtration chromatography and turnover per inactivation experiments indicated that one part of SP-A binds several molar parts of α1-antitrypsin. Conclusion We conclude that the binding of SP-A to α1-antitrypsin results in a decrease of the inhibition of neutrophil elastase. This interaction could have potential implications in the physiologic regulation of α1-antitrypsin activity, in the pathogenesis of pulmonary emphysema, and in the defense against infectious agents.

  5. Simple and rapid quantification of serotonin transporter binding using [11C]DASB bolus plus constant infusion.

    Science.gov (United States)

    Gryglewski, G; Rischka, L; Philippe, C; Hahn, A; James, G M; Klebermass, E; Hienert, M; Silberbauer, L; Vanicek, T; Kautzky, A; Berroterán-Infante, N; Nics, L; Traub-Weidinger, T; Mitterhauser, M; Wadsak, W; Hacker, M; Kasper, S; Lanzenberger, R

    2017-04-01

    In-vivo quantification of serotonin transporters (SERT) in human brain has been a mainstay of molecular imaging in the field of neuropsychiatric disorders and helped to explore the underpinnings of several medical conditions, therapeutic and environmental influences. The emergence of PET/MR hybrid systems and the heterogeneity of SERT binding call for the development of efficient methods making the investigation of larger or vulnerable populations with limited scanner time and simultaneous changes in molecular and functional measures possible. We propose [ 11 C]DASB bolus plus constant infusion for these applications and validate it against standard analyses of dynamic PET data. [ 11 C]DASB bolus/infusion optimization was performed on data acquired after [ 11 C]DASB bolus in 8 healthy subjects. Subsequently, 16 subjects underwent one scan using [ 11 C]DASB bolus plus constant infusion with K bol 160-179min and one scan after [ 11 C]DASB bolus for inter-method reliability analysis. Arterial blood sampling and metabolite analysis were performed for all scans. Distribution volumes (V T ) were obtained using Logan plots for bolus scans and ratios between tissue and plasma parent activity for bolus plus infusion scans for different time spans of the scan (V T-70 for 60-70min after start of tracer infusion, V T-90 for 75-90min, V T-120 for 100-120min) in 9 subjects. Omitting blood data, binding potentials (BP ND ) obtained using multilinear reference tissue modeling (MRTM2) and cerebellar gray matter as reference region were compared in 11 subjects. A K bol of 160min was observed to be optimal for rapid equilibration in thalamus and striatum. V T-70 showed good intraclass correlation coefficients (ICCs) of 0.61-0.70 for thalamus, striatal regions and olfactory cortex with bias ≤5.1% compared to bolus scans. ICCs increased to 0.72-0.78 for V T-90 and 0.77-0.93 for V T-120 in these regions. BP ND-90 had negligible bias ≤2.5%, low variability ≤7.9% and ICCs of 0

  6. Comparative study of binding constants from Love wave surface acoustic wave and surface plasmon resonance biosensors using kinetic analysis.

    Science.gov (United States)

    Lee, Sangdae; Kim, Yong-Il; Kim, Ki-Bok

    2013-11-01

    Biosensors are used in a variety of fields for early diagnosis of diseases, measurement of toxic contaminants, quick detection of pathogens, and separation of specific proteins or DNA. In this study, we fabricated and evaluated the capability of a high sensitivity Love wave surface acoustic wave (SAW) biosensor. The experimental setup was composed of the fabricated 155-MHz Love wave SAW biosensor, a signal measurement system, a liquid flow system, and a temperature-control system. Subsequently, we measured the lower limit of detection (LOD) of the 155-MHz Love wave SAW biosensor, and calculated the association and dissociation constants between protein G and anti-mouse IgG using kinetic analysis. We compared these results with those obtained using a commercial surface plasmon resonance (SPR) biosensor. We found that the LOD of the SAW biosensor for anti-mouse IgG and mouse IgG was 0.5 and 1 microg/ml, respectively, and the resultant equilibrium association and dissociation constants were similar to the corresponding values obtaining using the commercial SPR biosensor. Thus, we conclude that the fabricated 155-MHz Love wave SAW biosensor exhibited the high sensitivity of the commercial SPR biosensor and was able to analyze the binding properties of the ligand and receptor by kinetic analysis similarly to the commercial SPR biosensor.

  7. Germline transcription and switch recombination of a transgene containing the entire H chain constant region locus: effect of a mutation in a STAT6 binding site in the gamma 1 promoter.

    Science.gov (United States)

    Dunnick, Wesley A; Shi, Jian; Graves, Kevin A; Collins, John T

    2004-11-01

    The switch (S) in H chain class is preceded by germline transcription and then mediated by a DNA recombination event. One of the impediments toward understanding the mechanism is the lack of a system in which a recombinant DNA molecule undergoes cytokine-regulated class S recombination. To study class S recombination, we used transgenic mice with a 230-kb bacterial artificial chromosome that included a rearranged VDJ gene and the entire murine H chain constant region locus. We found that both germline transcription and S recombination to the transgenic gamma1 H chain gene were regulated by IL-4 like that of the endogenous genes. In mice with two or more copies of the H chain locus transgene, both germline transcripts and S recombination took place at levels comparable to those from the endogenous loci. We also prepared a version of the transgene with a 4-bp mutation in a STAT6 binding site in the gamma1 promoter region. On the average, this mutation reduced germline transcription by 80%, but did not change the amount of S recombination in vitro. Among both the wild-type and mutant transgenes, we found no significant correlation between the amount of germline transcripts and the amount of S recombination. We infer that the physiologic level of germline transcription of the gamma1 gene is in excess over the amount required for efficient S recombination.

  8. Variation in DNA binding constants with a change in geometry of ternary copper(II) complexes with N2O donor Schiff base and cyanate or dicyanamide

    Science.gov (United States)

    Jana, Subrata; Santra, Ramesh Chandra; Das, Saurabh; Chattopadhyay, Shouvik

    2014-09-01

    Two new copper(II) complexes, [Cu(L)(OCN)] (1) and [CuL(dca)]n (2), where HL = 2-(-(2-(diethylamino)ethylimino)methyl)naphthalen-1-ol, dca = N(CN)2-, have been synthesized and characterized by elemental analysis, IR, UV-VIS spectroscopy and single crystal X-ray diffraction studies. Complex 1 has square planar and complex 2 square pyramidal geometries in solid state around metal centre. Interactions of the complexes with calf thymus DNA (CT DNA) were studied by UV-VIS spectroscopy. Binding constant and site size of interaction were determined. Binding site size and intrinsic binding constant K revealed complex 1 interacted with calf thymus DNA better than complex 2.

  9. Effect of halo-substituted aromatic salts on counterion binding constants obtained from cationic nanoparticle catalyzed reactions of piperidine and phenyl salicylate

    Science.gov (United States)

    Fagge, Ibrahim I.; Yusof, Nor Saadah M.; Zain, Sharifuddin Md; Khan, M. Niyaz

    2017-12-01

    Halo-substitutions at 3-position of benzene ring of the salts of aromatic carboxylate, MX, revealed the effect of two different halide ions (Br- and Cl-) on the counterion binding constants obtained from cationic nanoparticle catalyzed piperidinolysis of ionized phenyl salicylate (PhS-). The values of observed rate constant, kobs, determined at a constant total concentration of cetyltrimethylammonium bromide, [CTABr]T, piperidine, ([P]T), [PhS-]T, NaOH, and various concentration of MX (MX = 3-BrC6H4CO2Na and 3-ClC6H4CO2Na), were determined using UV-visible X spectrophotometric technique at 35 °C and 370 nm. The average value of nanoparticle binding constant, KXBr, for X- = 3-BrC6H4CO2- (RXBr = 57) was found to be about 2-fold larger than that for X- = 3-ClC6H4CO2- (RXBr = 30). These XX values were dependent of substituents 3-Br and 3-Cl, and independent of [CTABr]T. Both are related to the presence of different extent of viscoelastic worm-like nanoparticles formation in the [CTABr]T of 6 and 10 mM.

  10. UniProtKB/Swiss-Prot.

    Science.gov (United States)

    Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Schneider, Michel; Bairoch, Amos

    2007-01-01

    The Swiss Institute of Bioinformatics (SIB), the European Bioinformatics Institute (EBI), and the Protein Information Resource (PIR) form the Universal Protein Resource (UniProt) consortium. Its main goal is to provide the scientific community with a central resource for protein sequences and functional information. The UniProt consortium maintains the UniProt KnowledgeBase (UniProtKB) and several supplementary databases including the UniProt Reference Clusters (UniRef) and the UniProt Archive (UniParc). (1) UniProtKB is a comprehensive protein sequence knowledgebase that consists of two sections: UniProtKB/Swiss-Prot, which contains manually annotated entries, and UniProtKB/TrEMBL, which contains computer-annotated entries. UniProtKB/Swiss-Prot entries contain information curated by biologists and provide users with cross-links to about 100 external databases and with access to additional information or tools. (2) The UniRef databases (UniRef100, UniRef90, and UniRef50) define clusters of protein sequences that share 100, 90, or 50% identity. (3) The UniParc database stores and maps all publicly available protein sequence data, including obsolete data excluded from UniProtKB. The UniProt databases can be accessed online (http://www.uniprot.org/) or downloaded in several formats (ftp://ftp.uniprot.org/pub). New releases are published every 2 weeks. The purpose of this chapter is to present a guided tour of a UniProtKB/Swiss-Prot entry, paying particular attention to the specificities of plant protein annotation. We will also present some of the tools and databases that are linked to each entry.

  11. A model of mitochondrial creatine kinase binding to membranes: adsorption constants, essential amino acids and the effect of ionic strength

    DEFF Research Database (Denmark)

    Fedosov, Sergey; Belousova, Lubov; Plesner, Igor

    1993-01-01

    of mitCK adsorption capacity by another method at pH 7.4, when the enzyme is almost protonated, gave View the MathML source. The effect of ionic strength on mitCK adsorption may be described in terms of Debye-Hückel's theory for activity coefficients assuming the charges of the interacting species......The quantitative aspects of mitochondrial creatinekinase (mitCK) binding to mitochondrial membranes were investigated. A simple adsorption and binding model was used for data fitting, taking into account the influence of protein concentration, pH, ionic strength and substrate concentration...... on the enzyme adsorption. An analysis of our own data as well as of the data from the literature is consistent with the adsorption site of the octameric mitCK being composed of 4 amino acid residues with pK = 8.8 in the free enzyme. The pK value changes to 9.8 upon binding of the protein to the membrane. Lysine...

  12. HypCal, a general-purpose computer program for the determination of standard reaction enthalpy and binding constant values by means of calorimetry.

    Science.gov (United States)

    Arena, Giuseppe; Gans, Peter; Sgarlata, Carmelo

    2016-09-01

    The program HypCal has been developed to provide a means for the simultaneous determination, from data obtained by isothermal titration calorimetry, of both standard enthalpy of reaction and binding constant values. The chemical system is defined in terms of species of given stoichiometry rather than in terms of binding models (e.g., independent or cooperative). The program does not impose any limits on the complexity of the chemical systems that can be treated, including competing ligand systems. Many titration curves may be treated simultaneously. HypCal can also be used as a simulation program when designing experiments. The use of the program is illustrated with data obtained with nicotinic acid (niacin, pyridine-3 carboxylic acid). Preliminary experiments were used to establish the rather different titration conditions for the two sets of titration curves that are needed to determine the parameters for protonation of the carboxylate and amine groups.

  13. Fast enantiomeric separation of uniconazole and diniconazole by electrokinetic chromatography using an anionic cyclodextrin: application to the determination of analyte-selector apparent binding constants for enantiomers.

    Science.gov (United States)

    Martín-Biosca, Y; García-Ruiz, C; Marina, M L

    2000-09-01

    The enantiomeric resolution of the fungicides uniconazole and diniconazole was performed using electrokinetic chromatography with cyclodextrins as pseudostationary phase (CD-EKC). A systematic evaluation of several chiral selectors was made. The anionic derivative carboxymethylated-gamma-cyclodextrin (CM-gamma-CD) was found to be the most appropriate for the enantioseparation of fungicides among all cyclodextrins tested. The influence of some experimental conditions such as nature and buffer pH, chiral selector concentration, and temperature on the enantiomeric separation of the compounds studied was also investigated. The use of a 50 mM phosphate buffer (pH 6.5) containing 5 mM CM-gamma-CD and a temperature of 50 degrees C enabled the baseline enantioresolution of mixtures of uniconazole and diniconazole in less than 5 min. In addition, apparent binding constants for each enantiomer-CM-gamma-CD pair at several temperatures, as well as thermodynamic parameters for binding were calculated.

  14. Isothermal titration calorimetry for drug design: Precision of the enthalpy and binding constant measurements and comparison of the instruments.

    Science.gov (United States)

    Linkuvienė, Vaida; Krainer, Georg; Chen, Wen-Yih; Matulis, Daumantas

    2016-12-15

    Isothermal titration calorimetry (ITC) is one of the most robust label- and immobilization-free techniques used to measure protein - small molecule interactions in drug design for the simultaneous determination of the binding affinity (ΔG) and the enthalpy (ΔH), both of which are important parameters for structure-thermodynamics correlations. It is important to evaluate the precision of the method and of various ITC instrument models by performing a single well-characterized reaction. The binding between carbonic anhydrase II and acetazolamide was measured by four ITC instruments - PEAQ-ITC, iTC200, VP-ITC, and MCS-ITC and the standard deviation of ΔG and ΔH was determined. Furthermore, the limit of an approach to reduce the protein concentration was studied for a high-affinity reaction (K d  = 0.3 nM), too tight to be measured by direct (non-displacement) ITC. Chemical validation of the enthalpy measurements is discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. The effect of dielectric constant on binding energy and impurity self-polarization in a GaAs-Ga1- x Al x As spherical quantum dot

    Science.gov (United States)

    Mese, A. I.; Cicek, E.; Erdogan, I.; Akankan, O.; Akbas, H.

    2017-03-01

    The ground state, 1s, and the excited state, 2p, energies of a hydrogenic impurity in a GaAs-Ga1- x Al x As spherical quantum dot, are computed as a function of the donor positions. We study how the impurity self-polarization depends on the location of the impurity and the dielectric constant. The excited state anomalous impurity self-polarization in the quantum dot is found to be present in the absence of any external influence and strongly depends on the impurity position and the radius of the dot. Therefore, the excited state anomalous impurity self-polarization can give information about the impurity position in the system. Also, the variation of E_{b1s} and E_{b2p} with the dielectric constant can be utilized as a tool for finding out the correct dielectric constant of the dot material by measuring the 1s or 2p state binding energy for a fixed dot radius and a fixed impurity position.

  16. Simultaneous quantitation of 5- and 7-hydroxyflavone antioxidants and their binding constants with BSA using dual chiral capillary electrophoresis (dCCE) and HPLC with fluorescent detection.

    Science.gov (United States)

    Abo Markeb, Ahmad; Abo El-Maali, Nagwa

    2014-02-01

    In this article we present two novel uses of the sensitive techniques HPLC fluorescence and dCCE for both the quantitation and binding studies of the 5- and 7-HFs extracted from the plant Alfalfa with Albumin. Ultrasonic extraction method as an extra energy source is used to enhance the extraction efficiency and speed up. The two antioxidants could be easily separated and quantified after a 10.0-min run time. Multiple calibration curves for their analysis exhibited consistent linearity and reproducibility in the range of 0.20-2.00 mg L(-1) for 5-HF (r >0.9979) and 0.01-0.10 mg L(-1) for 7-HF (r >0.9999). Limits of Detection were 0.500 µg L(-1) and 0.025 µg L(-1) for 5-HF and 7-HF respectively. Lower Limits of Quantification were 131.600 µg L(-1) for 5-HF and 6.579 µg L(-1) for 7-HF. Inter-assay imprecision was <10% for both flavones. Mean recovery was 104.76% (range 90%-110%) for 5-HF and 93.18% (range 90%-110%) for 7-HF. Since the intermolecular hydrogen atom transfer in the excited triplet state as well as in the excited singlet state might play an important role in the quenching process of photo-excited molecules in biological systems, the binding constants of these HFs with serum albumin have been also estimated to be 1.910 - 2.019 × 10(5) L mol(-1) and 2.390 - 2.500 × 10(5) L mol(-1) for 5-HF and 7-HF respectively. © 2013 Elsevier B.V. All rights reserved.

  17. Study of isomeric pentacyclic triterpene acids in traditional Chinese medicine of Forsythiae Fructus and their binding constants with β-cyclodextrin by capillary electrophoresis.

    Science.gov (United States)

    Ren, Tingjun; Xu, Zhongqi

    2018-01-05

    In this study, a capillary zone electrophoresis (CZE) method was first developed to identify three microconstituents of isomeric pentacyclic triterpene acids (PTAs including oleanolic acid (OA), ursolic acid (UA) and betulinic acid (BA)) in Forsythiae Fructus (FF). The baseline separation of PTAs by CZE were eventually achieved in a background electrolyte (BGE) containing 50.0 mmol/L borax and 0.5 mmol/L β-cyclodextrin (β-CD) at pH 9.5 within 13.0 min. Herein, it was not only the compositions of BGE were detail investigated for rapid and good separation, but also the binding ratio and the equilibrium constants (K) for OA, UA and BA with β-CD was estimated by double reciprocal equation to well understand the separation mechanism. The proposed method allowed the LODs of PTAs were averaged at 1.50 μg/mL with UV detection (at 200 nm). The interday RSD of migration time and peak area were around 2.0 and 4.7% (n = 5), respectively. Thus, the content of PTAs in 19 FF real samples distinguished from maturation stages and geographical areas in China was quantified with the proposed method. Depending on the amount of each PTA in FF, it was demonstrated these microconstituents might benefit to identify their harvested time even qualities. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. An advanced KB mirror pair for microfocusing

    CERN Document Server

    Ferme, J J

    2001-01-01

    A new range of micro-focusing mirrors based on KB pairs has been developed by SESO for Beamline Nanospectroscopy at the Elettra Storage Ring in Trieste, Italy. Both the focusing and the aspheric shape are adjustable with stepper motors. The goal of the beamline is to have a high photon density spot with a variable size in the experimental chamber over the whole soft X-ray range. The estimated dimension of the final spot should be smaller than 4 mu m sup 2 FWHM, with a photon density of the order of 10 sup 1 sup 3 photons/s mu m sup 2; this may be achieved only by accepting an angular divergence on these mirrors of between 5 and 10 mrad. This condition can be fulfilled only with elliptical (or plane elliptical) mirrors with very limited residual slope errors (below 1 mu rad RMS) that are able to correct even small focal distance errors.

  19. Integrating a Smartphone and Molecular Modeling for Determining the Binding Constant and Stoichiometry Ratio of the Iron(II)-Phenanthroline Complex: An Activity for Analytical and Physical Chemistry Laboratories

    Science.gov (United States)

    de Morais, Camilo de L. M.; Silva, Se´rgio R. B.; Vieira, Davi S.; Lima, Ka´ssio M. G.

    2016-01-01

    The binding constant and stoichiometry ratio for the formation of iron(II)-(1,10-phenanthroline) or iron(II)-o-phenanthroline complexes has been determined by a combination of a low-cost analytical method using a smartphone and a molecular modeling method as a laboratory experiment designed for analytical and physical chemistry courses. Intensity…

  20. Identification and characterization of survivin-derived H-2Kb-restricted CTL epitopes

    DEFF Research Database (Denmark)

    Hofmann, Uta B; Voigt, Heike; Andersen, Mads H

    2009-01-01

    for potential binding K(b)-restricted octamer peptide epitopes. Two epitopes, which bind strongly to K(b), were selected to test their immunogenicity in vivo. Spleen cells from mice vaccinated by intradermal injection of mature DC pulsed with these peptides displayed reactivity to the respective epitopes...... in subcutaneous tumors revealed that survivin-specific vaccination significantly reduced the number of intratumoral vessels. In summary, we demonstrated the immunogenicity of two K(b)-restricted peptide epitopes derived from the murine survivin protein; moreover, survivin-specific vaccination not only resulted...

  1. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 1 to 56. (A.L.B.)

  2. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    2000-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  3. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1998-01-01

    This paper is made of two tables. The first table describes the different particles (bosons and fermions) while the second one gives the nuclear constants of isotopes from the different elements with Z = 1 to 25. (J.S.)

  4. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  5. DNA binding studies of tartrazine food additive.

    Science.gov (United States)

    Kashanian, Soheila; Zeidali, Sahar Heidary

    2011-07-01

    The interaction of native calf thymus DNA with tartrazine in 10 mM Tris-HCl aqueous solution at neutral pH 7.4 was investigated. Tartrazine is a nitrous derivative and may cause allergic reactions, with a potential of toxicological risk. Also, tartrazine induces oxidative stress and DNA damage. Its DNA binding properties were studied by UV-vis and circular dichroism spectra, competitive binding with Hoechst 33258, and viscosity measurements. Tartrazine molecules bind to DNA via groove mode as illustrated by hyperchromism in the UV absorption band of tartrazine, decrease in Hoechst-DNA solution fluorescence, unchanged viscosity of DNA, and conformational changes such as conversion from B-like to C-like in the circular dichroism spectra of DNA. The binding constants (K(b)) of DNA with tartrazine were calculated at different temperatures. Enthalpy and entropy changes were calculated to be +37 and +213 kJ mol(-1), respectively, according to the Van't Hoff equation, which indicated that the reaction is predominantly entropically driven. Also, tartrazine does not cleave plasmid DNA. Tartrazine interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 3.75 × 10(4) M(-1).

  6. Measurement of the Dissociation-Equilibrium Constants for Low Affinity Antibiotic Binding Interaction with Bacterial Ribosomes by the T2 (CPMG) and Line-Broadening Methods

    Science.gov (United States)

    Verdier, L.; Gharbi-Benarous, J.; Bertho, G.; Mauvais, P.; Girault, J.-P.

    1999-10-01

    In this study the dissociation constants of the low antibiotic-ribosomes interaction were determined by the T2 (CPMG), the Carr-Purcell-Meiboom-Gill spin-echo decay rate and the line-broadening methods. Three MLSB antibiotics were studied, a macrolide roxithromycin, a ketolide HMR 3647 and a lincosamide clindamycin for their weak interaction with three bacterial ribosomes, E. coli, Staphylococcus aureus sensitive and resistant to erythromycin. Nous avons mesuré la constante de dissociation, Kd correspondant à l'interaction faible antibiotique-ribosome bactérien pour des antibiotiques de différentes classes, un macrolide (roxithromycine), un kétolide (HMR 3647) et une lincosamide (clindamycine) avec des ribosomes de différentes souches bactériennes (E. coli, Staphylococcus aureus sensible ou résistant à l'erythromycin) par deux méthodes : l'une basée sur la variation des largeurs de raies et l'autre sur les temps de relaxation transversaux T2 en utilisant une séquence CPMG.

  7. Cosmological constant as integration constant

    Science.gov (United States)

    Treder, H.-J.

    1994-08-01

    Einstein's field theory of elementary particles (Einstein 1919) yields black holes with a mass M approximately G-1 Lambda-1/2 c2 and a charge Q approximately G-1/2 Lambda-1/2 c2, their curvature radius is Lambda-1/2. Here Lambda is an integration constant of Einstein's 'trace-less' gravitation equations. The choice Lambda = G-1 h-1 c3 for this constant defines Planck ions and implies 'strong-gravity'. The choice Lambda = lambda = 3Hinf exp 2 c-2 (where Hinf means the Hubble parameter of a final de Sitter cosmos) involves 'weak-gravity' and describes an electro-vac spherical universe.

  8. The KB WOT Fisheries Programme carried out in 2015

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is established to maintain and develop the expertise needed to carry out the statutory obligations of the Netherlands in fisheries monitoring and advice. It is also a flexible program which responds to changes over time in WOT requirements, fisheries management and

  9. Mapping autonomously replicating sequence elements in a 73-kb ...

    Indian Academy of Sciences (India)

    Autonomously replicating sequence (ARS) elements are the genetic determinants of replication origin function in yeasts. They can be easily identified as the plasmids containing them transform yeast cells at a high frequency. As the first step towards identifying all potential replication origins in a 73-kb region of the long arm ...

  10. Synthesis, spectral, dna binding and cleavage properties of ruthenium(II Schiff base complexes containing PPh3/AsPh3 as co-ligands

    Directory of Open Access Journals (Sweden)

    Sathiyaraj Subbaiyan

    2014-01-01

    Full Text Available A dihydroxybenzaldehyde Schiff base ligands (L1-L3 and its ruthenium(II complexes, have been synthesized and characterized on the basis of elemental analysis, 1H, 13C, 31P NMR, mass spectra, UV-vis and IR spectra. The binding of ruthenium(II complexes have been investigated by UV-vis absorption spectroscopy. The experiment reveals that all the compounds can bind to DNA through an electrostatic mode and intrinsic binding constant (Kb has been estimated under similar set of experimental conditions. Absorption spectral study indicate that the ruthenium(II complexes has intrinsic binding constant in the range of 1.6-8.6 X 104 M-1. The complex [Ru(CO(PPh32(L3] bind more strongly than that of the other complexes. In addition, DNA cleavage property were tested for all ruthenium(II complexes.

  11. Sequence of the dog immunoglobulin alpha and epsilon constant region genes

    Energy Technology Data Exchange (ETDEWEB)

    Patel, M.; Selinger, D.; Mark, G.E.; Hollis, G.F.; Hickey, G.J. [Merck Research Labs., Rathway, NJ (United States)

    1995-03-01

    The immunoglobulin alpha (IGHAC) and epsilon (IGHEC) germline constant region genes were isolated from a dog liver genomic DNA library. Sequence analysis indicates that the dog IGHEC gene is encoded by four exons spread out over 1.7 kilobases (kb). The IGHAC sequence encompasses 1.5 kb and includes all three constant region coding exons. The complete exon/intron sequence of these genes is described. 28 refs., 2 figs., 2 tabs.

  12. The simplest possible design for a KB microfocus mirror system?

    Energy Technology Data Exchange (ETDEWEB)

    Collins, S. P., E-mail: steve.collins@diamond.ac.uk; Scott, S. M.; Hawkins, D. M.; Fabrizi, F.; Moser, B.; Nisbet, G.; Sutter, J. P. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Harwin, R. C. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Department of Physics, Cavendish Laboratory, JJ Thomson Avenue, Cambridge, CB3 0HE (United Kingdom); Harwin, W. S. [School of Systems Engineering, University of Reading, Whiteknights, Reading, Berkshire, RG6 6AH (United Kingdom)

    2016-07-27

    We report a design for a Kirkpatrick-Baez (KB) microfocussing mirror system. The main components are described, with emphasis on a ‘tripod’ manipulator, where we outline the required coordinate transformation calculations. The merit of this device lies in its simplicity of design, minimal degrees of freedom, and speed and ease of setup on a beamline. Test results and an example of the mirrors in use on Diamond Beamline I16, showing a high-resolution polar domain map of KTiOPO{sub 4} with a spot size of 1.25 µm × 1.5 µm, are presented.

  13. Sakharov at KB-11. The path of a genius

    International Nuclear Information System (INIS)

    Ilkaev, Radii I

    2012-01-01

    21 May 2011 would have marked the 90th birthday of Andrei Dmitrievich Sakharov, a towering 20th-century figure in science and human thought, whose ideas, research contributions, and life example exerted enormous influence on the history of the second half of the 20th century and, in particular, on the history of Russia. Whether as a scientist or a private person (including his public activities and exceptional attitude to human personality), he always displayed creativity and a freedom of spirit, thought, and action. Sakharov's life and creative work make him a model scientist and citizen for many and undoubtedly provide a legacy for the development of science and society in the 21st century. In this paper, some of Sakharov's key ideas and achievements relating to his KB-11 period are exemplified, and how they influence present day research and technology, notably as employed for affording national security, is examined. (conferences and symposia)

  14. HINT-KB: The human interactome knowledge base

    KAUST Repository

    Theofilatos, Konstantinos A.

    2012-01-01

    Proteins and their interactions are considered to play a significant role in many cellular processes. The identification of Protein-Protein interactions (PPIs) in human is an open research area. Many Databases, which contain information about experimentally and computationally detected human PPIs as well as their corresponding annotation data, have been developed. However, these databases contain many false positive interactions, are partial and only a few of them incorporate data from various sources. To overcome these limitations, we have developed HINT-KB (http://150.140.142.24:84/Default.aspx) which is a knowledge base that integrates data from various sources, provides a user-friendly interface for their retrieval, estimates a set of features of interest and computes a confidence score for every candidate protein interaction using a modern computational hybrid methodology. © 2012 IFIP International Federation for Information Processing.

  15. KB WOT Fisheries 2015 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2015-01-01

    The KB WOT Fisheries programme is essential to the maintenance and development of the expertise which are needed for the Dutch statutory obligations in fisheries monitoring and advice. The contents of the KB WOT Fisheries programme for 2015 reflects the needs of the research developments the WOT

  16. KB WOT Fisheries 2014 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2013-01-01

    The KB WOT Fisheries programme is fundamental to the maintenance and development of expertise needed to carry out the statutory obligations of the Dutch WOT Fisheries monitoring and advice. The structure of the KB WOT Fisheries programme 2014 is a result of discussions on the research direction and

  17. KB WOT Fisheries 2018: maintaining excellence and innovation in fisheries research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is developed to maintain and develop expertise needed to carry out the Dutch statutory obligations in fisheries monitoring and advice. The KB WOT Fisheries programme developed for 2018 reflects the scientific and management needs of the WOT fisheries programme. The

  18. Collateral sensitivity to cisplatin in KB-8-5-11 drug-resistant cancer cells.

    LENUS (Irish Health Repository)

    Doherty, Ben

    2014-01-01

    KB-8-5-11 cells are a drug-resistant cervical cell model that overexpresses ABCB1 (P-glycoprotein). KB-8-5-11 has become sensitive to non-ABCB1 substrate cisplatin. Understanding the mechanism of collateral sensitivity to cisplatin may lead to biomarker discovery for platinum sensitivity in patients with cancer.

  19. DNA- and BSA-binding studies and anticancer activity against human breast cancer cells (MCF-7) of the zinc(II) complex coordinated by 5,6-diphenyl-3-(2-pyridyl)-1,2,4-triazine.

    Science.gov (United States)

    Anjomshoa, Marzieh; Fatemi, Seyed Jamilaldin; Torkzadeh-Mahani, Masoud; Hadadzadeh, Hassan

    2014-06-05

    Binding studies of a mononuclear zinc(II) complex, [Zn(dppt)2Cl2] (dppt is 5,6-diphenyl-3-(2-pyridyl)-1,2,4-triazine), with DNA and bovine serum albumin (BSA) have been investigated under physiological conditions. The binding properties of the complex with fish sperm DNA (FS-DNA) have been investigated by UV-Vis absorption, thermal denaturation, competitive DNA-binding studies with ethidium bromide (EB) by fluorescence, and gel electrophoresis techniques. The competitive study with (EB) shows that the complex can displace EB from the DNA-EB system and compete for the DNA-binding sites with EB, which is usually characteristic of the intercalative interaction of compounds with DNA. The value of the fluorescence quenching constant (Ksv) was obtained as 3.1×10(4)M(-1), indicating that this complex shows a high quenching efficiency and a significant degree of binding to DNA. Moreover, the intercalative binding mode has also been verified by the results of UV-Vis absorption, thermal denaturation and gel electrophoresis. The value of Kb at room temperature was calculated to be 1.97×10(5)M(-1), indicating that the complex possesses strong tendency to bind with DNA. This value is very greater than to the values obtained for other zinc(II) complexes. The interaction of the complex with BSA has been studied by UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopic techniques. The results indicate that the complex has a quite strong ability to quench the fluorescence of BSA and the binding reaction is mainly a static quenching process. The quenching constants (KSV), the binding constants (Kb), the number of binding sites at different temperatures, the binding distance between BSA and the complex (r), and the thermodynamic parameters (ΔH(o), ΔS(o) and ΔG(o)) between BSA and the complex were calculated. The complex exhibits good binding propensity to BSA showing relatively high binding constant values. The positive ΔH(o) and ΔS(o) values indicate that

  20. Ion exchange equilibrium constants

    CERN Document Server

    Marcus, Y

    2013-01-01

    Ion Exchange Equilibrium Constants focuses on the test-compilation of equilibrium constants for ion exchange reactions. The book first underscores the scope of the compilation, equilibrium constants, symbols used, and arrangement of the table. The manuscript then presents the table of equilibrium constants, including polystyrene sulfonate cation exchanger, polyacrylate cation exchanger, polymethacrylate cation exchanger, polysterene phosphate cation exchanger, and zirconium phosphate cation exchanger. The text highlights zirconium oxide anion exchanger, zeolite type 13Y cation exchanger, and

  1. Complete physical map of the human immunoglobulin heavy chain constant region gene complex

    International Nuclear Information System (INIS)

    Hofker, M.H.; Walter, M.A.; Cox, D.W.

    1989-01-01

    The authors have found by pulsed-field gel electrophoresis that the human immunoglobulin heavy chain constant region gene complex maps entirely to a 350-kilobase (kb) Mlu I fragment. The enzyme Eag I was used with pulsed-field gel electrophoresis alone and in double digests with Spe I to map the region. C γ 3 maps 60 kb to the 3' side of C δ ; Cγ2 maps 80 kb to the 3' side of C α 1. C ψγ maps 35 kb to the 3' side of C α 1 and is in the same transcriptional orientation as the other genes. Although in the cloned DNA many CpG-containing restriction sites were identified, most of these were methylated in peripheral blood leukocytes. The sites that were not methylated were predominantly found in three clusters, or Hpa I tiny fragment islands. A region showing strong linkage disequilibrium between all C γ genes spans at least 160 kb. The 70-kb C μ -C γ 3 region, however, shows no linkage disequilibrium, possibly indicating a recombination hot spot. The immunoglobulin heavy chain constant region has been almost entirely cloned and mapped, and thus most rearrangements occurring in this region should be detectable

  2. KB425796-A, a novel antifungal antibiotic produced by Paenibacillus sp. 530603.

    Science.gov (United States)

    Kai, Hirohito; Yamashita, Midori; Takase, Shigehiro; Hashimoto, Michizane; Muramatsu, Hideyuki; Nakamura, Ikuko; Yoshikawa, Koji; Ezaki, Masami; Nitta, Kumiko; Watanabe, Masato; Inamura, Noriaki; Fujie, Akihiko

    2013-08-01

    The novel antifungal macrocyclic lipopeptidolactone, KB425796-A (1), was isolated from the fermentation broth of bacterial strain 530603, which was identified as a new Paenibacillus species based on morphological and physiological characteristics, and 16S rRNA sequences. KB425796-A (1) was isolated as white powder by solvent extraction, HP-20 and ODS-B column chromatography, and lyophilization, and was determined to have the molecular formula C79H115N19O18. KB425796-A (1) showed antifungal activities against Aspergillus fumigatus and the micafungin-resistant infectious fungi Trichosporon asahii, Rhizopus oryzae, Pseudallescheria boydii and Cryptococcus neoformans.

  3. Theoretical Calculation of the NMR Spin-Spin Coupling Constants and the NMR Shifts Allow Distinguishability between the Specific Direct and the Water-Mediated Binding of a Divalent Metal Cation to Guanine

    Czech Academy of Sciences Publication Activity Database

    Sychrovský, Vladimír; Šponer, Jiří; Hobza, Pavel

    2004-01-01

    Roč. 126, č. 2 (2004), s. 663-672 ISSN 0002-7863 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : nuclear-magnetic-resonance * ion binding * base-pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.903, year: 2004

  4. Binding behaviors of greenly synthesized silver nanoparticles - Lysozyme interaction: Spectroscopic approach

    Science.gov (United States)

    Roy, Swarup

    2018-02-01

    Interaction of greenly synthesized silver nanoparticles (SNP) and lysozyme (Lys) has been studied using spectroscopy. From UV-Vis study it is observed that a moderate association constant (Kapp) of 5.36 × 104 L/mol giving an indication of interaction. Fluorescence emission and time resolved study, confirm static mode of quenching phenomena and the binding constant (Kb) was 25.12, 3.98 and 1.99 × 103 L/mol at 298, 305 and 312 K respectively and the number of binding sites (n) was found to be ∼1. Using temperature dependent fluorimetric data, thermodynamic parameters calculated (Enthalpy change, ΔH = -143.95 kJ/mol, Entropy change, ΔS = -400.32 J/mol/K, Gibbs free energy change, ΔG = -24.66 kJ/mol at 298 K) and resulting insight indicative of weak force (van der Walls interaction & H-bonding) as key feature for the Lys-SNP interaction. By following Förster's non-radiative energy transfer (FRET) theory, average binding distance (r = 3.05 nm) was calculated and observed that nonradiative type energy transfer between SNP and Lys. What is more, circular dichroism (CD) spectra indicates presence of SNP does not display substantial alteration in the secondary structure of Lys. Hence, this results may be very useful for the well thought of essential aspects of binding between the Lys and SNP.

  5. Analysis of employee benefits in Factoring KB, a.s.v

    OpenAIRE

    Vachoušek, Stanislav

    2011-01-01

    The main objective of this work is to analyze employee benefits - benefits of Factoring KB, a.s. The theoretical part of the generally specifies the basic concepts related to employee benefits needed to cope with the analytical part. The content of this section is primarily a system of employee benefits, classification of employee benefits, tax savings and marginally trends in providing benefits. The analytical part is devoted exclusively to Factoring KB, there is an analysis of employee bene...

  6. The UniProtKB/Swiss-Prot knowledgebase and its Plant Proteome Annotation Program.

    Science.gov (United States)

    Schneider, Michel; Lane, Lydie; Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Bougueleret, Lydie; Bairoch, Amos

    2009-04-13

    The UniProt knowledgebase, UniProtKB, is the main product of the UniProt consortium. It consists of two sections, UniProtKB/Swiss-Prot, the manually curated section, and UniProtKB/TrEMBL, the computer translation of the EMBL/GenBank/DDBJ nucleotide sequence database. Taken together, these two sections cover all the proteins characterized or inferred from all publicly available nucleotide sequences. The Plant Proteome Annotation Program (PPAP) of UniProtKB/Swiss-Prot focuses on the manual annotation of plant-specific proteins and protein families. Our major effort is currently directed towards the two model plants Arabidopsis thaliana and Oryza sativa. In UniProtKB/Swiss-Prot, redundancy is minimized by merging all data from different sources in a single entry. The proposed protein sequence is frequently modified after comparison with ESTs, full length transcripts or homologous proteins from other species. The information present in manually curated entries allows the reconstruction of all described isoforms. The annotation also includes proteomics data such as PTM and protein identification MS experimental results. UniProtKB and the other products of the UniProt consortium are accessible online at www.uniprot.org.

  7. FragKB: structural and literature annotation resource of conserved peptide fragments and residues.

    Directory of Open Access Journals (Sweden)

    Ashish V Tendulkar

    Full Text Available BACKGROUND: FragKB (Fragment Knowledgebase is a repository of clusters of structurally similar fragments from proteins. Fragments are annotated with information at the level of sequence, structure and function, integrating biological descriptions derived from multiple existing resources and text mining. METHODOLOGY: FragKB contains approximately 400,000 conserved fragments from 4,800 representative proteins from PDB. Literature annotations are extracted from more than 1,700 articles and are available for over 12,000 fragments. The underlying systematic annotation workflow of FragKB ensures efficient update and maintenance of this database. The information in FragKB can be accessed through a web interface that facilitates sequence and structural visualization of fragments together with known literature information on the consequences of specific residue mutations and functional annotations of proteins and fragment clusters. FragKB is accessible online at http://ubio.bioinfo.cnio.es/biotools/fragkb/. SIGNIFICANCE: The information presented in FragKB can be used for modeling protein structures, for designing novel proteins and for functional characterization of related fragments. The current release is focused on functional characterization of proteins through inspection of conservation of the fragments.

  8. The Fine Structure Constant

    Indian Academy of Sciences (India)

    IAS Admin

    The article discusses the importance of the fine structure constant in quantum mechanics, along with the brief history of how it emerged. Al- though Sommerfelds idea of elliptical orbits has been replaced by wave mechanics, the fine struc- ture constant he introduced has remained as an important parameter in the field of ...

  9. The Cosmological Constant

    Directory of Open Access Journals (Sweden)

    Carroll Sean M.

    2001-01-01

    Full Text Available This is a review of the physics and cosmology of the cosmological constant. Focusing on recent developments, I present a pedagogical overview of cosmology in the presence of a cosmological constant, observational constraints on its magnitude, and the physics of a small (and potentially nonzero vacuum energy.

  10. On Aryabhata's Planetary Constants

    OpenAIRE

    Kak, Subhash

    2001-01-01

    This paper examines the theory of a Babylonian origin of Aryabhata's planetary constants. It shows that Aryabhata's basic constant is closer to the Indian counterpart than to the Babylonian one. Sketching connections between Aryabhata's framework and earlier Indic astronomical ideas on yugas and cyclic calendar systems, it is argued that Aryabhata's system is an outgrowth of an earlier Indic tradition.

  11. A structural basis for LCMV immune evasion: subversion of H-2D(b) and H-2K(b) presentation of gp33 revealed by comparative crystal structure.Analyses.

    Science.gov (United States)

    Achour, Adnane; Michaëlsson, Jakob; Harris, Robert A; Odeberg, Jacob; Grufman, Per; Sandberg, Johan K; Levitsky, Victor; Kärre, Klas; Sandalova, Tatyana; Schneider, Gunter

    2002-12-01

    LCMV infection of H-2(b) mice generates a CD8(+) CTL response mainly directed toward three immunodominant epitopes. One of these, gp33, is presented by both H-2D(b) and H-2K(b) MHC class I molecules. The virus can escape immune recognition in the context of both these MHC class I molecules through single mutations of the peptide. In order to understand the underlying structural mechanism, we determined the crystal structures of both complexes. The structures reveal that the peptide is presented in two diametrically opposed manners by H-2D(b) and H-2K(b), with residues used as anchor positions in one MHC class I molecule interacting with the TCR in the other. Importantly, the peptide's N-terminal residue p1K protrudes from the binding cleft in H-2K(b). We present structural evidence that explains the functional consequences of single mutations found in escape variants.

  12. Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA

    Science.gov (United States)

    Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

    2018-03-01

    DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH analysis, viscosity measurements and molecular docking.

  13. Binding affinities of Schiff base Fe(II) complex with BSA and calf-thymus DNA: Spectroscopic investigations and molecular docking analysis.

    Science.gov (United States)

    Rudra, Suparna; Dasmandal, Somnath; Patra, Chiranjit; Kundu, Arjama; Mahapatra, Ambikesh

    2016-09-05

    The binding interaction of a synthesized Schiff base Fe(II) complex with biological macromolecules viz., bovine serum albumin (BSA) and calf thymus(ct)-DNA have been investigated using different spectroscopic techniques coupled with viscosity measurements at physiological pH and 298K. Regular amendments in emission intensities of BSA upon the action of the complex indicate significant interaction between them, and the binding interaction have been characterized by Stern Volmer plots and thermodynamic binding parameters. On the basis of this quenching technique one binding site with binding constant (Kb=(7.6±0.21)×10(5)) between complex and protein have been obtained at 298K. Time-resolved fluorescence studies have also been encountered to understand the mechanism of quenching induced by the complex. Binding affinities of the complex to the fluorophores of BSA namely tryptophan (Trp) and tyrosine (Tyr) have been judged by synchronous fluorescence studies. Secondary structural changes of BSA rooted by the complex has been revealed by CD spectra. On the other hand, hypochromicity of absorption spectra of the complex with the addition of ct-DNA and the gradual reduction in emission intensities of ethidium bromide bound ct-DNA in presence of the complex indicate noticeable interaction between ct-DNA and the complex with the binding constant (4.2±0.11)×10(6)M(-1). Life-time measurements have been studied to determine the relative amplitude of binding of the complex to ct-DNA base pairs. Mode of binding interaction of the complex with ct-DNA has been deciphered by viscosity measurements. CD spectra have also been used to understand the changes in ct-DNA structure upon binding with the metal complex. Density functional theory (DFT) and molecular docking analysis have been employed in highlighting the interactive phenomenon and binding location of the complex with the macromolecules. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. A spectroscopic and molecular docking approach on the binding of tinzaparin sodium with human serum albumin

    Science.gov (United States)

    Abdullah, Saleh M. S.; Fatma, Sana; Rabbani, Gulam; Ashraf, Jalaluddin M.

    2017-01-01

    Protein bound toxins are poorly removed by conventional extracorporeal therapies. Venous thromboembolism (VTE) is a major cause of morbidity and mortality in patients with cancer. The interaction between tinzaparin, an inhibitor of angiotensin converting enzyme and human serum albumin, a principal plasma protein in the liver has been investigated in vitro under a simulated physiological condition by UV-vis spectrophotometry and fluorescence spectrometry. The intrinsic fluorescence intensity of human serum albumin was strongly quenched by tinzaparin (TP). The binding constants and binding stoichiometry can be calculated from the data obtained from fluorescence quenching experiments. The negative value of ΔG° reveals that the binding process is a spontaneous process. Thermodynamic analysis shows that the HSA-TP complex formation occurs via hydrogen bonds, hydrophobic interactions and undergoes slight structural changes as evident by far-UV CD. It indicated that the hydrophobic interactions play a main role in the binding of TP to human serum albumin. In addition, the distance between TP (acceptor) and tryptophan residues of human serum albumin (donor) was estimated to be 2.21 nm according to the Förster's resonance energy transfer theory. For the deeper understanding of the interaction, thermodynamic, and molecular docking studies were performed as well. Our docking results suggest that TP forms stable complex with HSA (Kb ∼ 104) and its primary binding site is located in subdomain IIA (Sudlow Site I). The results obtained herein will be of biological significance in pharmacology and clinical medicine.

  15. DNA binding, DNA cleavage and cytotoxicity studies of a new water soluble copper(II) complex: the effect of ligand shape on the mode of binding.

    Science.gov (United States)

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Roshanfekr, Hamideh; Shahabadi, Nahid; Mansouri, Ghobad

    2012-02-01

    The interaction of native calf thymus DNA (CT-DNA) with [Cu(ph(2)phen)(phen-dione)Cl]Cl was studied at physiological pH by spectrophotometric, spectrofluorometric, circular dichroism, and viscometric techniques. Considerable hypochromicity and red shift are observed in the UV absorption band of the Cu complex. Binding constants (K(b)) of DNA with the complex were calculated at different temperatures. Thermodynamic parameters, enthalpy and entropy changes were calculated according to Van't Hoff equation, which indicated that reaction is predominantly enthalpically driven. All these results indicate that Cu(II) complex interacts with CT-DNA via intercalative mode. Also, this new complex induced cleavage in pUC18 plasmid DNA as indicated in gel electrophoresis and showed excellent antitumor activity against K562 (human chronic myeloid leukemia) and human T lymphocyte carcinoma-Jurkat cell lines. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. The cosmological constant problem

    International Nuclear Information System (INIS)

    Dolgov, A.D.

    1989-05-01

    A review of the cosmological term problem is presented. Baby universe model and the compensating field model are discussed. The importance of more accurate data on the Hubble constant and the Universe age is stressed. 18 refs

  17. Deconstructing the Cosmological Constant

    CERN Document Server

    Jejjala, V; Minic, D; Jejjala, Vishnu; Leigh, Robert G.; Minic, Djordje

    2003-01-01

    Deconstruction provides a novel way of dealing with the notoriously difficult ultraviolet problems of four-dimensional gravity. This approach also naturally leads to a new perspective on the holographic principle, tying it to the fundamental requirements of unitarity and diffeomorphism invariance, as well as to a new viewpoint on the cosmological constant problem. The numerical smallness of the cosmological constant is implied by a unique combination of holography and supersymmetry, opening a new window into the fundamental physics of the vacuum.

  18. Effects of ketamine administration on the phosphorylation levels of CREB and TrKB and on oxidative damage after infusion of MEK inhibitor.

    Science.gov (United States)

    Réus, Gislaine Z; Abaleira, Helena M; Titus, Stephanie E; Arent, Camila O; Michels, Monique; da Luz, Jaine R; dos Santos, Maria Augusta B; Carlessi, Anelise S; Matias, Beatriz I; Bruchchen, Livia; Steckert, Amanda V; Ceretta, Luciane B; Dal-Pizzol, Felipe; Quevedo, João

    2016-02-01

    Ketamine, an antagonist of N-methyl-d-aspartate (NMDA) receptors, has presented antidepressant effects in basic and clinical studies. The MAPK kinase (MEK) signaling pathway could be a target for novel antidepressant drugs and an important pathway involved in neuronal plasticity. Thus, this study evaluated the effects of the administration of ketamine on the phosphorylation of TrKB and CREB, and oxidative stress parameters in the prefrontal cortex (PFC), hippocampus, amygdala, and nucleus accumbens (NAc) rats, after the inhibition of MAPK pathway (PD184161). Male adult Wistar rats were submitted to a surgical procedure to receive a single dose of a pharmacological inhibitor of MAPK (PD184161) at a dose of (0.1μg/μl) or vehicle. Then, they were divided: 1) vehicle+saline; 2) inhibitor PD184161+saline; 3) vehicle+ketamine 15mg/kg; and 4) inhibitor PD184161+ketamine 15mg/kg. MEK inhibitor and ketamine increased the phosphorylation of the transcription factor cAMP response element-binding protein (pCREB) and neurotrophic factor/tropomyosin related kinase B receptor (pTrKB) in the PFC, and decreased pCREB in the hippocampus. The MEK inhibitor abolished ketamine's effects in the hippocampus. In the amygdala, pCREB was decreased, and pTrKB was increased after MEK inhibitor plus ketamine. Ketamine increased the thiobarbituric acid reactive species (TBARS) in the PFC, hippocampus, amygdala, and NAc; MEK inhibitor antagonized these effects. The carbonyl was increased in the PFC by both ketamine and MEK inhibitor, but inhibitor infusion plus ketamine administration reduced this effect. In the amygdala, MEK inhibitor increased carbonyl. Ketamine's effects on pCREB, pTrKB, and oxidative stress are mediated, at least in part, by a mechanism dependent of MAPK signaling inhibition. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  19. New mixed ligand palladium(II) complexes based on the antiepileptic drug sodium valproate and bioactive nitrogen-donor ligands: Synthesis, structural characterization, binding interactions with DNA and BSA, in vitro cytotoxicity studies and DFT calculations

    Science.gov (United States)

    Tabrizi, Leila; Chiniforoshan, Hossein; Tavakol, Hossein

    2015-04-01

    The complexes [Pd(valp)2(imidazole)2] (1), [Pd(valp)2(pyrazine)2] (2) (valp is sodium valproate) have been synthesized and characterized using IR, 1H NMR, 13C{1H} NMR and UV-Vis spectrometry. The interaction of complexes with CT-DNA has been investigated using spectroscopic tools and viscosity measurement. In each case, the association constant (Kb) was deduced from the absorption spectral study and the number of binding sites (n) and the binding constant (K) were calculated from relevant fluorescence quenching data. As a result, a non-covalent interaction between the metal complex and DNA was suggested, which could be assigned to an intercalative binding. In addition, the interaction of 1 and 2 was ventured with bovine serum albumin (BSA) with the help of absorption and fluorescence spectroscopy measurements. Through these techniques, the apparent association constant (Kapp) and the binding constant (K) could be calculated for each complex. Evaluation of cytotoxic activity of the complexes against four different cancer cell lines proved that the complexes exhibited cytotoxic specificity and significant cancer cell inhibitory rate. Moreover, density functional theory (DFT) calculations were employed to provide more evidence about the observed data. The majority of trans isomers were supported not only by energies, but also by the similarity of its calculated IR frequencies, UV adsorptions and NMR chemical shifts to the experimental values.

  20. Elastic constants of calcite

    Science.gov (United States)

    Peselnick, L.; Robie, R.A.

    1962-01-01

    The recent measurements of the elastic constants of calcite by Reddy and Subrahmanyam (1960) disagree with the values obtained independently by Voigt (1910) and Bhimasenachar (1945). The present authors, using an ultrasonic pulse technique at 3 Mc and 25??C, determined the elastic constants of calcite using the exact equations governing the wave velocities in the single crystal. The results are C11=13.7, C33=8.11, C44=3.50, C12=4.82, C13=5.68, and C14=-2.00, in units of 1011 dyncm2. Independent checks of several of the elastic constants were made employing other directions and polarizations of the wave velocities. With the exception of C13, these values substantially agree with the data of Voigt and Bhimasenachar. ?? 1962 The American Institute of Physics.

  1. Fundamental physics constants

    International Nuclear Information System (INIS)

    Cohen, E.R.; Taylor, B.N.

    1995-01-01

    Present technological applications require the values used for the fundamental physical and chemical constants to be more and more precise and at the same time coherent. Great importance is then attached to the task of coordinating and comparing the most recent experimental data, extracting from them as a whole, by means of a least square fit, a set of values for the fundamental constants as precise and coherent as possible. The set of values which is at present in usage, derives from a fit performed in 1986, but new experimental results already promise a large reduction in the uncertainties of various constants. A new global fit that will implement such reductions is scheduled for completion in 1995 or 1996

  2. Radiographic constant exposure technique

    DEFF Research Database (Denmark)

    Domanus, Joseph Czeslaw

    1985-01-01

    The constant exposure technique has been applied to assess various industrial radiographic systems. Different X-ray films and radiographic papers of two producers were compared. Special attention was given to fast film and paper used with fluorometallic screens. Radiographic image quality was tes...... was tested by the use of ISO wire IQI's and ASTM penetrameters used on Al and Fe test plates. Relative speed and reduction of kilovoltage obtained with the constant exposure technique were calculated. The advantages of fast radiographic systems are pointed out...

  3. Radiographic constant exposure technique

    DEFF Research Database (Denmark)

    Domanus, Joseph Czeslaw

    1985-01-01

    The constant exposure technique has been applied to assess various industrial radiographic systems. Different X-ray films and radiographic papers of two producers were compared. Special attention was given to fast film and paper used with fluorometallic screens. Radiographic image quality...... was tested by the use of ISO wire IQI's and ASTM penetrameters used on Al and Fe test plates. Relative speed and reduction of kilovoltage obtained with the constant exposure technique were calculated. The advantages of fast radiographic systems are pointed out...

  4. Synthesis, structure characterization, DNA binding, and cleavage properties of mononuclear and tetranuclear cluster of copper(II) complexes.

    Science.gov (United States)

    Vafazadeh, Rasoul; Hasanzade, Naime; Heidari, Mohammad Mehdi; Willis, Anthony C

    2015-01-01

    Two copper(II) complexes, cluster 1, and mononuclear 2, have been synthesized by reacting acetylacetone and benzohydrazide (1:1 ratio for 1 and 1:2 ratio for 2) with CuCl(2) in a methanol solution. In 2, which is a new complex, the ligand acts as a tetradentate which binds the metal ion via two amide-O atoms and two imine-N atoms providing an N(2)O(2) square-planar around the copper(II) ion. The absorption spectra data evidence strongly suggested that the two copper(II) compounds could interact with CT-DNA (intrinsic binding constant, K(b) = 0.45×10(4) M-1 for 1 and K(b) = 2.39×10(4) M-1 for 2). The super coiled plasmid pBR322 DNA cleavage ability was studied with 1 and 2 in the presence and absence of H(2)O(2) as an oxidant. In both the absence and the presence of an oxidizing agent, complex 2 exhibited no nuclease activity. However, even in the absence of an oxidant, complex 1 exhibited significant DNA cleavage activity.

  5. Modulation of proteolytic polyprotein processing by coxsackievirus mutants resistant to inhibitors targeting phosphatidylinositol-4-kinase IIIβ or oxysterol binding protein

    NARCIS (Netherlands)

    Lyoo, Heyrhyoung; Dorobantu, Cristina M; van der Schaar, Hilde M; van Kuppeveld, Frank J M

    2017-01-01

    Enteroviruses (e.g. poliovirus, coxsackievirus, and rhinovirus) require several host factors for genome replication. Among these host factors are phosphatidylinositol-4-kinase IIIβ (PI4KB) and oxysterol binding protein (OSBP). Enterovirus mutants resistant to inhibitors of PI4KB and OSBP were

  6. Experimental and theoretical studies on the DNA-binding of cationic yttrium(III) complex containing 2,2‧-bipyridine

    Science.gov (United States)

    Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Akbari, Alireza; Mirkazehi-Rigi, Sohaila

    2015-03-01

    The interaction of DNA with [Y(bpy)(OH2)6]+3, where bpy is 2,2‧-bipyridine has been studied at physiological pH in Tris-HCl buffer. Fluorescence and absorption spectroscopy, agarose gel electrophoresis as well as EB quenching experiments are used to study DNA binding of the complex. The results reveal that DNA have the strong ability to bind with Y(III) complex. The binding constant, Kb and the Stern-Volmer quenching constant, KSV are determined. For characterization of the binding mode between the Y(III) complex and DNA various procedures such as: iodide quenching assay, salt effect and thermodynamical investigation are used. The results suggest that minor groove binding should be the interaction mode of complex to DNA. A gel electrophoresis assay demonstrates the ability of the complex to cleave the DNA via oxidative pathway. Electronic structure of [Y(bpy)(OH2)6]+3 was also carried out applying the density functional theory (DFT) method and applied to explain some obtained experimental observations.

  7. The Yamabe constant

    International Nuclear Information System (INIS)

    O Murchadha, N.

    1991-01-01

    The set of riemannian three-metrics with positive Yamabe constant defines the space of independent data for the gravitational field. The boundary of this set is investigated, and it is shown that metrics close to the boundary satisfy the positive-energy theorem. (Author) 18 refs

  8. FORMATION CONSTANTS AND THERMODYNAMIC ...

    African Journals Online (AJOL)

    , Ni(II), Cu(II) and Zn(II) ions has been ... A good deal of work has been reported on the preparation and structural investigation of. Schiff base ... Formation constants and thermodynamic parameters of Co, Ni, Cu and Zn complexes. Bull. Chem.

  9. Study on the effect of paclitaxel nanostructure lipid carrier cooperated with radiation on the KB Cells

    International Nuclear Information System (INIS)

    Liu Min; Li Zhihui; Xu Yujie

    2011-01-01

    Objective: To investigate the cytotoxicity effect of paclitaxel nanostructure lipid carrier (TAX-NLC) cooperated with radiation treatment on the KB cells. Methods: The cytotoxicity effect of TAX-NLC compared with free paclitaxel (TAX) on the KB cells was measured by MTT assay, and the cell cycle distribution was analyzed by flow cytometry. Results: The cytotoxicity effect of TAX-NLC was stronger than that of the free TAX. And the cooperative effect between the TAX-NLC and ionized radiation were observed, the cooperative effect of TAX-NLC was stronger than that of the free TAX. Flow cytometric analysis indicated that the rearrangement of cell cycle in KB cells were induced by TAX-NLC. The more G2/M phase cells were observed in KB cells treated by TAX-NLC compared with free TAX. The effect of TAX-NLC in the rearrangement of cell cycle was stronger than that of the free TAX. Conclusion: The cytotoxicity effect of TAX-NLC is stronger than that of the free TAX. And the cooperative effect of TAX-NLC is stronger than that of the free TAX. (authors)

  10. Structural and biophysical characterization of the PI4KB:14-3-3 protein complex

    Czech Academy of Sciences Publication Activity Database

    Chalupská, Dominika; Eisenreichová, Andrea; Rozycki, B.; Řežábková, L.; Humpolíčková, Jana; Klíma, Martin; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 191 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] Institutional support: RVO:61388963 Keywords : PI4KB * 14-3-3 protein s Subject RIV: CE - Biochemistry

  11. Data of evolutionary structure change: 1I7KB-2ONUA [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1I7KB-2ONUA 1I7K 2ONU B A PVGKRLQQELMTLMMSGDKGISAFPESDNLFKWVGTIHG.../entryChain> 2ONU A 2ONUA LEU CA 387 2ONU A 2ONU...248 THR CA 202 ALA CA 208 PHE CA 291 2ONU... A 2ONUA

  12. Analysis of common SHOX gene sequence variants and ∼4.9-kb ...

    Indian Academy of Sciences (India)

    [Solc R., Hirschfeldova K., Kebrdlova V. and Baxova A. 2014 Analysis of common SHOX gene sequence variants and ∼4.9-kb PAR1 deletion in ISS patients. J. Genet. 93, 505–508]. Introduction. Defects of the SHOX gene (short stature homeobox- containing gene), localized in the pseudoautosomal region 1. (PAR1) have ...

  13. Fabrication of nested elliptical KB mirrors using profile coating for synchrotron radiation X-ray focusing

    International Nuclear Information System (INIS)

    Liu Chian; Ice, G.E.; Liu, W.; Assoufid, L.; Qian, J.; Shi, B.; Khachatryan, R.; Wieczorek, M.; Zschack, P.; Tischler, J.Z.

    2012-01-01

    This paper describes fabrication methods used to demonstrate the advantages of nested or Montel optics for micro/nanofocusing of synchrotron X-ray beams. A standard Kirkpatrick-Baez (KB) mirror system uses two separated elliptical mirrors at glancing angles to the X-ray beam and sequentially arranged at 90° to each other to focus X-rays successively in the vertical and horizontal directions. A nested KB mirror system has the two mirrors positioned perpendicular and side-by-side to each other. Compared to a standard KB mirror system, Montel optics can focus a larger divergence and the mirrors can have a shorter focal length. As a result, nested mirrors can be fabricated with improved demagnification factor and ultimately smaller focal spot, than with a standard KB arrangement. The nested system is also more compact with an increased working distance, and is more stable, with reduced complexity of mirror stages. However, although Montel optics is commercially available for laboratory X-ray sources, due to technical difficulties they have not been used to microfocus synchrotron radiation X-rays, where ultra-precise mirror surfaces are essential. The main challenge in adapting nested optics for synchrotron microfocusing is to fabricate mirrors with a precise elliptical surface profile at the very edge where the two mirrors meet and where X-rays scatter. For example, in our application to achieve a sub-micron focus with high efficiency, a surface figure root-mean-square (rms) error on the order of 1 nm is required in the useable area along the X-ray footprint with a ∼0.1 mm-diameter cross section. In this paper we describe promising ways to fabricate precise nested KB mirrors using our profile coating technique and inexpensive flat Si substrates.

  14. UniProtKB amid the turmoil of plant proteomics research

    Directory of Open Access Journals (Sweden)

    Michel eSchneider

    2012-12-01

    Full Text Available The UniProt knowledgebase (UniProtKB provides a single, centralized, authoritative resource for protein sequences and functional information. The majority of its records is based on automatic translation of coding sequences (CDS provided by submitters at the time of initial deposition to the nucleotide sequence databases (INSDC. More and more frequently, only the raw sequence of a complete genome is deposited to the nucleotide sequence databases and the gene model predictions and annotations are kept in separate, specialized model organism databases (MODs. In order to be able to provide the complete proteome of model organisms, UniProtKB had to implement pipelines for import of protein sequences from Ensembl and EnsemblGenomes.A single genome can be the target of several unrelated sequencing projects and the final assembly and gene model predictions may diverge quite significantly. In addition, several cultivars of the same species are often sequenced -1001 Arabidopsis cultivars are currently under way- and the resulting proteomes are far from being identical. Therefore, one challenge for UniProtKB is to store and organize these data in a convenient way and to clearly defined reference proteomes that should be made available to users. Manual annotation is one of the landmarks of the Swiss-Prot section of UniProtKB. Besides adding functional annotation, curators are checking, and often correcting, gene model predictions. For plants, this task is limited to Arabidopsis thaliana and Oryza sativa subsp japonica. Proteomics data providing experimental evidences confirming the existence of proteins or identifying sequence features such as post translational modifications are also imported into UniProtKB records and the knowledgebase is cross-referenced to numerous proteomics resources.

  15. In vitro DNA binding studies of the sweetening agent saccharin and its copper(II) and zinc(II) complexes.

    Science.gov (United States)

    Icsel, Ceyda; Yilmaz, Veysel T

    2014-01-05

    The interactions of fish sperm DNA (FS-DNA) with the sodium salt of sweetener saccharin (sacH) and its copper and zinc complexes, namely [M(sac)2(H2O)4]·2H2O (M=Cu(II) or Zn(II)) were studied by using UV-Vis titration, fluorometric competition, thermal denaturation, viscosity and gel electrophoresis measurements. The intrinsic binding constants (Kb) obtained from absorption titrations were estimated to be 2.86 (±0.06)×10(4)M(-1) for Na(sac), 6.67 (±0.12)×10(4)M(-1) for Cu-sac and 4.01 (±0.08)×10(4)M(-1) for Zn-sac. The Cu-sac complex binds to FS-DNA via intercalation with a KA value of 50.12 (±0.22)×10(4)M(-1) as evidenced by competitive binding studies with ethidium bromide. Moreover, competition experiments with Hoechst 33258 are indicative of a groove binding mode of Na(sac) and Zn-sac with binding constants of 3.13 (±0.16)×10(4)M(-1) and 5.25 (±0.22)×10(4)M(-1), respectively. The spectroscopic measurements indicate a moderate DNA binding affinity of Na(sac) and its metal complexes. The suggested binding modes are further confirmed by the thermal denaturation and viscosity measurements. In addition, Cu-sac and Zn-sac show weak ability to damage to pBR322 supercoiled plasmid DNA. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Renormalization of Newton's constant

    Science.gov (United States)

    Falls, Kevin

    2015-12-01

    The problem of obtaining a gauge independent beta function for Newton's constant is addressed. By a specific parametrization of metric fluctuations a gauge independent functional integral is constructed for the semiclassical theory around an arbitrary Einstein space. The effective action then has the property that only physical polarizations of the graviton contribute, while all other modes cancel with the functional measure. We are then able to compute a gauge independent beta function for Newton's constant in d dimensions to one-loop order. No Landau pole is present provided Ng<18 , where Ng=d (d -3 )/2 is the number of polarizations of the graviton. While adding a large number of matter fields can change this picture, the absence of a pole persists for the particle content of the standard model in four spacetime dimensions.

  17. Production in constant evolution

    International Nuclear Information System (INIS)

    Lozano, T.

    2009-01-01

    The Cofrentes Nuclear Power Plant now has 25 years of operation behind it: a quarter century adding value and demonstrating the reasons why it is one of the most important energy producing facilities in the Spanish power market. Particularly noteworthy is the enterprising spirit of the plant, which has strived to continuously improve with the large number of modernization projects that it has undertaken over the past 25 years. The plant has constantly evolved thanks to the amount of investments made to improve safety and reliability and the perseverance to stay technologically up to date. Efficiency, training and teamwork have been key to the success of the plant over these 25 years of constant change and progress. (Author)

  18. The Fine Structure Constant

    Indian Academy of Sciences (India)

    IAS Admin

    important parameter in the field of atomic struc- ture. The values of the constants of ... tions in their core that produce carbon. As a result, .... atom in 1913. In other words, the size of a hydrogen atom is a factor α−2 ≈ 20000 times the size of an elec- tron. Another way of looking at α is to consider the ratio of the orbital speed of ...

  19. The cosmological constant

    International Nuclear Information System (INIS)

    Mellor, F.

    1989-01-01

    Astronomical observations predict to an extremely accurate degree that the cosmological term in Einstein's equations should be zero. This conflicts with the predictions from particle theories of a non-zero cosmological term. Attempts to resolve this paradox range from arguments based on the anthropic principle to supersymmetric theories to quantum cosmological proposals. These approaches are discussed here and the history of the cosmological constant is reviewed. (author)

  20. Connecting Fundamental Constants

    International Nuclear Information System (INIS)

    Di Mario, D.

    2008-01-01

    A model for a black hole electron is built from three basic constants only: h, c and G. The result is a description of the electron with its mass and charge. The nature of this black hole seems to fit the properties of the Planck particle and new relationships among basic constants are possible. The time dilation factor in a black hole associated with a variable gravitational field would appear to us as a charge; on the other hand the Planck time is acting as a time gap drastically limiting what we are able to measure and its dimension will appear in some quantities. This is why the Planck time is numerically very close to the gravitational/electric force ratio in an electron: its difference, disregarding a π√(2) factor, is only 0.2%. This is not a coincidence, it is always the same particle and the small difference is between a rotating and a non-rotating particle. The determination of its rotational speed yields accurate numbers for many quantities, including the fine structure constant and the electron magnetic moment

  1. The Hubble Constant.

    Science.gov (United States)

    Jackson, Neal

    2015-01-01

    I review the current state of determinations of the Hubble constant, which gives the length scale of the Universe by relating the expansion velocity of objects to their distance. There are two broad categories of measurements. The first uses individual astrophysical objects which have some property that allows their intrinsic luminosity or size to be determined, or allows the determination of their distance by geometric means. The second category comprises the use of all-sky cosmic microwave background, or correlations between large samples of galaxies, to determine information about the geometry of the Universe and hence the Hubble constant, typically in a combination with other cosmological parameters. Many, but not all, object-based measurements give H 0 values of around 72-74 km s -1 Mpc -1 , with typical errors of 2-3 km s -1 Mpc -1 . This is in mild discrepancy with CMB-based measurements, in particular those from the Planck satellite, which give values of 67-68 km s -1 Mpc -1 and typical errors of 1-2 km s -1 Mpc -1 . The size of the remaining systematics indicate that accuracy rather than precision is the remaining problem in a good determination of the Hubble constant. Whether a discrepancy exists, and whether new physics is needed to resolve it, depends on details of the systematics of the object-based methods, and also on the assumptions about other cosmological parameters and which datasets are combined in the case of the all-sky methods.

  2. Universe of constant

    Science.gov (United States)

    Yongquan, Han

    2016-10-01

    The ideal gas state equation is not applicable to ordinary gas, it should be applied to the Electromagnetic ``gas'' that is applied to the radiation, the radiation should be the ultimate state of matter changes or initial state, the universe is filled with radiation. That is, the ideal gas equation of state is suitable for the Singular point and the universe. Maybe someone consider that, there is no vessel can accommodate radiation, it is because the Ordinary container is too small to accommodate, if the radius of your container is the distance that Light through an hour, would you still think it can't accommodates radiation? Modern scientific determinate that the radius of the universe now is about 1027 m, assuming that the universe is a sphere whose volume is approximately: V = 4.19 × 1081 cubic meters, the temperature radiation of the universe (cosmic microwave background radiation temperature of the universe, should be the closest the average temperature of the universe) T = 3.15k, radiation pressure P = 5 × 10-6 N / m 2, according to the law of ideal gas state equation, PV / T = constant = 6 × 1075, the value of this constant is the universe, The singular point should also equal to the constant Author: hanyongquan

  3. Biochemical investigation of yttrium(III) complex containing 1,10-phenanthroline: DNA binding and antibacterial activity.

    Science.gov (United States)

    Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Moodi, Asieh; Niroomand, Sona

    2013-03-05

    Characterization of the interaction between yttrium(III) complex containing 1,10-phenanthroline as ligand, [Y(phen)2Cl(OH2)3]Cl2⋅H2O, and DNA has been carried out by UV absorption, fluorescence spectra and viscosity measurements in order to investigate binding mode. The experimental results indicate that the yttrium(III) complex binds to DNA and absorption is decreasing in charge transfer band with the increase in amount of DNA. The binding constant (Kb) at different temperatures as well as thermodynamic parameters, enthalpy change (ΔH°) and entropy change (ΔS°), were calculated according to relevant fluorescent data and Vant' Hoff equation. The results of interaction mechanism studies, suggested that groove binding plays a major role in the binding of the complex and DNA. The activity of yttrium(III) complex against some bacteria was tested and antimicrobial screening tests shown growth inhibitory activity in the presence of yttrium(III) complex. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. New silver(I) complex with diazafluorene based ligand: Synthesis, characterization, investigation of in vitro DNA binding and antimicrobial studies

    Science.gov (United States)

    Movahedi, Elaheh; Rezvani, Ali Reza

    2017-07-01

    A novel diazafluorene based complex with silver, [Ag(dian)2 ] NO3 , where dian is N-(4,5-diazafluoren-9-ylidene)aniline, has been prepared and characterized by elemental analysis, IR spectroscopy, 1HNMR, UV-Vis spectroscopy and cyclic voltammetry. In order to explore the relationship between the structure and biological properties, DNA binding propensity and in vitro antibacterial property have also been studied. The mode of DNA-complex interaction has been investigated by electronic absorption titration, luminescence titration, competitive binding experiment, effect of ionic strength, thermodynamic studies, viscometric evaluation, circular dichroism spectroscopy and cyclic voltammetry. The results reveal that the complex binds to CT-DNA in a moderate intercalation capability with the partial insertion of a planar dian ligand between the base stacks of double-stranded DNA with binding constant (Kb) of 2.4 × 105 M-1. The viscosities and CD spectra of the DNA provide strong evidence for the intercalation. An in vitro antibacterial efficacy of the Ag(I) complex on a series of Gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) indicates that the complex exhibits a marked antibacterial activity. The minimum inhibitory concentrations of the complex indicate that it exhibits much higher antibacterial effect on standard bacterial strains of Escherichia coli and Staphylococcus aureus than those of silver nitrate, silver sulfadiazine. The bacterial inhibitions of the silver(I) complex are closely agreed to its DNA binding affinities.

  5. DNA damaging, cell cytotoxicity and serum albumin binding efficacy of the rutin-Cu(ii) complex.

    Science.gov (United States)

    Roy, Atanu Singha; Tripathy, Debi Ranjan; Samanta, Sintu; Ghosh, Sudip K; Dasgupta, Swagata

    2016-04-26

    Flavonoids are widely used as anti-oxidants, anti-cancer agents and possess metal ion chelation properties. In this report we have investigated the DNA binding (and damaging), cell cytotoxicity and serum albumin (SA) binding efficacy of the rutin-Cu(ii) complex using differential spectroscopic methods. The rutin-Cu(ii) complex was able to intercalate into calf thymus DNA (ct-DNA) at lower concentrations and its DNA damaging properties were also confirmed from the agarose gel based assay, fluorescence and UV-vis studies. The copper complex was found to be effective against the growth of HeLa cells in vivo. The binding constants (Kb) of the rutin-Cu(ii) complex towards HSA and BSA were found to be (0.98 ± 0.03) and (1.05 ± 0.02) × 10(5) M(-1), respectively, at 299 K and observed to increase with the increase in temperature. Site selectivity studies revealed that the rutin-Cu(ii) complex binds near site 1 (subdomain IIA) of SAs. Thermodynamic parameters indicated that the mode of interaction of rutin and its copper complex with SAs are different from each other. Both ΔH° and ΔS° were observed to be positive for the interaction of the rutin-Cu(ii) complex with SAs, indicating the presence of hydrophobic association in binding. The values of ΔH° were estimated to be negative (-42.07 ± 2.92 and -23.29 ± 2.33 kJ mol(-1) for HSA and BSA respectively) in the binding of rutin with SAs. It implies that after chelation with Cu(ii) ion, rutin alters its binding mode which could have varying applications to its other physicochemical activities.

  6. The Hubble Constant

    Directory of Open Access Journals (Sweden)

    Neal Jackson

    2015-09-01

    Full Text Available I review the current state of determinations of the Hubble constant, which gives the length scale of the Universe by relating the expansion velocity of objects to their distance. There are two broad categories of measurements. The first uses individual astrophysical objects which have some property that allows their intrinsic luminosity or size to be determined, or allows the determination of their distance by geometric means. The second category comprises the use of all-sky cosmic microwave background, or correlations between large samples of galaxies, to determine information about the geometry of the Universe and hence the Hubble constant, typically in a combination with other cosmological parameters. Many, but not all, object-based measurements give H_0 values of around 72–74 km s^–1 Mpc^–1, with typical errors of 2–3 km s^–1 Mpc^–1. This is in mild discrepancy with CMB-based measurements, in particular those from the Planck satellite, which give values of 67–68 km s^–1 Mpc^–1 and typical errors of 1–2 km s^–1 Mpc^–1. The size of the remaining systematics indicate that accuracy rather than precision is the remaining problem in a good determination of the Hubble constant. Whether a discrepancy exists, and whether new physics is needed to resolve it, depends on details of the systematics of the object-based methods, and also on the assumptions about other cosmological parameters and which datasets are combined in the case of the all-sky methods.

  7. Spaces of constant curvature

    CERN Document Server

    Wolf, Joseph A

    2010-01-01

    This book is the sixth edition of the classic Spaces of Constant Curvature, first published in 1967, with the previous (fifth) edition published in 1984. It illustrates the high degree of interplay between group theory and geometry. The reader will benefit from the very concise treatments of riemannian and pseudo-riemannian manifolds and their curvatures, of the representation theory of finite groups, and of indications of recent progress in discrete subgroups of Lie groups. Part I is a brief introduction to differentiable manifolds, covering spaces, and riemannian and pseudo-riemannian geomet

  8. DNA binding, DNA cleavage and BSA interaction of a mixed-ligand copper(II) complex with taurine Schiff base and 1,10-phenanthroline.

    Science.gov (United States)

    Li, Lianzhi; Guo, Qiong; Dong, Jianfang; Xu, Tao; Li, Jinghong

    2013-08-05

    The DNA-binding properties and DNA-cleavage activities of a Cu(II) complex, [Cu(sal-tau(phen)]·1.5H2O (sal-tau=a Schiff base derived from salicylaldehyde and taurine, phen=1,10-phenanthroline), have been investigated by using UV-Vis absorption, fluorescence, circular dichroism (CD) spectra and agarose gel electrophoresis. Results indicated that this Cu(II) complex can bind to calf thymus DNA (CT-DNA) via an intercalative mode and shows efficient cleavage activity in the absence and presence of reducer. Its intrinsic binding constant Kb (1.66×10(4)M(-1)) was calculated by absorption spectra and its linear Stern-Volmer quenching constant K(sq) (3.05) was obtained from florescence spectroscopy, as well as the cleaving reaction rate constant k1 (2.0×10(-4)s(-1)) was acquired from agarose gel electrophoresis. Meanwhile, the interactions of the complex with BSA have also been studied by spectroscopy. Results showed that the complex could quench the intrinsic fluorescence of bovine serum albumin (BSA) remarkably through a static quenching process, and induce a conformational change with the loss of helical stability of protein. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Synthesis and DNA binding/cleavage of mononuclear copper(II) phenanthroline/bipyridine proline complexes.

    Science.gov (United States)

    Reddy, Pulimamidi R; Raju, Nomula; Manjula, Pallerla; Reddy, Karnati V G

    2007-07-01

    The complexes [Cu(II)(phen)(L-Pro)(H2O)]+ ClO4(-) (1; phen = 1,10-phenanthroline) and [Cu(II)(bipy)(L-Pro)(H2O)]+ ClO4(-) (2; bipy = 2,2'-bipyridine) were synthesized and characterized by IR, magnetic susceptibility, UV/VIS, EPR, ESI-MS, elemental analysis, and theoretical calculations. The metal center was found in a square-pyramidal geometry. UV/VIS, thermal-denaturation, and fluorescence-spectroscopic studies were conducted to assess the interaction of the complexes with CT-DNA. An intercalative mode of binding was found, with intrinsic binding constants (Kb) of 3.86x10(3) and 4.6x10(3) M(-1) and Stern-Volmer quenching constants (K) of 0.15 and 0.11 for 1 and 2, respectively. Interestingly, none of the Cu(II) complexes was able to cleave pUC-19 DNA, which is attributed to the absence of a Pro amide H-atom and inhibition of the formation of an OH radical from the axially coordinated H2O molecule.

  10. A Role for the NF-kb/Rel Transcription Factors in Human Breast Cancer

    Science.gov (United States)

    1998-07-01

    Carolina School of Medicine; Curricu- lum in Genetics and Molecular Biology; and Department of Endodontics , University of North Carolina School of...at this magnification . (D) DNA fragmentation in the absence of NF-KB activation. Rat-1 :iRasl and Rat-1 :iRasV cells were cultured at 1 x 105 cells...exclude the possibility that the ex- C.-Y. Wang, Curriculum in Genetics and Molecular Biol- ogy and Department of Endodontics , School of Dentis- try

  11. Cytotoxic Effect of Thymus caramanicus Jalas on Human Oral Epidermoid Carcinoma KB Cells.

    Science.gov (United States)

    Fekrazad, Reza; Afzali, Mehrad; Pasban-Aliabadi, Hamzeh; Esmaeili-Mahani, Saeed; Aminizadeh, Maryam; Mostafavi, Ali

    2017-01-01

    Identifying new chemotherapeutic agents with fewer side effects is a major concern for scientists today. Thymus caramanicus Jalas (Lamiaceae family) is one of the species of Thymus that grows wild in different regions of Iran. Traditionally, leaves of this plant are used in the treatment of diabetes, arthritis and cancer. Here was investigated the cytotoxic property of Thymus caramanicus essential oil and extract in human oral epidermoid carcinoma KB cells. Cell viability was measured by MTT and neutral red assays. The cells were exposed to different concentrations of essential oil (0.05-1 µL/mL) and extract (25-150 µg/mL) for 24 h. Doxorubicin was used as anticancer control drug. The data showed that the essential oil (IC50=0.44 µL/mL) and extract (IC50=105 µg/mL) induce potent cytotoxic property. Surprisingly, cytotoxic effects of essential oil and extract of this plant on KB cancer cells were greater than those on normal gingival HGF1-PI1 cell line. In addition, Thymus caramanicus could potentiate the effect of doxorubicin in sub-effective concentrations. The results of the present study indicate that essential oils and extracts of Thymus caramanicus have potential anti-proliferative property on KB cells and can be used as pharmaceutical case study for oral cancer treatments.

  12. Statistical Optimization of Media Components for Production of Fibrinolytic Alkaline Metalloproteases from Xenorhabdus indica KB-3

    Directory of Open Access Journals (Sweden)

    Kumar Pranaw

    2014-01-01

    Full Text Available Xenorhabdus indica KB-3, a well-known protease producer, was isolated from its entomopathogenic nematode symbiont Steinernema thermophilum. Since medium constituents are critical to the protease production, the chemical components of the selected medium (soya casein digest broth were optimized by rotatable central composite design (RCCD using response surface methodology (RSM. The effects of all five chemical components (considered as independent variables, namely tryptone, soya peptone, dextrose, NaCl, and dipotassium phosphate, on protease production (dependent variable were studied, and it was found that tryptone and dextrose had maximum influence on protease production. The protease production was increased significantly by 66.31% under optimal medium conditions (tryptone—5.71, soya peptone—4.9, dextrose—1.45, NaCl—6.08, and dipotassium phosphate—0.47 in g/L. To best of knowledge, there are no reports on optimization of medium component for protease production by X. indica KB-3 using RSM and their application in fibrinolysis. This study will be useful for industrial processes for production of protease enzyme from X. indica KB-3 for its application in the field of agriculture and medicine.

  13. Arsanilic acid-Sepharose chromatography of pyruvate kinase from KB cells.

    Science.gov (United States)

    Huang, R N; Yeh, H Y; Cheng, S C; Chow, L P; Lee, T C

    2000-03-31

    In the present study, arsanical-based affinity chromatography for pyruvate kinase (PK) isolation was explored. p-Arsanilic acid (4-aminophenyl arsonic acid), which contains an arsonic acid moiety structurally similar to inorganic pentavalent arsenate, was conjugated to Sepharose 4B via its para-amino group to form an As(V)-Sepharose matrix. The cellular proteins from KB cells bound to arsonic acid moieties were eluted by 50 mM sodium arsenate in Tris-HCl buffer (50 mM, pH 7.6). A single protein band with a molecular mass of 58 kDa was shown on a sodium dodecyl sulfate-polyacrylamide gel. By immunoblotting, amino acid sequencing and enzymatic analysis, the sodium arsenate-eluted 58-kDa protein was demonstrated to be a human PK (type M2). By using this one-step As(V)-Sepharose chromatography, PK from KB cells was purified 35.4-fold with a specific activity of 153.15 U/mg protein in the presence of 6 mM fructose-1,6-biphosphate. Although PK was eluted from an As(V)-Sepharose column with sodium arsenate, PK activity was apparently inhibited by the used eluent system, but not by p-arsanilic acid, indicating a specific interaction of As(V) to PK. In summary, our results indicate that As(V)-Sepharose can serve as a simple and efficient chromatographic support for PK purification from KB cells.

  14. KB-Rank: efficient protein structure and functional annotation identification via text query.

    Science.gov (United States)

    Julfayev, Elchin S; McLaughlin, Ryan J; Tao, Yi-Ping; McLaughlin, William A

    2012-06-01

    The KB-Rank tool was developed to help determine the functions of proteins. A user provides text query and protein structures are retrieved together with their functional annotation categories. Structures and annotation categories are ranked according to their estimated relevance to the queried text. The algorithm for ranking first retrieves matches between the query text and the text fields associated with the structures. The structures are next ordered by their relative content of annotations that are found to be prevalent across all the structures retrieved. An interactive web interface was implemented to navigate and interpret the relevance of the structures and annotation categories retrieved by a given search. The aim of the KB-Rank tool is to provide a means to quickly identify protein structures of interest and the annotations most relevant to the queries posed by a user. Informational and navigational searches regarding disease topics are described to illustrate the tool's utilities. The tool is available at the URL http://protein.tcmedc.org/KB-Rank.

  15. Un saludo constante

    OpenAIRE

    Salcedo Ortega, Manuela; Pontificia Universidad Javeriana, Cali

    2013-01-01

    La presencia familiar estará siempre en mi vida: Creo que esa unión va más allá de los lazos que creamos en ese primer abrir de ojos del nacimiento pues los lazos se fortalecen con el tiempo. Es que esos lazos van de la genética al riñón y puede que suene muy raro, pero esta es mi enfermedad, la primera y la constante, la que desaparece y reaparece, la heredada y la que cada vez que me saluda, deja su huella. Comenzó hace 16 años. Mis infecciones urinarias fueron el comienzo de muchas maluque...

  16. The Hubble Constant

    Directory of Open Access Journals (Sweden)

    Jackson Neal

    2007-09-01

    Full Text Available I review the current state of determinations of the Hubble constant, which gives the length scale of the Universe by relating the expansion velocity of objects to their distance. In the last 20 years, much progress has been made and estimates now range between 60 and 75 km s^-1 Mpc^-1, with most now between 70 and 75 km s^-1 Mpc^-1, a huge improvement over the factor-of-2 uncertainty which used to prevail. Further improvements which gave a generally agreed margin of error of a few percent rather than the current 10% would be vital input to much other interesting cosmology. There are several programmes which are likely to lead us to this point in the next 10 years.

  17. Constant Proportion Portfolio Insurance

    DEFF Research Database (Denmark)

    Jessen, Cathrine

    2014-01-01

    Portfolio insurance, as practiced in 1987, consisted of trading between an underlying stock portfolio and cash, using option theory to place a floor on the value of the position, as if it included a protective put. Constant Proportion Portfolio Insurance (CPPI) is an option-free variation...... on the theme, originally proposed by Fischer Black. In CPPI, a financial institution guarantees a floor value for the “insured” portfolio and adjusts the stock/bond mix to produce a leveraged exposure to the risky assets, which depends on how far the portfolio value is above the floor. Plain-vanilla portfolio...... insurance largely died with the crash of 1987, but CPPI is still going strong. In the frictionless markets of finance theory, the issuer’s strategy to hedge its liability under the contract is clear, but in the real world with transactions costs and stochastic jump risk, the optimal strategy is less obvious...

  18. Spectroscopic and molecular docking studies of binding interaction of gefitinib, lapatinib and sunitinib with bovine serum albumin (BSA).

    Science.gov (United States)

    Shen, Guo-Feng; Liu, Ting-Ting; Wang, Qi; Jiang, Min; Shi, Jie-Hua

    2015-12-01

    The binding interactions of three kinds of tyrosine kinase inhibitors (TKIs), such as gefitinib, lapatinib and sunitinib, with bovine serum albumin (BSA) were studied using ultraviolet spectrophotometry, fluorescence spectroscopy, circular dichroism (CD), Fourier transform infrared spectroscopy (FT-IR) and molecular docking methods. The experimental results showed that the intrinsic fluorescence quenching of BSA induced by the three TKIs resulted from the formation of stable TKIs-BSA complexes through the binding interaction of TKIs with BSA. The stoichiometry of three stable TKIs-BSA complexes was 1:1 and the binding constants (Kb) of the three TKIs-BSA complexes were in the order of 10(4)M(-1) at 310 K, indicating that there was a strong binding interaction of the three TKIs with BSA. Based on the analysis of the signs and magnitudes of the free energy change (ΔG(0)), enthalpic change (ΔH(0)) and entropic change (ΔS(0)) in the binding process, it can be deduced that the binding process of the three TKIs with BSA was spontaneous and enthalpy-driven process, and the main interaction forces between the three TKIs and BSA were van der Waals force and hydrogen bonding interaction. Moreover, from the results of CD, FT-IR and molecular docking, it can be concluded that there was a significant difference between the three TKIs in the binding site on BSA, lapatinib was located on site II (m) of BSA while gefitinib and sunitinib were bound on site I of BSA, and there were some changes in the BSA conformation when binding three TKIs to BSA but BSA still retains its secondary structure α-helicity. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Studies of the binding mode of TXNHCH2COOH with calf thymus DNA by spectroscopic methods

    Science.gov (United States)

    Ataci, Nese; Arsu, Nergis

    2016-12-01

    In this study, a thioxanthone derivative named 2-(9-oxo-9H-thioxanthen-2ylamino) acetic acid (TX-NHCH2COOH) was used to investigate small molecule and DNA binding interactions. Absorption and fluorescence emission spectroscopy were used and melting studies were used to explain the binding mode of TXNHCH2COOH-DNA. Intrinsic binding constant Kb TXNHCH2COOH was found 6 × 105 M- 1from UV-Vis absorption spectroscopy. Fluorescence emmision intensity increased by adding ct-DNA to the TXNHCH2COOH and KI quenching experiments resulted with low Ksv value. Additionally, 3.7 °C increase for Tm was observed. The observed quenching of EB and ct-DNA complex and increase viscosity values of ct-DNA by addition of TXNHCH2COOH was determined. All those results indicate that TXNHCH2COOH can intercalate into DNA base pairs. Fluorescence microscopy helped to display imaging of the TXNHCH2COOH-DNA solution.

  20. Hypermethylation of genomic 3.3-kb repeats is frequent event in HPV-positive cervical cancer

    Directory of Open Access Journals (Sweden)

    Kisseljova Natalia P

    2009-05-01

    Full Text Available Abstract Background Large-scale screening methods are widely used to reveal cancer-specific DNA methylation markers. We previously identified non-satellite 3.3-kb repeats associated with facioscapulohumeral muscular dystrophy (FSHD as hypermethylated in cervical cancer in genome-wide screening. To determine whether hypermethylation of 3.3-kb repeats is a tumor-specific event and to evaluate frequency of this event in tumors, we investigated the 3.3-kb repeat methylation status in human papilloma virus (HPV-positive cervical tumors, cancer cell lines, and normal cervical tissues. Open reading frames encoding DUX family proteins are contained within some 3.3-kb repeat units. The DUX mRNA expression profile was also studied in these tissues. Methods The methylation status of 3.3-kb repeats was evaluated by Southern blot hybridization and bisulfite genomic sequencing. The expression of DUX mRNA was analyzed by RT-PCR and specificity of PCR products was confirmed by sequencing analysis. Results Hypermethylation of 3.3-kb repeats relative to normal tissues was revealed for the first time in more than 50% (18/34 of cervical tumors and in 4 HPV-positive cervical cancer cell lines. Hypermethylation of 3.3-kb repeats was observed in tumors concurrently with or independently of hypomethylation of classical satellite 2 sequences (Sat2 that were hypomethylated in 75% (15/20 of cervical tumors. We have revealed the presence of transcripts highly homologous to DUX4 and DUX10 genes in normal tissues and down-regulation of transcripts in 68% of tumors with and without 3.3-kb repeats hypermethylation. Conclusion Our results demonstrate that hypermethylation rather than hypomethylation of 3.3-kb repeats is the predominant event in HPV-associated cervical cancer and provide new insight into the epigenetic changes of repetitive DNA elements in carcinogenesis.

  1. The role of CTCF binding sites in the 3’ immunoglobulin heavy chain regulatory region

    Directory of Open Access Journals (Sweden)

    Barbara K Birshtein

    2012-11-01

    Full Text Available The immunoglobulin heavy chain locus undergoes a series of DNA rearrangements and modifications to achieve the construction and expression of individual antibody heavy chain genes in B cells. These events affect variable regions, through VDJ joining and subsequent somatic hypermutation, and constant regions through class switch recombination. Levels of IgH expression are also regulated during B cell development, resulting in high levels of secreted antibodies from fully-differentiated plasma cells. Regulation of these events has been attributed primarily to two cis-elements that work from long distances on their target sequences, i.e., an ~1 kb intronic enhancer, Eμ, located between the V region segments and the most 5′ constant region gene, Cμ; and an ~40 kb 3′ regulatory region (3′ RR that is located downstream of the most 3′ CH gene, Cα. The 3′ RR is a candidate for an end of B cell-specific regulation of the Igh locus. The 3′ RR contains several B cell-specific enhancers associated with DNase I hypersensitive sites (hs1-4, which are essential for class switch recombination and for high levels of IgH expression in plasma cells. Downstream of this enhancer-containing region is a region of high-density CTCF binding sites, which extends through hs5, 6, and 7 and further downstream. CTCF, with its enhancer-blocking activities, has been associated with all mammalian insulators and implicated in multiple chromosomal interactions. Here we address the 3′ RR CTCF-binding region as a potential insulator of the Igh locus, an independent regulatory element and a predicted modulator of the activity of 3’ RR enhancers. Using chromosome conformation capture technology, chromatin immunoprecipitation and genetic approaches, we have found that the 3’ RR with its CTCF binding region interacts with target sequences in the VH, Eμ and CH regions through DNA looping as regulated by protein binding. This region impacts on B cell-specific Igh

  2. Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate

    Science.gov (United States)

    Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Muhammad, Niaz; Shah, Naseer Ali; Sohail, Manzar; Pandarinathan, Vedapriya

    2015-08-01

    A new binuclear O-bridged Cu(II) complex with 4-chlorophenyl acetate and 2,2‧-bipyridine has been synthesized and characterized using FT-IR, powder and single crystal XRD and electrochemical solution studies. The results revealed that the two penta-coordinated Cu(II) centers are linked by two carboxylate ligands in end-on bonding fashion. The coordination geometry is slightly distorted square pyramidal (SP) with bridging oxygen atoms occupying the apical position and other ligands lying in the equatorial plane. The striking difference in Cu-O bond distance of the bridging oxygen atom in the complex may be responsible for the SP geometry of Cu(II) ion. The complex gave rise to metal centered irreversible electro-activity where one electron Cu(II)/Cu(III) oxidation process and a single step two electron Cu(II)/Cu(0) reduction process was observed. The redox processes were found predominantly adsorption controlled. The values of diffusion coefficient and heterogeneous rate constant for oxidation process were 6.98 × 10-7 cm2 s-1 and 4.60 × 10-5 cm s-1 while the corresponding values for reduction were 5.30 × 10-8 cm2 s-1 and 5.41 × 10-6 cm s-1, respectively. The formal potential and charge transfer coefficient were also calculated. The DNA-binding ability was explored through cyclic voltammetry and UV-Visible spectroscopy. Diminution in the value of Do for oxidation indicated the binding of the complex with DNA corresponding to Kb = 8.58 × 104 M-1. UV-Visible spectroscopy yielded ε = 49 L mol-1 cm-1 and Kb = 2.96 × 104 M-1. The data of both techniques support each other. The self-induced redox activation of the complex, as indicated by cyclic voltammetry heralds its potential applications in redox catalysis and anticancer activity.

  3. Breed relationships facilitate fine-mapping studies: a 7.8-kb deletion cosegregates with Collie eye anomaly across multiple dog breeds.

    Science.gov (United States)

    Parker, Heidi G; Kukekova, Anna V; Akey, Dayna T; Goldstein, Orly; Kirkness, Ewen F; Baysac, Kathleen C; Mosher, Dana S; Aguirre, Gustavo D; Acland, Gregory M; Ostrander, Elaine A

    2007-11-01

    The features of modern dog breeds that increase the ease of mapping common diseases, such as reduced heterogeneity and extensive linkage disequilibrium, may also increase the difficulty associated with fine mapping and identifying causative mutations. One way to address this problem is by combining data from multiple breeds segregating the same trait after initial linkage has been determined. The multibreed approach increases the number of potentially informative recombination events and reduces the size of the critical haplotype by taking advantage of shortened linkage disequilibrium distances found across breeds. In order to identify breeds that likely share a trait inherited from the same ancestral source, we have used cluster analysis to divide 132 breeds of dog into five primary breed groups. We then use the multibreed approach to fine-map Collie eye anomaly (cea), a complex disorder of ocular development that was initially mapped to a 3.9-cM region on canine chromosome 37. Combined genotypes from affected individuals from four breeds of a single breed group significantly narrowed the candidate gene region to a 103-kb interval spanning only four genes. Sequence analysis revealed that all affected dogs share a homozygous deletion of 7.8 kb in the NHEJ1 gene. This intronic deletion spans a highly conserved binding domain to which several developmentally important proteins bind. This work both establishes that the primary cea mutation arose as a single disease allele in a common ancestor of herding breeds as well as highlights the value of comparative population analysis for refining regions of linkage.

  4. Beyond the Hubble Constant

    Science.gov (United States)

    1995-08-01

    about the distances to galaxies and thereby about the expansion rate of the Universe. A simple way to determine the distance to a remote galaxy is by measuring its redshift, calculate its velocity from the redshift and divide this by the Hubble constant, H0. For instance, the measured redshift of the parent galaxy of SN 1995K (0.478) yields a velocity of 116,000 km/sec, somewhat more than one-third of the speed of light (300,000 km/sec). From the universal expansion rate, described by the Hubble constant (H0 = 20 km/sec per million lightyears as found by some studies), this velocity would indicate a distance to the supernova and its parent galaxy of about 5,800 million lightyears. The explosion of the supernova would thus have taken place 5,800 million years ago, i.e. about 1,000 million years before the solar system was formed. However, such a simple calculation works only for relatively ``nearby'' objects, perhaps out to some hundred million lightyears. When we look much further into space, we also look far back in time and it is not excluded that the universal expansion rate, i.e. the Hubble constant, may have been different at earlier epochs. This means that unless we know the change of the Hubble constant with time, we cannot determine reliable distances of distant galaxies from their measured redshifts and velocities. At the same time, knowledge about such change or lack of the same will provide unique information about the time elapsed since the Universe began to expand (the ``Big Bang''), that is, the age of the Universe and also its ultimate fate. The Deceleration Parameter q0 Cosmologists are therefore eager to determine not only the current expansion rate (i.e., the Hubble constant, H0) but also its possible change with time (known as the deceleration parameter, q0). Although a highly accurate value of H0 has still not become available, increasing attention is now given to the observational determination of the second parameter, cf. also the Appendix at the

  5. Cross-reactivity patterns of vaccinia-specific cytotoxic T lymphocytes from H-2Kb mutants.

    Science.gov (United States)

    Hurwitz, J L; Pan, S; Wettstein, P J; Doherty, P C

    1983-01-01

    Limit-dilution cultures were used to select vaccinia-immune T-cell populations from bm1 and bm3 mutant mice that were not lytic for virus-infected targets expressing the Kb and Db MHC glycoprotein. Approximately 30% of virus-immune CTL were restricted in each case to Kbm1 and Kbm3, rather than to Db. Evidence of extensive cross-reactivity was found for these virus-immune CTL. Bm3 and bm11 mice sharing one amino acid mutation from wild-type but differing by a second mutation seen only in bm3 are the most cross-reactive pair in their presentation of vaccinia. The bm1 and bm10 pair with dissimilar mutations from wild-type affecting the same CNBr fragment are also largely cross-reactive. However, 30% cross-reactivity is also found for bm1 and bm3, which differ in separate CNBr fragments. That mutants expressing amino acid substitutions in the same region of the peptide tend to show more evidence of cross-reactivity does not necessarily mean the T cells see linear arrays of amino acids on the MHC glycoprotein. For instance, Kbm1 and Kbm10 differ for three amino acids, but bm1 T cells are highly lytic for bm10 virus-infected targets. However, there is no cross-reactivity for Kbm1 and Kb, which differ at only two amino acids. The key to further understanding may rest with defining the nature of the conformational differences among the Kbm1, Kbm10, and Kb glycoproteins.

  6. Aloin Inhibits Interleukin (IL)-1β-Stimulated IL-8 Production in KB Cells.

    Science.gov (United States)

    Na, Hee Sam; Song, Yu Ri; Kim, Seyeon; Heo, Jun-Young; Chung, Hae-Young; Chung, Jin

    2016-06-01

    Interleukin (IL)-1β, which is elevated in oral diseases including gingivitis, stimulates epithelial cells to produce IL-8 and perpetuate inflammatory responses. This study investigates stimulatory effects of salivary IL-1β in IL-8 production and determines if aloin inhibits IL-1β-stimulated IL-8 production in epithelial cells. Saliva was collected from volunteers to determine IL-1β and IL-8 levels. Samples from volunteers were divided into two groups: those with low and those with high IL-1β levels. KB cells were stimulated with IL-1β or saliva with or without IL-1 receptor agonist or specific mitogen-activated protein kinase (MAPK) inhibitors. IL-8 production was measured by enzyme-linked immunosorbent assay (ELISA). MAPK protein expression involved in IL-1β-induced IL-8 secretion was detected by Western blot. KB cells were pretreated with aloin, and its effect on IL-1β-induced IL-8 production was examined by ELISA and Western blot analysis. Saliva with high IL-1β strongly stimulated IL-8 production in KB cells, and IL-1 receptor agonist significantly inhibited IL-8 production. Low IL-1β-containing saliva did not increase IL-8 production. IL-1β treatment of KB cells induced activation of MAPK signaling molecules as well as nuclear factor-kappa B. IL-1β-induced IL-8 production was decreased by p38 and extracellular signal-regulated kinase (ERK) inhibitor treatment. Aloin pretreatment inhibited IL-1β-induced IL-8 production in a dose-dependent manner and inhibited activation of the p38 and ERK signaling pathway. Finally, aloin pretreatment also inhibited saliva-induced IL-8 production. Results indicated that IL-1β in saliva stimulates epithelial cells to produce IL-8 and that aloin effectively inhibits salivary IL-1β-induced IL-8 production by mitigating the p38 and ERK pathway. Therefore, aloin may be a good candidate for modulating oral inflammatory diseases.

  7. Collaborative annotation of genes and proteins between UniProtKB/Swiss-Prot and dictyBase.

    Science.gov (United States)

    Gaudet, P; Lane, L; Fey, P; Bridge, A; Poux, S; Auchincloss, A; Axelsen, K; Braconi Quintaje, S; Boutet, E; Brown, P; Coudert, E; Datta, R S; de Lima, W C; de Oliveira Lima, T; Duvaud, S; Farriol-Mathis, N; Ferro Rojas, S; Feuermann, M; Gateau, A; Hinz, U; Hulo, C; James, J; Jimenez, S; Jungo, F; Keller, G; Lemercier, P; Lieberherr, D; Moinat, M; Nikolskaya, A; Pedruzzi, I; Rivoire, C; Roechert, B; Schneider, M; Stanley, E; Tognolli, M; Sjölander, K; Bougueleret, L; Chisholm, R L; Bairoch, A

    2009-01-01

    UniProtKB/Swiss-Prot, a curated protein database, and dictyBase, the Model Organism Database for Dictyostelium discoideum, have established a collaboration to improve data sharing. One of the major steps in this effort was the 'Dicty annotation marathon', a week-long exercise with 30 annotators aimed at achieving a major increase in the number of D. discoideum proteins represented in UniProtKB/Swiss-Prot. The marathon led to the annotation of over 1000 D. discoideum proteins in UniProtKB/Swiss-Prot. Concomitantly, there were a large number of updates in dictyBase concerning gene symbols, protein names and gene models. This exercise demonstrates how UniProtKB/Swiss-Prot can work in very close cooperation with model organism databases and how the annotation of proteins can be accelerated through those collaborations.

  8. Cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror

    OpenAIRE

    Yuan, Sheng Sam

    2010-01-01

    At the Advanced Light Source (ALS), we are developing broadly applicable, high-accuracy, in-situ, at-wavelength wavefront slope measurement techniques for Kirkpatrick-Baez (KB) mirror nano-focusing. In this paper, we report an initial cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror. This cross-check provides a validation of the in-situ shearing interferometry currently under development at the ALS.

  9. Thiol groups controls on arsenite binding by organic matter: new experimental and modeling evidence.

    Science.gov (United States)

    Catrouillet, Charlotte; Davranche, Mélanie; Dia, Aline; Bouhnik-Le Coz, Martine; Pédrot, Mathieu; Marsac, Rémi; Gruau, Gérard

    2015-12-15

    Although it has been suggested that several mechanisms can describe the direct binding of As(III) to organic matter (OM), more recently, the thiol functional group of humic acid (HA) was shown to be an important potential binding site for As(III). Isotherm experiments on As(III) sorption to HAs, that have either been grafted with thiol or not, were thus conducted to investigate the preferential As(III) binding sites. There was a low level of binding of As(III) to HA, which was strongly dependent on the abundance of the thiols. Experimental datasets were used to develop a new model (the modified PHREEQC-Model VI), which defines HA as a group of discrete carboxylic, phenolic and thiol sites. Protonation/deprotonation constants were determined for each group of sites (pKA=4.28±0.03; ΔpKA=2.13±0.10; pKB=7.11±0.26; ΔpKB=3.52±0.49; pKS=5.82±0.052; ΔpKS=6.12±0.12 for the carboxylic, phenolic and thiols sites, respectively) from HAs that were either grafted with thiol or not. The pKS value corresponds to that of single thiol-containing organic ligands. Two binding models were tested: the Mono model, which considered that As(III) is bound to the HA thiol site as monodentate complexes, and the Tri model, which considered that As(III) is bound as tridentate complexes. A simulation of the available literature datasets was used to validate the Mono model, with logKMS=2.91±0.04, i.e. the monodentate hypothesis. This study highlighted the importance of thiol groups in OM reactivity and, notably, determined the As(III) concentration bound to OM (considering that Fe is lacking or at least negligible) and was used to develop a model that is able to determine the As(III) concentrations bound to OM. Copyright © 2015. Published by Elsevier Inc.

  10. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    KAUST Repository

    Boudellioua, Imene

    2016-07-08

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations.

  11. Apoptosis-Inducing Effect of Three Medicinal Plants on Oral Cancer Cells KB and ORL-48

    Directory of Open Access Journals (Sweden)

    Mohd Zabidi Majid

    2014-01-01

    Full Text Available Brucea javanica, Azadirachta indica, and Typhonium flagelliforme are medicinal plants commonly used to treat conditions associated with tumour formation. This study aimed to determine the antiproliferative activity of these plants extracts on KB and ORL-48 oral cancer cell lines and to suggest their mode of cell death. The concentration producing 50% cell inhibition (IC50 was determined and the activity was examined under an inverted microscope. Immunohistochemistry fluorescent staining method (TUNEL was performed to indicate the mechanism of cell death and the fragmented DNA band pattern produced was obtained for verification. Compared to Azadirachta sp. and Typhonium sp., the antiproliferative activity of Brucea sp. extract was the most potent on both KB and ORL-48 cells with IC50 of 24.37 ± 1.75 and 6.67 ± 1.15 µg/mL, respectively. Signs of cell attrition were observed 24 hr after treatment. Green fluorescent spots indicating cell death by apoptosis were observed in images of both cells following treatment with all the three extracts. DNA fragments harvested from Brucea-treated cells produced bands in a ladder pattern suggesting the apoptotic effect of the extract. It is thus concluded that Brucea sp. extract exhibited cytotoxic activity on ORL-48 cells and their action mechanism is via apoptosis.

  12. VenomKB, a new knowledge base for facilitating the validation of putative venom therapies.

    Science.gov (United States)

    Romano, Joseph D; Tatonetti, Nicholas P

    2015-11-24

    Animal venoms have been used for therapeutic purposes since the dawn of recorded history. Only a small fraction, however, have been tested for pharmaceutical utility. Modern computational methods enable the systematic exploration of novel therapeutic uses for venom compounds. Unfortunately, there is currently no comprehensive resource describing the clinical effects of venoms to support this computational analysis. We present VenomKB, a new publicly accessible knowledge base and website that aims to act as a repository for emerging and putative venom therapies. Presently, it consists of three database tables: (1) Manually curated records of putative venom therapies supported by scientific literature, (2) automatically parsed MEDLINE articles describing compounds that may be venom derived, and their effects on the human body, and (3) automatically retrieved records from the new Semantic Medline resource that describe the effects of venom compounds on mammalian anatomy. Data from VenomKB may be selectively retrieved in a variety of popular data formats, are open-source, and will be continually updated as venom therapies become better understood.

  13. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    Energy Technology Data Exchange (ETDEWEB)

    Tennyson, C.N.; Worton, R.G. [Univ. of Toronto and the Hospital for Sick Children, Ontario (Canada)

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  14. A sequential binding mechanism in a PDZ domain

    DEFF Research Database (Denmark)

    Chi, Celestine N; Bach, Anders; Engström, Åke

    2009-01-01

    that ligand binding involves at least a two-step process. By using an ultrarapid continuous-flow mixer, we then detected a hyperbolic dependence of binding rate constants on peptide concentration, corroborating the two-step binding mechanism. Furthermore, we found a similar dependence of the rate constants...

  15. Identification of ten KB425796-A congeners from Paenibacillus sp. 530603 using an antifungal assay against Aspergillus fumigatus in combination with micafungin.

    Science.gov (United States)

    Kai, Hirohito; Yamashita, Midori; Takase, Shigehiro; Hashimoto, Michizane; Muramatsu, Hideyuki; Nakamura, Ikuko; Yoshikawa, Koji; Kanasaki, Ryuichi; Ezaki, Masami; Nitta, Kumiko; Watanabe, Masato; Inamura, Noriaki; Fujie, Akihiko

    2013-08-01

    The discovery and characterization of natural congeners is one approach for understanding the relationship between chemical structure and biological function. We recently isolated the novel antifungal metabolite KB425796-A produced by the recently isolated bacterium Paenibacillus sp. 530603. On the basis of morphological changes of Aspergillus fumigatus induced by KB425796-A in combination with micafungin, we developed a highly sensitive screening method for the specific detection of KB425796-A congeners. Using this method, we isolated ten congeners of KB425796-A, named KB425796-B, -C, -D, -E, -F, -G, -H, -I, -J and -K, which exhibited diverse antifungal potencies against A. fumigatus. One of the most potent congeners, KB425796-C, had antifungal activities against several micafungin-resistant infectious fungi. KB425796-C can be a potential drug candidate for treating micafungin-resistant fungal infections.

  16. K-B microfocusing system using monolithic flexure-hinge mirrors for synchrotron X-rays

    CERN Document Server

    Chen, S J; Tseng, P C; Kuan, C K; Wang, D J; Chen, C T

    2001-01-01

    A Kirkpatrick-Baez (K-B) mirror system is designed while considering gain, efficiency, and focal spot size to theoretically achieve a spot size of 6.7x2.9 mu m sup 2 and a gain of 6.2x10 sup 3 in the elliptical polarization undulator (EPU) soft X-ray beamline. This mirror system, which contains two high order polynomial corrected cylindrical mirrors (i.e., horizontal microfocusing mirror, HMFM, and vertical microfocusing mirror, VMFM) with a monolithic flexure-hinge design, can collect and microfocus the undulator source into a nearly perfect point image. To ensure that the mirrors are easily mounted and adjusted, a modular system on a rotatable CF flange is designed to independently motorize each mirror with four degrees of freedom.

  17. Binding of naringin and naringenin with hen egg white lysozyme: A spectroscopic investigation and molecular docking study

    Science.gov (United States)

    Das, Sourav; Ghosh, Pooja; Koley, Sudipta; Singha Roy, Atanu

    2018-03-01

    The interactions of naringenin (NG) and naringin (NR) with Hen Egg White Lysozyme (HEWL) in aqueous medium have been investigated using UV-vis spectroscopy, steady-state fluorescence, circular dichroism (CD), Fourier Transform infrared spectroscopy (FT-IR) and molecular docking analyses. Both NG and NR can quench the intrinsic fluorescence of HEWL via static quenching mechanism. At 300 K, the value of binding constant (Kb) of HEWL-NG complex (5.596 ± 0.063 × 104 M- 1) was found to be greater than that of HEWL-NR complex (3.404 ± 0.407 × 104 M- 1). The negative ΔG° values in cases of both the complexes specify the spontaneous binding. The binding distance between the donor (HEWL) and acceptor (NG/NR) was estimated using the Försters theory and the possibility of non-radiative energy transfer from HEWL to NG/NR was observed. The presence of metal ions (Ca2 +, Cu2 + and Fe2 +) decreased the binding affinity of NG/NR towards HEWL. Synchronous fluorescence studies indicate the change in Trp micro-environment due to the incorporation of NG/NR into HEWL. CD and FT-IR studies indicated that the α-helicity of the HEWL was slightly enhanced due to ligand binding. NG and NR inhibited the enzymatic activity of HEWL and exhibited their affinity for the active site of HEWL. Molecular docking studies revealed that both NG and NR bind in the close vicinity of Trp 62 and Trp 63 residues which is vital for the catalytic activity.

  18. DNA-binding, spectroscopic and antimicrobial studies of palladium(II) complexes containing 2,2'-bipyridine and 1-phenylpiperazine

    Science.gov (United States)

    Shoukry, Azza A.; Mohamed, Mervat S.

    2012-10-01

    With the purpose of evaluating the ability of Pd(II) complex to interact with DNA molecule as the main biological target, two new complexes [Pd(bpy)(OH2)2] (1) and [Pd(Phenpip)(OH2)2] (2), where (bpy = 2,2'-bipyridine; Phenpip = 1-phenylpiperazine), have been synthesized and the binding properties of these complexes with CT-DNA were investigated. The intrinsic binding constants (Kb) calculated from UV-Vis absorption studies were 3.78 × 103 M-1 and 4.14 × 103 M-1 for complexes 1 and 2 respectively. Thermal denaturation has been systematically studied by spectrophotometric method and the calculated ΔTm was nearly 5 °C for each complex. All the results suggest an electrostatic and/or groove binding mode for the interaction between the complexes and CT-DNA. The redox behavior of the two complexes in the absence and in the presence of calf thymus DNA has been investigated by cyclic voltammetry. The cyclic voltammogram exhibits one quasi-reversible redox wave. The change in E1/2, ΔEp and Ipc/Ipa supports that the two complexes exhibit strong binding to calf thymus DNA. Further insight into the binding of complexes with CT-DNA has been made by gel electrophoresis, where the binding of complexes is confirmed through decreasing the intensity of DNA bands. The two complexes have been screened for their antimicrobial activities using the disc diffusion method against some selected Gram-positive and Gram-negative bacteria. The activity data showed that both complexes were more active against Gram-negative than Gram-positive bacteria. It may be concluded that the antimicrobial activity of the compounds is related to cell wall structure of bacteria.

  19. ct-DNA Binding and Antibacterial Activity of Octahedral Titanium (IV Heteroleptic (Benzoylacetone and Hydroxamic Acids Complexes

    Directory of Open Access Journals (Sweden)

    Raj Kaushal

    2016-01-01

    Full Text Available Five structurally related titanium (IV heteroleptic complexes, [TiCl2(bzac(L1–4] and [TiCl3(bzac(HL5]; bzac = benzoylacetonate; L1–5 = benzohydroximate (L1, salicylhydroximate (L2, acetohydroximate (L3, hydroxyurea (L4, and N-benzoyl-N-phenyl hydroxylamine (L5, were used for the assessment of their antibacterial activities against ten pathogenic bacterial strains. The titanium (IV complexes (1–5 demonstrated significant level of antibacterial properties as measured using agar well diffusion method. UV-Vis absorption spectroscopic technique was applied, to get a better insight into the nature of binding between titanium (IV complexes with calf thymus DNA (ct-DNA. On the basis of the results of UV-Vis absorption spectroscopy, the interaction between ct-DNA and the titanium (IV complexes is likely to occur through the same mode. Results indicated that titanium (IV complex can bind to calf thymus DNA (ct-DNA via an intercalative mode. The intrinsic binding constant (Kb was calculated by absorption spectra by using Benesi-Hildebrand equation. Further, Gibbs free energy was also calculated for all the complexes.

  20. DNA binding and gel electrophoresis studies of a copper (II) complex containing mixed aliphatic and aromatic dinitrogen ligands.

    Science.gov (United States)

    Shahabadi, Nahid; Darabi, Farivash; Maghsudi, Maryam; Kashanian, Soheila

    2010-06-01

    The interaction of a novel mixed ligand copper (II) complex, [Cu(N-N)(L)(EtOH)](NO(3))(2) . 2H(2)O, in which N-N indicates 2,9-dimethyl-1,10-phenanthroline and L indicates N,N-dimethyltrimethylenediamine with calf thymus DNA was investigated by absorption, circular dichroism, voltammetric, and viscosimetric techniques. The absorption spectra of the complex with calf thymus DNA showed a marked hypochromism in the pi --> pi* and metal to ligand charge transfer (MLCT) transitions, with no obvious red shift attributed to a partial intercalation. The intrinsic binding constant (K(b)) was determined as 2 x 10(5) M(-1). There was slight to appreciable changes in the relative viscosity of DNA, which is consistent with enhanced hydrophobic interaction of the methyl-substituted phen ring and partial intercalation mode of binding. Electrochemical studies showed a decrease in the peak current, which is ascribed to the strong binding between Cu (II) complex and DNA. The fluorescence spectral characteristics showed that the Cu (II) complex is able to displace the methylene blue bound to DNA, but not as complete as intercalative molecules. It is remarkable that this mixed ligand complex, in contrast to [Cu(2,9-dmp)(2)](+) (2,9-dmp = 2,9-dimethyl-1,10-phenanthroline), which fails to cleave DNA, has ability to cleave the supercoiled plasmid DNA.

  1. Spectrophotometric determination of association constant

    DEFF Research Database (Denmark)

    2016-01-01

    Least-squares 'Systematic Trial-and-Error Procedure' (STEP) for spectrophotometric evaluation of association constant (equilibrium constant) K and molar absorption coefficient E for a 1:1 molecular complex, A + B = C, with error analysis according to Conrow et al. (1964). An analysis of the Charg...

  2. Phylogeography, salinity adaptations and metabolic potential of the Candidate Division KB1 Bacteria based on a partial single cell genome.

    Directory of Open Access Journals (Sweden)

    Lisa M Nigro

    2016-08-01

    Full Text Available Deep-sea hypersaline anoxic basins (DHABs and other hypersaline environments contain abundant and diverse microbial life that has adapted to these extreme conditions. The bacterial Candidate Division KB1 represents one of several uncultured groups that has been consistently observed in hypersaline microbial diversity studies. Here we report the phylogeography of KB1, its phylogenetic relationships to Candidate Division OP1 Bacteria, and its potential metabolic and osmotic stress adaptations based on a partial single cell amplified genome (SAG of KB1 from Orca Basin, the largest hypersaline seafloor brine basin in the Gulf of Mexico. Our results are consistent with the hypothesis – previously developed based on 14C incorporation experiments with mixed-species enrichments from Mediterranean seafloor brines - that KB1 has adapted its proteins to elevated intracellular salinity, but at the same time KB1 apparently imports glycine betaine; this compatible solute is potentially not limited to osmoregulation but could also serve as a carbon and energy source.

  3. Identities of P2 and P3 Residues of H-2Kb-Bound Peptides Determine Mouse Ly49C Recognition.

    Directory of Open Access Journals (Sweden)

    Elsa A Marquez

    Full Text Available Ly49 receptors can be peptide selective in their recognition of MHC-I-peptide complexes, affording them a level of discrimination beyond detecting the presence or absence of specific MHC-I allele products. Despite this ability, little is understood regarding the properties that enable some peptides, when bound to MHC-I molecules, to support Ly49 recognition, but not others. Using RMA-S target cells expressing MHC-I molecules loaded with individual peptides and effector cells expressing the ectodomain of the inhibitory Ly49C receptor, we found that two adjacent amino acid residues, P2 and P3, both buried in the peptide binding groove of H-2Kb, determine mouse Ly49C specificity. If both are aliphatic residues, this is supportive. Whereas, small amino acids at P2 and aromatic amino acids at the P3 auxiliary anchor residue are detrimental to Ly49C recognition. These results resemble those with a rat Ly49 where the identity of a peptide anchor residue determines recognition, suggesting that dependence on specific peptide residues buried in the MHC-I peptide-binding groove may be fundamental to Ly49 peptide selectivity and recognition.

  4. Generation of ordered phage sublibraries of YAC clones: construction of a 400-kb phage contig in the human dystrophin gene.

    Science.gov (United States)

    Whittaker, P A; Wood, L; Mathrubutham, M; Anand, R

    1993-02-01

    A phage contig of 400 kb that extends from the brain-specific promoter at the 5'-end of the human dystrophin gene, through the muscle-specific promoter over 100 kb further downstream, and across most of intron 1 has been assembled. To achieve this, a yeast artificial chromosome (YAC) subcloning approach was used. Total DNA from a yeast strain containing a 400-kb YAC from the dystrophin gene was cloned using a lambda phage vector containing RNA polymerase promoters flanking the cloning sites. Phage containing human DNA inserts were then ordered into an overlapping set by hybridization of end-specific RNA probes from individual clones back to plaque lifts of gridded phage subclones. The clones generated will be useful as reagents for detailed structural and functional analyses of this region of the dystrophin gene.

  5. Generation of ordered phage sublibraries of YAC clones: Construction of a 400-kb phage contig in the human dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    Whittaker, P.A.; Wood, L.; Mathrubutham, M. (Southampton General Hospital (United Kingdom)); Anand, R. (ICI Pharmaceuticals, Macclesfield Cheshire (United Kingdom))

    1993-02-01

    A phage contig of 400 kb that extends from the brain-specific promoter at the 5[prime]-end of the human dystrophin gene, through the muscle-specific promoter over 100 kb further downstream, and across most of intron 1 has been assembled. To achieve this, a yeast artificial chromosome (YAC) subcloning approach was used. Total DNA from a yeast strain containing a 400-kb YAC from the dystrophin gene was cloned using [lambda] phage vector containing RNA polymerase promoters flanking the cloning sites. Phage containing human DNA inserts were then ordered into an overlapping set by hybridization of end-specific RNA probes from individual clones back to plaque lifts of gridded phage subclones. The clones generated will be useful as reagents for detailed structural and functional analyses of this region of the dystrophin gene. 6 refs., 2 figs.

  6. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1

    International Nuclear Information System (INIS)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-01-01

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1

  7. Na+/Ca2+ exchange inhibitor, KB-R7943, attenuates contrast-induced acute 
kidney injury.

    Science.gov (United States)

    Yang, Dingwei; Yang, Dingping; Jia, Ruhan; Tan, Jin

    2013-01-01

    Intracellular Ca2+ overload is considered to be a key factor in contrast-induced acute kidney injury (CI-AKI). The Na+/Ca2+ exchanger (NCX) system is one of the main pathways of intracellular Ca2+ overload. We investigated the effects of KB-R7943, an inhibitor of the reverse mode of NCX, on CI-AKI in a rat model. Rats were divided into control group, CI-AKI group and pretreatment groups (with KB-R7943 dose of 5 or 10 mg/kg). CI-AKI was induced by diatrizoate administration in rats with cholesterol-supplemented diet for 8 weeks. Renal function and renal hemodynamics were determined 1 day following contrast medium administration. Renal histopathology was observed by light microscope. Renal tubular apoptosis was examined by TUNEL. Renal endothelin-1 (ET-1) was measured by radioimmunoassay. Renal malondialdehyde (MDA) and catalase (CAT) were measured as oxidative markers. Levels of serum creatinine (Scr), renal ET-1, MDA and CAT, and resistance index (RI) of renal blood vessels increased significantly in CI-AKI rats. The 
increases in Scr and RI of renal blood vessels induced by diatrizoate were suppressed significantly and 
dose-dependently by pretreatment with KB-R7943. Histopathological and TUNEL results showed that 
the contrast medium-induced severe renal tubular 
necrosis and apoptosis were significantly and dose-dependently attenuated by KB-R7943. KB-R7943 significantly suppressed the increment of renal ET-1 content and MDA and CAT level induced by contrast medium administration. Activation of the reverse mode of NCX, followed by ET-1 overproduction and increased oxidative stress, seems to play an important role in the pathogenesis of CI-AKI. The inhibitor of the reverse mode of NCX, KB-R7943, has renoprotective effects on CI-AKI.

  8. miR-195 Inhibits Tumor Progression by Targeting RPS6KB1 in Human Prostate Cancer.

    Science.gov (United States)

    Cai, Chao; Chen, Qing-Biao; Han, Zhao-Dong; Zhang, Yan-Qiong; He, Hui-Chan; Chen, Jia-Hong; Chen, Yan-Ru; Yang, Sheng-Bang; Wu, Yong-Ding; Zeng, Yan-Ru; Qin, Guo-Qiang; Liang, Yu-Xiang; Dai, Qi-Shan; Jiang, Fu-Neng; Wu, Shu-lin; Zeng, Guo-Hua; Zhong, Wei-De; Wu, Chin-Lee

    2015-11-01

    To investigate the involvement of hsa-miRNA-195-5p (miR-195) in progression and prognosis of human prostate cancer. qRT-PCR was performed to detect miR-195 expression in both prostate cancer cell lines and clinical tissue samples. Its clinical significance was statistically analyzed. The roles of miR-195 and its candidate target gene, ribosomal protein S6 kinase, 70 kDa, polypeptide 1 (RPS6KB1) in prostate cancer progression were confirmed on the basis of both in vitro and in vivo systems. miR-195 downregulation in prostate cancer tissues was significantly associated with high Gleason score (P = 0.001), positive metastasis failure (P biochemical recurrence (BCR, P cancer patients (P = 0.022). Then, we confirmed the tumor suppressive role of miR-195 through prostate cancer cell invasion, migration, and apoptosis assays in vitro, along with tumor xenograft growth, angiogenesis, and invasion in vivo according to both gain-of-function and loss-of-function experiments. In addition, RPS6KB1 was identified as a novel direct target of miR-195 through proteomic expression profiling combined with bioinformatic target prediction and luciferase reporter assay. Moreover, the reexpression and knockdown of RPS6KB1 could respectively rescue and imitate the effects induced by miR-195. Importantly, RPS6KB1 expression was closely correlated with aggressive progression and poor prognosis in prostate cancer patients as opposed to miR-195. Furthermore, we identified MMP-9, VEGF, BAD, and E-cadherin as the downstream effectors of miR-195-RPS6KB1 axis. The newly identified miR-195-RPS6KB1 axis partially illustrates the molecular mechanism of prostate cancer progression and represents a novel potential therapeutic target for prostate cancer treatment. ©2015 American Association for Cancer Research.

  9. Chemoresistance to 5-FU inhibited by 635 nm LED irradiation in CD133+ KB cell line.

    Science.gov (United States)

    Kim, Donghwi; Park, Mineon; Jang, Hyunwoong; Hyun, Hoon; Lim, Wonbong

    2018-01-01

    Consistent with cancer stem cell theory, a small fraction of cancer cells, described as cancer stem cells (CSCs), may promote tumor recurrence and anti-cancer drug resistance. Therefore, much effort has been devoted to the development of CSC targeted therapy to vanquish drug resistance. In this study, we have investigated the effect of multiple light-emitting diode (LED) irradiation treatments with conventional anti-cancer drugs on CSC-like oral cancer cells that acquired stemness by ectopic over expression of CD133. To evaluate combined LED irradiation anti-cancer drug effects, we investigated the chemosensitizing effect of 635 nm irradiation on 5-fluorouracil (5FU)-treated KB CD133+ and KB Vec cells, interrogating the underlying molecular mechanisms associated with stemness and apoptosis that are responsible for chemopreventive activity. In addition, combination therapy with LED irradiation and 5-FU treatment was carried out in KB CD133+ and KB Vec cell-inoculated mouse models. LED irradiation of 635 nm inhibited CSC-like properties consistent with a decrease in OCT4 and NANOG protein expression, reducing colony-forming ability. In addition, LED irradiation enhanced 5-FU-induced cytotoxicity and improved 5-FU chemosensitivity in KB CD133+ via enhancement of apoptosis. These findings were validated in vivo, wherein LED irradiation combined with 5-FU treatment inhibited tumor growth in KB CD133+ -inoculated mice. Collectively, our results provide novel evidence for 635 nm irradiation-induced 5-FU chemosensitization of CSC in oral cancer. In addition, this research highlights that 635 nm LED irradiation may serve as an adjunct treatment to conventional chemotherapeutic drugs in patients with oral cancer.

  10. rsfMRI effects of KB220Z™ on Neural Pathways in Reward Circuitry of Abstinent Genotyped Heroin Addicts

    Science.gov (United States)

    Blum, Kenneth; Liu, Yijun; Wang, Wei; Wang, Yarong; Zhang, Yi; Oscar-Berman, Marlene; Smolen, Andrew; Febo, Marcelo; Han, David; Simpatico, Thomas; Cronjé, Frans J; Demetrovics, Zsolt; Gold, Mark S.

    2016-01-01

    Recently Willuhn et al. reported that cocaine use and even non-substance related addictive behavior, increases, as dopaminergic function is reduced. Chronic cocaine exposure has been associated with decreases in D2/D3 receptors, also associated with lower activation to cues in occipital cortex and cerebellum in a recent PET study from Volkow’s group. Therefore, treatment strategies, like dopamine agonist therapy, that might conserve dopamine function may be an interesting approach to relapse prevention in psychoactive drug and behavioral addictions. To this aim, we evaluated the effect of KB220Z™ on reward circuitry of ten heroin addicts undergoing protracted abstinence, an average 16.9 months. In a randomized placebo-controlled crossover study of KB220Z™ five subjects completed a triple blinded–experiment in which the subject, the person administering the treatment and the person evaluating the response to treatment were blinded as to which treatment any particular subject was receiving. In addition, nine subjects total were genotyped utilizing the GARSRX™ test. We preliminarily report that KB220Z ™ induced an increase in BOLD activation in caudate-accumbens-dopaminergic pathways compared to placebo following one-hour acute administration. Furthermore, KB220Z™ also reduced resting state activity in the putamen of abstinent heroin addicts. In the second phase of this pilot study of all ten abstinent heroin-dependent subjects, three brain regions of interest (ROIs) we observed to be significantly activated from resting state by KB220Z compared to placebo (P addiction by direct or indirect dopaminergic interaction. Due to small sample size, we caution definitive interpretation of these preliminary results and confirmation with additional research and ongoing rodent and human studies of KB220Z, is required. PMID:25526228

  11. PERSEPSI PRIA DAN HUBUNGANNYA DALAM KEIKUTSERTAAN PROGRAM KB METODE OPERATIF PRIA DI KECAMATAN SEMARANG BARAT KOTA SEMARANG

    Directory of Open Access Journals (Sweden)

    Yulanda Datu Febriani

    2016-01-01

    Full Text Available Program KB nasional menargetkan keikutsertaan pria dalam MOP sebesar 29.825 pada tahun 2014. Namun pada kenyataannya baru memenuhi 19,68% dari total sasaran. Penelitian ini bertujuan untuk mengetahui bagaimana persepsi pria mengenai KB MOP dan hubungannya dengan keikutsertaan Program KB MOP. Jenis penelitian ini menggunakan metode penelitian kualitatif dengan teknik pengambilan informan purposive sampling. Informan terdiri dari 5 orang akseptor KB MOP, 2 orang petugas PLKB, dan 2 orang kader KB. Teknik pengambilan data yang digunakan berupa wawancara mendalam. Teknik analisis data yang digunakan yaitu pengumpulan data, reduksi data, sajian data dan verifikasi data. Hasil penelitian menunjukkan bahwa semua informan berpartisipasi dalam program KB MOP karena kondisi fisik istri informan yang tidak memungkinkan untuk menggunakan alat kontrasepsi. Informan berpersepsi bahwa dengan mengikuti KB MOP akan bermanfaat bagi keluarganya, dari segi kesehatan dan segi ekonomi. Informan menyatakan tidak mengalami hambatan apapun dalam mengikuti KB MOP baik dari segi larangan agama, pembiayaan, seksualitas, dan keluhan medis. Informan mendapatkan dukungan dari istri maupun kerabat mereka. The national contraceptive program targeting male contraceptive method in 2014 by 29.825 participation. But in fact, there was only fulfil 19,68% from total national target. The purpose of this research was to know the men’s perception about male contraceptive methode and its relation in men contraceptive program. This research was a qualitative research with purposive sampling technique. Informants for this research were 5 acceptors of vasectomy, 2 officer of PLKB, and 2 cadres. Data items were collected by indepth interview. Data items were analyzed by data collection, data reduction, data presentation and data verification. The result showed that all of informants agreed to involve in male contraception program or vasectomy because of their wife’s phisical condition

  12. Determination of Rate Constants and Equilibrium Constants for Solution-Phase Drug–Protein Interactions by Ultrafast Affinity Extraction

    Science.gov (United States)

    2015-01-01

    A method was created on the basis of ultrafast affinity extraction to determine both the dissociation rate constants and equilibrium constants for drug–protein interactions in solution. Human serum albumin (HSA), an important binding agent for many drugs in blood, was used as both a model soluble protein and as an immobilized binding agent in affinity microcolumns for the analysis of free drug fractions. Several drugs were examined that are known to bind to HSA. Various conditions to optimize in the use of ultrafast affinity extraction for equilibrium and kinetic studies were considered, and several approaches for these measurements were examined. The dissociation rate constants obtained for soluble HSA with each drug gave good agreement with previous rate constants reported for the same drugs or other solutes with comparable affinities for HSA. The equilibrium constants that were determined also showed good agreement with the literature. The results demonstrated that ultrafast affinity extraction could be used as a rapid approach to provide information on both the kinetics and thermodynamics of a drug–protein interaction in solution. This approach could be extended to other systems and should be valuable for high-throughput drug screening or biointeraction studies. PMID:24911267

  13. Synthesis and Structural Investigation of New Bio-Relevant Complexes of Lanthanides with 5-Hydroxyflavone: DNA Binding and Protein Interaction Studies

    Directory of Open Access Journals (Sweden)

    Alexandra-Cristina Munteanu

    2016-12-01

    Full Text Available In the present work, we attempted to develop new metal coordination complexes of the natural flavonoid 5-hydroxyflavone with Sm(III, Eu(III, Gd(III, Tb(III. The resultant hydroxo complexes have been characterized by a variety of spectroscopic techniques, including fluorescence, FT-IR, UV-Vis, EPR and mass spectral studies. The general chemical formula of the complexes is [Ln(C15H9O33(OH2(H2Ox]·nH2O, where Ln is the lanthanide cation and x = 0 for Sm(III, x = 1 for Eu(III, Gd(III, Tb(III and n = 0 for Sm(III, Gd(III, Tb(III, n = 1 for Eu(III, respectively. The proposed structures of the complexes were optimized by DFT calculations. Theoretical calculations and experimental determinations sustain the proposed structures of the hydroxo complexes, with two molecules of 5-hydroxyflavone acting as monoanionic bidentate chelate ligands. The interaction of the complexes with calf thymus DNA has been explored by fluorescence titration and UV-Vis absorption binding studies, and revealed that the synthesized complexes interact with DNA with binding constants (Kb ~ 104. Human serum albumin (HSA and transferrin (Tf binding studies have also been performed by fluorescence titration techniques (fluorescence quenching studies, synchronous fluorescence spectra. The apparent association constants (Ka and thermodynamic parameters have been calculated from the fluorescence quenching experiment at 299 K, 308 K, and 318 K. The quenching curves indicate that the complexes bind to HSA with smaller affinity than the ligand, but to Tf with higher binding affinities than the ligand.

  14. Varying Constants, Gravitation and Cosmology.

    Science.gov (United States)

    Uzan, Jean-Philippe

    2011-01-01

    Fundamental constants are a cornerstone of our physical laws. Any constant varying in space and/or time would reflect the existence of an almost massless field that couples to matter. This will induce a violation of the universality of free fall. Thus, it is of utmost importance for our understanding of gravity and of the domain of validity of general relativity to test for their constancy. We detail the relations between the constants, the tests of the local position invariance and of the universality of free fall. We then review the main experimental and observational constraints that have been obtained from atomic clocks, the Oklo phenomenon, solar system observations, meteorite dating, quasar absorption spectra, stellar physics, pulsar timing, the cosmic microwave background and big bang nucleosynthesis. At each step we describe the basics of each system, its dependence with respect to the constants, the known systematic effects and the most recent constraints that have been obtained. We then describe the main theoretical frameworks in which the low-energy constants may actually be varying and we focus on the unification mechanisms and the relations between the variation of different constants. To finish, we discuss the more speculative possibility of understanding their numerical values and the apparent fine-tuning that they confront us with.

  15. Varying Constants, Gravitation and Cosmology

    Directory of Open Access Journals (Sweden)

    Jean-Philippe Uzan

    2011-03-01

    Full Text Available Fundamental constants are a cornerstone of our physical laws. Any constant varying in space and/or time would reflect the existence of an almost massless field that couples to matter. This will induce a violation of the universality of free fall. Thus, it is of utmost importance for our understanding of gravity and of the domain of validity of general relativity to test for their constancy. We detail the relations between the constants, the tests of the local position invariance and of the universality of free fall. We then review the main experimental and observational constraints that have been obtained from atomic clocks, the Oklo phenomenon, solar system observations, meteorite dating, quasar absorption spectra, stellar physics, pulsar timing, the cosmic microwave background and big bang nucleosynthesis. At each step we describe the basics of each system, its dependence with respect to the constants, the known systematic effects and the most recent constraints that have been obtained. We then describe the main theoretical frameworks in which the low-energy constants may actually be varying and we focus on the unification mechanisms and the relations between the variation of different constants. To finish, we discuss the more speculative possibility of understanding their numerical values and the apparent fine-tuning that they confront us with.

  16. Protein binding of psychotropic agents

    International Nuclear Information System (INIS)

    Hassan, H.A.

    1990-01-01

    Based upon fluorescence measurements, protein binding of some psychotropic agents (chlorpromazine, promethazine, and trifluoperazine) to human IgG and HSA was studied in aqueous cacodylate buffer, PH7. The interaction parameters determined from emission quenching of the proteins. The interaction parameters determined include the equilibrium constant (K), calculated from equations derived by Borazan and coworkers, the number of binding sites (n) available to the monomer molecules on a single protein molecule. The results revealed a high level of affinity, as reflected by high values of K, and the existence of specific binding sites, since a limited number of n values are obtained. 39 tabs.; 37 figs.; 83 refs

  17. From the Rydberg constant to the fundamental constants metrology

    International Nuclear Information System (INIS)

    Nez, F.

    2005-06-01

    This document reviews the theoretical and experimental achievements of the author since the beginning of his scientific career. This document is dedicated to the spectroscopy of hydrogen, deuterium and helium atoms. The first part is divided into 6 sub-sections: 1) the principles of hydrogen spectroscopy, 2) the measurement of the 2S-nS/nD transitions, 3) other optical frequency measurements, 4) our contribution to the determination of the Rydberg constant, 5) our current experiment on the 1S-3S transition, 6) the spectroscopy of the muonic hydrogen. Our experiments have improved the accuracy of the Rydberg Constant by a factor 25 in 15 years and we have achieved the first absolute optical frequency measurement of a transition in hydrogen. The second part is dedicated to the measurement of the fine structure constant and the last part deals with helium spectroscopy and the search for optical references in the near infrared range. (A.C.)

  18. Constant fields and constant gradients in open ionic channels.

    Science.gov (United States)

    Chen, D P; Barcilon, V; Eisenberg, R S

    1992-05-01

    Ions enter cells through pores in proteins that are holes in dielectrics. The energy of interaction between ion and charge induced on the dielectric is many kT, and so the dielectric properties of channel and pore are important. We describe ionic movement by (three-dimensional) Nemst-Planck equations (including flux and net charge). Potential is described by Poisson's equation in the pore and Laplace's equation in the channel wall, allowing induced but not permanent charge. Asymptotic expansions are constructed exploiting the long narrow shape of the pore and the relatively high dielectric constant of the pore's contents. The resulting one-dimensional equations can be integrated numerically; they can be analyzed when channels are short or long (compared with the Debye length). Traditional constant field equations are derived if the induced charge is small, e.g., if the channel is short or if the total concentration gradient is zero. A constant gradient of concentration is derived if the channel is long. Plots directly comparable to experiments are given of current vs voltage, reversal potential vs. concentration, and slope conductance vs. concentration. This dielectric theory can easily be tested: its parameters can be determined by traditional constant field measurements. The dielectric theory then predicts current-voltage relations quite different from constant field, usually more linear, when gradients of total concentration are imposed. Numerical analysis shows that the interaction of ion and channel can be described by a mean potential if, but only if, the induced charge is negligible, that is to say, the electric field is spatially constant.

  19. Learning Read-constant Polynomials of Constant Degree modulo Composites

    DEFF Research Database (Denmark)

    Chattopadhyay, Arkadev; Gavaldá, Richard; Hansen, Kristoffer Arnsfelt

    2011-01-01

    Boolean functions that have constant degree polynomial representation over a fixed finite ring form a natural and strict subclass of the complexity class \\textACC0ACC0. They are also precisely the functions computable efficiently by programs over fixed and finite nilpotent groups. This class...... is not known to be learnable in any reasonable learning model. In this paper, we provide a deterministic polynomial time algorithm for learning Boolean functions represented by polynomials of constant degree over arbitrary finite rings from membership queries, with the additional constraint that each variable...

  20. Deoxyribonucleic acid synthesis in synchronized mammalian KB cells infected with herpes simplex virus.

    Science.gov (United States)

    Cohen, G H; Vaughan, R K; Lawrence, W C

    1971-06-01

    We examined the patterns of host cell and virus deoxyribonucleic acid (DNA) synthesis in synchronized cultures of KB cells infected at different stages of the cell cycle with herpes simplex virus (HSV). We found that the initiation of HSV DNA synthesis, we well as the production of new infectious virus, is independent of the S, G1, and G2 phases of the mitotic cycle of the host cell. This is in contrast to data previously found with equine abortion virus. Because HSV replicates independently of the cell cycle, we were able to establish conditions that would permit the study of rates of HSV DNA synthesized in logarithmically growing cells in the virtual absence of cellular DNA synthesis. This eliminates the need for separation of viral and cellular DNA by isopycnic centrifugation in CsCl. We found that HSV DNA synthesis was initiated between 2 to 3 hr after infection. The rate of DNA synthesis increased rapidly, reaching a maximum 4 hr after infection, and decreased to 50% of maximum by 8 hr. Evidence is also presented which suggests that HSV infection can inhibit both the ongoing synthesis of host DNA as well as the initiation of the S phase.

  1. Analysis of gene and protein name synonyms in Entrez Gene and UniProtKB resources

    KAUST Repository

    Arkasosy, Basil

    2013-05-11

    Ambiguity in texts is a well-known problem: words can carry several meanings, and hence, can be read and interpreted differently. This is also true in the biological literature; names of biological concepts, such as genes and proteins, might be ambiguous, referring in some cases to more than one gene or one protein, or in others, to both genes and proteins at the same time. Public biological databases give a very useful insight about genes and proteins information, including their names. In this study, we made a thorough analysis of the nomenclatures of genes and proteins in two data sources and for six different species. We developed an automated process that parses, extracts, processes and stores information available in two major biological databases: Entrez Gene and UniProtKB. We analysed gene and protein synonyms, their types, frequencies, and the ambiguities within a species, in between data sources and cross-species. We found that at least 40% of the cross-species ambiguities are caused by names that are already ambiguous within the species. Our study shows that from the six species we analysed (Homo Sapiens, Mus Musculus, Arabidopsis Thaliana, Oryza Sativa, Bacillus Subtilis and Pseudomonas Fluorescens), rice (Oriza Sativa) has the best naming model in Entrez Gene database, with low ambiguities between data sources and cross-species.

  2. A 660-Kb Deletion with Antagonistic Effects on Fertility and Milk Production Segregates at High Frequency in Nordic Red Cattle

    DEFF Research Database (Denmark)

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole

    The spectacular increase in productivity of dairy cattle has been accompanied by a decline in fertility. It is assumed that this reduction is due to the negative energy balance of high producing cows. We herein describe the dissection of a fertility QTL in Nordic Red cattle to a 660-Kb deletion o...

  3. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  4. Geomechanical modeling of surface uplift around well KB-502 at the in Salah CO2 storage site

    NARCIS (Netherlands)

    Fokker, P.A.; Orlic, B.; Meer, L.G.H. van der; Geel, C.R.

    2011-01-01

    Injection of CO2 in the InSalah field has caused uplift of the surface, as observed by satellite geodetic techniques (InSAR). Around one of the wells, KB-502, the uplift shows anomalous behaviour: a two-lobe pattern develops in the direction of the preferred fracture orientation. This indicates the

  5. From the Rydberg constant to the fundamental constants metrology; De la constante de Rydberg a la metrologie des constantes fondamentales

    Energy Technology Data Exchange (ETDEWEB)

    Nez, F

    2005-06-15

    This document reviews the theoretical and experimental achievements of the author since the beginning of his scientific career. This document is dedicated to the spectroscopy of hydrogen, deuterium and helium atoms. The first part is divided into 6 sub-sections: 1) the principles of hydrogen spectroscopy, 2) the measurement of the 2S-nS/nD transitions, 3) other optical frequency measurements, 4) our contribution to the determination of the Rydberg constant, 5) our current experiment on the 1S-3S transition, 6) the spectroscopy of the muonic hydrogen. Our experiments have improved the accuracy of the Rydberg Constant by a factor 25 in 15 years and we have achieved the first absolute optical frequency measurement of a transition in hydrogen. The second part is dedicated to the measurement of the fine structure constant and the last part deals with helium spectroscopy and the search for optical references in the near infrared range. (A.C.)

  6. Systematics of constant roll inflation

    Science.gov (United States)

    Anguelova, Lilia; Suranyi, Peter; Wijewardhana, L. C. R.

    2018-02-01

    We study constant roll inflation systematically. This is a regime, in which the slow roll approximation can be violated. It has long been thought that this approximation is necessary for agreement with observations. However, recently it was understood that there can be inflationary models with a constant, and not necessarily small, rate of roll that are both stable and compatible with the observational constraint ns ≈ 1. We investigate systematically the condition for such a constant-roll regime. In the process, we find a whole new class of inflationary models, in addition to the known solutions. We show that the new models are stable under scalar perturbations. Finally, we find a part of their parameter space, in which they produce a nearly scale-invariant scalar power spectrum, as needed for observational viability.

  7. Strain fluctuations and elastic constants

    Energy Technology Data Exchange (ETDEWEB)

    Parrinello, M.; Rahman, A.

    1982-03-01

    It is shown that the elastic strain fluctuations are a direct measure of elastic compliances in a general anisotropic medium; depending on the ensemble in which the fluctuation is measured either the isothermal or the adiabatic compliances are obtained. These fluctuations can now be calculated in a constant enthalpy and pressure, and hence, constant entropy, ensemble due to recent develpments in the molecular dynamics techniques. A calculation for a Ni single crystal under uniform uniaxial 100 tensile or compressive load is presented as an illustration of the relationships derived between various strain fluctuations and the elastic modulii. The Born stability criteria and the behavior of strain fluctuations are shown to be related.

  8. Evolutionary analysis of the 3.3 kb tandem repeat sequence associated with facioscapulohumeral muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Hewitt, J.E.; Clark, L.N.; Wienberg, J. [and others

    1994-09-01

    Facioscapulohumeral muscular dystrophy (FSHD) is an autosomal dominant progressive disorder affecting primarily the facial and shoulder girdle muscles. The FSHD gene has been localized to distal 4q35. Genetic and physical mapping has identified a polymorphic 3.3 kb tandem repeat (D4Z4) which is closely lined to the disease. In the majority of sporadic cases there are de novo DNA rearrangements resulting in loss of an integral number of D4Z4 repeats. Sequencing of D4Z4 showed it to contain two homeoboxes and a previously identified human repeat sequences (L Sau). At present, it is not known how these rearrangements affect the pathogenesis of FSHD; however, D4Z4 clearly has an important function. It is part of a complex, dispersed human tandem repeat family which is evolutionarily conserved with a marked difference in copy number in humans and great apes compared to other species. Given the unique structure and organization of the D4Z4 repeat and its role in the FSHD disease mechanism, we have further investigated the evolutionary conservation of D4Z4. Comparison of Southern blot data from Old and New World monkeys, great apes, and humans shows that this increase in the number of D4Z4-like loci occurred after the divergence of great apes and Old World monkeys. The localization of these loci in great apes has been investigated using fluorescent in situ hybridization. These studies provide evidence that the D4Z4 repeat has evolved very recently in the great ape lineage. An understanding of how this repeat family has arisen and identification of the ancestral locus in Old World monkeys should provide clues as to the role of this sequence in FSHD.

  9. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

    Science.gov (United States)

    Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

    2004-11-01

    Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

  10. Non-constant retardation coefficient

    International Nuclear Information System (INIS)

    Wang Zhiming; Gu Zhijie; Yang Yue'e; Li Shushen

    2004-12-01

    Retardation coefficient is one of the important parameters used in transport models describing radionuclide migration in geological media and usually regarded as a constant in the models. The objectives of the work are to understand: (1) Whether the retardation coefficient, R d , is a constant? (2) How much effect is R d on calculated consequence if R d is not constant? (3) Is the retardation coefficient derived from distribution coefficient, k d , according to conventional equation suitable for safety assessment? The objectives are achieved through test and analysis of the test results on radionuclide migration in unsaturated loess. It can be seen from the results that retardation coefficient, R d , of 85 Sr is not constant and increases with water content, θ, under unsaturated condition. R d , of 85 Sr derived from k d according to conventional equation can not be used for safety assessment. R d , used for safety assessment should be directly measured, rather than derived from k d . It is shown from calculation that the effect of R d on calculated consequence is very considerable. (authors)

  11. Universal relation between spectroscopic constants

    Indian Academy of Sciences (India)

    (3) The author has used eq. (6) of his paper to calculate De. This relation leads to a large deviation from the correct value depending upon the extent to which experimental values are known. Guided by this fact, in our work, we used experimentally observed De values to derive the relation between spectroscopic constants.

  12. Determination of the Boltzmann constant using a quasi-spherical acoustic resonator.

    Science.gov (United States)

    Pitre, Laurent; Sparasci, Fernando; Truong, Daniel; Guillou, Arnaud; Risegari, Lara; Himbert, Marc E

    2011-10-28

    The paper reports a new experiment to determine the value of the Boltzmann constant, k(B)=1.3806477(17)×10(-23) J K(-1), with a relative standard uncertainty of 1.2 parts in 10(6). k(B) was deduced from measurements of the velocity of sound in argon, inside a closed quasi-spherical cavity at a temperature of the triple point of water. The shape of the cavity was achieved using an extremely accurate diamond turning process. The traceability of temperature measurements was ensured at the highest level of accuracy. The volume of the resonator was calculated from measurements of the resonance frequencies of microwave modes. The molar mass of the gas was determined by chemical and isotopic composition measurements with a mass spectrometer. Within combined uncertainties, our new value of k(B) is consistent with the 2006 Committee on Data for Science and Technology (CODATA) value: (k(B)(new)/k(B_CODATA)-1)=-1.96×10(-6), where the relative uncertainties are u(r)(k(B)(new))=1.2×10(-6) and u(r)(k(B_CODATA))=1.7×10(-6). The new relative uncertainty approaches the target value of 1×10(-6) set by the Consultative Committee on Thermometry as a precondition for redefining the unit of the thermodynamic temperature, the kelvin.

  13. DNA interaction studies of a copper (II) complex containing an antiviral drug, valacyclovir: the effect of metal center on the mode of binding.

    Science.gov (United States)

    Shahabadi, Nahid; Fatahi, Parvin

    2012-07-01

    The water-soluble complex, [Cu(Val)(2)(NO(3))(2)]; in which Val = valacyclovir, an antiviral drug, has been synthesized and characterized by elemental analysis, furier transfer-infrared, hydrogen nuclear magnetic resonance (H NMR), and UV-Vis techniques. The binding of this Cu (II) complex to calf thymus DNA was investigated using fluorimetry, spectrophotometry, circular dichroism, and viscosimetry. In fluorimetric studies, the enthalpy and entropy of the reaction between the complex and calf-thymus DNA (CT-DNA) showed that the reaction is endothermic (ΔH = 208.22 kJ mol(-1); ΔS = 851.35 J mol(-1)K(-1)). The complex showed the absorption hyperchromism in its ultra violet-visible (UV-Vis) spectrum with DNA. The calculated binding constant, K(b), obtained from UV-Vis absorption studies was 2 × 10(5) M(-1). Moreover, the complex induced detectable changes in the circular dichroism spectrum of CT-DNA, as well as changes in its viscosity. The results suggest that this copper (II) complex interacts with CT-DNA via a groove-binding mode.

  14. Stabilized power constant alimentation; Alimentation regulee a puissance constante

    Energy Technology Data Exchange (ETDEWEB)

    Roussel, L. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1968-06-01

    The study and realization of a stabilized power alimentation variable from 5 to 100 watts are described. In order to realize a constant power drift of Lithium compensated diodes, we have searched a 1 per cent precision of regulation and a response time minus than 1 sec. Recent components like Hall multiplicator and integrated amplifiers give this possibility and it is easy to use permutable circuits. (author) [French] On decrit l'etude et la realisation d'une alimentation a puissance constante reglable dans une gamme de 5 a 100 watts. Prevue pour le drift a puissance constante des diodes compensees au lithium, l'etude a ete menee en vue d'obtenir une precision de regulation de 1 pour cent et un temps de reponse inferieur a la seconde. Des systemes recents tels que multiplicateurs a effet Hall et circuits integres ont permis d'atteindre ce but tout en facilitant l'emploi de modules interchangeables. (auteur)

  15. Constant-bandwidth constant-temperature hot-wire anemometer.

    Science.gov (United States)

    Ligeza, P

    2007-07-01

    A constant-temperature anemometer (CTA) enables the measurement of fast-changing velocity fluctuations. In the classical solution of CTA, the transmission band is a function of flow velocity. This is a minor drawback when the mean flow velocity does not significantly change, though it might lead to dynamic errors when flow velocity varies over a considerable range. A modification is outlined, whereby an adaptive controller is incorporated in the CTA system such that the anemometer's transmission band remains constant in the function of flow velocity. For that purpose, a second feedback loop is provided, and the output signal from the anemometer will regulate the controller's parameters such that the transmission bandwidth remains constant. The mathematical model of a CTA that has been developed and model testing data allow a through evaluation of the proposed solution. A modified anemometer can be used in measurements of high-frequency variable flows in a wide range of velocities. The proposed modification allows the minimization of dynamic measurement errors.

  16. DNA binding propensity and nuclease efficacy of biosensitive Schiff base complexes containing pyrazolone moiety: Synthesis and characterization

    Science.gov (United States)

    Paulpandiyan, Rajakkani; Raman, Natarajan

    2016-12-01

    A series of novel Co(II), Cu(II), Ni(II) and Zn(II) complexes (1-8) were synthesized from pyrazolone precursor Schiff base(s), obtained by the condensation of 4-amino-2,3-dimethyl-1-phenyl-3-pyrazolin-5-one (4-aminoantipyrine) with cinnamaldehyde/benzaldehyde and respective metal(II) chloride. They have been characterized by elemental analysis, magnetic susceptibility, molar conductance measurements, UV-Vis., IR, NMR, ESI mass spectra and EPR studies. These complexes show lower conductance values, supporting their non-electrolytic nature. Spectroscopic and other analytical data of the complexes suggest octahedral geometry. The binding properties of these complexes with DNA have been explored by electronic absorption spectra, cyclic voltammetry and viscosity measurements which reveal that the complexes have the ability to interact with calf thymus DNA (CT DNA) by intercalative mode. The binding constant (Kb) values clearly signify that the complex 1 has more intercalating ability than other complexes. DNA cleavage efficacy of these complexes with pUC18 DNA has been investigated by gel electrophoresis technique. All the complexes have been found to promote cleavage of pUC18 DNA from the super coiled form I to the open circular form II in presence of hydrogen peroxide. The in vitro antibacterial and antifungal assay, investigated by Minimum Inhibitory Concentration (MIC) method indicates that these complexes are good antimicrobial agents against various pathogens.

  17. Single water entropy: hydrophobic crossover and application to drug binding.

    Science.gov (United States)

    Sasikala, Wilbee D; Mukherjee, Arnab

    2014-09-11

    Entropy of water plays an important role in both chemical and biological processes e.g. hydrophobic effect, molecular recognition etc. Here we use a new approach to calculate translational and rotational entropy of the individual water molecules around different hydrophobic and charged solutes. We show that for small hydrophobic solutes, the translational and rotational entropies of each water molecule increase as a function of its distance from the solute reaching finally to a constant bulk value. As the size of the solute increases (0.746 nm), the behavior of the translational entropy is opposite; water molecules closest to the solute have higher entropy that reduces with distance from the solute. This indicates that there is a crossover in translational entropy of water molecules around hydrophobic solutes from negative to positive values as the size of the solute is increased. Rotational entropy of water molecules around hydrophobic solutes for all sizes increases with distance from the solute, indicating the absence of crossover in rotational entropy. This makes the crossover in total entropy (translation + rotation) of water molecule happen at much larger size (>1.5 nm) for hydrophobic solutes. Translational entropy of single water molecule scales logarithmically (Str(QH) = C + kB ln V), with the volume V obtained from the ellipsoid of inertia. We further discuss the origin of higher entropy of water around water and show the possibility of recovering the entropy loss of some hypothetical solutes. The results obtained are helpful to understand water entropy behavior around various hydrophobic and charged environments within biomolecules. Finally, we show how our approach can be used to calculate the entropy of the individual water molecules in a protein cavity that may be replaced during ligand binding.

  18. Cosmological Constant and Local Gravity

    CERN Document Server

    Bernabeu, Jose; Mavromatos, Nick E

    2010-01-01

    We discuss the linearization of Einstein equations in the presence of a cosmological constant, by expanding the solution for the metric around a flat Minkowski space-time. We demonstrate that one can find consistent solutions to the linearized set of equations for the metric perturbations, in the Lorentz gauge, which are not spherically symmetric, but they rather exhibit a cylindrical symmetry. We find that the components of the gravitational field satisfying the appropriate Poisson equations have the property of ensuring that a scalar potential can be constructed, in which both contributions, from ordinary matter and $\\Lambda > 0$, are attractive. In addition, there is a novel tensor potential, induced by the pressure density, in which the effect of the cosmological constant is repulsive. We also linearize the Schwarzschild-de Sitter exact solution of Einstein's equations (due to a generalization of Birkhoff's theorem) in the domain between the two horizons. We manage to transform it first to a gauge in whic...

  19. Evolution of the solar constant

    International Nuclear Information System (INIS)

    Newman, M.J.

    1978-01-01

    The ultimate source of the energy utilized by life on Earth is the Sun, and the behavior of the Sun determines to a large extent the conditions under which life originated and continues to thrive. What can be said about the history of the Sun. Has the solar constant, the rate at which energy is received by the Earth from the Sun per unit area per unit time, been constant at its present level since Archean times. Three mechanisms by which it has been suggested that the solar energy output can vary with time are discussed, characterized by long (approx. 10 9 years), intermediate (approx. 10 8 years), and short (approx. years to decades) time scales

  20. Potential constants of CF4

    International Nuclear Information System (INIS)

    Jones, L.H.; Kennedy, C.; Ekberg, S.

    1978-01-01

    The infrared spectra of the 12 C, 13 C, and 14 C isotopic species of CF 4 have been observed at a resolution of 0.06 cm -1 . In addition to the fundamentals ν 3 and ν 4 a number of combination bands have been observed. Using these results, combined with Raman data in the literature, we have calculated the quadratic valence force field, in terms of force constants as well as compliance constants, with considerably better precision than previously obtained. Interaction displacement coordinates have been calculated and show that stretching one CF bond leads, for minimum energy near equilibrium, to opening up of the angles between the other three bonds as well as to their contraction

  1. Photodissociation constant of NO2

    International Nuclear Information System (INIS)

    Nootebos, M.A.; Bange, P.

    1992-01-01

    The velocity of the dissociation of NO 2 into ozone and NO mainly depends on the ultraviolet sunlight quantity, and with that the cloudiness. A correct value for this reaction constant is important for the accurate modelling of O 3 - and NO 2 -concentrations in plumes of electric power plants, in particular in the case of determination of the amount of photochemical summer smog. An advanced signal processing method (deconvolution, correlation) was applied on the measurements. The measurements were carried out from aeroplanes

  2. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available A ≈ 38kB plasmid (pXF-RIV5 was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51 sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th century.

  3. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Science.gov (United States)

    Rogers, Elizabeth E; Stenger, Drake C

    2012-01-01

    A ≈ 38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th) century.

  4. RADOM, an efficient in vivo method for assembling designed DNA fragments up to 10 kb long in Saccharomyces cerevisiae.

    Science.gov (United States)

    Lin, Qiuhui; Jia, Bin; Mitchell, Leslie A; Luo, Jingchuan; Yang, Kun; Zeller, Karen I; Zhang, Wenqian; Xu, Zhuwei; Stracquadanio, Giovanni; Bader, Joel S; Boeke, Jef D; Yuan, Ying-Jin

    2015-03-20

    We describe rapid assembly of DNA overlapping multifragments (RADOM), an improved assembly method via homologous recombination in Saccharomyces cerevisiae, which combines assembly in yeasto with blue/white screening in Escherichia coli. We show that RADOM can successfully assemble ∼3 and ∼10 kb DNA fragments that are highly similar to the yeast genome rapidly and accurately. This method was tested in the Build-A-Genome course by undergraduate students, where 125 ∼3 kb "minichunks" from the synthetic yeast genome project Sc2.0 were assembled. Here, 122 out of 125 minichunks achieved insertions with correct sizes, and 102 minichunks were sequenced verified. As this method reduces the time-consuming and labor-intensive efforts of yeast assembly by improving the screening efficiency for correct assemblies, it may find routine applications in the construction of DNA fragments, especially in hierarchical assembly projects.

  5. PENICILLIN-BINDING PROTEIN 2X OF STREPTOCOCCUS-PNEUMONIAE - EXPRESSION IN ESCHERICHIA-COLI AND PURIFICATION OF A SOLUBLE ENZYMATICALLY ACTIVE DERIVATIVE

    NARCIS (Netherlands)

    LAIBLE, G; KECK, W; LURZ, R; MOTTL, H; FRERE, JM; JAMIN, M; HAKENBECK, R

    1992-01-01

    A 2.5-kb DNA fragment including the structural gene coding for the penicillin-binding protein 2x (PBP 2x) of Streptococcus pneumoniae has been cloned into the vector pJDC9 and expressed in Escherichia coli. Mapping of RNA polymerase binding sites by electron microscopy indicated that the pbpX

  6. Deletion of 2.7 kb near HOXD3 in an Arabian horse with occipitoatlantoaxial malformation.

    Science.gov (United States)

    Bordbari, M H; Penedo, M C T; Aleman, M; Valberg, S J; Mickelson, J; Finno, C J

    2017-06-01

    In the horse, the term occipitoatlantoaxial malformation (OAAM) is used to describe a developmental defect in which the first cervical vertebra (atlas) resembles the base of the skull (occiput) and the second cervical vertebra (axis) resembles the atlas. Affected individuals demonstrate an abnormal posture and varying degrees of ataxia. The homeobox (HOX) gene cluster is involved in the development of both the axial and appendicular skeleton. Hoxd3-null mice demonstrate a strikingly similar phenotype to Arabian foals with OAAM. Whole-genome sequencing was performed in an OAAM-affected horse (OAAM1) and seven unaffected Arabian horses. Visual inspection of the raw reads within the region of HOXD3 identified a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3. A genotyping assay revealed that both parents of OAAM1 were heterozygous for the deletion. Additional genotyping identified two of 162 heterozygote Arabians, and the deletion was not present in 371 horses of other breeds. Comparative genomics studies have revealed that this region is highly conserved across species and that the entire genomic region between Hoxd4 and Hoxd3 is transcribed in mice. Two additional Arabian foals diagnosed with OAAM (OAAM 2 and 3) were genotyped and did not have the 2.7-kb deletion. Closer examination of the phenotype in these cases revealed notable variation. OAAM3 also had facial malformations and a patent ductus arteriosus, and the actual malformation at the craniocervical junction differed. Genetic heterogeneity may exist across the HOXD locus in Arabian foals with OAAM. © 2017 Stichting International Foundation for Animal Genetics.

  7. Searching for Kaprekar's constants: algorithms and results

    OpenAIRE

    Walden, Byron L.

    2005-01-01

    We examine some new results on Kaprekar's constants, specifically establishing the unique 7-digit (in base 4) and 9-digit (in base 5) Kaprekar's constants and showing that there are no 15-, 21-, 27-, or 33-digit Kaprekar's constants.

  8. A putative autonomous 20.5 kb-CACTA transposon insertion in an F3'H allele identifies a new CACTA transposon subfamily in Glycine max

    Directory of Open Access Journals (Sweden)

    Vodkin Lila

    2008-12-01

    in the gray trichome allele t*. Conclusion The molecular characterization of a 20.5 kb insertion in the flavonoid 3'-hydroxylase (F3'H gene of a soybean gray pubescence allele (t* identified the structure of a CACTA transposon designated Tgmt*. Besides the terminal inverted repeats and subterminal repeated motifs,Tgmt* encoded a large gene with two putative functions that are required for excision and transposition of a CACTA element, a transposase and the DNA binding protein known to associate to the subterminal repeated motifs. The degree of dissimilarity between Tgmt* transposase and subterminal repeated motifs with those of previously characterized defective CACTA elements (Tgm1-7 were evidence of the existence of two subfamilies of CACTA transposons in soybean, an observation not previously reported in other plants. In addition, our analyses of a genetically active and potentially autonomous element sheds light on the complete structure of a soybean element that is useful for annotation of the repetitive fraction of the soybean genome sequence and may prove useful for transposon tagging or transposon display experiments in different genetic lines.

  9. Low power constant fraction discriminator

    International Nuclear Information System (INIS)

    Krishnan, Shanti; Raut, S.M.; Mukhopadhyay, P.K.

    2001-01-01

    This paper describes the design of a low power ultrafast constant fraction discriminator, which significantly reduces the power consumption. A conventional fast discriminator consumes about 1250 MW of power whereas this low power version consumes about 440 MW. In a multi detector system, where the number of discriminators is very large, reduction of power is of utmost importance. This low power discriminator is being designed for GRACE (Gamma Ray Atmospheric Cerenkov Experiments) telescope where 1000 channels of discriminators are required. A novel method of decreasing power consumption has been described. (author)

  10. Can coupling constants be related

    International Nuclear Information System (INIS)

    Nandi, Satyanarayan; Ng, Wing-Chiu.

    1978-06-01

    We analyze the conditions under which several coupling constants in field theory can be related to each other. When the relation is independent of the renormalization point, the relation between any g and g' must satisfy a differential equation as follows from the renormalization group equations. Using this differential equation, we investigate the criteria for the feasibility of a power-series relation for various theories, especially the Weinberg-Salam type (including Higgs bosons) with an arbitrary number of quark and lepton flavors. (orig./WL) [de

  11. Measurement of Newton's gravitational constant

    International Nuclear Information System (INIS)

    Schlamminger, St.; Holzschuh, E.; Kuendig, W.; Nolting, F.; Pixley, R. E.; Schurr, J.; Straumann, U.

    2006-01-01

    A precision measurement of the gravitational constant G has been made using a beam balance. Special attention has been given to determining the calibration, the effect of a possible nonlinearity of the balance and the zero-point variation of the balance. The equipment, the measurements, and the analysis are described in detail. The value obtained for G is 6.674 252(109)(54)x10 -11 m 3 kg -1 s -2 . The relative statistical and systematic uncertainties of this result are 16.3x10 -6 and 8.1x10 -6 , respectively

  12. Exact constants in approximation theory

    CERN Document Server

    Korneichuk, N

    1991-01-01

    This book is intended as a self-contained introduction for non-specialists, or as a reference work for experts, to the particular area of approximation theory that is concerned with exact constants. The results apply mainly to extremal problems in approximation theory, which in turn are closely related to numerical analysis and optimization. The book encompasses a wide range of questions and problems: best approximation by polynomials and splines; linear approximation methods, such as spline-approximation; optimal reconstruction of functions and linear functionals. Many of the results are base

  13. Binding Studies of Lamotrigine with Sera of Different Animal Species

    African Journals Online (AJOL)

    Erah

    into the mechanism of interaction, evaluate the effect of dielectric constant on binding affinity, and to determine the effect of ..... Physico-chemical aspects of protein binding of nimesulide, Ind J. Pharm Sci, 2005; 2: 243-246. 10. Dutta, SK, Basu, SK, Sen KK. Binding of diclofenac sodium with bovine serum albumin at different ...

  14. A Leaf-Inhabiting Endophytic Bacterium, Rhodococcus sp. KB6, Enhances Sweet Potato Resistance to Black Rot Disease Caused by Ceratocystis fimbriata.

    Science.gov (United States)

    Hong, Chi Eun; Jeong, Haeyoung; Jo, Sung Hee; Jeong, Jae Cheol; Kwon, Suk Yoon; An, Donghwan; Park, Jeong Mee

    2016-03-01

    Rhodococcus species have become increasingly important owing to their ability to degrade a wide range of toxic chemicals and produce bioactive compounds. Here, we report isolation of the Rhodococcus sp. KB6, which is a new leaf-inhabiting endophytic bacterium that suppresses black rot disease in sweet potato leaves. We determined the 7.0 Mb draft genome sequence of KB6 and have predicted 19 biosynthetic gene clusters for secondary metabolites, including heterobactins, which are a new class of siderophores. Notably, we showed the first internal colonization of host plants with Rhodococcus sp. KB6 and discuss its potential as a biocontrol agent for sustainable agriculture.

  15. The fundamental constants a mystery of physics

    CERN Document Server

    Fritzsch, Harald

    2009-01-01

    The speed of light, the fine structure constant, and Newton's constant of gravity — these are just three among the many physical constants that define our picture of the world. Where do they come from? Are they constant in time and across space? In this book, physicist and author Harald Fritzsch invites the reader to explore the mystery of the fundamental constants of physics in the company of Isaac Newton, Albert Einstein, and a modern-day physicist

  16. Omnidirectional antenna having constant phase

    Energy Technology Data Exchange (ETDEWEB)

    Sena, Matthew

    2017-04-04

    Various technologies presented herein relate to constructing and/or operating an antenna having an omnidirectional electrical field of constant phase. The antenna comprises an upper plate made up of multiple conductive rings, a lower ground-plane plate, a plurality of grounding posts, a conical feed, and a radio frequency (RF) feed connector. The upper plate has a multi-ring configuration comprising a large outer ring and several smaller rings of equal size located within the outer ring. The large outer ring and the four smaller rings have the same cross-section. The grounding posts ground the upper plate to the lower plate while maintaining a required spacing/parallelism therebetween.

  17. Constant Proportion Debt Obligations (CPDOs)

    DEFF Research Database (Denmark)

    Cont, Rama; Jessen, Cathrine

    2012-01-01

    be made arbitrarily small—and thus the credit rating arbitrarily high—by increasing leverage, but the ratings obtained strongly depend on assumptions on the credit environment (high spread or low spread). More importantly, CPDO loss distributions are found to exhibit a wide range of tail risk measures......Constant Proportion Debt Obligations (CPDOs) are structured credit derivatives that generate high coupon payments by dynamically leveraging a position in an underlying portfolio of investment-grade index default swaps. CPDO coupons and principal notes received high initial credit ratings from...... the major rating agencies, based on complex models for the joint transition of ratings and spreads for all names in the underlying portfolio. We propose a parsimonious model for analysing the performance of CPDO strategies using a top-down approach that captures the essential risk factors of the CPDO. Our...

  18. Protection against SHIV-KB9 Infection by Combining rDNA and rFPV Vaccines Based on HIV Multiepitope and p24 Protein in Chinese Rhesus Macaques

    Directory of Open Access Journals (Sweden)

    Chang Li

    2012-01-01

    Full Text Available Developing an effective vaccine against HIV infection remains an urgent goal. We used a DNA prime/fowlpox virus boost regimen to immunize Chinese rhesus macaques. The animals were challenged intramuscularly with pathogenic molecularly cloned SHIV-KB9. Immunogenicity and protective efficacy of vaccines were investigated by measuring IFN-γ levels, monitoring HIV-specific binding antibodies, examining viral load, and analyzing CD4/CD8 ratio. Results show that, upon challenge, the vaccine group can induce a strong immune response in the body, represented by increased expression of IFN-γ, slow and steady elevated antibody production, reduced peak value of acute viral load, and increase in the average CD4/CD8 ratio. The current research suggests that rapid reaction speed, appropriate response strength, and long-lasting immune response time may be key protection factors for AIDS vaccine. The present study contributes significantly to AIDS vaccine and preclinical research.

  19. Pro-dopamine regulator, KB220Z, attenuates hoarding and shopping behavior in a female, diagnosed with SUD and ADHD.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Steinberg, Bruce; Modestino, Edward J; Fried, Lyle; Baron, David; Siwicki, David; Braverman, Eric R; Badgaiyan, Rajendra D

    2018-03-01

    Background Addictive-like behaviors (e.g., hoarding and shopping) may be the result of the cumulative effects of dopaminergic and other neurotransmitter genetic variants as well as elevated stress levels. We, therefore, propose that dopamine homeostasis may be the preferred goal in combating such challenging and unwanted behaviors, when simple dopaminergic activation through potent agonists may not provide any resolution. Case presentation C.J. is a 38-year-old, single, female, living with her mother. She has a history of substance use disorder as well as attention deficit hyperactivity disorder, inattentive type. She had been stable on buprenorphine/naloxone combination and amphetamine, dextroamphetamine mixed salts for many years when unexpectedly she lost her job for oversleeping and not calling into work. KB200z (a pro-dopamine compound) was added to her regimen for complaints of low drive and motivation. After taking this nutraceutical for 4 weeks, she noticed a marked improvement in her mental status and many behaviors. She noted that her shopping and hoarding addictions had appreciably decreased. Furthermore, her lifelong history of terrifying lucid dreams was eliminated. Finally, she felt more in control; her locus of control shifted from external to more internal. Discussion The hypothesis is that C.J.'s reported, behavioral, and psychological benefits resulted from the pro-dopamine-regulating effect of KB220Z across the brain reward system. Conclusions This effect, we surmise, could be the result of a new dopamine balance, across C.J.'s brain reward system. Dopamine homeostasis is an effect of KB220Z seen in both animal and human placebo-controlled fMRI experiments.

  20. Europium (III) and americium (III) stability constants with humic acid

    International Nuclear Information System (INIS)

    Torres, R.A.; Choppin, G.R.

    1984-01-01

    The stability constants for tracer concentrations of Eu(III) and Am(III) complexes with a humic acid extracted from a lake-bottom sediment were measured using a solvent extraction system. The organic extractant was di(2-ethylhexyl)-phosphoric acid in toluene while the humate aqueous phase had a constant ionic strength of 0.1 M (NaClO 4 ). Aqueous humic acid concentrations were monitored by measuring uv-visible absorbances at approx.= 380 nm. The total carboxylate capacity of the humic acid was determined by direct potentiometric titration to be 3.86 +- 0.03 meq/g. The humic acid displayed typical characteristics of a polyelectrolyte - the apparent pKsub(a), as well as the calculated metal ion stability constants increased as the degree of ionization (α) increased. The binding data required a fit of two stability constants, β 1 and β 2 , such that for Eu, log β 1 = 8.86 α + 4.39, log β 2 = 3.55 α + 11.06 while for Am, log β 1 = 10.58 α + 3.84, log β 2 = 5.32 α + 10.42. With hydroxide, carbonate, and humate as competing ligands, the humate complex associated with the β 1 constant is calculated to be the dominant species for the trivalent actinides and lanthanides under conditions present in natural waters. (orig.)

  1. The effect of Lactobacillus brevis KB290 against irritable bowel syndrome: a placebo-controlled double-blind crossover trial

    Directory of Open Access Journals (Sweden)

    Murakami Katsumi

    2012-08-01

    Full Text Available Abstract Background Irritable bowel syndrome (IBS is a functional disorder of the digestive tract that causes chronic abdominal symptoms. We evaluated the effects of Lactobacillus brevis KB290 (KB290, which has been demonstrated to be effective at improving bowel movements and the composition of intestinal microflora, on IBS symptoms. Methods We performed a placebo control double-blind cross matched trial. Thirty-five males and females (aged 6 years and above who had been diagnosed with IBS according to the Rome III criteria were divided into 2 groups, and after a 4-week pre-trial observation period, they were administered test capsules containing KB290 or placebo for 4 weeks (consumption period I. Then, the capsule administration was suspended for 4 weeks in both groups (washout period, before the opposite capsules were administered for a further 4 weeks (consumption period II. Fecal samples were collected on the first day of the pre-consumption observation period, the last day of consumption period I, the last day of the washout period, and the last day of consumption period II. In addition, the subjects’ IBS symptoms and quality of life (QOL and any adverse events that they experienced were evaluated. Results No significant difference in IBS symptoms was noted among the various periods. However, the mean QOL scores were improved during the test capsule consumption. The frequencies of watery and mushy feces were significantly lower in the test capsule consumption period than during the pre-consumption observation period, and the frequency of abdominal pain was significantly reduced in the test capsule consumption period compared with the other periods. The frequency of the genus Bifidobacterium was significantly higher, and that of the genus Clostridium was significantly lower, after the test capsule consumption than after the placebo consumption. The frequencies of the genera Lactobacillus, Bacteroides, and Enterococcus were also

  2. Novel 31.2 kb α0 Deletion in a Palestinian Family with α-Thalassemia

    DEFF Research Database (Denmark)

    Brieghel, Christian; Birgens, Henrik; Frederiksen, Henrik

    2015-01-01

    A previously unknown α(0) deletion, designated - -(DANE), was found in three generations of a Danish family of Palestinian origin. Six patients were heterozygous and three patients had deletional Hb H (β4) disease with a compound heterozygosity for the common -α(3.7) (rightward) deletion. Multiplex...... ligation-dependent probe amplification (MLPA) supplemented by repeated polymerase chain reaction (PCR) amplification identified the 5' and 3' breakpoints in the α-globin gene cluster. This novel 31.2 kb deletion (NG_000006.1: g.8800_40007del31208) leads to the removal of the HBZ, HBA2 and HBA1 genes....

  3. FluKB: A Knowledge-Based System for Influenza Vaccine Target Discovery and Analysis of the Immunological Properties of Influenza Viruses

    DEFF Research Database (Denmark)

    Simon, Christian; Kudahl, Ulrich Johan; Sun, Jing

    2015-01-01

    responses. FluKB consists of more than 400,000 influenza protein sequences, known epitope data (357 verified T-cell epitopes, 685 HLA binders, and 16 naturally processed MHC ligands), and a collection of 28 influenza antibodies and their structurally defined B-cell epitopes. FluKB was built using amodular......FluKB is a knowledge-based system focusing on data and analytical tools for influenza vaccine discovery. The main goal of FluKB is to provide access to curated influenza sequence and epitope data and enhance the analysis of influenza sequence diversity and the analysis of targets of immune...... framework allowing the implementation of analytical workflows and includes standard search tools, such as keyword search and sequence similarity queries, as well as advanced tools for the analysis of sequence variability.The advanced analytical tools for vaccine discovery include visual mapping of T- and B...

  4. DNA binding studies of Sunset Yellow FCF using spectroscopy, viscometry and electrochemical techniques

    Science.gov (United States)

    Asaadi, Sara; Hajian, Reza

    2017-10-01

    Color is one of the important factors in food industry. All food companies use synthetic pigments to improve the aesthetic of products. Studies on the interaction between deoxyribonucleic acid (DNA) and food dye molecules is important because DNA is responsible for some processes including replication and transcription of cells, mutations, genetic diseases, and some synthetic chemical nucleases. In this study, the molecular interaction between Sunset Yellow FCF (SY) as a common food coloring additive and calf thymus DNA (ct-DNA) has been studied using UV-Vis spectrophotometry, spectrofluorometry, Fourier transform infrared (FTIR) spectroscopy, cyclic voltammetry and viscometry techniques. The binding constant between ct-DNA and SY in phosphate buffer solution (pH 7.4) was calculated as 2.09 × 103 L mol-1. The non-electrostatic bonding constant (K0t) was almost consistent and the ratio of K0t/Kb increased by increasing the ionic strength in the range of 0.01-0.1 mol L-1 of KCl. This observation shows that, the molecular bonding of SY to ct-DNA is a combination of electrostatic and intercalation interactions. In the electrochemical studies, an oxidation peak at 0.71 V and a reduction peak at about 0.63 V was observed with the peak potential difference (ΔEp) of 0.08 V, showing a reversible process. The oxidation and reduction peaks were significantly decreased in the presence of ct-DNA and the reduction peak current shifted to negative values. In spectrofluorometric study, the fluorescence intensity of SY increased dramatically after successive addition of DNA due to the increasing of molecular surface area and decreasing of impact frequency between solvent and SY-DNA adduct. Moreover, viscometric study shows that the increasing of viscosity for SY solution in the presence of DNA is due to the intercalation mechanism with double strand DNA (ds-DNA).

  5. Comparative In Vitro Binding Studies of TiCl2(dpme2, Ti(ada2(bzac2, and TiCl2(bzac(bpme Titanium Complexes with Calf-Thymus DNA

    Directory of Open Access Journals (Sweden)

    Pamita Awasthi

    2015-01-01

    Full Text Available The binding of TiCl2(dpme2 (1, (dpme = 6,6′-dimethyl-2,2′-bipyridine, Ti(ada2(bzac2 (2, (ada = adamantylamine; bzac = benzoylacetone, and TiCl2(bzac(bpme (3, (bpme = 4,4′-dimethyl-2,2′-bipyrdine with calf thymus (ct DNA has been studied by UV-visible spectroscopy, thermal denaturation, and circular dichroism spectroscopy. In UV-visible study complexes 1, 2, and 3 showed red, blue, and red shifts, respectively, upon the addition of ct-DNA along with a significant hyperchromism. The intrinsic binding constants (Kb calculated from UV-visible absorption studies were 2.3 × 103 M−1, 3.3 × 103 M−1 and, 7.1 × 103 M−1 for complexes 1, 2, and 3, respectively. The change in melting temperature (ΔTm was calculated to be 2-3°C for each complex. Circular dichroism (CD study showed blue shift for complex 2 and red shift for complexes 1 and 3 along with rise in molecular ellipticity upon the addition of complexes. Results suggest a binding mode of complex 2 different than 1 and 3.

  6. Arrhenius Rate: constant volume burn

    Energy Technology Data Exchange (ETDEWEB)

    Menikoff, Ralph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-12-06

    A constant volume burn occurs for an idealized initial state in which a large volume of reactants at rest is suddenly raised to a high temperature and begins to burn. Due to the uniform spatial state, there is no fluid motion and no heat conduction. This reduces the time evolu tion to an ODE for the reaction progress variable. With an Arrhenius reaction rate, two characteristics of thermal ignition are illustrated: induction time and thermal runaway. The Frank-Kamenetskii approximation then leads to a simple expression for the adiabatic induction time. For a first order reaction, the analytic solution is derived and used to illustrate the effect of varying the activation temperature; in particular, on the induction time. In general, the ODE can be solved numerically. This is used to illustrate the effect of varying the reaction order. We note that for a first order reaction, the time evolution of the reaction progress variable has an exponential tail. In contrast, for a reaction order less than one, the reaction completes in a nite time. The reaction order also affects the induction time.

  7. A new ternary copper(II) complex derived from 2-(2'-pyridyl)benzimidazole and glycylglycine: synthesis, characterization, DNA binding and cleavage, antioxidation and HSA interaction.

    Science.gov (United States)

    Fu, Xia-Bing; Lin, Zi-Hua; Liu, Hai-Feng; Le, Xue-Yi

    2014-03-25

    A new ternary copper(II)-dipeptide complex [Cu(glygly)(HPB)(Cl)]⋅2H2O (glygly=glycylglycine anion, HPB=2-(2'-pyridyl)benzimidazole) has been synthesized and characterized. The DNA interaction of the complex was studied by spectroscopic methods, viscosity, and electrophoresis measurements. The antioxidant activity was also investigated using the pyrogallol autoxidation assay. Besides, the interaction of the complex with human serum albumin (HSA) in vitro was examined by multispectroscopic techniques. The complex partially intercalated to CT-DNA with a high binding constant (Kb=7.28×10(5) M(-1)), and cleaved pBR322 DNA efficiently via an oxidative mechanism in the presence of Vc, with the HO· and O2(-) as the active species, and the SOD as a promoter. Furthermore, the complex shows a considerable SOD-like activity with the IC50 value of 3.8386 μM. The complex exhibits desired binding affinity to HSA, in which hydrogen bond or vander Waals force played a major role. The alterations of HSA secondary structure induced by the complex were confirmed by UV-visible, CD, synchronous fluorescence and 3D fluorescence spectroscopy. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. A new ternary copper(II) complex derived from 2-(2";-pyridyl)benzimidazole and glycylglycine: Synthesis, characterization, DNA binding and cleavage, antioxidation and HSA interaction

    Science.gov (United States)

    Fu, Xia-Bing; Lin, Zi-Hua; Liu, Hai-Feng; Le, Xue-Yi

    2014-03-01

    A new ternary copper(II)-dipeptide complex [Cu(glygly)(HPB)(Cl)]ṡ2H2O (glygly = glycylglycine anion, HPB = 2-(2";-pyridyl)benzimidazole) has been synthesized and characterized. The DNA interaction of the complex was studied by spectroscopic methods, viscosity, and electrophoresis measurements. The antioxidant activity was also investigated using the pyrogallol autoxidation assay. Besides, the interaction of the complex with human serum albumin (HSA) in vitro was examined by multispectroscopic techniques. The complex partially intercalated to CT-DNA with a high binding constant (Kb = 7.28 × 105 M-1), and cleaved pBR322 DNA efficiently via an oxidative mechanism in the presence of Vc, with the HO· and O2-rad as the active species, and the SOD as a promoter. Furthermore, the complex shows a considerable SOD-like activity with the IC50 value of 3.8386 μM. The complex exhibits desired binding affinity to HSA, in which hydrogen bond or vander Waals force played a major role. The alterations of HSA secondary structure induced by the complex were confirmed by UV-visible, CD, synchronous fluorescence and 3D fluorescence spectroscopy.

  9. Ternary copper(II) complexes with amino acid chains and heterocyclic bases: DNA binding, cytotoxic and cell apoptosis induction properties.

    Science.gov (United States)

    Ma, Tieliang; Xu, Jun; Wang, Yuan; Yu, Hao; Yang, Yong; Liu, Yang; Ding, Weiliang; Zhu, Wenjiao; Chen, Ruhua; Ge, Zhijun; Tan, Yongfei; Jia, Lei; Zhu, Taofeng

    2015-03-01

    Nowadays, chemotherapy is a common means of oncology. However, it is difficult to find excellent chemotherapy drugs. Here we reported three new ternary copper(II) complexes which have potential chemotherapy characteristics with reduced Schiff base ligand and heterocyclic bases (TBHP), [Cu(phen)(TBHP)]H2O (1), [Cu(dpz)(TBHP)]H2O (2) and [Cu(dppz)(TBHP)]H2O (3) (phen=1,10-phenanthroline, dpz=dipyrido [3,2:2',3'-f]quinoxaline, dppz=dipyrido [3,2-a:2',3'-c]phenazine, H2TBHP=2-(3,5-di-tert-butyl-2-hydroxybenzylamino)-2-benzyl-acetic acid). The DNA-binding properties of the complexes were investigated by spectrometric titrations, ethidium bromide displacement experiments and viscosity measurements. The results indicated that the three complexes, especially the complex 13, can strongly bind to calf-thymus DNA (CT-DNA). The intrinsic binding constants Kb of the ternary copper(II) complexes with CT-DNA were 1.37×10(5), 1.81×10(5) and 3.21×10(5) for 1, 2 and 3 respectively. Comparative cytotoxic activities of the copper(II) complexes were also determined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results showed that the ternary copper(II) complexes had significant cytotoxic activity against the human lung cancer (A549), human esophageal cancer (Eca109) and human gastric cancer (SGC7901) cell lines. Cell apoptosis were detected by AnnexinV/PI flow cytometry and by Western blotting with the protein expression of p53, Bax and Bcl-2. All the three copper complexes can effectively induce apoptosis of the three human tumor cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Synergistic antifungal activity of KB425796-C in combination with micafungin against Aspergillus fumigatus and its efficacy in murine infection models.

    Science.gov (United States)

    Kai, Hirohito; Yamashita, Midori; Nakamura, Ikuko; Yoshikawa, Koji; Nitta, Kumiko; Watanabe, Masato; Inamura, Noriaki; Fujie, Akihiko

    2013-08-01

    KB425796-C is a novel antifungal metabolite produced by the newly isolated bacterial strain Paenibacillus sp. No. 530603. This compound is a 40-membered macrocyclic lipopeptidolactone consisting of 12 amino acids and a 3-hydroxy-15-methylpalmitoyl moiety. KB425796-C displayed antifungal activity against micafungin-resistant fungi and was fungicidal to Trichosporon asahii in vitro. In a murine systemic infection model of T. asahii, KB425796-C showed excellent efficacy upon i.p. administration at 32 mg kg(-1). In addition, KB425796-C induced morphological changes in the hyphae of Aspergillus fumigatus and had fungicidal effects in combination with micafungin. In a mouse model of septic A. fumigatus infection, although non-treated mice survived for a maximum of only 6 days, the survival rate of micafungin-treated mice (0.1 mg kg(-1)) increased to 20%, while the survival rate of mice treated with a combination of micafungin (0.1 mg kg(-1)) and KB425796-C (32 mg kg(-1)) increased to 100% during the 31-day post-infection period. Our findings suggest that KB425796-C is a good candidate for the treatment of aspergillosis in combination with micafungin.

  11. Alpinia pricei Rhizome Extracts Induce Cell Cycle Arrest in Human Squamous Carcinoma KB Cells and Suppress Tumor Growth in Nude Mice

    Directory of Open Access Journals (Sweden)

    You-Cheng Hseu

    2011-01-01

    Full Text Available Alpinia pricei has been shown to induce apoptosis in human squamous carcinoma (KB cells. In this study, we report the effectiveness of the ethanol (70% extracts of A. pricei rhizome (AP extracts in terms of tumor regression as determined using both in vitro cell culture and in vivo athymic nude mice models of KB cells. We found that the AP extract (25–200 μg/mL treatment decreased the proliferation of KB cells by arresting progression through the G2/M phase of the cell cycle. This cell cycle blockade was associated with reductions in cyclin A and B1, Cdc2, and Cdc25C, and increased p21/WAF1, Wee1, p53 and phospho-p53 (p-p53 in a dose- and time-dependent manner. Moreover, we found that AP extract treatment decreased metalloproteinase-9 (MMP-9 and urokinase plasminogen activator (u-PA expression, while expression of their endogenous inhibitors, tissue inhibitor of MMP-1 (TIMP-1 and plasminogen activator inhibitor-1 (PAI-1, were increased in KB cells. Furthermore, AP extract treatment effectively delayed tumor incidence in nude mice inoculated with KB cells and reduced the tumor burden. AP extract treatment also induced apoptotic DNA fragmentation, as detected by in situ TUNEL staining. Thus, A. pricei may possess antitumor activity in human squamous carcinoma (KB cells.

  12. Pharmacological characterization and binding modes of novel racemic and optically active phenylalanine-based antagonists of AMPA receptors

    DEFF Research Database (Denmark)

    Szymańska, Ewa; Nielsen, Birgitte; Johansen, Tommy Nørskov

    2017-01-01

    -isomer showing Ki of 1.71 µM at the GluA2 subtype, was found to competitively antagonize GluA2(Q)i receptors in TEVC electrophysiological experiments (Kb = 2.13 µM). Molecular docking experiments allowed us to compare two alternative antagonist binding modes for the synthesized phenylalanines at the GluA2...

  13. Measuring Binding Affinity of Protein-Ligand Interaction Using Spectrophotometry: Binding of Neutral Red to Riboflavin-Binding Protein

    Science.gov (United States)

    Chenprakhon, Pirom; Sucharitakul, Jeerus; Panijpan, Bhinyo; Chaiyen, Pimchai

    2010-01-01

    The dissociation constant, K[subscript d], of the binding of riboflavin-binding protein (RP) with neutral red (NR) can be determined by titrating RP to a fixed concentration of NR. Upon adding RP to the NR solution, the maximum absorption peak of NR shifts to 545 nm from 450 nm for the free NR. The change of the absorption can be used to determine…

  14. Characterization of lactose utilization and β-galactosidase in Lactobacillus brevis KB290, the hetero-fermentative lactic acid bacterium.

    Science.gov (United States)

    Honda, Hiroyuki; Yajima, Nobuhiro; Saito, Tadao

    2012-12-01

    Unlike dairy lactic acid bacteria, Lactobacillus brevis cannot ferment milk. We characterized the lactose utilization by L. brevis KB290. In a carbohydrate fermentation assay using API 50 CHL, we showed during 7 days L. brevis did not ferment lactose. L. brevis grew to the stationary phase in 2 weeks in MRS broth containing lactose as the carbon source. L. brevis slowly consumed the lactose in the medium. L. brevis hydrolyzed lactose and a lactose analog, o-nitrophenyl-β-D-galactopyranoside (ONPGal). This β-galactosidase activity for ONPGal was not repressed by glucose, galactose, fructose, xylose, or maltose showing the microorganism may not have carbon catabolite repression. We purified the L. brevis β-galactosidase using ammonium sulfate precipitation and several chromatographies. The enzyme's molecular weight is estimated at 72 and 37 kDa using SDS-PAGE analysis. The N-terminal amino acid sequence of the larger protein was 90 % similar to the sequence of the putative β-galactosidase (YP_796339) and the smaller protein was identical to the sequence of the putative β-galactosidase (YP_796338) in L. brevis ATCC367. This suggests the enzyme is a heterodimeric β-galactosidase. The specific activity of the purified enzyme for lactose is 55 U/mg. We speculate inhibition of lactose transport delays the lactose utilization in L. brevis KB290.

  15. The mitochondrial genome and a 60-kb nuclear DNA segment from Naegleria fowleri, the causative agent of primary amoebic meningoencephalitis.

    Science.gov (United States)

    Herman, Emily K; Greninger, Alexander L; Visvesvara, Govinda S; Marciano-Cabral, Francine; Dacks, Joel B; Chiu, Charles Y

    2013-01-01

    Naegleria fowleri is a unicellular eukaryote causing primary amoebic meningoencephalitis, a neuropathic disease killing 99% of those infected, usually within 7-14 days. Naegleria fowleri is found globally in regions including the US and Australia. The genome of the related nonpathogenic species Naegleria gruberi has been sequenced, but the genetic basis for N. fowleri pathogenicity is unclear. To generate such insight, we sequenced and assembled the mitochondrial genome and a 60-kb segment of nuclear genome from N. fowleri. The mitochondrial genome is highly similar to its counterpart in N. gruberi in gene complement and organization, while distinct lack of synteny is observed for the nuclear segments. Even in this short (60-kb) segment, we identified examples of potential factors for pathogenesis, including ten novel N. fowleri-specific genes. We also identified a homolog of cathepsin B; proteases proposed to be involved in the pathogenesis of diverse eukaryotic pathogens, including N. fowleri. Finally, we demonstrate a likely case of horizontal gene transfer between N. fowleri and two unrelated amoebae, one of which causes granulomatous amoebic encephalitis. This initial look into the N. fowleri nuclear genome has revealed several examples of potential pathogenesis factors, improving our understanding of a neglected pathogen of increasing global importance. © 2013 The Author(s) Journal of Eukaryotic Microbiology © 2013 International Society of Protistologists.

  16. The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia.

    Science.gov (United States)

    Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei

    2014-04-01

    α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.

  17. Effect of surface charge and agglomerate degree of magnetic iron oxide nanoparticles on KB cellular uptake in vitro.

    Science.gov (United States)

    Ge, Yuqing; Zhang, Yu; Xia, Jingguang; Ma, Ming; He, Shiying; Nie, Fang; Gu, Ning

    2009-10-15

    We synthesized three types of magnetic iron oxide nanoparticles (MNPs), which were meso-2,3-dimercaptosuccinic acid (DMSA) coated MNPs (DMSA@MNPs, 17.3+/-4.8 nm, negative charge), chitosan (CS) coated MNPs (CS@MNPs, 16.5+/-6.1 nm, positive charge) and magnetic nanoparticles agglomerates, formed by electronic aggregation between DMSA@MNPs and CS (CS-DMSA@MNPs, 85.7+/-72.9 nm, positive charge) respectively. The interactions of these MNPs with Oral Squamous Carcinoma Cell KB were investigated. The results showed that cellular uptakes of MNPs were on the dependence of incubation time, nanoparticles concentration and nanoparticles properties such as surface charge, size, etc. The cellular uptake was enhanced with the increase of incubation time and nanoparticles concentration. Although all MNPs could enter to cells, we observed apparent differences in the magnitude of nanoparticles uptaken. The cellular uptake of CS-DMSA@MNPs by KB cells was the highest and that of DMSA@MNPs was the lowest among the three types of MNPs. The same conclusions were drawn via the reduction of water proton relaxation times T(2)(*), resulting from the different iron load of labeled cells using a 1.5T clinical MR imager. The finding of this study will have implications in the chemical design of nanomaterials for biomedical applications.

  18. ESR melting under constant voltage conditions

    Energy Technology Data Exchange (ETDEWEB)

    Schlienger, M.E.

    1997-02-01

    Typical industrial ESR melting practice includes operation at a constant current. This constant current operation is achieved through the use of a power supply whose output provides this constant current characteristic. Analysis of this melting mode indicates that the ESR process under conditions of constant current is inherently unstable. Analysis also indicates that ESR melting under the condition of a constant applied voltage yields a process which is inherently stable. This paper reviews the process stability arguments for both constant current and constant voltage operation. Explanations are given as to why there is a difference between the two modes of operation. Finally, constant voltage process considerations such as melt rate control, response to electrode anomalies and impact on solidification will be discussed.

  19. Lepton decay constants of light mesons

    International Nuclear Information System (INIS)

    Simonov, Yu. A.

    2016-01-01

    A theory of lepton decay constants based on the path-integral formalism is given for chiral and vector mesons. Decay constants of the pseudoscalar and vector mesons are calculated and compared to other existing results.

  20. Capacitive Cells for Dielectric Constant Measurement

    Science.gov (United States)

    Aguilar, Horacio Munguía; Maldonado, Rigoberto Franco

    2015-01-01

    A simple capacitive cell for dielectric constant measurement in liquids is presented. As an illustrative application, the cell is used for measuring the degradation of overheated edible oil through the evaluation of their dielectric constant.

  1. Critical survey of stability constants of EDTA complexes critical evaluation of equilibrium constants in solution stability constants of metal complexes

    CERN Document Server

    Anderegg, G

    2013-01-01

    Critical Survey of Stability Constants of EDTA Complexes focuses on the computations, values, and characteristics of stability constants. The book emphasizes that for a critical discussion of experimentally determined stability constants, it is important to consider the precision of the values that manifests the self-consistency of the constant, taking into consideration the random errors. The publication reviews the stability constants of metal complexes. The numerical calculations affirm the reactions and transformations of metal ions when exposed to varying conditions. The text also present

  2. Surprises in numerical expressions of physical constants

    OpenAIRE

    Amir, Ariel; Lemeshko, Mikhail; Tokieda, Tadashi

    2016-01-01

    In science, as in life, `surprises' can be adequately appreciated only in the presence of a null model, what we expect a priori. In physics, theories sometimes express the values of dimensionless physical constants as combinations of mathematical constants like pi or e. The inverse problem also arises, whereby the measured value of a physical constant admits a `surprisingly' simple approximation in terms of well-known mathematical constants. Can we estimate the probability for this to be a me...

  3. Searching for Kaprekar's constants: algorithms and results

    Directory of Open Access Journals (Sweden)

    Byron L. Walden

    2005-01-01

    Full Text Available We examine some new results on Kaprekar's constants, specifically establishing the unique 7-digit (in base 4 and 9-digit (in base 5 Kaprekar's constants and showing that there are no 15-, 21-, 27-, or 33-digit Kaprekar's constants.

  4. Generalized Euler constants for arithmetical progressions

    Science.gov (United States)

    Dilcher, Karl

    1992-07-01

    The work of Lehmer and Briggs on Euler constants in arithmetical progressions is extended to the generalized Euler constants that arise in the Laurent expansion of ζ(s) about s = 1 . The results are applied to the summation of several classes of slowly converging series. A table of the constants is provided.

  5. Differential dissociation micromethod for the investigation of binding of metandrostenolone (Nerobol) to plasma proteins

    International Nuclear Information System (INIS)

    Bojadzsieva, Milka; Kocsar, Laszlo; Kremmer, Tibor

    1985-01-01

    A micromethod was developed to determine the binding of anabolic streoids to plasma proteins. The new procedure combines precipitation with ammonium sulphate and differential dissociation. The binding parameters (association constant, specific binding capacity) are calculated on the basis of dissociation curves of sup(3)H-metandrostenolone from the precipitated sexual binding globuline. (L.E.)

  6. Differential dissociation micromethod for the investigation of binding of metandrostenolone (Nerobol) to plasma proteins

    Energy Technology Data Exchange (ETDEWEB)

    Bojadzsieva, M.; Kocsar, L. (Orszagos Frederic Joliot-Curie Sugarbiologiai es Sugaregeszseguegyi Kutato Intezet, Budapest (Hungary)); Kremmer, T. (Orszagos Onkologiai Intezet, Budapest (Hungary))

    1985-01-01

    A micromethod was developed to determine the binding of anabolic steroids to plasma proteins. The new procedure combines precipitation with ammonium sulphate and differential dissociation. The binding parameters (association constant, specific binding capacity) are calculated on the basis of dissociation curves of sup(3)H-metandrostenolone from the precipitated sexual binding globuline.

  7. Insulin binding to individual rat skeletal muscles

    International Nuclear Information System (INIS)

    Koerker, D.J.; Sweet, I.R.; Baskin, D.G.

    1990-01-01

    Studies of insulin binding to skeletal muscle, performed using sarcolemmal membrane preparations or whole muscle incubations of mixed muscle or typical red (soleus, psoas) or white [extensor digitorum longus (EDL), gastrocnemius] muscle, have suggested that red muscle binds more insulin than white muscle. We have evaluated this hypothesis using cryostat sections of unfixed tissue to measure insulin binding in a broad range of skeletal muscles; many were of similar fiber-type profiles. Insulin binding per square millimeter of skeletal muscle slice was measured by autoradiography and computer-assisted densitometry. We found a 4.5-fold range in specific insulin tracer binding, with heart and predominantly slow-twitch oxidative muscles (SO) at the high end and the predominantly fast-twitch glycolytic (FG) muscles at the low end of the range. This pattern reflects insulin sensitivity. Evaluation of displacement curves for insulin binding yielded linear Scatchard plots. The dissociation constants varied over a ninefold range (0.26-2.06 nM). Binding capacity varied from 12.2 to 82.7 fmol/mm2. Neither binding parameter was correlated with fiber type or insulin sensitivity; e.g., among three muscles of similar fiber-type profile, the EDL had high numbers of low-affinity binding sites, whereas the quadriceps had low numbers of high-affinity sites. In summary, considerable heterogeneity in insulin binding was found among hindlimb muscles of the rat, which can be attributed to heterogeneity in binding affinities and the numbers of binding sites. It can be concluded that a given fiber type is not uniquely associated with a set of insulin binding parameters that result in high or low binding

  8. Insulin binding to individual rat skeletal muscles

    Energy Technology Data Exchange (ETDEWEB)

    Koerker, D.J.; Sweet, I.R.; Baskin, D.G. (Univ. of Washington, Seattle (USA))

    1990-10-01

    Studies of insulin binding to skeletal muscle, performed using sarcolemmal membrane preparations or whole muscle incubations of mixed muscle or typical red (soleus, psoas) or white (extensor digitorum longus (EDL), gastrocnemius) muscle, have suggested that red muscle binds more insulin than white muscle. We have evaluated this hypothesis using cryostat sections of unfixed tissue to measure insulin binding in a broad range of skeletal muscles; many were of similar fiber-type profiles. Insulin binding per square millimeter of skeletal muscle slice was measured by autoradiography and computer-assisted densitometry. We found a 4.5-fold range in specific insulin tracer binding, with heart and predominantly slow-twitch oxidative muscles (SO) at the high end and the predominantly fast-twitch glycolytic (FG) muscles at the low end of the range. This pattern reflects insulin sensitivity. Evaluation of displacement curves for insulin binding yielded linear Scatchard plots. The dissociation constants varied over a ninefold range (0.26-2.06 nM). Binding capacity varied from 12.2 to 82.7 fmol/mm2. Neither binding parameter was correlated with fiber type or insulin sensitivity; e.g., among three muscles of similar fiber-type profile, the EDL had high numbers of low-affinity binding sites, whereas the quadriceps had low numbers of high-affinity sites. In summary, considerable heterogeneity in insulin binding was found among hindlimb muscles of the rat, which can be attributed to heterogeneity in binding affinities and the numbers of binding sites. It can be concluded that a given fiber type is not uniquely associated with a set of insulin binding parameters that result in high or low binding.

  9. A mononuclear Ni(II) complex with 5,6-diphenyl-3-(2-pyridyl)-1,2,4-triazine: DNA- and BSA-binding and anticancer activity against human breast carcinoma cells.

    Science.gov (United States)

    Anjomshoa, Marzieh; Hadadzadeh, Hassan; Fatemi, Seyed Jamilaldin; Torkzadeh-Mahani, Masoud

    2015-02-05

    DNA- and BSA-binding properties of a mononuclear Ni(II) complex, [Ni(dppt)2Cl2] (dppt = 5,6-diphenyl-3-(2-pyridyl)-1,2,4-triazine), have been investigated under physiological conditions. The interaction of the complex with the fish sperm DNA (FS-DNA) has been studied by UV-Vis absorption, thermal denaturation, viscosity measurement, competitive DNA-binding studies with ethidium bromide (EB) by fluorescence, and gel electrophoresis technique. The experimental results indicate that the complex interacts with DNA by intercalative binding mode. The competitive study with ethidium bromide (EB) shows that the complex competes for the DNA-binding sites with EB and displaces the DNA-bound EB molecule. The interactions of the dppt ligand and the complex with BSA have been studied by UV-Vis absorption and fluorescence spectroscopic techniques. The values of Kb for the BSA-dppt and the BSA-complex systems at room temperature were calculated to be 0.14×10(4) M(-1) and 0.32×10(5) M(-1), respectively, indicating that the complex has stronger tendency to bind with BSA than the dppt ligand. The quenching constants (Ksv), binding constants (Kbin), and number of binding sites (n) at different temperatures, as well as the binding distance (r) and thermodynamic parameters (ΔH°, ΔS° and ΔG°) have been calculated for the BSA-dppt and the BSA-complex systems. The cytotoxicities of the dppt ligand and the complex have been also tested against the human breast adenocarcinoma (MCF-7) cell line using the MTT assay. The results indicate that the dppt ligand and the complex display cytotoxicity against human breast cancer cell lines (MCF-7) with the IC50 values of 17.35 μM and 13.00 μM, respectively. It is remarkable that the complex can introduce as a potential anticancer drug. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Giant panda BAC library construction and assembly of a 650-kb contig spanning major histocompatibility complex class II region

    Directory of Open Access Journals (Sweden)

    Pan Hui-Juan

    2007-09-01

    Full Text Available Abstract Background Giant panda is rare and endangered species endemic to China. The low rates of reproductive success and infectious disease resistance have severely hampered the development of captive and wild populations of the giant panda. The major histocompatibility complex (MHC plays important roles in immune response and reproductive system such as mate choice and mother-fetus bio-compatibility. It is thus essential to understand genetic details of the giant panda MHC. Construction of a bacterial artificial chromosome (BAC library will provide a new tool for panda genome physical mapping and thus facilitate understanding of panda MHC genes. Results A giant panda BAC library consisting of 205,800 clones has been constructed. The average insert size was calculated to be 97 kb based on the examination of 174 randomly selected clones, indicating that the giant panda library contained 6.8-fold genome equivalents. Screening of the library with 16 giant panda PCR primer pairs revealed 6.4 positive clones per locus, in good agreement with an expected 6.8-fold genomic coverage of the library. Based on this BAC library, we constructed a contig map of the giant panda MHC class II region from BTNL2 to DAXX spanning about 650 kb by a three-step method: (1 PCR-based screening of the BAC library with primers from homologous MHC class II gene loci, end sequences and BAC clone shotgun sequences, (2 DNA sequencing validation of positive clones, and (3 restriction digest fingerprinting verification of inter-clone overlapping. Conclusion The identifications of genes and genomic regions of interest are greatly favored by the availability of this giant panda BAC library. The giant panda BAC library thus provides a useful platform for physical mapping, genome sequencing or complex analysis of targeted genomic regions. The 650 kb sequence-ready BAC contig map of the giant panda MHC class II region from BTNL2 to DAXX, verified by the three-step method, offers a

  11. DNA binding properties, histidine interaction and cytotoxicity studies of water soluble ruthenium(ii) terpyridine complexes.

    Science.gov (United States)

    Lazić, Dejan; Arsenijević, Aleksandar; Puchta, Ralph; Bugarčić, Živadin D; Rilak, Ana

    2016-03-21

    In this study, two representatives of previously synthesized ruthenium(ii) terpyridine complexes, i.e., [Ru(Cl-tpy)(en)Cl][Cl] (1) and [Ru(Cl-tpy)(dach)Cl][Cl] (2), were chosen and a detailed study of the kinetic parameters of their reactivity toward l-histidine (l-His), using the UV-Vis and (1)H NMR techniques, was developed. The inner molecular rearrangement from N3-coordinated l-His to the N1 bound isomer, observable in the NMR data, was corroborated by DFT calculations favoring N1 coordination by nearly 4 kcal mol(-1). These two ruthenium(ii) terpyridine complexes were investigated for their interactions with DNA employing UV-Vis spectroscopy, DNA viscosity measurements and fluorescence quenching measurements. The high binding constants obtained in the DNA binding studies (Kb = 10(4)-10(5) M(-1)) suggest a strong binding of the complexes to calf thymus (CT) DNA. Competitive studies with ethidium bromide (EB) showed that the complexes can displace DNA-bound EB, suggesting strong competition with EB (Ksv = 1.5-2.5 × 10(4) M(-1)). In fact, the results indicate that these complexes can bind to DNA covalently and non-covalently. In order to gain insight of the behavior of a neutral compound, besides the four previously synthesized cationic complexes [Ru(Cl-tpy)(en)Cl][Cl] (1), [Ru(Cl-tpy)(dach)Cl][Cl] (2), [Ru(Cl-tpy)(bpy)Cl][Cl] (3) and [Ru(tpy)Cl3] (P2), a new complex, [Ru(Cl-tpy)(pic)Cl] (4), was used in the biological studies. Their cytotoxicity was investigated against three different tumor cell lines, i.e., A549 (human lung carcinoma cell line), HCT116 (human colon carcinoma cell line), and CT26 (mouse colon carcinoma cell line), by the MTT assay. Complexes 1 and 2 showed higher activity than complexes 3, 4 and P2 against all the selected cell lines. The results on in vitro anticancer activity confirmed that only compounds that hydrolyze the monodentate ligand at a reasonable rate show moderate activity, provided that the chelate ligand is a hydrogen bond

  12. Novel 5.712 kb mitochondrial DNA deletion in a patient with Pearson syndrome: a case report.

    Science.gov (United States)

    Park, Joonhong; Ryu, Hyejin; Jang, Woori; Chae, Hyojin; Kim, Myungshin; Kim, Yonggoo; Kim, Jiyeon; Lee, Jae Wook; Chung, Nack-Gyun; Cho, Bin; Suh, Byung Kyu

    2015-05-01

    Pearson marrow‑pancreas syndrome (PS) is a progressive multi‑organ disorder caused by deletions and duplications of mitochondrial DNA (mtDNA). PS is often fatal in infancy, and the majority of patients with PS succumb to the disease before reaching three‑years‑of‑age, due to septicemia, metabolic acidosis or hepatocellular insufficiency. The present report describes the case of a four‑month‑old infant with severe normocytic normochromic anemia, vacuolization of hematopoietic precursors and metabolic acidosis. After extensive clinical investigation, the patient was diagnosed with PS, which was confirmed by molecular analysis of mtDNA. The molecular analysis detected a novel large‑scale (5.712 kb) deletion spanning nucleotides 8,011 to 13,722 of mtDNA, which lacked direct repeats at the deletion boundaries. The present report is, to the best of our knowledge, the first case reported in South Korea.

  13. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    Directory of Open Access Journals (Sweden)

    Person Alexandra M

    2011-11-01

    Full Text Available Abstract Background Along with high affinity binding of epibatidine (Kd1≈10 pM to α4β2 nicotinic acetylcholine receptor (nAChR, low affinity binding of epibatidine (Kd2≈1-10 nM to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after

  14. Modulation of proteolytic polyprotein processing by coxsackievirus mutants resistant to inhibitors targeting phosphatidylinositol-4-kinase IIIβ or oxysterol binding protein

    OpenAIRE

    Lyoo, Heyrhyoung; Dorobantu, Cristina M; van der Schaar, Hilde M; van Kuppeveld, Frank J M

    2017-01-01

    Enteroviruses (e.g. poliovirus, coxsackievirus, and rhinovirus) require several host factors for genome replication. Among these host factors are phosphatidylinositol-4-kinase IIIβ (PI4KB) and oxysterol binding protein (OSBP). Enterovirus mutants resistant to inhibitors of PI4KB and OSBP were previously isolated, which demonstrated a role of single substitutions in the non-structural 3A protein in conferring resistance. Besides the 3A substitutions (i.e., 3A-I54F and 3A-H57Y) in coxsackieviru...

  15. The importance of being (a) constant

    International Nuclear Information System (INIS)

    Levy-Leblond, J.-M.

    1979-01-01

    The author intends to show how the epistemological status of the physical constants bears witness to the development of physical science in general. He classifies the various physical constants into three types, properties of particular physical objects, characteristics of classes of physical phenomena and universal constants. He discusses the phenomena of fundamental constants experiencing a change in their type, at length on the example of two important constants, c and G. He considers Planck's constant and discusses the conceptual role of universal constants in general, as well as some aspects of quantum mechanics which appear in a new light from the proposed point of view. The existence is shown of hidden universal constants, forgotten ones in the realm of classical physics, as well as overlooked ones in modern physics. The velocity of light is studied as an example of general considerations on universal constants, and as a way to approach some epistemological problems of special relativity. Newton's gravitational constant is studied in connection with the interpretation of general relativity. (Auth./C.F.)

  16. Consequences of the discontinuation of the International Protein Index (IPI) database and its substitution by the UniProtKB "complete proteome" sets.

    Science.gov (United States)

    Griss, Johannes; Martín, María; O'Donovan, Claire; Apweiler, Rolf; Hermjakob, Henning; Vizcaíno, Juan Antonio

    2011-11-01

    The International Protein Index (IPI) database has been one of the most widely used protein databases in MS proteomics approaches. Recently, the closure of IPI in September 2011 was announced. Its recommended replacement is the new UniProt Knowledgebase (UniProtKB) "complete proteome" sets, launched in May 2011. Here, we analyze the consequences of IPI's discontinuation for human and mouse data, and the effect of its substitution with UniProtKB on two levels: (i) data already produced and (ii) newly performed experiments. To estimate the effect on existing data, we investigated how well IPI identifiers map to UniProtKB accessions. We found that 21% of human and 10% of mouse identifiers do not map to UniProtKB and would thus be "lost." To investigate the impact on new experiments, we compared the theoretical search space (i.e. the tryptic peptides) of both resources and found that it is decreased by 14.0% for human and 8.9% for mouse data through IPI's closure. An analysis on the experimental evidence for these "lost" peptides showed that the vast majority has not been identified in experiments available in the major proteomics repositories. It thus seems likely that the search space provided by UniProtKB is of higher quality than the one currently provided by IPI. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Effects of KB-R9032, a new Na+/H+ exchange inhibitor, on canine coronary occlusion/reperfusion-induced ventricular arrhythmias.

    Science.gov (United States)

    Yamada, Chikaomi; Xue, YiXue; Chino, Daisuke; Hashimoto, Keitaro

    2005-08-01

    We investigated the effects of KB-R9032 (N-(4-isopropyl-2,2-dimethyl-3-oxo-3,4-dihydro-2H-benzo[1,4]oxazine-6-carbonyl) guanidine methanesulfonate), a new Na(+)/H(+) exchange inhibitor, on a coronary artery occlusion/reperfusion-induced arrhythmia model in pentobarbital anesthetized dogs. KB-R9032 reduced the number of ventricular premature contractions seen during the coronary occlusion, while it did not alter the heart rate, mean blood pressure, or electrocardiographic parameters (PR, QRS, or QTc interval). KB-R9032 also decreased the incidence of fatal ventricular fibrillation during coronary artery occlusion and/or after reperfusion. These antiarrhythmic effects were observed not only in the pre-ischemic administration group, but also in the group given KB-R9032 at the 15th min of the 30-min occlusion. These findings support the view that Na(+)/H(+) exchanger may play an important role in inducing coronary ischemia/reperfusion arrhythmias. This suggests that the use of Na(+)/H(+) exchange inhibitors, such as KB-R9032, may be an effective clinical approach to suppress sudden cardiac death due to acute myocardial ischemia/reperfusion such as during coronary bypass surgery, cardiac valve surgery, or percutaneous transluminal coronary angioplasty.

  18. Antiproliferative activity of flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the MCF7, KB, and NIH/3T3 cell lines.

    Science.gov (United States)

    Nedel, Fernanda; Begnini, Karine; Carvalho, Pedro Henrique de Azambuja; Lund, Rafael Guerra; Beira, Fátima T A; Del Pino, Francisco Augusto B

    2012-11-01

    This study assessed the antiproliferative effect in vitro of the flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the human breast adenocarcinoma (MCF-7), human mouth epidermal carcinoma (KB), and mouse embryonic fibroblast (NIH 3T3) cell lines, using sulforhodamine B (SRB) assay. A cell density of 2×10(4)/well was seeded in 96-well plates, and samples at different concentrations ranging from 10 to 500 mg/mL were tested. The optical density was determined in an ELISA multiplate reader (Thermo Plate TP-Reader). Results demonstrated that the hexane extract presented antiproliferative activity against both the tumor cell lines KB and MCF-7, presenting a GI(50) (MCF-7=13.09 mg/mL), TGI (KB=37.76 mg/mL), and IL(50) (KB=291.07 mg/mL). Also, the hexane extract presented antiproliferative activity toward NIH 3T3 cells GI(50) (183.65 mg/mL), TGI (280.54 mg/mL), and IL(50) (384.59 mg/mL). The results indicate that the flower hexane extract obtained from M. spicata associated with M. rotundifolia presents an antineoplastic activity against KB and MCF-7, although an antiproliferative effect at a high concentration of the extract was observed toward NIH 3T3.

  19. Dendritic cell vaccination induces cross-reactive cytotoxic T lymphocytes specific for wild-type and natural variant human immunodeficiency virus type 1 epitopes in HLA-A*0201/Kb transgenic mice.

    Science.gov (United States)

    Abdel-Motal, U M; Friedline, R; Poligone, B; Pogue-Caley, R R; Frelinger, J A; Tisch, R

    2001-10-01

    Dendritic cells (DC) are highly efficient at inducing primary T cell responses. Consequently, DC are being investigated for their potential to prevent and/or treat human immunodeficiency virus type 1 (HIV-1) infection. In the current study, we examined the capacity of DC to elicit CD8+ cytotoxic T lymphocyte (CTL) reactivity against an HLA-A*0201-restricted HIV-1 reverse transcriptase (pol) epitope (residues 476-484) and two naturally occurring variants. Previous work demonstrated that the wild-type pol epitope is recognized by CTLs from HIV-1-infected individuals, whereas the variant pol epitopes are not, despite binding to HLA-A*0201. In agreement with these observations, parenteral administration of wild-type pol peptide induced HLA-A*0201-restricted CTL activity in A2Kb transgenic mice. In contrast, similar treatment with the two variant pol peptides failed to stimulate CTL reactivity, and this lack of immunogenicity correlated with reduced peptide:HLA-A*0201 complex stability. However, CTL responses were induced in A2Kb transgenic mice upon adoptive transfer of syngeneic bone marrow DC pulsed with the variant pol peptides. Furthermore, DC pulsed with the wild-type pol peptide elicited CTLs that cross-reacted with the variant pol epitopes. These results demonstrate that DC effectively expand the T cell repertoire of a given epitope to include cross-reactive T cell clonotypes. Accordingly, DC vaccination may aid in immune recognition of HIV-1 escape variants by broadening the T cell response. Copyright 2001 Academic Press.

  20. Stability constants of scandium complexes, 1

    International Nuclear Information System (INIS)

    Itoh, Hisako; Itoh, Naomi; Suzuki, Yasuo

    1984-01-01

    The stability constants of scandium complexes with some carboxylate ligands were determined potentiometrically at 25.0 and 40.0 0 C and at an ionic strength of 0.10 with potassium nitrate as supporting electrolyte. The constants of the scandium complexes were appreciably greater than those of the corresponding lanthanoid complexes, as expected. The changes in free energy, enthalpy, and entropy for the formation of the scandium complexes were calculated from the stability constants at two temperatures. (author)

  1. Determination of diffuse double layer protonation constants for hydrous ferric oxide (HFO): supporting evidence for the Dzombak and Morel compilation

    CSIR Research Space (South Africa)

    Pretorius, PJ

    1998-01-01

    Full Text Available of the experimental system suggests that titration points below pH 4 should not be used for the determination of protonation constants because of potential HFO dissolution. Surface protonation constant, PZC and binding site estimates agree excellently with currently...

  2. A natural cosmological constant from chameleons

    Directory of Open Access Journals (Sweden)

    Horatiu Nastase

    2015-07-01

    Full Text Available We present a simple model where the effective cosmological constant appears from chameleon scalar fields. For a Kachru–Kallosh–Linde–Trivedi (KKLT-inspired form of the potential and a particular chameleon coupling to the local density, patches of approximately constant scalar field potential cluster around regions of matter with density above a certain value, generating the effect of a cosmological constant on large scales. This construction addresses both the cosmological constant problem (why Λ is so small, yet nonzero and the coincidence problem (why Λ is comparable to the matter density now.

  3. A natural cosmological constant from chameleons

    Energy Technology Data Exchange (ETDEWEB)

    Nastase, Horatiu, E-mail: nastase@ift.unesp.br [Instituto de Física Teórica, UNESP-Universidade Estadual Paulista, R. Dr. Bento T. Ferraz 271, Bl. II, Sao Paulo 01140-070, SP (Brazil); Weltman, Amanda, E-mail: amanda.weltman@uct.ac.za [Astrophysics, Cosmology & Gravity Center, Department of Mathematics and Applied Mathematics, University of Cape Town, Private Bag, Rondebosch 7700 (South Africa)

    2015-07-30

    We present a simple model where the effective cosmological constant appears from chameleon scalar fields. For a Kachru–Kallosh–Linde–Trivedi (KKLT)-inspired form of the potential and a particular chameleon coupling to the local density, patches of approximately constant scalar field potential cluster around regions of matter with density above a certain value, generating the effect of a cosmological constant on large scales. This construction addresses both the cosmological constant problem (why Λ is so small, yet nonzero) and the coincidence problem (why Λ is comparable to the matter density now)

  4. A natural cosmological constant from chameleons

    International Nuclear Information System (INIS)

    Nastase, Horatiu; Weltman, Amanda

    2015-01-01

    We present a simple model where the effective cosmological constant appears from chameleon scalar fields. For a Kachru–Kallosh–Linde–Trivedi (KKLT)-inspired form of the potential and a particular chameleon coupling to the local density, patches of approximately constant scalar field potential cluster around regions of matter with density above a certain value, generating the effect of a cosmological constant on large scales. This construction addresses both the cosmological constant problem (why Λ is so small, yet nonzero) and the coincidence problem (why Λ is comparable to the matter density now)

  5. Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models*

    Science.gov (United States)

    Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart

    2016-01-01

    Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers. PMID:26912662

  6. Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models.

    Science.gov (United States)

    Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart

    2016-05-06

    Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Synthesis of new piperazine derived Cu(II)/Zn(II) metal complexes, their DNA binding studies, electrochemistry and anti-microbial activity: Validation for specific recognition of Zn(II) complex to DNA helix by interaction with thymine base

    Science.gov (United States)

    Bhat, Irshad-ul-Haq; Tabassum, Sartaj

    2009-06-01

    New 3,4:9,10-dibenzo-2,11-dihydroxy-1,12-bispiperazine-5,8-dioxododecane complexes [C 24H 36N 4O 6Cu] ( 1), [C 24H 32N 4O 4Zn] ( 2) have been synthesized and characterized by elemental analysis, IR, NMR, Mass, EPR, UV-vis spectroscopy and molar conductance measurements. The complexes are non-ionic in nature and possess octahedral geometry around Cu 2+, Zn 2+ central metal ions. The binding studies of 1 and 2 with calf thymus DNA (CT-DNA) were investigated by UV-vis, fluorescence, cyclic voltammetery and viscosity measurements. The calculated binding constant Kb for 1 and 2 obtained from UV-vis absorption studies was 7.6 × 10 3 M -1, 80.8 × 10 4 M -1, respectively. The intrinsic binding constants were also estimated to be 7.0 × 10 4 M -1 and 7.53 × 10 5 M -1 for 1 and 2, respectively by using emission titrations. These experimental results suggest that complexes are groove binders and interact to CT-DNA with different affinities. Both the complexes in presence and absence of CT-DNA show quasireversible wave corresponding to Cu II/Cu I and Zn II/Zn I redox couple. The changes in E1/2, Δ E, Ipa/ Ipc ascertain the interaction of 1 and 2 with CT-DNA. Further, decrease in viscosity of CT-DNA with increasing concentration of complexes was observed. In vitro, antimicrobial activity against fungi A. brassicicola, A. niger and bacteria E. coli, P. aeruginosa of complexes were carried out, which indicate that complex 2 is more active against both fungal and bacterial strains as shown by % inhibition data.

  8. Titration ELISA as a Method to Determine the Dissociation Constant of Receptor Ligand Interaction.

    Science.gov (United States)

    Eble, Johannes A

    2018-02-15

    The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial parameter to compare different ligands, e.g., competitive inhibitors, protein isoforms and mutants, for their binding strength to a binding partner. Dissociation constants are determined by plotting concentrations of bound versus free ligand as binding curves. In contrast, titration curves, in which a signal that is proportional to the concentration of bound ligand is plotted against the total concentration of added ligand, are much easier to record. The signal can be detected spectroscopically and by enzyme-linked immunosorbent assay (ELISA). This is exemplified in a protocol for a titration ELISA that measures the binding of the snake venom-derived rhodocetin to its immobilized target domain of α2β1 integrin. Titration ELISAs are versatile and widely used. Any pair of interacting proteins can be used as immobilized receptor and soluble ligand, provided that both proteins are pure, and their concentrations are known. The difficulty so far has been to determine the dissociation constant from a titration curve. In this study, a mathematical function underlying titration curves is introduced. Without any error-prone graphical estimation of a saturation yield, this algorithm allows processing of the raw data (signal intensities at different concentrations of added ligand) directly by mathematical evaluation via non-linear regression. Thus, several titration curves can be recorded simultaneously and transformed into a set of characteristic parameters, among them the dissociation constant and the concentration of binding-active receptor, and they can be evaluated statistically. When combined with this algorithm, titration ELISAs gain the advantage of directly presenting the dissociation constant. Therefore, they may be used more efficiently in the future.

  9. Fluorescence spectroscopic studies on binding of a flavonoid ...

    Indian Academy of Sciences (India)

    Binding of quercetin to human serum albumin (HSA) was studied and the binding constant measured by following the red-shifted absorption spectrum of quercetin in the presence of HSA and the quenching of the intrinsic protein fluorescence in the presence of different concentrations of quercetin. Fluorescence lifetime ...

  10. Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny.

    Directory of Open Access Journals (Sweden)

    Dorcas J Orengo

    Full Text Available The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO. We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription.

  11. Fundamental Physical Constants: Looking from Different Angles

    OpenAIRE

    Karshenboim, Savely G.

    2005-01-01

    We consider fundamental physical constants which are among a few of the most important pieces of information we have learned about Nature after its intensive centuries-long studies. We discuss their multifunctional role in modern physics including problems related to the art of measurement, natural and practical units, origin of the constants, their possible calculability and variability etc.

  12. Constant Width Planar Computation Characterizes ACC0

    DEFF Research Database (Denmark)

    Hansen, K.A.

    2004-01-01

    We obtain a characterization of ACC 0 in terms of a natural class of constant width circuits, namely in terms of constant width polynomial size planar circuits. This is shown via a characterization of the class of acyclic digraphs which can be embedded on a cylinder surface in such a way that all...

  13. Constant Width Planar Computation Characterizes ACC0

    DEFF Research Database (Denmark)

    Hansen, Kristoffer Arnsfelt

    2006-01-01

    We obtain a characterization of ACC0 in terms of a natural class of constant width circuits, namely in terms of constant width polynomial size planar circuits. This is shown via a characterization of the class of acyclic digraphs which can be embedded on a cylinder surface in such a way that all...

  14. Stability constants for silicate adsorbed to ferrihydrite

    DEFF Research Database (Denmark)

    Hansen, Hans Christian Bruun; Wetche, T.P.; Raulund-Rasmussen, Karsten

    1994-01-01

    Intrinsic surface acidity constants (K(a1)intr, K(a2)intr) and surface complexation constant for adsorption of orthosilicate onto synthetic ferrihydrite (K(Si) for the complex = FeOSi(OH)3) have been determined from acid/base titrations in 0.001-0.1 m NaClO4 electrolytes and silicate adsorption...

  15. On special relativity with cosmological constant

    International Nuclear Information System (INIS)

    Guo Hanying; Huang Chaoguang; Xu Zhan; Zhou Bin

    2004-01-01

    Based on the principle of relativity and the postulate of invariant speed and length, we propose the theory of special relativity with cosmological constant SRc,R, in which the cosmological constant is linked with the invariant length. Its relation with the doubly special relativity is briefly mentioned

  16. The case for the cosmological constant

    Indian Academy of Sciences (India)

    I present a short overview of current observational results and theoretical models for a cosmological constant. The main motivation for invoking a small cosmological constant (or -term) at the present epoch has to do with observations of high redshift Type Ia supernovae which suggest an accelerating universe.

  17. Some zero-sum constants with weights

    Indian Academy of Sciences (India)

    to zero-sum problems, Discrete Math. 306 (2006) 1–10. [2] Adhikari S D and Chen Y G, Davenport constant with weights and some related ques- tions – II, J. Combin. Theory A115 (2008) 178–184. [3] Adhikari Sukumar Das and Rath Purusottam, Davenport constant with weights and some related questions, Integers 6 ...

  18. The time constant of the somatogravic illusion.

    Science.gov (United States)

    Correia Grácio, B J; de Winkel, K N; Groen, E L; Wentink, M; Bos, J E

    2013-02-01

    Without visual feedback, humans perceive tilt when experiencing a sustained linear acceleration. This tilt illusion is commonly referred to as the somatogravic illusion. Although the physiological basis of the illusion seems to be well understood, the dynamic behavior is still subject to discussion. In this study, the dynamic behavior of the illusion was measured experimentally for three motion profiles with different frequency content. Subjects were exposed to pure centripetal accelerations in the lateral direction and were asked to indicate their tilt percept by means of a joystick. Variable-radius centrifugation during constant angular rotation was used to generate these motion profiles. Two self-motion perception models were fitted to the experimental data and were used to obtain the time constant of the somatogravic illusion. Results showed that the time constant of the somatogravic illusion was on the order of two seconds, in contrast to the higher time constant found in fixed-radius centrifugation studies. Furthermore, the time constant was significantly affected by the frequency content of the motion profiles. Motion profiles with higher frequency content revealed shorter time constants which cannot be explained by self-motion perception models that assume a fixed time constant. Therefore, these models need to be improved with a mechanism that deals with this variable time constant. Apart from the fundamental importance, these results also have practical consequences for the simulation of sustained accelerations in motion simulators.

  19. The case for the cosmological constant

    Indian Academy of Sciences (India)

    Abstract. I present a short overview of current observational results and theoretical models for a cosmological constant. The main motivation for invoking a small cosmological constant (orA-term) at the present epoch has to do with observations of high redshift Type Ia supernovae which suggest an accelerating universe.

  20. Equilibrium-constant expressions for aqueous plutonium

    International Nuclear Information System (INIS)

    Silver, G.L.

    2010-01-01

    Equilibrium-constant expressions for Pu disproportionation reactions traditionally contain three or four terms representing the concentrations or fractions of the oxidation states. The expressions can be rewritten so that one of the oxidation states is replaced by a term containing the oxidation number of the plutonium. Experimental estimations of the numerical values of the constants can then be checked in several ways. (author)

  1. DETERMINATION OF STABILITY CONSTANTS OF MANGANESE (II ...

    African Journals Online (AJOL)

    DR. AMINU

    Keywords: Amino acids, dissociation constant, potentiometry, stability constant. INTRODUCTION. Acids – base titration involves the gradual addition or removal of protons for example using the deprotic form of glycine. The plot has two distinct stages corresponding to the deprotonation of the two different groups on glycine.

  2. Effects of taxol and ionizing radiation on cytotoxicity and prostaglandin production in KB, RPMI-2650, SW-13 and L929

    International Nuclear Information System (INIS)

    Lee, Keon Il; Yoo, Dong Soo

    1998-01-01

    The author evaluated the effects of taxol, a microtubular inhibitor, as a possible radiation sensitizer and the production of prostaglandins on three human cancer cell lines (KB, RPMI-2650 and SW-13) and one murine cell line (L929). Each cell line was divided into four groups (control, taxol only, radiation only and combination of taxol and radiation). The treatment consisted of a single irradiation of 10 Gy and graded doses (5, 50, 100, 200, 300, 500 nM) of taxol for a 24-h period. The cytotoxicity of taxol alone was measured at 1 day after (1-day group) and 4 days after (4-day group) the treatment. The survival ratio of cell was analyzed by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyl tetrazolium bromide) test. Prostaglandins (PGE2 and PGI2) were measured in the culture medium by a radioimmunoassay. The results obtained were as follows ; 1. There was a significantly in creased cytotoxicity of KB cells in 4-day group than those in 1-day group. There was a high correlation between doses of taxol and cell viability in both groups (1-day group R=0.82741, 4-day group R=0.84655). 2. There was a significantly increased cytotoxicity of RPMI-2650 cells treated with high concentration of taxol in 4-day group than those in 1-day group. Also there was a high correlation between doses of taxol and cell viability in 4-day group (R=0.93917). 3. There was a significantly increased cytotoxicity of SW-13 cell treated with high concentration of taxol in 4-day group than those in 1-day group. However no high correlation was observed between doses of taxol and cell viability in both groups (1-day group R=0.46362, 4-day group R=0.65425). 4. There was a significantly increased cytotoxicity of L929 cells treated with low concentration of taxol in 4-day group than those in 1-day group. At the same time, there was a low correlation between doses of taxol and cell viability in both groups (1-day group R=0.34237, 4-day group R=0.23381). 5. In 1-day group of L929 cells, higher

  3. Graviton fluctuations erase the cosmological constant

    Science.gov (United States)

    Wetterich, C.

    2017-10-01

    Graviton fluctuations induce strong non-perturbative infrared renormalization effects for the cosmological constant. The functional renormalization flow drives a positive cosmological constant towards zero, solving the cosmological constant problem without the need to tune parameters. We propose a simple computation of the graviton contribution to the flow of the effective potential for scalar fields. Within variable gravity, with effective Planck mass proportional to the scalar field, we find that the potential increases asymptotically at most quadratically with the scalar field. The solutions of the derived cosmological equations lead to an asymptotically vanishing cosmological ;constant; in the infinite future, providing for dynamical dark energy in the present cosmological epoch. Beyond a solution of the cosmological constant problem, our simplified computation also entails a sizeable positive graviton-induced anomalous dimension for the quartic Higgs coupling in the ultraviolet regime, substantiating the successful prediction of the Higgs boson mass within the asymptotic safety scenario for quantum gravity.

  4. Tadpole diagrams in constant electromagnetic fields

    Science.gov (United States)

    Karbstein, Felix

    2017-10-01

    We show how all possible one-particle reducible tadpole diagrams in constant electromagnetic fields can be constructed from one-particle irreducible constant-field diagrams. The construction procedure is essentially algebraic and involves differentiations of the latter class of diagrams with respect to the field strength tensor and contractions with derivatives of the one-particle irreducible part of the Heisenberg-Euler effective Lagrangian in constant fields. Specific examples include the two-loop addendum to the Heisenberg-Euler effective action as well as a novel one-loop correction to the charged particle propagator in constant electromagnetic fields discovered recently. As an additional example, the approach devised in the present article is adopted to derive the tadpole contribution to the two-loop photon polarization tensor in constant fields for the first time.

  5. Solar constant values for estimating solar radiation

    International Nuclear Information System (INIS)

    Li, Huashan; Lian, Yongwang; Wang, Xianlong; Ma, Weibin; Zhao, Liang

    2011-01-01

    There are many solar constant values given and adopted by researchers, leading to confusion in estimating solar radiation. In this study, some solar constant values collected from literature for estimating solar radiation with the Angstroem-Prescott correlation are tested in China using the measured data between 1971 and 2000. According to the ranking method based on the t-statistic, a strategy to select the best solar constant value for estimating the monthly average daily global solar radiation with the Angstroem-Prescott correlation is proposed. -- Research highlights: → The effect of the solar constant on estimating solar radiation is investigated. → The investigation covers a diverse range of climate and geography in China. → A strategy to select the best solar constant for estimating radiation is proposed.

  6. Cryptic Streptococcus mutans 5.6-kb plasmids encode a toxin–antitoxin system for plasmid stabilization

    Directory of Open Access Journals (Sweden)

    Anke Rheinberg

    2013-01-01

    Full Text Available Background: In all Streptococcus mutans strains, 5–13% carry a 5.6-kb plasmid. Despite its frequency, little is known about its mediated functions with most of the information coming from a single study focussing on plasmid pUA140. Objective: Here, we describe the sequence and genetic organization of two S. mutans 5.6-kb plasmids, pDC09 and pNC101. Results: Based on PicoGreen dsDNA quantification and Real-Time quantitative PCR (RTQ-PCR, the plasmid copy number was found to range between 10 and 74, depending on the strain tested. In contrast to literature, we identified six instead of five open reading frames (ORFs. While the putative gene products of ORF1 (as a Rep-protein and ORF2 (as a Mob-protein could be confirmed as being identical to those from pUA140, the functions of ORF3 (unknown and ORF 4 (possibly AtpE homologue could not be further revealed. However, the product of ORF5 showed a fairly high identity (38–50% and structural similarity (58–74% to RelE of Streptococcus pneumoniae, Streptococcus equi, and Streptococcus downei. In addition, we identified a functionally corresponding ORF6 encoding a protein with 61–68% identity (81–86% similarity to the S. equi and S. downei antitoxin of the RelB family. RelE and RelB together form a plasmid-encoded toxin-antitoxin (TA system, RelBEplas. Despite its rather limited sequence similarity with chromosomal TA systems in S. mutans (RelBEchro, MazEF, HicBA, we found similar tertiary structures applying I-Tasser protein prediction analysis. Conclusion: Type II-toxins, as the plasmid-encoded RelE, are RNA endonucleases. Depending on their mRNA cleavage activity, they might 1 kill every plasmid-free progeny, thereby stabilizing plasmid transfer at the expense of the host and/or 2 help S. mutans enter a dormant state and survive unfavourable environmental conditions. Whilst a function in plasmid stabilization has been confirmed, a function in persistence under nutritional stress, tested here

  7. Combination of Aloe vera and xenograft induction on decreasing of NF-kb of tooth extraction socket preservation in Cavia cobaya

    Directory of Open Access Journals (Sweden)

    Utari Kresnoadi

    2014-03-01

    Full Text Available Background: Tooth extraction can naturally cause inflammation triggering osteoclast proliferation and alveolar bone resorption. Preservation of the tooth extraction sockets is needed for patients in order to reduce alveolar bone resorption risks. Aloe vera is known to have anthraquinones components, namely Aloin, Aloe emedin, and barbaloin, considered as anti-inflammation. Therefore, to overcome the inflammation, the role of NF-kb is very significant to decrease nuclear factor kappa b (NF-kb. As a result, inflammation risks will be decreased. Purpose: The study was aimed to determine the induction effect of combination of Aloe vera and XCB into tooth extraction sockets to reduce inflammation by reducing NF-kb expression, osteoclasts and osteoblasts. Methods: Forty-eight Cavia cobaya were divided into eight groups, each group consisted of six animals. The mandibular incisors of those Cavia cobaya were extracted and induced with either PEG, XCB, Aloe vera, or the combination of Aloe vera + XCB. Those animals were sacrificed on day 7 and day 30 after the extraction. Then immunohistochemical and histopathology examinations were conducted to observe NF-kb expression, osteoblasts and osteoclasts. Results: It was known that in group induced with the combination of Aloe vera and xenograft concelous bovine, the growth of osteoblasts was high, while NF-kb expression and osteoclasts reduced. Conclusion: It can be concluded that the induction of the combination of Aloe vera and XCB into the tooth extraction sockets can reduce NF-kb expression and osteoclast, as a result, alveolar bone resorption risks decrease, and osteoblast increase.Latar belakang: Trauma mekanis akibat pencabutan gigi asli menyebabkan keradangan. Keradangan memicu proliferasi osteoklas sehingga menyebabkan resorpsi tulang alveolararis. Pada pembuatan gigi tiruan, resorpsi tulang alveolar yang terjadi, sangat tidak diinginkan, sebab resorpsi tulang alveolar mengurangi keberhasilan

  8. Synthesis and DNA binding studies of Ni(II), Co(II), Cu(II) and Zn(II) metal complexes of N 1,N 5-bis[pyridine-2-methylene]-thiocarbohydrazone Schiff-base ligand

    Science.gov (United States)

    Tiwari, A. D.; Mishra, A. K.; Mishra, S. B.; Mamba, B. B.; Maji, B.; Bhattacharya, S.

    2011-09-01

    The thiocarbohydrazone Schiff-base ligand with a nitrogen and sulphur donor was synthesized through condensation of pyridine-2-carbaldehyde and thiocarbohydrazide. Schiff-base ligands have the ability to conjugate with metal salts. A series of metal complexes with a general formula [MCl 2(H 2L)]· nH 2O (M dbnd Ni, Co, Cu and Zn) were synthesized by forming complexes of the N 1,N 5-bis[pyridine-2-methylene]-thiocarbohydrazone (H 2L) Schiff-base ligand. These metal complexes and ligand were characterized by using ultraviolet-visible (UV-Vis), Fourier Transform Infrared (FT-IR), 1H and 13C NMR spectroscopy and mass spectroscopy, physicochemical characterization, CHNS and conductivity. The biological activity of the synthesized ligand was investigated by using Escherichia coli DNA as target. The DNA interaction of the synthesized ligand and complexes on E. coli plasmid DNA was investigated in the aqueous medium by UV-Vis spectroscopy and the binding constant ( Kb) was calculated. The DNA binding studies showed that the metal complexes had an improved interaction due to trans-geometrical isomers of the complexes than ligand isomers in cis-positions.

  9. Synthesis, DNA binding, cellular DNA lesion and cytotoxicity of a series of new benzimidazole-based Schiff base copper(II) complexes.

    Science.gov (United States)

    Paul, Anup; Anbu, Sellamuthu; Sharma, Gunjan; Kuznetsov, Maxim L; Koch, Biplob; Guedes da Silva, M Fátima C; Pombeiro, Armando J L

    2015-12-14

    A series of new benzimidazole containing compounds 2-((1-R-1-H-benzimidazol-2-yl)phenyl-imino)naphthol HL(1-3) (R = methyl, ethyl or propyl, respectively) have been synthesized by Schiff base condensation of 2-(1-R-1-H-benzo[d]imidazol-2-yl)aniline and 2-hydroxy-1-naphthaldehyde. The reactions of HL(1-3) with Cu(NO3)2·2.5H2O led to the corresponding copper(II) complexes [Cu(L)(NO3)] 1-3. All the compounds were characterized by conventional analytical techniques and, for 1 and 3, also by single-crystal X-ray analysis. The interactions of complexes 1-3 with calf thymus DNA were studied by absorption and fluorescence spectroscopic techniques and the calculated binding constants (K(b)) are in the range of 3.5 × 10(5) M(-1)-3.2 × 10(5) M(-1). Complexes 1-3 effectively bind DNA through an intercalative mode, as proved by molecular docking studies. The binding affinity of the complexes decreases with the size increase of the N-alkyl substituent, in the order of 1 > 2 > 3, which is also in accord with the calculated LUMO(complex) energies. They show substantial in vitro cytotoxic effect against human lung (A-549), breast (MDA-MB-231) and cervical (HeLa) cancer cell lines. Complex 1 exhibits a significant inhibitory effect on the proliferation of the A-549 cancer cells. The antiproliferative efficacy of 1 has also been analysed by a DNA fragmentation assay, fluorescence activated cell sorting (FACS) and nuclear morphology using a fluorescence microscope. The possible mode for the apoptosis pathway of 1 has also been evaluated by a reactive oxygen species (ROS) generation study.

  10. KB21 METAR

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — METAR is a routine scheduled observation and is the primary observation code used in the United States to satisfy requirements for reporting surface meteorological...

  11. YAC/STS map across 12 Mb of Xq27 at 25-kb resolution, merging Xq26-qter

    Energy Technology Data Exchange (ETDEWEB)

    Zucchi, I.; Susani, L. [C.N.R.-I.T.B.A., Milano (Italy); Mumm, S.; Pilia, G. [Washington Univ. School of Medicine, St. Louis, MO (United States)] [and others

    1996-05-15

    A 12-Mb YAC contig has been assembled spanning the Xq27 cytogenetic band with 203 YACs, 121 STSs, and >300 hybridization probes to a resolution of 25 kb. At its centromeric end, the contig is merged with a 9-Mb contig covering Xq26.1-q26.3 at a point 1 Mb telomeric to the factor IX gene; at its telomeric end, it is merged to 7.5 Mb of contigs form the IDS gene to the Xq28 telomere. Thus, the distal 29 Mb of the Xq arm is available cloned in long-range contiguity. The physical map has been integrated with current genetic data by the localization of 18 markers that detect polymorphism. Apparent recombination levels reach >4.5 cM/Mb near the centromeric border of Xq27. The ratio of cM/Mb correspondingly delimits the location of several disease genes-including, for example, X-linked hypoparathyroidism in 3 Mb (6 cM) telomeric to Factor IX. 50 refs., 3 figs., 1 tab.

  12. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  13. Dual AAV Gene Therapy for Duchenne Muscular Dystrophy with a 7-kb Mini-Dystrophin Gene in the Canine Model.

    Science.gov (United States)

    Kodippili, Kasun; Hakim, Chady H; Pan, Xiufang; Yang, Hsiao T; Yue, Yongping; Zhang, Yadong; Shin, Jin-Hong; Yang, N Nora; Duan, Dongsheng

    2018-03-01

    Dual adeno-associated virus (AAV) technology was developed in 2000 to double the packaging capacity of the AAV vector. The proof of principle has been demonstrated in various mouse models. Yet, pivotal evidence is lacking in large animal models of human diseases. Here we report expression of a 7-kb canine ΔH2-R15 mini-dystrophin gene using a pair of dual AAV vectors in the canine model of Duchenne muscular dystrophy (DMD). The ΔH2-R15 minigene is by far the most potent synthetic dystrophin gene engineered for DMD gene therapy. We packaged minigene dual vectors in Y731F tyrosine-modified AAV-9 and delivered to the extensor carpi ulnaris muscle of a 12-month-old affected dog at the dose of 2 × 10 13 viral genome particles/vector/muscle. Widespread mini-dystrophin expression was observed 2 months after gene transfer. The missing dystrophin-associated glycoprotein complex was restored. Treatment also reduced muscle degeneration and fibrosis and improved myofiber size distribution. Importantly, dual AAV therapy greatly protected the muscle from eccentric contraction-induced force loss. Our data provide the first clear evidence that dual AAV therapy can be translated to a diseased large mammal. Further development of dual AAV technology may lead to effective therapies for DMD and many other diseases in human patients.

  14. Immobilization of Cellulase from Bacillus subtilis UniMAP-KB01 on Multi-walled Carbon Nanotubes for Biofuel Production

    Science.gov (United States)

    Naresh, Sandrasekaran; Hoong Shuit, Siew; Kunasundari, Balakrishnan; Hoo Peng, Yong; Qi, Hwa Ng; Teoh, Yi Peng

    2018-03-01

    Bacillus subtilis UniMAP-KB01, a cellulase producer was isolated from Malaysian mangrove soil. Through morphological identification it was observed that the B. subtilis appears to be in rod shaped and identified as a gram positive bacterium. Growth profile of isolated B. subtilis was established by measuring optical density (OD) at 600 nm for every 1 hour intervals. Polymath software was employed to plot the growth profile and the non-linear plot established gave the precision value of linear regression, R2 of 0.9602, root mean square deviation (RMSD) of 0.0176 and variance of 0.0025. The hydrolysis capacity testing revealed the cellulolytic index of 2.83 ± 0.46 after stained with Gram’s Iodine. The harvested crude enzyme after 24 hours incubation in carboxymethylcellulose (CMC) broth at 45°C and 100 RPM, was tested for enzyme activity. Through Filter Paper Assay (FPA), the cellulase activity was calculated to be 0.05 U/mL. The hydrolysis capacity testing and FPA shown an acceptable value for thermophilic bacterial enzyme activity. Thus, this isolated strain reasoned to be potential for producing thermostable cellulase which will be immobilized onto multi-walled carbon nanotubes and the cellulolytic activity will be characterized for biofuel production.

  15. A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH.

    Directory of Open Access Journals (Sweden)

    Birte Möhlendick

    Full Text Available Comprehensive genome wide analyses of single cells became increasingly important in cancer research, but remain to be a technically challenging task. Here, we provide a protocol for array comparative genomic hybridization (aCGH of single cells. The protocol is based on an established adapter-linker PCR (WGAM and allowed us to detect copy number alterations as small as 56 kb in single cells. In addition we report on factors influencing the success of single cell aCGH downstream of the amplification method, including the characteristics of the reference DNA, the labeling technique, the amount of input DNA, reamplification, the aCGH resolution, and data analysis. In comparison with two other commercially available non-linear single cell amplification methods, WGAM showed a very good performance in aCGH experiments. Finally, we demonstrate that cancer cells that were processed and identified by the CellSearch® System and that were subsequently isolated from the CellSearch® cartridge as single cells by fluorescence activated cell sorting (FACS could be successfully analyzed using our WGAM-aCGH protocol. We believe that even in the era of next-generation sequencing, our single cell aCGH protocol will be a useful and (cost- effective approach to study copy number alterations in single cells at resolution comparable to those reported currently for single cell digital karyotyping based on next generation sequencing data.

  16. Tissue specificity of endothelin binding sites

    Energy Technology Data Exchange (ETDEWEB)

    Bolger, G.T.; Liard, F.; Krogsrud, R.; Thibeault, D.; Jaramillo, J. (BioMega, Inc., Laval, Quebec (Canada))

    1990-09-01

    A measurement was made of the binding of 125I-labeled endothelin (125I-ET) to crude membrane fractions prepared from rat aorta, atrium, ventricle, portal vein, trachea, lung parenchyma, vas deferens, ileum, bladder, and guinea-pig taenia coli and lung parenchyma. Scatchard analysis of 125I-ET binding in all tissues indicated binding to a single class of saturable sites. The affinity and density of 125I-ET binding sites varied between tissues. The Kd of 125I-ET binding was approximately 0.5 nM for rat aorta, trachea, lung parenchyma, ventricle, bladder, and vas deferens, and guinea-pig taenia coli and lung parenchyma, 1.8 nM for rat portal vein and atrium, and 3.3 nM for ileum. The Bmax of 125I-ET binding had the following rank order of density in rat tissues: trachea greater than lung parenchyma = vas deferens much greater than aorta = portal vein = atrium greater than bladder greater than ventricle = ileum. The properties of 125I-ET endothelin binding were characterized in rat ventricular membranes. 125I-ET binding was time dependent, reaching a maximum within 45-60 min at 25 degrees C. The calculated microassociation constant was 9.67 x 10(5) s-1 M-1. Only 15-20% of 125I-ET dissociated from its binding site even when dissociation was studied as long as 3 h. Preincubation of ventricular membranes with ET prevented binding of 125I-ET. 125I-ET binding was destroyed by boiling of ventricular membranes and was temperature, pH, and cation (Ca2+, Mg2+, and Na+) dependent.

  17. Scalar-tensor cosmology with cosmological constant

    International Nuclear Information System (INIS)

    Maslanka, K.

    1983-01-01

    The equations of scalar-tensor theory of gravitation with cosmological constant in the case of homogeneous and isotropic cosmological model can be reduced to dynamical system of three differential equations with unknown functions H=R/R, THETA=phi/phi, S=e/phi. When new variables are introduced the system becomes more symmetrical and cosmological solutions R(t), phi(t), e(t) are found. It is shown that when cosmological constant is introduced large class of solutions which depend also on Dicke-Brans parameter can be obtained. Investigations of these solutions give general limits for cosmological constant and mean density of matter in plane model. (author)

  18. Constant strength fuel-fuel cell

    International Nuclear Information System (INIS)

    Vaseen, V.A.

    1980-01-01

    A fuel cell is an electrochemical apparatus composed of both a nonconsumable anode and cathode; and electrolyte, fuel oxidant and controls. This invention guarantees the constant transfer of hydrogen atoms and their respective electrons, thus a constant flow of power by submergence of the negative electrode in a constant strength hydrogen furnishing fuel; when said fuel is an aqueous absorbed hydrocarbon, such as and similar to ethanol or methnol. The objective is accomplished by recirculation of the liquid fuel, as depleted in the cell through specific type membranes which pass water molecules and reject the fuel molecules; thus concentrating them for recycle use

  19. On the constants for some Sobolev imbeddings

    Directory of Open Access Journals (Sweden)

    Pizzocchero Livio

    2001-01-01

    Full Text Available We consider the imbedding inequality is the Sobolev space (or Bessel potential space of type and (integer or fractional order . We write down upper bounds for the constants , using an argument previously applied in the literature in particular cases. We prove that the upper bounds computed in this way are in fact the sharp constants if , , and exhibit the maximising functions. Furthermore, using convenient trial functions, we derive lower bounds on for in many cases these are close to the previous upper bounds, as illustrated by a number of examples, thus characterizing the sharp constants with little uncertainty.

  20. On the constant-roll inflation

    Science.gov (United States)

    Yi, Zhu; Gong, Yungui

    2018-03-01

    The primordial power spectra of scalar and tensor perturbations during slow-roll inflation are usually calculated with the method of Bessel function approximation. For constant-roll or ultra slow-roll inflation, the method of Bessel function approximation may be invalid. We compare the numerical results with the analytical results derived from the Bessel function approximation, and we find that they differ significantly on super-horizon scales if the constant slow-roll parameter ηH is not small. More accurate method is needed for calculating the primordial power spectrum for constant-roll inflation.

  1. Cosmological constant and advanced gravitational wave detectors

    International Nuclear Information System (INIS)

    Wang, Y.; Turner, E.L.

    1997-01-01

    Interferometric gravitational wave detectors could measure the frequency sweep of a binary inspiral (characterized by its chirp mass) to high accuracy. The observed chirp mass is the intrinsic chirp mass of the binary source multiplied by (1+z), where z is the redshift of the source. Assuming a nonzero cosmological constant, we compute the expected redshift distribution of observed events for an advanced LIGO detector. We find that the redshift distribution has a robust and sizable dependence on the cosmological constant; the data from advanced LIGO detectors could provide an independent measurement of the cosmological constant. copyright 1997 The American Physical Society

  2. 3,3′,4,4′,5-Pentachlorobiphenyl Inhibits Drug Efflux Through P-Glycoprotein in KB-3 Cells Expressing Mutant Human P-Glycoprotein

    Directory of Open Access Journals (Sweden)

    Hiroshi Fujise

    2004-01-01

    Full Text Available The effects on the drug efflux of 3,3′,4,4′,5-pentachlorobiphenyl (PCB-126, the most toxic of all coplanar polychlorinated biphenyls (Co-PCBs, were examined in KB-3 cells expressing human wild-type and mutant P-glycoprotein in which the 61st amino acid was substituted for serine or phenylalanine (KB3-Phe61. In the cells expressing P-glycoproteins, accumulations of vinblastine and colchicine decreased form 85% to 92% and from 62% to 91%, respectively, and the drug tolerances for these chemicals were increased. In KB3-Phe61, the decreases in drug accumulation were inhibited by adding PCB-126 in a way similar to that with cyclosporine A: by adding 1 μM PCB-126, the accumulations of vinblastine and colchicine increased up to 3.3- and 2.3-fold, respectively. It is suggested that PCB-126 decreased the drug efflux by inhibiting the P-glycoprotein in KB3-Phe61. Since there were various P-glycoproteins and many congeners of Co-PCBs, this inhibition has to be considered a new cause of the toxic effects of Co-PCBs.

  3. UniProtKB/Swiss-Prot, the Manually Annotated Section of the UniProt KnowledgeBase: How to Use the Entry View.

    Science.gov (United States)

    Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Schneider, Michel; Bansal, Parit; Bridge, Alan J; Poux, Sylvain; Bougueleret, Lydie; Xenarios, Ioannis

    2016-01-01

    The Universal Protein Resource (UniProt, http://www.uniprot.org ) consortium is an initiative of the SIB Swiss Institute of Bioinformatics (SIB), the European Bioinformatics Institute (EBI) and the Protein Information Resource (PIR) to provide the scientific community with a central resource for protein sequences and functional information. The UniProt consortium maintains the UniProt KnowledgeBase (UniProtKB), updated every 4 weeks, and several supplementary databases including the UniProt Reference Clusters (UniRef) and the UniProt Archive (UniParc).The Swiss-Prot section of the UniProt KnowledgeBase (UniProtKB/Swiss-Prot) contains publicly available expertly manually annotated protein sequences obtained from a broad spectrum of organisms. Plant protein entries are produced in the frame of the Plant Proteome Annotation Program (PPAP), with an emphasis on characterized proteins of Arabidopsis thaliana and Oryza sativa. High level annotations provided by UniProtKB/Swiss-Prot are widely used to predict annotation of newly available proteins through automatic pipelines.The purpose of this chapter is to present a guided tour of a UniProtKB/Swiss-Prot entry. We will also present some of the tools and databases that are linked to each entry.

  4. Chronic myeloid leukemia may be associated with several bcr-abl transcripts including the acute lymphoid leukemia-type 7 kb transcript

    NARCIS (Netherlands)

    Selleri, L.; von Lindern, M.; Hermans, A.; Meijer, D.; Torelli, G.; Grosveld, G.

    1990-01-01

    In the majority of Philadelphia (Ph)-positive chronic myeloid leukemia (CML) patients, the c-abl gene is fused to the bcr gene, resulting in the transcription of an 8.5 kb chimeric bcr-abl mRNA, which is translated into a p210bcr-abl fusion protein. In about 50% of the Ph-positive acute lymphoid

  5. One in Four Individuals of African-American Ancestry Harbors a 5.5kb Deletion at chromosome 11q13.1

    Science.gov (United States)

    Zainabadi, Kayvan; Jain, Anuja V.; Donovan, Frank X.; Elashoff, David; Rao, Nagesh P.; Murty, Vundavalli V.; Chandrasekharappa, Settara C.; Srivatsan, Eri S.

    2014-01-01

    Cloning and sequencing of 5.5kb deletion at chromosome 11q13.1 from the HeLa cells, tumorigenic hybrids and two fibroblast cell lines has revealed homologous recombination between AluSx and AluY resulting in the deletion of intervening sequences. Long-range PCR of the 5.5kb sequence in 494 normal lymphocyte samples showed heterozygous deletion in 28.3% of African- American ancestry samples but only in 4.8% of Caucasian samples (pdeletion occurs in 27% of YRI (Yoruba – West African) population but none in non-African populations. The HapMap analysis further identified strong linkage disequilibrium between 5 single nucleotide polymorphisms and the 5.5kb deletion in the people of African ancestry. Computational analysis of 175kb sequence surrounding the deletion site revealed enhanced flexibility, low thermodynamic stability, high repetitiveness, and stable stem-loop/hairpin secondary structures that are hallmarks of common fragile sites. PMID:24412158

  6. Characterization of mouse 45S ribosomal RNA subspecies suggests that the first processing cleavage occurs 600 +/- 100 nucleotides from the 5' end and the second 500 +/- 100 nucleotides from the 3' end of a 13.9 kb precursor.

    OpenAIRE

    Gurney, T

    1985-01-01

    Mouse fibroblasts labeled 1-9 h with 3H-uridine contained radioactive 45S rRNA subspecies of 13.9, 13.3, and 12.8 kb, as determined by hybrid-selection with rDNA plasmids and by electrophoresis in agarose-formaldehyde. The 13.9 kb subspecies contained 5' and 3' terminal rDNA sequences known from the work of Grummt and colleagues to be at or near the ends of the primary transcript. The 13.3 kb subspecies contained the 3' terminal sequence but lacked the 5' terminal sequence. The 12.8 kb subspe...

  7. Phosphorylation of nitrogen regulator I of Escherichia coli induces strong cooperative binding to DNA essential for activation of transcription.

    OpenAIRE

    Weiss, V; Claverie-Martin, F; Magasanik, B

    1992-01-01

    We studied the effect of phosphorylation of nitrogen regulator I (NRI) on its binding properties. Both phosphorylated and unphosphorylated NRI bind linearly to a single binding site but cooperatively to two adjacent binding sites. Cooperative binding of NRI is severely affected by phosphorylation: half-maximal binding of NRI-phosphate is at 20-fold lower concentrations than that of unphosphorylated NRI. This is more due to a huge increase in the cooperativity constant--which is the strength o...

  8. Interacting universes and the cosmological constant

    Energy Technology Data Exchange (ETDEWEB)

    Alonso-Serrano, A. [Centro de Física “Miguel Catalán”, Instituto de Física Fundamental, Consejo Superior de Investigaciones Científicas, Serrano 121, 28006 Madrid (Spain); Estación Ecológica de Biocosmología, Pedro de Alvarado 14, 06411 Medellín (Spain); Bastos, C. [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Avenida Rovisco Pais 1, 1049-001 Lisboa (Portugal); Bertolami, O. [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Avenida Rovisco Pais 1, 1049-001 Lisboa (Portugal); Departamento de Física e Astronomia, Faculdade de Ciências da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Robles-Pérez, S., E-mail: salvarp@imaff.cfmac.csic.es [Centro de Física “Miguel Catalán”, Instituto de Física Fundamental, Consejo Superior de Investigaciones Científicas, Serrano 121, 28006 Madrid (Spain); Estación Ecológica de Biocosmología, Pedro de Alvarado 14, 06411 Medellín (Spain); Física Teórica, Universidad del País Vasco, Apartado 644, 48080 Bilbao (Spain)

    2013-02-12

    In this Letter it is studied the effects that an interaction scheme among universes can have in the values of their cosmological constants. In the case of two interacting universes, the value of the cosmological constant of one of the universes becomes very close to zero at the expense of an increasing value of the cosmological constant of the partner universe. In the more general case of a chain of N interacting universes with periodic boundary conditions, the spectrum of the Hamiltonian splits into a large number of levels, each of them associated with a particular value of the cosmological constant, that can be occupied by single universes revealing a collective behavior that plainly shows that the multiverse is much more than the mere sum of its parts.

  9. An improved dosimeter having constant flow pump

    International Nuclear Information System (INIS)

    Baker, W.B.

    1980-01-01

    A dosemeter designed for individual use which can be used to monitor toxic radon gas and toxic related products of radon gas in mines and which incorporates a constant air stream flowing through the dosimeter is described. (U.K.)

  10. Constant conditional entropy and related hypotheses

    International Nuclear Information System (INIS)

    Ferrer-i-Cancho, Ramon; Dębowski, Łukasz; Moscoso del Prado Martín, Fermín

    2013-01-01

    Constant entropy rate (conditional entropies must remain constant as the sequence length increases) and uniform information density (conditional probabilities must remain constant as the sequence length increases) are two information theoretic principles that are argued to underlie a wide range of linguistic phenomena. Here we revise the predictions of these principles in the light of Hilberg’s law on the scaling of conditional entropy in language and related laws. We show that constant entropy rate (CER) and two interpretations for uniform information density (UID), full UID and strong UID, are inconsistent with these laws. Strong UID implies CER but the reverse is not true. Full UID, a particular case of UID, leads to costly uncorrelated sequences that are totally unrealistic. We conclude that CER and its particular cases are incomplete hypotheses about the scaling of conditional entropies. (letter)

  11. Interacting universes and the cosmological constant

    International Nuclear Information System (INIS)

    Alonso-Serrano, A.; Bastos, C.; Bertolami, O.; Robles-Pérez, S.

    2013-01-01

    In this Letter it is studied the effects that an interaction scheme among universes can have in the values of their cosmological constants. In the case of two interacting universes, the value of the cosmological constant of one of the universes becomes very close to zero at the expense of an increasing value of the cosmological constant of the partner universe. In the more general case of a chain of N interacting universes with periodic boundary conditions, the spectrum of the Hamiltonian splits into a large number of levels, each of them associated with a particular value of the cosmological constant, that can be occupied by single universes revealing a collective behavior that plainly shows that the multiverse is much more than the mere sum of its parts

  12. Hydrolysis and formation constants at 250C

    International Nuclear Information System (INIS)

    Phillips, S.L.

    1982-05-01

    A database consisting of hydrolysis and formation constants for about 20 metals associated with the disposal of nuclear waste is given. Complexing ligands for the various ionic species of these metals include OH, F, Cl, SO 4 , PO 4 and CO 3 . Table 1 consists of tabulated calculated and experimental values of log K/sub xy/, mainly at 25 0 C and various ionic strengths together with references to the origin of the data. Table 2 consists of a column of recommended stability constants at 25 0 C and zero ionic strength tabulated in the column headed log K/sub xy/(0); other columns contain coefficients for an extended Debye-Huckel equation to permit calculations of stability constants up to 3 ionic strength, and up to 0.7 ionic strength using the Davies equation. Selected stability constants calculated with these coefficients for various ionic strengths agree to an average of +- 2% when compared with published experimental and calculated values

  13. A quadri-constant fraction discriminator

    International Nuclear Information System (INIS)

    Wang Wei; Gu Zhongdao

    1992-01-01

    A quad Constant Fraction (Amplitude and Rise Time Compensation) Discriminator Circuit is described, which is based on the ECL high-speed dual comparator AD 9687. The CFD (ARCD) is of the constant fraction timing type (the amplitude and rise time compensation timing type) employing a leading edge discriminator to eliminate error triggers caused by noises. A timing walk measurement indicates a timing walk of less than +- 150 ps from -50 mV to -5 V

  14. Building evolutionary architectures support constant change

    CERN Document Server

    Ford, Neal; Kua, Patrick

    2017-01-01

    The software development ecosystem is constantly changing, providing a constant stream of new tools, frameworks, techniques, and paradigms. Over the past few years, incremental developments in core engineering practices for software development have created the foundations for rethinking how architecture changes over time, along with ways to protect important architectural characteristics as it evolves. This practical guide ties those parts together with a new way to think about architecture and time.

  15. Nuclei quadrupole coupling constants in diatomic molecule

    International Nuclear Information System (INIS)

    Ivanov, A.I.; Rebane, T.K.

    1993-01-01

    An approximate relationship between the constants of quadrupole interaction of nuclei in a two-atom molecule is found. It enabled to establish proportionality of oscillatory-rotation corrections to these constants for both nuclei in the molecule. Similar results were obtained for the factors of electrical dipole-quadrupole screening of nuclei. Applicability of these relationships is proven by the example of lithium deuteride molecule. 4 refs., 1 tab

  16. Optical constants of concentrated aqueous ammonium sulfate.

    Science.gov (United States)

    Remsberg, E. E.

    1973-01-01

    Using experimental data obtained from applying spectroscopy to a 39-wt-% aqueous ammonium sulfate solution, it is shown that, even though specific aerosol optical constants appear quite accurate, spectral variations may exist as functions of material composition or concentration or both. Prudent users of optical constant data must then include liberal data error estimates when performing calculations or in interpreting spectroscopic surveys of collected aerosol material.

  17. Determination of the degradation constant and endogenous constant and endogenous respiration using a respirometric technique. Determinacion de la constante de degradacion y respiracion endogena mediante una tecnica respirometrica

    Energy Technology Data Exchange (ETDEWEB)

    Menendez Gutierrez, C.; Perez Olmo, J.

    1993-08-01

    Using the common basic equation for expressing the activated sludge process, it was established that where the sludge is more than 5 days old, employing the total biomass descomposition speed coefficient (kb) may lead to EDAR design errors. It should be replaced by the coefficient for the degradable biomass (kj) which is relatively quick and easy to determine. (Author) 5 refs.

  18. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  19. A Meiotic Drive Element in the Maize Pathogen Fusarium verticillioides Is Located Within a 102 kb Region of Chromosome V

    Directory of Open Access Journals (Sweden)

    Jay Pyle

    2016-08-01

    Full Text Available Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK that causes nearly all surviving meiotic progeny from an SkK × Spore killer-susceptible (SkS cross to inherit the SkK allele. SkK has been mapped to chromosome V but the genetic element responsible for meiotic drive has yet to be identified. In this study, we used cleaved amplified polymorphic sequence markers to genotype individual progeny from an SkK × SkS mapping population. We also sequenced the genomes of three progeny from the mapping population to determine their single nucleotide polymorphisms. These techniques allowed us to refine the location of SkK to a contiguous 102 kb interval of chromosome V, herein referred to as the Sk region. Relative to SkS genotypes, SkK genotypes have one extra gene within this region for a total of 42 genes. The additional gene in SkK genotypes, herein named SKC1 for Spore Killer Candidate 1, is the most highly expressed gene from the Sk region during early stages of sexual development. The Sk region also has three hyper-variable regions, the longest of which includes SKC1. The possibility that SKC1, or another gene from the Sk region, is an essential component of meiotic drive and spore killing is discussed.

  20. In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR.

    Directory of Open Access Journals (Sweden)

    Faqing Huang

    Full Text Available The precise assembly of defined DNA sequences into plasmids is an essential task in bioscience research. While a number of molecular cloning techniques have been developed, many methods require specialized expensive reagents or laborious experimental procedure. Not surprisingly, conventional cloning techniques based on restriction digestion and ligation are still commonly used in routine DNA cloning. Here, we describe a simple, fast, and economical cloning method based on RecA- and RecET-independent in vivo recombination of DNA fragments with overlapping ends using E. coli. All DNA fragments were prepared by a 2-consecutive PCR procedure with Q5 DNA polymerase and used directly for transformation resulting in 95% cloning accuracy and zero background from parental template plasmids. Quantitative relationships were established between cloning efficiency and three factors-the length of overlapping nucleotides, the number of DNA fragments, and the size of target plasmids-which can provide general guidance for selecting in vivo cloning parameters. The method may be used to accurately assemble up to 5 DNA fragments with 25 nt overlapping ends into relatively small plasmids, and 3 DNA fragments into plasmids up to 16 kb in size. The whole cloning procedure may be completed within 2 days by a researcher with little training in cloning. The combination of high accuracy and zero background eliminates the need for screening a large number of colonies. The method requires no enzymes other than Q5 DNA polymerase, has no sequence restriction, is highly reliable, and represents one of the simplest, fastest, and cheapest cloning techniques available. Our method is particularly suitable for common cloning tasks in the lab where the primary goal is to quickly generate a plasmid with a pre-defined sequence at low costs.

  1. Scrutinizing MHC-I binding peptides and their limits of variation.

    Directory of Open Access Journals (Sweden)

    Christian P Koch

    Full Text Available Designed peptides that bind to major histocompatibility protein I (MHC-I allomorphs bear the promise of representing epitopes that stimulate a desired immune response. A rigorous bioinformatical exploration of sequence patterns hidden in peptides that bind to the mouse MHC-I allomorph H-2K(b is presented. We exemplify and validate these motif findings by systematically dissecting the epitope SIINFEKL and analyzing the resulting fragments for their binding potential to H-2K(b in a thermal denaturation assay. The results demonstrate that only fragments exclusively retaining the carboxy- or amino-terminus of the reference peptide exhibit significant binding potential, with the N-terminal pentapeptide SIINF as shortest ligand. This study demonstrates that sophisticated machine-learning algorithms excel at extracting fine-grained patterns from peptide sequence data and predicting MHC-I binding peptides, thereby considerably extending existing linear prediction models and providing a fresh view on the computer-based molecular design of future synthetic vaccines. The server for prediction is available at http://modlab-cadd.ethz.ch (SLiDER tool, MHC-I version 2012.

  2. Multiple binding of bilirubin to human serum albumin and cobinding with laurate

    DEFF Research Database (Denmark)

    Sato, H; Honoré, B; Brodersen, R

    1988-01-01

    Numerical analysis of multiple binding of two ligands to one carrier has been accomplished, using the principle of several sets of acceptable binding constants, with bilirubin-laurate-albumin as an example. Binding of bilirubin to defatted human serum albumin was investigated by a spectroscopic m...

  3. Calculation of the thermodynamic and transport properties of aqueous species at high pressures and temperatures: Correlation algorithms for ionic species and equation of state predictions to 5 kb and 1000°C

    Science.gov (United States)

    Shock, Everett L.; Helgeson, Harold C.

    1988-08-01

    Correlation algorithms permit prediction of species-dependent parameters in revised equations of state ( TANGER and HELGESON, 1988) for aqueous ions and electrolytes which can be used together with values at 25°C and 1 bar of the standard partial molal entropies ( S0), volumes ( V0), and heat capacities ( C0p) of the ions to calculate their standard partial molal thermodynamic properties at pressures and temperatures to 5 kb and 1000°C. Values of V0 and C0p at 25°C and 1 bar have been calculated for 128 aqueous ions from analysis of published experimental data or from correlations of these properties with S0. Equation of state parameters have also been generated for these ions and examples are given of predicted standard partial molal thermodynamic properties of representative cations and anions at high pressures and temperatures. Close agreement between independently predicted and experimentally determined equilibrium constants for acid anion dissociation reactions at high temperatures supports the validity and generality of the predictive algorithms.

  4. Total iron binding capacity

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003489.htm Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  5. Cordyceps militaris Fraction induces apoptosis and G2/M Arrest via c-Jun N-Terminal kinase signaling pathway in oral squamous carcinoma KB Cells

    Science.gov (United States)

    Xie, Wangshi; Zhang, Zhang; Song, Liyan; Huang, Chunhua; Guo, Zhongyi; Hu, Xianjing; Bi, Sixue; Yu, Rongmin

    2018-01-01

    Background: Cordyceps militaris fraction (CMF) has been shown to possess in vitro antitumor activity against human chronic myeloid leukemia K562 cells in our previous research. Materials and Methods: The in vitro inhibitory activities of CMF on the growth of KB cells were evaluated by viability assay. The apoptotic and cell cycle influences of CMF were detected by 4′,6-diamidino-2-phenylindole staining and flow cytometry assay. The expression of different apoptosis-associated proteins and cell cycle regulatory proteins was examined by Western blot assay. The nuclear localization of c-Jun was observed by fluorescence staining. Objective: The objective of this study was to investigate the antiproliferative effect of CMF as well as the mechanism underlying the apoptosis and cell cycle arrest it induces in KB cells. Results: CMF suppressed KB cells’ proliferation in a dose- and time-dependent manner. Flow cytometric analysis indicated that CMF induced G2/M cell cycle arrest and apoptosis. Western blot analysis revealed that CMF induced caspase-3, caspase-9, and PARP cleavages, and increased the Bax/Bcl-2 ratio. CMF also led to increased expression of p21, decreased expression of cyclin B1, mitotic phosphatase cdc25c, and mitotic kinase cdc2, as well as unchanged expression of p53. In addition, CMF stimulated c-Jun N-terminal kinases (JNK) protein phosphorylations, resulting in upregulated expression of c-Jun and nuclear localization of c-Jun. Pretreatment with JNK inhibitor SP600125 suppressed CMF-induced apoptosis and G2/M arrest. Conclusions: CMF is capable of modulating c-Jun caspase and Bcl-2 family proteins through JNK-dependent apoptosis, which results in G2/M phase arrest in KB cells. CMF could be developed as a promising candidate for the new antitumor agents. SUMMARY CMF exhibited strong anticancer activity against oral squamous carcinoma KB cellsCMF inhibited KB cells’ proliferation via induction of apoptosis and G2/M cell cycle arrestCMF activated JNK

  6. Derivation of the optical constants of anisotropic

    Science.gov (United States)

    Aronson, J. R.; Emslie, A. G.; Smith, E. M.; Strong, P. F.

    1985-07-01

    This report concerns the development of methods for obtaining the optical constants of anisotropic crystals of the triclinic and monoclinic systems. The principal method used, classical dispersion theory, is adapted to these crystal systems by extending the Lorentz line parameters to include the angles characterizing the individual resonances, and by replacing the dielectric constant by a dielectric tensor. The sample crystals are gypsium, orthoclase and chalcanthite. The derived optical constants are shown to be suitable for modeling the optical properties of particulate media in the infrared spectral region. For those materials where suitable size single crystals are not available, an extension of a previously used method is applied to alabaster, a polycrystalline material of the monoclinic crystal system.

  7. Fast optimization algorithms and the cosmological constant

    Science.gov (United States)

    Bao, Ning; Bousso, Raphael; Jordan, Stephen; Lackey, Brad

    2017-11-01

    Denef and Douglas have observed that in certain landscape models the problem of finding small values of the cosmological constant is a large instance of a problem that is hard for the complexity class NP (Nondeterministic Polynomial-time). The number of elementary operations (quantum gates) needed to solve this problem by brute force search exceeds the estimated computational capacity of the observable Universe. Here we describe a way out of this puzzling circumstance: despite being NP-hard, the problem of finding a small cosmological constant can be attacked by more sophisticated algorithms whose performance vastly exceeds brute force search. In fact, in some parameter regimes the average-case complexity is polynomial. We demonstrate this by explicitly finding a cosmological constant of order 10-120 in a randomly generated 1 09-dimensional Arkani-Hamed-Dimopoulos-Kachru landscape.

  8. Stability constants for silicate adsorbed to ferrihydrite

    DEFF Research Database (Denmark)

    Hansen, Hans Christian Bruun; Wetche, T.P.; Raulund-Rasmussen, Karsten

    1994-01-01

    Intrinsic surface acidity constants (K(a1)intr, K(a2)intr) and surface complexation constant for adsorption of orthosilicate onto synthetic ferrihydrite (K(Si) for the complex = FeOSi(OH)3) have been determined from acid/base titrations in 0.001-0.1 m NaClO4 electrolytes and silicate adsorption...... experiments in 0.01 m NaNO3 electrolyte (pH 3-6). The surface equilibrium constants were calculated according to the two-layer model by Dzombak & Morel (1990). Near equilibrium between protons/hydroxyls in solution and the ferrihydrite surface was obtained within minutes while equilibration with silicate...

  9. Effects of quantum entropy on bag constant

    International Nuclear Information System (INIS)

    Miller, D.E.; Tawfik, A.

    2012-01-01

    The effects of quantum entropy on the bag constant are studied at low temperatures and for small chemical potentials. The inclusion of the quantum entropy of the quarks in the equation of state provides the hadronic bag with an additional heat which causes a decrease in the effective latent heat inside the bag. We have considered two types of baryonic bags, Δ and Ω - . In both cases we have found that the bag constant without the quantum entropy almost does not change with temperature and quark chemical potential. The contribution from the quantum entropy to the equation of state clearly decreases the value of the bag constant. Furthermore, we construct states densities for quarks using the 'Thomas Fermi model' and take into consideration a thermal potential for the interaction. (author)

  10. Conformally invariant braneworld and the cosmological constant

    International Nuclear Information System (INIS)

    Guendelman, E.I.

    2004-01-01

    A six-dimensional braneworld scenario based on a model describing the interaction of gravity, gauge fields and 3+1 branes in a conformally invariant way is described. The action of the model is defined using a measure of integration built of degrees of freedom independent of the metric. There is no need to fine tune any bulk cosmological constant or the tension of the two (in the scenario described here) parallel branes to obtain zero cosmological constant, the only solutions are those with zero 4D cosmological constant. The two extra dimensions are compactified in a 'football' fashion and the branes lie on the two opposite poles of the compact 'football-shaped' sphere

  11. A single base difference between Pit-1 binding sites at the hGH promoter and locus control region specifies distinct Pit-1 conformations and functions.

    Science.gov (United States)

    Shewchuk, Brian M; Ho, Yugong; Liebhaber, Stephen A; Cooke, Nancy E

    2006-09-01

    Activation of the human growth hormone (hGH-N) gene in pituitary somatotropes is mediated by a locus control region (LCR). This LCR is composed of DNase I-hypersensitive sites (HS) located -14.5 kb to -32 kb relative to the hGH-N promoter. HSI, at -14.5 kb, is the dominant determinant of hGH-N expression and is essential for establishment of a 32-kb domain of histone acetylation that encompasses the active hGH locus. This activity is conferred by three binding sites for the POU domain transcription factor Pit-1. These Pit-1 elements are sufficient to activate hGH-N expression in the mouse pituitary. In contrast, Pit-1 sites at the hGH-N promoter are consistently unable to mediate similar activity. In the present study, we demonstrate that the functional difference between the promoter-proximal and the HSI Pit-1 binding sites can be attributed in part to a single base difference. This base affects the conformation of the Pit-1/DNA complex, and reciprocal exchange of the divergent bases between the two sets of Pit-1 elements results in a partial reversal of their transgenic activities. These data support a model in which the Pit-1 binding sites in the hGH LCR allosterically program the bound Pit-1 complex for chromatin activating functions.

  12. A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH

    DEFF Research Database (Denmark)

    Ramsing, Mette; Becher, Naja Helene; Christensen, Rikke

    A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH......A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH...

  13. Construction and experimental testing of the constant-bandwidth constant-temperature anemometer.

    Science.gov (United States)

    Ligeza, P

    2008-09-01

    A classical constant-temperature hot-wire anemometer enables the measurement of fast-changing flow velocity fluctuations, although its transmission bandwidth is a function of measured velocity. This may be a source of significant dynamic errors. Incorporation of an adaptive controller into the constant-temperature system results in hot-wire anemometer operating with a constant transmission bandwidth. The construction together with the results of experimental testing of a constant-bandwidth hot-wire anemometer prototype are presented in this article. During the testing, an approximately constant transmission bandwidth of the anemometer was achieved. The constant-bandwidth hot-wire anemometer can be used in measurements of high-frequency variable flows characterized by a wide range of velocity changes.

  14. Thermodynamics of nucleotide binding to actomyosin V and VI: a positive heat capacity change accompanies strong ADP binding.

    Science.gov (United States)

    Robblee, James P; Cao, Wenxiang; Henn, Arnon; Hannemann, Diane E; De La Cruz, Enrique M

    2005-08-02

    We have measured the energetics of ATP and ADP binding to single-headed actomyosin V and VI from the temperature dependence of the rate and equilibrium binding constants. Nucleotide binding to actomyosin V and VI can be modeled as two-step binding mechanisms involving the formation of collision complexes followed by isomerization to states with high nucleotide affinity. Formation of the actomyosin VI-ATP collision complex is much weaker and slower than for actomyosin V. A three-step binding mechanism where actomyosin VI isomerizes between two conformations, one competent to bind ATP and one not, followed by rapid ATP binding best accounts for the data. ADP binds to actomyosin V more tightly than actomyosin VI. At 25 degrees C, the strong ADP-binding equilibria are comparable for actomyosin V and VI, and the different overall ADP affinities arise from differences in the ADP collision complex affinity. The actomyosin-ADP isomerization leading to strong ADP binding is entropy driven at >15 degrees C and occurs with a large, positive change in heat capacity (DeltaC(P) degrees ) for both actomyosin V and VI. Sucrose slows ADP binding and dissociation from actomyosin V and VI but not the overall equilibrium constants for strong ADP binding, indicating that solvent viscosity dampens ADP-dependent kinetic transitions, presumably a tail swing that occurs with ADP binding and release. We favor a mechanism where strong ADP binding increases the dynamics and flexibility of the actomyosin complex. The heat capacity (DeltaC(P) degrees ) and entropy (DeltaS degrees ) changes are greater for actomyosin VI than actomyosin V, suggesting different extents of ADP-induced structural rearrangement.

  15. Cosmological constant, supersymmetry, nonassociativity, and big numbers

    Energy Technology Data Exchange (ETDEWEB)

    Dzhunushaliev, Vladimir [KazNU, Department of Theoretical and Nuclear Physics, Almaty (Kazakhstan); IETP, Al-Farabi KazNU, Almaty (Kazakhstan)

    2015-02-01

    The nonassociative generalization of supersymmetry is considered. It is shown that the associator of four supersymmetry generators has the coefficient ∝ ℎ/l{sub 0}{sup 2} where l0 is some characteristic length. Two cases are considered: (a) l{sub 0}{sup -2} coincides with the cosmological constant; (b) l{sub 0} is the classical radius of the electron. It is also shown that the scaled constant is of the order of 10{sup -120} for the first case and 10{sup -30} for the second case. The possible manifestation and smallness of nonassociativity is discussed. (orig.)

  16. The Cosmological Constant Problem (2/2)

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    I will review the cosmological constant problem as a serious challenge to our notion of naturalness in Physics. Weinberg’s no go theorem is worked through in detail. I review a number of proposals possibly including Linde's universe multiplication, Coleman's wormholes, the fat graviton, and SLED, to name a few. Large distance modifications of gravity are also discussed, with causality considerations pointing towards a global modification as being the most sensible option. The global nature of the cosmological constant problem is also emphasized, and as a result, the sequestering scenario is reviewed in some detail, demonstrating the cancellation of the Standard Model vacuum energy through a global modification of General Relativity.

  17. The Cosmological Constant Problem (1/2)

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    I will review the cosmological constant problem as a serious challenge to our notion of naturalness in Physics. Weinberg’s no go theorem is worked through in detail. I review a number of proposals possibly including Linde's universe multiplication, Coleman's wormholes, the fat graviton, and SLED, to name a few. Large distance modifications of gravity are also discussed, with causality considerations pointing towards a global modification as being the most sensible option. The global nature of the cosmological constant problem is also emphasized, and as a result, the sequestering scenario is reviewed in some detail, demonstrating the cancellation of the Standard Model vacuum energy through a global modification of General Relativity.

  18. Atomic weights: no longer constants of nature

    Science.gov (United States)

    Coplen, Tyler B.; Holden, Norman E.

    2011-01-01

    Many of us were taught that the standard atomic weights we found in the back of our chemistry textbooks or on the Periodic Table of the Chemical Elements hanging on the wall of our chemistry classroom are constants of nature. This was common knowledge for more than a century and a half, but not anymore. The following text explains how advances in chemical instrumentation and isotopic analysis have changed the way we view atomic weights and why they are no longer constants of nature

  19. Decay constants of heavy-light mesons

    International Nuclear Information System (INIS)

    Allton, C.R.; Crisafulli, M.; Lubicz, V.; Martinelli, G.; Salina, G.; Bartoloni, A.; Battista, C.; Cabasino, S.; Cabibbo, N.; Marzano, F.; Paolucci, P.S.; Pech, J.; Rapuano, F.; Sarno, R.; Todesco, G.M.; Torelli, M.; Tross, W.; Vicini, P.

    1994-01-01

    The decay constants of the heavy-light pseudoscalar mesons are studied in a high statistics run using the Wilson action at β=6.0 and β=6.2, and the clover action at β=6.0. The systematics of O(a) discretisation errors are discussed. Our best estimates of the decay constants are: f D =218(9) MeV, f D /f D s =1.11(1) and we obtain preliminary values for f B . (orig.)

  20. Lattice theta constants vs Riemann theta constants and NSR superstring measures

    International Nuclear Information System (INIS)

    Dunin-Barkowski, P.; Morozov, A.; Sleptsov, A.

    2009-01-01

    We discuss relations between two different representations of hypothetical holomorphic NSR measures, based on two different ways of constructing the semi-modular forms of weight 8. One of these ways is to build forms from the ordinary Riemann theta constants and another - from the lattice theta constants. We discuss unexpectedly elegant relations between lattice theta constants, corresponding to 16-dimensional self-dual lattices, and Riemann theta constants and present explicit formulae expressing the former ones through the latter. Starting from genus 5 the modular-form approach to construction of NSR measures is clearly sick and it seems to fail completely already at genus 6.

  1. FACTOR NUCLEAR kB (NF-kB: SIGNALOSOMA Y SU IMPORTANCIA EN ENFERMEDADES INFLAMATORIAS Y CÁNCER

    Directory of Open Access Journals (Sweden)

    Nancy P. Echeverry R.L

    2008-04-01

    Full Text Available El factor nuclear kB (NF-kB es un dímero constituido por proteínas de la familia Rel. El NF-kB se encuentra en el citoplasma unido a proteínas inhibidoras (IkB. Las IkB son fosforiladas por diferentes cinasas que hacen parte del signalosoma como las cinasas de IKKa e IKKb y el modulador esencial de NF-kB (NEMO, la proteína cinasa activadora de mitosis (MAPK o p38 y la cinasa inductora de NF-kB (NIK. Estas cinasas al ser activadas por señales dependientes de citocinas y luz ultravioleta, fosforilan las IkB provocando su ubiquitinación, su degradación por proteosoma y la subsecuente liberación y translocación al núcleo de NF-kB. Recientemente se le ha dado una gran importancia al NF-kB en la vía de señalización desencadenada por estrés oxidativo, estrés genotóxico y daño en el DNA. A diferencia de la vía denominada clásica, en esta ruta ocurre una SUMOilación de NEMO y translocación al núcleo. En el núcleo NEMO interactúa con la proteína de la ataxia telangiectasia mutada (ATM activada en respuesta a modificaciones en la cromatina y daño en el DNA. El complejo ATM/NEMO es translocado al citoplasma donde la ATM fosforila a las IKK llevando a la ubiquitinación y posterior liberación de NF-kB que es translocado al núcleo. NF-kB desencadena procesos de supervivencia incluyendo el aumento de la transcripción de enzimas antioxidantes como la superóxido dismutasa, catalasa y glutatión. Estas enzimas participan en el control de los niveles de especies reactivas de oxígeno en la célula. La sobreactivación de NF-kB se relaciona con inflamación y cáncer. En la actualidad se desarrolla una búsqueda de fármacos que actúen sobre moléculas del signalosoma de NF-kB, no sólo para el manejo de enfermedades inflamatorias sino también para el uso durante el tratamiento de tumores resistentes a radio y quimioterapia.

  2. The 29.5 kb APOBEC3B Deletion Polymorphism Is Not Associated with Clinical Outcome of Breast Cancer.

    Science.gov (United States)

    Liu, Jingjing; Sieuwerts, Anieta M; Look, Maxime P; van der Vlugt-Daane, Michelle; Meijer-van Gelder, Marion E; Foekens, John A; Hollestelle, Antoinette; Martens, John W M

    2016-01-01

    Increased APOBEC3B mRNA levels are associated with a hypermutator phenotype and poor prognosis in ER-positive breast cancer patients. In addition, a 29.5 kb deletion polymorphism of APOBEC3B, resulting in an APOBEC3A-B hybrid transcript, has been associated with an increased breast cancer risk and the hypermutator phenotype. Here we evaluated whether the APOBEC3B deletion polymorphism also associates with clinical outcome of breast cancer. Copy number analysis was performed by quantitative PCR (qPCR) in primary tumors of 1,756 Dutch breast cancer patients. The APOBEC3B deletion was found in 187 patients of whom 16 carried a two-copy deletion and 171 carried a one-copy deletion. The prognostic value of the APOBEC3B deletion for the natural course of the disease was evaluated among 1,076 lymph-node negative (LNN) patients who did not receive adjuvant systemic treatment. No association was found between APOBEC3B copy number values and the length of metastasis-free survival (MFS; hazard ratio (HR) = 1.00, 95% confidence interval (CI) = 0.90-1.11, P = 0.96). Subgroup analysis by ER status also did not reveal an association between APOBEC3B copy number values and the length of MFS. The predictive value of the APOBEC3B deletion was assessed among 329 ER-positive breast cancer patients who received tamoxifen as the first-line therapy for recurrent disease and 226 breast cancer patients who received first-line chemotherapy for recurrent disease. No association between APOBEC3B copy number values and the overall response rate (ORR) to either tamoxifen (odds ratio (OR) = 0.88, 95% CI = 0.69-1.13, P = 0.31) or chemotherapy (OR = 0.97, 95% CI = 0.71-1.33, P = 0.87) was found. Thus, in contrast to APOBEC3B mRNA levels, the APOBEC3B deletion polymorphism has neither a prognostic nor a predictive value for breast cancer patients. Although a correlation exists between APOBEC3B copy number and mRNA expression, it is relatively weak. This suggests that other mechanisms exist that may

  3. Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region

    Energy Technology Data Exchange (ETDEWEB)

    Wong, W.; Emanuel, B.S.; Siegert, J. [Children`s Hospital of Philadelphia, PA (United States)] [and others

    1994-09-01

    DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use of cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.

  4. A Tunisian patient with Pearson syndrome harboring the 4.977kb common deletion associated to two novel large-scale mitochondrial deletions.

    Science.gov (United States)

    Ayed, Imen Ben; Chamkha, Imen; Mkaouar-Rebai, Emna; Kammoun, Thouraya; Mezghani, Najla; Chabchoub, Imen; Aloulou, Hajer; Hachicha, Mongia; Fakhfakh, Faiza

    2011-07-29

    Pearson syndrome (PS) is a multisystem disease including refractory anemia, vacuolization of marrow precursors and pancreatic fibrosis. The disease starts during infancy and affects various tissues and organs, and most affected children die before the age of 3years. Pearson syndrome is caused by de novo large-scale deletions or, more rarely, duplications in the mitochondrial genome. In the present report, we described a Pearson syndrome patient harboring multiple mitochondrial deletions which is, in our knowledge, the first case described and studied in Tunisia. In fact, we reported the common 4.977kb deletion and two novel heteroplasmic deletions (5.030 and 5.234kb) of the mtDNA. These deletions affect several protein-coding and tRNAs genes and could strongly lead to defects in mitochondrial polypeptides synthesis, and impair oxidative phosphorylation and energy metabolism in the respiratory chain in the studied patient. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Cytotoxic agents for KB and SiHa cells from n-hexane fraction of Cissampelos pareira and its chemical composition.

    Science.gov (United States)

    Bala, Manju; Pratap, Kunal; Verma, Praveen Kumar; Padwad, Yogendra; Singh, Bikram

    2015-01-01

    Eleven constituents were characterised by gas chromatography-mass spectrometry analysis, and five molecules were isolated using column chromatography. The in vitro study of the extract and isolated molecules against KB and SiHa cell lines revealed oleanolic acid (1) and oleic acid (2) as potent cytotoxic molecules with potential anticancer activity. The IC50 values of n-hexane extract (CPHF), oleanolic acid (1) and oleic acid (2) were >300, 56.08 and 70.7 μg/mL (μM), respectively, against KB cell lines and >300, 47.24 and 80.2 μg/mL (μM), respectively, against SiHa cell lines.

  6. Loop-Mediated Isothermal Amplification (LAMP) for Rapid Detection and Quantification of Dehalococcoides Biomarker Genes in Commercial Reductive Dechlorinating Cultures KB-1 and SDC-9.

    Science.gov (United States)

    Kanitkar, Yogendra H; Stedtfeld, Robert D; Steffan, Robert J; Hashsham, Syed A; Cupples, Alison M

    2016-01-08

    Real-time quantitative PCR (qPCR) protocols specific to the reductive dehalogenase (RDase) genes vcrA, bvcA, and tceA are commonly used to quantify Dehalococcoides spp. in groundwater from chlorinated solvent-contaminated sites. In this study, loop-mediated isothermal amplification (LAMP) was developed as an alternative approach for the quantification of these genes. LAMP does not require a real-time thermal cycler (i.e., amplification is isothermal), allowing the method to be performed using less-expensive and potentially field-deployable detection devices. Six LAMP primers were designed for each of three RDase genes (vcrA, bvcA, and tceA) using Primer Explorer V4. The LAMP assays were compared to conventional qPCR approaches using plasmid standards, two commercially available bioaugmentation cultures, KB-1 and SDC-9 (both contain Dehalococcoides species). DNA was extracted over a growth cycle from KB-1 and SDC-9 cultures amended with trichloroethene and vinyl chloride, respectively. All three genes were quantified for KB-1, whereas only vcrA was quantified for SDC-9. A comparison of LAMP and qPCR using standard plasmids indicated that quantification results were similar over a large range of gene concentrations. In addition, the quantitative increase in gene concentrations over one growth cycle of KB-1 and SDC-9 using LAMP was comparable to that of qPCR. The developed LAMP assays for vcrA and tceA genes were validated by comparing quantification on the Gene-Z handheld platform and a real-time thermal cycler using DNA isolated from eight groundwater samples obtained from an SDC-9-bioaugmented site (Tulsa, OK). These assays will be particularly useful at sites subject to bioaugmentation with these two commonly used Dehalococcoides species-containing cultures. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. Kernel-Based Visual Hazard Comparison (kbVHC): a Simulation-Free Diagnostic for Parametric Repeated Time-to-Event Models.

    Science.gov (United States)

    Goulooze, Sebastiaan C; Välitalo, Pyry A J; Knibbe, Catherijne A J; Krekels, Elke H J

    2017-11-27

    Repeated time-to-event (RTTE) models are the preferred method to characterize the repeated occurrence of clinical events. Commonly used diagnostics for parametric RTTE models require representative simulations, which may be difficult to generate in situations with dose titration or informative dropout. Here, we present a novel simulation-free diagnostic tool for parametric RTTE models; the kernel-based visual hazard comparison (kbVHC). The kbVHC aims to evaluate whether the mean predicted hazard rate of a parametric RTTE model is an adequate approximation of the true hazard rate. Because the true hazard rate cannot be directly observed, the predicted hazard is compared to a non-parametric kernel estimator of the hazard rate. With the degree of smoothing of the kernel estimator being determined by its bandwidth, the local kernel bandwidth is set to the lowest value that results in a bootstrap coefficient of variation (CV) of the hazard rate that is equal to or lower than a user-defined target value (CV target ). The kbVHC was evaluated in simulated scenarios with different number of subjects, hazard rates, CV target values, and hazard models (Weibull, Gompertz, and circadian-varying hazard). The kbVHC was able to distinguish between Weibull and Gompertz hazard models, even when the hazard rate was relatively low (< 2 events per subject). Additionally, it was more sensitive than the Kaplan-Meier VPC to detect circadian variation of the hazard rate. An additional useful feature of the kernel estimator is that it can be generated prior to model development to explore the shape of the hazard rate function.

  8. Thymoquinone prevents RANKL-induced osteoclastogenesis activation and osteolysis in an in vivo model of inflammation by suppressing NF-KB and MAPK Signalling.

    Science.gov (United States)

    Thummuri, Dinesh; Jeengar, Manish Kumar; Shrivastava, Shweta; Nemani, Harishankar; Ramavat, Ravindar Naik; Chaudhari, Pradip; Naidu, V G M

    2015-09-01

    Osteoclasts are multinuclear giant cells responsible for bone resorption in inflammatory bone diseases such as osteoporosis, rheumatoid arthritis and periodontitis. Because of deleterious side effects with currently available drugs the search continues for novel effective and safe therapies. Thymoquinone (TQ), the major bioactive component of Nigella sativa has been investigated for its anti-inflammatory, antioxidant and anticancer activities. However, its effects in osteoclastogenesis have not been reported. In the present study we show for the first time that TQ inhibits nuclear factor-KB ligand (RANKL) induced osteoclastogenesis in RAW 264.7 and primary bone marrow derived macrophages (BMMs) cells. RANKL induced osteoclastogenesis is associated with increased expression of multiple transcription factors via activation of NF-KB, MAPKs signalling and reactive oxygen species (ROS). Mechanistically TQ blocked the RANKL induced NF-KB activation by attenuating the phosphorylation of IkB kinase (IKKα/β). Interestingly, in RAW 264.7 cells TQ inhibited the RANKL induced phosphorylation of MAPKs and mRNA expression of osteoclastic specific genes such as TRAP, DC-STAMP, NFATc1 and c-Fos. In addition, TQ also decreased the RANKL stimulated ROS generation in macropahges (RAW 264.7) and H2O2 induced ROS generation in osteoblasts (MC-3T3-E1). Consistent with in vitro results, TQ inhibited lipopolysaccharide (LPS) induced bone resorption by suppressing the osteoclastogenesis. Indeed, micro-CT analysis showed that bone mineral density (BMD) and bone architecture parameters were positively modulated by TQ. Taken together our data demonstrate that TQ has antiosteoclastogenic effect by inhibiting inflammation induced activation of MAPKs, NF-KB and ROS generation followed by suppressing the gene expression of c-Fos and NFATc1 in osteoclast precursors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Soggy, a spermatocyte-specific gene, lies 3.8 kb upstream of and antipodal to TEAD-2, a transcription factor expressed at the beginning of mouse development.

    Science.gov (United States)

    Kaneko, K J; DePamphilis, M L

    2000-10-15

    Investigation of the regulatory region of mTEAD-2, a gene expressed at the beginning of mouse pre-implantation development, led to the surprising discovery of another gene only 3.8 kb upstream of mTEAD-2. Here we show that this new gene is a single copy, testis-specific gene called SOGGY: (mSgy) that produces a single, dominant mRNA approximately 1.3 kb in length. It is transcribed in the direction opposite to mTEAD-2, thus placing the regulatory elements of these two genes in close proximity. mSgy contains three methionine codons that could potentially act as translation start sites, but most mSGY protein synthesis in vitro was initiated from the first Met codon to produce a full-length protein, suggesting that mSGY normally consists of 230 amino acids (26.7 kDa). Transcription began at a cluster of nucleotides approximately 150 bp upstream of the first Met codon using a TATA-less promoter contained within the first 0.9 kb upstream. The activity of this promoter was repressed by upstream sequences between -0.9 and -2.5 kb in cells that did not express mSgy, but this repression was relieved in cells that did express mSgy. mSgy mRNA was detected in embryos only after day 15 and in adult tissues only in the developing spermatocytes of seminiferous tubules, suggesting that mSgy is a spermatocyte-specific gene. Since mTEAD-2 and mSgy were not expressed in the same cells, the mSgy/mTEAD-2 locus provides a unique paradigm for differential regulation of gene expression during mammalian development.

  10. Binding of poly(amidoamine), carbosilane, phosphorus and hybrid dendrimers to thrombin-Constants and mechanisms.

    Science.gov (United States)

    Shcharbin, Dzmitry; Pedziwiatr-Werbicka, Elzbieta; Vcherashniaya, Aliaksandra; Janaszewska, Anna; Marcinkowska, Monika; Goska, Piotr; Klajnert-Maculewicz, Barbara; Ionov, Maksim; Abashkin, Viktar; Ihnatsyeu-Kachan, Aliaksei; de la Mata, F Javier; Ortega, Paula; Gomez-Ramirez, Rafael; Majoral, Jean-Pierre; Bryszewska, Maria

    2017-07-01

    Thrombin is an essential part of the blood coagulation system; it is a serine protease that converts soluble fibrinogen into insoluble strands of fibrin, and catalyzes many other coagulation-related reactions. Absorption at its surface of small nanoparticles can completely change the biological properties of thrombin. We have analyzed the influence on thrombin of 3 different kinds of small nanoparticles: dendrimers (phosphorus-based, carbosilane based and polyamidoamine) and 2 hybrid systems containing carbosilane, viologen and phosphorus dendritic scaffolds in one single molecule, bearing different flexibility, size and surface charge. There was significant alteration in the rigidity of the rigid dendrimers in contrast to flexible dendrimers. These differences in their action are important in understanding interactions taking place at a bio-nanointerface. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Determination of stability constants using genetic algorithms

    NARCIS (Netherlands)

    Hartnett, Margaret K.; Bos, M.; van der Linden, W.E.; Diamond, Dermot

    1995-01-01

    A genetic algorithm (GA)-simplex hybrid approach has been developed for the determination of stability constants using calorimetric and polarographic data obtained from literature sources. The GA determined both the most suitable equilibrium model for the systems studied and the values of the

  12. Bounds on Gromov hyperbolicity constant in graphs

    Indian Academy of Sciences (India)

    Home; Journals; Proceedings – Mathematical Sciences; Volume 122; Issue 1. Bounds on Gromov Hyperbolicity Constant in Graphs. José M Rodríguez José M Sigarreta. Volume 122 ... Spain; Facultad de Matemáticas, Universidad Autónoma de Guerrero, Carlos E. Adame No. 54 Col. Garita, 39650 Acalpulco Gro., Mexico ...

  13. Timelike Constant Mean Curvature Surfaces with Singularities

    DEFF Research Database (Denmark)

    Brander, David; Svensson, Martin

    2014-01-01

    We use integrable systems techniques to study the singularities of timelike non-minimal constant mean curvature (CMC) surfaces in the Lorentz–Minkowski 3-space. The singularities arise at the boundary of the Birkhoff big cell of the loop group involved. We examine the behavior of the surfaces...

  14. Dissociative electron attachment to ozone: rate constant

    International Nuclear Information System (INIS)

    Skalny, J.D.; Cicman, P.; Maerk, T.D.

    2002-01-01

    The rate constant for dissociative electron attachment to ozone has been derived over the energy range of 0-10 eV by using previously measured cross section data revisited here in regards to discrimination effect occurring during the extraction of ions. The obtained data for both possible channels exhibit the maximum at mean electron energies close to 1 eV. (author)

  15. Internal machining accomplished at constant radii

    Science.gov (United States)

    Gollihugh, T. E.

    1966-01-01

    Device machines fluid passages in workpieces at constant radii through two adjacent surfaces that are at included angles up to approximately 120 degrees. This technique has been used extensively in fabricating engine parts where close control of fluid flow is a requirement.

  16. On the determination of the Hubble constant

    International Nuclear Information System (INIS)

    Gurzadyan, V.G.; Harutyunyan, V.V.; Kocharyan, A.A.

    1990-10-01

    The possibility of an alternative determination of the distance scale of the Universe and the Hubble constant based on the numerical analysis of the hierarchical nature of the large scale Universe (galaxies, clusters and superclusters) is proposed. The results of computer experiments performed by means of special numerical algorithms are represented. (author). 9 refs, 7 figs

  17. On Product Logic with Truth-Constants

    Czech Academy of Sciences Publication Activity Database

    Savický, Petr; Cignoli, R.; Esteva, F.; Godo, L.; Noguera, C.

    2006-01-01

    Roč. 16, č. 2 (2006), s. 205-225 ISSN 0955-792X R&D Projects: GA MŠk 1M0545 Keywords : non-classical logic * fuzzy logic * product logic * truth-constants * standard completeness Subject RIV: BA - General Mathematics Impact factor: 0.840, year: 2006

  18. The Nature of the Cosmological Constant Problem

    Science.gov (United States)

    Maia, M. D.; Capistrano, A. J. S.; Monte, E. M.

    General relativity postulates the Minkowski space-time as the standard (flat) geometry against which we compare all curved space-times and also as the gravitational ground state where particles, quantum fields and their vacua are defined. On the other hand, experimental evidences tell that there exists a non-zero cosmological constant, which implies in a deSitter ground state, which not compatible with the assumed Minkowski structure. Such inconsistency is an evidence of the missing standard of curvature in Riemann's geometry, which in general relativity manifests itself in the form of the cosmological constant problem. We show how the lack of a curvature standard in Riemann's geometry can be fixed by Nash's theorem on metric perturbations. The resulting higher dimensional gravitational theory is more general than general relativity, similar to brane-world gravity, but where the propagation of the gravitational field along the extra dimensions is a mathematical necessity, rather than a postulate. After a brief introduction to Nash's theorem, we show that the vacuum energy density must remain confined to four-dimensional space-times, but the cosmological constant resulting from the contracted Bianchi identity represents a gravitational term which is not confined. In this case, the comparison between the vacuum energy and the cosmological constant in general relativity does not make sense. Instead, the geometrical fix provided by Nash's theorem suggests that the vacuum energy density contributes to the perturbations of the gravitational field.

  19. Redundant internal coordinates, compliance constants and non ...

    Indian Academy of Sciences (India)

    Abstract. A long standing problem in normal mode analysis is identifying the right internal coordinates given only the cartesian coordinates, the masses of the atoms and the cartesian force constants without using any other additional chemical information. A possible solution is suggested here as drawing the normal modes.

  20. Lifetime of titanium filament at constant current

    International Nuclear Information System (INIS)

    Chou, T.S.; Lanni, C.

    1981-01-01

    Titanium Sublimation Pump (TSP) represents the most efficient and the least expensive method to produce Ultra High Vacuum (UHV) in storage rings. In ISABELLE, a proton storage accelerator under construction at Brookhaven National Laboratory, for example, TSP provides a pumping speed for hydrogen of > 2 x 10 6 l/s. Due to the finite life of titanium filaments, new filaments have to be switched in before the end of filament burn out, to ensure smooth operation of the accelerator. Therefore, several operational modes that can be used to activate the TSP were studied. The constant current mode is a convenient way of maintaining constant evaporating rate by increasing the power input while the filament diameter decreases as titanium evaporates. The filaments used in this experiment were standard Varian 916-0024 filaments made of Ti 85%, Mo 15% alloy. During their lifetime at a constant current of 48 amperes, the evaporation rate rose to a maximum at about 10% of their life and then flattened out to a constant value, 0.25 g/hr. The maximum evaporation rate occurs coincidently with the recrystallization of 74% Ti 26% Mo 2 from microstructure crystalline at higher titanium concentration to macrostructure crystalline at lower titanium concentration. As the macrocrystal grows, the slip plane develops at the grain boundary resulting in high resistance at the slip plane which will eventually cause the filament burn out due to local heating

  1. Simple atoms: QED tests and fundamental constants

    International Nuclear Information System (INIS)

    Karshenboim, S.G.

    2002-01-01

    Full text: Study of simple atoms can be performed theoretically and experimentally with a high accuracy and a comparison of theory and experiment provide us with several high precision tests of bound state QED. Theory cannot actually leads to a figure to compare with experiment, but it only can present some measurable quantities in terms of fundamental and auxiliary constants. That offers an opportunity to obtain new accurate values of some fundamental constants. Theory of simple atoms is based on Quantum electrodynamics but also involves an essential part of nuclear and particle physics. A significant part of experiments are related to high-resolution laser spectroscopy. Present status of the precision physics of simple atoms is presented in detail. We overview a comparison of the theory of such atoms, bound state QED, and the experiment. In particular, we consider the hyperfine structure in light atoms and the g-factor of a bound electron in hydrogen-like ions at low and medium Z. We discuss a project on optical measurement of of 2s hyperfine interval in atomic hydrogen. We also pay attention to determination of the fundamental constants from study of simple atoms. The constants under consideration includes alpha, electron-to-proton mass ratio and electron-to-muon mass ratio

  2. The case for the cosmological constant

    Indian Academy of Sciences (India)

    The main motivation for invoking a small cosmological constant (orA-term) at the present epoch has to ... positive A-term leads to an increase in the luminosity distance and hence to a decline in the observed luminosity of high .... 0 leads to a longer age for the universe and could resolve the 'age problem' which has proved ...

  3. PION-NUCLEON COUPLING-CONSTANT

    NARCIS (Netherlands)

    STOKS,; TIMMERMANS, R; DESWART, JJ

    In view of the persisting misunderstandings about the determination of the pion-nucleon coupling constants in the Nijmegen multienergy partial-wave analyses of pp, np, and ppBAR scattering data, we present additional information which may clarify several points of discussion. We comment on several

  4. Time constant of logarithmic creep and relaxation

    CSIR Research Space (South Africa)

    Nabarro, FRN

    2001-07-15

    Full Text Available length and hardness which vary logarithmically with time. For dimensional reasons, a logarithmic variation must involve a time constant tau characteristic of the process, so that the deformation is proportional to ln(t/tau). Two distinct mechanisms...

  5. HLA-C -35kb expression SNP is associated with differential control of β-HPV infection in squamous cell carcinoma cases and controls.

    Directory of Open Access Journals (Sweden)

    Karin A Vineretsky

    Full Text Available A single nucleotide polymorphism (SNP 35 kb upstream of the HLA-C gene is associated with HLA-C expression, and the high expressing genotype (CC has been associated with HIV-I control. HLA-C is unique among the classical MHC class I molecules for its role in the control of viral infections and recognition of abnormal or missing self. This immunosurveillance is central to the pathogenesis of non-melanoma skin cancer (NMSC, and of squamous cell carcinoma (SCC in particular. While sun exposure is a major risk factor for these cancers, cutaneous infections with genus β-HPV have been implicated in the development of SCC. We hypothesized that the high expression HLA-C genotype is associated with β-HPV infections. Therefore, we investigated the association between β-HPV serology and the -35 kb SNP (rs9264942 in a population-based case-control study of 510 SCC cases and 608 controls. Among controls, the high expression -35 kb SNP genotype (CC reduced the likelihood of positive serology for multiple (≥2 β-HPV infections (OR = 0.49, 95% CI: 0.25-0.97, and β-HPV species 2 infection (OR = 0.43, 95% CI: 0.23-0.79. However, no association with β-HPV status was observed among SCC cases. Our findings suggest that underlying immunogenotype plays an important role in differential control of β-HPV in SCC cases and controls.

  6. The white gene of the tephritid fruit fly Bactrocera tryoni is characterized by a long untranslated 5' leader and a 12kb first intron.

    Science.gov (United States)

    Bennett, C L; Frommer, M

    1997-11-01

    A 300 bp fragment from exon 6 of the white gene of Bactrocera tryoni was used to screen a B. tryoni genomic library. One positive (approximately 14 kb) insert contained exons 2-6 of white by nucleotide and amino acid sequence similarity to the white genes of D. melanogaster (O'Hare et al., 1984; Pepling & Mount, 1990). Lucilia cuprina (Garcia et al., 1996). Ceratitis capitata (Zwiebel et al., 1995) and Anopheles gambiae (Besansky et al., 1995). A white 5' cDNA fragment containing exons 1, 2 and part of exon 3 was amplified, cloned and sequenced. An inverse PCR fragment of genomic DNA was generated, containing the exon 1 coding region plus approximately 2.1 kb of upstream sequence, encompassing the putative promoter of the gene. Exon 1 was found to be 728 bp long, encoding the first twenty-five amino acids. The full length of intron 1 was shown to be 12 kb (amplified using long PCR protocols), up to 3 times the length of the longest white intron 1 isolated to date.

  7. Low-Resolution Electromagnetic Tomography (LORETA) of changed Brain Function Provoked by Pro-Dopamine Regulator (KB220z) in one Adult ADHD case

    Science.gov (United States)

    Steinberg, Bruce; Blum, Kenneth; McLaughlin, Thomas; Lubar, Joel; Febo, Marcelo; Braverman, Eric R.; Badgaiyan, Rajendra D

    2016-01-01

    Attention Deficit-Hyperactivity Disorder (ADHD) often continues into adulthood. Recent neuroimaging studies found lowered baseline dopamine tone in the brains of affected individuals that may place them at risk for Substance Use Disorder (SUD). This is an observational case study of the potential for novel management of Adult ADHD with a non-addictive glutaminergic-dopaminergic optimization complex KB200z. Low-resolution electromagnetic tomography (LORETA) was used to evaluate the effects of KB220z on a 72-year-old male with ADHD, at baseline and one hour following administration. The resultant z-scores, averaged across Eyes Closed, Eyes Open and Working Memory conditions, increased for each frequency band, in the anterior, dorsal and posterior cingulate regions, as well as the right dorsolateral prefrontal cortex during Working Memory, with KB220z. These scores are consistent with other human and animal neuroimaging studies that demonstrated increased connectivity volumes in reward circuitry and may offer a new approach to ADHD treatment. However, larger randomized trials to confirm these results are required. PMID:27610420

  8. Construction of Lines of Constant Density and Constant Refractive Index for Ternary Liquid Mixtures.

    Science.gov (United States)

    Tasic, Aleksandar Z.; Djordjevic, Bojan D.

    1983-01-01

    Demonstrates construction of density constant and refractive index constant lines in triangular coordinate system on basis of systematic experimental determinations of density and refractive index for both homogeneous (single-phase) ternary liquid mixtures (of known composition) and the corresponding binary compositions. Background information,…

  9. Molecular equilibrium structures from experimental rotational constants and calculated vibration-rotation interaction constants

    DEFF Research Database (Denmark)

    Pawlowski, F; Jorgensen, P; Olsen, Jeppe

    2002-01-01

    A detailed study is carried out of the accuracy of molecular equilibrium geometries obtained from least-squares fits involving experimental rotational constants B(0) and sums of ab initio vibration-rotation interaction constants alpha(r)(B). The vibration-rotation interaction constants have been...... calculated for 18 single-configuration dominated molecules containing hydrogen and first-row atoms at various standard levels of ab initio theory. Comparisons with the experimental data and tests for the internal consistency of the calculations show that the equilibrium structures generated using Hartree......-Fock vibration-rotation interaction constants have an accuracy similar to that obtained by a direct minimization of the CCSD(T) energy. The most accurate vibration-rotation interaction constants are those calculated at the CCSD(T)/cc-pVQZ level. The equilibrium bond distances determined from these interaction...

  10. The binding of Np to rat bone

    International Nuclear Information System (INIS)

    Ramounet, B.; Taylor, D.M.

    1997-01-01

    Neptunium has been shown to massively deposit in bone, after intravenous or intramuscular injections. Initially, it was uniformly distributed on periosteal and endosteal bone surfaces. The nature of the binding molecules, for this actinide, in the skeleton, has not yet been identified. The aim of this work was to characterize the ligands of neptunium by selective extractions of bone components. The preliminary results displayed the binding of 237 Np(IV) in the organic phase of bone, after intravenous or intramuscular contamination. Further studies are in progress, to quantify the fraction of Np bound to the organic and mineral compartment of bone, and to determine the affinity constant and the turn-over of the binding proteins. (authors)

  11. The expressions of NF-kb and TGFb-1 on odontoblast-like cells of human dental pulp injected with propolis extracts

    Directory of Open Access Journals (Sweden)

    Ira Widjiastuti

    2014-03-01

    Full Text Available Background: Propolis is known to have beneficial effects, namely anti- bacterial, anti-viral, anti-inflammatory, antioxidant, and immunomodulatory. Propolis extracts with anti-inflammatory properties are expected to be useful in treating inflamed pulp tissue with a diagnosis of reversible pulpitis. The inflammation of pulp tissue is caused by bacteria, namely Lactobacillus acidophilus. This research used odontoblast like cells derived from pulp tissue of human third molars. Odontoblast like cells exposed to Lactobacillus achidophilus were used as a model of proinflammatory cytokine signaling. This research examined the effects of propolis extracts on odontoblast like cells exposed to Lactobacillus acidophilus. Purpose: This research was aimed to determine the effectiveness of propolis extracts on the activities of odontoblast-like cells exposed to Lactobacillus acidophillus by measuring the expressions of NFkb and TGF- b1. Methods: First, pulp odontoblast cultures were derived from human dental pulp tissues of impacted third molars removed by using digestion method. Next, odontoblast-like cells exposed to inactive Lactobacillus acidophilus bacteria were given propolis extract. Finally, the activities of odontoblast-like cells were monitored by measuring the expressions of NF-kb and TGFb-1 with immunocytochemistry technique. Results: A decline NF-kb expression and on increase of TGFb-1 expression on odontoblast like cells exposed to inactive Lactobacillus acidophilus. Conclusion: Propolis extracts inhibit the expression of NF-kb, and increase the expression of TGF-b1 in pulp odontoblast-like cells exposed to inactive Lactobacillus acidophillus.Latar belakang: Propolis dilaporkan mempunyai efek menguntungkan yaitu bersifat anti bakteri, anti virus, anti inflamasi, anti oksidan, dan imunomodulator. Ekstrak propolis dengan sifat anti inflamasi diharapkan bermanfaat untuk mengobati jaringan pulpa yang mengalami inflamasi dengan diagnosis pulpitis

  12. Benjamin Constant. Libertad, democracia y pluralismo

    Directory of Open Access Journals (Sweden)

    Claudia Patricia Fonnegra Osorio

    2015-01-01

    Full Text Available A partir de un enfoque interpretativo, en este artículo se aborda por qué para Benjamin Constant la democracia solo puede darse en donde se presenta una relación necesaria entre la libertad entendida como defensa de los derechos individuales —libertad como independencia o negativa— y la libertad concebida como principio de la participación pública —libertad como autonomía o positiva—. Asimismo, se presenta la importancia que atribuye el autor a las tradiciones que dan vida a la configuración del universo cultural de un pueblo. Se concluye que en la obra de Constant se encuentra una clara defensa del Estado de derecho y del pluralismo, la cual puede iluminar la comprensión de los problemas políticos de la contemporaneidad.

  13. Supersymmetric Dark Matter with a Cosmological Constant

    CERN Document Server

    Wells, J D

    1998-01-01

    Recent measurements of cosmological parameters from the microwave background radiation, type Ia supernovae, and the age of globular clusters help determine the relic matter density in the universe. It is first shown with mild cosmological assumptions that the relic matter density satisfies $\\Omega_M h^2 < 0.6$ independent of the cosmological constant and independent of the SNIa data. Including the SNIa data, the constraint becomes $\\Omega_M h^2 < 0.35$. This result is then applied to supersymmetric models motivated by generic features in supergravity mediated supersymmetry breaking. The result is an upper bound on gaugino masses within reach of the LHC and a 1.5 TeV lepton collider. Thus, cosmological considerations are beginning to limit the supersymmetric mass spectra in the experimentally verifiable range without recourse to finetuning arguments, and without assuming a zero cosmological constant.

  14. Understanding fine structure constants and three generations

    International Nuclear Information System (INIS)

    Bennett, D.L.; Nielsen, H.B.

    1988-02-01

    We put forward a model inspired by random dynamics that relates the smallness of the gauge coupling constants to the number of generations being 'large'. The new element in the present version of our model is the appearance of a free parameter χ that is a measure of the (presumably relatively minor) importance of a term in the plaquette action proportional to the trace in the (1/6, 2, 3) representation of the Standard Model. Calling N gen the number of generations, the sets of allowed (N gen , χN gen )-pairs obtained by imposing the three measured coupling constant values of the Standard Model form three lines. In addition to finding that these lines cross at a single point (as needed for a consistent fit), the intersection occurs with surprising accuracy at the integer N gen = 3 (thereby predicting exactly three generations). It is also encouraging that the parameter χ turns out to be small and positive as expected. (orig.)

  15. Parametrised Constants and Replication for Spatial Mobility

    DEFF Research Database (Denmark)

    Hüttel, Hans; Haagensen, Bjørn

    2009-01-01

    and the calculus of mobile ambients. Here, processes are located at sites and can migrate between them. In this paper we say that an encoding is local if it does not introduce extra migration. We first study this property for the distributed π-calculus where locations can be dynamically created. If the set...... of reachable sites is static an encoding exists, but we also show that parametrised constants can not be encoded in the full calculus. The locality requirement supplements widely accepted encoding criteria. It appears to be a natural property in spatial calculi where links and locations can fail. The versions...... of the distributed π-calculus with parametrised constants and replication are incomparable. On the other hand, we shall see that there exists a simple encoding of recursion in mobile ambients....

  16. The cosmological constant and the pulsating universe.

    Science.gov (United States)

    Tangherlini, F. R.

    1991-02-01

    The author's recently described method for obtaining an upper bound for a recollapsing, closed universe with a positive cosmological constant is extended to obtain a lower bound for a negative Λ. The bounds are readily generalized to cosmologies of higher dimensions. As the radius of recollapse becomes infinite and the metric Minkowskian, the bounds shrink to zero. It is inferred that in a special relativistic theory, the cosmological term should vanish. A special relativistic proof of this is given based on requiring invariance under the "tilting" of the spacelike hypersurface. Some of the remaining problems and possible successes of the pulsating universe are also described. In the appendix, the well-known instability of the Einstein universe is briefly treated by the method used here to obtain bounds on the cosmological constant.

  17. Benjamin Constant. Libertad, democracia y pluralismo

    Directory of Open Access Journals (Sweden)

    Claudia Patricia Fonnegra Osorio

    2015-12-01

    Full Text Available A partir de un enfoque interpretativo, en este artículo se aborda por qué para Benjamin Constant la democracia solo puede darse en donde se presenta una relación necesaria entre la libertad entendida como defensa de los derechos individuales -libertad como independencia o negativa- y la libertad concebida como principio de la participación pública -libertad como autonomía o positiva-. Asimismo, se presenta la importancia que atribuye el autor a las tradiciones que dan vida a la configuración del universo cultural de un pueblo. Se concluye que en la obra de Constant se encuentra una clara defensa del Estado de derecho y del pluralismo, la cual puede iluminar la comprensión de los problemas políticos de la contemporaneidad.

  18. Constant force extensional rheometry of polymer solutions

    DEFF Research Database (Denmark)

    Szabo, Peter; McKinley, Gareth H.; Clasen, Christian

    2012-01-01

    We revisit the rapid stretching of a liquid filament under the action of a constant imposed tensile force, a problem which was first considered by Matta and Tytus [J. Non-Newton. Fluid Mech. 35 (1990) 215–229]. A liquid bridge formed from a viscous Newtonian fluid or from a dilute polymer solution...... is first established between two cylindrical disks. The upper disk is held fixed and may be connected to a force transducer while the lower cylinder falls due to gravity. By varying the mass of the falling cylinder and measuring its resulting acceleration, the viscoelastic nature of the elongating fluid...... filament can be probed. In particular, we show that with this constant force pull (CFP) technique it is possible to readily impose very large material strains and strain rates so that the maximum extensibility of the polymer molecules may be quantified. This unique characteristic of the experiment...

  19. Bardeen-Cooper-Schrieffer universal constants generalized

    International Nuclear Information System (INIS)

    Hazaimeh, A.H.

    1992-01-01

    Weak- and moderate-coupling BCS superconductivity theory is shown to admit a more general T c formula, wherein T c approaches zero somewhat faster than with the familiar BCS T c -formula. This theory leads to a departure from the universal behavior of the gap-to-T c ratio and is consistent with some recent empirical values for exotic superconductors. This ratio is smaller than the universal BCS value of 3.53 in a way which is consistent with weak electron-boson coupling. Similarly, other universal constants related to specific heat and critical magnetic field are modified. In this dissertation, The author investigates the latter constants for weak-coupling and moderate-coupling and carry out detailed comparisons with experimental data for the cuprates and with the corresponding predictions of strong-coupling theory. This effort is to elucidate the nature of these superconductors with regards to coupling strength within an electron-boson mechanism

  20. f(R) constant-roll inflation

    Energy Technology Data Exchange (ETDEWEB)

    Motohashi, Hayato [Universidad de Valencia-CSIC, Instituto de Fisica Corpuscular (IFIC), Valencia (Spain); Starobinsky, Alexei A. [L.D. Landau Institute for Theoretical Physics, RAS, Moscow (Russian Federation); National Research University Higher School of Economics, Moscow (Russian Federation)

    2017-08-15

    The previously introduced class of two-parametric phenomenological inflationary models in general relativity in which the slow-roll assumption is replaced by the more general, constant-roll condition is generalized to the case of f(R) gravity. A simple constant-roll condition is defined in the original Jordan frame, and exact expressions for a scalaron potential in the Einstein frame, for a function f(R) (in the parametric form) and for inflationary dynamics are obtained. The region of the model parameters permitted by the latest observational constraints on the scalar spectral index and the tensor-to-scalar ratio of primordial metric perturbations generated during inflation is determined. (orig.)

  1. Bounds on Gromov hyperbolicity constant in graphs

    Indian Academy of Sciences (India)

    is a topic of recent and increasing interest in graph theory; see, for instance [3–5, 8–10,. 15–17, 18–20, 22, 23, 25–27]. The theory ..... the Laplace matrix μ∗, we have δ(G) ≤ n(μ∗ − d0) μ∗ . Proof. ..... [27] Tourís E, Graphs and Gromov hyperbolicity of non-constant negatively curved surfaces,. J. Math. Anal. Appl. 380 (2011) ...

  2. Simulated annealing with constant thermodynamic speed

    International Nuclear Information System (INIS)

    Salamon, P.; Ruppeiner, G.; Liao, L.; Pedersen, J.

    1987-01-01

    Arguments are presented to the effect that the optimal annealing schedule for simulated annealing proceeds with constant thermodynamic speed, i.e., with dT/dt = -(v T)/(ε-√C), where T is the temperature, ε- is the relaxation time, C ist the heat capacity, t is the time, and v is the thermodynamic speed. Experimental results consistent with this conjecture are presented from simulated annealing on graph partitioning problems. (orig.)

  3. Electromagnetic corrections to pseudoscalar decay constants

    Energy Technology Data Exchange (ETDEWEB)

    Glaessle, Benjamin Simon

    2017-03-06

    First principles Lattice quantum chromodynamics (LQCD) calculations enable the determination of low energy hadronic amplitudes. Precision LQCD calculations with relative errors smaller than approximately 1% require the inclusion of electromagnetic effects. We demonstrate that including (quenched) quantum electrodynamics effects in the LQCD calculation effects the values obtained for pseudoscalar decay constants in the per mille range. The importance of systematic effects, including finite volume effects and the charge dependence of renormalization and improvement coefficients, is highlighted.

  4. The cosmological constant and galaxy formation

    International Nuclear Information System (INIS)

    Durrer, R.; Straumann, N.

    1990-01-01

    We derive a restrictive upper bound for the cosmological constant from the requirement that the formation of galaxies in a cold dark matter scenario should be compatible with the present observational limits for possible anisotropies of the microwave background. If the total density parameter Ω (including the vacuum energy) is equal to the critical value (Ω = 1), we find for the contribution Ω V of the vacuum energy density the conservative bound Ω V <0.7. (author)

  5. A Memorandum Report: Physical Constants of MCE

    Science.gov (United States)

    2016-08-01

    the density and surface tension. In effect, this constant is a corrected molar volume = P = MS / = S / where P = Parachor M = molar volume ...Clapeyron equation Surface tension Viscosity Freezing point GA 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER...to the Figure will show. The volatility of the MCE was calculated from the calculated values of vapor pressure by the ideal gas law and the values

  6. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri

    2012-07-01

    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  7. Emergent gravity in spaces of constant curvature

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez, Orlando; Haddad, Matthew [Department of Physics, University of Miami,1320 Campo Sano Ave, Coral Gables, FL 33146 (United States)

    2017-03-07

    In physical theories where the energy (action) is localized near a submanifold of a constant curvature space, there is a universal expression for the energy (or the action). We derive a multipole expansion for the energy that has a finite number of terms, and depends on intrinsic geometric invariants of the submanifold and extrinsic invariants of the embedding of the submanifold. This is the second of a pair of articles in which we try to develop a theory of emergent gravity arising from the embedding of a submanifold into an ambient space equipped with a quantum field theory. Our theoretical method requires a generalization of a formula due to by Hermann Weyl. While the first paper discussed the framework in Euclidean (Minkowski) space, here we discuss how this framework generalizes to spaces of constant sectional curvature. We focus primarily on anti de Sitter space. We then discuss how such a theory can give rise to a cosmological constant and Planck mass that are within reasonable bounds of the experimental values.

  8. Emergent gravity in spaces of constant curvature

    Science.gov (United States)

    Alvarez, Orlando; Haddad, Matthew

    2017-03-01

    In physical theories where the energy (action) is localized near a submanifold of a constant curvature space, there is a universal expression for the energy (or the action). We derive a multipole expansion for the energy that has a finite number of terms, and depends on intrinsic geometric invariants of the submanifold and extrinsic invariants of the embedding of the submanifold. This is the second of a pair of articles in which we try to develop a theory of emergent gravity arising from the embedding of a submanifold into an ambient space equipped with a quantum field theory. Our theoretical method requires a generalization of a formula due to by Hermann Weyl. While the first paper discussed the framework in Euclidean (Minkowski) space, here we discuss how this framework generalizes to spaces of constant sectional curvature. We focus primarily on anti de Sitter space. We then discuss how such a theory can give rise to a cosmological constant and Planck mass that are within reasonable bounds of the experimental values.

  9. Constant load and constant volume response of municipal solid waste in simple shear.

    Science.gov (United States)

    Zekkos, Dimitrios; Fei, Xunchang

    2017-05-01

    Constant load and constant volume simple shear testing was conducted on relatively fresh municipal solid waste (MSW) from two landfills in the United States, one in Michigan and a second in Texas, at respective natural moisture content below field capacity. The results were assessed in terms of two failure strain criteria, at 10% and 30% shear strain, and two interpretations of effective friction angle. Overall, friction angle obtained assuming that the failure plane is horizontal and at 10% shear strain resulted in a conservative estimation of shear strength of MSW. Comparisons between constant volume and constant load simple shear testing results indicated significant differences in the shear response of MSW with the shear resistance in constant volume being lower than the shear resistance in constant load. The majority of specimens were nearly uncompacted during specimen preparation to reproduce the state of MSW in bioreactor landfills or in uncontrolled waste dumps. The specimens had identical percentage of waste. The results of these tests suggest the possibility of significantly lower shear strength of MSW in bioreactor landfills where waste is placed with low compaction effort and constant volume, i.e., "undrained", conditions may occur. Compacted MSW specimens resulted in shear strength parameters that are higher than uncompacted specimens and closer to values reported in the literature. However, the normalized undrained shear strength in simple shear for uncompacted and compacted MSW was still higher than the normalized undrained shear strength reported in the literature for clayey and silty soils. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. DNS & Bind Cookbook

    CERN Document Server

    Liu, Cricket

    2011-01-01

    The DNS & BIND Cookbook presents solutions to the many problems faced by network administrators responsible for a name server. Following O'Reilly's popular problem-and-solution cookbook format, this title is an indispensable companion to DNS & BIND, 4th Edition, the definitive guide to the critical task of name server administration. The cookbook contains dozens of code recipes showing solutions to everyday problems, ranging from simple questions, like, "How do I get BIND?" to more advanced topics like providing name service for IPv6 addresses. It's full of BIND configuration files that yo

  11. Atomic Clocks and Constraints on Variations of Fundamental Constants

    OpenAIRE

    Karshenboim, Savely G.; Flambaum, Victor; Peik, Ekkehard

    2004-01-01

    We consider an application of precision frequency measurements to searches for possible time variations of the fundamental physical constants. Current laboratory constraints on variations of the fine structure constant alpha and other fundamental constants are presented.

  12. Quantitative determination of thallium binding to ferric hexacyanoferrate: Prussian blue.

    Science.gov (United States)

    Yang, Yongsheng; Faustino, Patrick J; Progar, Joseph J; Brownell, Charles R; Sadrieh, Nakissa; May, Joan C; Leutzinger, Eldon; Place, David A; Duffy, Eric P; Yu, Lawrence X; Khan, Mansoor A; Lyon, Robbe C

    2008-04-02

    Ferric hexacyanoferrate, (Fe(4)(III)[Fe(II)(CN)(6)](3)), also known as insoluble Prussian blue (PB), is the active pharmaceutical ingredient (API) of Radiogardase which is the first approved drug product (DP) for treatment of thallium and radiocesium poisoning. The aim of this study is (1) to determine the in vitro thallium binding capacity and binding rates of insoluble PB; and (2) to evaluate the effect of physiological pH conditions, PB particle size and storage conditions on the binding to PB. Experimental pH levels from 1.0 to 7.5 were used to cover the range of pH levels that PB may encounter when traveling through the gastrointestinal (GI) tract in humans. Measurements of thallium binding were made between 1 and 24h, to cover gastric and intestinal tract residence time. PB was found to have a binding capacity of approximately 1400 mg/g at pH 7.5. When the pH decreased, the binding decreased as well. The results indicated that the hydration state of PB influences the thallium binding process. It was also found that there exits a direct correlation between the moisture loss in PB and the thallium binding rate constant. The PB with 17 mol of water had a binding rate constant of 0.52, which was reduced to 0.32 when PB was dehydrated to 2.5 mol of water. Significant differences were observed in both binding capacity and binding rate constant among PB fractions with different particle size ranges. PB fraction with particle size of 220-1000 microm had a binding rate constant of 0.43, which increased to 0.64 when the particle size was reduced to 32-90 microm. Batch-to-batch variation in thallium binding was also observed among the APIs and the DPs and this was related to particle size and hydration state. These findings can be utilized to evaluate and predict drug product quality under certain manufacturing and dry storage conditions.

  13. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    Energy Technology Data Exchange (ETDEWEB)

    Botcheva K.; McCorkle S. R.; McCombie W. R.; Dunn J. J.; Anderson C. W.

    2011-12-15

    We report here genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands, in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIPseq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells.

  14. Effect of physical properties of nanogel particles on the kinetic constants of multipoint protein recognition process.

    Science.gov (United States)

    Nakamoto, Masahiko; Hoshino, Yu; Miura, Yoshiko

    2014-02-10

    We report the effect of physical properties, such as flexibility and polymer density, of nanogel particles (NPs) on the association/dissociation rates constant (kon and koff) and equilibrium constants (Kd) of multipoint protein recognition process. NPs having different flexibilities and densities at 25 °C were synthesized by tuning cross-linking degrees and the volume phase transition (VPT) temperature. Rate constants were quantified by analyzing time course of protein binding process on NPs monitored by a quartz crystal microbalance (QCM). Both kon and koff of swollen phase NPs increased with decreasing cross-linking degree, whereas cross-linking degree did not affect kon and koff of the collapsed phase NPs, indicating that polymer density of NPs governs kon and koff. The results also suggest that the mechanical flexibility of NPs, defined as the Young's modulus, does not always have crucial roles in the multipoint molecular recognition process. On the other hand, Kd was independent of the cross-linking degree and depended only on the phase of NPs, indicating that molecular-scale flexibility, such as side-chain and segmental-mode mobility, as well as the conformation change, of polymer chains assist the formation of stable binding sites in NPs. Our results reveal the rationale for designing NPs having desired affinity and binding kinetics to target molecules.

  15. Gait Control for Redundant Legged Biped Robot at Constant Velocity and Constant Height of the Waist

    Science.gov (United States)

    Shima, Ryoichi; Haishi, Masahiko; Shibata, Masaaki

    In this paper, we propose a gait control method for redundant legged biped robot based on leg center of mass (COM) position control at constant velocity and constant height of the waist. The developed biped robot has redundant legs, which have 4 degree-of-freedoms (DOFs) on each in the saggital plane. The redundant DOF enables to move its leg tip position and its leg COM position independently. Therefore proposed robot has structural capability to control the leg COM position for keeping the projection of the total COM inside the support polygon without upper body motion. Such capability enables the stable static walk in the arbitrarily desired velocity and height of the waist motion. The validity of the proposed method for the static walk at constant velocity and constant height of the waist in the leg COM position control for redundant legged biped robot is confirmed by several results of simulation and experiment.

  16. Competitive association binding kinetic assays: a new tool to detect two different binding orientations of a ligand to its target protein under distinct conditions?

    Science.gov (United States)

    Wittmann, Hans-Joachim; Strasser, Andrea

    2017-06-01

    Within the last years, for several ligands, binding to G protein-coupled receptors or other target proteins, a binding of the ligand in two different orientations is described. One appropriate experimental technique to detect two different binding orientations is the crystallization of the ligand-protein-complex, but crystallization and subsequent X-ray analysis do not belong to the routine methods. By traditional competitive radioligand equilibrium binding assays, it is not possible to detect or to distinguish between two different binding orientations, but there is a possibility to identify two different binding orientations by performing kinetic competitive radioligand-binding assays. To study the limitations of this new technique, the related differential equations were defined and solved numerically for 8 different sets of rate constants, also considering an experimental error up to ~10%. In principal, the kinetic competitive radioligand binding assay is a suitable technique to detect two different ligand binding orientations. However, the present study shows that this is only possible under distinct conditions: (1) the rate constants of dissociation for both binding orientations of the cold ligand should at least be > 10-fold different to each other and (2) the experimental error should be as small as possible. Although there are some limitations for the experimental usability of this method, it is worthwhile to perform kinetic competitive binding assays, especially if there are hints for two binding orientations of a ligand, e.g. based on molecular modelling studies.

  17. Constant load and constant displacement stress corrosion in simulated water reactor environments

    International Nuclear Information System (INIS)

    Lloyd, G.J.

    1987-02-01

    The stress corrosion behaviour of selected water reactor constructional materials, as determined by constant load or constant displacement test techniques, is reviewed. Experimental results obtained using a very wide range of conditions have been collected in a form for easy reference. A discussion is given of some apparent trends in these data. The possible reasons for these trends are considered together with a discussion of how the observed discrepancies may be resolved. (author)

  18. DNS BIND Server Configuration

    Directory of Open Access Journals (Sweden)

    Radu MARSANU

    2011-01-01

    Full Text Available After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  19. DNS BIND Server Configuratio

    OpenAIRE

    Radu MARSANU

    2011-01-01

    After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  20. DNS BIND Server Configuration

    OpenAIRE

    Radu MARSANU

    2011-01-01

    After a brief presentation of the DNS and BIND standard for Unix platforms, the paper presents an application which has a principal objective, the configuring of the DNS BIND 9 server. The general objectives of the application are presented, follow by the description of the details of designing the program.

  1. Melanin-binding radiopharmaceuticals

    Energy Technology Data Exchange (ETDEWEB)

    Packer, S; Fairchild, R G; Watts, K P; Greenberg, D; Hannon, S J

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed. (PSB)

  2. Melanin-binding radiopharmaceuticals

    International Nuclear Information System (INIS)

    Packer, S.; Fairchild, R.G.; Watts, K.P.; Greenberg, D.; Hannon, S.J.

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed

  3. CONSTANT LEVERAGE AND CONSTANT COST OF CAPITAL: A COMMON KNOWLEDGE HALF-TRUTH

    Directory of Open Access Journals (Sweden)

    IGNACIO VÉLEZ-PAREJA

    2008-01-01

    Full Text Available Un enfoque típico para valorar flujos de caja finitos es suponer que el endeudamiento es constante (generalmente como un endeudamiento objetivo o deseado y que por tanto, el costo del patrimonio, Ke y el costo promedio ponderado de capital CPPC, también son constantes. Para los flujos de caja perpetuos, y con el costo de la deuda, Kd como la tasa de descuento para el ahorro en impuestos o escudo fiscal, Ke y el CPPC aplicado al flujo de caja libre FCL son constantes si el endeudamiento es constante. Sin embargo esto no es verdad para los flujos de caja finitos. En este documento mostramos que para flujos de caja finitos, Ke y por lo tanto el CPPC dependen de la tasa de descuento que se utiliza para valorar el ahorro en impuestos, AI y según lo esperado, Ke y el CPPC no son constantes con Kd como la tasa de descuento para el ahorro en impuestos, aunque el endeudamiento sea constante. Ilustramos esta situación con un ejemplo simple. Analizamos cinco métodos: el flujo de caja descontado, FCD, usando APV, el FCD y la formulación tradicional y general del CPPC, el valor presente del flujo de caja del accionista, FCA más deuda y el flujo de caja de capital, FCC.

  4. Assessment of the binding properties of granuloszint

    Energy Technology Data Exchange (ETDEWEB)

    Schubiger, P.A.; Hasler, P.H.; Novak-Hofer, I.; Blaeuenstein, P.

    1989-09-01

    /sup 123/I-granuloszint (a murine monoclonal antibody - called AK-47 - against NCA-95 glycoprotein of granulocytes) has been proved to be a very convenient and successful radiopharmaceutical for visualizing infectious diseases. For a broad introduction in routine nuclear medicine it was necessary to optimize the labelling method and to determine in vitro exactly those biological and binding parameters which are relevant for an effective application in vivo. Binding to granulocytes has been shown to be specific and saturable (nonspecific binding about 10%) and is not via the Fc part of the antibody. The investigation of the binding properties of /sup 125/I-labelled AK-47 gave the following results: Affinity constant 5x10/sup 8/, 20,000-100,000 epitopes per granulocyte and an immunoreactivity of more than 90%. Labelling with /sup 123/I reduced the immunoreactivity to 40%. The Lindmo method and immunoblotting are used as quality control to check the likely in vivo behaviour of the labelled antibody. There is a good correspondence between the results from the two methods. With our special labelling method and the different in vitro checks we have found a reliable way to control the production and to assure an optimal binding behaviour of /sup 123/I-granuloszint. (orig.).

  5. Determination of intrinsic equilibrium constants at an alumina/electrolyte interface

    Directory of Open Access Journals (Sweden)

    SLOBODAN K. MILONJIC

    2004-12-01

    Full Text Available Intrinsic ionization and complexation constants at an alumina/electrolyte interface were studied by the site binding model, while the sorption of alkali cations from aqueous solutions was interpreted by the triple-layer model. The surface properties of alumina were investigated by the potentiometric acid-base titration method. The point of zero charge (pHpzc of alumina obtained by this method was found to be 7.2. The obtained mean values of the intrinsic protonation and ionization constants of the surface hydroxyl groups and the intrinsic surface complexation constant, in different electrolytes, are pKinta1 = 4.4, pKinta2 = 9.6 and pKintM+ = 9.5, respectively.

  6. TASI Lectures on the cosmological constant

    Energy Technology Data Exchange (ETDEWEB)

    Bousso, Raphael; Bousso, Raphael

    2007-08-30

    The energy density of the vacuum, Lambda, is at least 60 orders of magnitude smaller than several known contributions to it. Approaches to this problem are tightly constrained by data ranging from elementary observations to precision experiments. Absent overwhelming evidence to the contrary, dark energy can only be interpreted as vacuum energy, so the venerable assumption that Lambda=0 conflicts with observation. The possibility remains that Lambda is fundamentally variable, though constant over large spacetime regions. This can explain the observed value, but only in a theory satisfying a number of restrictive kinematic and dynamical conditions. String theory offers a concrete realization through its landscape of metastable vacua.

  7. Radiation balances and the solar constant

    Science.gov (United States)

    Crommelynck, D.

    1981-01-01

    The radiometric concepts are defined in order to consider various types of radiation balances and relate them to the diabetic form of the energy balance. Variability in space and time of the components of the radiation field are presented. A specific concept for sweeping which is tailored to the requirements is proposed. Finally, after establishing the truncated character of the present knowledge of the radiation balance. The results of the last observations of the solar constant are given. Ground and satellite measurement techniques are discussed.

  8. Infrared propagator corrections for constant deceleration

    Energy Technology Data Exchange (ETDEWEB)

    Janssen, T M; Miao, S P; Prokopec, T [Institute for Theoretical Physics and Spinoza Institute, Utrecht University, Leuvenlaan 4, Postbus 80.195, 3508 TD Utrecht (Netherlands); Woodard, R P [Department of Physics, University of Florida Gainesville, FL 32611 (United States)], E-mail: T.M.Janssen@uu.nl, E-mail: S.Miao@uu.nl, E-mail: T.Prokopec@uu.nl, E-mail: woodard@phys.ufl.edu

    2008-12-21

    We derive the propagator for a massless, minimally coupled scalar on a D-dimensional, spatially flat, homogeneous and isotropic background with arbitrary constant deceleration parameter. Our construction uses the operator formalism by integrating the Fourier mode sum. We give special attention to infrared corrections from the nonzero lower limit associated with working on finite spatial sections. These corrections eliminate infrared divergences that would otherwise be incorrectly treated by dimensional regularization, resulting in off-coincidence divergences for those special values of the deceleration parameter at which the infrared divergence is logarithmic. As an application we compute the expectation value of the scalar stress-energy tensor.

  9. Measurements of hyperfine constants in Ca+

    International Nuclear Information System (INIS)

    Goble, A.T.; Maleki, S.

    1990-01-01

    We have measured the hyperfine constants A( 2 S 1/2 ), A( 2 P 1/2 ), and A( 2 P 3/2 ) for Ca + . We compare our results with the calculations of Martensson-Pendrill and Salomonson [Phys. Rev. A 30, 712 (1984)], who used many-body perturbation theory (MBPT). The agreement between our results and MBPT calculations for Ca + is about 3%, which is comparable to similar comparisons reported for Cs [S. Blundell, in 2 Relativistic, Quantum Electrodynamic, and Weak Interaction Effects in Atoms, AIP Conf. Proc. No. 189, edited by Walter Johnson, Peter Mohr, and Joseph Sucher (AIP, New York, 1988)

  10. Rugged constant-temperature thermal anemometer.

    Science.gov (United States)

    Palma, J; Labbé, R

    2016-12-01

    Here we report a robust thermal anemometer which can be easily built. It was conceived to measure outdoor wind speeds and for airspeed monitoring in wind tunnels and other indoor uses. It works at a constant, low temperature of approximately 90 °C, so that an independent measurement of the air temperature is required to give a correct speed reading. Despite the size and high thermal inertia of the probe, the test results show that this anemometer is capable of measuring turbulent fluctuations up to ∼100 Hz in winds of ∼14 m/s, which corresponds to a scale similar to the length of the probe.

  11. Putative dopamine agonist (KB220Z) attenuates lucid nightmares in PTSD patients: role of enhanced brain reward functional connectivity and homeostasis redeeming joy.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Oscar-Berman, Marlene; Febo, Marcelo; Agan, Gozde; Fratantonio, James L; Simpatico, Thomas; Gold, Mark S

    2015-06-01

    Lucid dreams are frequently pleasant and training techniques have been developed to teach dreamers to induce them. In addition, the induction of lucid dreams has also been used as a way to ameliorate nightmares. On the other hand, lucid dreams may be associated with psychiatric conditions, including Post-Traumatic Stress Disorder (PTSD) and Reward Deficiency Syndrome-associated diagnoses. In the latter conditions, lucid dreams can assume an unpleasant and frequently terrifying character. We present two cases of dramatic alleviation of terrifying lucid dreams in patients with PTSD. In the first case study, a 51-year-old, obese woman, diagnosed with PTSD and depression, had attempted suicide and experienced terrifying lucid nightmares linked to sexual/physical abuse from early childhood by family members including her alcoholic father. Her vivid "bad dreams" remained refractory in spite of 6 months of treatment with Dialectical Behavioral Therapy (DBT) and standard pharmaceutical agents which included prazosin, clonidie and Adderall. The second 39-year-old PTSD woman patient had also suffered from lucid nightmares. The medication visit notes reveal changes in the frequency, intensity and nature of these dreams after the complex putative dopamine agonist KB220Z was added to the first patient's regimen. The patient reported her first experience of an extended period of happy dreams. The second PTSD patient, who had suffered from lucid nightmares, was administered KB220Z to attenuate methadone withdrawal symptoms and incidentally reported dreams full of happiness and laughter. These cases are discussed with reference to the known effects of KB220Z including enhanced dopamine homeostasis and functional connectivity of brain reward circuitry in rodents and humans. Their understanding awaits intensive investigation involving large-population, double-blinded studies.

  12. Putative Dopamine Agonist (KB220Z) Attenuates Lucid Nightmares in PTSD Patients: Role of Enhanced Brain Reward Functional Connectivity and Homeostasis Redeeming Joy

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Oscar-Berman, Marlene; Febo, Marcelo; Agan, Gozde; Fratantonio, James L.; Simpatico, Thomas; Gold, Mark S.

    2015-01-01

    Background Lucid dreams are frequently pleasant and training techniques have been developed to teach dreamers to induce them. In addition, the induction of lucid dreams has also been used as a way to ameliorate nightmares. On the other hand, lucid dreams may be associated with psychiatric conditions, including Post-Traumatic Stress Disorder (PTSD) and Reward Deficiency Syndrome-associated diagnoses. In the latter conditions, lucid dreams can assume an unpleasant and frequently terrifying character. Case Presentations We present two cases of dramatic alleviation of terrifying lucid dreams in patients with PTSD. In the first case study, a 51-year-old, obese woman, diagnosed with PTSD and depression, had attempted suicide and experienced terrifying lucid nightmares linked to sexual/physical abuse from early childhood by family members including her alcoholic father. Her vivid “bad dreams” remained refractory in spite of 6 months of treatment with Dialectical Behavioral Therapy (DBT) and standard pharmaceutical agents which included prazosin, clonidie and Adderall. The second 39-year-old PTSD woman patient had also suffered from lucid nightmares. Results The medication visit notes reveal changes in the frequency, intensity and nature of these dreams after the complex putative dopamine agonist KB220Z was added to the first patient’s regimen. The patient reported her first experience of an extended period of happy dreams. The second PTSD patient, who had suffered from lucid nightmares, was administered KB220Z to attenuate methadone withdrawal symptoms and incidentally reported dreams full of happiness and laughter. Conclusions These cases are discussed with reference to the known effects of KB220Z including enhanced dopamine homeostasis and functional connectivity of brain reward circuitry in rodents and humans. Their understanding awaits intensive investigation involving large-population, double-blinded studies. PMID:26132915

  13. KB220Z™ a Pro-Dopamine Regulator Associated with the Protracted, Alleviation of Terrifying Lucid Dreams. Can We Infer Neuroplasticity-induced Changes in the Reward Circuit?

    Science.gov (United States)

    McLaughlin, Thomas; Febo, Marcelo; Badgaiyan, Rajendra D; Barh, Debmalya; Dushaj, Kristina; Braverman, Eric R; Li, Mona; Madigan, Margaret A; Blum, Kenneth

    2016-01-01

    Recent reports by our laboratory have indicated that lucid dreams may be linked to psychiatric conditions, including Attention Deficit Hyperactivity Disorder (ADHD) and other Reward Deficiency Syndrome-related diagnoses. In the latter case, it has been our observation that such lucid dreams can be unpleasant and frequently terrifying. We present four cases of a dramatic and persistent alleviation of terrifying, lucid dreams in patients diagnosed with ADHD/PTSD and/or opiate/opioid addiction. The amelioration of such dreams could well be permanent, since the patients had stopped taking the nutraceutical for between 10 to 12 months, without their recollection or recurrence. In the first case, the patient is a 47-year-old, married male who required continued Buprenorphine/ Naloxone (Suboxone) treatment. The second case involved a 32-year-old female with the sole diagnosis of ADHD. The third case involves a 38-year-old male who carried the diagnoses of Substance Use Dependence and ADHD. The fourth case involved a 50-year-old female with the diagnoses of Alcohol Abuse, ADHD and Posttraumatic Stress Disorder. In order to attempt to understand the possibility of neuroplasticity, we evaluated the effect of KB220Z in non-opioid-addicted rats utilizing functional Magnetic Resonance Imaging methodology. While we cannot make a definitive claim because rat brain functional connectivity may not be exactly the same as humans, it does provide some interesting clues. We did find following seeding of the dorsal hippocampus, enhanced connectivity volume across several Regions of Interest (ROI), with the exception of the pre- frontal cortex. Interestingly, the latter region is only infrequently activated in lucid human dreaming, when the dreamer reports that he/she had the thought that they were dreaming during the lucid dream. The four patients initially reported a gradual but, then, complete amelioration of their long-term, terrifying, lucid dreams, while taking KB220Z. The

  14. KB220Z™ a Pro-Dopamine Regulator Associated with the Protracted, Alleviation of Terrifying Lucid Dreams. Can We Infer Neuroplasticity-induced Changes in the Reward Circuit?

    Science.gov (United States)

    McLaughlin, Thomas; Febo, Marcelo; Badgaiyan, Rajendra D.; Barh, Debmalya; Dushaj, Kristina; Braverman, Eric R.; Li, Mona; Madigan, Margaret A.; Blum, Kenneth

    2017-01-01

    Background Recent reports by our laboratory have indicated that lucid dreams may be linked to psychiatric conditions, including Attention Deficit Hyperactivity Disorder (ADHD) and other Reward Deficiency Syndrome-related diagnoses. In the latter case, it has been our observation that such lucid dreams can be unpleasant and frequently terrifying. Case presentations We present four cases of a dramatic and persistent alleviation of terrifying, lucid dreams in patients diagnosed with ADHD/PTSD and/or opiate/opioid addiction. The amelioration of such dreams could well be permanent, since the patients had stopped taking the nutraceutical for between 10 to 12 months, without their recollection or recurrence. In the first case, the patient is a 47-year-old, married male who required continued Buprenorphine/ Naloxone (Suboxone) treatment. The second case involved a 32-year-old female with the sole diagnosis of ADHD. The third case involves a 38-year-old male who carried the diagnoses of Substance Use Dependence and ADHD. The fourth case involved a 50-year-old female with the diagnoses of Alcohol Abuse, ADHD and Posttraumatic Stress Disorder. Results In order to attempt to understand the possibility of neuroplasticity, we evaluated the effect of KB220Z in non-opioid-addicted rats utilizing functional Magnetic Resonance Imaging methodology. While we cannot make a definitive claim because rat brain functional connectivity may not be exactly the same as humans, it does provide some interesting clues. We did find following seeding of the dorsal hippocampus, enhanced connectivity volume across several Regions of Interest (ROI), with the exception of the pre- frontal cortex. Interestingly, the latter region is only infrequently activated in lucid human dreaming, when the dreamer reports that he/she had the thought that they were dreaming during the lucid dream. Conclusions The four patients initially reported a gradual but, then, complete amelioration of their long

  15. KB-R7943 reduces 4-aminopyridine-induced epileptiform activity in adult rats after neuronal damage induced by neonatal monosodium glutamate treatment.

    Science.gov (United States)

    Hernandez-Ojeda, Mariana; Ureña-Guerrero, Monica E; Gutierrez-Barajas, Paola E; Cardenas-Castillo, Jazmin A; Camins, Antoni; Beas-Zarate, Carlos

    2017-05-09

    Neonatal monosodium glutamate (MSG) treatment triggers excitotoxicity and induces a degenerative process that affects several brain regions in a way that could lead to epileptogenesis. Na + /Ca 2+ exchangers (NCX1-3) are implicated in Ca 2+ brain homeostasis; normally, they extrude Ca 2+ to control cell inflammation, but after damage and in epilepsy, they introduce Ca 2+ by acting in the reverse mode, amplifying the damage. Changes in NCX3 expression in the hippocampus have been reported immediately after neonatal MSG treatment. In this study, the expression level of NCX1-3 in the entorhinal cortex (EC) and hippocampus (Hp); and the effects of blockade of NCXs on the seizures induced by 4-Aminopyridine (4-AP) were analysed in adult rats after neonatal MSG treatment. KB-R7943 was applied as NCXs blocker, but is more selective to NCX3 in reverse mode. Neonatal MSG treatment was applied to newborn male rats at postnatal days (PD) 1, 3, 5, and 7 (4 g/kg of body weight, s.c.). Western blot analysis was performed on total protein extracts from the EC and Hp to estimate the expression level of NCX1-3 proteins in relative way to the expression of β-actin, as constitutive protein. Electrographic activity of the EC and Hp were acquired before and after intracerebroventricular (i.c.v.) infusion of 4-AP (3 nmol) and KB-R7943 (62.5 pmol), alone or in combination. All experiments were performed at PD60. Behavioural alterations were also recorder. Neonatal MSG treatment significantly increased the expression of NCX3 protein in both studied regions, and NCX1 protein only in the EC. The 4-AP-induced epileptiform activity was significantly higher in MSG-treated rats than in controls, and KB-R7943 co-administered with 4-AP reduced the epileptiform activity in more prominent way in MSG-treated rats than in controls. The long-term effects of neonatal MSG treatment include increases on functional expression of NCXs (mainly of NCX3) in the EC and Hp, which seems to contribute to

  16. Synthesis, spectroscopic characterization and antimicrobial activity of binuclear metal complexes of a new asymmetrical Schiff base ligand: DNA binding affinity of copper(II) complexes

    Science.gov (United States)

    Shebl, Magdy

    2014-01-01

    The 1:1 condensation of o-acetoacetylphenol and 1,2-diaminopropane under condition of high dilution gives the mono-condensed Schiff base, (E)-3-(1-aminopropan-2-ylimino)-1-(2-hydroxyphenyl)butan-1-one. The mono-condensed Schiff base has been used for further condensation with isatin to obtain the new asymmetrical dicompartmental Schiff base ligand, (E)-3-(2-((E)-4-(2-hydroxyphenyl)-4-oxobutan-2-ylideneamino) propylimino)indolin-2-one (H3L) with a N2O3 donor set. Reactions of the ligand with metal salts give a series of new binuclear complexes. The ligand and its metal complexes were characterized by elemental analyses, IR, 1H and 13C NMR, electronic, ESR and mass spectra, conductivity and magnetic susceptibility measurements as well as thermal analyses. The analytical and spectroscopic tools showed that the complexes can be formulated as: [(HL)(VO)2(SO4)(H2O)]·4H2O, [(HL)Fe2Cl4(H2O)3]·EtOH, [(HL)Fe2(ox)Cl2(H2O)3]·2H2O, [(L)M2(OAc)(H2O)m]·nH2O; M = Co, Ni or Cu, m = 4, 0 and n = 2, 3, [(HL)Cu2Cl]Cl·6H2O and [(L)(UO2)2(OAc)(H2O)3]·6H2O. The metal complexes exhibited octahedral geometrical arrangements except copper complexes that exhibited tetrahedral geometries and uranyl complex in which the metal ion is octa-coordinated. The Schiff base and its metal complexes were evaluated for antimicrobial activity against Gram positive bacteria (Staphylococcus aureus), Gram negative bacteria (Escherichia coli) and fungi (Candida albicans and Aspergillus flavus). The ligand and some of its complexes were found to be biologically active. The DNA-binding properties of the copper complexes (6 and 7) have been investigated by electronic absorption, fluorescence and viscosity measurements. The results obtained indicate that these complexes bind to DNA via an intercalation binding mode with an intrinsic binding constant, Kb of 1.34 × 104 and 2.5 × 104 M-1, respectively.

  17. Holographic dark energy with cosmological constant

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Yazhou; Li, Nan; Zhang, Zhenhui [State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, Chinese Academy of Sciences, Beijing, 100190 (China); Li, Miao, E-mail: asiahu@itp.ac.cn, E-mail: mli@itp.ac.cn, E-mail: linan@itp.ac.cn, E-mail: zhangzhh@mail.ustc.edu.cn [School of Astronomy and Space Science, Sun Yat-Sen University, Guangzhou 510275 (China)

    2015-08-01

    Inspired by the multiverse scenario, we study a heterotic dark energy model in which there are two parts, the first being the cosmological constant and the second being the holographic dark energy, thus this model is named the ΛHDE model. By studying the ΛHDE model theoretically, we find that the parameters d and Ω{sub hde} are divided into a few domains in which the fate of the universe is quite different. We investigate dynamical behaviors of this model, and especially the future evolution of the universe. We perform fitting analysis on the cosmological parameters in the ΛHDE model by using the recent observational data. We find the model yields χ{sup 2}{sub min}=426.27 when constrained by Planck+SNLS3+BAO+HST, comparable to the results of the HDE model (428.20) and the concordant ΛCDM model (431.35). At 68.3% CL, we obtain −0.07<Ω{sub Λ0}<0.68 and correspondingly 0.04<Ω{sub hde0}<0.79, implying at present there is considerable degeneracy between the holographic dark energy and cosmological constant components in the ΛHDE model.

  18. Ventricular fibrillation time constant for swine

    International Nuclear Information System (INIS)

    Wu, Jiun-Yan; Sun, Hongyu; Nimunkar, Amit J; Webster, John G; O'Rourke, Ann; Huebner, Shane; Will, James A

    2008-01-01

    The strength–duration curve for cardiac excitation can be modeled by a parallel resistor–capacitor circuit that has a time constant. Experiments on six pigs were performed by delivering current from the X26 Taser dart at a distance from the heart to cause ventricular fibrillation (VF). The X26 Taser is an electromuscular incapacitation device (EMD), which generates about 50 kV and delivers a pulse train of about 15–19 pulses s −1 with a pulse duration of about 150 µs and peak current about 2 A. Similarly a continuous 60 Hz alternating current of the amplitude required to cause VF was delivered from the same distance. The average current and duration of the current pulse were estimated in both sets of experiments. The strength–duration equation was solved to yield an average time constant of 2.87 ms ± 1.90 (SD). Results obtained may help in the development of safety standards for future electromuscular incapacitation devices (EMDs) without requiring additional animal tests

  19. A Constant-Force Resistive Exercise Unit

    Science.gov (United States)

    Colosky, Paul; Ruttley, Tara

    2010-01-01

    A constant-force resistive exercise unit (CFREU) has been invented for use in both normal gravitational and microgravitational environments. In comparison with a typical conventional exercise machine, this CFREU weighs less and is less bulky: Whereas weight plates and associated bulky supporting structures are used to generate resistive forces in typical conventional exercise machines, they are not used in this CFREU. Instead, resistive forces are generated in this CFREU by relatively compact, lightweight mechanisms based on constant-torque springs wound on drums. Each such mechanism is contained in a module, denoted a resistive pack, that includes a shaft for making a torque connection to a cable drum. During a stroke of resistive exercise, the cable is withdrawn from the cable drum against the torque exerted by the resistance pack. The CFREU includes a housing, within which can be mounted one or more resistive pack(s). The CFREU also includes mechanisms for engaging any combination of (1) one or more resistive pack(s) and (2) one or more spring(s) within each resistive pack to obtain a desired level of resistance.

  20. Is cosmological constant needed in Higgs inflation?

    Directory of Open Access Journals (Sweden)

    Chao-Jun Feng

    2014-11-01

    Full Text Available The detection of B-mode shows a very powerful constraint to theoretical inflation models through the measurement of the tensor-to-scalar ratio r. Higgs boson is the most likely candidate of the inflaton field. But usually, Higgs inflation models predict a small value of r, which is not quite consistent with the recent results from BICEP2. In this paper, we explored whether a cosmological constant energy component is needed to improve the situation. And we found the answer is yes. For the so-called Higgs chaotic inflation model with a quadratic potential, it predicts r≈0.2, ns≈0.96 with e-folds number N≈56, which is large enough to overcome the problems such as the horizon problem in the Big Bang cosmology. The required energy scale of the cosmological constant is roughly Λ∼(1014 GeV2, which means a mechanism is still needed to solve the fine-tuning problem in the later time evolution of the universe, e.g. by introducing some dark energy component.

  1. Positive Cosmological Constant and Quantum Theory

    Directory of Open Access Journals (Sweden)

    Felix M. Lev

    2010-11-01

    Full Text Available We argue that quantum theory should proceed not from a spacetime background but from a Lie algebra, which is treated as a symmetry algebra. Then the fact that the cosmological constant is positive means not that the spacetime background is curved but that the de Sitter (dS algebra as the symmetry algebra is more relevant than the Poincare or anti de Sitter ones. The physical interpretation of irreducible representations (IRs of the dS algebra is considerably different from that for the other two algebras. One IR of the dS algebra splits into independent IRs for a particle and its antiparticle only when Poincare approximation works with a high accuracy. Only in this case additive quantum numbers such as electric, baryon and lepton charges are conserved, while at early stages of the Universe they could not be conserved. Another property of IRs of the dS algebra is that only fermions can be elementary and there can be no neutral elementary particles. The cosmological repulsion is a simple kinematical consequence of dS symmetry on quantum level when quasiclassical approximation is valid. Therefore the cosmological constant problem does not exist and there is no need to involve dark energy or other fields for explaining this phenomenon (in agreement with a similar conclusion by Bianchi and Rovelli.

  2. Local Pain Dynamics during Constant Exhaustive Exercise.

    Directory of Open Access Journals (Sweden)

    Agne Slapsinskaite

    Full Text Available The purpose of this study was to delineate the topological dynamics of pain and discomfort during constant exercise performed until volitional exhaustion. Eleven physical education students were tested while cycling and running at a "hard" intensity level (e.g., corresponding to Borg's RPE (6-20 = 15. During the tests, participants reported their discomfort and pain on a body map every 15s. "Time on task" for each participant was divided into five equal non-overlapping temporal windows within which their ratings were considered for analysis. The analyses revealed that the number of body locations with perceived pain and discomfort increased throughout the five temporal windows until reaching the mean (± SE values of 4.2 ± 0.7 and 4.1 ± 0.6 in cycling and running, respectively. The dominant locations included the quadriceps and hamstrings during cycling and quadriceps and chest during running. In conclusion, pain seemed to spread throughout the body during constant cycling and running performed up to volitional exhaustion with differences between cycling and running in the upper body but not in the lower body dynamics.

  3. Lepton Collider Operation with Constant Currents

    CERN Document Server

    Wienands, Ulrich

    2005-01-01

    Traditionally, electron-positron colliders have been operating in a top-off-and-coast fashion with a cycle time depending on the beam life time, typically on the order of an hour. Each top-off involves ramping detector systems in addition to the actual filling time. The loss in accumulated luminosity is typically 20-50%. During the last year, both B-Factories have commissioned a continuous-injection mode of operation in which beam is injected without ramping the detector, thus raising luminosity integration by constant operation at peak luminosity. Constant beam currents reduce thermal drift and trips caused by change in beam loading. To achieve this level of operation, special efforts were made to reduce the injection losses and also to implement special gating procedures in the detectors, minimizing dead time. Bunch-injection control decides which bunch to inject into next while maintaining small charge variation between bunches. Beam collimation can reduce injection noise but also cause an increase in back...

  4. Holographic dark energy with cosmological constant

    International Nuclear Information System (INIS)

    Hu, Yazhou; Li, Nan; Zhang, Zhenhui; Li, Miao

    2015-01-01

    Inspired by the multiverse scenario, we study a heterotic dark energy model in which there are two parts, the first being the cosmological constant and the second being the holographic dark energy, thus this model is named the ΛHDE model. By studying the ΛHDE model theoretically, we find that the parameters d and Ω hde are divided into a few domains in which the fate of the universe is quite different. We investigate dynamical behaviors of this model, and especially the future evolution of the universe. We perform fitting analysis on the cosmological parameters in the ΛHDE model by using the recent observational data. We find the model yields χ 2 min =426.27 when constrained by Planck+SNLS3+BAO+HST, comparable to the results of the HDE model (428.20) and the concordant ΛCDM model (431.35). At 68.3% CL, we obtain −0.07<Ω Λ0 <0.68 and correspondingly 0.04<Ω hde0 <0.79, implying at present there is considerable degeneracy between the holographic dark energy and cosmological constant components in the ΛHDE model

  5. In Situ Protein Binding Assay Using Fc-Fusion Proteins.

    Science.gov (United States)

    Padmanabhan, Nirmala; Siddiqui, Tabrez J

    2017-01-01

    This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.

  6. In vitro binding of germanium to proteins of rice shoots

    International Nuclear Information System (INIS)

    Matsumoto, Hideaki; Takahashi, Eiichi

    1976-01-01

    The possibility of in vitro binding between proteins of rice shoots and germanium (Ge) was investigated. The proteins in mixtures of aqueous extracts of rice shoots and radioactive germanium ( 68 GeO 2 ) were fractionated. The binding of radioactivity to the proteins was observed even after 5 successive fractionation steps from the original mixtures. At the final fractionation step using polyacrylamide gel electrophoresis, a constant proportionality between protein concentration and associated radioactivity was found in most samples although not all. These results indicate that the binding of 68 Ge to proteins is not due to the simple adsorption by proteins. (auth.)

  7. The constant composition method for crystallization of calcium carbonate at constant supersaturation

    Science.gov (United States)

    Beck, R.; Seiersten, M.; Andreassen, J.-P.

    2013-10-01

    The exact control of supersaturation is of great importance when studying the formation of crystalline and amorphous matter. The constant composition method is suitable for the study of crystallization processes at constant supersaturation by controlled addition of titrants to a crystallizer to maintain constant pH. Not all aspects necessary for successful operation of this method are obvious from the existing literature, and the method is often used in an incorrect way. The focus of the present work is to highlight pitfalls associated with the constant composition method. The method is assessed and described in detail to show that even if the solution pH is kept constant, the supersaturation may change. First and foremost, it is illustrated how crucial it is to use a chemical composition of the titrant solutions which is in accordance with the initially prepared aqueous solution. General rules are presented for carbonates as to how the composition of the titrant solutions should be calculated based on total alkalinity in order to maintain constant supersaturation. This has - to the knowledge of the authors - not been shown before. Then, it is shown how exchange of carbon dioxide with the atmosphere corrupts the constancy of the supersaturation level during an experiment. Third, it is pointed out that the ionic strength should be kept constant throughout crystallization experiments since a change in ionic strength alters the activity of the ions in solution. Here, the determination of the thermodynamic driving force (supersaturation) is explained based on the relevant chemical equilibria, total alkalinity and calculation of the activity coefficients. The calculations are presented for the least stable polymorph of calcium carbonate, vaterite, but can easily be extended to the other polymorphs and other pH-dependent systems allowing for crystallization studies at low and maintained supersaturation levels typical of naturally occurring processes in geology and

  8. A de-novo large deletion of 2.8 kb produced in the ABCD1 gene causing adrenoleukodystrophy disease.

    Science.gov (United States)

    Kallabi, Fakhri; Ben Salah, Ghada; Ben Chehida, Amel; Tabebi, Mouna; Felhi, Rahma; Ben Turkia, Hadhami; Tebib, Neji; Keskes, Leila; Kamoun, Hassen

    2016-06-01

    X-linked adrenoleukodystrophy (X-ALD) is a neurodegenerative disorder caused by mutations in the ABCD1 gene, which encodes an ATP-binding cassette transporter protein, ALDP. The disease is characterized by increased concentrations of very long chain fatty acids (VLCFAs) in plasma, adrenal, testicular, and nerve tissues. For this study, our objective was to conduct clinical, molecular, and genetic studies of a Tunisian patient with X-ALD. The diagnosis was based on clinical indications, biochemical analyses, typical brain-scan patterns, and molecular biology; the molecular analyses were based on PCR, long-range PCR, and sequencing. The molecular analysis by long-range PCR and direct sequencing of the ABCD1 gene showed the presence of a de-novo 2794 bp deletion covering the whole of exon 2. Using bioinformatics tools, we demonstrate that the large deletion is located in a region rich with Alu sequences. Furthermore, we suggest that the AluJb sequence could be the cause of the large deletion of intron 1, exon 2, and intron 2, and the creation of a premature stop codon within exon 3. This report is the first report in which we demonstrate the breakpoints and the size of a large deletion in a Tunisian with X-ALD.

  9. Search for a Variation of Fundamental Constants

    Science.gov (United States)

    Ubachs, W.

    2013-06-01

    Since the days of Dirac scientists have speculated about the possibility that the laws of nature, and the fundamental constants appearing in those laws, are not rock-solid and eternal but may be subject to change in time or space. Such a scenario of evolving constants might provide an answer to the deepest puzzle of contemporary science, namely why the conditions in our local Universe allow for extreme complexity: the fine-tuning problem. In the past decade it has been established that spectral lines of atoms and molecules, which can currently be measured at ever-higher accuracies, form an ideal test ground for probing drifting constants. This has brought this subject from the realm of metaphysics to that of experimental science. In particular the spectra of molecules are sensitive for probing a variation of the proton-electron mass ratio μ, either on a cosmological time scale, or on a laboratory time scale. A comparison can be made between spectra of molecular hydrogen observed in the laboratory and at a high redshift (z=2-3), using the Very Large Telescope (Paranal, Chile) and the Keck telescope (Hawaii). This puts a constraint on a varying mass ratio Δμ/μ at the 10^{-5} level. The optical work can also be extended to include CO molecules. Further a novel direction will be discussed: it was discovered that molecules exhibiting hindered internal rotation have spectral lines in the radio-spectrum that are extremely sensitive to a varying proton-electron mass ratio. Such lines in the spectrum of methanol were recently observed with the radio-telescope in Effelsberg (Germany). F. van Weerdenburg, M.T. Murphy, A.L. Malec, L. Kaper, W. Ubachs, Phys. Rev. Lett. 106, 180802 (2011). A. Malec, R. Buning, M.T. Murphy, N. Milutinovic, S.L. Ellison, J.X. Prochaska, L. Kaper, J. Tumlinson, R.F. Carswell, W. Ubachs, Mon. Not. Roy. Astron. Soc. 403, 1541 (2010). E.J. Salumbides, M.L. Niu, J. Bagdonaite, N. de Oliveira, D. Joyeux, L. Nahon, W. Ubachs, Phys. Rev. A 86, 022510

  10. Evidence for a relationship between equine abortion (herpes) virus deoxyribonucleic acid synthesis and the S phase of the KB cell mitotic cycle.

    Science.gov (United States)

    Lawrence, W C

    1971-06-01

    Autoradiographic analyses of deoxyribonucleic acid (DNA) synthesis in randomly growing KB cell cultures infected with equine abortion virus (EAV) suggested that viral DNA synthesis was initiated only at times that coincided with the entry of noninfected control cells into the S phase of the cell cycle. Synchronized cultures of KB cells were infected at different stages of the cell cycle, and rates of synthesis of cellular and viral DNA were measured. When cells were infected at different times within the S phase, viral DNA synthesis was initiated 2 to 3 hr after infection. However, when cells in G1 and G2 were infected, the initiation of viral DNA synthesis was delayed and occurred only at times corresponding to the S phase. The times when viral DNA synthesis began were independent of the time of infection and differed by as much as 5 hr, depending on the stage of the cell cycle at which cells were infected. Viral one-step growth curves were also related to the S phase in a manner which indicated a relationship between the initiation of viral DNA synthesis and the S phase. These data support the concept that initiation of EAV DNA synthesis is dependent upon some cellular function(s) which is related to the S phase of the cell cycle.

  11. The human interactome knowledge base (hint-kb): An integrative human protein interaction database enriched with predicted protein–protein interaction scores using a novel hybrid technique

    KAUST Repository

    Theofilatos, Konstantinos A.

    2013-07-12

    Proteins are the functional components of many cellular processes and the identification of their physical protein–protein interactions (PPIs) is an area of mature academic research. Various databases have been developed containing information about experimentally and computationally detected human PPIs as well as their corresponding annotation data. However, these databases contain many false positive interactions, are partial and only a few of them incorporate data from various sources. To overcome these limitations, we have developed HINT-KB (http://biotools.ceid.upatras.gr/hint-kb/), a knowledge base that integrates data from various sources, provides a user-friendly interface for their retrieval, cal-culatesasetoffeaturesofinterest and computesaconfidence score for every candidate protein interaction. This confidence score is essential for filtering the false positive interactions which are present in existing databases, predicting new protein interactions and measuring the frequency of each true protein interaction. For this reason, a novel machine learning hybrid methodology, called (Evolutionary Kalman Mathematical Modelling—EvoKalMaModel), was used to achieve an accurate and interpretable scoring methodology. The experimental results indicated that the proposed scoring scheme outperforms existing computational methods for the prediction of PPIs.

  12. Early Intervention of Intravenous KB220IV- Neuroadaptagen Amino-Acid Therapy (NAAT)™ Improves Behavioral Outcomes in a Residential Addiction Treatment Program: A Pilot Study

    Science.gov (United States)

    Miller, Merlene; Chen, Amanda LC; Stokes, Stan D.; Silverman, Susan; Bowirrat, Abdalla; Manka, Matthew; Manka, Debra; Miller, David K.; Perrine, Kenneth; Chen, Thomas JH; Bailey, John A.; Downs, William; Waite, Roger L.; Madigan, Margaret A.; Braverman, Eric R.; Damle, Uma; Kerner, Mallory; Giordano, John; Morse, Siobhan; Oscar-Berman, Marlene; Barh, Debmalya; Blum, Kenneth

    2014-01-01

    Substance use disorders (SUD) are inheritable and the culprit is hypodopaminergic function regulated by reward genes. We evaluated a natural dopaminergic agonist; KB220 intravenous (IV) and oral variants, to improve dopaminergic function in SUD. Our pilot experiment found a significant reduction of chronic symptoms, measured by the Chronic Abstinence Symptom Severity (CASS) Scale. The combined group (IV and oral) did significantly better than the oral-only group over the first week and 30-day follow-up period. Next, the combination was given to129 subjects and three factors; Emotion, Somatic, and Impaired Cognition, with eigenvalues greater than one were extracted for baseline CASS-Revised (CASS-R) variables. Paired sample t-tests for pre and post-treatment scales showed significant declines (p = .00001) from pre- to post-treatment: t = 19.1 for Emotion, t = 16.1 for Somatic, and t = 14.9 for Impaired Cognition. In a two-year follow-up of 23 subjects who underwent KB220IV therapy (at least five IV treatments over seven days) plus orals for 30+ days: 21 (91%) were sober at six months, 19 (82%) having no relapse; 19 (82%) were sober at one year, 18 (78%) having no relapse; and 21 (91%) were sober two-years post-treatment, 16 (70%) having no relapse. We await additional research and advise caution in interpreting these encouraging results. PMID:23457891

  13. HAMAP: a database of completely sequenced microbial proteome sets and manually curated microbial protein families in UniProtKB/Swiss-Prot.

    Science.gov (United States)

    Lima, Tania; Auchincloss, Andrea H; Coudert, Elisabeth; Keller, Guillaume; Michoud, Karine; Rivoire, Catherine; Bulliard, Virginie; de Castro, Edouard; Lachaize, Corinne; Baratin, Delphine; Phan, Isabelle; Bougueleret, Lydie; Bairoch, Amos

    2009-01-01

    The growth in the number of completely sequenced microbial genomes (bacterial and archaeal) has generated a need for a procedure that provides UniProtKB/Swiss-Prot-quality annotation to as many protein sequences as possible. We have devised a semi-automated system, HAMAP (High-quality Automated and Manual Annotation of microbial Proteomes), that uses manually built annotation templates for protein families to propagate annotation to all members of manually defined protein families, using very strict criteria. The HAMAP system is composed of two databases, the proteome database and the family database, and of an automatic annotation pipeline. The proteome database comprises biological and sequence information for each completely sequenced microbial proteome, and it offers several tools for CDS searches, BLAST options and retrieval of specific sets of proteins. The family database currently comprises more than 1500 manually curated protein families and their annotation templates that are used to annotate proteins that belong to one of the HAMAP families. On the HAMAP website, individual sequences as well as whole genomes can be scanned against all HAMAP families. The system provides warnings for the absence of conserved amino acid residues, unusual sequence length, etc. Thanks to the implementation of HAMAP, more than 200,000 microbial proteins have been fully annotated in UniProtKB/Swiss-Prot (HAMAP website: http://www.expasy.org/sprot/hamap).

  14. The interaction of parsing rules and argument – Predicate constructions: implications for the structure of the Grammaticon in FunGramKB

    Directory of Open Access Journals (Sweden)

    María del Carmen Fumero Pérez

    2017-07-01

    Full Text Available The Functional Grammar Knowledge Base (FunGramKB, (Periñán-Pascual and Arcas-Túnez 2010 is a multipurpose lexico-conceptual knowledge base designed to be used in different Natural Language Processing (NLP tasks. It is complemented with the ARTEMIS (Automatically Representing Text Meaning via an Interlingua–based System application, a parsing device linguistically grounded on Role and Reference Grammar (RRG that transduces natural language fragments into their corresponding grammatical and semantic structures. This paper unveils the different phases involved in its parsing routine, paying special attention to the treatment of argumental constructions. As an illustrative case, we will follow all the steps necessary to effectively parse a For-Benefactive structure within ARTEMIS. This methodology will reveal the necessity to distinguish between Kernel constructs and L1-constructions, since the latter involve a modification of the lexical template of the verb. Our definition of L1-constructions leads to the reorganization of the catalogue of FunGramKB L1-constructions, formerly based on Levin’s (1993 alternations. Accordingly, a rearrangement of the internal configuration of the L1-Constructicon within the Grammaticon is proposed.

  15. Constant-parameter capture-recapture models

    Science.gov (United States)

    Brownie, C.; Hines, J.E.; Nichols, J.D.

    1986-01-01

    Jolly (1982, Biometrics 38, 301-321) presented modifications of the Jolly-Seber model for capture-recapture data, which assume constant survival and/or capture rates. Where appropriate, because of the reduced number of parameters, these models lead to more efficient estimators than the Jolly-Seber model. The tests to compare models given by Jolly do not make complete use of the data, and we present here the appropriate modifications, and also indicate how to carry out goodness-of-fit tests which utilize individual capture history information. We also describe analogous models for the case where young and adult animals are tagged. The availability of computer programs to perform the analysis is noted, and examples are given using output from these programs.

  16. Gravitational gauge fields and the cosmological constant

    International Nuclear Information System (INIS)

    Pagels, H.R.

    1984-01-01

    We describe field theories for which the action is completely independent of the metric and connection of the space-time manifold. The metric in our approach is no more a fundamental field than a hadron field is a fundamental field in QCD. The fundamental fields in the action are O(5) gauge fields and combinations of these fields are interpreted as the metric and connection so that conventional general relativity is obtained. Remarkably, all renormalizable matter actions for scalar, spinor, and Yang-Mills gauge fields can be made metric independent. Significantly, we find a new elementary invariance of the action which implies the cosmological constant must vanish. Finally, we discuss the quantum theory resulting from these ideas

  17. Statistical Modelling of the Soil Dielectric Constant

    Science.gov (United States)

    Usowicz, Boguslaw; Marczewski, Wojciech; Bogdan Usowicz, Jerzy; Lipiec, Jerzy

    2010-05-01

    The dielectric constant of soil is the physical property being very sensitive on water content. It funds several electrical measurement techniques for determining the water content by means of direct (TDR, FDR, and others related to effects of electrical conductance and/or capacitance) and indirect RS (Remote Sensing) methods. The work is devoted to a particular statistical manner of modelling the dielectric constant as the property accounting a wide range of specific soil composition, porosity, and mass density, within the unsaturated water content. Usually, similar models are determined for few particular soil types, and changing the soil type one needs switching the model on another type or to adjust it by parametrization of soil compounds. Therefore, it is difficult comparing and referring results between models. The presented model was developed for a generic representation of soil being a hypothetical mixture of spheres, each representing a soil fraction, in its proper phase state. The model generates a serial-parallel mesh of conductive and capacitive paths, which is analysed for a total conductive or capacitive property. The model was firstly developed to determine the thermal conductivity property, and now it is extended on the dielectric constant by analysing the capacitive mesh. The analysis is provided by statistical means obeying physical laws related to the serial-parallel branching of the representative electrical mesh. Physical relevance of the analysis is established electrically, but the definition of the electrical mesh is controlled statistically by parametrization of compound fractions, by determining the number of representative spheres per unitary volume per fraction, and by determining the number of fractions. That way the model is capable covering properties of nearly all possible soil types, all phase states within recognition of the Lorenz and Knudsen conditions. In effect the model allows on generating a hypothetical representative of

  18. Hawking temperature of constant curvature black holes

    International Nuclear Information System (INIS)

    Cai Ronggen; Myung, Yun Soo

    2011-01-01

    The constant curvature (CC) black holes are higher dimensional generalizations of Banados-Teitelboim-Zanelli black holes. It is known that these black holes have the unusual topology of M D-1 xS 1 , where D is the spacetime dimension and M D-1 stands for a conformal Minkowski spacetime in D-1 dimensions. The unusual topology and time-dependence for the exterior of these black holes cause some difficulties to derive their thermodynamic quantities. In this work, by using a globally embedding approach, we obtain the Hawking temperature of the CC black holes. We find that the Hawking temperature takes the same form when using both the static and global coordinates. Also, it is identical to the Gibbons-Hawking temperature of the boundary de Sitter spaces of these CC black holes.

  19. Dielectric Constant Measurements of Solid 4He

    Science.gov (United States)

    Yin, L.; Xia, J. S.; Huan, C.; Sullivan, N. S.; Chan, M. H. W.

    2011-03-01

    Careful measurements of the dielectric properties of solid 4He have been carried out down to 35 mK, considerably lower than the temperature range of previous studies. The sample was prepared from high purity gas with 3He concentrations of the order of 200 ppb and were formed by the blocked capillary method. The molar volume of the sample was 20.30 cm3. The dielectric constant of the samples was found to be independent of temperature down to 120 mK before showing a continuous increase with decreasing temperature and saturating below 50 mK. The total increase in ɛ is 2 parts in 10-5. The temperature dependence of ɛ mimics the increase in the resonant frequency found in the torsional oscillator studies and also the increase found in the shear modulus measurements.

  20. On the substructure of the cosmological constant

    Science.gov (United States)

    Dvali, G.; Gomez, C.; Zell, S.

    We summarize the findings of our paper arXiv:1701.08776 [hep-th]. We start by defining the quantum break-time. Once one understands a classical solution as expectation value of an underlying quantum state, it emerges as time-scale after which the true quantum evolution departs from the classical mean field evolution. We apply this idea to de Sitter space. Following earlier work, we construct a simple model of a spin-2 field, which for some time reproduces the de Sitter metric and simultaneously allows for its well-defined representation as coherent quantum state of gravitons. The mean occupation number N of background gravitons turns out to be equal to the de Sitter horizon area in Planck units, while their frequency is given by the de Sitter Hubble parameter. In the semi-classical limit, we show that the model reproduces all semi-classical calculations in de Sitter, such as thermal Gibbons-Hawking radiation, all in the language of quantum S-matrix scatterings and decays of coherent state gravitons. Most importantly, this framework allows to capture the (1/N)-effects of back reaction to which the usual semi-classical treatment is blind. They violate the de Sitter symmetry and lead to a finite quantum break-time of the de Sitter state equal to the de Sitter radius times N. We also point out that the quantum-break time is inversely proportional to the number of particle species in the theory. Thus, the quantum break-time imposes the following consistency condition: Older and species-richer universes must have smaller cosmological constants. For the maximal, phenomenologically acceptable number of species, the observed cosmological constant would saturate this bound if our Universe were 10100 years old in its entire classical history.

  1. Higgs inflation and the cosmological constant

    Energy Technology Data Exchange (ETDEWEB)

    Jegerlehner, Fred [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)

    2014-02-15

    The Higgs not only induces the masses of all SM particles, the Higgs, given its special mass value, is the natural candidate for the inflaton and in fact is ruling the evolution of the early universe, by providing the necessary dark energy which remains the dominant energy density. SM running couplings not only allow us to extrapolate SM physics up to the Planck scale, but equally important they are triggering the Higgs mechanism. This is possible by the fact that the bare mass term in the Higgs potential changes sign at about μ{sub 0}≅1.40 x 10{sup 16} GeV and in the symmetric phase is enhanced by quadratic terms in the Planck mass. Such a huge Higgs mass term is able to play a key role in triggering inflation in the early universe. In this article we extend our previous investigation by working out the details of a Higgs inflation scenario. We show how different terms contributing to the Higgs Lagrangian are affecting inflation. Given the SM and its extrapolation to scales μ>μ{sub 0} we find a calculable cosmological constant V(0) which is weakly scale dependent and actually remains large during inflation. This is different to the Higgs fluctuation field dependent ΔV(φ), which decays exponentially during inflation, and actually would not provide a sufficient amount of inflation. The fluctuation field has a different effective mass which shifts the bare Higgs transition point to a lower value μ'{sub 0} ≅7.7 x 10{sup 14} GeV. The vacuum energy V(0) being proportional to M{sub Pl}{sup 4} has a coefficient which vanishes near the Higgs transition point, such that the bare and the renormalized cosmological constant match at this point. The role of the Higgs in reheating and baryogenesis is emphasized.

  2. Universal equations and constants of turbulent motion

    Science.gov (United States)

    Baumert, H. Z.

    2013-07-01

    This paper presents a parameter-free theory of shear-generated turbulence at asymptotically high Reynolds numbers in incompressible fluids. It is based on a two-fluids concept. Both components are materially identical and inviscid. The first component is an ensemble of quasi-rigid dipole-vortex tubes (vortex filaments, excitations) as quasi-particles in chaotic motion. The second is a superfluid performing evasive motions between the tubes. The local dipole motions follow Helmholtz' law. The vortex radii scale with the energy-containing length scale. Collisions between quasi-particles lead either to annihilation (likewise rotation, turbulent dissipation) or to scattering (counterrotation, turbulent diffusion). There are analogies with birth and death processes of population dynamics and their master equations and with Landau's two-fluid theory of liquid helium. For free homogeneous decay the theory predicts the turbulent kinetic energy to follow t-1. With an adiabatic wall condition it predicts the logarithmic law with von Kármán's constant as 1/\\sqrt {2\\,\\pi }= 0.399 . Likewise rotating couples form localized dissipative patches almost at rest (→ intermittency) wherein under local quasi-steady conditions the spectrum evolves into an ‘Apollonian gear’ as discussed first by Herrmann (1990 Correlation and Connectivity (Dordrecht: Kluwer) pp 108-20). Dissipation happens exclusively at scale zero and at finite scales this system is frictionless and reminds of Prigogine's (1947 Etude Thermodynamique des Phenomenes Irreversibles (Liege: Desoer) p 143) law of minimum (here: zero) entropy production. The theory predicts further the prefactor of the 3D-wavenumber spectrum (a Kolmogorov constant) as \\frac {1}{3}(4\\,\\pi )^{2/3}=1.802 , well within the scatter range of observational, experimental and direct numerical simulation results.

  3. Fluorodeoxyglucose rate constants, lumped constant, and glucose metabolic rate in rabbit heart

    International Nuclear Information System (INIS)

    Krivokapich, J.; Huang, S.C.; Selin, C.E.; Phelps, M.E.

    1987-01-01

    The isolated arterial perfused rabbit interventricular septum was used to measure myocardial metabolic rate for glucose (MMRGlc) and rate constants and lumped constant (LC) for the glucose analogue [ 18 F]fluorodeoxyglucose (FDG) using a tracer kinetic model. FDG was delivered by constant infusion during coincidence counting of tissue 18 F radioactivity. The MMRGlc was measured by the Fick method. Control septa were paced at 72 beats/min and perfused at 1.5 ml/min with oxygenated perfusate containing 5.6 mM glucose and 5 mU/ml insulin. The following conditions were tested: 3.0 and 4.5 ml/min; insulin increased to 25 mU/ml; insulin omitted; 2.8 mM and 11.2 mM glucose; 144 beats/min and 96 paired stimuli/min; and anoxia. Under all conditions studied the phosphorylation (hexokinase) reaction was rate limiting relative to transport. Compared with control conditions, the phosphorylation rate constant was significantly increased with 2.8 mM glucose as well as in anoxia. With 4.5 ml/min and 11.2 mM glucose, conditions that should increase glucose flux into tissue without increasing demand, the phosphorylation rate constant decreased significantly. With 11.2 mM glucose, 96 paired stimuli/min, and anoxia without insulin, a significant increase in the hydrolysis rate of FDG 6-phosphate was observed and suggests that hydrolysis is also an important mechanism for regulating the MMRGlc. Increased transport rate constants were observed with increased flow rates, 96 paired stimuli/min, and anoxia at 96 beats/min. The LC was not significantly different from control in 11 of 14 conditions studied. Therefore, under most conditions in average LC can be used to calculate MMRGlc estimates

  4. [On true and apparent Michaelis constants in enzymology. I. Differences].

    Science.gov (United States)

    Karakhim, S A

    2011-01-01

    Differences between both true and apparent rate constants and Michaelis constants have been examined. Rate constants of elementary stages of real mechanisms are true ones. True Michaelis constant Km is expressed by equation Km = (k(-1) + k2)/k. True constants may be determined for reliable mechanism only for which the equation of initial rate was obtained which displays physical sense of these constants and permits to find the method of their calculation. The true constant values are independent of concentration of reactants, activators, inhibitors, extraneous agents and pH. The apparent rate constants are such constants of the composite reaction which are observed when this reaction is described by the equation of simple reaction. Michaelis constant calculated by a half of the ultimate constant is an apparent constant. The apparent constants may be functions of several true rate constants and/or concentrations of reacting substances. The evident physical sense of apparent constants being absent, only formal relation between the reaction rate and reactant concentration independent of the investigated mechanism is provided.

  5. Constant Leverage And Constant Cost Of Capital: A Common Knowledge Half-Truth

    Directory of Open Access Journals (Sweden)

    Ignacio Vélez–Pareja

    2008-04-01

    In this document we show that for finite cash flows, Ke and hence WACC depend on the discount rate that is used to value the tax shield, TS and as expected, Ke and WACC are not constant with Kd as the discount rate for the tax shield, even if the leverage is constant. We illustrate this situation with a simple example. We analyze five methods: DCF using APV, FCF and traditional and general formulation for WACC, present value of CFE plus debt and Capital Cash Flow, CCF.

  6. Analytical estimation of the gravitational constant with atomic and nuclear physical constants

    International Nuclear Information System (INIS)

    Seshavatharam, U.V.S.; Lakshminarayana, S.

    2015-01-01

    If N A represents the Avogadro's number, gravitational constant associated with atomic electromagnetic interaction can be expressed as G E ≅ N 2 A G. With G E and with the assumed two new pseudo numbers x ≈ 38.725 and y ≈ 47.415, value of G can be fixed for 10 digits in a verifiable approach. (x, y) can be called as the back ground analytical numbers using by which micro-macro physical constants can be interlinked qualitatively and quantitatively

  7. Counterion Binding Effects on the Micellar Catalysis of the Base ...

    African Journals Online (AJOL)

    The effects of counterion binding on micellar catalysis of the base hydrolysis of FE(phen) has been investaged. Pseudo first order rate constant, k , incrases with increase in the concentrations of ME NCI and (But) NC1 at any fixed Sodium dodecyl sulphate (SDS) concentration while the reserve is the case with NH CL.

  8. Fluorescence spectroscopic studies on binding of a flavonoid ...

    Indian Academy of Sciences (India)

    Unknown

    Human serum albumin; bovine serum albumin; quercetin; energy transfer; binding constant. 1. Introduction. Serum albumins are abundantly found in blood plasma and are often termed transport proteins.1–4 They are circulated in the body several times and act as carri- ers for numerous exogenous and endogenous com-.

  9. Characterization of 6-mercaptopurine binding to bovine serum albumin and its displacement from the binding sites by quercetin and rutin

    Energy Technology Data Exchange (ETDEWEB)

    Ehteshami, Mehdi [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rasoulzadeh, Farzaneh [Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Mahboob, Soltanali [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rashidi, Mohammad-Reza, E-mail: rashidi@tbzmed.ac.ir [Research Center for Pharmaceutical Nanotechnology, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of)

    2013-03-15

    Binding of a drug to the serum albumins as major serum transport proteins can be influenced by other ligands leading to alteration of its pharmacological properties. In the present study, binding characteristics of 6-mercaptopurine (6-MP) with bovine serum albumin (BSA) together with its displacement from its binding site by quercetin and rutin have been investigated by the spectroscopic method. According to the binding parameters, a static quenching component in overall dynamic quenching process is operative in the interaction between 6-MP and BSA. The binding of 6-MP to BSA occurred spontaneously due to entropy-driven hydrophobic interactions. The synchronous fluorescence spectroscopy study revealed that the secondary structure of BSA is changed in the presence of 6-MP and both Tyr and Trp residues participate in the interaction between 6-MP and BSA with the later one being more dominant. The binding constant value of 6-MP-BSA in the presence of quercetin and rutin increased. 6-MP was displaced by ibuprofen indicating that the binding site of 6-MP on albumin is site II. Therefore, the change of the pharmacokinetic and pharmacodynamic properties of 6-MP by quercetin and rutin through alteration of binding capacity of 6-MP to the serum albumin cannot be ruled out. In addition, the displacement study showed that 6-MP is located in site II of BSA. - Highlights: Black-Right-Pointing-Pointer Participation of both Tyr and particularly Trp residues in the interaction between 6-MP and BSA. Black-Right-Pointing-Pointer Involvement of a static quenching component in an overall dynamic quenching process. Black-Right-Pointing-Pointer Ability of quercetin and rutin to change the binding constants of 6-MP-BSA complex. Black-Right-Pointing-Pointer Binding of 6-MP to BSA through entropy-driven hydrophobic interactions.

  10. Antioxidant flavonoids bind human serum albumin

    Science.gov (United States)

    Kanakis, C. D.; Tarantilis, P. A.; Polissiou, M. G.; Diamantoglou, S.; Tajmir-Riahi, H. A.

    2006-10-01

    Human serum albumin (HSA) is a principal extracellular protein with a high concentration in blood plasma and carrier for many drugs to different molecular targets. Flavonoids are powerful antioxidants and prevent DNA damage. The antioxidative protections are related to their binding modes to DNA duplex and complexation with free radicals in vivo. However, flavonoids are known to inhibit the activities of several enzymes such as calcium phospholipid-dependent protein kinase, tyrosine protein kinase from rat lung, phosphorylase kinase, phosphatidylinositol 3-kinase and DNA topoisomerases that exhibit the importance of flavonoid-protein interaction. This study was designed to examine the interaction of human serum albumin (HSA) with quercetin (que), kaempferol (kae) and delphinidin (del) in aqueous solution at physiological conditions, using constant protein concentration of 0.25 mM (final) and various drug contents of 1 μM-1 mM. FTIR and UV-vis spectroscopic methods were used to determine the polyphenolic binding mode, the binding constant and the effects of flavonoid complexation on protein secondary structure. The spectroscopic results showed that flavonoids are located along the polypeptide chains through H-bonding interactions with overall affinity constant of Kque = 1.4 × 10 4 M -1, Kkae = 2.6 × 10 5 M -1 and Kdel = 4.71 × 10 5 M -1. The protein secondary structure showed no alterations at low pigment concentration (1 μM), whereas at high flavonoid content (1 mM), major reduction of α-helix from 55% (free HSA) to 42-46% and increase of β-sheet from 15% (free HSA) to 17-19% and β-anti from 7% (free HSA) to 10-20% occurred in the flavonoid-HSA adducts. The major reduction of HSA α-helix is indicative of a partial protein unfolding upon flavonoid interaction.

  11. Effects of constant voltage and constant current stress in PCBM:P3HT solar cells

    DEFF Research Database (Denmark)

    Cester, Andrea; Rizzo, Aldo; Bazzega, A.

    2015-01-01

    The aimof this work is the investigation of forward and reverse bias stress effects, cell self-heating and annealing in roll coated organic solar cells with PCBM:P3HT active layer. In reverse bias stress cells show a constant degradation over time. In forward current stress cells alternate...

  12. Some aspects of preparation and testing of group constants group constant system ABBN-90

    International Nuclear Information System (INIS)

    Nikolaev, M.N.; Tsiboulia, A.M.; Manturov, G.N.

    1996-01-01

    This paper presents an overview of activities performed to prepare and test the group constants ABBN-90. The ABBN-90 set is designed for application calculations of fast, intermediate and thermal nuclear reactors. The calculations of subgroup parameters are discussed. The processing code system GRUCON is mentioned in comparison to the NJOY code system. Proposals are made for future activities. (author). Figs, tabs

  13. Tight-binding treatment of conjugated polymers

    DEFF Research Database (Denmark)

    Lynge, Thomas Bastholm

    This PhD thesis concerns conjugated polymers which constitute a constantly growing research area. Today, among other things, conjugated polymers play a role in plastic based solar cells, photodetectors and light emitting diodes, and even today such plastic-based components constitute an alternative...... of tomorrow. This thesis specifically treats the three conjugated polymers trans-polyacetylene (tPA), poly(para-phenylene) (PPP) and poly(para-phe\\-nylene vinylene) (PPV). The present results, which are derived within the tight-binding model, are divided into two parts. In one part, analytic results...... are derived for the optical properties of the polymers expressed in terms of the optical susceptibility both in the presence and in the absence of a static electric field. In the other part, the cumputationally efficient Density Functional-based Tight-Binding (DFTB) model is applied to the description...

  14. Synthesis and structural characterization of ternary Cu (II) complexes of glycine with 2,2'-bipyridine and 2,2'-dipyridylamine. The DNA-binding studies and biological activity.

    Science.gov (United States)

    Mohamed, Mervat S; Shoukry, Azza A; Ali, Ayat G

    2012-02-01

    In this study two new complexes [Cu(bpy)(Gly)Cl]·2H(2)O (1) and [Cu(dpa)(Gly)Cl]·2H(2)O (2) (bpy=2,2'-bipyridine; dpa=2,2'-dipyridylamine, Gly=glycine) have been synthesized and characterized by elemental analysis, IR, TGA, UV-vis and magnetic susceptibility measurements. The binding properties of the complexes with CT-DNA were investigated by electronic absorption spectra. The intrinsic binding constants (K(b)) calculated from UV-vis absorption studies were 1.84 × 10(3) M(-1) and 3.1 × 10(3) M(-1) for complexes 1 and 2 respectively. Thermal denaturation has been systematically studied by spectrophotometric method and the calculated ΔT(m) was nearly 5 °C for each complex. All the results suggest that the interaction modes between the complexes and CT-DNA were electrostatic and/or groove binding. The redox behavior of the two complexes was investigated by cyclic voltammetry. Both complexes, in presence and absence of CT-DNA show a quasi-reversible wave corresponding to Cu(II)/Cu(I) redox couple. The change in E(1/2), ΔE and I(pc)/I(pa) ascertain the interaction of complexes 1 and 2 with CT-DNA. Further insight into the binding of complexes with CT-DNA has been made by gel electrophoresis, where the binding of complexes is confirmed through decreasing the mobility and intensity of DNA bands. In addition, the antitumor activity of the complexes was tested on two cancer cell lines; the breast cancer (MCF7) and the human hepatocellular carcinoma (HEPG2), as well as one normal cell line; the human normal melanocytes (HFB4). The results showed that complex 1 was more potent antitumor agent than complex 2. The in-vitro antimicrobial activity of the two complexes was carried out using the disc diffusion method against different species of pathogenic bacteria and fungi. The activity data showed that complex 2 was more active in inhibiting the growth of the tested organisms. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Synthesis and structural characterization of ternary Cu (II) complexes of glycine with 2,2'-bipyridine and 2,2'-dipyridylamine. The DNA-binding studies and biological activity

    Science.gov (United States)

    Mohamed, Mervat S.; Shoukry, Azza A.; Ali, Ayat G.

    2012-02-01

    In this study two new complexes [Cu(bpy)(Gly)Cl]·2H 2O ( 1) and [Cu(dpa)(Gly)Cl]·2H 2O ( 2) (bpy = 2,2'-bipyridine; dpa = 2,2'-dipyridylamine, Gly = glycine) have been synthesized and characterized by elemental analysis, IR, TGA, UV-vis and magnetic susceptibility measurements. The binding properties of the complexes with CT-DNA were investigated by electronic absorption spectra. The intrinsic binding constants ( Kb) calculated from UV-vis absorption studies were 1.84 × 10 3 M -1 and 3.1 × 10 3 M -1 for complexes 1 and 2 respectively. Thermal denaturation has been systematically studied by spectrophotometric method and the calculated Δ Tm was nearly 5 °C for each complex. All the results suggest that the interaction modes between the complexes and CT-DNA were electrostatic and/or groove binding. The redox behavior of the two complexes was investigated by cyclic voltammetry. Both complexes, in presence and absence of CT-DNA show a quasi-reversible wave corresponding to Cu II/Cu I redox couple. The change in E1/2, Δ E and Ipc/ Ipa ascertain the interaction of complexes 1 and 2 with CT-DNA. Further insight into the binding of complexes with CT-DNA has been made by gel electrophoresis, where the binding of complexes is confirmed through decreasing the mobility and intensity of DNA bands. In addition, the antitumor activity of the complexes was tested on two cancer cell lines; the breast cancer (MCF7) and the human hepatocellular carcinoma (HEPG2), as well as one normal cell line; the human normal melanocytes (HFB4). The results showed that complex 1 was more potent antitumor agent than complex 2. The in-vitro antimicrobial activity of the two complexes was carried out using the disc diffusion method against different species of pathogenic bacteria and fungi. The activity data showed that complex 2 was more active in inhibiting the growth of the tested organisms.

  16. Modulation of proteolytic polyprotein processing by coxsackievirus mutants resistant to inhibitors targeting phosphatidylinositol-4-kinase IIIβ or oxysterol binding protein.

    Science.gov (United States)

    Lyoo, Heyrhyoung; Dorobantu, Cristina M; van der Schaar, Hilde M; van Kuppeveld, Frank J M

    2017-11-01

    Enteroviruses (e.g. poliovirus, coxsackievirus, and rhinovirus) require several host factors for genome replication. Among these host factors are phosphatidylinositol-4-kinase IIIβ (PI4KB) and oxysterol binding protein (OSBP). Enterovirus mutants resistant to inhibitors of PI4KB and OSBP were previously isolated, which demonstrated a role of single substitutions in the non-structural 3A protein in conferring resistance. Besides the 3A substitutions (i.e., 3A-I54F and 3A-H57Y) in coxsackievirus B3 (CVB3), substitution N2D in 2C was identified in each of the PI4KB-inhibitor resistant CVB3 pools, but its possible benefit has not been investigated yet. In this study, we set out to investigate the possible role of 2C-N2D in the resistance to PI4KB and OSBP inhibition. We show that 2C-N2D by itself did not confer any resistance to inhibitors of PI4KB and OSBP. However, the double mutant (i.e., 2C-N2D/3A-H57Y) showed better replication than the 3A-H57Y single mutant in the presence of inhibitors. Growing evidence suggests that alterations in lipid homeostasis affect the proteolytic processing of the poliovirus polyprotein. Therefore, we studied the effect of PI4KB or OSBP inhibition on proteolytic processing of the CVB3 polyprotein during infection as well as in a replication-independent system. We show that both PI4KB and OSBP inhibitors specifically affected the cleavage at the 3A-3B junction, and that mutation 3A-H57Y recovered impaired proteolytic processing at this junction. Although 2C-N2D enhanced replication of the 3A-H57Y single mutant, we did not detect additional effects of this substitution on polyprotein processing, which leaves the mechanism of how 2C-N2D contributes to the resistance to be revealed. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  17. How does fatty acid influence anti-thyroid drugs binding and ...

    Indian Academy of Sciences (India)

    ... 2-thiouracil (TU), 6-methyl-2-thiouracil (MTU), 6--propyl-2-thiouracil (PTU) with a model plasma protein Human SerumAlbumin (HSA) in the presence and absence of fatty acid (FA). The drug-protein binding efficiency is characterized in terms of binding free energy and the association constant (Ka, which is estimated as ...

  18. Analysis of the chemical equilibrium of combustion at constant volume

    Directory of Open Access Journals (Sweden)

    Marius BREBENEL

    2014-04-01

    Full Text Available Determining the composition of a mixture of combustion gases at a given temperature is based on chemical equilibrium, when the equilibrium constants are calculated on the assumption of constant pressure and temperature. In this paper, an analysis of changes occurring when combustion takes place at constant volume is presented, deriving a specific formula of the equilibrium constant. The simple reaction of carbon combustion in pure oxygen in both cases (constant pressure and constant volume is next considered as example of application, observing the changes occurring in the composition of the combustion gases depending on temperature.

  19. CARBOHYDRATE-CONTAINING COMPOUNDS WHICH BIND TO CARBOHYDRATE BINDING RECEPTORS

    DEFF Research Database (Denmark)

    1995-01-01

    Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases.......Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases....

  20. Magnetically modified biocells in constant magnetic field

    International Nuclear Information System (INIS)

    Abramov, E.G.; Panina, L.K.; Kolikov, V.A.; Bogomolova, E.V.; Snetov, V.N.; Cherepkova, I.A.; Kiselev, A.A.

    2017-01-01

    Paper addresses the inverse problem in determining the area, where the external constant magnetic field captures the biological cells modified by the magnetic nanoparticles. Zero velocity isolines, in area where the modified cells are captured by the magnetic field were determined by numerical method for two locations of the magnet. The problem was solved taking into account the gravitational field, magnetic induction, density of medium, concentration and size of cells, and size and magnetization of nanoparticles attached to the cell. Increase in the number of the nanoparticles attached to the cell and decrease in the cell’ size, enlarges the area, where the modified cells are captured and concentrated by the magnet. Solution is confirmed by the visible pattern formation of the modified cells Saccharomyces cerevisiae. - Highlights: • The inverse problem was solved for finding zero velocity isolines of magnetically modified biological cells. • Solution of the inverse problem depends on the size of cells and the number of nanoparticles attached to the single cell. • The experimental data are in agreement with theoretical solution.

  1. Magnetically modified biocells in constant magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Abramov, E.G.; Panina, L.K. [Saint Petersburg State University, St. Petersburg (Russian Federation); Kolikov, V.A., E-mail: kolikov1@yandex.ru [Institute for Electrophysics and Electric Power of the RAS, St. Petersburg (Russian Federation); Bogomolova, E.V. [Botanical Institute of the RAS after V.L.Komarov, St. Petersburg (Russian Federation); Snetov, V.N. [Institute for Electrophysics and Electric Power of the RAS, St. Petersburg (Russian Federation); Cherepkova, I.A. [Saint Petersburg State Institute of Technology, St. Petersburg (Russian Federation); Kiselev, A.A. [Institute for Electrophysics and Electric Power of the RAS, St. Petersburg (Russian Federation)

    2017-02-01

    Paper addresses the inverse problem in determining the area, where the external constant magnetic field captures the biological cells modified by the magnetic nanoparticles. Zero velocity isolines, in area where the modified cells are captured by the magnetic field were determined by numerical method for two locations of the magnet. The problem was solved taking into account the gravitational field, magnetic induction, density of medium, concentration and size of cells, and size and magnetization of nanoparticles attached to the cell. Increase in the number of the nanoparticles attached to the cell and decrease in the cell’ size, enlarges the area, where the modified cells are captured and concentrated by the magnet. Solution is confirmed by the visible pattern formation of the modified cells Saccharomyces cerevisiae. - Highlights: • The inverse problem was solved for finding zero velocity isolines of magnetically modified biological cells. • Solution of the inverse problem depends on the size of cells and the number of nanoparticles attached to the single cell. • The experimental data are in agreement with theoretical solution.

  2. Solvation free energies and solvent force constants

    International Nuclear Information System (INIS)

    Fonseca, T.; Ladanyi, B.M.; Hynes, J.T.

    1992-01-01

    A theoretical formulation for the solvent force constant k q , which gauges electrical potential fluctuations for an ion in solution and whose charge dependence is a measure of nonlinear aspects of solvation, is presented in terms of the solute charge (q) variation of the solvation free energy. This formulation allows the calculation of k q via integral equation theories. This is illustrated by a series of calculations for ionic solutes in model dipolar-quadrupolar solvents via the reference hypernetted chain (RHNC) integral equation approach. It is found that the q variation of k q can be comprehended in terms of the cooperative (or competing) contributions of the solvent dipole and quadrupole to the acceleration of the solvation free energy. By contrast, traditional notions of dielectric saturation prove to be of much less direct relevance, due in part to the importance of competing electrostriction effects. The formalism is also applied to available simulation and integral equation solvation free energy studies of aqueous ionic solvation to infer to behavior of k q . The extensions for the formalism to more complex solutes (e.g., ion pairs), to higher order fluctuations (e.g., electric field), and to the solvent frequency and effective mass are briefly indicated. 51 refs., 11 figs., 1 tab

  3. Relativistic motion in a constant electromagnetic field

    International Nuclear Information System (INIS)

    Chin, Siu A.

    2009-01-01

    For a relativistic charged particle moving in a constant electromagnetic field, its velocity 4-vector has been well studied. However, despite the fact that both the electromagnetic field and the equations of motion are purely real, the resulting 4-velocity is seemingly due to a complex electromagnetic field. This work shows that this is not due to some complex formalism used (such as Clifford algebra) but is intrinsically due to the fact that the o(3,1) Lie algebra of the Lorentz group is equivalent to two commuting complex su(2) algebras. Expressing the complex su(2) generators in terms of the boost and rotation operators then naturally introduces a complex electromagnetic field. This work solves the equation of motion not as a matrix equation, but as an operator evolution equation in terms of the generators of the Lorentz group. The factorization of the real evolution operator into two commuting complex evolution operators then directly gives the time evolution of the velocity 4-vector without any reference to an intermediate field

  4. The Constant Comparative Method of Qualitative Analysis

    Directory of Open Access Journals (Sweden)

    Barney G. Glaser, Ph.D.

    2008-11-01

    Full Text Available Currently, the general approaches to the analysis of qualitative data are these:1. If the analyst wishes to convert qualitative data into crudely quantifiable form so that he can provisionally test a hypothesis, he codes the data first and then analyzes it. He makes an effort to code “all relevant data [that] can be brought to bear on a point,” and then systematically assembles, assesses and analyzes these data in a fashion that will “constitute proof for a given proposition.”i2. If the analyst wishes only to generate theoretical ideasnew categories and their properties, hypotheses and interrelated hypotheses- he cannot be confined to the practice of coding first and then analyzing the data since, in generating theory, he is constantly redesigning and reintegrating his theoretical notions as he reviews his material.ii Analysis with his purpose, but the explicit coding itself often seems an unnecessary, burdensome task. As a result, the analyst merely inspects his data for new properties of his theoretical categories, and writes memos on these properties.We wish to suggest a third approach

  5. Neuropsychological phenotype of a patient with a de novo 970 kb interstitial deletion in the distal 16p11.2 region

    Directory of Open Access Journals (Sweden)

    Egger JI

    2014-03-01

    Full Text Available Jos I M Egger,1–3 Willem M A Verhoeven,1,4 Wim Verbeeck,5 Nicole de Leeuw61Vincent van Gogh Institute for Psychiatry, Centre of Excellence for Neuropsychiatry, Venray, the Netherlands; 2Donders Institute for Brain, Cognition and Behaviour, Radboud University Nijmegen, Nijmegen, the Netherlands; 3Behavioural Science Institute, Radboud University Nijmegen, Nijmegen, the Netherlands; 4Erasmus University Medical Centre, Department of Psychiatry, Rotterdam, the Netherlands; 5Vincent van Gogh Institute for Psychiatry, Centre for Autism and ADHD, Venray, the Netherlands; 6Department of Human Genetics, Radboud University Medical Centre, Nijmegen, the NetherlandsAbstract: The 16p11.2 microdeletion syndrome is characterized by a wide range of phenotypic expressions and is frequently associated with developmental delay, symptoms from the autism spectrum, epilepsy, congenital anomalies, and obesity. These phenotypes are often related to a proximal 16p11.2 deletion of approximately 600 kb (BP4–BP5 that includes the SH2B1 gene that is reported to be causative for morbid obesity. This more centromeric deletion is most strongly related to autism spectrum susceptibility and is functionally different from the more distal 16p12.2p11.2 region, which includes the so-called atypical 16p11.2 BP2–BP3 deletion (approximately 220 kb presenting with developmental delay, behavioral problems and mild facial dysmorphisms. Here, an adult male with a long history of maladaptive behaviors is described who was referred for diagnostic assessment of his amotivational features. Extensive neuropsychological examination demonstrated rigid thinking, anxious beliefs, and ideas of reference in the presence of normal intelligence. Microarray analysis demonstrated a de novo 970 kb 16p11.2 BP1–BP4 microdeletion that can be regarded as explanatory for his behavioral profile. It is concluded that microdeletion syndromes are not exclusively related to intellectual disabilities and

  6. Analysis of (3H) Kainic acid binding with rat and Frog brain membranes

    International Nuclear Information System (INIS)

    Zharkovskii, A.M.; Zharkovskaya, T.A.

    1985-01-01

    This paper analyzes the binding of (H 3)-KA with membrances in vitro and the effect of various neuroactive amino acids, suggested as endogenous ligands for binding sites of (H 3)-KA, on binding. Experiments were carried out on male albino rats and on winter frogs. Choice of the frog's brain was determined by the high density of high-affinity binding sites of (H 3)-KA. The concentrations of substances inhibiting binding (H 3)-KA by 50% were calculated by logit-probit analysis, and inhibition constants were also calculated. It is shown that although L-glutamate and folic acid inhibit binding of (H 3)-KA, they do not satisfy the criteria to be met by endogenous ligands, and this inhibition of binding is noncompetitive in character. This suggests that KA binding sites and glutamate receptors are not identical, although they may perhaps be subunits of a single complex

  7. Characterization of heme binding to recombinant α1-microglobulin

    Directory of Open Access Journals (Sweden)

    Elena eKarnaukhova

    2014-12-01

    Full Text Available Background: Alpha-1-microglobulin (A1M, a small lipocalin protein found in plasma and tissues, has been identified as a heme and radical scavenger that may participate in the mitigation of toxicities caused by degradation of hemoglobin. The objective of this work was to investigate heme interactions with A1M in vitro using various analytical techniques and to optimize analytical methodology suitable for rapid evaluation of the ligand binding properties of recombinant A1M versions. Methods: To examine heme binding properties of A1M we utilized UV/Vis absorption spectroscopy, visible circular dichroism (CD, catalase-like activity, migration shift electrophoresis, and surface plasmon resonance (SPR, which was specifically developed for the assessment of His-tagged A1M. Results: The results of this study confirm that A1M is a heme binding protein that can accommodate heme at more than one binding site and/or in coordination with different amino acid residues depending upon heme concentration and ligand-to-protein molar ratio. UV/Vis titration of A1M with heme revealed an unusually large bathochromic shift, up to 38 nm, observed for heme binding to a primary binding site. UV/Vis spectroscopy, visible CD and catalase-like activity suggested that heme is accommodated inside His-tagged (tgA1M and tagless A1M (ntA1M in a rather similar fashion although the His-tag is very likely involved into coordination with iron of the heme molecule. SPR data indicated kinetic rate constants and equilibrium binding constants with KD values in a uM range. Conclusions: This study provided experimental evidence of the A1M heme binding properties by aid of different techniques and suggested an analytical methodology for a rapid evaluation of ligand-binding properties of recombinant A1M versions, also suitable for other His-tagged proteins.

  8. Genomewide and biochemical analyses of DNA-binding activity of Cdc6/Orc1 and Mcm proteins in Pyrococcus sp.

    Science.gov (United States)

    Matsunaga, Fujihiko; Glatigny, Annie; Mucchielli-Giorgi, Marie-Hélène; Agier, Nicolas; Delacroix, Hervé; Marisa, Laetitia; Durosay, Patrice; Ishino, Yoshizumi; Aggerbeck, Lawrence; Forterre, Patrick

    2007-01-01

    The origin of DNA replication (oriC) of the hyperthermophilic archaeon Pyrococcus abyssi contains multiple ORB and mini-ORB repeats that show sequence similarities to other archaeal ORB (origin recognition box). We report here that the binding of Cdc6/Orc1 to a 5 kb region containing oriC in vivo was highly specific both in exponential and stationary phases, by means of chromatin immunoprecipitation coupled with hybridization on a whole genome microarray (ChIP-chip). The oriC region is practically the sole binding site for the Cdc6/Orc1, thereby distinguishing oriC in the 1.8 M bp genome. We found that the 5 kb region contains a previously unnoticed cluster of ORB and mini-ORB repeats in the gene encoding the small subunit (dp1) for DNA polymerase II (PolD). ChIP and the gel retardation analyses further revealed that Cdc6/Orc1 specifically binds both of the ORB clusters in oriC and dp1. The organization of the ORB clusters in the dp1 and oriC is conserved during evolution in the order Thermococcales, suggesting a role in the initiation of DNA replication. Our ChIP-chip analysis also revealed that Mcm alters the binding specificity to the oriC region according to the growth phase, consistent with its role as a licensing factor.

  9. A 725 kb deletion at 22q13.1 chromosomal region including SOX10 gene in a boy with a neurologic variant of Waardenburg syndrome type 2.

    Science.gov (United States)

    Siomou, Elisavet; Manolakos, Emmanouil; Petersen, Michael; Thomaidis, Loretta; Gyftodimou, Yolanda; Orru, Sandro; Papoulidis, Ioannis

    2012-11-01

    Waardenburg syndrome (WS) is a rare (1/40,000) autosomal dominant disorder resulting from melanocyte defects, with varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair, skin, and inner ear. WS is classified into four clinical subtypes (WS1-S4). Six genes have been identified to be associated with the different subtypes of WS, among which SOX10, which is localized within the region 22q13.1. Lately it has been suggested that whole SOX10 gene deletions can be encountered when testing for WS. In this study we report a case of a 13-year-old boy with a unique de novo 725 kb deletion within the 22q13.1 chromosomal region, including the SOX10 gene and presenting clinical features of a neurologic variant of WS2. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  10. Estimation of expiratory time constants via fuzzy clustering

    NARCIS (Netherlands)

    M.S. Lourens (M.S.); L. Ali (Lejla); B.W. van den Berg (Bart); A.F.M. Verbraak (Anton); J.M. Bogaard (Jan); H.C. Hoogsteden (Henk); R. Babuška (R.)

    2001-01-01

    markdownabstractObjective. In mechanically ventilated patients the expiratorytime constant provides information about respiratory mechanics. In thepresent study a new method, fuzzy clustering, is proposed to determine expiratory time constants. Fuzzy clustering differs from other methods since it

  11. Wheatstone bridge fed from a bilateral constant current source.

    Science.gov (United States)

    Velayudhan, C; Oommen, D

    1980-03-01

    A simple inexpensive scheme of an electronic amplifier for Wheatstone bridge application is presented. The bridge is excited from a bilateral constant current square wave source. The advantage of constant current drive is presented.

  12. Stunt Barbie - A Laboratory Practicum Combining Constant Velocity and Constant Acceleration

    Science.gov (United States)

    Hertting, Scott

    2011-04-01

    In preparing to teach the advanced physics course at my high school, I found it useful to work through the end-of-chapter problems in the book used by the advanced class. A problem on motion in one dimension involved a stunt woman in free fall from a tree limb onto a horse running beneath her.2 The problem presents a connected learning opportunity for students because it requires the use of the constant velocity model xf = v*t + xi and the constant acceleration model yf = ½* g* t2 + vyi* t + yi (where g = 9.8 m/s/s) to solve it. I named the stunt woman Barbie and created an activity titled "Stunt Barbie."

  13. Using the Neuroadaptagen KB200z™ to Ameliorate Terrifying, Lucid Nightmares in RDS Patients: the Role of Enhanced, Brain-Reward, Functional Connectivity and Dopaminergic Homeostasis.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Oscar-Berman, Marlene; Febo, Marcelo; Demetrovics, Zsolt; Agan, Gozde; Fratantonio, James; Gold, Mark S

    Lucid Dreams are a form of dream life, during which the dreamer may be aware that he/she is dreaming, can stop/re-start the dreams, depending on the pleasantness or unpleasant nature of the dream, and experiences the dream as if he/she were fully awake. Depending on their content, they may be pleasant, un-pleasant or terrifying, at least in the context of patients, who also exhibit characteristics of Reward Deficiency Syndrome (RDS) and Posttraumatic Stress Disorder (PTSD). We present eight clinical cases, with known substance abuse, childhood abuse and diagnosed PTSD/RDS. The administration of a putative dopamine agonist, KB200Z™, was associated with the elimination of unpleasant and/or terrifying, lucid dreams in 87.5% of the cases presented, whereas one very heavy cocaine abuser showed a minimal response. These results required the continuous use of this nutraceutical. The lucid dreams themselves were distinguishable from typical, PTSD nightmares insofar as their content did not appear to reflect a symbolic rendition of an originally-experienced, historical trauma. Each of the cases was diagnosed with a form of RDS, i.e., ADHD, ADD, and/or Tourette's syndrome. They all also suffered from some form of Post-Traumatic-Stress-Disorder (PTSD) and other psychiatric diagnoses as well. The reduction or elimination of terrifying Lucid Dreams seemed to be dependent on KB220Z, whereby voluntary stopping of the agent results in reinstatement of the terrifying non-pleasant nature of the dreams. Following more required research on a much larger population we anticipate confirmation of these seemingly interesting observations. If these results in a small number of patients are indeed confirmed we may have found a frontline solution to a very perplexing and complicated symptom known as lucid dreams.

  14. Spherical α-MnO2 Supported on N-KB as Efficient Electrocatalyst for Oxygen Reduction in Al–Air Battery

    Directory of Open Access Journals (Sweden)

    Kui Chen

    2018-04-01

    Full Text Available Traditional noble metal platinum (Pt is regarded as a bifunctional oxygen catalyst due to its highly catalytic efficiency, but its commercial availability and application is often restricted by high cost. Herein, a cheap and effective catalyst mixed with α-MnO2 and nitrogen-doped Ketjenblack (N-KB (denoted as MnO2-SM150-0.5 is examined as a potential electrocatalyst in oxygen reduction reactions (ORR and oxygen evolution reactions (OER. This α-MnO2 is prepared by redox reaction between K2S2O8 and MnSO4 in acid conditions with a facile hydrothermal process (named the SM method. As a result, MnO2-SM150-0.5 exhibits a good catalytic performance for ORR in alkaline solution, and this result is comparable to a Pt/C catalyst. Moreover, this catalyst also shows superior durability and methanol tolerance compared with a Pt/C catalyst. It also displays a discharge voltage (~1.28 V at a discharge density of 50 mA cm−2 in homemade Al–air batteries that is higher than commercial 20% Pt/C (~1.19 V. The superior electrocatalytic performance of MnO2-SM150-0.5 could be attributed to its higher Mn3+/Mn4+ ratio and the synergistic effect between MnO2 and the nitrogen-doped KB. This study provides a novel strategy for the preparation of an MnO2-based composite electrocatalyst.

  15. In Vivo Deletion of the Cebpa +37 kb Enhancer Markedly Reduces Cebpa mRNA in Myeloid Progenitors but Not in Non-Hematopoietic Tissues to Impair Granulopoiesis

    Science.gov (United States)

    Guo, Hong; Cooper, Stacy; Friedman, Alan D.

    2016-01-01

    The murine Cebpa gene contains a +37 kb, evolutionarily conserved 440 bp enhancer that directs high-level expression to myeloid progenitors in transgenic mice. The enhancer is bound and activated by Runx1, Scl, GATA2, C/EBPα, c-Myb, Pu.1, and additional Ets factors in myeloid cells. CRISPR/Cas9-mediated replacement of the wild-type enhancer with a variant mutant in its seven Ets sites leads to 20-fold reduction of Cebpa mRNA in the 32Dcl3 myeloid cell line. To determine the effect of deleting the enhancer in vivo, we now characterize C57BL/6 mice in which loxP sites flank a 688 bp DNA segment containing the enhancer. CMV-Cre mediated germline deletion resulted in diminution of the expected number of viable Enh(f/f);CMV-Cre offspring, with 28-fold reduction in marrow Cebpa mRNA but normal levels in liver, lung, adipose, intestine, muscle, and kidney. Cre-transduction of lineage-negative marrow cells in vitro reduced Cebpa mRNA 12-fold, with impairment of granulocytic maturation, morphologic blast accumulation, and IL-3 dependent myeloid colony replating for >12 generations. Exposure of Enh(f/f);Mx1-Cre mice to pIpC led to 14-fold reduction of Cebpa mRNA in GMP or CMP, 30-fold reduction in LSK, and deletion and confirmed marrow-intrinsic impairment of granulopoiesis and B cell generation with LSK and monocyte lineage expansion. These findings demonstrate a critical role for the +37 kb Cebpa enhancer for hematopoietic-specific Cebpa expression, with enhancer deletion leading to impaired myelopoiesis and potentially preleukemic progenitor expansion. PMID:26937964

  16. Fine genetic mapping of the white immature fruit color gene w to a 33.0-kb region in cucumber (Cucumis sativus L.).

    Science.gov (United States)

    Liu, Hanqiang; Meng, Huanwen; Pan, Yupeng; Liang, Xinjing; Jiao, Jianqing; Li, Yuhong; Chen, Shuxia; Cheng, Zhihui

    2015-12-01

    The white immature fruit color gene w was rapidly mapped to a 33.0-kb region to identify a valuable candidate gene that encodes peroxidase. The skin color of immature fruit is a crucial external trait of cucumbers, and white skin is shared by limited numbers of commercial cultivars. Herein, one BC1 population and two F2 segregating populations were constructed using four inbred parental lines (WD3 × B-2-2 and Q30 × Q24) to investigate the inheritance patterns and chromosomal locations of immature fruit color genes in cucumbers. Consequently, a single recessive gene, w, was identified that controls white immature fruit color. A total of 526 markers, which were derived from published genetic maps, two reference cucumber genomes ("9930" and GY14), and two parents (Q30 and Q24) for which whole-genome sequence information is available, were used to map the target gene w to a 33.0-kb region flanked by two SNP-based markers, ASPCR39262 and ASPCR39229, which are physically located at 39262450 and 39229482 of chromosome 3 ("9930" draft genome assembly), respectively. Gene prediction indicated that four potential genes were located in the target region. One gene that encodes peroxidase is likely to be a valuable candidate gene because quantitative real-time PCR revealed an eightfold difference in its transcriptional level, and several amino acid variations were found when the deduced amino acid sequence was aligned. A co-segregating marker was used synergistically to test its ability to predict the skin colors of 83 dark green/white germplasms, and the validity of its utility in marker-assisted selection was confirmed. Fine mapping of this locus will assist in cloning the gene and in marker-assisted breeding to develop dark green/white cucumber cultivars.

  17. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  18. Using the Neuroadaptagen KB200z™ to Ameliorate Terrifying, Lucid Nightmares in RDS Patients: the Role of Enhanced, Brain-Reward, Functional Connectivity and Dopaminergic Homeostasis

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Oscar-Berman, Marlene; Febo, Marcelo; Demetrovics, Zsolt; Agan, Gozde; Fratantonio, James; Gold, Mark S.

    2015-01-01

    Background Lucid Dreams are a form of dream life, during which the dreamer may be aware that he/she is dreaming, can stop/re-start the dreams, depending on the pleasantness or unpleasant nature of the dream, and experiences the dream as if he/she were fully awake. Depending on their content, they may be pleasant, un-pleasant or terrifying, at least in the context of patients, who also exhibit characteristics of Reward Deficiency Syndrome (RDS) and Posttraumatic Stress Disorder (PTSD). Case Series We present eight clinical cases, with known substance abuse, childhood abuse and diagnosed PTSD/RDS. The administration of a putative dopamine agonist, KB200Z™, was associated with the elimination of unpleasant and/or terrifying, lucid dreams in 87.5% of the cases presented, whereas one very heavy cocaine abuser showed a minimal response. These results required the continuous use of this nutraceutical. The lucid dreams themselves were distinguishable from typical, PTSD nightmares insofar as their content did not appear to reflect a symbolic rendition of an originally-experienced, historical trauma. Each of the cases was diagnosed with a form of RDS, i.e., ADHD, ADD, and/or Tourette’s syndrome. They all also suffered from some form of Post-Traumatic-Stress-Disorder (PTSD) and other psychiatric diagnoses as well. Conclusion The reduction or elimination of terrifying Lucid Dreams seemed to be dependent on KB220Z, whereby voluntary stopping of the agent results in reinstatement of the terrifying non-pleasant nature of the dreams. Following more required research on a much larger population we anticipate confirmation of these seemingly interesting observations. If these results in a small number of patients are indeed confirmed we may have found a frontline solution to a very perplexing and complicated symptom known as lucid dreams. PMID:26065033

  19. Various types of LRP5 mutations in four patients with osteoporosis-pseudoglioma syndrome: identification of a 7.2-kb microdeletion using oligonucleotide tiling microarray.

    Science.gov (United States)

    Narumi, Satoshi; Numakura, Chikahiko; Shiihara, Takashi; Seiwa, Chizuru; Nozaki, Yasuyuki; Yamagata, Takanori; Momoi, Mariko Y; Watanabe, Yoriko; Yoshino, Makoto; Matsuishi, Toyojiro; Nishi, Eriko; Kawame, Hiroshi; Akahane, Tsutomu; Nishimura, Gen; Emi, Mitsuru; Hasegawa, Tomonobu

    2010-01-01

    Osteoporosis-pseudoglioma syndrome (OPS; OMIM 259770) is an autosomal-recessive genetic disorder characterized by severe osteoporosis and visual disturbance from childhood. Biallelic mutations in the low-density lipoprotein receptor-related protein 5 gene (LRP5) have been frequently detected, while a subset of patients had only one or no detectable mutation. We report on the clinical and molecular findings of four unrelated Japanese patients with the syndrome. The four patients had typical skeletal and ocular phenotypes of OPS, namely severe juvenile osteoporosis and early-onset visual disturbance, with or without mental retardation. We undertook standard PCR-based sequencing for LRP5 and found four missense mutations (p.L145F, p.T244M, p.P382L, and p.T552M), one nonsense mutation (p.R1534X), and one splice site mutation (c.1584+1G>A) among four OPS patients. Although three patients had two heterozygous mutations, one had only one heterozygous splice site mutation. In this patient, RT-PCR from lymphocytic RNA demonstrated splice error resulting in 63-bp insertion between exons 7 and 8. Furthermore, the patient was found to have only mutated RT-PCR fragment, implying that a seemingly normal allele did not express LRP5 mRNA. We then conducted custom- designed oligonucleotide tiling microarray analyses targeted to a 600-kb genome region harboring LRP5 and discovered a 7.2-kb microdeletion encompassing exons 22 and 23 of LRP5. We found various types of LRP5 mutations, including an exon-level deletion that is undetectable by standard PCR-based mutation screening. Oligonucleotide tiling microarray seems to be a powerful tool in identifying cryptic structural mutations.

  20. DNA-binding cytotoxic alkaloids: comparative study of the energetics of binding of berberine, palmatine, and coralyne.

    Science.gov (United States)

    Bhadra, Kakali; Maiti, Motilal; Kumar, Gopinatha Suresh

    2008-12-01

    Deoxyribonucleic acid is the site of storage and retrieval of genetic information through interaction with proteins and other small molecules. In the present study, the interaction of two natural cytotoxic protoberberine plant alkaloids, berberine and palmatine, and a synthetic derivative, coralyne, with mammalian herring testis DNA was investigated using a combination of isothermal titration calorimetry, differential scanning calorimetry, and optical melting experiments to characterize the energetics of their binding. The binding constants of these alkaloids to DNA under identical conditions were evaluated from the UV melting data, and the enthalpy of binding was elucidated from isothermal titration studies. The binding constants of berberine, palmatine, and coralyne to DNA were found to be 1.15 x 10(4), 2.84 x 10(4), and 3.5 x 10(6) M(-1) at 20 degrees C in buffer of 20 mM [Na+]. Parsing of the free energy change of the interaction observed into polyelectrolytic and nonpolyelectrolytic components suggested that although these alkaloids are charged, the major contributor of about 75% of the binding free energy arises from the nonpolyelectrolytic forces. The binding in case of palmatine and coralyne was predominantly enthalpy driven with favoring smaller entropy terms, while that of berberine was favored by both negative enthalpy and positive entropy changes. Temperature dependence of the binding enthalpies determined from ITC studies in the range 20-40 degrees C was used to calculate the binding-induced change in heat capacity (DeltaC(o)(p)) values as -117, -135, and -157 cal/mol K, respectively, for berberine, palmatine, and coralyne. Taken together, the results suggest that the DNA binding of the planar synthetic coralyne is stronger and thermodynamically more favored compared to the buckled natural berberine and palmatine.

  1. Equilibrium and kinetics of Sin Nombre hantavirus binding at DAF/CD55 functionalized bead surfaces.

    Science.gov (United States)

    Buranda, Tione; Swanson, Scarlett; Bondu, Virginie; Schaefer, Leah; Maclean, James; Mo, Zhenzhen; Wycoff, Keith; Belle, Archana; Hjelle, Brian

    2014-03-10

    Decay accelerating factor (DAF/CD55) is targeted by many pathogens for cell entry. It has been implicated as a co-receptor for hantaviruses. To examine the binding of hantaviruses to DAF, we describe the use of Protein G beads for binding human IgG Fc domain-functionalized DAF ((DAF)₂-Fc). When mixed with Protein G beads the resulting DAF beads can be used as a generalizable platform for measuring kinetic and equilibrium binding constants of DAF binding targets. The hantavirus interaction has high affinity (24-30 nM; k(on) ~ 10⁵ M⁻¹ s⁻¹, k(off) ~ 0.0045 s⁻¹). The bivalent (DAF)₂-Fc/SNV data agree with hantavirus binding to DAF expressed on Tanoue B cells (K(d) = 14.0 nM). Monovalent affinity interaction between SNV and recombinant DAF of 58.0 nM is determined from competition binding. This study serves a dual purpose of presenting a convenient and quantitative approach of measuring binding affinities between DAF and the many cognate viral and bacterial ligands and providing new data on the binding constant of DAF and Sin Nombre hantavirus. Knowledge of the equilibrium binding constant allows for the determination of the relative fractions of bound and free virus particles in cell entry assays. This is important for drug discovery assays for cell entry inhibitors.

  2. The fine-structure constant before quantum mechanics

    CERN Document Server

    Kragh, H

    2003-01-01

    This paper focuses on the early history of the fine-structure constant, largely the period until 1925. Contrary to what is generally assumed, speculations concerning the interdependence of the elementary electric charge and Planck's constant predated Arnold Sommerfeld's 1916 discussion of the dimensionless constant. This paper pays particular attention to a little known work from 1914 in which G N Lewis and E Q Adams derived what is effectively a numerical expression for the fine-structure constant.

  3. Articles translated from Journal Yadernye Konstanty (Nuclear Constants). Series: Nuclear Constants, Issue No. 1, 2000

    International Nuclear Information System (INIS)

    2001-12-01

    This report contains translations of seven papers published in the Nuclear Constants journal (Voprosy Atomnoj Nauki I Teknniki, seriya: Yadernye Konstanty (YK), vypusk 1, 2000). They are marked as 'Translated from Russian'. Two original papers published in YK in English are included with correction of found misprints and small format changes. As a result the report contains all papers presented in YK, 1 (2000). (author)

  4. Articles translated from Journal Yadernye Konstanty (Nuclear Constants). Series: Nuclear Constants, Issue No. 1, 2001

    International Nuclear Information System (INIS)

    2002-12-01

    This report contains translations of eight papers published in the Nuclear Constants journal (Voprosy Atomnoj Nauki I Teknniki, seriya: Yadernye Konstanty (YK), vypusk 1, 2001). They are marked as 'Translated from Russian'. Six original papers published in YK in English are included with correction of found misprints and small format changes. As a result the report contains all papers presented in YK, 1 (2001). (author)

  5. low cost constant low cost constant – head drip irrigation emitter

    African Journals Online (AJOL)

    eobe

    constant – head drip system on the other hand for a 25 m2 plot size was N 15, 870 ($79) at a current exchange rate of N210 to $1(US), further evaluation also revealed that the system can be extended to irrigate up to 100 m2 by raising the barrel to a height of 1 m above the ground, this will serve 560 maize crop stands. This.

  6. Stability constant of the trisglycinto metal complexes | Na'aliya ...

    African Journals Online (AJOL)

    The stability constants of iron, manganese, cobalt, and nickel complexes of glycine have been determined in aqueous solution by potentiometric titration with standard sodium hydroxide solution. The values of the stepwise stability constants were obtained by ORIGIN '50' program. The overall stability constants of the ...

  7. Nuclear magnetic resonance J coupling constant polarizabilities of hydrogen peroxide

    DEFF Research Database (Denmark)

    Kjær, Hanna; Nielsen, Monia R.; Pagola, Gabriel I.

    2012-01-01

    In this paper we present the so far most extended investigation of the calculation of the coupling constant polarizability of a molecule. The components of the coupling constant polarizability are derivatives of the NMR indirect nuclear spin-spin coupling constant with respect to an external elec...

  8. Determination of optical constants and nonlinear optical coefficients ...

    Indian Academy of Sciences (India)

    The optical properties of Violet 1-doped polyvinyl alcohol (PVA) have been investigated using Wemble and Didomenico (WD) method. The optical constants such as refractive index , the dispersion energy , the oscillation energy 0, the lattice dielectric constant ∞, light frequency dielectric constant 0 and the ratio of ...

  9. Garbage-free reversible constant multipliers for arbitrary integers

    DEFF Research Database (Denmark)

    Mogensen, Torben Ægidius

    2013-01-01

    We present a method for constructing reversible circuitry for multiplying integers by arbitrary integer constants. The method is based on Mealy machines and gives circuits whose size are (in the worst case) linear in the size of the constant. This makes the method unsuitable for large constants...

  10. Towards Grothendieck constants and LHV models in quantum mechanics

    International Nuclear Information System (INIS)

    Hua, Bobo; Li, Ming; Zhang, Tinggui; Zhou, Chunqin; Li-Jost, Xianqing; Fei, Shao-Ming

    2015-01-01

    We adopt a continuous model to estimate the Grothendieck constants. An analytical formula to compute the lower bounds of Grothendieck constants has been explicitly derived for arbitrary orders, which improves previous bounds. Moreover, our lower bound of the Grothendieck constant of order three gives a refined bound of the threshold value for the nonlocality of the two-qubit Werner states. (paper)

  11. Reliability concerns with logical constants in Xilinx FPGA designs

    Energy Technology Data Exchange (ETDEWEB)

    Quinn, Heather M [Los Alamos National Laboratory; Graham, Paul [Los Alamos National Laboratory; Morgan, Keith [Los Alamos National Laboratory; Ostler, Patrick [Los Alamos National Laboratory; Allen, Greg [JPL; Swift, Gary [XILINX; Tseng, Chen W [XILINX

    2009-01-01

    In Xilinx Field Programmable Gate Arrays logical constants, which ground unused inputs and provide constants for designs, are implemented in SEU-susceptible logic. In the past, these logical constants have been shown to cause the user circuit to output bad data and were not resetable through off-line rcconfiguration. In the more recent devices, logical constants are less problematic, though mitigation should still be considered for high reliability applications. In conclusion, we have presented a number of reliability concerns with logical constants in the Xilinx Virtex family. There are two main categories of logical constants: implicit and explicit logical constants. In all of the Virtex devices, the implicit logical constants are implemented using half latches, which in the most recent devices are several orders of magnitudes smaller than configuration bit cells. Explicit logical constants are implemented exclusively using constant LUTs in the Virtex-I and Virtex-II, and use a combination of constant LUTs and architectural posts to the ground plane in the Virtex-4. We have also presented mitigation methods and options for these devices. While SEUs in implicit and some types of explicit logical constants can cause data corrupt, the chance of failure from these components is now much smaller than it was in the Virtex-I device. Therefore, for many cases, mitigation might not be necessary, except under extremely high reliability situations.

  12. Stability constants of the Europium complexes with the chloride ions

    International Nuclear Information System (INIS)

    Jimenez R, M.; Solache R, M.; Rojas H, A.

    2000-01-01

    The stability constants of lanthanides complexes with chloride ions which were determined at the same ionic force but in different media, are significantly different. It does not exist a systematic study over these stability constants. The purpose of this work is to determine the stability constants of the europium complexes with chloride ions at 303 K, by the solvents extraction method. (Author)

  13. An automated approach for finding variable-constant pairing bugs

    DEFF Research Database (Denmark)

    Lawall, Julia; Lo, David

    2010-01-01

    operating systems provide little support for checking the usage of named constants.  This affects correctness, when a constant is used in a context where its value is meaningless, and software maintenance, when a constant has the right value for its usage context but the wrong name. We propose a hybrid...

  14. Constant False Alarm Rate (CFAR) Autotrend Evaluation Report

    Science.gov (United States)

    2011-12-01

    TECHNICAL REPORT RDMR-AE-11-01 CONSTANT FALSE ALARM RATE ( CFAR ) AUTOTREND EVALUATION REPORT Daniel Wade Aviation Engineering...TYPE AND DATES COVERED Final 4. TITLE AND SUBTITLE Constant False Alarm Rate ( CFAR ) Autotrend Evaluation Report 5. FUNDING NUMBERS...performance of the Constant False Alarm Rate ( CFAR ) Autotrend dynamic alert detection technology as an augmentation to the Apache Modernized Signal

  15. Determination and stability constants of Manganese (II) amino acid ...

    African Journals Online (AJOL)

    Determination and stability constants of Manganese (II) amino acid complexes. HN Aliyu, J Na'aliya. Abstract. The stepwise and the overall stability constants of the complexes formed by manganese (II) ion and twelve (12) amino acids have been determined. The dissociation constants, pKa, of the amino acids determined ...

  16. DFT computations of the lattice constant, stable atomic structure and ...

    African Journals Online (AJOL)

    This paper presents the most stable atomic structure and lattice constant of Fullerenes (C60). FHI-aims DFT code was used to predict the stable structure and the computational lattice constant of C60. These were compared with known experimental structures and lattice constants of C60. The results obtained showed that ...

  17. Investigation of three flavonoids binding to bovine serum albumin using molecular fluorescence technique

    International Nuclear Information System (INIS)

    Bi Shuyun; Yan Lili; Pang Bo; Wang Yu

    2012-01-01

    The three flavonoids including naringenin, hesperetin and apigenin binding to bovine serum albumin (BSA) at pH 7.4 was studied by fluorescence quenching, synchronous fluorescence and UV-vis absorption spectroscopic techniques. The results obtained revealed that naringenin, hesperetin and apigenin strongly quenched the intrinsic fluorescence of BSA. The Stern-Volmer curves suggested that these quenching processes were all static quenching processes. At 291 K, the value and the order of the binding constant were K A n aringenin) =4.08x10 4 A(hesperetin) =5.40x10 4 ∼K A(apigenin) =5.32x10 4 L mol -1 . The main binding force between the flavonoid and BSA was hydrophobic and electrostatic force. According to the Foerster theory of non-radiation energy transfer, the binding distances (r 0 ) were obtained as 3.36, 3.47 and 3.30 nm for naringenin-BSA, hesperetin-BSA and apigenin-BSA, respectively. The effect of some common ions such as Fe 3+ , Cu 2+ , Mg 2+ , Mn 2+ , Zn 2+ and Ca 2+ on the binding was also studied in detail. The competition binding was also performed. The apparent binding constant (K' A ) obtained suggested that one flavonoid had an obvious effect on the binding of another flavonoid to protein when they coexisted in BSA solution. - Highlights: → Quenchings of BSA fluorescence by the flavonoids was all static quenchings. → Synchronous fluorescence was applied to study the structural change of BSA. → Binding constant, binding site and binding force were determined. → Competition binding experiments were performed. → One flavonoid had an obvious effect on the binding of another one to BSA.

  18. First-principles calculations on third-order elastic constants and internal relaxation for monolayer graphene

    International Nuclear Information System (INIS)

    Wang Rui; Wang Shaofeng; Wu Xiaozhi; Liang Xiao

    2010-01-01

    The method of homogeneous deformation is combined with first-principles total-energy calculations on determining third-order elastic constants and internal relaxation for monolayer graphene. We employ density functional theory (DFT) within generalized-gradient-approximation (GGA). The elastic constants are obtained from a polynomial fitted to the calculations of strain-energy and strain-stress relations. Our results agree well with recent calculations by DFT calculations, tight-binding atomistic simulations, and experiments with an atomic force microscope. The internal relaxation displacement has also been determined from ab initio calculations. The details of internal lattice relaxation by first principles are basically consistent with the previous molecular dynamics (MD) simulation. But for tiny deformation, there is an anomalous region in which the behavior of internal relaxation is backward action. In addition, we have also demonstrated that the symmetry of the relationship between the internal displacement and the infinitesimal stains can be satisfied.

  19. A Computational Scheme To Evaluate Hamaker Constants of Molecules with Practical Size and Anisotropy.

    Science.gov (United States)

    Hongo, Kenta; Maezono, Ryo

    2017-11-14

    We propose a computational scheme to evaluate Hamaker constants, A, of molecules with practical sizes and anisotropies. Upon the increasing feasibility of diffusion Monte Carlo (DMC) methods to evaluate binding curves for such molecules to extract the constants, we discussed how to treat the averaging over anisotropy and how to correct the bias due to the nonadditivity. We have developed a computational procedure for dealing with the anisotropy and reducing statistical errors and biases in DMC evaluations, based on possible validations on predicted A. We applied the scheme to cyclohexasilane molecule, Si 6 H 12 , used in "printed electronics" fabrications, getting A ≈ 105 ± 2 zJ, being in plausible range supported even by other possible extrapolations. The scheme provided here would open a way to use handy ab initio evaluations to predict wettabilities as in the form of materials informatics over broader molecules.

  20. Strong Nuclear Gravitational Constant and the Origin of Nuclear Planck Scale

    Directory of Open Access Journals (Sweden)

    Seshavatharam U. V. S.

    2010-07-01

    Full Text Available Whether it may be real or an equivalent, existence of strong nuclear gravitational con- stant G S is assumed. Its value is obtained from Fermi’s weak coupling constant as G S = 6 : 9427284 10 31 m 3 / kg sec 2 and thus “nuclear planck scale” is defined. For strong interaction existence of a new integral charged “confined fermion” of mass 105.383 MeV is assumed. Strong coupling constant is the ratio of nuclear planck energy = 11.97 MeV and assumed 105.383 MeV. 1 s = X s is defined as the strong interaction mass gen- erator. With 105.383 MeV fermion various nuclear unit radii are fitted. Fermi’s weak coupling constant, strong interaction upper limit and Bohr radius are fitted at funda- mental level. Considering Fermi’s weak coupling constant and nuclear planck length a new number X e = 294.8183 is defined for fitting the electron, muon and tau rest masses. Using X s , X e and 105 : 32 = 0 : 769 MeV as the Coulombic energy constant = E c , en- ergy coe cients of the semi-empirical mass formula are estimated as E v = 16 : 32 MeV ; E s = 19 : 37 MeV ; E a = 23 : 86 MeV and E p = 11 : 97 MeV where Coulombic energy term contains [ Z ] 2 : Starting from Z = 2 nuclear binding energy is fitted with two terms along with only one energy constant = 0.769 MeV. Finally nucleon mass and its excited levels are fitted.

  1. binding protein (HABP1)

    Indian Academy of Sciences (India)

    Unknown

    adsorbed on carbon coated copper grid (400 mesh) for. 5 min at room temperature. The grids were subsequently .... and inhibition by GAGs and DMA were determined on polystyrene wells of microtitre plates (Costar, ... for binding inhibition assays was carried out by mixing equal volumes of the conjugate and the inhibitor at ...

  2. Quarkeosynthesis Binding Energy

    Science.gov (United States)

    Webb, Bill

    2009-05-01

    Quarkeosynthesis shows that the binding energy of a nucleus is the difference between the relativistic kinetic energies of its threesome of Jumbo Quarks and that of its building block quarks from neutrons and protons. There is no involvement of a nuclear strong force or gluon material.

  3. Sequential memory: Binding dynamics

    Science.gov (United States)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail

    2015-10-01

    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  4. binding protein (HABP1)

    Indian Academy of Sciences (India)

    Unknown

    of HA in a concentration-dependent manner, suggesting its multiligand affinity amongst carbohydrates. rHABP1 shows differential affinity ... site is seen to correspond to the carbohydrate-binding site in E-selectin, which has similarity in the ... adsorbed on carbon coated copper grid (400 mesh) for. 5 min at room temperature.

  5. The cosmological constant in theories with finite spacetime

    International Nuclear Information System (INIS)

    Kummer, Janis

    2014-08-01

    We study the role of the cosmological constant in different theories with finite spacetime. The cosmological constant appears both as an initial condition and as a constant of integration. In the context of the cosmological constant problem a new model will be presented. This modification of general relativity generates a small, non-vanishing cosmological constant, which is radiatively stable. The dynamics of the expansion of the universe in this model will be analyzed. Eventually, we try to solve the emergent problems concerning the generation of accelerated expansion using a quintessence model of dark energy.

  6. A unifying mathematical framework for experimental TCR-pMHC kinetic constants.

    Science.gov (United States)

    Faro, Jose; Castro, Mario; Molina-París, Carmen

    2017-04-26

    Receptor binding and triggering are central in Immunology as T cells activated through their T cell receptors (TCR) by protein antigens orchestrate immune responses. In order to understand receptor-ligand interactions, many groups working with different experimental techniques and assays have generated a vast body of knowledge during the last decades. However, in recent years a type of assays, referred to as two-dimensional or membrane-to-membrane, has questioned our current understanding of the role of different kinetic constants (for instance, on- versus off-rate constants) on TCR-ligand interaction and subsequent T cell activation. Here we present a general mathematical framework that provides a unifying umbrella to relate fundamental and effective (or experimentally determined) kinetic constants, as well as describe and compare state-of-the-art experimental methods. Our framework is able to predict the correlations between functional output, such as 1/EC 50 , and effective kinetic constants for a range of different experimental assays (in two and three dimensions). Furthermore, our approach can be applied beyond Immunology, and serve as a "translation method" for the biochemical characterization of receptor-ligand interactions.

  7. Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

    Science.gov (United States)

    Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

    2011-01-01

    Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

  8. Note: Determination of torsional spring constant of atomic force microscopy cantilevers: Combining normal spring constant and classical beam theory

    DEFF Research Database (Denmark)

    Álvarez-Asencio, R.; Thormann, Esben; Rutland, M.W.

    2013-01-01

    A technique has been developed for the calculation of torsional spring constants for AFM cantilevers based on the combination of the normal spring constant and plate/beam theory. It is easy to apply and allow the determination of torsional constants for stiff cantilevers where the thermal power...

  9. Spectroscopic studies of the binding of Cu(II) complexes of oxicam NSAIDs to alternating G-C and homopolymeric G-C sequences.

    Science.gov (United States)

    Chakraborty, Sreeja; Bose, Madhuparna; Sarkar, Munna

    2014-03-25

    Drugs belonging to the Non-steroidal anti-inflammatory (NSAID) group are not only used as anti-inflammatory, analgesic and anti-pyretic agents, but also show anti-cancer effects. Complexing them with a bioactive metal like copper, show an enhancement in their anti-cancer effects compared to the bare drugs, whose exact mechanism of action is not yet fully understood. For the first time, it was shown by our group that Cu(II)-NSAIDs can directly bind to the DNA backbone. The ability of the copper complexes of NSAIDs namely meloxicam and piroxicam to bind to the DNA backbone could be a possible molecular mechanism behind their enhanced anticancer effects. Elucidating base sequence specific interaction of Cu(II)-NSAIDs to the DNA will provide information on their possible binding sites in the genome sequence. In this work, we present how these complexes respond to differences in structure and hydration pattern of GC rich sequences. For this, binding studies of Cu(II) complexes of piroxicam [Cu(II)-(Px)2 (L)2] and meloxicam [Cu(II)-(Mx)2 (L)] with alternating GC (polydG-dC) and homopolymeric GC (polydG-polydC) sequences were carried out using a combination of spectroscopic techniques that include UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy. The Cu(II)-NSAIDs show strong binding affinity to both polydG-dC and polydG-polydC. The role reversal of Cu(II)-meloxicam from a strong binder of polydG-dC (Kb=11.5×10(3) M(-1)) to a weak binder of polydG-polydC (Kb=5.02×10(3) M(-1)), while Cu(II)-piroxicam changes from a strong binder of polydG-polydC (Kb=8.18×10(3) M(-1)) to a weak one of polydG-dC (Kb=2.18×10(3) M(-1)), point to the sensitivity of these complexes to changes in the backbone structures/hydration. Changes in the profiles of UV absorption band and CD difference spectra, upon complex binding to polynucleotides and the results of competitive binding assay using ethidium bromide (EtBr) fluorescence indicate different binding modes in each

  10. Spectroscopic studies of the binding of Cu(II) complexes of oxicam NSAIDs to alternating G-C and homopolymeric G-C sequences

    Science.gov (United States)

    Chakraborty, Sreeja; Bose, Madhuparna; Sarkar, Munna

    2014-03-01

    Drugs belonging to the Non-steroidal anti-inflammatory (NSAID) group are not only used as anti-inflammatory, analgesic and anti-pyretic agents, but also show anti-cancer effects. Complexing them with a bioactive metal like copper, show an enhancement in their anti-cancer effects compared to the bare drugs, whose exact mechanism of action is not yet fully understood. For the first time, it was shown by our group that Cu(II)-NSAIDs can directly bind to the DNA backbone. The ability of the copper complexes of NSAIDs namely meloxicam and piroxicam to bind to the DNA backbone could be a possible molecular mechanism behind their enhanced anticancer effects. Elucidating base sequence specific interaction of Cu(II)-NSAIDs to the DNA will provide information on their possible binding sites in the genome sequence. In this work, we present how these complexes respond to differences in structure and hydration pattern of GC rich sequences. For this, binding studies of Cu(II) complexes of piroxicam [Cu(II)-(Px)2 (L)2] and meloxicam [Cu(II)-(Mx)2 (L)] with alternating GC (polydG-dC) and homopolymeric GC (polydG-polydC) sequences were carried out using a combination of spectroscopic techniques that include UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy. The Cu(II)-NSAIDs show strong binding affinity to both polydG-dC and polydG-polydC. The role reversal of Cu(II)-meloxicam from a strong binder of polydG-dC (Kb = 11.5 × 103 M-1) to a weak binder of polydG-polydC (Kb = 5.02 × 103 M-1), while Cu(II)-piroxicam changes from a strong binder of polydG-polydC (Kb = 8.18 × 103 M-1) to a weak one of polydG-dC (Kb = 2.18 × 103 M-1), point to the sensitivity of these complexes to changes in the backbone structures/hydration. Changes in the profiles of UV absorption band and CD difference spectra, upon complex binding to polynucleotides and the results of competitive binding assay using ethidium bromide (EtBr) fluorescence indicate different binding modes in each

  11. Multiple constant multiplication optimizations for field programmable gate arrays

    CERN Document Server

    Kumm, Martin

    2016-01-01

    This work covers field programmable gate array (FPGA)-specific optimizations of circuits computing the multiplication of a variable by several constants, commonly denoted as multiple constant multiplication (MCM). These optimizations focus on low resource usage but high performance. They comprise the use of fast carry-chains in adder-based constant multiplications including ternary (3-input) adders as well as the integration of look-up table-based constant multipliers and embedded multipliers to get the optimal mapping to modern FPGAs. The proposed methods can be used for the efficient implementation of digital filters, discrete transforms and many other circuits in the domain of digital signal processing, communication and image processing. Contents Heuristic and ILP-Based Optimal Solutions for the Pipelined Multiple Constant Multiplication Problem Methods to Integrate Embedded Multipliers, LUT-Based Constant Multipliers and Ternary (3-Input) Adders An Optimized Multiple Constant Multiplication Architecture ...

  12. Miz-1 activates gene expression via a novel consensus DNA binding motif.

    Directory of Open Access Journals (Sweden)

    Bonnie L Barrilleaux

    Full Text Available The transcription factor Miz-1 can either activate or repress gene expression in concert with binding partners including the Myc oncoprotein. The genomic binding of Miz-1 includes both core promoters and more distal sites, but the preferred DNA binding motif of Miz-1 has been unclear. We used a high-throughput in vitro technique, Bind-n-Seq, to identify two Miz-1 consensus DNA binding motif sequences--ATCGGTAATC and ATCGAT (Mizm1 and Mizm2--bound by full-length Miz-1 and its zinc finger domain, respectively. We validated these sequences directly as high affinity Miz-1 binding motifs. Competition assays using mutant probes indicated that the binding affinity of Miz-1 for Mizm1 and Mizm2 is highly sequence-specific. Miz-1 strongly activates gene expression through the motifs in a Myc-independent manner. MEME-ChIP analysis of Miz-1 ChIP-seq data in two different cell types reveals a long motif with a central core sequence highly similar to the Mizm1 motif identified by Bind-n-Seq, validating the in vivo relevance of the findings. Miz-1 ChIP-seq peaks containing the long motif are predominantly located outside of proximal promoter regions, in contrast to peaks without the motif, which are highly concentrated within 1.5 kb of the nearest transcription start site. Overall, our results indicate that Miz-1 may be directed in vivo to the novel motif sequences we have identified, where it can recruit its specific binding partners to control gene expression and ultimately regulate cell fate.

  13. FOREWORD: International determination of the Avogadro constant International determination of the Avogadro constant

    Science.gov (United States)

    Massa, Enrico; Nicolaus, Arnold

    2011-04-01

    This issue of Metrologia collects papers about the results of an international research project aimed at the determination of the Avogadro constant, NA, by counting the atoms in a silicon crystal highly enriched with the isotope 28Si. Fifty years ago, Egidi [1] thought about realizing an atomic mass standard. In 1965, Bonse and Hart [2] operated the first x-ray interferometer, thus paving the way to the achievement of Egidi's dream, and soon Deslattes et al [3] completed the first counting of the atoms in a natural silicon crystal. The present project, outlined by Zosi [4] in 1983, began in 2004 by combining the experiences and capabilities of the BIPM, INRIM, IRMM, NIST, NPL, NMIA, NMIJ and PTB. The start signal, ratified by a memorandum of understanding, was a contract for the production of a silicon crystal highly enriched with 28Si. The enrichment process was undertaken by the Central Design Bureau of Machine Building in St Petersburg. Subsequently, a polycrystal was grown in the Institute of Chemistry of High-Purity Substances of the Russian Academy of Sciences in Nizhny Novgorod and a 28Si boule was grown and purified by the Leibniz-Institut für Kristallzüchtung in Berlin. Isotope enrichment made it possible to apply isotope dilution mass spectroscopy, to determine the Avogadro constant with unprecedented accuracy, and to fulfil Egidi's dream. To convey Egidi's 'fantasy' into practice, two 28Si kilogram prototypes shaped as quasi-perfect spheres were manufactured by the Australian Centre for Precision Optics; their isotopic composition, molar mass, mass, volume, density and lattice parameter were accurately determined and their surfaces were chemically and physically characterized at the atomic scale. The paper by Andreas et al reviews the work carried out; it collates all the findings and illustrates how Avogadro's constant was obtained. Impurity concentration and gradients in the enriched crystal were measured by infrared spectroscopy and taken into

  14. Retrospective analysis in oculocutaneous albinism patients for the 2.7 kb deletion in theOCA2gene revealed a co-segregation of the controversial variant, p.R305W.

    Science.gov (United States)

    Gao, Jackson; D'Souza, Leera; Wetherby, Keith; Antolik, Christian; Reeves, Melissa; Adams, David R; Tumminia, Santa; Wang, Xinjing

    2017-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. A significant portion of OCA patients has been found with a single pathogenic variant either in the TYR or the OCA2 gene. Diagnostic sequencing of the TYR and OCA2 genes is routinely used for molecular diagnosis of OCA subtypes. To study the possibility that genomic abnormalities with single or multiple exon involvement may account for a portion of the potential missing pathogenic variants (the second), we retrospectively analyzed the TYR gene by long range PCR and analyzed the target 2.7 kb deletion in the OCA2 gene spanning exon 7 in OCA patients with a single pathogenic variant in the target genes. In the 108 patients analyzed, we found that one patient was heterozygous for the 2.7 kb OCA2 gene deletion and this patient was positive with one pathogenic variant and one possibly pathogenic variant [c.1103C>T (p.Ala368Val) + c.913C>T (p.R305W)]. Further analysis of maternal DNA, and two additional OCA DNA homozygous for the 2.7 kb deletion, revealed that the phenotypically normal mother is heterozygous of the 2.7 kb deletion and homozygous of the p.R305W. The two previously reported patients with homozygous of the 2.7 kb deletion are also homozygous of p.R305W. Among the reported pathogenic variants, the pathogenicity of the p.R305W has been discussed intensively in literature. Our results indicate that p.R305W is unlikely a pathogenic variant. The possibility of linkage disequilibrium between p.R305W with the 2.7 kb deletion in OCA2 gene is also suggested.

  15. Seed viability constants for Eucalyptus grandis Constantes de viabilidade para sementes de Eucalyptus grandis

    Directory of Open Access Journals (Sweden)

    Jussara Bertho Fantinatti

    2007-01-01

    Full Text Available This work aimed to analyse Eucalyptus grandis W.Hill ex Maiden seed behaviour, under controlled deterioration, and to estimate viability equation constants for the species. Seeds were harvested in the growing season of 1999, and the moisture contents were adjusted from 11.3% to a range between 1.2 and 18.1% at 25ºC. The subsamples were sealed into laminate aluminium-foil packets, for storage in incubators at 40, 50 and 65±0.5ºC. The seeds presented orthodox performance, in which the constants for predicting seed longevity of E. grandis were K E = 9.661, C W = 6.467, C H = 0.03498 and C Q = 0.0002330. The usual and inverse relationship between water content and seed longevity was also observed. The lowest moisture content limit for application of the viability equation at 65ºC was 4.9%, estimated under hygroscopic equilibrium with 23% of relative humidity in the storage environment.Este trabalho teve como objetivos verificar o desempenho de sementes de Eucalyptus grandis W.Hill ex Maiden, após a deterioração em condições controladas, e obter as constantes da equação de viabilidade. As sementes foram colhidas na safra de 1999, e a umidade foi ajustada de 11,3% para valores entre 1,2 e 18,1% a 25ºC As subamostras foram acondicionadas em embalagens de alumínio termossoldadas, armazenadas a 40, 50 e 65±0,5ºC. As sementes apresentaram um desempenho ortodoxo em relação ao armazenamento. As constantes para a predição da longevidade foram K E = 9,661, C W = 6,467, C H = 0,03498 e C Q = 0,0002330. Foi observada a relação inversa entre teor de água e longevidade. O limite inferior de grau de umidade, calculado para aplicação da equação a 65ºC, foi de 4,9%, estimativa obtida sob equilíbrio higroscópico com umidade relativa de 23% no ambiente de armazenamento.

  16. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. A2AR Binding Kinetics in the Ligand Depletion Regime.

    Science.gov (United States)

    McNeely, Patrick M; Naranjo, Andrea N; Forsten-Williams, Kimberly; Robinson, Anne Skaja

    2017-02-01

    Ligand binding plays a fundamental role in stimulating the downstream signaling of membrane receptors. Here, ligand-binding kinetics of the full-length human adenosine A 2A receptor (A 2A R) reconstituted in detergent micelles were measured using a fluorescently labeled ligand via fluorescence anisotropy. Importantly, to optimize the signal-to-noise ratio, these experiments were conducted in the ligand depletion regime. In the ligand depletion regime, the assumptions used to determine analytical solutions for one-site binding models for either one or two ligands in competition are no longer valid. We therefore implemented a numerical solution approach to analyze kinetic binding data as experimental conditions approach the ligand depletion regime. By comparing the results from the numerical and the analytical solutions, we highlight the ligand-receptor ratios at which the analytical solution begins to lose predictive accuracy. Using the numerical solution approach, we determined the kinetic rate constants of the fluorescent ligand, FITC-APEC, and those for three unlabeled ligands using competitive association experiments. The association and dissociation rate constants of the unlabeled ligands determined from the competitive association experiments were then independently validated using competitive dissociation data. Based on this study, a numerical solution is recommended to determine kinetic ligand-binding parameters for experiments conducted in the ligand-depletion regime.

  18. Binding affinity of surface functionalized gold nanoparticles to hydroxyapatite.

    Science.gov (United States)

    Ross, Ryan D; Roeder, Ryan K

    2011-10-01

    Gold nanoparticles (Au NPs) have been investigated for a number of biomedical applications, including drug and gene delivery vehicles, thermal ablation therapy, diagnostic sensors, and imaging contrast agents. Surface functionalization with molecular groups exhibiting calcium affinity can enable targeted delivery of Au NPs to calcified tissue, including damaged bone tissue. Therefore, the objective of this study was to investigate the binding affinity of functionalized Au NPs for targeted delivery to bone mineral, using hydroxyapatite (HA) crystals as a synthetic analog in vitro. Au NPs were synthesized to a mean particle size of 10-15 nm and surface functionalized with either L-glutamic acid, 2-aminoethylphosphonic acid, or alendronate, which exhibit a primary amine for binding gold opposite carboxylate, phosphonate, or bisphosphonate groups, respectively, for targeting calcium. Bisphosphonate functionalized Au NPs exhibited the most rapid binding kinetics and greatest binding affinity to HA, followed by glutamic acid and phosphonic acid. All functional groups reached complete binding after 24 h. Equilibrium binding constants in de-ionized water, determined by nonlinear regression of Langmuir isotherms, were 3.40, 0.69, and 0.25 mg/L for bisphosphonate, carboxylate, and phosphonate functionalized Au NPs, respectively. Functionalized Au NPs exhibited lower overall binding in fetal bovine serum compared to de-ionized water, but relative differences between functional groups were similar. Copyright © 2011 Wiley Periodicals, Inc.

  19. Thermodynamics of sequence-specific binding of PNA to DNA

    DEFF Research Database (Denmark)

    Ratilainen, T; Holmén, A; Tuite, E

    2000-01-01

    For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes) and seq......For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes......) and sequence specificity of binding (singly mismatched duplexes) using mainly absorption hypochromicity melting curves and isothermal titration calorimetry. For perfectly sequence-matched duplexes of varying lengths (6-20 bp), the average free energy of binding (DeltaG degrees ) was determined to be -6...... relative to that of the perfectly matched sequence with a corresponding free energy penalty of about 15 kJ mol(-1) bp(-1). The average cost of a single mismatch is therefore estimated to be on the order of or larger than the gain of two matched base pairs, resulting in an apparent binding constant of only...

  20. Human chorionic ganodotropin binding sites in the human endometrium

    International Nuclear Information System (INIS)

    Bhattacharya, S.; Banerjee, J.; Sen, S.; Manna, P.R.

    1993-01-01

    The existence of high-affinity and low-capacity specific binding sites for luteinizing hormone/human chorionic gonadotropin (hCG) has been reported in porcine, rabbit and rat uteri. The authors have identified the hCG binding sites in the human endometrium collected from 35-42-year-old ovulatory and anovulatory women. The binding characteristics of hCG to endometrial tissue preparations from ovulatory and anovulatory women showed saturability with high affinity and low capacity. Scatchard plot analysis showed the dissociation constant of specific binding sites in the ovulatory women to be 3.5x10 -10 mol/l and in anovulatory women to be 3.1x10 -10 mol/l. The maximum binding capacity varied considerably between ovulatory and anovulatory endometrium. Among the divalent metal ions tested Zn 2+ effected a remarkable increase in [ 125 I]hCG binding to the endometrium, whereas Mn 2+ showed a marginal increase and other metal ions did not have any effect. Data obtained with human endometrium indicate an influence of the functional state of the ovary on [ 125 I]hCG binding to endometrium. 14 refs., 3 figs