WorldWideScience

Sample records for binding constant kb

  1. Disruption of a -35kb enhancer impairs CTCF binding and MLH1 expression in colorectal cells.

    Science.gov (United States)

    Liu, Qing; Thoms, Julie A; Nunez, Andrea C; Huang, Yizhou; Knezevic, Kathy; Packham, Deborah; Poulos, Rebecca C; Williams, Rachel; Beck, Dominik; Hawkins, Nicholas J; Ward, Robyn L; Wong, Jason W H; Hesson, Luke B; Sloane, Mathew A; Pimanda, John

    2018-06-13

    MLH1 is a major tumour suppressor gene involved in the pathogenesis of Lynch syndrome and various sporadic cancers. Despite their potential pathogenic importance, genomic regions capable of regulating MLH1 expression over long distances have yet to be identified. Here we use chromosome conformation capture (3C) to screen a 650-kb region flanking the MLH1 locus to identify interactions between the MLH1 promoter and distal regions in MLH1 expressing and non-expressing cells. Putative enhancers were functionally validated using luciferase reporter assays, chromatin immunoprecipitation and CRISPR-Cas9 mediated deletion of endogenous regions. To evaluate whether germline variants in the enhancer might contribute to impaired MLH1 expression in patients with suspected Lynch syndrome, we also screened germline DNA from a cohort of 74 patients with no known coding mutations or epimutations at the MLH1 promoter. A 1.8kb DNA fragment, 35kb upstream of the MLH1 transcription start site enhances MLH1 gene expression in colorectal cells. The enhancer was bound by CTCF and CRISPR-Cas9 mediated deletion of a core binding region impairs endogenous MLH1 expression. 5.4% of suspected Lynch syndrome patients have a rare single nucleotide variant (G>A; rs143969848; 2.5% in gnomAD European, non-Finnish) within a highly conserved CTCF binding motif, which disrupts enhancer activity in SW620 colorectal carcinoma cells. A CTCF bound region within the MLH1 -35 enhancer regulates MLH1 expression in colorectal cells and is worthy of scrutiny in future genetic screening strategies for suspected Lynch syndrome associated with loss of MLH1 expression. Copyright ©2018, American Association for Cancer Research.

  2. Interactions of Poly(amidoamine) Dendrimers with Human Serum Albumin: Binding Constants and Mechanisms

    OpenAIRE

    Giri, Jyotsnendu; Diallo, Mamadou S.; Simpson, André J.; Liu, Yi; Goddard, William A., III; Kumar, Rajeev; Woods, Gwen C.

    2011-01-01

    The interactions of nanomaterials with plasma proteins have a significant impact on their in vivo transport and fate in biological fluids. This article discusses the binding of human serum albumin (HSA) to poly(amidoamine) [PAMAM] dendrimers. We use protein-coated silica particles to measure the HSA binding constants (K_b) of a homologous series of 19 PAMAM dendrimers in aqueous solutions at physiological pH (7.4) as a function of dendrimer generation, terminal group, and core chemistry. To g...

  3. Interactions of poly(amidoamine) dendrimers with human serum albumin: binding constants and mechanisms.

    Science.gov (United States)

    Giri, Jyotsnendu; Diallo, Mamadou S; Simpson, André J; Liu, Yi; Goddard, William A; Kumar, Rajeev; Woods, Gwen C

    2011-05-24

    The interactions of nanomaterials with plasma proteins have a significant impact on their in vivo transport and fate in biological fluids. This article discusses the binding of human serum albumin (HSA) to poly(amidoamine) [PAMAM] dendrimers. We use protein-coated silica particles to measure the HSA binding constants (K(b)) of a homologous series of 19 PAMAM dendrimers in aqueous solutions at physiological pH (7.4) as a function of dendrimer generation, terminal group, and core chemistry. To gain insight into the mechanisms of HSA binding to PAMAM dendrimers, we combined (1)H NMR, saturation transfer difference (STD) NMR, and NMR diffusion ordered spectroscopy (DOSY) of dendrimer-HSA complexes with atomistic molecular dynamics (MD) simulations of dendrimer conformation in aqueous solutions. The binding measurements show that the HSA binding constants (K(b)) of PAMAM dendrimers depend on dendrimer size and terminal group chemistry. The NMR (1)H and DOSY experiments indicate that the interactions between HSA and PAMAM dendrimers are relatively weak. The (1)H NMR STD experiments and MD simulations suggest that the inner shell protons of the dendrimers groups interact more strongly with HSA proteins. These interactions, which are consistently observed for different dendrimer generations (G0-NH(2)vs G4-NH(2)) and terminal groups (G4-NH(2)vs G4-OH with amidoethanol groups), suggest that PAMAM dendrimers adopt backfolded configurations as they form weak complexes with HSA proteins in aqueous solutions at physiological pH (7.4).

  4. Semi-empirical proton binding constants for natural organic matter

    Science.gov (United States)

    Matynia, Anthony; Lenoir, Thomas; Causse, Benjamin; Spadini, Lorenzo; Jacquet, Thierry; Manceau, Alain

    2010-03-01

    Average proton binding constants ( KH,i) for structure models of humic (HA) and fulvic (FA) acids were estimated semi-empirically by breaking down the macromolecules into reactive structural units (RSUs), and calculating KH,i values of the RSUs using linear free energy relationships (LFER) of Hammett. Predicted log KH,COOH and log KH,Ph-OH are 3.73 ± 0.13 and 9.83 ± 0.23 for HA, and 3.80 ± 0.20 and 9.87 ± 0.31 for FA. The predicted constants for phenolic-type sites (Ph-OH) are generally higher than those derived from potentiometric titrations, but the difference may not be significant in view of the considerable uncertainty of the acidity constants determined from acid-base measurements at high pH. The predicted constants for carboxylic-type sites agree well with titration data analyzed with Model VI (4.10 ± 0.16 for HA, 3.20 ± 0.13 for FA; Tipping, 1998), the Impermeable Sphere model (3.50-4.50 for HA; Avena et al., 1999), and the Stockholm Humic Model (4.10 ± 0.20 for HA, 3.50 ± 0.40 for FA; Gustafsson, 2001), but differ by about one log unit from those obtained by Milne et al. (2001) with the NICA-Donnan model (3.09 ± 0.51 for HA, 2.65 ± 0.43 for FA), and used to derive recommended generic values. To clarify this ambiguity, 10 high-quality titration data from Milne et al. (2001) were re-analyzed with the new predicted equilibrium constants. The data are described equally well with the previous and new sets of values ( R2 ⩾ 0.98), not necessarily because the NICA-Donnan model is overparametrized, but because titration lacks the sensitivity needed to quantify the full binding properties of humic substances. Correlations between NICA-Donnan parameters are discussed, but general progress is impeded by the unknown number of independent parameters that can be varied during regression of a model fit to titration data. The high consistency between predicted and experimental KH,COOH values, excluding those of Milne et al. (2001), gives faith in the proposed

  5. Simultaneous Determination of Binding Constants for Multiple Carbohydrate Hosts in Complex Mixtures

    DEFF Research Database (Denmark)

    Meier, Sebastian; Beeren, Sophie

    2014-01-01

    We describe a simple method for the simultaneous determination of association constants for a guest binding to seven different hosts in a mixture of more than 20 different oligosaccharides. If the binding parameters are known for one component in the mixture, a single NMR titration suffices...

  6. Effect of the dielectric constant of mesoscopic particle on the exciton binding energy

    International Nuclear Information System (INIS)

    Lai Zuyou; Gu Shiwei

    1991-09-01

    For materials with big exciton reduced mass and big dielectric constant, such as TiO 2 , the variation of dielectric constant with the radius of an ultrafine particle (UFP) is important for determining the exciton binding energy. For the first time a phenomenological formula of the dielectric constant of a UFP with its radius in mesoscopic range is put forward in order to explain the optical properties of TiO 2 UFP. (author). 22 refs, 3 figs, 1 tab

  7. Antibody binding constants from Farr test and other radioimmunoassays. A theoretical and experimental analysis

    International Nuclear Information System (INIS)

    Engel, J.; Schalch, W.

    1980-01-01

    For the reaction of monovalently reacting antibody (116-700pIEF) with its antigen (streptococcal group A-variant polysaccharide), an apparent binding constant Ksub(a) was derived by the ammonium sulfate precipitation technique (Farr assay) which was 40 times larger than the true binding constant K = 10 6 M -1 determined by fluorescence titration and equilibrium dialysis. For monovalently reacting antibodies the time needed for re-equilibration of the binding reaction is short as compared to the time of ammonium sulfate incubation. A thermodynamic analysis was therefore performed for the case of complete equilibration of all components in solution and in the ammonium sulfate precipitate. It was found that in this limiting case Ksub(a)/K is equal to the ratio of the solubilities of the antibody and the antibody complex corrected by the activity coefficients of the components in the precipitate. For other antibody-antigen reactions in which the antibody reacts with both binding sites to the same antigen molecule, re-equilibration of the binding reaction in solution is much slower. For such systems a disturbance of the binding reaction by the precipitation is less likely and correct binding constants may be obtained by the Farr technique or other radioimmunoassays involving precipitation. (author)

  8. Binding constants of Southern rice black-streaked dwarf virus Coat Protein with ferulic acid derivatives

    Directory of Open Access Journals (Sweden)

    Longlu Ran

    2018-04-01

    Full Text Available The data present binding constants between ferulic acid derivatives and the Coat Protein (P10 by fluorescence titration in this article, which is hosted in the research article entitled “Interaction Research on an Antiviral Molecule that Targets the Coat Protein of Southern rice black-streaked dwarf virus’’ (Ran et al., 2017 [1]. The data include fluorescence quenching spectrum, Stern–Volmer quenching constants, and binding parameters. In this article, a more comprehensive data interpretation and analysis is explained.

  9. The +37 kb Cebpa Enhancer Is Critical for Cebpa Myeloid Gene Expression and Contains Functional Sites that Bind SCL, GATA2, C/EBPα, PU.1, and Additional Ets Factors

    Science.gov (United States)

    Cooper, Stacy; Guo, Hong; Friedman, Alan D.

    2015-01-01

    The murine Cebpa gene contains an evolutionarily conserved 453 bp enhancer located at +37 kb that, together with its promoter, directs expression to myeloid progenitors and to long-term hematopoietic stem cells in transgenic mice. In human acute myeloid leukemia cases, the enhancer lacks point mutations but binds the RUNX1-ETO oncoprotein. The enhancer contains the H3K4me1 and H3K27Ac histone modifications, denoting an active enhancer, at progressively increasing levels as long-term hematopoietic stem cells transition to granulocyte-monocyte progenitors. We previously identified four enhancer sites that bind RUNX1 and demonstrated that their integrity is required for maximal enhancer activity in 32Dcl3 myeloid cells. The +37 kb Cebpa enhancer also contains C/EBP, Ets factor, Myb, GATA, and E-box consensus sites conserved in the human +42 kb CEBPA enhancer. Mutation of the two C/EBP, seven Ets, one Myb, two GATA, or two E-box sites reduces activity of an enhancer-promoter reporter in 32Dcl3 cells. In 293T gel shift assays, exogenous C/EBPα binds both C/EBP sites, c-Myb binds the Myb site, PU.1 binds the second Ets site, PU.1, Fli-1, ERG, and Ets1 bind the sixth Ets site, GATA2 binds both GATA sites, and SCL binds the second E-box. Endogenous hematopoietic RUNX1, PU.1, Fli-1, ERG, C/EBPα, GATA2, and SCL were previously shown to bind the enhancer, and we find that endogenous PU.1 binds the second Ets site in 32Dcl3 cells. Using CRISPR/Cas9, we developed 32Dcl3 lines in which the wild-type enhancer alleles are replaced with a variant mutant in the seven Ets sites. These lines have 20-fold reduced Cebpa mRNA when cultured in IL-3 or G-CSF, demonstrating a critical requirement for enhancer integrity for optimal Cebpa expression. In addition, these results indicate that the +37 kb Cebpa enhancer is the focus of multiple regulatory transcriptional pathways that impact its expression during normal hematopoiesis and potentially during myeloid transformation. PMID:25938608

  10. Palmitate and stearate binding to human serum albumin. Determination of relative binding constants

    DEFF Research Database (Denmark)

    Vorum, H; Fisker, K; Honoré, B

    1997-01-01

    Multiple binding equilibria of two apparently insoluble ligands, palmitate and stearate, to defatted human serum albumin were studied in a 66 mM sodium phosphate buffer (pH 7.4) at 37 degrees C, by determination of dialytic exchange rates of ligands among identical equilibrium solutions. The expe...

  11. KB WOT Fisheries 2017

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is developed to maintain and advance the expertise needed to carry out the statutory obligations in fisheries monitoring and advice of The Netherlands. The contents of the KB WOT Fisheries programme for 2017 reflects the scientific and management needs of the WOT

  12. Binding Of Ferrocyphen By Sds, Ctab And Triton X-100 In Water ...

    African Journals Online (AJOL)

    SDS), cetyltrimethylammonium bromide (CTAB) and Triton X-100 surfactants was studied spectrophotometrically in water-ethanol medium. The equilibrium binding constant (Kb) and the number of binding sites (n) per surfactant monomer were ...

  13. Iron hexacyanide/cytochrome-C - intramolecular electron transfer and binding constants - (pulse radiolytic study). Progress report

    International Nuclear Information System (INIS)

    Ilan, Y.; Shafferman, A.

    Internal oxidation and reduction rates of horse cytochrome-c in the complexes, CII.Fe/sup III/(CN) -3 6 and CIII.Fe/sup II/(CN) -4 6 , are 4.6.10 4 s -1 and 3.3.10 2 s -1 , respectively. The binding sites of the iron hexacyanide ions on either CII or CIII are kinetically almost indistinguishable; binding constants range from 0.87.10 3 to 2.10 3 M -1 . The present pulse radiolytic kinetic data are compared with that from N.M.R, T-jump and equilibrium dialysis studies

  14. Determination of binding constants of cyclodextrin inclusion complexes with amino acids and dipeptides by potentiometric titration.

    Science.gov (United States)

    Kahle, Claudia; Holzgrabe, Ulrike

    2004-10-01

    Cyclodextrins are well known for their ability to separate enantiomers of drugs, natural products, and other chiral substances using HPLC, GC, or CE. The resolution of the enantiomers is due to the formation of diastereomeric complexes between the cyclodextrin and the pairs of enantiomers. The aim of this study was to determine the binding constants of the complexes between alpha- and beta-cyclodextrin and the enantiomers of a series of aliphatic and aromatic amino acids, and dipeptides, using a potentiometric titration method. The results of this method are compared to other methods, and correlated to findings in cyclodextrin-modified capillary electrophoresis and possible complex structures. Potentiometric titration was found to be an appropriate tool to determine the binding constants of cyclodextrin inclusion complexes.

  15. Computational Approaches to the Chemical Equilibrium Constant in Protein-ligand Binding.

    Science.gov (United States)

    Montalvo-Acosta, Joel José; Cecchini, Marco

    2016-12-01

    The physiological role played by protein-ligand recognition has motivated the development of several computational approaches to the ligand binding affinity. Some of them, termed rigorous, have a strong theoretical foundation but involve too much computation to be generally useful. Some others alleviate the computational burden by introducing strong approximations and/or empirical calibrations, which also limit their general use. Most importantly, there is no straightforward correlation between the predictive power and the level of approximation introduced. Here, we present a general framework for the quantitative interpretation of protein-ligand binding based on statistical mechanics. Within this framework, we re-derive self-consistently the fundamental equations of some popular approaches to the binding constant and pinpoint the inherent approximations. Our analysis represents a first step towards the development of variants with optimum accuracy/efficiency ratio for each stage of the drug discovery pipeline. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Mobility-based correction for accurate determination of binding constants by capillary electrophoresis-frontal analysis.

    Science.gov (United States)

    Qian, Cheng; Kovalchik, Kevin A; MacLennan, Matthew S; Huang, Xiaohua; Chen, David D Y

    2017-06-01

    Capillary electrophoresis frontal analysis (CE-FA) can be used to determine binding affinity of molecular interactions. However, its current data processing method mandate specific requirement on the mobilities of the binding pair in order to obtain accurate binding constants. This work shows that significant errors are resulted when the mobilities of the interacting species do not meet these requirements. Therefore, the applicability of CE-FA in many real word applications becomes questionable. An electrophoretic mobility-based correction method is developed in this work based on the flux of each species. A simulation program and a pair of model compounds are used to verify the new equations and evaluate the effectiveness of this method. Ibuprofen and hydroxypropyl-β-cyclodextrinare used to demonstrate the differences in the obtained binding constant by CE-FA when different calculation methods are used, and the results are compared with those obtained by affinity capillary electrophoresis (ACE). The results suggest that CE-FA, with the mobility-based correction method, can be a generally applicable method for a much wider range of applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Calculation of elastic constants of BCC transition metals: tight-binding recursion method

    International Nuclear Information System (INIS)

    Masuda, K.; Hamada, N.; Terakura, K.

    1984-01-01

    The elastic constants of BCC transition metals (Fe, Nb, Mo and W) are calculated by using the tight-binding d band and the Born-Mayer repulsive potential. Introducing a small distortion characteristic to C 44 (or C') elastic deformation and calculating the energy change up to second order in the atomic displacement, the shear elastic constants C 44 and C' are determined. The elastic constants C 11 and C 12 are then calculated by using the relations B=1/3(C 11 + 2C 12 ) and C'=1/2(C 11 -C 12 ), where B is the bulk modulus. In general, the agreement between the present results and the experimental values is satisfactory. The characteristic elasticity behaviour, i.e. the strong Nsub(d) (number of d electrons) dependence of the observed anisotropy factor A=C 44 /C', will also be discussed. (author)

  18. Application of quantitative structure-activity relationship to the determination of binding constant based on fluorescence quenching

    Energy Technology Data Exchange (ETDEWEB)

    Wen Yingying [Department of Applied Chemistry, Yantai University, Yantai 264005 (China); Liu Huitao, E-mail: liuht-ytu@163.co [Department of Applied Chemistry, Yantai University, Yantai 264005 (China); Luan Feng; Gao Yuan [Department of Applied Chemistry, Yantai University, Yantai 264005 (China)

    2011-01-15

    Quantitative structure-activity relationship (QSAR) model was used to predict and explain binding constant (log K) determined by fluorescence quenching. This method allowed us to predict binding constants of a variety of compounds with human serum albumin (HSA) based on their structures alone. Stepwise multiple linear regression (MLR) and nonlinear radial basis function neural network (RBFNN) were performed to build the models. The statistical parameters provided by the MLR model (R{sup 2}=0.8521, RMS=0.2678) indicated satisfactory stability and predictive ability while the RBFNN predictive ability is somewhat superior (R{sup 2}=0.9245, RMS=0.1736). The proposed models were used to predict the binding constants of two bioactive components in traditional Chinese medicines (isoimperatorin and chrysophanol) whose experimental results were obtained in our laboratory and the predicted results were in good agreement with the experimental results. This QSAR approach can contribute to a better understanding of structural factors of the compounds responsible for drug-protein interactions, and can be useful in predicting the binding constants of other compounds. - Research Highlights: QSAR models for binding constants of some compounds to HSA were developed. The models provide a simple and straightforward way to predict binding constant. QSAR can give some insight into structural features related to binding behavior.

  19. Signatures of van der Waals binding: A coupling-constant scaling analysis

    Science.gov (United States)

    Jiao, Yang; Schröder, Elsebeth; Hyldgaard, Per

    2018-02-01

    The van der Waals (vdW) density functional (vdW-DF) method [Rep. Prog. Phys. 78, 066501 (2015), 10.1088/0034-4885/78/6/066501] describes dispersion or vdW binding by tracking the effects of an electrodynamic coupling among pairs of electrons and their associated exchange-correlation holes. This is done in a nonlocal-correlation energy term Ecnl, which permits density functional theory calculation in the Kohn-Sham scheme. However, to map the nature of vdW forces in a fully interacting materials system, it is necessary to also account for associated kinetic-correlation energy effects. Here, we present a coupling-constant scaling analysis, which permits us to compute the kinetic-correlation energy Tcnl that is specific to the vdW-DF account of nonlocal correlations. We thus provide a more complete spatially resolved analysis of the electrodynamical-coupling nature of nonlocal-correlation binding, including vdW attraction, in both covalently and noncovalently bonded systems. We find that kinetic-correlation energy effects play a significant role in the account of vdW or dispersion interactions among molecules. Furthermore, our mapping shows that the total nonlocal-correlation binding is concentrated to pockets in the sparse electron distribution located between the material fragments.

  20. Binding Constant of Amines to Water/AOT/n-Hexene Reverse Micelles. Influence of the Chemical Structure

    Directory of Open Access Journals (Sweden)

    J. J. Silber

    2000-03-01

    Full Text Available The distribution of different amines between n-hexane bulk and the micellar pseudophase of AOT reverse micelles were measured by a fluorometric method. An independent method was used to corroborate the incorporation of the amines to the interface. The effect of the amine structure on the binding constant was analysed.

  1. Binding constants of membrane-anchored receptors and ligands: A general theory corroborated by Monte Carlo simulations.

    Science.gov (United States)

    Xu, Guang-Kui; Hu, Jinglei; Lipowsky, Reinhard; Weikl, Thomas R

    2015-12-28

    Adhesion processes of biological membranes that enclose cells and cellular organelles are essential for immune responses, tissue formation, and signaling. These processes depend sensitively on the binding constant K2D of the membrane-anchored receptor and ligand proteins that mediate adhesion, which is difficult to measure in the "two-dimensional" (2D) membrane environment of the proteins. An important problem therefore is to relate K2D to the binding constant K3D of soluble variants of the receptors and ligands that lack the membrane anchors and are free to diffuse in three dimensions (3D). In this article, we present a general theory for the binding constants K2D and K3D of rather stiff proteins whose main degrees of freedom are translation and rotation, along membranes and around anchor points "in 2D," or unconstrained "in 3D." The theory generalizes previous results by describing how K2D depends both on the average separation and thermal nanoscale roughness of the apposing membranes, and on the length and anchoring flexibility of the receptors and ligands. Our theoretical results for the ratio K2D/K3D of the binding constants agree with detailed results from Monte Carlo simulations without any data fitting, which indicates that the theory captures the essential features of the "dimensionality reduction" due to membrane anchoring. In our Monte Carlo simulations, we consider a novel coarse-grained model of biomembrane adhesion in which the membranes are represented as discretized elastic surfaces, and the receptors and ligands as anchored molecules that diffuse continuously along the membranes and rotate at their anchor points.

  2. Estimation of apparent binding constant of complexes of selected acyclic nucleoside phosphonates with beta-cyclodextrin by affinity capillary electrophoresis

    Czech Academy of Sciences Publication Activity Database

    Šolínová, Veronika; Mikysková, Hana; Kaiser, Martin Maxmilian; Janeba, Zlatko; Holý, Antonín; Kašička, Václav

    2016-01-01

    Roč. 37, č. 2 (2016), s. 239-247 ISSN 0173-0835 R&D Projects: GA ČR(CZ) GA13-17224S; GA ČR(CZ) GA15-01948S Institutional support: RVO:61388963 Keywords : acyclic nucleoside phosphonates * affinity capillary electrophoresis * binding constant * nucleotide analogs * beta-cyclodextrin Subject RIV: CB - Analytical Chemistry , Separation Impact factor: 2.744, year: 2016

  3. DNA unwinding induced by photoaddition of psoralen derivatives and determination of dark-binding equilibrium constants by gel electrophoresis

    International Nuclear Information System (INIS)

    Wiesehahn, G.; Hearst, J.E.

    1978-01-01

    Derivatives of furo[3,2-g]coumarin (psoralen) can bind to the DNA double helix and, in the presence of long-wavelength uv light, the bound psoralen may react covalently with pyrimidine residues on one or both strands of the helix. By using agarose gel electrophoresis, we have determined the unwinding angle associated with each of four different psoralen derivatives to be 28 0 +- 4 0 . For 4,5',8-trimethylpsoralen (trioxsalen) the unwinding angle was found to be independent of the initial DNA superhelix density in the range that is accessible to agarose gel electrophoresis. Also by using agarose gel electrophoresis, we have determined the unwinding angle for ethidium intercalation. This was done by the total relaxation of supercoiled DNA in the presence of a series of ethidium concentrations. By using published values for the association constant for ethidium binding to DNA and evaluating the final superhelix density (after removal of ethidium) of the DNA on gels, we calculated an unwinding angle of 29 0 +- 3 0 . Assuming an unwinding angle of 28 0 for the noncovalent intercalation of psoralen derivatives, we used the same procedure to determine intercalation binding constants. The association constants for 4'-aminomethyltrioxsalen were 300 to 1400 M -1 in NaCl at 0.2 to 0.05 M and 300 to 2500 M -1 in Mg 2+ at 4 to 0.5 mM. The association constant for 4'-hydroxymethyltrioxsalen in 0.5 mM Mg 2+ was determined to be 70 M -1

  4. Improved estimation of receptor density and binding rate constants using a single tracer injection and displacement

    International Nuclear Information System (INIS)

    Syrota, A.; Delforge, J.; Mazoyer, B.M.

    1988-01-01

    The possibility of improving receptor model parameter estimation using a displacement experiment in which an excess of an unlabeled ligand (J) is injected after a delay (t D ) following injection of trace amounts of the β + - labeled ligand (J*) is investigated. The effects of varying t D and J/J* on parameter uncertainties are studied in the case of 11 C-MQNB binding to myocardial acetycholine receptor using parameters identified in a dog experiment

  5. Using electrophoretic mobility shift assays to measure equilibrium dissociation constants: GAL4-p53 binding DNA as a model system.

    Science.gov (United States)

    Heffler, Michael A; Walters, Ryan D; Kugel, Jennifer F

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K(D) ) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel; the DNA migrates more slowly when bound to a protein. To determine a K(D) the amount of unbound and protein-bound DNA in the gel is measured as the protein concentration increases. By performing this experiment, students will be introduced to making affinity measurements and gain experience in performing quantitative EMSAs. The experiment describes measuring the K(D) for the interaction between the chimeric protein GAL4-p53 and its DNA recognition site; however, the techniques are adaptable to other DNA binding proteins. In addition, the basic experiment described can be easily expanded to include additional inquiry-driven experimentation. © 2012 by The International Union of Biochemistry and Molecular Biology. Copyright © 2012 Wiley Periodicals, Inc.

  6. Flexible Acyclic Polyol-Chloride Anion Complexes and Their Characterization by Photoelectron Spectroscopy and Variable Temperature Binding Constant Determinations

    Energy Technology Data Exchange (ETDEWEB)

    Shokri, Alireza; Wang, Xue B.; Wang, Yangping; O' Doherty, George A.; Kass, Steven R.

    2016-03-17

    Flexible acyclic alcohols with 1–5 hydroxyl groups were bound to chloride anion and these complexes were interrogated by negative ion photoelectron spectroscopy and companion density functional theory computations. The resulting vertical detachment energies are reproduced on average to 0.10 eV by M06-2X/aug-cc-pVTZ predictions and range from 4.45 – 5.96 eV. These values are 0.84 – 2.35 eV larger than the adiabatic detachment energy of Cl– as a result of the larger hydrogen bond networks in the bigger polyols. Adiabatic detachment energies of the alcohol–Cl– clusters are more difficult to determine both experimentally and computationally. This is due to the large geometry changes that occur upon photodetachment and the large bond dissociation energy of H–Cl which enables the resulting chlorine atom to abstract a hydrogen from any of the methylene (CH2) or methine (CH) positions. Both ionic and non-ionic hydrogen bonds (i.e., OH•••Cl– and OH•••OH•••Cl–) form in the larger polyols complexes, and are found to be energetically comparable. Subtle structural differences, consequently can lead to the formation of different types of hydrogen bonds and maximizing the ionic ones is not always preferred. Solution equilibrium binding constants between the alcohols and tetrrabuylammonium chloride (TBACl) in acetonitrile at -24.2, 22.0, and 53.6 °C were also determined. The free energies of association are nearly identical for all of the substrates (i.e., ΔG° = -2.8 ± 0.7 kcal mol–1). Compensating enthalpy and entropy values reveal, contrary to expectation and the intrinsic gas-phase preferences, that the bigger systems with more hydroxyl groups are entropically favored and enthalpically disfavored relative to the smaller species. This suggests that more solvent molecules are released upon binding TBACl to alcohols with more hydroxyl groups and is consistent with the measured negative heat capacities. These quantities increase with

  7. A model of mitochondrial creatine kinase binding to membranes: adsorption constants, essential amino acids and the effect of ionic strength

    DEFF Research Database (Denmark)

    Fedosov, Sergey; Belousova, Lubov; Plesner, Igor

    1993-01-01

    The quantitative aspects of mitochondrial creatinekinase (mitCK) binding to mitochondrial membranes were investigated. A simple adsorption and binding model was used for data fitting, taking into account the influence of protein concentration, pH, ionic strength and substrate concentration on the...

  8. Identification and characterization of survivin-derived H-2Kb-restricted CTL epitopes

    DEFF Research Database (Denmark)

    Hofmann, Uta B; Voigt, Heike; Andersen, Mads H

    2009-01-01

    for potential binding K(b)-restricted octamer peptide epitopes. Two epitopes, which bind strongly to K(b), were selected to test their immunogenicity in vivo. Spleen cells from mice vaccinated by intradermal injection of mature DC pulsed with these peptides displayed reactivity to the respective epitopes...

  9. Semi-empirical spectrophotometric (SESp) method for the indirect determination of the ratio of cationic micellar binding constants of counterions X⁻ and Br⁻(K(X)/K(Br)).

    Science.gov (United States)

    Khan, Mohammad Niyaz; Yusof, Nor Saadah Mohd; Razak, Norazizah Abdul

    2013-01-01

    The semi-empirical spectrophotometric (SESp) method, for the indirect determination of ion exchange constants (K(X)(Br)) of ion exchange processes occurring between counterions (X⁻ and Br⁻) at the cationic micellar surface, is described in this article. The method uses an anionic spectrophotometric probe molecule, N-(2-methoxyphenyl)phthalamate ion (1⁻), which measures the effects of varying concentrations of inert inorganic or organic salt (Na(v)X, v = 1, 2) on absorbance, (A(ob)) at 310 nm, of samples containing constant concentrations of 1⁻, NaOH and cationic micelles. The observed data fit satisfactorily to an empirical equation which gives the values of two empirical constants. These empirical constants lead to the determination of K(X)(Br) (= K(X)/K(Br) with K(X) and K(Br) representing cationic micellar binding constants of counterions X and Br⁻). This method gives values of K(X)(Br) for both moderately hydrophobic and hydrophilic X⁻. The values of K(X)(Br), obtained by using this method, are comparable with the corresponding values of K(X)(Br), obtained by the use of semi-empirical kinetic (SEK) method, for different moderately hydrophobic X. The values of K(X)(Br) for X = Cl⁻ and 2,6-Cl₂C6H₃CO₂⁻, obtained by the use of SESp and SEK methods, are similar to those obtained by the use of other different conventional methods.

  10. Identification of MHC class I H-2 Kb/Db-restricted immunogenic peptides derived from retinal proteins

    DEFF Research Database (Denmark)

    Wang, Mingjun; Bai, Fang; Pries, Mette

    2006-01-01

    PURPOSE: To identify H-2 Kb/Db-binding immunogenic peptides derived from retinal proteins. METHODS: Computer-based prediction was used to identify potentially H-2 Kb/Db-binding peptides derived from the interphotoreceptor retinol-binding protein (IRBP), soluble retinal antigen (S...... on day 21 after immunization with IRBP or IRBP and the immunogenic peptides. RESULTS: All the 21 predicted peptides were found to upregulate expression of H-2 Kb/Db on RMA-S cells. Five peptides, the two IRBP-derived peptides IRBP89-96 and IRBP(101-108), and the three PEDF-derived peptides, PEDF389....... The immunogenic peptides alone did not induce inflammation in the eyes, but they could enhance severity of uveitis induced by IRBP. CONCLUSIONS: Five of 21 H-2 Kb/Db-binding retinal protein-derived peptides were found to be immunogenic, suggesting that these peptides could function as autoantigenic epitopes...

  11. 13C and 17O NMR binding constant studies of uranyl carbonate complexes in near-neutral aqueous solution. Yucca Mountain Project Milestone Report 3351

    International Nuclear Information System (INIS)

    Clark, D.L.; Newton, T.W.; Palmer, P.D.; Zwick, B.D.

    1995-01-01

    Valuable structural information, much of it unavailable by other methods, can be obtained about complexes in solution through NMR spectroscopy. From chemical shift and intensity measurements of complexed species, NMR can serve as a species-specific structural probe for molecules in solution and can be used to validate thermodynamic constants used in geochemical modeling. Fourier-transform nuclear magnetic resonance (FT-NMR) spectroscopy has been employed to study the speciation of uranium(VI) ions in aqueous carbonate solutions as a function of pH, ionic strength, carbonate concentration, uranium concentration, and temperature. Carbon-13 and oxygen-17 NMR spectroscopy were used to monitor the fractions, and hence thermodynamic binding constants of two different uranyl species U0 2 (CO 3 ) 3 4- and (UO 2 ) 3 (CO 3 ) 6 6- in aqueous solution. Synthetic buffer solutions were prepared under the ionic strength conditions used in the NMR studies in order to obtain an accurate measure of the hydrogen ion concentration, and a discussion of pH = -log(a H + ) versus p[H] = -log[H+] is provided. It is shown that for quantitative studies, the quantity p[H] needs to be used. Fourteen uranium(VI) binding constants recommended by the OECD NEA literature review were corrected to the ionic strengths employed in the NMR study using specific ion interaction theory (SIT), and the predicted species distributions were compared with the actual species observed by multinuclear NMR. Agreement between observed and predicted stability fields is excellent. This establishes the utility of multinuclear NMR as a species-specific tool for the study of the actinide carbonate complexation constants, and serves as a means for validating the recommendations provided by the OECD NEA

  12. The effect of dielectric constant on binding energy and impurity self-polarization in a GaAs-Ga1- x Al x As spherical quantum dot

    Science.gov (United States)

    Mese, A. I.; Cicek, E.; Erdogan, I.; Akankan, O.; Akbas, H.

    2017-03-01

    The ground state, 1s, and the excited state, 2p, energies of a hydrogenic impurity in a GaAs-Ga1- x Al x As spherical quantum dot, are computed as a function of the donor positions. We study how the impurity self-polarization depends on the location of the impurity and the dielectric constant. The excited state anomalous impurity self-polarization in the quantum dot is found to be present in the absence of any external influence and strongly depends on the impurity position and the radius of the dot. Therefore, the excited state anomalous impurity self-polarization can give information about the impurity position in the system. Also, the variation of E_{b1s} and E_{b2p} with the dielectric constant can be utilized as a tool for finding out the correct dielectric constant of the dot material by measuring the 1s or 2p state binding energy for a fixed dot radius and a fixed impurity position.

  13. A DSC study of zinc binding to bovine serum albumin (BSA

    Directory of Open Access Journals (Sweden)

    SANJA OSTOJIC

    2007-04-01

    Full Text Available The thermal denaturation of bovine serum albumin (BSA is a kinetically and thermodynamically controlled process. The effects of zinc binding to bovine serum albumin (BSA, followed by differential scanning calorimetry (DSC, were investigated in this work, with the purpose of obtaining a better understanding of the albumin/zinc interaction. From the DSC curves, the thermodynamic parameters of protein denaturation were obtained, i.e., the temperature of thermal transition maximum (Tm, calorimetric enthalpy (DHcal, van't Hoff enthalpy (DHvH, the number of binding sites (I, II, the binding constants for each binding site (KbI, KbII and the average number of ligands bound per mole of native protein XN. The thermodynamic data of protein unfolding showed that zinc binding to bovine serum albumin increases the stability of the protein (higher values of DHcal and the different ratio DHcal/DHvH indicates the perturbation of the protein during thermal denaturation.

  14. Pressure derivatives of elastic moduli of fused quartz to 10 kb

    Science.gov (United States)

    Peselnick, L.; Meister, R.; Wilson, W.H.

    1967-01-01

    Measurements of the longitudinal and shear moduli were made on fused quartz to 10 kb at 24??5??C. The anomalous behavior of the bulk modulus K at low pressure, ???K ???P 0, at higher pressures. The pressure derivative of the rigidity modulus ???G ???P remains constant and negative for the pressure range covered. A 15-kb hydrostatic pressure vessel is described for use with ultrasonic pulse instrumentation for precise measurements of elastic moduli and density changes with pressure. The placing of the transducer outside the pressure medium, and the use of C-ring pressure seals result in ease of operation and simplicity of design. ?? 1967.

  15. ARMed SPHINCS computing a 41KB signature in 16KB of RAM

    NARCIS (Netherlands)

    Hülsing, A.T.; Rijneveld, J.; Schwabe, P.; Cheng, C.-M.; Chung, K.-M.; Persiano, G.; Yang, B.-Y.

    2016-01-01

    This paper shows that it is feasible to implement the stateless hash-based signature scheme SPHINCS-256 on an embedded microprocessor with memory even smaller than a signature and limited computing power. We demonstrate that it is possible to generate and verify the 41KB signature on an ARM Cortex

  16. ARMed SPHINCS : computing a 41KB signature in 16KB of RAM

    NARCIS (Netherlands)

    Hülsing, A.T.; Rijneveld, J.; Schwabe, P.

    2015-01-01

    This paper shows that it is feasible to implement the stateless hash-based signature scheme SPHINCS-256 on a "very small device" with memory even smaller than a signature and limited computing power. We demonstrate that it is possible to generate and verify the 41\\,KB signature on an ARM Cortex M3

  17. Study of isomeric pentacyclic triterpene acids in traditional Chinese medicine of Forsythiae Fructus and their binding constants with β-cyclodextrin by capillary electrophoresis.

    Science.gov (United States)

    Ren, Tingjun; Xu, Zhongqi

    2018-04-01

    In this study, a capillary zone electrophoresis (CZE) method was first developed to identify three microconstituents of isomeric pentacyclic triterpene acids (PTAs including oleanolic acid (OA), ursolic acid (UA) and betulinic acid (BA)) in Forsythiae Fructus (FF). The baseline separation of PTAs by CZE were eventually achieved in a background electrolyte (BGE) containing 50.0 mmol/L borax and 0.5 mmol/L β-cyclodextrin (β-CD) at pH 9.5 within 13.0 min. Herein, it was not only the compositions of BGE were detail investigated for rapid and good separation, but also the binding ratio and the equilibrium constants (K) for OA, UA and BA with β-CD was estimated by double reciprocal equation to well understand the separation mechanism. The proposed method allowed the LODs of PTAs were averaged at 1.50 μg/mL with UV detection (at 200 nm). The interday RSD of migration time and peak area were around 2.0 and 4.7% (n = 5), respectively. Thus, the content of PTAs in 19 FF real samples distinguished from maturation stages and geographical areas in China was quantified with the proposed method. Depending on the amount of each PTA in FF, it was demonstrated these microconstituents might benefit to identify their harvested time even qualities. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. An advanced KB mirror pair for microfocusing

    CERN Document Server

    Ferme, J J

    2001-01-01

    A new range of micro-focusing mirrors based on KB pairs has been developed by SESO for Beamline Nanospectroscopy at the Elettra Storage Ring in Trieste, Italy. Both the focusing and the aspheric shape are adjustable with stepper motors. The goal of the beamline is to have a high photon density spot with a variable size in the experimental chamber over the whole soft X-ray range. The estimated dimension of the final spot should be smaller than 4 mu m sup 2 FWHM, with a photon density of the order of 10 sup 1 sup 3 photons/s mu m sup 2; this may be achieved only by accepting an angular divergence on these mirrors of between 5 and 10 mrad. This condition can be fulfilled only with elliptical (or plane elliptical) mirrors with very limited residual slope errors (below 1 mu rad RMS) that are able to correct even small focal distance errors.

  19. Calculation of site affinity constants and cooperativity coefficients for binding of ligands and/or protons to macromolecules. II. Relationships between chemical model and partition function algorithm.

    Science.gov (United States)

    Fisicaro, E; Braibanti, A; Lamb, J D; Oscarson, J L

    1990-05-01

    The relationships between the chemical properties of a system and the partition function algorithm as applied to the description of multiple equilibria in solution are explained. The partition functions ZM, ZA, and ZH are obtained from powers of the binary generating functions Jj = (1 + kappa j gamma j,i[Y])i tau j, where i tau j = p tau j, q tau j, or r tau j represent the maximum number of sites in sites in class j, for Y = M, A, or H, respectively. Each term of the generating function can be considered an element (ij) of a vector Jj and each power of the cooperativity factor gamma ij,i can be considered an element of a diagonal cooperativity matrix gamma j. The vectors Jj are combined in tensor product matrices L tau = (J1) [J2]...[Jj]..., thus representing different receptor-ligand combinations. The partition functions are obtained by summing elements of the tensor matrices. The relationship of the partition functions with the total chemical amounts TM, TA, and TH has been found. The aim is to describe the total chemical amounts TM, TA, and TH as functions of the site affinity constants kappa j and cooperativity coefficients bj. The total amounts are calculated from the sum of elements of tensor matrices Ll. Each set of indices (pj..., qj..., rj...) represents one element of a tensor matrix L tau and defines each term of the summation. Each term corresponds to the concentration of a chemical microspecies. The distinction between microspecies MpjAqjHrj with ligands bound on specific sites and macrospecies MpAqHR corresponding to a chemical stoichiometric composition is shown. The translation of the properties of chemical model schemes into the algorithms for the generation of partition functions is illustrated with reference to a series of examples of gradually increasing complexity. The equilibria examined concern: (1) a unique class of sites; (2) the protonation of a base with two classes of sites; (3) the simultaneous binding of ligand A and proton H to a

  20. Comparison of the binding constant (Ksub(D)) of /sup 125/I-labelled 3-(4-iodophenoxy)-1-isopropylaminopropan-2-ol obtained on. beta. -adrenoceptors in guinea-pig myocardial membranes, with its dissociation constants (Ksub(B)) obtained on guinea-pig isolated atria and trachea

    Energy Technology Data Exchange (ETDEWEB)

    O' Donnell, S R [Queensland Univ., Brisbane (Australia). Dept. Of Physiology; Woodcock, E A

    1978-02-01

    The dissociation constant of binding (Ksub(D) of /sup 125/I-labelled 3-(4-iodophenoxy)-isopropylaminopropan-2-ol (IIP) to guinea pig myocardial membrane preparations was 2.2 x 10/sup -8/M. In pharmacological experiments with non-labelled material and 60 min contact time, IIP produced a parallel shift in the orciprenaline concentration-response line on guinea-pig isolated tracheal and atrial preparations. The dissociation constant (Ksub(B) of IIP was 2.9 x 10/sup -8/M on atria (pA/sub 2/ 7.54) and 3.3 x 10/sup -8/M on trachea (PA/sub 2/ 7.48). These values indicate that IIP is not a selective B-adrenoceptor blocking drug. In addition, agreement was found between the affinity constant of this antagonist for B-adrenoceptors as determined by a direct binding study and an indirect pharmacological study.

  1. DNA binding studies of tartrazine food additive.

    Science.gov (United States)

    Kashanian, Soheila; Zeidali, Sahar Heidary

    2011-07-01

    The interaction of native calf thymus DNA with tartrazine in 10 mM Tris-HCl aqueous solution at neutral pH 7.4 was investigated. Tartrazine is a nitrous derivative and may cause allergic reactions, with a potential of toxicological risk. Also, tartrazine induces oxidative stress and DNA damage. Its DNA binding properties were studied by UV-vis and circular dichroism spectra, competitive binding with Hoechst 33258, and viscosity measurements. Tartrazine molecules bind to DNA via groove mode as illustrated by hyperchromism in the UV absorption band of tartrazine, decrease in Hoechst-DNA solution fluorescence, unchanged viscosity of DNA, and conformational changes such as conversion from B-like to C-like in the circular dichroism spectra of DNA. The binding constants (K(b)) of DNA with tartrazine were calculated at different temperatures. Enthalpy and entropy changes were calculated to be +37 and +213 kJ mol(-1), respectively, according to the Van't Hoff equation, which indicated that the reaction is predominantly entropically driven. Also, tartrazine does not cleave plasmid DNA. Tartrazine interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 3.75 × 10(4) M(-1).

  2. Thermal performance measurements on ATLAS-SCT KB forward modules

    CERN Document Server

    Donegà, M; D'Onofrio, M; Ferrère, D; Hirt, C; Ikegami, Y; Kohriki, T; Kondo, T; Lindsay, S; Mangin-Brinet, M; Niinikoski, T O; Pernegger, H; Perrin, E; Taylor, G; Terada, S; Unno, Y; Wallny, R; Weber, M

    2003-01-01

    The thermal design of the KB module is presented. A Finite Elements Analysis (FEA) has been used to finalize the module design. The thermal performance of an outer irradiated KB module has been measured at different cooling conditions. The thermal runaway of the module has been measured. The FEA model has been compared with the measurements and has been used to predict the thermal performance in a realistic SCT scenario.

  3. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking*

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-01-01

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. PMID:26453302

  4. High potency inhibition of hERG potassium channels by the sodium–calcium exchange inhibitor KB-R7943

    Science.gov (United States)

    Cheng, Hongwei; Zhang, Yihong; Du, Chunyun; Dempsey, Christopher E; Hancox, Jules C

    2012-01-01

    BACKGROUND AND PURPOSE KB-R7943 is an isothiourea derivative that is used widely as a pharmacological inhibitor of sodium–calcium exchange (NCX) in experiments on cardiac and other tissue types. This study investigated KB-R7943 inhibition of hERG (human ether-à-go-go-related gene) K+ channels that underpin the cardiac rapid delayed rectifier potassium current, IKr. EXPERIMENTAL APPROACH Whole-cell patch-clamp measurements were made of hERG current (IhERG) carried by wild-type or mutant hERG channels and of native rabbit ventricular IKr. Docking simulations utilized a hERG homology model built on a MthK-based template. KEY RESULTS KB-R7943 inhibited both IhERG and native IKr rapidly on membrane depolarization with IC50 values of ∼89 and ∼120 nM, respectively, for current tails at −40 mV following depolarizing voltage commands to +20 mV. Marked IhERG inhibition also occurred under ventricular action potential voltage clamp. IhERG inhibition by KB-R7943 exhibited both time- and voltage-dependence but showed no preference for inactivated over activated channels. Results of alanine mutagenesis and docking simulations indicate that KB-R7943 can bind to a pocket formed of the side chains of aromatic residues Y652 and F656, with the compound's nitrobenzyl group orientated towards the cytoplasmic side of the channel pore. The structurally related NCX inhibitor SN-6 also inhibited IhERG, but with a markedly reduced potency. CONCLUSIONS AND IMPLICATIONS KB-R7943 inhibits IhERG/IKr with a potency that exceeds that reported previously for acute cardiac NCX inhibition. Our results also support the feasibility of benzyloxyphenyl-containing NCX inhibitors with reduced potential, in comparison with KB-R7943, to inhibit hERG. PMID:21950687

  5. Fluorescent Inhibitors as Tools To Characterize Enzymes: Case Study of the Lipid Kinase Phosphatidylinositol 4-Kinase IIIβ (PI4KB).

    Science.gov (United States)

    Humpolickova, Jana; Mejdrová, Ivana; Matousova, Marika; Nencka, Radim; Boura, Evzen

    2017-01-12

    The lipid kinase phosphatidylinositol 4-kinase IIIβ (PI4KB) is an essential host factor for many positive-sense single-stranded RNA (+RNA) viruses including human pathogens hepatitis C virus (HCV), Severe acute respiratory syndrome (SARS), coxsackie viruses, and rhinoviruses. Inhibitors of PI4KB are considered to be potential broad-spectrum virostatics, and it is therefore critical to develop a biochemical understanding of the kinase. Here, we present highly potent and selective fluorescent inhibitors that we show to be useful chemical biology tools especially in determination of dissociation constants. Moreover, we show that the coumarin-labeled inhibitor can be used to image PI4KB in cells using fluorescence-lifetime imaging microscopy (FLIM) microscopy.

  6. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 1 to 56. (A.L.B.)

  7. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    2000-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  8. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1998-01-01

    This paper is made of two tables. The first table describes the different particles (bosons and fermions) while the second one gives the nuclear constants of isotopes from the different elements with Z = 1 to 25. (J.S.)

  9. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  10. Are fundamental constants really constant

    International Nuclear Information System (INIS)

    Norman, E.B.

    1986-01-01

    Reasons for suspecting that fundamental constants might change with time are reviewed. Possible consequences of such variations are examined. The present status of experimental tests of these ideas is discussed

  11. Measurement of the Dissociation-Equilibrium Constants for Low Affinity Antibiotic Binding Interaction with Bacterial Ribosomes by the T2 (CPMG) and Line-Broadening Methods

    Science.gov (United States)

    Verdier, L.; Gharbi-Benarous, J.; Bertho, G.; Mauvais, P.; Girault, J.-P.

    1999-10-01

    In this study the dissociation constants of the low antibiotic-ribosomes interaction were determined by the T2 (CPMG), the Carr-Purcell-Meiboom-Gill spin-echo decay rate and the line-broadening methods. Three MLSB antibiotics were studied, a macrolide roxithromycin, a ketolide HMR 3647 and a lincosamide clindamycin for their weak interaction with three bacterial ribosomes, E. coli, Staphylococcus aureus sensitive and resistant to erythromycin. Nous avons mesuré la constante de dissociation, Kd correspondant à l'interaction faible antibiotique-ribosome bactérien pour des antibiotiques de différentes classes, un macrolide (roxithromycine), un kétolide (HMR 3647) et une lincosamide (clindamycine) avec des ribosomes de différentes souches bactériennes (E. coli, Staphylococcus aureus sensible ou résistant à l'erythromycin) par deux méthodes : l'une basée sur la variation des largeurs de raies et l'autre sur les temps de relaxation transversaux T2 en utilisant une séquence CPMG.

  12. Modulation of NF-KB in rescued irradiated cells

    International Nuclear Information System (INIS)

    Lam, R.K.K.; Fung, Y.K.; Han, W.; Li, L.; Chiu, S.K.; Cheng, S.H.; Yu, K.N.

    2015-01-01

    Studies by different groups on the rescue effect, where unirradiated bystander cells mitigated the damages in the irradiated cells, since its discovery by the authors' group in 2011 were first reviewed. The properties of the rescue effect were then examined using a novel experimental set-up to physically separate the rescue signals from the bystander signals. The authors' results showed that the rescue effect was mediated through activation of the nuclear factor-KB (NF-KB) response pathway in the irradiated cells, and that the NF-KB activation inhibitor BAy -1 1-7082 did not affect the activation of this response pathway in the irradiated cells induced by direct irradiation. (authors)

  13. The KB WOT Fisheries Programme carried out in 2015

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is established to maintain and develop the expertise needed to carry out the statutory obligations of the Netherlands in fisheries monitoring and advice. It is also a flexible program which responds to changes over time in WOT requirements, fisheries management and

  14. Mapping autonomously replicating sequence elements in a 73-kb ...

    Indian Academy of Sciences (India)

    Autonomously replicating sequence (ARS) elements are the genetic determinants of replication origin function in yeasts. They can be easily identified as the plasmids containing them transform yeast cells at a high frequency. As the first step towards identifying all potential replication origins in a 73-kb region of the long arm ...

  15. DNA-binding studies of valrubicin as a chemotherapy drug using spectroscopy and electrochemical techniques

    Directory of Open Access Journals (Sweden)

    Reza Hajian

    2017-06-01

    Full Text Available In this study, the molecular interactions between valrubicin, an anticancer drug, and fish sperm DNA have been studied in phosphate buffer solution (pH 7.4 using UV–Vis spectrophotometry and cyclic voltammetry techniques. Valrubicin intercalated into double stranded DNA under a weak displacement reaction with methylene blue (MB molecule in a competitive reaction. The binding constant (kb of valrubicin-DNA was determined as 1.75×103 L/mol by spectrophotometric titration. The value of non-electrostatic binding constant (kt0 was almost constant at different ionic strengths while the ratio of kt0/kb increased from 4.51% to 23.77%. These results indicate that valrubicin binds to ds-DNA via electrostatic and intercalation modes. Thermodynamic parameters including ΔH0, ΔS0 and ΔG0 for valrubicin-DNA interaction were determined as −25.21×103 kJ/mol, 1.55×102 kJ/mol K and −22.03 kJ/mol, respectively. Cyclic voltammetry study shows a pair of redox peaks for valrubicin at 0.45 V and 0.36 V (vs. Ag/AgCl. The peak currents decreased and peak positions shifted to positive direction in the presence of DNA, showing intercalation mechanism due to the variation in formal potential.

  16. The human thyroglobulin gene is over 300 kb long and contains introns of up to 64 kb

    NARCIS (Netherlands)

    Baas, F.; van Ommen, G. J.; Bikker, H.; Arnberg, A. C.; de Vijlder, J. J.

    1986-01-01

    Thyroglobulin (Tg), the precursor of thyroid hormones, is a 660.000 Da dimeric glycoprotein synthesized exclusively in the thyroid gland. We have cloned the human thyroglobulin gene from cosmid and phage libraries and constructed a complete restriction map. The gene encodes an 8.7 kb mRNA, covers at

  17. Crystal structure and thermal behavior of KB3O6

    International Nuclear Information System (INIS)

    Bubnova, R.S.; Fundamenskij, V.S.; Filatov, S.K.; Polyakova, I.G.

    2004-01-01

    The structure of potassium triborate prepared in metastable state by crystallization from melt at ∼ 800 deg C was studied by the method of X-ray diffraction analysis. It was ascertained that KB 3 O 6 belongs to monoclinic crystal system, space group P2 1 /c, a = 9.319(1), b = 6.648(1), c = 21.094(2) A, β = 94.38(1) deg, Z = 12. The compound is referred to a new structural type. Anion of the structure is a single boron-oxygen frame formed by three independent rigid triborate rings of [B 3 O 5 ] - , each of them consisting of two BO 3 triangles and BO 4 tetrahedron. Phase transformations during KB 3 O 6 heating up to 800 deg C, as well as thermal expansion in the range of 20-650 deg C, were studied [ru

  18. MicroRNA-205 suppresses the oral carcinoma oncogenic activity via down-regulation of Axin-2 in KB human oral cancer cell.

    Science.gov (United States)

    Kim, Jae-Sung; Park, Sun-Young; Lee, Seul Ah; Park, Min-Gyeong; Yu, Sun-Kyoung; Lee, Myoung-Hwa; Park, Mi-Ra; Kim, Su-Gwan; Oh, Ji-Su; Lee, Sook-Young; Kim, Chun Sung; Kim, Heung-Joong; Chun, Hong Sung; Kim, Jin-Soo; Moon, Sung-Min; Kim, Do Kyung

    2014-02-01

    MicroRNA (miRNA) is a small noncoding RNA molecule, 19-25 nucleotides in length, which regulates several pathways including cell development, cell proliferation, carcinogenesis, apoptosis, etc. In this study, the over-expression of microRNA-205 (miR-205) increased the number of apoptotic cells by at least 4 times compared to the control. In addition, over-expressed miRNA in KB oral cancer cells triggered apoptosis via the caspase cascade, including the cleavage of caspase-9, caspase-7, caspase-3, and PARP. Flow cytometry showed that apoptotic cell death was increased significantly by 35.33% in KB oral cancer cells with over-expressed miR-205 compared to the control. The microarray data showed that axis inhibitor protein 2 (Axin2) was down-regulated in KB oral cancer cells transfected with miR-205. In addition, Axin2 was down-regulated by approximately 50% by over-expressed miR-205 at both the mRNA and protein levels. Interestingly, Axin2 was up-regulated in KB oral cancer compared to human normal oral keratinocytes. Furthermore, the cell cytotoxicity and apoptotic population of KB oral cancer cells were increased significantly after Axin2 siRNA transfection. These results suggest that Axin2 is might be as potential oncogene in KB oral cancer cells. The luciferase assay showed that over-expressed miR-205 in KB oral cancer cells suppressed AXIN2 expression through an interaction with its own binding site at AXIN2 3'UTR (64-92). These results suggest that miR-205 is a novel anti-oncogenic miRNA in KB oral cancer cells, and may have potential applications in oral cancer therapy.

  19. Carboxyl-terminal Truncations of ClC-Kb Abolish Channel Activation by Barttin Via Modified Common Gating and Trafficking.

    Science.gov (United States)

    Stölting, Gabriel; Bungert-Plümke, Stefanie; Franzen, Arne; Fahlke, Christoph

    2015-12-18

    ClC-K chloride channels are crucial for auditory transduction and urine concentration. Mutations in CLCNKB, the gene encoding the renal chloride channel hClC-Kb, cause Bartter syndrome type III, a human genetic condition characterized by polyuria, hypokalemia, and alkalosis. In recent years, several Bartter syndrome-associated mutations have been described that result in truncations of the intracellular carboxyl terminus of hClC-Kb. We here used a combination of whole-cell patch clamp, confocal imaging, co-immunoprecipitation, and surface biotinylation to study the functional consequences of a frequent CLCNKB mutation that creates a premature stop codon at Trp-610. We found that W610X leaves the association of hClC-Kb and the accessory subunit barttin unaffected, but impairs its regulation by barttin. W610X attenuates hClC-Kb surface membrane insertion. Moreover, W610X results in hClC-Kb channel opening in the absence of barttin and prevents further barttin-mediated activation. To describe how the carboxyl terminus modifies the regulation by barttin we used V166E rClC-K1. V166E rClC-K1 is active without barttin and exhibits prominent, barttin-regulated voltage-dependent gating. Electrophysiological characterization of truncated V166E rClC-K1 demonstrated that the distal carboxyl terminus is necessary for slow cooperative gating. Since barttin modifies this particular gating process, channels lacking the distal carboxyl-terminal domain are no longer regulated by the accessory subunit. Our results demonstrate that the carboxyl terminus of hClC-Kb is not part of the binding site for barttin, but functionally modifies the interplay with barttin. The loss-of-activation of truncated hClC-Kb channels in heterologous expression systems fully explains the reduced basolateral chloride conductance in affected kidneys and the clinical symptoms of Bartter syndrome patients. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. The T alpha 2 nuclear protein binding site from the human T cell receptor alpha enhancer functions as both a T cell-specific transcriptional activator and repressor

    OpenAIRE

    1990-01-01

    T cell-specific expression of the human T cell receptor alpha (TCR- alpha) gene is regulated by the interaction of variable region promoter elements with a transcriptional enhancer that is located 4.5 kb 3' of the TCR-alpha constant region (C alpha) gene segment. The minimal TCR- alpha enhancer is composed of two nuclear protein binding sites, T alpha 1 and T alpha 2, that are both required for the T cell-specific activity of the enhancer. The T alpha 1 binding site contains a consensus cAMP ...

  1. The simplest possible design for a KB microfocus mirror system?

    Energy Technology Data Exchange (ETDEWEB)

    Collins, S. P., E-mail: steve.collins@diamond.ac.uk; Scott, S. M.; Hawkins, D. M.; Fabrizi, F.; Moser, B.; Nisbet, G.; Sutter, J. P. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Harwin, R. C. [Diamond Light Source, Harwell Science & Innovation Campus, Didcot, OX11 0DE (United Kingdom); Department of Physics, Cavendish Laboratory, JJ Thomson Avenue, Cambridge, CB3 0HE (United Kingdom); Harwin, W. S. [School of Systems Engineering, University of Reading, Whiteknights, Reading, Berkshire, RG6 6AH (United Kingdom)

    2016-07-27

    We report a design for a Kirkpatrick-Baez (KB) microfocussing mirror system. The main components are described, with emphasis on a ‘tripod’ manipulator, where we outline the required coordinate transformation calculations. The merit of this device lies in its simplicity of design, minimal degrees of freedom, and speed and ease of setup on a beamline. Test results and an example of the mirrors in use on Diamond Beamline I16, showing a high-resolution polar domain map of KTiOPO{sub 4} with a spot size of 1.25 µm × 1.5 µm, are presented.

  2. Composition and size of Apollo asteroid 1984 KB

    Science.gov (United States)

    Bell, Jeffrey F.; Hawke, B. Ray; Brown, Robert Hamilton

    1988-01-01

    The Class S object-typifying spectral signatures of olivine, pyroxene, and NiFe metal are noted in the present reflection spectra and thermal-emission radiometric data for the earth orbit-crossing Apollo object, 1984KB; a surface material akin to the rare lodranite meteorites. While the Class S object identification is strengthened by standard asteroid thermal model's indication of an about 0.7-km radius, and albedo of about 0.16, which is inconsistent with the IR spectrum, is obtained by an analysis of the same thermal data with a bare-rock thermal model. The object must have a significant regolith despite its small size.

  3. KB WOT Fisheries 2013 - Maintaining Excellence and Innvovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Beek, van F.A.

    2013-01-01

    Het KB programma voor Visserijonderzoek onderhoudt en ontwikkelt de expertise, die nodig is om de WOT voor de visserij uit te voeren. De inhoud van het KB WOT-programma voor 2013 weerspiegelt de recente discussies tussen IMARES, CVO en EZ over de toekomstige richting van het onderzoek. De KB

  4. Sakharov at KB-11. The path of a genius

    International Nuclear Information System (INIS)

    Ilkaev, Radii I

    2012-01-01

    21 May 2011 would have marked the 90th birthday of Andrei Dmitrievich Sakharov, a towering 20th-century figure in science and human thought, whose ideas, research contributions, and life example exerted enormous influence on the history of the second half of the 20th century and, in particular, on the history of Russia. Whether as a scientist or a private person (including his public activities and exceptional attitude to human personality), he always displayed creativity and a freedom of spirit, thought, and action. Sakharov's life and creative work make him a model scientist and citizen for many and undoubtedly provide a legacy for the development of science and society in the 21st century. In this paper, some of Sakharov's key ideas and achievements relating to his KB-11 period are exemplified, and how they influence present day research and technology, notably as employed for affording national security, is examined. (conferences and symposia)

  5. Sakharov at KB-11. The path of a genius

    Science.gov (United States)

    Ilkaev, Radii I.

    2012-02-01

    21 May 2011 would have marked the 90th birthday of Andrei Dmitrievich Sakharov, a towering 20th-century figure in science and human thought, whose ideas, research contributions, and life example exerted enormous influence on the history of the second half of the 20th century and, in particular, on the history of Russia. Whether as a scientist or a private person (including his public activities and exceptional attitude to human personality), he always displayed creativity and a freedom of spirit, thought, and action. Sakharov's life and creative work make him a model scientist and citizen for many and undoubtedly provide a legacy for the development of science and society in the 21st century. In this paper, some of Sakharov's key ideas and achievements relating to his KB-11 period are exemplified, and how they influence present day research and technology, notably as employed for affording national security, is examined.

  6. HINT-KB: The human interactome knowledge base

    KAUST Repository

    Theofilatos, Konstantinos A.

    2012-01-01

    Proteins and their interactions are considered to play a significant role in many cellular processes. The identification of Protein-Protein interactions (PPIs) in human is an open research area. Many Databases, which contain information about experimentally and computationally detected human PPIs as well as their corresponding annotation data, have been developed. However, these databases contain many false positive interactions, are partial and only a few of them incorporate data from various sources. To overcome these limitations, we have developed HINT-KB (http://150.140.142.24:84/Default.aspx) which is a knowledge base that integrates data from various sources, provides a user-friendly interface for their retrieval, estimates a set of features of interest and computes a confidence score for every candidate protein interaction using a modern computational hybrid methodology. © 2012 IFIP International Federation for Information Processing.

  7. Mirror profile optimization for nano-focusing KB mirror

    International Nuclear Information System (INIS)

    Zhang Lin; Baker, Robert; Barrett, Ray; Cloetens, Peter; Dabin, Yves

    2010-01-01

    A KB focusing mirror width profile has been optimized to achieve nano-focusing for the nano-imaging end-station ID22NI at the ESRF. The complete mirror and flexure bender assembly has been modeled in 3D with finite element analysis using ANSYS. Bender stiffness, anticlastic effects and geometrical non-linear effects have been considered. Various points have been studied: anisotropy and crystal orientation, stress in the mirror and bender, actuator resolution and the mirror-bender adhesive bonding... Extremely high performance of the mirror is expected with residual slope error smaller than 0.6 μrad, peak-to-valley, compared to the bent slope of 3000 μrad.

  8. SAFOD Brittle Microstructure and Mechanics Knowledge Base (BM2KB)

    Science.gov (United States)

    Babaie, Hassan A.; Broda Cindi, M.; Hadizadeh, Jafar; Kumar, Anuj

    2013-07-01

    Scientific drilling near Parkfield, California has established the San Andreas Fault Observatory at Depth (SAFOD), which provides the solid earth community with short range geophysical and fault zone material data. The BM2KB ontology was developed in order to formalize the knowledge about brittle microstructures in the fault rocks sampled from the SAFOD cores. A knowledge base, instantiated from this domain ontology, stores and presents the observed microstructural and analytical data with respect to implications for brittle deformation and mechanics of faulting. These data can be searched on the knowledge base‧s Web interface by selecting a set of terms (classes, properties) from different drop-down lists that are dynamically populated from the ontology. In addition to this general search, a query can also be conducted to view data contributed by a specific investigator. A search by sample is done using the EarthScope SAFOD Core Viewer that allows a user to locate samples on high resolution images of core sections belonging to different runs and holes. The class hierarchy of the BM2KB ontology was initially designed using the Unified Modeling Language (UML), which was used as a visual guide to develop the ontology in OWL applying the Protégé ontology editor. Various Semantic Web technologies such as the RDF, RDFS, and OWL ontology languages, SPARQL query language, and Pellet reasoning engine, were used to develop the ontology. An interactive Web application interface was developed through Jena, a java based framework, with AJAX technology, jsp pages, and java servlets, and deployed via an Apache tomcat server. The interface allows the registered user to submit data related to their research on a sample of the SAFOD core. The submitted data, after initial review by the knowledge base administrator, are added to the extensible knowledge base and become available in subsequent queries to all types of users. The interface facilitates inference capabilities in the

  9. The clinical significance of HER-2 and NF-KB expression in gastric cancer.

    Science.gov (United States)

    Li, Xiaogai; Tu, Jiancheng; Zhang, Di; Xu, Zhigao; Yang, Guifang; Gong, Lingling; Yu, Mingxia

    2013-09-01

    To investigate the expression of human epidermal growth factor 2 (HER-2) and Nuclear factor-Kb (NF-KB) in gastric cancer, and the relation of these two parameters with stage, grade and metastasis of gastric cancer. The serum level of HER-2 in 75 gastric cancer patients and control participants were determined by enzyme-linked immunosorbent assay (ELISA) kits. Expression of HER-2 and NF-KB protein were detected by immunohistochemical staining (SP method) of paraffin-embedded tissues in 75 tumors (observed group) and 22 normal gastric specimens. The clinical pathological data was statistically analyzed. Serum HER-2 level were significantly increased in study group compared with those in the control group (pKB in the observed group was 24.00% (18/75) and 62.67% (47/75) respectively. The expression of HER-2 and NF-KB were not correlated with age and gender, but with stage, grade and metastasis (pKB was correlated with tumor size (pKB had a positive rate of 94.44% (17/18), but a positive rate of 52.63% (30/57) when HER-2 was negative. Expression of NF-KB in gastric cancer tissue was correlated with HER-2 expression (X2 = 8.514, pKB in gastric cancer tissue is correlated with HER-2 expression, and they may play a very important role in the progress of gastric cancer.

  10. Collateral sensitivity to cisplatin in KB-8-5-11 drug-resistant cancer cells.

    Science.gov (United States)

    Doherty, Ben; Lawlor, Denise; Gillet, Jean-Pierre; Gottesman, Michael; O'Leary, John J; Stordal, Britta

    2014-01-01

    KB-8-5-11 cells are a drug-resistant cervical cell model that overexpresses ABCB1 (P-glycoprotein). KB-8-5-11 has become sensitive to non-ABCB1 substrate cisplatin. Understanding the mechanism of collateral sensitivity to cisplatin may lead to biomarker discovery for platinum sensitivity in patients with cancer. A Taqman low-density array was used to characterize the expression of 380 genes previously associated with chemoresistance. Identified pathways were further analyzed using cytotoxicity assays, metabolomics and western blots. KB-8-5-11 cells were sensitive to CuSO4 and the glutathione inhibitor buthionine sulphoximine. Expression of ATPase, Cu(2+) transporting alpha (ATP7A) and ATP7B were decreased at the protein and gene levels respectively in KB-8-5-11. KB-8-5-11 had decreased gene expression of glutathione S-transferase pi 1 (GSTP1), GSTA4 and GSTK1. Cisplatin treatment significantly lowered total cellular glutathione in parental KB-3-1 cells. Glutathione also tended to be lower in KB-8-5-11 cells compared to KB-3-1 cells. KB-8-5-11 cells have alterations in their copper transporters and glutathione metabolism, contributing to their cisplatin-sensitive phenotype.

  11. Constant physics and characteristics of fundamental constant

    International Nuclear Information System (INIS)

    Tarrach, R.

    1998-01-01

    We present some evidence which supports a surprising physical interpretation of the fundamental constants. First, we relate two of them through the renormalization group. This leaves as many fundamental constants as base units. Second, we introduce and a dimensional system of units without fundamental constants. Third, and most important, we find, while interpreting the units of the a dimensional system, that is all cases accessible to experimentation the fundamental constants indicate either discretization at small values or boundedness at large values of the corresponding physical quantity. (Author) 12 refs

  12. Collateral sensitivity to cisplatin in KB-8-5-11 drug-resistant cancer cells.

    LENUS (Irish Health Repository)

    Doherty, Ben

    2014-01-01

    KB-8-5-11 cells are a drug-resistant cervical cell model that overexpresses ABCB1 (P-glycoprotein). KB-8-5-11 has become sensitive to non-ABCB1 substrate cisplatin. Understanding the mechanism of collateral sensitivity to cisplatin may lead to biomarker discovery for platinum sensitivity in patients with cancer.

  13. KB WOT Fisheries 2018: maintaining excellence and innovation in fisheries research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2017-01-01

    The KB WOT Fisheries programme is developed to maintain and develop expertise needed to carry out the Dutch statutory obligations in fisheries monitoring and advice. The KB WOT Fisheries programme developed for 2018 reflects the scientific and management needs of the WOT fisheries programme. The

  14. KB WOT Fisheries 2014 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2013-01-01

    The KB WOT Fisheries programme is fundamental to the maintenance and development of expertise needed to carry out the statutory obligations of the Dutch WOT Fisheries monitoring and advice. The structure of the KB WOT Fisheries programme 2014 is a result of discussions on the research direction and

  15. KB WOT Fisheries 2015 - Maintaining Excellence and Innovation in Fisheries Research

    NARCIS (Netherlands)

    Damme, van C.J.G.; Verver, S.W.

    2015-01-01

    The KB WOT Fisheries programme is essential to the maintenance and development of the expertise which are needed for the Dutch statutory obligations in fisheries monitoring and advice. The contents of the KB WOT Fisheries programme for 2015 reflects the needs of the research developments the WOT

  16. [Effect of the 10 kb sequence of piscine Streptococcus agalactiae on bacterial virulence].

    Science.gov (United States)

    Liu, Guangjin; Zhu, Jielian; Shi, Ziwei; Ding, Ming; Wang, Ruyi; Yao, Huochun; Lu, Chengping; Xu, Pao

    2016-01-04

    From the previous comparative genomic analysis, we found a specific unknown 10 kb sequence (including 11 Open reading Frames) in Chinese piscine strain GD201008-001 genome. To study the role of 10 kb in the pathogenicity of piscine S. agalactiae, the 10 kb sequence was deleted from the GD201008-001 genome. The isogenic mutant Δ10 kb was constructed by using the temperature-sensitive Streptococcus-E. coli shuttle vector pSET4s. We compared the growth characteristics, adherence to HEp-2 cell and bacterial virulence in a zebrafish infection model between wild strain and mutant. Meanwhile the expressions of the known virulence genes from GD201008-001 and Δ10 kb were also quantified by real-time PCR. The Δ10 kb showed no significant differences in bacterial morphology and adherence to HEp-2 cells compared with the wild-type strain, but the speed of growth was slightly slower than the wild strain. Furthermore the 50% lethal dose of Δ10 kb was decreased up to 10-fold (P kb sequence of piscine Streptococcus agalactiae exerts a significant effect on bacterial virulence and probably regulates the virulence genes expression of GD20 1008-001.

  17. Cosmological Hubble constant and nuclear Hubble constant

    International Nuclear Information System (INIS)

    Horbuniev, Amelia; Besliu, Calin; Jipa, Alexandru

    2005-01-01

    The evolution of the Universe after the Big Bang and the evolution of the dense and highly excited nuclear matter formed by relativistic nuclear collisions are investigated and compared. Values of the Hubble constants for cosmological and nuclear processes are obtained. For nucleus-nucleus collisions at high energies the nuclear Hubble constant is obtained in the frame of different models involving the hydrodynamic flow of the nuclear matter. Significant difference in the values of the two Hubble constant - cosmological and nuclear - is observed

  18. Involvement of histidine residues in the pH-dependent β-galactoside binding activity of human galectin-1.

    Science.gov (United States)

    Hiramatsu, Hirotsugu; Takeuchi, Katsuyuki; Takeuchi, Hideo

    2013-04-02

    The pH dependence of the β-galactoside binding activity of human galectin-1 (hGal-1) was investigated by fluorescence spectroscopy using lactose as a ligand. The obtained binding constant Kb was 2.94 ± 0.10 mM(-1) at pH 7.5. The Kb value decreased at acidic pH with a midpoint of transition at pH 6.0 ± 0.1. To elucidate the molecular mechanism of the pH dependence, we investigated the structures of hGal-1 and its two His mutants (H44Q and H52Q) using fluorescence, circular dichroism, UV absorption, and UV resonance Raman spectroscopy. Analysis of the spectra has shown that the pKa values of His44 and His52 are 5.7 ± 0.2 and 6.3 ± 0.1, respectively. The protonation of His52 below pH 6.3 induces a small change in secondary structure and partly reduces the galactoside binding activity. On the other hand, the protonation of His44 below pH 5.7 exerts a cation-π interaction with Trp68 and largely diminishes the galactoside binding activity. With reference to the literature X-ray structures at pH 7.0 and 5.6, protonated His52 is proposed to move slightly away from the galactoside-binding region with a partial unfolding of the β-strand containing His52. On the other hand, protonated His44 becomes unable to form a hydrogen bond with galactoside and additionally induces a reorientation and/or displacement of Trp68 through cation-π interaction, leading to a loosening of the galactoside-binding pocket. These structural changes associated with His protonation are likely to be the origin of the pH dependence of the galactoside binding activity of hGal-1.

  19. Radiative transfer in disc galaxies - V. The accuracy of the KB approximation

    Science.gov (United States)

    Lee, Dukhang; Baes, Maarten; Seon, Kwang-Il; Camps, Peter; Verstocken, Sam; Han, Wonyong

    2016-12-01

    We investigate the accuracy of an approximate radiative transfer technique that was first proposed by Kylafis & Bahcall (hereafter the KB approximation) and has been popular in modelling dusty late-type galaxies. We compare realistic galaxy models calculated with the KB approximation with those of a three-dimensional Monte Carlo radiative transfer code SKIRT. The SKIRT code fully takes into account of the contribution of multiple scattering whereas the KB approximation calculates only single scattered intensity and multiple scattering components are approximated. We find that the KB approximation gives fairly accurate results if optically thin, face-on galaxies are considered. However, for highly inclined (I ≳ 85°) and/or optically thick (central face-on optical depth ≳1) galaxy models, the approximation can give rise to substantial errors, sometimes, up to ≳40 per cent. Moreover, it is also found that the KB approximation is not always physical, sometimes producing infinite intensities at lines of sight with high optical depth in edge-on galaxy models. There is no `simple recipe' to correct the errors of the KB approximation that is universally applicable to any galaxy models. Therefore, it is recommended that the full radiative transfer calculation be used, even though it is slower than the KB approximation.

  20. Establishment and characterization of arsenic trioxide resistant KB/ATO cells.

    Science.gov (United States)

    Zhang, Yun-Kai; Dai, Chunling; Yuan, Chun-Gang; Wu, Hsiang-Chun; Xiao, Zhijie; Lei, Zi-Ning; Yang, Dong-Hua; Le, X Chris; Fu, Liwu; Chen, Zhe-Sheng

    2017-09-01

    Arsenic trioxide (ATO) is used as a chemotherapeutic agent for the treatment of acute promyelocytic leukemia. However, increasing drug resistance is reducing its efficacy. Therefore, a better understanding of ATO resistance mechanism is required. In this study, we established an ATO-resistant human epidermoid carcinoma cell line, KB/ATO, from its parental KB-3-1 cells. In addition to ATO, KB/ATO cells also exhibited cross-resistance to other anticancer drugs such as cisplatin, antimony potassium tartrate, and 6-mercaptopurine. The arsenic accumulation in KB/ATO cells was significantly lower than that in KB-3-1 cells. Further analysis indicated that neither application of P-glycoprotein inhibitor, breast cancer resistant protein (BCRP) inhibitor, or multidrug resistance protein 1 (MRP1) inhibitor could eliminate ATO resistance. We found that the expression level of ABCB6 was increased in KB/ATO cells. In conclusion, ABCB6 could be an important factor for ATO resistance in KB/ATO cells. The ABCB6 level may serve as a predictive biomarker for the effectiveness of ATO therapy.

  1. Binding behaviors of greenly synthesized silver nanoparticles - Lysozyme interaction: Spectroscopic approach

    Science.gov (United States)

    Roy, Swarup

    2018-02-01

    Interaction of greenly synthesized silver nanoparticles (SNP) and lysozyme (Lys) has been studied using spectroscopy. From UV-Vis study it is observed that a moderate association constant (Kapp) of 5.36 × 104 L/mol giving an indication of interaction. Fluorescence emission and time resolved study, confirm static mode of quenching phenomena and the binding constant (Kb) was 25.12, 3.98 and 1.99 × 103 L/mol at 298, 305 and 312 K respectively and the number of binding sites (n) was found to be ∼1. Using temperature dependent fluorimetric data, thermodynamic parameters calculated (Enthalpy change, ΔH = -143.95 kJ/mol, Entropy change, ΔS = -400.32 J/mol/K, Gibbs free energy change, ΔG = -24.66 kJ/mol at 298 K) and resulting insight indicative of weak force (van der Walls interaction & H-bonding) as key feature for the Lys-SNP interaction. By following Förster's non-radiative energy transfer (FRET) theory, average binding distance (r = 3.05 nm) was calculated and observed that nonradiative type energy transfer between SNP and Lys. What is more, circular dichroism (CD) spectra indicates presence of SNP does not display substantial alteration in the secondary structure of Lys. Hence, this results may be very useful for the well thought of essential aspects of binding between the Lys and SNP.

  2. KB425796-A, a novel antifungal antibiotic produced by Paenibacillus sp. 530603.

    Science.gov (United States)

    Kai, Hirohito; Yamashita, Midori; Takase, Shigehiro; Hashimoto, Michizane; Muramatsu, Hideyuki; Nakamura, Ikuko; Yoshikawa, Koji; Ezaki, Masami; Nitta, Kumiko; Watanabe, Masato; Inamura, Noriaki; Fujie, Akihiko

    2013-08-01

    The novel antifungal macrocyclic lipopeptidolactone, KB425796-A (1), was isolated from the fermentation broth of bacterial strain 530603, which was identified as a new Paenibacillus species based on morphological and physiological characteristics, and 16S rRNA sequences. KB425796-A (1) was isolated as white powder by solvent extraction, HP-20 and ODS-B column chromatography, and lyophilization, and was determined to have the molecular formula C79H115N19O18. KB425796-A (1) showed antifungal activities against Aspergillus fumigatus and the micafungin-resistant infectious fungi Trichosporon asahii, Rhizopus oryzae, Pseudallescheria boydii and Cryptococcus neoformans.

  3. FORMATION CONSTANTS AND THERMODYNAMIC ...

    African Journals Online (AJOL)

    KEY WORDS: Metal complexes, Schiff base ligand, Formation constant, DFT calculation ... best values for the formation constants of the proposed equilibrium model by .... to its positive charge distribution and the ligand deformation geometry.

  4. Ion exchange equilibrium constants

    CERN Document Server

    Marcus, Y

    2013-01-01

    Ion Exchange Equilibrium Constants focuses on the test-compilation of equilibrium constants for ion exchange reactions. The book first underscores the scope of the compilation, equilibrium constants, symbols used, and arrangement of the table. The manuscript then presents the table of equilibrium constants, including polystyrene sulfonate cation exchanger, polyacrylate cation exchanger, polymethacrylate cation exchanger, polysterene phosphate cation exchanger, and zirconium phosphate cation exchanger. The text highlights zirconium oxide anion exchanger, zeolite type 13Y cation exchanger, and

  5. Analysis of employee benefits in Factoring KB, a.s.v

    OpenAIRE

    Vachoušek, Stanislav

    2011-01-01

    The main objective of this work is to analyze employee benefits - benefits of Factoring KB, a.s. The theoretical part of the generally specifies the basic concepts related to employee benefits needed to cope with the analytical part. The content of this section is primarily a system of employee benefits, classification of employee benefits, tax savings and marginally trends in providing benefits. The analytical part is devoted exclusively to Factoring KB, there is an analysis of employee bene...

  6. Paradoxical effects of KB-R7943 on arrhythmogenicity in a chronic myocardial infarction rabbit model.

    Science.gov (United States)

    Chang, Po-Cheng; Wo, Hung-Ta; Lee, Hui-Ling; Wen, Ming-Shien; Chou, Chung-Chuan

    2015-07-01

    Na(+)/Ca(2+) exchanger blockade has been reported to be anti-arrhythmic in different models. The effects of KB-R7943, a Na(+)/Ca(2+) exchanger blocker, on arrhythmogenesis in hearts with chronic myocardial infarction (MI) remain unclear. Dual voltage and intracellular Ca(2+) (Cai) optical mapping was performed in nine rabbit hearts with chronic MI and four control hearts. Electrophysiology studies including inducibility of ventricular tachyarrhythmias, ventricular fibrillation dominant frequency, action potential, Cai alternans, Cai decay, and conduction velocity were performed. The same protocol was repeated in the presence of KB-R7943 (0.5, 1, and 5μM) after the baseline studies. KB-R7943 was effective in suppressing afterdepolarizations and spontaneous ventricular tachyarrhythmias in hearts with chronic MI. Surprisingly, KB-R7943 increased the inducibility of ventricular tachyarrhythmias in a dose-dependent manner (11%, 11%, 22%, and 56% at baseline and with 0.5, 1, and 5μM KB-R7943, respectively, p=0.02). Optical mapping analysis revealed that the underlying mechanisms of the induced ventricular tachyarrhythmias were probably spatially discordant alternans with wave breaks and rotors. Further analysis showed that KB-R7943 significantly enhanced both action potential (p=0.033) and Cai (p=0.001) alternans, prolonged Cai decay (tau value) in a dose-dependent manner (p=0.004), and caused heterogeneous conduction delay especially at peri-infarct zones during rapid burst pacing. In contrast, KB-R7943 had insignificant effects in control hearts. In this chronic MI rabbit model, KB-R7943 has contrasting effects on arrhythmogenesis, suppressing afterdepolarizations and spontaneous ventricular tachyarrhythmias, but enhancing the inducibility of tachyarrhythmias. The mechanism is probably the enhanced spatially discordant alternans because of prolonged Cai decay and heterogeneous conduction delay. Copyright © 2014 Japanese College of Cardiology. Published by Elsevier

  7. Capsaicin induces cell cycle arrest and apoptosis in human KB cancer cells.

    Science.gov (United States)

    Lin, Chia-Han; Lu, Wei-Cheng; Wang, Che-Wei; Chan, Ya-Chi; Chen, Mu-Kuan

    2013-02-25

    Capsaicin, a pungent phytochemical in a variety of red peppers of the genus Capsicum, has shown an anti-proliferative effect on various human cancer cell lines. In contrast, capsaicin has also been considered to promote the growth of cancer cells. Thus, the effects of capsaicin on various cell types need to be explored. The anti-proliferative effects of capsaicin on human KB cancer cells are still unknown. Therefore, we examined the viability, cell cycle progression, and factors associated with apoptosis in KB cells treated with capsaicin. The cell proliferation/viability and cytotoxicity of KB cells exposed to capsaicin were determined by a sulforhodamine B colorimetric assay and trypan blue exclusion. Apoptosis was detected by Hoechst staining and confirmed by western blot analysis of poly-(ADP-ribose) polymerase cleavage. Cell cycle distribution and changes of the mitochondrial membrane potential were analyzed by flow cytometry. Furthermore, the expression of caspase 3, 8 and 9 was evaluated by immunoblotting. We found that treatment of KB cells with capsaicin significantly reduced cell proliferation/viability and induced cell death in a dose-dependent manner compared with that in the untreated control. Cell cycle analysis indicated that exposure of KB cells to capsaicin resulted in cell cycle arrest at G2/M phase. Capsaicin-induced growth inhibition of KB cells appeared to be associated with induction of apoptosis. Moreover, capsaicin induced disruption of the mitochondrial membrane potential as well as activation of caspase 9, 3 and poly-(ADP-ribose) polymerase in KB cells. Our data demonstrate that capsaicin modulates cell cycle progression and induces apoptosis in human KB cancer cells through mitochondrial membrane permeabilization and caspase activation. These observations suggest an anti-cancer activity of capsaicin.

  8. The UniProtKB/Swiss-Prot knowledgebase and its Plant Proteome Annotation Program.

    Science.gov (United States)

    Schneider, Michel; Lane, Lydie; Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Bougueleret, Lydie; Bairoch, Amos

    2009-04-13

    The UniProt knowledgebase, UniProtKB, is the main product of the UniProt consortium. It consists of two sections, UniProtKB/Swiss-Prot, the manually curated section, and UniProtKB/TrEMBL, the computer translation of the EMBL/GenBank/DDBJ nucleotide sequence database. Taken together, these two sections cover all the proteins characterized or inferred from all publicly available nucleotide sequences. The Plant Proteome Annotation Program (PPAP) of UniProtKB/Swiss-Prot focuses on the manual annotation of plant-specific proteins and protein families. Our major effort is currently directed towards the two model plants Arabidopsis thaliana and Oryza sativa. In UniProtKB/Swiss-Prot, redundancy is minimized by merging all data from different sources in a single entry. The proposed protein sequence is frequently modified after comparison with ESTs, full length transcripts or homologous proteins from other species. The information present in manually curated entries allows the reconstruction of all described isoforms. The annotation also includes proteomics data such as PTM and protein identification MS experimental results. UniProtKB and the other products of the UniProt consortium are accessible online at www.uniprot.org.

  9. FragKB: structural and literature annotation resource of conserved peptide fragments and residues.

    Directory of Open Access Journals (Sweden)

    Ashish V Tendulkar

    Full Text Available BACKGROUND: FragKB (Fragment Knowledgebase is a repository of clusters of structurally similar fragments from proteins. Fragments are annotated with information at the level of sequence, structure and function, integrating biological descriptions derived from multiple existing resources and text mining. METHODOLOGY: FragKB contains approximately 400,000 conserved fragments from 4,800 representative proteins from PDB. Literature annotations are extracted from more than 1,700 articles and are available for over 12,000 fragments. The underlying systematic annotation workflow of FragKB ensures efficient update and maintenance of this database. The information in FragKB can be accessed through a web interface that facilitates sequence and structural visualization of fragments together with known literature information on the consequences of specific residue mutations and functional annotations of proteins and fragment clusters. FragKB is accessible online at http://ubio.bioinfo.cnio.es/biotools/fragkb/. SIGNIFICANCE: The information presented in FragKB can be used for modeling protein structures, for designing novel proteins and for functional characterization of related fragments. The current release is focused on functional characterization of proteins through inspection of conservation of the fragments.

  10. [Effects of metformin on human oral cancer KB cell proliferation and apoptosis in vitro].

    Science.gov (United States)

    Wang, Fang; Xu, Jincheng; Xia, Fei; Liu, Zhe; Zhao, Surong; Liu, Hao; Jiang, Zhiwen

    2014-02-01

    To investigate the effects of metformin on the proliferation and apoptosis of human oral cancer cell line KB in vitro. Human oral cancer cell line KB was exposed to different doses of metformin (0, 1.25, 2.5, 5, 10, and 20 mmol/L), and the changes in cell viability were detected using MTT assay. Colony formation of the cells was observed following an 8-day metformin exposure. The changes in mitochondrial membrane potential were measured by JC-1 assay, and PI staining was used to observe the cell apoptosis. Western blotting was employed to detect the changes in the protein expressions of GRP78 and activated caspase-3. Metformin exposure caused time- and dose-dependent suppression of KB cell proliferation, and exposure to 5 mmol/L metformin for 24, 48 and 72 h resulted in cell survival rates of 68.0%, 36.9%, and 14.5%, respectively. Metformin significantly inhibited KB cell colony formation. Exposure of the cells to increased concentrations of metformin gradually increased the apoptotic rate and decreased mitochondrial membrane potential. Metformin caused an initial up-regulation followed by a down-regulation of GRP78 expression in KB cells and increased the expression of activated caspase-3. Metformin can inhibit the proliferation and induce apoptosis of KB cells, the mechanism of which may involve the activation of the mitochondrial apoptotic pathway and endoplasmic reticulum stress.

  11. Binding affinities of Schiff base Fe(II) complex with BSA and calf-thymus DNA: Spectroscopic investigations and molecular docking analysis

    Science.gov (United States)

    Rudra, Suparna; Dasmandal, Somnath; Patra, Chiranjit; Kundu, Arjama; Mahapatra, Ambikesh

    2016-09-01

    The binding interaction of a synthesized Schiff base Fe(II) complex with biological macromolecules viz., bovine serum albumin (BSA) and calf thymus(ct)-DNA have been investigated using different spectroscopic techniques coupled with viscosity measurements at physiological pH and 298 K. Regular amendments in emission intensities of BSA upon the action of the complex indicate significant interaction between them, and the binding interaction have been characterized by Stern Volmer plots and thermodynamic binding parameters. On the basis of this quenching technique one binding site with binding constant (Kb = (7.6 ± 0.21) × 105) between complex and protein have been obtained at 298 K. Time-resolved fluorescence studies have also been encountered to understand the mechanism of quenching induced by the complex. Binding affinities of the complex to the fluorophores of BSA namely tryptophan (Trp) and tyrosine (Tyr) have been judged by synchronous fluorescence studies. Secondary structural changes of BSA rooted by the complex has been revealed by CD spectra. On the other hand, hypochromicity of absorption spectra of the complex with the addition of ct-DNA and the gradual reduction in emission intensities of ethidium bromide bound ct-DNA in presence of the complex indicate noticeable interaction between ct-DNA and the complex with the binding constant (4.2 ± 0.11) × 106 M- 1. Life-time measurements have been studied to determine the relative amplitude of binding of the complex to ct-DNA base pairs. Mode of binding interaction of the complex with ct-DNA has been deciphered by viscosity measurements. CD spectra have also been used to understand the changes in ct-DNA structure upon binding with the metal complex. Density functional theory (DFT) and molecular docking analysis have been employed in highlighting the interactive phenomenon and binding location of the complex with the macromolecules.

  12. The Nucleotide-Free State of the Multidrug Resistance ABC Transporter LmrA: Sulfhydryl Cross-Linking Supports a Constant Contact, Head-to-Tail Configuration of the Nucleotide-Binding Domains.

    Directory of Open Access Journals (Sweden)

    Peter M Jones

    Full Text Available ABC transporters are integral membrane pumps that are responsible for the import or export of a diverse range of molecules across cell membranes. ABC transporters have been implicated in many phenomena of medical importance, including cystic fibrosis and multidrug resistance in humans. The molecular architecture of ABC transporters comprises two transmembrane domains and two ATP-binding cassettes, or nucleotide-binding domains (NBDs, which are highly conserved and contain motifs that are crucial to ATP binding and hydrolysis. Despite the improved clarity of recent structural, biophysical, and biochemical data, the seemingly simple process of ATP binding and hydrolysis remains controversial, with a major unresolved issue being whether the NBD protomers separate during the catalytic cycle. Here chemical cross-linking data is presented for the bacterial ABC multidrug resistance (MDR transporter LmrA. These indicate that in the absence of nucleotide or substrate, the NBDs come into contact to a significant extent, even at 4°C, where ATPase activity is abrogated. The data are clearly not in accord with an inward-closed conformation akin to that observed in a crystal structure of V. cholerae MsbA. Rather, they suggest a head-to-tail configuration 'sandwich' dimer similar to that observed in crystal structures of nucleotide-bound ABC NBDs. We argue the data are more readily reconciled with the notion that the NBDs are in proximity while undergoing intra-domain motions, than with an NBD 'Switch' mechanism in which the NBD monomers separate in between ATP hydrolysis cycles.

  13. Inhibition of the cardiac ATP-dependent potassium current by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Vornanen, Matti

    2014-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, in cardiomyocytes KB-R7943 also effectively blocks several K(+) currents including the delayed rectifier, IKr, and background inward rectifier, IK1. In the present study we analyze the effects of KB-R7943 on the ATP-dependent potassium current (IKATP) recorded by whole-cell patch-clamp in ventricular cardiomyocytes from a mammal (mouse) and a fish (crucian carp). IKATP was induced by external application of a mitochondrial uncoupler CCCP (3×10(-7) M) and internal perfusion of the cell with ATP-free pipette solution. A weakly inwardly rectifying current with a large outward component, recorded in the presence of CCCP, was blocked with 10(-5) M glibenclamide by 56.1±4.6% and 56.9±3.6% in crucian carp and mouse ventricular myocytes, respectively. In fish cardiomyocytes IKATP was blocked by KB-R7943 with an IC50 value of 3.14×10(-7) M, while in mammalian cells IC50 was 2.8×10(-6) M (PKB-R7943 inhibited CCCP-induced IKATP by 99.9±0.13% and 97.5±1.2% in crucian carp and mouse ventricular myocytes, respectively. In crucian carp the IKATP is about an order of magnitude more sensitive to KB-R7943 than the background IK1, but in mammals IKATP and IK1 are almost equally sensitive to KB-R7943. Therefore, the ability of KB-R7943 to block IKATP should be taken into account together with INCX inhibition when investigating possible cardioprotective effects of this compound. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. The Fine Structure Constant

    Indian Academy of Sciences (India)

    IAS Admin

    The article discusses the importance of the fine structure constant in quantum mechanics, along with the brief history of how it emerged. Al- though Sommerfelds idea of elliptical orbits has been replaced by wave mechanics, the fine struc- ture constant he introduced has remained as an important parameter in the field of ...

  15. Cosmological constants and variations

    International Nuclear Information System (INIS)

    Barrow, John D

    2005-01-01

    We review properties of theories for the variation of the gravitation and fine structure 'constants'. We highlight some general features of the cosmological models that exist in these theories with reference to recent quasar data that is consistent with time-variation in the fine structure 'constant' since a redshift of 3.5. The behaviour of a simple class of varying alpha cosmologies is outlined in the light of all the observational constraints. We also discuss some of the consequences of varying 'constants' for oscillating universes and show by means of exact solutions that they appear to evolve monotonically in time even though the scale factor of the universe oscillates

  16. Inhibition of the cardiac inward rectifier potassium currents by KB-R7943.

    Science.gov (United States)

    Abramochkin, Denis V; Alekseeva, Eugenia I; Vornanen, Matti

    2013-09-01

    KB-R7943 (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea) was developed as a specific inhibitor of the sarcolemmal sodium-calcium exchanger (NCX) with potential experimental and therapeutic use. However, KB-R7943 is shown to be a potent blocker of several ion currents including inward and delayed rectifier K(+) currents of cardiomyocytes. To further characterize KB-R7943 as a blocker of the cardiac inward rectifiers we compared KB-R7943 sensitivity of the background inward rectifier (IK1) and the carbacholine-induced inward rectifier (IKACh) currents in mammalian (Rattus norvegicus; rat) and fish (Carassius carassius; crucian carp) cardiac myocytes. The basal IK1 of ventricular myocytes was blocked with apparent IC50-values of 4.6×10(-6) M and 3.5×10(-6) M for rat and fish, respectively. IKACh was almost an order of magnitude more sensitive to KB-R7943 than IK1 with IC50-values of 6.2×10(-7) M for rat and 2.5×10(-7) M for fish. The fish cardiac NCX current was half-maximally blocked at the concentration of 1.9-3×10(-6) M in both forward and reversed mode of operation. Thus, the sensitivity of three cardiac currents to KB-R7943 block increases in the order IK1~INCXrectifier potassium currents, in particular IKACh, should be taken into account when interpreting the data with this inhibitor from in vivo and in vitro experiments in both mammalian and fish models. © 2013.

  17. The redesigned Forensic Research/Reference on Genetics-knowledge base, FROG-kb.

    Science.gov (United States)

    Kidd, Kenneth K; Soundararajan, Usha; Rajeevan, Haseena; Pakstis, Andrew J; Moore, Katherine N; Ropero-Miller, Jeri D

    2018-03-01

    The Forensic Resource/Reference on Genetics-knowledge base (FROG-kb) web site was introduced in 2011 and in the five years since the previous publication ongoing research into how the database can better serve forensics has resulted in extensive redesign of the database interface and functionality. Originally designed as a prototype to support forensic use of single nucleotide polymorphisms (SNPs), FROG-kb provides a freely accessible web interface that facilitates forensic practice and can be useful for teaching and research. Based on knowledge gained through its use, the web interface has been redesigned for easier navigation through the multiple components. The site also has functional enhancements, extensive new documentation, and new reference panels of SNPs with new curated data. FROG-kb focuses on single nucleotide polymorphisms (SNPs) and provides reference population data for several published panels of individual identification SNPs (IISNPs) and several published panels of ancestry inference SNPs (AISNPs). For each of the various marker panels with reference population data, FROG-kb calculates random match probabilities (RMP) and relative likelihoods of ancestry for a user-entered genotype profile (either completely or partially specified). Example genotype profiles are available and the User's Manual presents interpretation guidelines for the calculations. The extensive documentation along with ongoing updates makes FROG-kb a comprehensive tool in facilitating use of SNPs in forensic practice and education. An overview of the new FROG-kb with examples and material explaining the results of its use are presented here. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  18. A low-delay 8 Kb/s backward-adaptive CELP coder

    Science.gov (United States)

    Neumeyer, L. G.; Leblanc, W. P.; Mahmoud, S. A.

    1990-01-01

    Code excited linear prediction coding is an efficient technique for compressing speech sequences. Communications quality of speech can be obtained at bit rates below 8 Kb/s. However, relatively large coding delays are necessary to buffer the input speech in order to perform the LPC analysis. A low delay 8 Kb/s CELP coder is introduced in which the short term predictor is based on past synthesized speech. A new distortion measure that improves the tracking of the formant filter is discussed. Formal listening tests showed that the performance of the backward adaptive coder is almost as good as the conventional CELP coder.

  19. The cosmological constant problem

    International Nuclear Information System (INIS)

    Dolgov, A.D.

    1989-05-01

    A review of the cosmological term problem is presented. Baby universe model and the compensating field model are discussed. The importance of more accurate data on the Hubble constant and the Universe age is stressed. 18 refs

  20. Biochemical investigation of yttrium(III) complex containing 1,10-phenanthroline: DNA binding and antibacterial activity.

    Science.gov (United States)

    Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Moodi, Asieh; Niroomand, Sona

    2013-03-05

    Characterization of the interaction between yttrium(III) complex containing 1,10-phenanthroline as ligand, [Y(phen)2Cl(OH2)3]Cl2⋅H2O, and DNA has been carried out by UV absorption, fluorescence spectra and viscosity measurements in order to investigate binding mode. The experimental results indicate that the yttrium(III) complex binds to DNA and absorption is decreasing in charge transfer band with the increase in amount of DNA. The binding constant (Kb) at different temperatures as well as thermodynamic parameters, enthalpy change (ΔH°) and entropy change (ΔS°), were calculated according to relevant fluorescent data and Vant' Hoff equation. The results of interaction mechanism studies, suggested that groove binding plays a major role in the binding of the complex and DNA. The activity of yttrium(III) complex against some bacteria was tested and antimicrobial screening tests shown growth inhibitory activity in the presence of yttrium(III) complex. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Study on the effect of paclitaxel nanostructure lipid carrier cooperated with radiation on the KB Cells

    International Nuclear Information System (INIS)

    Liu Min; Li Zhihui; Xu Yujie

    2011-01-01

    Objective: To investigate the cytotoxicity effect of paclitaxel nanostructure lipid carrier (TAX-NLC) cooperated with radiation treatment on the KB cells. Methods: The cytotoxicity effect of TAX-NLC compared with free paclitaxel (TAX) on the KB cells was measured by MTT assay, and the cell cycle distribution was analyzed by flow cytometry. Results: The cytotoxicity effect of TAX-NLC was stronger than that of the free TAX. And the cooperative effect between the TAX-NLC and ionized radiation were observed, the cooperative effect of TAX-NLC was stronger than that of the free TAX. Flow cytometric analysis indicated that the rearrangement of cell cycle in KB cells were induced by TAX-NLC. The more G2/M phase cells were observed in KB cells treated by TAX-NLC compared with free TAX. The effect of TAX-NLC in the rearrangement of cell cycle was stronger than that of the free TAX. Conclusion: The cytotoxicity effect of TAX-NLC is stronger than that of the free TAX. And the cooperative effect of TAX-NLC is stronger than that of the free TAX. (authors)

  2. Structural and biophysical characterization of the PI4KB:14-3-3 protein complex

    Czech Academy of Sciences Publication Activity Database

    Chalupská, Dominika; Eisenreichová, Andrea; Rozycki, B.; Řežábková, L.; Humpolíčková, Jana; Klíma, Martin; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 191 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] Institutional support: RVO:61388963 Keywords : PI4KB * 14-3-3 proteins Subject RIV: CE - Biochemistry

  3. Report of the KB-WOT fisheries programme carried out in 2007

    NARCIS (Netherlands)

    Dickey-Collas, M.; Beek, van F.A.

    2008-01-01

    This report documents the activities of the KB WOT fisheries programme in 2007. It gives the results, products and documents the experienced gained by staff through the programme. It also shows how the individual projects fit into the research priority areas of WOT fisheries programme for 2007. The

  4. Introducing the Forensic Research/Reference on Genetics knowledge base, FROG-kb.

    Science.gov (United States)

    Rajeevan, Haseena; Soundararajan, Usha; Pakstis, Andrew J; Kidd, Kenneth K

    2012-09-01

    Online tools and databases based on multi-allelic short tandem repeat polymorphisms (STRPs) are actively used in forensic teaching, research, and investigations. The Fst value of each CODIS marker tends to be low across the populations of the world and most populations typically have all the common STRP alleles present diminishing the ability of these systems to discriminate ethnicity. Recently, considerable research is being conducted on single nucleotide polymorphisms (SNPs) to be considered for human identification and description. However, online tools and databases that can be used for forensic research and investigation are limited. The back end DBMS (Database Management System) for FROG-kb is Oracle version 10. The front end is implemented with specific code using technologies such as Java, Java Servlet, JSP, JQuery, and GoogleCharts. We present an open access web application, FROG-kb (Forensic Research/Reference on Genetics-knowledge base, http://frog.med.yale.edu), that is useful for teaching and research relevant to forensics and can serve as a tool facilitating forensic practice. The underlying data for FROG-kb are provided by the already extensively used and referenced ALlele FREquency Database, ALFRED (http://alfred.med.yale.edu). In addition to displaying data in an organized manner, computational tools that use the underlying allele frequencies with user-provided data are implemented in FROG-kb. These tools are organized by the different published SNP/marker panels available. This web tool currently has implemented general functions possible for two types of SNP panels, individual identification and ancestry inference, and a prediction function specific to a phenotype informative panel for eye color. The current online version of FROG-kb already provides new and useful functionality. We expect FROG-kb to grow and expand in capabilities and welcome input from the forensic community in identifying datasets and functionalities that will be most helpful

  5. Biomarkers’ Responses to Reductive Dechlorination Rates and Oxygen Stress in Bioaugmentation Culture KB-1TM

    Directory of Open Access Journals (Sweden)

    Gretchen L. W. Heavner

    2018-02-01

    Full Text Available Using mRNA transcript levels for key functional enzymes as proxies for the organohalide respiration (OHR rate, is a promising approach for monitoring bioremediation populations in situ at chlorinated solvent-contaminated field sites. However, to date, no correlations have been empirically derived for chlorinated solvent respiring, Dehalococcoides mccartyi (DMC containing, bioaugmentation cultures. In the current study, genome-wide transcriptome and proteome data were first used to confirm the most highly expressed OHR-related enzymes in the bioaugmentation culture, KB-1TM, including several reductive dehalogenases (RDases and a Ni-Fe hydrogenase, Hup. Different KB-1™ DMC strains could be resolved at the RNA and protein level through differences in the sequence of a common RDase (DET1545-like homologs and differences in expression of their vinyl chloride-respiring RDases. The dominant strain expresses VcrA, whereas the minor strain utilizes BvcA. We then used quantitative reverse-transcriptase PCR (qRT-PCR as a targeted approach for quantifying transcript copies in the KB-1TM consortium operated under a range of TCE respiration rates in continuously-fed, pseudo-steady-state reactors. These candidate biomarkers from KB-1TM demonstrated a variety of trends in terms of transcript abundance as a function of respiration rate over the range: 7.7 × 10−12 to 5.9 × 10−10 microelectron equivalents per cell per hour (μeeq/cell∙h. Power law trends were observed between the respiration rate and transcript abundance for the main DMC RDase (VcrA and the hydrogenase HupL (R2 = 0.83 and 0.88, respectively, but not transcripts for 16S rRNA or three other RDases examined: TceA, BvcA or the RDase DET1545 homologs in KB1TM. Overall, HupL transcripts appear to be the most robust activity biomarker across multiple DMC strains and in mixed communities including DMC co-cultures such as KB1TM. The addition of oxygen induced cell stress that caused respiration

  6. Biomarkers' Responses to Reductive Dechlorination Rates and Oxygen Stress in Bioaugmentation Culture KB-1TM.

    Science.gov (United States)

    Heavner, Gretchen L W; Mansfeldt, Cresten B; Debs, Garrett E; Hellerstedt, Sage T; Rowe, Annette R; Richardson, Ruth E

    2018-02-08

    Using mRNA transcript levels for key functional enzymes as proxies for the organohalide respiration (OHR) rate, is a promising approach for monitoring bioremediation populations in situ at chlorinated solvent-contaminated field sites. However, to date, no correlations have been empirically derived for chlorinated solvent respiring, Dehalococcoides mccartyi (DMC) containing, bioaugmentation cultures. In the current study, genome-wide transcriptome and proteome data were first used to confirm the most highly expressed OHR-related enzymes in the bioaugmentation culture, KB-1 TM , including several reductive dehalogenases (RDases) and a Ni-Fe hydrogenase, Hup. Different KB-1™ DMC strains could be resolved at the RNA and protein level through differences in the sequence of a common RDase (DET1545-like homologs) and differences in expression of their vinyl chloride-respiring RDases. The dominant strain expresses VcrA, whereas the minor strain utilizes BvcA. We then used quantitative reverse-transcriptase PCR (qRT-PCR) as a targeted approach for quantifying transcript copies in the KB-1 TM consortium operated under a range of TCE respiration rates in continuously-fed, pseudo-steady-state reactors. These candidate biomarkers from KB-1 TM demonstrated a variety of trends in terms of transcript abundance as a function of respiration rate over the range: 7.7 × 10 -12 to 5.9 × 10 -10 microelectron equivalents per cell per hour (μeeq/cell∙h). Power law trends were observed between the respiration rate and transcript abundance for the main DMC RDase (VcrA) and the hydrogenase HupL (R² = 0.83 and 0.88, respectively), but not transcripts for 16S rRNA or three other RDases examined: TceA, BvcA or the RDase DET1545 homologs in KB1 TM . Overall, HupL transcripts appear to be the most robust activity biomarker across multiple DMC strains and in mixed communities including DMC co-cultures such as KB1 TM . The addition of oxygen induced cell stress that caused respiration rates

  7. UniProtKB amid the turmoil of plant proteomics research

    Directory of Open Access Journals (Sweden)

    Michel eSchneider

    2012-12-01

    Full Text Available The UniProt knowledgebase (UniProtKB provides a single, centralized, authoritative resource for protein sequences and functional information. The majority of its records is based on automatic translation of coding sequences (CDS provided by submitters at the time of initial deposition to the nucleotide sequence databases (INSDC. More and more frequently, only the raw sequence of a complete genome is deposited to the nucleotide sequence databases and the gene model predictions and annotations are kept in separate, specialized model organism databases (MODs. In order to be able to provide the complete proteome of model organisms, UniProtKB had to implement pipelines for import of protein sequences from Ensembl and EnsemblGenomes.A single genome can be the target of several unrelated sequencing projects and the final assembly and gene model predictions may diverge quite significantly. In addition, several cultivars of the same species are often sequenced -1001 Arabidopsis cultivars are currently under way- and the resulting proteomes are far from being identical. Therefore, one challenge for UniProtKB is to store and organize these data in a convenient way and to clearly defined reference proteomes that should be made available to users. Manual annotation is one of the landmarks of the Swiss-Prot section of UniProtKB. Besides adding functional annotation, curators are checking, and often correcting, gene model predictions. For plants, this task is limited to Arabidopsis thaliana and Oryza sativa subsp japonica. Proteomics data providing experimental evidences confirming the existence of proteins or identifying sequence features such as post translational modifications are also imported into UniProtKB records and the knowledgebase is cross-referenced to numerous proteomics resources.

  8. Fabrication of nested elliptical KB mirrors using profile coating for synchrotron radiation X-ray focusing

    International Nuclear Information System (INIS)

    Liu Chian; Ice, G.E.; Liu, W.; Assoufid, L.; Qian, J.; Shi, B.; Khachatryan, R.; Wieczorek, M.; Zschack, P.; Tischler, J.Z.

    2012-01-01

    This paper describes fabrication methods used to demonstrate the advantages of nested or Montel optics for micro/nanofocusing of synchrotron X-ray beams. A standard Kirkpatrick-Baez (KB) mirror system uses two separated elliptical mirrors at glancing angles to the X-ray beam and sequentially arranged at 90° to each other to focus X-rays successively in the vertical and horizontal directions. A nested KB mirror system has the two mirrors positioned perpendicular and side-by-side to each other. Compared to a standard KB mirror system, Montel optics can focus a larger divergence and the mirrors can have a shorter focal length. As a result, nested mirrors can be fabricated with improved demagnification factor and ultimately smaller focal spot, than with a standard KB arrangement. The nested system is also more compact with an increased working distance, and is more stable, with reduced complexity of mirror stages. However, although Montel optics is commercially available for laboratory X-ray sources, due to technical difficulties they have not been used to microfocus synchrotron radiation X-rays, where ultra-precise mirror surfaces are essential. The main challenge in adapting nested optics for synchrotron microfocusing is to fabricate mirrors with a precise elliptical surface profile at the very edge where the two mirrors meet and where X-rays scatter. For example, in our application to achieve a sub-micron focus with high efficiency, a surface figure root-mean-square (rms) error on the order of 1 nm is required in the useable area along the X-ray footprint with a ∼0.1 mm-diameter cross section. In this paper we describe promising ways to fabricate precise nested KB mirrors using our profile coating technique and inexpensive flat Si substrates.

  9. Growth characteristics of Lactobacillus brevis KB290 in the presence of bile.

    Science.gov (United States)

    Kimoto-Nira, Hiromi; Suzuki, Shigenori; Suganuma, Hiroyuki; Moriya, Naoko; Suzuki, Chise

    2015-10-01

    Live Lactobacillus brevis KB290 have several probiotic activities, including immune stimulation and modulation of intestinal microbial balance. We investigated the adaptation of L. brevis KB290 to bile as a mechanism of intestinal survival. Strain KB290 was grown for 5 days at 37 °C in tryptone-yeast extract-glucose (TYG) broth supplemented with 0.5% sodium acetate (TYGA) containing 0.15%, 0.3%, or 0.5% bile. Growth was determined by absorbance at 620 nm or by dry weight. Growth was enhanced as the broth's bile concentration increased. Bile-enhanced growth was not observed in TYG broth or with xylose or fructose as the carbon source, although strain KB290 could assimilate these sugars. Compared with cells grown without bile, cells grown with bile had twice the cell yield (dry weight) and higher hydrophobicity, which may improve epithelial adhesion. Metabolite analysis revealed that bile induced more lactate production by glycolysis, thus enhancing growth efficiency. Scanning electron microscopy revealed that cells cultured without bile for 5 days in TYGA broth had a shortened rod shape and showed lysis and aggregation, unlike cells cultured for 1 day; cells grown with bile for 5 days had an intact rod shape and rarely appeared damaged. Cellular material leakage through autolysis was lower in the presence of bile than in its absence. Thus lysis of strain KB290 cells cultured for extended periods was suppressed in the presence of bile. This study provides new role of bile and sodium acetate for retaining an intact cell shape and enhancing cell yield, which are beneficial for intestinal survival. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Radiographic constant exposure technique

    DEFF Research Database (Denmark)

    Domanus, Joseph Czeslaw

    1985-01-01

    The constant exposure technique has been applied to assess various industrial radiographic systems. Different X-ray films and radiographic papers of two producers were compared. Special attention was given to fast film and paper used with fluorometallic screens. Radiographic image quality...... was tested by the use of ISO wire IQI's and ASTM penetrameters used on Al and Fe test plates. Relative speed and reduction of kilovoltage obtained with the constant exposure technique were calculated. The advantages of fast radiographic systems are pointed out...

  11. On the cosmical constant

    International Nuclear Information System (INIS)

    Chandra, R.

    1977-01-01

    On the grounds of the two correspondence limits, the Newtonian limit and the special theory limit of Einstein field equations, a modification of the cosmical constant has been proposed which gives realistic results in the case of a homogeneous universe. Also, according to this modification an explanation for the negative pressure in the steady-state model of the universe has been given. (author)

  12. Cosmological constant problem

    International Nuclear Information System (INIS)

    Weinberg, S.

    1989-01-01

    Cosmological constant problem is discussed. History of the problem is briefly considered. Five different approaches to solution of the problem are described: supersymmetry, supergravity, superstring; anthropic approach; mechamism of lagrangian alignment; modification of gravitation theory and quantum cosmology. It is noted that approach, based on quantum cosmology is the most promising one

  13. The Yamabe constant

    International Nuclear Information System (INIS)

    O Murchadha, N.

    1991-01-01

    The set of riemannian three-metrics with positive Yamabe constant defines the space of independent data for the gravitational field. The boundary of this set is investigated, and it is shown that metrics close to the boundary satisfy the positive-energy theorem. (Author) 18 refs

  14. In vitro Cytotoxicity, Pharmacokinetics, Tissue Distribution, and Metabolism of Small-Molecule Protein Kinase D Inhibitors, kb-NB142-70 and kb-NB165-09, in Mice bearing Human Cancer Xenografts

    Science.gov (United States)

    Guo, Jianxia; Clausen, Dana M.; Beumer, Jan H.; Parise, Robert A.; Egorin, Merrill J.; Bravo-Altamirano, Karla; Wipf, Peter; Sharlow, Elizabeth R.; Wang, Qiming Jane; Eiseman, Julie L.

    2012-01-01

    Purpose Protein kinase D (PKD) mediates diverse biological responses including cell growth and survival. Therefore, PKD inhibitors may have therapeutic potential. We evaluated the in vitro cytotoxicity of two PKD inhibitors, kb-NB142-70 and its methoxy analog, kb-NB165-09, and examined their in vivo efficacy and pharmacokinetics. Methods The in vitro cytotoxicities of kb-NB142-70 and kb-NB165-09 were evaluated by MTT assay against PC-3, androgen independent prostate cancer cells, and CFPAC-1 and PANC-1, pancreatic cancer cells. Efficacy studies were conducted in mice bearing either PC-3 or CPFAC-1 xenografts. Tumor-bearing mice were euthanized between 5 and 1440 min after iv dosing, and plasma and tissue concentrations were measured by HPLC-UV. Metabolites were characterized by LC-MS/MS. Results kb-NB142-70 and kb-NB165-09 inhibited cellular growth in the low-mid μM range. The compounds were inactive when administered to tumor-bearing mice. In mice treated with kb-NB142-70, the plasma Cmax was 36.9 nmol/mL and the PC-3 tumor Cmax was 11.8 nmol/g. In mice dosed with kb-NB165-09, the plasma Cmax was 61.9 nmol/mL while the PANC-1 tumor Cmax was 8.0 nmol/g. The plasma half-lives of kb-NB142-70 and kb-NB165-09 were 6 and 14 min, respectively. Both compounds underwent oxidation and glucuronidation. Conclusions kb-NB142-70 and kb-NB165-09 were rapidly metabolized, and concentrations in tumor were lower than those required for in vitro cytotoxicity. Replacement of the phenolic hydroxyl group with a methoxy group increased the plasma half-life of kb-NB165-09 2.3-fold over that of kb-NB142-70. Rapid metabolism in mice suggests that next-generation compounds will require further structural modifications to increase potency and/or metabolic stability. PMID:23108699

  15. Synthesis and DNA binding/cleavage of mononuclear copper(II) phenanthroline/bipyridine proline complexes.

    Science.gov (United States)

    Reddy, Pulimamidi R; Raju, Nomula; Manjula, Pallerla; Reddy, Karnati V G

    2007-07-01

    The complexes [Cu(II)(phen)(L-Pro)(H2O)]+ ClO4(-) (1; phen = 1,10-phenanthroline) and [Cu(II)(bipy)(L-Pro)(H2O)]+ ClO4(-) (2; bipy = 2,2'-bipyridine) were synthesized and characterized by IR, magnetic susceptibility, UV/VIS, EPR, ESI-MS, elemental analysis, and theoretical calculations. The metal center was found in a square-pyramidal geometry. UV/VIS, thermal-denaturation, and fluorescence-spectroscopic studies were conducted to assess the interaction of the complexes with CT-DNA. An intercalative mode of binding was found, with intrinsic binding constants (Kb) of 3.86x10(3) and 4.6x10(3) M(-1) and Stern-Volmer quenching constants (K) of 0.15 and 0.11 for 1 and 2, respectively. Interestingly, none of the Cu(II) complexes was able to cleave pUC-19 DNA, which is attributed to the absence of a Pro amide H-atom and inhibition of the formation of an OH radical from the axially coordinated H2O molecule.

  16. Production in constant evolution

    International Nuclear Information System (INIS)

    Lozano, T.

    2009-01-01

    The Cofrentes Nuclear Power Plant now has 25 years of operation behind it: a quarter century adding value and demonstrating the reasons why it is one of the most important energy producing facilities in the Spanish power market. Particularly noteworthy is the enterprising spirit of the plant, which has strived to continuously improve with the large number of modernization projects that it has undertaken over the past 25 years. The plant has constantly evolved thanks to the amount of investments made to improve safety and reliability and the perseverance to stay technologically up to date. Efficiency, training and teamwork have been key to the success of the plant over these 25 years of constant change and progress. (Author)

  17. Is the sun constant

    International Nuclear Information System (INIS)

    Blake, J.B.; Dearborn, D.S.P.

    1979-01-01

    Small fluctuations in the solar constant can occur on timescales much shorter than the Kelvin time. Changes in the ability of convection to transmit energy through the superadiabatic and transition regions of the convection zone cause structure adjustments which can occur on a time scale of days. The bulk of the convection zone reacts to maintain hydrostatic equilibrium (though not thermal equilibrium) and causes a luminosity change. While small radius variations will occur, most of the change will be seen in temperature

  18. Stabilized power constant alimentation

    International Nuclear Information System (INIS)

    Roussel, L.

    1968-06-01

    The study and realization of a stabilized power alimentation variable from 5 to 100 watts are described. In order to realize a constant power drift of Lithium compensated diodes, we have searched a 1 per cent precision of regulation and a response time minus than 1 sec. Recent components like Hall multiplicator and integrated amplifiers give this possibility and it is easy to use permutable circuits. (author) [fr

  19. Universe of constant

    Science.gov (United States)

    Yongquan, Han

    2016-10-01

    The ideal gas state equation is not applicable to ordinary gas, it should be applied to the Electromagnetic ``gas'' that is applied to the radiation, the radiation should be the ultimate state of matter changes or initial state, the universe is filled with radiation. That is, the ideal gas equation of state is suitable for the Singular point and the universe. Maybe someone consider that, there is no vessel can accommodate radiation, it is because the Ordinary container is too small to accommodate, if the radius of your container is the distance that Light through an hour, would you still think it can't accommodates radiation? Modern scientific determinate that the radius of the universe now is about 1027 m, assuming that the universe is a sphere whose volume is approximately: V = 4.19 × 1081 cubic meters, the temperature radiation of the universe (cosmic microwave background radiation temperature of the universe, should be the closest the average temperature of the universe) T = 3.15k, radiation pressure P = 5 × 10-6 N / m 2, according to the law of ideal gas state equation, PV / T = constant = 6 × 1075, the value of this constant is the universe, The singular point should also equal to the constant Author: hanyongquan

  20. Connecting Fundamental Constants

    International Nuclear Information System (INIS)

    Di Mario, D.

    2008-01-01

    A model for a black hole electron is built from three basic constants only: h, c and G. The result is a description of the electron with its mass and charge. The nature of this black hole seems to fit the properties of the Planck particle and new relationships among basic constants are possible. The time dilation factor in a black hole associated with a variable gravitational field would appear to us as a charge; on the other hand the Planck time is acting as a time gap drastically limiting what we are able to measure and its dimension will appear in some quantities. This is why the Planck time is numerically very close to the gravitational/electric force ratio in an electron: its difference, disregarding a π√(2) factor, is only 0.2%. This is not a coincidence, it is always the same particle and the small difference is between a rotating and a non-rotating particle. The determination of its rotational speed yields accurate numbers for many quantities, including the fine structure constant and the electron magnetic moment

  1. Kirkpatrick-Baez (KB) and Lobster Eye (LE) Optics for Astronomical and Laboratory Applications

    International Nuclear Information System (INIS)

    Hudec, R.; Hudec, R.

    2010-01-01

    Most of grazing incidence (reflective) X-ray imaging systems used in astronomy and in other (laboratory) applications are based on the Wolter 1 (or modified) arrangement. But there were proposed also other designs and configurations, which are considered for future applications for both in laboratory and (finitely) in space. The Kirkpatrick-Baez (KB) lenses as well as various types of Lobster-Eye (LE) optics and MCP/Micropore optics serve as an example. Analogously to Wolter lenses, the X-rays are mostly reflected twice in these systems to create focal images. The KB systems have already found wide usage in laboratory and synchrotron, both application are reviewed and discussed in detail in this paper. While this paper focuses on future possible applications of non-Wolter grazing incidence systems in space and astronomy, we also discuss in detail applications in other areas of science, where (in contrary to astronomy) some of these systems have demonstrated their advantages

  2. Alignment of KB mirrors with at-wavelength metrology tool simulated using SRW

    Science.gov (United States)

    Idir, Mourad; Rakitin, Maksim; Gao, Bo; Xue, Junpeng; Huang, Lei; Chubar, Oleg

    2017-08-01

    Synchrotron Radiation Workshop (SRW) is a powerful synchrotron radiation simulation tool and has been widely used at synchrotron facilities all over the world. During the last decade, many types of X-ray wavefront sensors have been developed and used. In this work, we present our recent effort on the development of at-wavelength metrology simulation based on SRW mainly focused on the Hartmann Wavefront Sensor (HWS). Various conditions have been studied to verify that the simulated HWS is performing as expected in terms of accuracy. This at-wavelength metrology simulation tool is then used to align KB mirrors by minimizing the wavefront aberrations. We will present our optimization process to perform an `in situ' alignment using conditions as close as possible to the real experiments (KB mirrors with different levels of figure errors or different misalignment geometry).

  3. Structural basis for hijacking of human ACBD3 and PI4KB proteins by picornaviruses

    Czech Academy of Sciences Publication Activity Database

    Klíma, Martin; Chalupská, Dominika; Rozycki, B.; Humpolíčková, Jana; Smola, Miroslav; Horová, Vladimíra; Hexnerová, Rozálie; Veverka, Václav; Toth, D.; Balla, T.; Bouřa, Evžen

    2017-01-01

    Roč. 284, Suppl 1 (2017), s. 129 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] R&D Projects: GA ČR(CZ) GJ17-07058Y; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : picornavirus * ACBD3 * PI4KB Subject RIV: CE - Biochemistry

  4. Deep functional analysis of synII, a 770 kb synthetic yeast chromosome

    OpenAIRE

    Shen, Yue; Wang, Yun; Chen, Tai; Gao, Feng; Gong, Jianhui; Abramczyk, Dariusz; Walker, Roy; Zhao, Hongcui; Chen, Shihong; Liu, Wei; Luo, Yisha; Müller, Carolin A.; Paul-Dubois-Taine, Adrien; Alver, Bonnie; Stracquadanio, Giovanni

    2017-01-01

    Herein we report the successful design, construction and characterization of a 770 kb synthetic yeast chromosome II (synII). Our study incorporates characterization at multiple levels, including phenomics, transcriptomics, proteomics, chromosome segregation and replication analysis to provide a thorough and comprehensive analysis of a synthetic chromosome. Our “Trans-Omics” analyses reveal a modest but potentially significant pervasive up-regulation of translational machinery observed in synI...

  5. Super-resolution imaging of a 2.5 kb non-repetitive DNA in situ in the nuclear genome using molecular beacon probes

    Science.gov (United States)

    Ni, Yanxiang; Cao, Bo; Ma, Tszshan; Niu, Gang; Huo, Yingdong; Huang, Jiandong; Chen, Danni; Liu, Yi; Yu, Bin; Zhang, Michael Q; Niu, Hanben

    2017-01-01

    High-resolution visualization of short non-repetitive DNA in situ in the nuclear genome is essential for studying looping interactions and chromatin organization in single cells. Recent advances in fluorescence in situ hybridization (FISH) using Oligopaint probes have enabled super-resolution imaging of genomic domains with a resolution limit of 4.9 kb. To target shorter elements, we developed a simple FISH method that uses molecular beacon (MB) probes to facilitate the probe-target binding, while minimizing non-specific fluorescence. We used three-dimensional stochastic optical reconstruction microscopy (3D-STORM) with optimized imaging conditions to efficiently distinguish sparsely distributed Alexa-647 from background cellular autofluorescence. Utilizing 3D-STORM and only 29–34 individual MB probes, we observed 3D fine-scale nanostructures of 2.5 kb integrated or endogenous unique DNA in situ in human or mouse genome, respectively. We demonstrated our MB-based FISH method was capable of visualizing the so far shortest non-repetitive genomic sequence in 3D at super-resolution. DOI: http://dx.doi.org/10.7554/eLife.21660.001 PMID:28485713

  6. Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA

    Science.gov (United States)

    Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

    2018-03-01

    DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking.

  7. The Hubble Constant

    Directory of Open Access Journals (Sweden)

    Neal Jackson

    2015-09-01

    Full Text Available I review the current state of determinations of the Hubble constant, which gives the length scale of the Universe by relating the expansion velocity of objects to their distance. There are two broad categories of measurements. The first uses individual astrophysical objects which have some property that allows their intrinsic luminosity or size to be determined, or allows the determination of their distance by geometric means. The second category comprises the use of all-sky cosmic microwave background, or correlations between large samples of galaxies, to determine information about the geometry of the Universe and hence the Hubble constant, typically in a combination with other cosmological parameters. Many, but not all, object-based measurements give H_0 values of around 72–74 km s^–1 Mpc^–1, with typical errors of 2–3 km s^–1 Mpc^–1. This is in mild discrepancy with CMB-based measurements, in particular those from the Planck satellite, which give values of 67–68 km s^–1 Mpc^–1 and typical errors of 1–2 km s^–1 Mpc^–1. The size of the remaining systematics indicate that accuracy rather than precision is the remaining problem in a good determination of the Hubble constant. Whether a discrepancy exists, and whether new physics is needed to resolve it, depends on details of the systematics of the object-based methods, and also on the assumptions about other cosmological parameters and which datasets are combined in the case of the all-sky methods.

  8. The inconstant solar constant

    International Nuclear Information System (INIS)

    Willson, R.C.; Hudson, H.

    1984-01-01

    The Active Cavity Radiometer Irradiance Monitor (ACRIM) of the Solar Maximum Mission satellite measures the radiant power emitted by the sun in the direction of the earth and has worked flawlessly since 1980. The main motivation for ACRIM's use to measure the solar constant is the determination of the extent to which this quantity's variations affect earth weather and climate. Data from the solar minimum of 1986-1987 is eagerly anticipated, with a view to the possible presence of a solar cycle variation in addition to that caused directly by sunspots

  9. Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate

    Science.gov (United States)

    Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Muhammad, Niaz; Shah, Naseer Ali; Sohail, Manzar; Pandarinathan, Vedapriya

    2015-08-01

    A new binuclear O-bridged Cu(II) complex with 4-chlorophenyl acetate and 2,2‧-bipyridine has been synthesized and characterized using FT-IR, powder and single crystal XRD and electrochemical solution studies. The results revealed that the two penta-coordinated Cu(II) centers are linked by two carboxylate ligands in end-on bonding fashion. The coordination geometry is slightly distorted square pyramidal (SP) with bridging oxygen atoms occupying the apical position and other ligands lying in the equatorial plane. The striking difference in Cu-O bond distance of the bridging oxygen atom in the complex may be responsible for the SP geometry of Cu(II) ion. The complex gave rise to metal centered irreversible electro-activity where one electron Cu(II)/Cu(III) oxidation process and a single step two electron Cu(II)/Cu(0) reduction process was observed. The redox processes were found predominantly adsorption controlled. The values of diffusion coefficient and heterogeneous rate constant for oxidation process were 6.98 × 10-7 cm2 s-1 and 4.60 × 10-5 cm s-1 while the corresponding values for reduction were 5.30 × 10-8 cm2 s-1 and 5.41 × 10-6 cm s-1, respectively. The formal potential and charge transfer coefficient were also calculated. The DNA-binding ability was explored through cyclic voltammetry and UV-Visible spectroscopy. Diminution in the value of Do for oxidation indicated the binding of the complex with DNA corresponding to Kb = 8.58 × 104 M-1. UV-Visible spectroscopy yielded ε = 49 L mol-1 cm-1 and Kb = 2.96 × 104 M-1. The data of both techniques support each other. The self-induced redox activation of the complex, as indicated by cyclic voltammetry heralds its potential applications in redox catalysis and anticancer activity.

  10. Aloin Inhibits Interleukin (IL)-1β-Stimulated IL-8 Production in KB Cells.

    Science.gov (United States)

    Na, Hee Sam; Song, Yu Ri; Kim, Seyeon; Heo, Jun-Young; Chung, Hae-Young; Chung, Jin

    2016-06-01

    Interleukin (IL)-1β, which is elevated in oral diseases including gingivitis, stimulates epithelial cells to produce IL-8 and perpetuate inflammatory responses. This study investigates stimulatory effects of salivary IL-1β in IL-8 production and determines if aloin inhibits IL-1β-stimulated IL-8 production in epithelial cells. Saliva was collected from volunteers to determine IL-1β and IL-8 levels. Samples from volunteers were divided into two groups: those with low and those with high IL-1β levels. KB cells were stimulated with IL-1β or saliva with or without IL-1 receptor agonist or specific mitogen-activated protein kinase (MAPK) inhibitors. IL-8 production was measured by enzyme-linked immunosorbent assay (ELISA). MAPK protein expression involved in IL-1β-induced IL-8 secretion was detected by Western blot. KB cells were pretreated with aloin, and its effect on IL-1β-induced IL-8 production was examined by ELISA and Western blot analysis. Saliva with high IL-1β strongly stimulated IL-8 production in KB cells, and IL-1 receptor agonist significantly inhibited IL-8 production. Low IL-1β-containing saliva did not increase IL-8 production. IL-1β treatment of KB cells induced activation of MAPK signaling molecules as well as nuclear factor-kappa B. IL-1β-induced IL-8 production was decreased by p38 and extracellular signal-regulated kinase (ERK) inhibitor treatment. Aloin pretreatment inhibited IL-1β-induced IL-8 production in a dose-dependent manner and inhibited activation of the p38 and ERK signaling pathway. Finally, aloin pretreatment also inhibited saliva-induced IL-8 production. Results indicated that IL-1β in saliva stimulates epithelial cells to produce IL-8 and that aloin effectively inhibits salivary IL-1β-induced IL-8 production by mitigating the p38 and ERK pathway. Therefore, aloin may be a good candidate for modulating oral inflammatory diseases.

  11. Potential constants and centrifugal distortion constants of octahedral hexafluoride molecules

    Energy Technology Data Exchange (ETDEWEB)

    Manivannan, G [Government Thirumagal Mill' s Coll., Gudiyattam, Tamil Nadu (India)

    1981-04-01

    The kinetic constants method outlined by Thirugnanasambandham (1964) based on Wilson's (1955) group theory has been adapted in evaluating the potential constants for SF/sub 6/, SeF/sub 6/, WF/sub 6/, IrF/sub 6/, UF/sub 6/, NpF/sub 6/, and PuF/sub 6/ using the experimentally observed vibrational frequency data. These constants are used to calculate the centrifugal distortion constants for the first time.

  12. Cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror

    International Nuclear Information System (INIS)

    Yuan Sheng; Goldberg, Kenneth A.; Yashchuk, Valeriy V.; Celestre, Richard; McKinney, Wayne R.; Morrison, Gregory; Macdougall, James; Mochi, Iacopo; Warwick, Tony

    2011-01-01

    At the Advanced Light Source (ALS), we are developing broadly applicable, high-accuracy, in-situ, at-wavelength wavefront slope measurement techniques for Kirkpatrick-Baez (KB) mirror nano-focusing. In this paper, we report an initial cross-check of ex-situ and in-situ metrology of a bendable temperature stabilized KB mirror. This cross-check provides a validation of the in-situ shearing interferometry, currently under development at the ALS.

  13. OC-2-KB: A software pipeline to build an evidence-based obesity and cancer knowledge base.

    Science.gov (United States)

    Lossio-Ventura, Juan Antonio; Hogan, William; Modave, François; Guo, Yi; He, Zhe; Hicks, Amanda; Bian, Jiang

    2017-11-01

    Obesity has been linked to several types of cancer. Access to adequate health information activates people's participation in managing their own health, which ultimately improves their health outcomes. Nevertheless, the existing online information about the relationship between obesity and cancer is heterogeneous and poorly organized. A formal knowledge representation can help better organize and deliver quality health information. Currently, there are several efforts in the biomedical domain to convert unstructured data to structured data and store them in Semantic Web knowledge bases (KB). In this demo paper, we present, OC-2-KB (Obesity and Cancer to Knowledge Base), a system that is tailored to guide the automatic KB construction for managing obesity and cancer knowledge from free-text scientific literature (i.e., PubMed abstracts) in a systematic way. OC-2-KB has two important modules which perform the acquisition of entities and the extraction then classification of relationships among these entities. We tested the OC-2-KB system on a data set with 23 manually annotated obesity and cancer PubMed abstracts and created a preliminary KB with 765 triples. We conducted a preliminary evaluation on this sample of triples and reported our evaluation results.

  14. Beyond the Hubble Constant

    Science.gov (United States)

    1995-08-01

    about the distances to galaxies and thereby about the expansion rate of the Universe. A simple way to determine the distance to a remote galaxy is by measuring its redshift, calculate its velocity from the redshift and divide this by the Hubble constant, H0. For instance, the measured redshift of the parent galaxy of SN 1995K (0.478) yields a velocity of 116,000 km/sec, somewhat more than one-third of the speed of light (300,000 km/sec). From the universal expansion rate, described by the Hubble constant (H0 = 20 km/sec per million lightyears as found by some studies), this velocity would indicate a distance to the supernova and its parent galaxy of about 5,800 million lightyears. The explosion of the supernova would thus have taken place 5,800 million years ago, i.e. about 1,000 million years before the solar system was formed. However, such a simple calculation works only for relatively ``nearby'' objects, perhaps out to some hundred million lightyears. When we look much further into space, we also look far back in time and it is not excluded that the universal expansion rate, i.e. the Hubble constant, may have been different at earlier epochs. This means that unless we know the change of the Hubble constant with time, we cannot determine reliable distances of distant galaxies from their measured redshifts and velocities. At the same time, knowledge about such change or lack of the same will provide unique information about the time elapsed since the Universe began to expand (the ``Big Bang''), that is, the age of the Universe and also its ultimate fate. The Deceleration Parameter q0 Cosmologists are therefore eager to determine not only the current expansion rate (i.e., the Hubble constant, H0) but also its possible change with time (known as the deceleration parameter, q0). Although a highly accurate value of H0 has still not become available, increasing attention is now given to the observational determination of the second parameter, cf. also the Appendix at the

  15. VenomKB, a new knowledge base for facilitating the validation of putative venom therapies.

    Science.gov (United States)

    Romano, Joseph D; Tatonetti, Nicholas P

    2015-11-24

    Animal venoms have been used for therapeutic purposes since the dawn of recorded history. Only a small fraction, however, have been tested for pharmaceutical utility. Modern computational methods enable the systematic exploration of novel therapeutic uses for venom compounds. Unfortunately, there is currently no comprehensive resource describing the clinical effects of venoms to support this computational analysis. We present VenomKB, a new publicly accessible knowledge base and website that aims to act as a repository for emerging and putative venom therapies. Presently, it consists of three database tables: (1) Manually curated records of putative venom therapies supported by scientific literature, (2) automatically parsed MEDLINE articles describing compounds that may be venom derived, and their effects on the human body, and (3) automatically retrieved records from the new Semantic Medline resource that describe the effects of venom compounds on mammalian anatomy. Data from VenomKB may be selectively retrieved in a variety of popular data formats, are open-source, and will be continually updated as venom therapies become better understood.

  16. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    Energy Technology Data Exchange (ETDEWEB)

    Tennyson, C.N.; Worton, R.G. [Univ. of Toronto and the Hospital for Sick Children, Ontario (Canada)

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  17. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    KAUST Repository

    Boudellioua, Imene; Saidi, Rabie; Hoehndorf, Robert; Martin, Maria J.; Solovyev, Victor

    2016-01-01

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations.

  18. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    KAUST Repository

    Boudellioua, Imene

    2016-07-08

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations.

  19. Apoptosis-Inducing Effect of Three Medicinal Plants on Oral Cancer Cells KB and ORL-48

    Directory of Open Access Journals (Sweden)

    Mohd Zabidi Majid

    2014-01-01

    Full Text Available Brucea javanica, Azadirachta indica, and Typhonium flagelliforme are medicinal plants commonly used to treat conditions associated with tumour formation. This study aimed to determine the antiproliferative activity of these plants extracts on KB and ORL-48 oral cancer cell lines and to suggest their mode of cell death. The concentration producing 50% cell inhibition (IC50 was determined and the activity was examined under an inverted microscope. Immunohistochemistry fluorescent staining method (TUNEL was performed to indicate the mechanism of cell death and the fragmented DNA band pattern produced was obtained for verification. Compared to Azadirachta sp. and Typhonium sp., the antiproliferative activity of Brucea sp. extract was the most potent on both KB and ORL-48 cells with IC50 of 24.37 ± 1.75 and 6.67 ± 1.15 µg/mL, respectively. Signs of cell attrition were observed 24 hr after treatment. Green fluorescent spots indicating cell death by apoptosis were observed in images of both cells following treatment with all the three extracts. DNA fragments harvested from Brucea-treated cells produced bands in a ladder pattern suggesting the apoptotic effect of the extract. It is thus concluded that Brucea sp. extract exhibited cytotoxic activity on ORL-48 cells and their action mechanism is via apoptosis.

  20. Association constants of telluronium salts

    International Nuclear Information System (INIS)

    Kovach, N.A.; Rivkin, B.B.; Sadekov, T.D.; Shvajka, O.P.

    1996-01-01

    Association constants in acetonitrile of triphenyl telluronium salts, which are dilute electrolytes, are determined through the conductometry method. Satisfactory correlation dependence of constants of interion association and threshold molar electroconductivity on the Litvinenko-Popov constants for depositing groups is identified. 6 refs

  1. Anisotropic constant-roll inflation

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Asuka; Soda, Jiro [Kobe University, Department of Physics, Kobe (Japan)

    2018-01-15

    We study constant-roll inflation in the presence of a gauge field coupled to an inflaton. By imposing the constant anisotropy condition, we find new exact anisotropic constant-roll inflationary solutions which include anisotropic power-law inflation as a special case. We also numerically show that the new anisotropic solutions are attractors in the phase space. (orig.)

  2. Quintessence and the cosmological constant

    International Nuclear Information System (INIS)

    Doran, M.; Wetterich, C.

    2003-01-01

    Quintessence -- the energy density of a slowly evolving scalar field -- may constitute a dynamical form of the homogeneous dark energy in the universe. We review the basic idea in the light of the cosmological constant problem. Cosmological observations or a time variation of fundamental 'constants' can distinguish quintessence from a cosmological constant

  3. A sequential binding mechanism in a PDZ domain

    DEFF Research Database (Denmark)

    Chi, Celestine N; Bach, Anders; Engström, Åke

    2009-01-01

    that ligand binding involves at least a two-step process. By using an ultrarapid continuous-flow mixer, we then detected a hyperbolic dependence of binding rate constants on peptide concentration, corroborating the two-step binding mechanism. Furthermore, we found a similar dependence of the rate constants...

  4. Loss of retrovirus production in JB/RH melanoma cells transfected with H-2Kb and TAP-1 genes.

    Science.gov (United States)

    Li, M; Xu, F; Muller, J; Huang, X; Hearing, V J; Gorelik, E

    1999-01-20

    JB/RH1 melanoma cells, as well as other melanomas of C57BL/6 mice (B16 and JB/MS), express a common melanoma-associated antigen (MAA) encoded by an ecotropic melanoma-associated retrovirus (MelARV). JB/RH1 cells do not express the H-2Kb molecules due to down-regulation of the H-2Kb and TAP-1 genes. When JB/RH1 cells were transfected with the H-2Kb and cotransfected with the TAP-1 gene, it resulted in the appearance of H-2Kb molecules and an increase in their immunogenicity, albeit they lost expression of retrovirus-encoded MAA recognized by MM2-9B6 mAb. Loss of MAA was found to result from a complete and stable elimination of ecotropic MelARV production in the H-2Kb/TAP-1-transfected JB/RH1 cells. Northern blot analysis showed no differences in ecotropic retroviral messages in MelARV-producing and -nonproducing melanoma cells, suggesting that loss of MelARV production was not due to down-regulation of MelARV transcription. Southern blot analysis revealed several rearrangements in the proviral DNA of H-2Kb-positive JB/RH1 melanoma cells. Sequence analysis of the ecotropic proviral DNA from these cells showed numerous nucleotide substitutions, some of which resulted in the appearance of a novel intraviral PstI restriction site and the loss of a HindIII restriction site in the pol region. PCR amplification of the proviral DNAs indicates that an ecotropic provirus found in the H-2Kb-positive cells is novel and does not preexist in the parental H-2Kb-negative melanoma cells. Conversely, the ecotropic provirus of the parental JB/RH1 cells was not amplifable from the H-2Kb-positive cells. Our data indicate that stable loss of retroviral production in the H-2Kb/TAP-1-transfected melanoma cells is probably due to the induction of recombination between a productive ecotropic MelARV and a defective nonecotropic provirus leading to the generation of a defective ecotropic provirus and the loss of MelARV production and expression of the retrovirus-encoded MAA. Copyright 1999

  5. ct-DNA Binding and Antibacterial Activity of Octahedral Titanium (IV Heteroleptic (Benzoylacetone and Hydroxamic Acids Complexes

    Directory of Open Access Journals (Sweden)

    Raj Kaushal

    2016-01-01

    Full Text Available Five structurally related titanium (IV heteroleptic complexes, [TiCl2(bzac(L1–4] and [TiCl3(bzac(HL5]; bzac = benzoylacetonate; L1–5 = benzohydroximate (L1, salicylhydroximate (L2, acetohydroximate (L3, hydroxyurea (L4, and N-benzoyl-N-phenyl hydroxylamine (L5, were used for the assessment of their antibacterial activities against ten pathogenic bacterial strains. The titanium (IV complexes (1–5 demonstrated significant level of antibacterial properties as measured using agar well diffusion method. UV-Vis absorption spectroscopic technique was applied, to get a better insight into the nature of binding between titanium (IV complexes with calf thymus DNA (ct-DNA. On the basis of the results of UV-Vis absorption spectroscopy, the interaction between ct-DNA and the titanium (IV complexes is likely to occur through the same mode. Results indicated that titanium (IV complex can bind to calf thymus DNA (ct-DNA via an intercalative mode. The intrinsic binding constant (Kb was calculated by absorption spectra by using Benesi-Hildebrand equation. Further, Gibbs free energy was also calculated for all the complexes.

  6. Binding of naringin and naringenin with hen egg white lysozyme: A spectroscopic investigation and molecular docking study

    Science.gov (United States)

    Das, Sourav; Ghosh, Pooja; Koley, Sudipta; Singha Roy, Atanu

    2018-03-01

    The interactions of naringenin (NG) and naringin (NR) with Hen Egg White Lysozyme (HEWL) in aqueous medium have been investigated using UV-vis spectroscopy, steady-state fluorescence, circular dichroism (CD), Fourier Transform infrared spectroscopy (FT-IR) and molecular docking analyses. Both NG and NR can quench the intrinsic fluorescence of HEWL via static quenching mechanism. At 300 K, the value of binding constant (Kb) of HEWL-NG complex (5.596 ± 0.063 × 104 M- 1) was found to be greater than that of HEWL-NR complex (3.404 ± 0.407 × 104 M- 1). The negative ΔG° values in cases of both the complexes specify the spontaneous binding. The binding distance between the donor (HEWL) and acceptor (NG/NR) was estimated using the Försters theory and the possibility of non-radiative energy transfer from HEWL to NG/NR was observed. The presence of metal ions (Ca2 +, Cu2 + and Fe2 +) decreased the binding affinity of NG/NR towards HEWL. Synchronous fluorescence studies indicate the change in Trp micro-environment due to the incorporation of NG/NR into HEWL. CD and FT-IR studies indicated that the α-helicity of the HEWL was slightly enhanced due to ligand binding. NG and NR inhibited the enzymatic activity of HEWL and exhibited their affinity for the active site of HEWL. Molecular docking studies revealed that both NG and NR bind in the close vicinity of Trp 62 and Trp 63 residues which is vital for the catalytic activity.

  7. Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway

    Science.gov (United States)

    KIM, JAE-SUNG; PARK, MI-RA; LEE, SOOK-YOUNG; KIM, DO KYOUNG; MOON, SUNG-MIN; KIM, CHUN SUNG; CHO, SEUNG SIK; YOON, GOO; IM, HEE-JEONG; YOU, JAE-SEEK; OH, JI-SU; KIM, SU-GWAN

    2014-01-01

    Licochalcone A (Lico-A) is a natural phenol licorice compound with multiple bioactivities, including anti-inflammatory, anti-microbial, anti-fungal and osteogenesis-inducing properties. In the present study, we investigated the Lico-A-induced apoptotic effects and examined the associated apoptosis pathway in KB human oral cancer cells. Lico-A decreased the number of viable KB oral cancer cells. However, Lico-A did not have an effect on primary normal human oral keratinocytes. In addition, the IC50 value of Lico-A was determined to be ~50 μM following dose-dependent stimulation. KB oral cancer cells stimulated with Lico-A for 24 h showed chromatin condensation by DAPI staining, genomic DNA fragmentation by agarose gel electrophoresis and a gradually increased apoptotic cell population by FACS analysis. These data suggest that Lico-A induces apoptosis in KB oral cancer cells. Additionally, Lico-A-induced apoptosis in KB oral cancer cells was mediated by the expression of factor associated suicide ligand (FasL) and activated caspase-8 and −3 and poly(ADP-ribose) polymerase (PARP). Furthermore, in the KB oral cancer cells co-stimulation with a caspase inhibitor (Z-VAD-fmk) and Lico-A significantly abolished the apoptotic phenomena. Our findings demonstrated that Lico-A-induced apoptosis in KB oral cancer cells involves the extrinsic apoptotic signaling pathway, which involves a caspase-dependent FasL-mediated death receptor pathway. Our data suggest that Lico-A be developed as a chemotherapeutic agent for the management of oral cancer. PMID:24337492

  8. Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway.

    Science.gov (United States)

    Kim, Jae-Sung; Park, Mi-Ra; Lee, Sook-Young; Kim, Do Kyoung; Moon, Sung-Min; Kim, Chun Sung; Cho, Seung Sik; Yoon, Goo; Im, Hee-Jeong; You, Jae-Seek; Oh, Ji-Su; Kim, Su-Gwan

    2014-02-01

    Licochalcone A (Lico-A) is a natural phenol licorice compound with multiple bioactivities, including anti-inflammatory, anti-microbial, anti-fungal and osteogenesis-inducing properties. In the present study, we investigated the Lico-A-induced apoptotic effects and examined the associated apoptosis pathway in KB human oral cancer cells. Lico-A decreased the number of viable KB oral cancer cells. However, Lico-A did not have an effect on primary normal human oral keratinocytes. In addition, the IC50 value of Lico-A was determined to be ~50 µM following dose-dependent stimulation. KB oral cancer cells stimulated with Lico-A for 24 h showed chromatin condensation by DAPI staining, genomic DNA fragmentation by agarose gel electrophoresis and a gradually increased apoptotic cell population by FACS analysis. These data suggest that Lico-A induces apoptosis in KB oral cancer cells. Additionally, Lico‑A‑induced apoptosis in KB oral cancer cells was mediated by the expression of factor associated suicide ligand (FasL) and activated caspase-8 and -3 and poly(ADP-ribose) polymerase (PARP). Furthermore, in the KB oral cancer cells co-stimulation with a caspase inhibitor (Z-VAD-fmk) and Lico-A significantly abolished the apoptotic phenomena. Our findings demonstrated that Lico‑A-induced apoptosis in KB oral cancer cells involves the extrinsic apoptotic signaling pathway, which involves a caspase-dependent FasL-mediated death receptor pathway. Our data suggest that Lico-A be developed as a chemotherapeutic agent for the management of oral cancer.

  9. The Half-Life of the HSV-1 1.5 kb LAT Intron is similar to the half-Life of the 2.0 kb LAT Intron

    Science.gov (United States)

    Brinkman, Kerry K.; Mishra, Prakhar; Fraser, Nigel W.

    2013-01-01

    Herpes Simplex Virus type 1 (HSV-1) establishes a latent infection in the sensory neurons of the peripheral nervous system of humans. Although about 80 genes are expressed during the lytic cycle of the virus infection, essentially only one gene is expressed during the latent cycle. This gene is known as the latency associated transcript (LAT) and it appears to play a role in the latency cycle through an anti-apoptotic function in the 5’ end of the gene and miRNA encoded along the length of the transcript which down regulate some of the viral immediate early (IE) gene products. The LAT gene is about 8.3 kb long and consists of two exons separated by an unusual intron. The intron between the exons consists of two nested introns. This arrangement of introns has been called a twintron. Furthermore, the larger (2 kb) intron has been shown to be very stable. In this study we measure the stability of the shorter 1.5 kb nested intron and find its half-life is similar to the longer intron. This was achieved by deleting the 0.5 kb overlapping intron from a plasmid construct designed to express the LAT transcript from a tet-inducible promoter, and measuring the half-life of the 1.5 kb intron in tissue culture cells. This finding supports the hypothesis that it is the common branch-point region of these nested introns that is responsible for their stability. PMID:23335177

  10. Phylogeography, salinity adaptations and metabolic potential of the Candidate Division KB1 Bacteria based on a partial single cell genome.

    Directory of Open Access Journals (Sweden)

    Lisa M Nigro

    2016-08-01

    Full Text Available Deep-sea hypersaline anoxic basins (DHABs and other hypersaline environments contain abundant and diverse microbial life that has adapted to these extreme conditions. The bacterial Candidate Division KB1 represents one of several uncultured groups that has been consistently observed in hypersaline microbial diversity studies. Here we report the phylogeography of KB1, its phylogenetic relationships to Candidate Division OP1 Bacteria, and its potential metabolic and osmotic stress adaptations based on a partial single cell amplified genome (SAG of KB1 from Orca Basin, the largest hypersaline seafloor brine basin in the Gulf of Mexico. Our results are consistent with the hypothesis – previously developed based on 14C incorporation experiments with mixed-species enrichments from Mediterranean seafloor brines - that KB1 has adapted its proteins to elevated intracellular salinity, but at the same time KB1 apparently imports glycine betaine; this compatible solute is potentially not limited to osmoregulation but could also serve as a carbon and energy source.

  11. STUDI NILAI ANAK, JUMLAH ANAK YANG DIINGINKAN, DAN KEIKUTSERTAAN ORANG TUA DALAM PROGRAM KB

    Directory of Open Access Journals (Sweden)

    Hartoyo Hartoyo

    2011-01-01

    Full Text Available  This research was to analyze the correlation between mother and family characteristics with value of children and the influence factors of demand for children and involvement of parent in family planning programme. This research involved 60 families who be acceptor and non-acceptor KB that were selected randomly. Mother’s age had significant correlation with power and influence dimension, working status of mother had significant correlation with stimulation and fun dimension and morality dimension, mother’s education had significant correlation with morality dimension, the number of living children had significant correlation with adult status and social identity dimension and economic utility and security in old age dimension. Moreover, family size variable had significant positive influence to demand for children. Beside that, age of mother’s first marriage and difference of the number of living children with demand for children had significant positive influence to participating family in family planning programme. 

  12. Deep functional analysis of synII, a 770 kb synthetic yeast chromosome

    Science.gov (United States)

    Gao, Feng; Gong, Jianhui; Abramczyk, Dariusz; Walker, Roy; Zhao, Hongcui; Chen, Shihong; Liu, Wei; Luo, Yisha; Müller, Carolin A.; Paul-Dubois-Taine, Adrien; Alver, Bonnie; Stracquadanio, Giovanni; Mitchell, Leslie A.; Luo, Zhouqing; Fan, Yanqun; Zhou, Baojin; Wen, Bo; Tan, Fengji; Wang, Yujia; Zi, Jin; Xie, Zexiong; Li, Bingzhi; Yang, Kun; Richardson, Sarah M.; Jiang, Hui; French, Christopher E.; Nieduszynski, Conrad A.; Koszul, Romain; Marston, Adele L.; Yuan, Yingjin; Wang, Jian; Bader, Joel S.; Dai, Junbiao; Boeke, Jef D.; Xu, Xun; Cai, Yizhi; Yang, Huanming

    2017-01-01

    Herein we report the successful design, construction and characterization of a 770 kb synthetic yeast chromosome II (synII). Our study incorporates characterization at multiple levels, including phenomics, transcriptomics, proteomics, chromosome segregation and replication analysis to provide a thorough and comprehensive analysis of a synthetic chromosome. Our “Trans-Omics” analyses reveal a modest but potentially significant pervasive up-regulation of translational machinery observed in synII is mainly caused by the deletion of 13 tRNAs. By both complementation assays and SCRaMbLE, we targeted and debuged the origin of a growth defect at 37°C in glycerol medium, which is related to misregulation of the HOG response. Despite the subtle differences, the synII strain shows highly consistent biological processes comparable to the native strain. PMID:28280153

  13. A 320 mV, 6 kb subthreshold 10T SRAM employing voltage lowering techniques

    International Nuclear Information System (INIS)

    Cai Jiangzheng; Zhang Sumin; Yuan Jia; Shang Xinchao; Chen Liming; Hei Yong

    2015-01-01

    This paper presents a 6 kb SRAM that uses a novel 10T cell to achieve a minimum operating voltage of 320 mV in a 130 nm CMOS process. A number of low power circuit techniques are included to enable the proposed SRAM to operate in the subthreshold region. The reverse short channel effect and the reverse narrow channel effect are utilized to improve the performance of the SRAM. A novel subthreshold pulse generation circuit produces an ideal pulse to make read operation stable. A floating write bit-line effectively reduces the standby leakage consumption. Finally, a short read bit-line makes the read operation fast and energy-saving. Measurements indicate that these techniques are effective, the SRAM can operate at 800 kHz and consume 1.94 μW at its lowest voltage (320 mV). (paper)

  14. Identities of P2 and P3 Residues of H-2Kb-Bound Peptides Determine Mouse Ly49C Recognition.

    Directory of Open Access Journals (Sweden)

    Elsa A Marquez

    Full Text Available Ly49 receptors can be peptide selective in their recognition of MHC-I-peptide complexes, affording them a level of discrimination beyond detecting the presence or absence of specific MHC-I allele products. Despite this ability, little is understood regarding the properties that enable some peptides, when bound to MHC-I molecules, to support Ly49 recognition, but not others. Using RMA-S target cells expressing MHC-I molecules loaded with individual peptides and effector cells expressing the ectodomain of the inhibitory Ly49C receptor, we found that two adjacent amino acid residues, P2 and P3, both buried in the peptide binding groove of H-2Kb, determine mouse Ly49C specificity. If both are aliphatic residues, this is supportive. Whereas, small amino acids at P2 and aromatic amino acids at the P3 auxiliary anchor residue are detrimental to Ly49C recognition. These results resemble those with a rat Ly49 where the identity of a peptide anchor residue determines recognition, suggesting that dependence on specific peptide residues buried in the MHC-I peptide-binding groove may be fundamental to Ly49 peptide selectivity and recognition.

  15. Enhanced Salt Tolerance Conferred by the Complete 2.3 kb cDNA of the Rice Vacuolar Na(+)/H(+) Antiporter Gene Compared to 1.9 kb Coding Region with 5' UTR in Transgenic Lines of Rice.

    Science.gov (United States)

    Amin, U S M; Biswas, Sudip; Elias, Sabrina M; Razzaque, Samsad; Haque, Taslima; Malo, Richard; Seraj, Zeba I

    2016-01-01

    Soil salinity is one of the most challenging problems that restricts the normal growth and production of rice worldwide. It has therefore become very important to produce more saline tolerant rice varieties. This study shows constitutive over-expression of the vacuolar Na(+)/H(+) antiporter gene (OsNHX1) from the rice landrace (Pokkali) and attainment of enhanced level of salinity tolerance in transgenic rice plants. It also shows that inclusion of the complete un-translated regions (UTRs) of the alternatively spliced OsNHX1 gene provides a higher level of tolerance to the transgenic rice. Two separate transformation events of the OsNHX1 gene, one with 1.9 kb region containing the 5' UTR with CDS and the other of 2.3 kb, including 5' UTR, CDS, and the 3' UTR regions were performed. The transgenic plants with these two different constructs were advanced to the T3 generation and physiological and molecular screening of homozygous plants was conducted at seedling and reproductive stages under salinity (NaCl) stress. Both transgenic lines were observed to be tolerant compared to WT plants at both physiological stages. However, the transgenic lines containing the CDS with both the 5' and 3' UTR were significantly more tolerant compared to the transgenic lines containing OsNHX1 gene without the 3' UTR. At the seedling stage at 12 dS/m stress, the chlorophyll content was significantly higher (P kb > 1.9 kb > and WT lines. Yield in g/plant in the best line from the 2.3 kb plants was significantly more (P kb line and WT plants at stress of 6 dS/m. Transformation with the complete transcripts rather than the CDS may therefore provide more durable level of tolerance.

  16. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1

    International Nuclear Information System (INIS)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-01-01

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1

  17. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1.

    Science.gov (United States)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-04-04

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1.

  18. The reverse-mode NCX1 activity inhibitor KB-R7943 promotes prostate cancer cell death by activating the JNK pathway and blocking autophagic flux.

    Science.gov (United States)

    Long, Zhou; Chen, BaiJun; Liu, Qian; Zhao, Jiang; Yang, ZhenXing; Dong, XingYou; Xia, LiuBin; Huang, ShengQuan; Hu, XiaoYan; Song, Bo; Li, LongKun

    2016-07-05

    We explored the effects of KB-R7943, an inhibitor of reverse-mode NCX1 activity, in prostate cancer (PCa). NCX1 was overexpressed in PCa tissues and cell lines, and higher NCX1 levels were associated higher PCa grades. At concentrations greater than 10 μM, KB-R7943 dose-dependently decreased PC3 and LNCaP cell viability. KB-R7943 also increased cell cycle G1/S phase arrest and induced apoptosis in PC3 cells. KB-R7943 increased autophagosome accumulation in PCa cells as indicated by increases in LC3-II levels and eGFP-LC3 puncta. Combined treatment with chloroquine (CQ) and KB-R7943 decreased P62 and increased LC3-II protein levels in PC3 cells, indicating that KB-R7943 blocked autophagic flux. KB-R7943 induced autophagosome accumulation mainly by downregulating the PI3K/AKT/m-TOR pathway and upregulating the JNK pathway. In xenograft experiments, KB-R7943 inhibited tumor growth. Combined treatment with KB-R7943 and an autophagy inhibitor inhibited growth and increased apoptosis. These results indicate that KB-R7943 promotes cell death in PCa by activating the JNK signaling pathway and blocking autophagic flux.

  19. Vitamin K3 disrupts the microtubule networks by binding to tubulin: a novel mechanism of its antiproliferative activity.

    Science.gov (United States)

    Acharya, Bipul R; Choudhury, Diptiman; Das, Amlan; Chakrabarti, Gopal

    2009-07-28

    Vitamin K3 (2-methyl-1,4-naphthoquinone), also known as menadione, is the synthetic precursor of all the naturally occurring vitamin K in the body. Vitamin K is necessary for the production of prothrombin and five other blood-clotting factors in humans. We have examined the effects of menadione on cellular microtubules ex vivo as well as its binding with purified tubulin and microtubules in vitro. Cell viability experiments using human cervical epithelial cancer cells (HeLa) and human oral epithelial cancer cells (KB) indicated that the IC(50) values for menadione are 25.6 +/- 0.6 and 64.3 +/- 0.36 microM, respectively, in those cells. Mendione arrests HeLa cells in mitosis. Immunofluorescence studies using an anti-alpha-tubulin antibody showed a significant irreversible depolymeriztion of the interphase microtubule network and spindle microtubule in a dose-dependent manner. In vitro polymerization of purified tubulin into microtubules is inhibited by menadione with an IC(50) value of 47 +/- 0.65 microM. The binding of menadione with tubulin was studied using menadione fluorescence and intrinsic tryptophan fluorescence of tubulin. Binding of menadione to tubulin is slow, taking 35 min for equilibration at 25 degrees C. The association reaction kinetics is biphasic in nature, and the association rate constants for fast and slow phases are 189.12 +/- 17 and 32.44 +/- 21 M(-1) s(-1) at 25 degrees C, respectively. The stoichiometry of menadione binding to tubulin is 1:1 (molar ratio) with a dissociation constant from 2.44 +/- 0.34 to 3.65 +/- 0.25 microM at 25 degrees C. Menadione competes for the colchicine binding site with a K(i) of 2.5 muM as determined from a modified Dixon plot. The obtained data suggested that menadione binds at the colchicine binding site to tubulin. Thus, we can conclude one novel mechanism of inhibition of cancer cell proliferation by menadione is through tubulin binding.

  20. Elongational flow of polymer melts at constant strain rate, constant stress and constant force

    Science.gov (United States)

    Wagner, Manfred H.; Rolón-Garrido, Víctor H.

    2013-04-01

    Characterization of polymer melts in elongational flow is typically performed at constant elongational rate or rarely at constant tensile stress conditions. One of the disadvantages of these deformation modes is that they are hampered by the onset of "necking" instabilities according to the Considère criterion. Experiments at constant tensile force have been performed even more rarely, in spite of the fact that this deformation mode is free from necking instabilities and is of considerable industrial relevance as it is the correct analogue of steady fiber spinning. It is the objective of the present contribution to present for the first time a full experimental characterization of a long-chain branched polyethylene melt in elongational flow. Experiments were performed at constant elongation rate, constant tensile stress and constant tensile force by use of a Sentmanat Extensional Rheometer (SER) in combination with an Anton Paar MCR301 rotational rheometer. The accessible experimental window and experimental limitations are discussed. The experimental data are modelled by using the Wagner I model. Predictions of the steady-start elongational viscosity in constant strain rate and creep experiments are found to be identical, albeit only by extrapolation of the experimental data to Hencky strains of the order of 6. For constant stress experiments, a minimum in the strain rate and a corresponding maximum in the elongational viscosity is found at a Hencky strain of the order of 3, which, although larger than the steady-state value, follows roughly the general trend of the steady-state elongational viscosity. The constitutive analysis also reveals that constant tensile force experiments indicate a larger strain hardening potential than seen in constant elongation rate or constant tensile stress experiments. This may be indicative of the effect of necking under constant elongation rate or constant tensile stress conditions according to the Considère criterion.

  1. NcoI dimorphic site located 8kb 3' to the human apolipoprotein AIV (APOA4) gene

    Energy Technology Data Exchange (ETDEWEB)

    Coleman, R T; Malloy, M J; Kane, J P; Frossard, P M

    1988-02-11

    pA4C3 a 0.5kb fragment from the 3' end of the human apolipoprotein AIV cDNA was isolated from a human intestine cDNA library and cloned into the EcoRI site of the plasmid pUC18. NcoI (CCATGG) (New England Biolabs) detects a single two-allele polymorphism with a band at either 18.6kb or at 12.6kb. The human apolipoprotein AI-CIII-AIV gene complex has been assigned to the long arm of chromosome 11 by Southern blot analysis of human-Chinese hamster cell hybrids. Co-dominant segregation was demonstrated in one family of six individuals.

  2. Synthesis and Structural Investigation of New Bio-Relevant Complexes of Lanthanides with 5-Hydroxyflavone: DNA Binding and Protein Interaction Studies

    Directory of Open Access Journals (Sweden)

    Alexandra-Cristina Munteanu

    2016-12-01

    Full Text Available In the present work, we attempted to develop new metal coordination complexes of the natural flavonoid 5-hydroxyflavone with Sm(III, Eu(III, Gd(III, Tb(III. The resultant hydroxo complexes have been characterized by a variety of spectroscopic techniques, including fluorescence, FT-IR, UV-Vis, EPR and mass spectral studies. The general chemical formula of the complexes is [Ln(C15H9O33(OH2(H2Ox]·nH2O, where Ln is the lanthanide cation and x = 0 for Sm(III, x = 1 for Eu(III, Gd(III, Tb(III and n = 0 for Sm(III, Gd(III, Tb(III, n = 1 for Eu(III, respectively. The proposed structures of the complexes were optimized by DFT calculations. Theoretical calculations and experimental determinations sustain the proposed structures of the hydroxo complexes, with two molecules of 5-hydroxyflavone acting as monoanionic bidentate chelate ligands. The interaction of the complexes with calf thymus DNA has been explored by fluorescence titration and UV-Vis absorption binding studies, and revealed that the synthesized complexes interact with DNA with binding constants (Kb ~ 104. Human serum albumin (HSA and transferrin (Tf binding studies have also been performed by fluorescence titration techniques (fluorescence quenching studies, synchronous fluorescence spectra. The apparent association constants (Ka and thermodynamic parameters have been calculated from the fluorescence quenching experiment at 299 K, 308 K, and 318 K. The quenching curves indicate that the complexes bind to HSA with smaller affinity than the ligand, but to Tf with higher binding affinities than the ligand.

  3. Na+/Ca2+ exchange inhibitor, KB-R7943, attenuates contrast-induced acute 
kidney injury.

    Science.gov (United States)

    Yang, Dingwei; Yang, Dingping; Jia, Ruhan; Tan, Jin

    2013-01-01

    Intracellular Ca2+ overload is considered to be a key factor in contrast-induced acute kidney injury (CI-AKI). The Na+/Ca2+ exchanger (NCX) system is one of the main pathways of intracellular Ca2+ overload. We investigated the effects of KB-R7943, an inhibitor of the reverse mode of NCX, on CI-AKI in a rat model. Rats were divided into control group, CI-AKI group and pretreatment groups (with KB-R7943 dose of 5 or 10 mg/kg). CI-AKI was induced by diatrizoate administration in rats with cholesterol-supplemented diet for 8 weeks. Renal function and renal hemodynamics were determined 1 day following contrast medium administration. Renal histopathology was observed by light microscope. Renal tubular apoptosis was examined by TUNEL. Renal endothelin-1 (ET-1) was measured by radioimmunoassay. Renal malondialdehyde (MDA) and catalase (CAT) were measured as oxidative markers. Levels of serum creatinine (Scr), renal ET-1, MDA and CAT, and resistance index (RI) of renal blood vessels increased significantly in CI-AKI rats. The 
increases in Scr and RI of renal blood vessels induced by diatrizoate were suppressed significantly and 
dose-dependently by pretreatment with KB-R7943. Histopathological and TUNEL results showed that 
the contrast medium-induced severe renal tubular 
necrosis and apoptosis were significantly and dose-dependently attenuated by KB-R7943. KB-R7943 significantly suppressed the increment of renal ET-1 content and MDA and CAT level induced by contrast medium administration. Activation of the reverse mode of NCX, followed by ET-1 overproduction and increased oxidative stress, seems to play an important role in the pathogenesis of CI-AKI. The inhibitor of the reverse mode of NCX, KB-R7943, has renoprotective effects on CI-AKI.

  4. Chemoresistance to 5-FU inhibited by 635 nm LED irradiation in CD133+ KB cell line.

    Science.gov (United States)

    Kim, Donghwi; Park, Mineon; Jang, Hyunwoong; Hyun, Hoon; Lim, Wonbong

    2018-01-01

    Consistent with cancer stem cell theory, a small fraction of cancer cells, described as cancer stem cells (CSCs), may promote tumor recurrence and anti-cancer drug resistance. Therefore, much effort has been devoted to the development of CSC targeted therapy to vanquish drug resistance. In this study, we have investigated the effect of multiple light-emitting diode (LED) irradiation treatments with conventional anti-cancer drugs on CSC-like oral cancer cells that acquired stemness by ectopic over expression of CD133. To evaluate combined LED irradiation anti-cancer drug effects, we investigated the chemosensitizing effect of 635 nm irradiation on 5-fluorouracil (5FU)-treated KB CD133+ and KB Vec cells, interrogating the underlying molecular mechanisms associated with stemness and apoptosis that are responsible for chemopreventive activity. In addition, combination therapy with LED irradiation and 5-FU treatment was carried out in KB CD133+ and KB Vec cell-inoculated mouse models. LED irradiation of 635 nm inhibited CSC-like properties consistent with a decrease in OCT4 and NANOG protein expression, reducing colony-forming ability. In addition, LED irradiation enhanced 5-FU-induced cytotoxicity and improved 5-FU chemosensitivity in KB CD133+ via enhancement of apoptosis. These findings were validated in vivo, wherein LED irradiation combined with 5-FU treatment inhibited tumor growth in KB CD133+ -inoculated mice. Collectively, our results provide novel evidence for 635 nm irradiation-induced 5-FU chemosensitization of CSC in oral cancer. In addition, this research highlights that 635 nm LED irradiation may serve as an adjunct treatment to conventional chemotherapeutic drugs in patients with oral cancer.

  5. rsfMRI effects of KB220Z™ on Neural Pathways in Reward Circuitry of Abstinent Genotyped Heroin Addicts

    Science.gov (United States)

    Blum, Kenneth; Liu, Yijun; Wang, Wei; Wang, Yarong; Zhang, Yi; Oscar-Berman, Marlene; Smolen, Andrew; Febo, Marcelo; Han, David; Simpatico, Thomas; Cronjé, Frans J; Demetrovics, Zsolt; Gold, Mark S.

    2016-01-01

    Recently Willuhn et al. reported that cocaine use and even non-substance related addictive behavior, increases, as dopaminergic function is reduced. Chronic cocaine exposure has been associated with decreases in D2/D3 receptors, also associated with lower activation to cues in occipital cortex and cerebellum in a recent PET study from Volkow’s group. Therefore, treatment strategies, like dopamine agonist therapy, that might conserve dopamine function may be an interesting approach to relapse prevention in psychoactive drug and behavioral addictions. To this aim, we evaluated the effect of KB220Z™ on reward circuitry of ten heroin addicts undergoing protracted abstinence, an average 16.9 months. In a randomized placebo-controlled crossover study of KB220Z™ five subjects completed a triple blinded–experiment in which the subject, the person administering the treatment and the person evaluating the response to treatment were blinded as to which treatment any particular subject was receiving. In addition, nine subjects total were genotyped utilizing the GARSRX™ test. We preliminarily report that KB220Z ™ induced an increase in BOLD activation in caudate-accumbens-dopaminergic pathways compared to placebo following one-hour acute administration. Furthermore, KB220Z™ also reduced resting state activity in the putamen of abstinent heroin addicts. In the second phase of this pilot study of all ten abstinent heroin-dependent subjects, three brain regions of interest (ROIs) we observed to be significantly activated from resting state by KB220Z compared to placebo (P addiction by direct or indirect dopaminergic interaction. Due to small sample size, we caution definitive interpretation of these preliminary results and confirmation with additional research and ongoing rodent and human studies of KB220Z, is required. PMID:25526228

  6. Melting relations in the Fe-rich portion of the system FeFeS at 30 kb pressure

    Science.gov (United States)

    Brett, R.; Bell, P.M.

    1969-01-01

    The melting relations of FeFeS mixtures covering the composition range from Fe to Fe67S33 have been determined at 30 kb pressure. The phase relations are similar to those at low pressure. The eutectic has a composition of Fe72.9S27.1 and a temperature of 990??C. Solubility of S in Fe at elevated temperatures at 30 kb is of the same order of magnitude as at low pressure. Sulfur may have significantly lowered the melting point of iron in the upper mantle during the period of coalescence of metal prior to core formation in the primitive earth. ?? 1969.

  7. Spectrophotometric determination of association constant

    DEFF Research Database (Denmark)

    2016-01-01

    Least-squares 'Systematic Trial-and-Error Procedure' (STEP) for spectrophotometric evaluation of association constant (equilibrium constant) K and molar absorption coefficient E for a 1:1 molecular complex, A + B = C, with error analysis according to Conrow et al. (1964). An analysis of the Charge...

  8. Protein binding of psychotropic agents

    International Nuclear Information System (INIS)

    Hassan, H.A.

    1990-01-01

    Based upon fluorescence measurements, protein binding of some psychotropic agents (chlorpromazine, promethazine, and trifluoperazine) to human IgG and HSA was studied in aqueous cacodylate buffer, PH7. The interaction parameters determined from emission quenching of the proteins. The interaction parameters determined include the equilibrium constant (K), calculated from equations derived by Borazan and coworkers, the number of binding sites (n) available to the monomer molecules on a single protein molecule. The results revealed a high level of affinity, as reflected by high values of K, and the existence of specific binding sites, since a limited number of n values are obtained. 39 tabs.; 37 figs.; 83 refs

  9. PGen: large-scale genomic variations analysis workflow and browser in SoyKB.

    Science.gov (United States)

    Liu, Yang; Khan, Saad M; Wang, Juexin; Rynge, Mats; Zhang, Yuanxun; Zeng, Shuai; Chen, Shiyuan; Maldonado Dos Santos, Joao V; Valliyodan, Babu; Calyam, Prasad P; Merchant, Nirav; Nguyen, Henry T; Xu, Dong; Joshi, Trupti

    2016-10-06

    With the advances in next-generation sequencing (NGS) technology and significant reductions in sequencing costs, it is now possible to sequence large collections of germplasm in crops for detecting genome-scale genetic variations and to apply the knowledge towards improvements in traits. To efficiently facilitate large-scale NGS resequencing data analysis of genomic variations, we have developed "PGen", an integrated and optimized workflow using the Extreme Science and Engineering Discovery Environment (XSEDE) high-performance computing (HPC) virtual system, iPlant cloud data storage resources and Pegasus workflow management system (Pegasus-WMS). The workflow allows users to identify single nucleotide polymorphisms (SNPs) and insertion-deletions (indels), perform SNP annotations and conduct copy number variation analyses on multiple resequencing datasets in a user-friendly and seamless way. We have developed both a Linux version in GitHub ( https://github.com/pegasus-isi/PGen-GenomicVariations-Workflow ) and a web-based implementation of the PGen workflow integrated within the Soybean Knowledge Base (SoyKB), ( http://soykb.org/Pegasus/index.php ). Using PGen, we identified 10,218,140 single-nucleotide polymorphisms (SNPs) and 1,398,982 indels from analysis of 106 soybean lines sequenced at 15X coverage. 297,245 non-synonymous SNPs and 3330 copy number variation (CNV) regions were identified from this analysis. SNPs identified using PGen from additional soybean resequencing projects adding to 500+ soybean germplasm lines in total have been integrated. These SNPs are being utilized for trait improvement using genotype to phenotype prediction approaches developed in-house. In order to browse and access NGS data easily, we have also developed an NGS resequencing data browser ( http://soykb.org/NGS_Resequence/NGS_index.php ) within SoyKB to provide easy access to SNP and downstream analysis results for soybean researchers. PGen workflow has been optimized for the most

  10. Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

    Science.gov (United States)

    Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

    2013-06-01

    Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

  11. FluKB: A Knowledge-Based System for Influenza Vaccine Target Discovery and Analysis of the Immunological Properties of Influenza Viruses

    DEFF Research Database (Denmark)

    Simon, Christian; Kudahl, Ulrich Johan; Sun, Jing

    2015-01-01

    FluKB is a knowledge-based system focusing on data and analytical tools for influenza vaccine discovery. The main goal of FluKB is to provide access to curated influenza sequence and epitope data and enhance the analysis of influenza sequence diversity and the analysis of targets of immune...... responses. FluKB consists of more than 400,000 influenza protein sequences, known epitope data (357 verified T-cell epitopes, 685 HLA binders, and 16 naturally processed MHC ligands), and a collection of 28 influenza antibodies and their structurally defined B-cell epitopes. FluKB was built using amodular...

  12. A high frequency MspI RFLP at the human vitamin D binding protein (hDBP) locus

    Energy Technology Data Exchange (ETDEWEB)

    Ray, K; Cooke, N E [Univ. of Pennsylvania, Philadelphia (USA)

    1988-07-25

    A nearly full-length cDNA encoding the human vitamin D binding protein (hDBP), also known as Gc-globulin, was isolated from a human liver cDNA expression library. This 1.73 kb cDNA was digested with EcoRI and the 5{prime}, 140 bp fragment of the cDNA, subcloned into plasmid SP65 (phDBP140), was used as probe. MspI identifies a two allele polymorphism with either a band at 12 kb or a band at 5 kb. The frequency was estimated from a study of 24 unrelated North American Caucasians. The hDBP gene has been localized to chromosome 4 using a cDNA probe and a panel of rodent X human somatic cell hybrids. It was sublocalized to 4q11-q13 by in situ hybridization. Co-dominant autosomal segregation of the polymorphic alleles has been observed in two informative families (20 individuals). With overexposure of the autoradiograph two faint variant bands are seen at 17 kb and 13.5 kb which appear to cosegregate with the 12 kb band and the 5 kb band respectively.

  13. Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe.

    Science.gov (United States)

    Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee

    2017-03-01

    This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

  14. A 660-Kb Deletion with Antagonistic Effects on Fertility and Milk Production Segregates at High Frequency in Nordic Red Cattle

    DEFF Research Database (Denmark)

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole

    The spectacular increase in productivity of dairy cattle has been accompanied by a decline in fertility. It is assumed that this reduction is due to the negative energy balance of high producing cows. We herein describe the dissection of a fertility QTL in Nordic Red cattle to a 660-Kb deletion...

  15. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  16. Analysis of gene and protein name synonyms in Entrez Gene and UniProtKB resources

    KAUST Repository

    Arkasosy, Basil

    2013-05-11

    Ambiguity in texts is a well-known problem: words can carry several meanings, and hence, can be read and interpreted differently. This is also true in the biological literature; names of biological concepts, such as genes and proteins, might be ambiguous, referring in some cases to more than one gene or one protein, or in others, to both genes and proteins at the same time. Public biological databases give a very useful insight about genes and proteins information, including their names. In this study, we made a thorough analysis of the nomenclatures of genes and proteins in two data sources and for six different species. We developed an automated process that parses, extracts, processes and stores information available in two major biological databases: Entrez Gene and UniProtKB. We analysed gene and protein synonyms, their types, frequencies, and the ambiguities within a species, in between data sources and cross-species. We found that at least 40% of the cross-species ambiguities are caused by names that are already ambiguous within the species. Our study shows that from the six species we analysed (Homo Sapiens, Mus Musculus, Arabidopsis Thaliana, Oryza Sativa, Bacillus Subtilis and Pseudomonas Fluorescens), rice (Oriza Sativa) has the best naming model in Entrez Gene database, with low ambiguities between data sources and cross-species.

  17. Human liver aldehyde dehydrogenase: coenzyme binding

    International Nuclear Information System (INIS)

    Kosley, L.L.; Pietruszko, R.

    1987-01-01

    The binding of [U- 14 C] NAD to mitochondrial (E2) and cytoplasmin(E1) aldehyde dehydrogenase was measured by gel filtration and sedimentation techniques. The binding data for NAD and (E1) yielded linear Scatchard plots giving a dissociation constant of 25 (+/- 8) uM and the stoichiometry of 2 mol of NAD bound per mol of E1. The binding data for NAD and (E2) gave nonlinear Scatchard plots. The binding of NADH to E2 was measured via fluorescence enhancement; this could not be done with E1 because there was no signal. The dissociation constant for E2 by this technique was 0.7 (+/- 0.4) uM and stoichiometry of 1.0 was obtained. The binding of [U- 14 C] NADH to (E1) and (E2) was also measured by the sedimentation technique. The binding data for (E1) and NADH gave linear Scatchard plots giving a dissociation constant of 13 (+/- 6) uM and the stoichiometry of 2.0. The binding data for NADH to (E2) gave nonlinear Scatchard plots. With (E1), the dissociation constants for both NAD and NADH are similar to those determined kinetically, but the stoichiometry is only half of that found by stopped flow technique. With (E2) the dissociation constant by fluorometric procedure was 2 orders of magnitude less than that from catalytic reaction

  18. Varying Constants, Gravitation and Cosmology

    Directory of Open Access Journals (Sweden)

    Jean-Philippe Uzan

    2011-03-01

    Full Text Available Fundamental constants are a cornerstone of our physical laws. Any constant varying in space and/or time would reflect the existence of an almost massless field that couples to matter. This will induce a violation of the universality of free fall. Thus, it is of utmost importance for our understanding of gravity and of the domain of validity of general relativity to test for their constancy. We detail the relations between the constants, the tests of the local position invariance and of the universality of free fall. We then review the main experimental and observational constraints that have been obtained from atomic clocks, the Oklo phenomenon, solar system observations, meteorite dating, quasar absorption spectra, stellar physics, pulsar timing, the cosmic microwave background and big bang nucleosynthesis. At each step we describe the basics of each system, its dependence with respect to the constants, the known systematic effects and the most recent constraints that have been obtained. We then describe the main theoretical frameworks in which the low-energy constants may actually be varying and we focus on the unification mechanisms and the relations between the variation of different constants. To finish, we discuss the more speculative possibility of understanding their numerical values and the apparent fine-tuning that they confront us with.

  19. Stabilized power constant alimentation; Alimentation regulee a puissance constante

    Energy Technology Data Exchange (ETDEWEB)

    Roussel, L [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1968-06-01

    The study and realization of a stabilized power alimentation variable from 5 to 100 watts are described. In order to realize a constant power drift of Lithium compensated diodes, we have searched a 1 per cent precision of regulation and a response time minus than 1 sec. Recent components like Hall multiplicator and integrated amplifiers give this possibility and it is easy to use permutable circuits. (author) [French] On decrit l'etude et la realisation d'une alimentation a puissance constante reglable dans une gamme de 5 a 100 watts. Prevue pour le drift a puissance constante des diodes compensees au lithium, l'etude a ete menee en vue d'obtenir une precision de regulation de 1 pour cent et un temps de reponse inferieur a la seconde. Des systemes recents tels que multiplicateurs a effet Hall et circuits integres ont permis d'atteindre ce but tout en facilitant l'emploi de modules interchangeables. (auteur)

  20. From the Rydberg constant to the fundamental constants metrology

    International Nuclear Information System (INIS)

    Nez, F.

    2005-06-01

    This document reviews the theoretical and experimental achievements of the author since the beginning of his scientific career. This document is dedicated to the spectroscopy of hydrogen, deuterium and helium atoms. The first part is divided into 6 sub-sections: 1) the principles of hydrogen spectroscopy, 2) the measurement of the 2S-nS/nD transitions, 3) other optical frequency measurements, 4) our contribution to the determination of the Rydberg constant, 5) our current experiment on the 1S-3S transition, 6) the spectroscopy of the muonic hydrogen. Our experiments have improved the accuracy of the Rydberg Constant by a factor 25 in 15 years and we have achieved the first absolute optical frequency measurement of a transition in hydrogen. The second part is dedicated to the measurement of the fine structure constant and the last part deals with helium spectroscopy and the search for optical references in the near infrared range. (A.C.)

  1. Learning Read-constant Polynomials of Constant Degree modulo Composites

    DEFF Research Database (Denmark)

    Chattopadhyay, Arkadev; Gavaldá, Richard; Hansen, Kristoffer Arnsfelt

    2011-01-01

    Boolean functions that have constant degree polynomial representation over a fixed finite ring form a natural and strict subclass of the complexity class \\textACC0ACC0. They are also precisely the functions computable efficiently by programs over fixed and finite nilpotent groups. This class...... is not known to be learnable in any reasonable learning model. In this paper, we provide a deterministic polynomial time algorithm for learning Boolean functions represented by polynomials of constant degree over arbitrary finite rings from membership queries, with the additional constraint that each variable...

  2. PENICILLIN-BINDING PROTEIN 2X OF STREPTOCOCCUS-PNEUMONIAE - EXPRESSION IN ESCHERICHIA-COLI AND PURIFICATION OF A SOLUBLE ENZYMATICALLY ACTIVE DERIVATIVE

    NARCIS (Netherlands)

    LAIBLE, G; KECK, W; LURZ, R; MOTTL, H; FRERE, JM; JAMIN, M; HAKENBECK, R

    1992-01-01

    A 2.5-kb DNA fragment including the structural gene coding for the penicillin-binding protein 2x (PBP 2x) of Streptococcus pneumoniae has been cloned into the vector pJDC9 and expressed in Escherichia coli. Mapping of RNA polymerase binding sites by electron microscopy indicated that the pbpX

  3. Determination of the Boltzmann constant using a quasi-spherical acoustic resonator.

    Science.gov (United States)

    Pitre, Laurent; Sparasci, Fernando; Truong, Daniel; Guillou, Arnaud; Risegari, Lara; Himbert, Marc E

    2011-10-28

    The paper reports a new experiment to determine the value of the Boltzmann constant, k(B)=1.3806477(17)×10(-23) J K(-1), with a relative standard uncertainty of 1.2 parts in 10(6). k(B) was deduced from measurements of the velocity of sound in argon, inside a closed quasi-spherical cavity at a temperature of the triple point of water. The shape of the cavity was achieved using an extremely accurate diamond turning process. The traceability of temperature measurements was ensured at the highest level of accuracy. The volume of the resonator was calculated from measurements of the resonance frequencies of microwave modes. The molar mass of the gas was determined by chemical and isotopic composition measurements with a mass spectrometer. Within combined uncertainties, our new value of k(B) is consistent with the 2006 Committee on Data for Science and Technology (CODATA) value: (k(B)(new)/k(B_CODATA)-1)=-1.96×10(-6), where the relative uncertainties are u(r)(k(B)(new))=1.2×10(-6) and u(r)(k(B_CODATA))=1.7×10(-6). The new relative uncertainty approaches the target value of 1×10(-6) set by the Consultative Committee on Thermometry as a precondition for redefining the unit of the thermodynamic temperature, the kelvin.

  4. The Norrie disease gene maps to a 150 kb region on chromosome Xp11.3.

    Science.gov (United States)

    Sims, K B; Lebo, R V; Benson, G; Shalish, C; Schuback, D; Chen, Z Y; Bruns, G; Craig, I W; Golbus, M S; Breakefield, X O

    1992-05-01

    Norrie disease is a human X-linked recessive disorder of unknown etiology characterized by congenital blindness, sensory neural deafness and mental retardation. This disease gene was previously linked to the DXS7 (L1.28) locus and the MAO genes in band Xp11.3. We report here fine physical mapping of the obligate region containing the Norrie disease gene (NDP) defined by a recombination and by the smallest submicroscopic chromosomal deletion associated with Norrie disease identified to date. Analysis, using in addition two overlapping YAC clones from this region, allowed orientation of the MAOA and MAOB genes in a 5'-3'-3'-5' configuration. A recombination event between a (GT)n polymorphism in intron 2 of the MAOB gene and the NDP locus, in a family previously reported to have a recombination between DXS7 and NDP, delineates a flanking marker telomeric to this disease gene. An anonymous DNA probe, dc12, present in one of the YACs and in a patient with a submicroscopic deletion which includes MAOA and MAOB but not L1.28, serves as a flanking marker centromeric to the disease gene. An Alu-PCR fragment from the right arm of the MAO YAC (YMAO.AluR) is not deleted in this patient and also delineates the centromeric extent of the obligate disease region. The apparent order of these loci is telomere ... DXS7-MAOA-MAOB-NDP-dc12-YMAO.AluR ... centromere. Together these data define the obligate region containing the NDP gene to a chromosomal segment less than 150 kb.

  5. Reactive oxygen species are crucial for hydroxychavicol toxicity toward KB epithelial cells.

    Science.gov (United States)

    Jeng, J H; Wang, Y J; Chang, W H; Wu, H L; Li, C H; Uang, B J; Kang, J J; Lee, J J; Hahn, L J; Lin, B R; Chang, M C

    2004-01-01

    Betel quid (BQ) chewing shows a strong correlation to the incidence of oral submucous fibrosis (OSF), leukoplakia and oral cancer. BQ contains mainly areca nut, lime, Piper betle leaf (PBL) and the inflorescence of P. betle (IPB). Hydroxychavicol (4-allyl-catechol, HC), as a major phenolic compound in PBL and IPB, is shown to induce oxidative stress, glutathione (GSH) depletion and cell cycle deregulation. Using bivariate BrdU/PI flow cytometry, KB cells in DNA synthesis (S phase) are shown to be sensitive to the toxic effect of HC and show cell cycle arrest and apoptosis following exposure to 0.1 and 0.3 mM HC. HC-induced apoptosis and cell cycle arrest are associated with mitochondrial membrane potential (delta Psim) depolarization as revealed by a decrease in rhodamine fluorescence. N-acetyl-L-cysteine (1 mM), superoxide dismutase (100 U/ml) and catalase (1000 U/ml) were effective in prevention of HC-induced GSH depletion (as indicated by chloromethylfluorescein fluorescence), reactive oxygen species (ROS) production (by dichlorofluorescein fluorescence), cell cycle arrest and apoptosis. However, dimethylthiourea (2 mM), neocuproine (1 mM), 1,10-phenanthroline (200 microM) and desferrioxamine (0.5 mM) showed little effect on HC-induced cell changes. HC elevated the cellular and mitochondrial GSH levels at moderate concentrations (0.05-0.1 mM), whereas at a concentration of 0.3 mM, inhibitory effects were noted. These results indicate that HC consumption may be associated with BQ-chewing-related oral mucosal diseases via GSH depletion, ROS production, mitochondrial dysfunction, cell cycle disturbance and the induction of apoptosis. These events are related to the production of superoxide radicals and hydrogen peroxide.

  6. FluKB: A Knowledge-Based System for Influenza Vaccine Target Discovery and Analysis of the Immunological Properties of Influenza Viruses

    DEFF Research Database (Denmark)

    Simon, Christian; Kudahl, Ulrich Johan; Sun, Jing

    2015-01-01

    responses. FluKB consists of more than 400,000 influenza protein sequences, known epitope data (357 verified T-cell epitopes, 685 HLA binders, and 16 naturally processed MHC ligands), and a collection of 28 influenza antibodies and their structurally defined B-cell epitopes. FluKB was built using amodular...

  7. Protective effect of Na(+)/Ca (2+) exchange blocker KB-R7943 on myocardial ischemia-reperfusion injury in hypercholesterolemic rats.

    Science.gov (United States)

    Lv, Yan; Ren, Yongkui; Sun, Lufan; Wang, Shaojun; Wei, Minjie; Jia, Dalin

    2013-06-01

    Reverse-mode activation of the Na(+)/Ca(2+) exchanger (NCX) during reperfusion following ischemia contributes to Ca(2+) overload and cardiomyocyte injury. KB-R7943, a selective reverse-mode NCX inhibitor, reduces lethal reperfusion injury under non-ischemic conditions. However, the effectiveness of this compound under ischemic conditions is unclear. In the present study, we studied the effects of KB-R7943 in an animal model of hyperlipidemia. We further assessed whether the K ATP (+) channels are involved in potential protective mechanisms of KB-R7943. Twelve rats were fed normal chow, while 48 animals were fed a high cholesterol diet. The hearts from the control and hypercholesterolemic rats were subjected to 25 min of global ischemia followed by a 120-min reperfusion. Before this, hearts from hypercholesterolemic rats either received no intervention (cholesterol control group) or were pre-treated with 1 μM KB-R7943 and 0.3 μM of K ATP (+) blocker glibenclamide or glibenclamide alone. The infarction sizes (triphenyltetrazolium assay) were 35 ± 5.0 % in the control group, 46 ± 8.7 % in the cholesterol control group (p KB-R7943 group (p KB-R7943 and glibenclamide group, and 47 ± 8.5 % in the glibenclamide group (p KB-R7943 attenuated the magnitude of cell apoptosis (p KB-R7943 reduces the infarction size and apoptosis in hyperlipidemic animals through the activation of K ATP (+) channels.

  8. From the Rydberg constant to the fundamental constants metrology; De la constante de Rydberg a la metrologie des constantes fondamentales

    Energy Technology Data Exchange (ETDEWEB)

    Nez, F

    2005-06-15

    This document reviews the theoretical and experimental achievements of the author since the beginning of his scientific career. This document is dedicated to the spectroscopy of hydrogen, deuterium and helium atoms. The first part is divided into 6 sub-sections: 1) the principles of hydrogen spectroscopy, 2) the measurement of the 2S-nS/nD transitions, 3) other optical frequency measurements, 4) our contribution to the determination of the Rydberg constant, 5) our current experiment on the 1S-3S transition, 6) the spectroscopy of the muonic hydrogen. Our experiments have improved the accuracy of the Rydberg Constant by a factor 25 in 15 years and we have achieved the first absolute optical frequency measurement of a transition in hydrogen. The second part is dedicated to the measurement of the fine structure constant and the last part deals with helium spectroscopy and the search for optical references in the near infrared range. (A.C.)

  9. Systematics of constant roll inflation

    Science.gov (United States)

    Anguelova, Lilia; Suranyi, Peter; Wijewardhana, L. C. R.

    2018-02-01

    We study constant roll inflation systematically. This is a regime, in which the slow roll approximation can be violated. It has long been thought that this approximation is necessary for agreement with observations. However, recently it was understood that there can be inflationary models with a constant, and not necessarily small, rate of roll that are both stable and compatible with the observational constraint ns ≈ 1. We investigate systematically the condition for such a constant-roll regime. In the process, we find a whole new class of inflationary models, in addition to the known solutions. We show that the new models are stable under scalar perturbations. Finally, we find a part of their parameter space, in which they produce a nearly scale-invariant scalar power spectrum, as needed for observational viability.

  10. Strain fluctuations and elastic constants

    Energy Technology Data Exchange (ETDEWEB)

    Parrinello, M.; Rahman, A.

    1982-03-01

    It is shown that the elastic strain fluctuations are a direct measure of elastic compliances in a general anisotropic medium; depending on the ensemble in which the fluctuation is measured either the isothermal or the adiabatic compliances are obtained. These fluctuations can now be calculated in a constant enthalpy and pressure, and hence, constant entropy, ensemble due to recent develpments in the molecular dynamics techniques. A calculation for a Ni single crystal under uniform uniaxial 100 tensile or compressive load is presented as an illustration of the relationships derived between various strain fluctuations and the elastic modulii. The Born stability criteria and the behavior of strain fluctuations are shown to be related.

  11. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  12. Synthesis of isatin thiosemicarbazones derivatives: in vitro anti-cancer, DNA binding and cleavage activities.

    Science.gov (United States)

    Ali, Amna Qasem; Teoh, Siang Guan; Salhin, Abdussalam; Eltayeb, Naser Eltaher; Khadeer Ahamed, Mohamed B; Abdul Majid, A M S

    2014-05-05

    New derivatives of thiosemicarbazone Schiff base with isatin moiety were synthesized L1-L6. The structures of these compounds were characterized based on the spectroscopic techniques. Compound L6 was further characterized by XRD single crystal. The interaction of these compounds with calf thymus (CT-DNA) exhibited high intrinsic binding constant (k(b)=5.03-33.00×10(5) M(-1)) for L1-L3 and L5 and (6.14-9.47×10(4) M(-1)) for L4 and L6 which reflect intercalative activity of these compounds toward CT-DNA. This result was also confirmed by the viscosity data. The electrophoresis studies reveal the higher cleavage activity of L1-L3 than L4-L6. The in vitro anti-proliferative activity of these compounds against human colon cancer cell line (HCT 116) revealed that the synthesized compounds (L3, L6 and L2) exhibited good anticancer potency. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Universal relation between spectroscopic constants

    Indian Academy of Sciences (India)

    (3) The author has used eq. (6) of his paper to calculate De. This relation leads to a large deviation from the correct value depending upon the extent to which experimental values are known. Guided by this fact, in our work, we used experimentally observed De values to derive the relation between spectroscopic constants.

  14. Tachyon constant-roll inflation

    Science.gov (United States)

    Mohammadi, A.; Saaidi, Kh.; Golanbari, T.

    2018-04-01

    The constant-roll inflation is studied where the inflaton is taken as a tachyon field. Based on this approach, the second slow-roll parameter is taken as a constant which leads to a differential equation for the Hubble parameter. Finding an exact solution for the Hubble parameter is difficult and leads us to a numerical solution for the Hubble parameter. On the other hand, since in this formalism the slow-roll parameter η is constant and could not be assumed to be necessarily small, the perturbation parameters should be reconsidered again which, in turn, results in new terms appearing in the amplitude of scalar perturbations and the scalar spectral index. Utilizing the numerical solution for the Hubble parameter, we estimate the perturbation parameter at the horizon exit time and compare it with observational data. The results show that, for specific values of the constant parameter η , we could have an almost scale-invariant amplitude of scalar perturbations. Finally, the attractor behavior for the solution of the model is presented, and we determine that the feature could be properly satisfied.

  15. Receptor-mediated targeting of 67Ga-Deferoxamine-Folate to folate-receptor-positive human kb tumor xenografts

    International Nuclear Information System (INIS)

    Mathias, Carla J.; Wang, Susan; Low, Philip S.; Waters, David J.; Green, Mark A.

    1999-01-01

    The radiochemical synthesis and stability of 67 Ga-deferoxamine-folate ([ 67 Ga]Ga-DF-Folate) were examined as a function of DF-Folate concentration. Optimal labeling occurred at DF-Folate concentrations ≥2.5 μg/mL. To define the possible biological significance of variations in product formulation, the biodistribution of [ 67 Ga]Ga-DF-Folate was examined as a function of administered deferoxamine-folate dose in an athymic mouse KB tumor model. The folate-receptor-positive KB tumors were found to concentrate the 67 Ga radiolabel in a dose-dependent fashion, consistent with saturable involvement of the folate receptor in mediating tumor accumulation of the radiopharmaceutical

  16. Deletion of 2.7 kb near HOXD3 in an Arabian horse with occipitoatlantoaxial malformation.

    Science.gov (United States)

    Bordbari, M H; Penedo, M C T; Aleman, M; Valberg, S J; Mickelson, J; Finno, C J

    2017-06-01

    In the horse, the term occipitoatlantoaxial malformation (OAAM) is used to describe a developmental defect in which the first cervical vertebra (atlas) resembles the base of the skull (occiput) and the second cervical vertebra (axis) resembles the atlas. Affected individuals demonstrate an abnormal posture and varying degrees of ataxia. The homeobox (HOX) gene cluster is involved in the development of both the axial and appendicular skeleton. Hoxd3-null mice demonstrate a strikingly similar phenotype to Arabian foals with OAAM. Whole-genome sequencing was performed in an OAAM-affected horse (OAAM1) and seven unaffected Arabian horses. Visual inspection of the raw reads within the region of HOXD3 identified a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3. A genotyping assay revealed that both parents of OAAM1 were heterozygous for the deletion. Additional genotyping identified two of 162 heterozygote Arabians, and the deletion was not present in 371 horses of other breeds. Comparative genomics studies have revealed that this region is highly conserved across species and that the entire genomic region between Hoxd4 and Hoxd3 is transcribed in mice. Two additional Arabian foals diagnosed with OAAM (OAAM 2 and 3) were genotyped and did not have the 2.7-kb deletion. Closer examination of the phenotype in these cases revealed notable variation. OAAM3 also had facial malformations and a patent ductus arteriosus, and the actual malformation at the craniocervical junction differed. Genetic heterogeneity may exist across the HOXD locus in Arabian foals with OAAM. © 2017 Stichting International Foundation for Animal Genetics.

  17. Stabilized power constant alimentation; Alimentation regulee a puissance constante

    Energy Technology Data Exchange (ETDEWEB)

    Roussel, L. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1968-06-01

    The study and realization of a stabilized power alimentation variable from 5 to 100 watts are described. In order to realize a constant power drift of Lithium compensated diodes, we have searched a 1 per cent precision of regulation and a response time minus than 1 sec. Recent components like Hall multiplicator and integrated amplifiers give this possibility and it is easy to use permutable circuits. (author) [French] On decrit l'etude et la realisation d'une alimentation a puissance constante reglable dans une gamme de 5 a 100 watts. Prevue pour le drift a puissance constante des diodes compensees au lithium, l'etude a ete menee en vue d'obtenir une precision de regulation de 1 pour cent et un temps de reponse inferieur a la seconde. Des systemes recents tels que multiplicateurs a effet Hall et circuits integres ont permis d'atteindre ce but tout en facilitant l'emploi de modules interchangeables. (auteur)

  18. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Science.gov (United States)

    Rogers, Elizabeth E; Stenger, Drake C

    2012-01-01

    A ≈ 38kB plasmid (pXF-RIV5) was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51) sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb) from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV) similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th) century.

  19. A conjugative 38 kB plasmid is present in multiple subspecies of Xylella fastidiosa.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available A ≈ 38kB plasmid (pXF-RIV5 was present in the Riv5 strain of Xylella fastidiosa subsp. multiplex isolated from ornamental plum in southern California. The complete nucleotide sequence of pXF-RIV5 is almost identical to that of pXFAS01 from X. fastidiosa subsp. fastidiosa strain M23; the two plasmids vary at only 6 nucleotide positions. BLAST searches and phylogenetic analyses indicate pXF-RIV5 and pXFAS01 share some similarity to chromosomal and plasmid (pXF51 sequences of X. fastidiosa subsp. pauca strain 9a5c and more distant similarity to plasmids from a wide variety of bacteria. Both pXF-RIV5 and pXFAS01 encode homologues of a complete Type IV secretion system involved in conjugation and DNA transfer among bacteria. Mating pair formation proteins (Trb from Yersinia pseudotuberculosis IP31758 are the mostly closely related non-X. fastidiosa proteins to most of the Trb proteins encoded by pXF-RIV5 and pXFAS01. Unlike many bacterial conjugative plasmids, pXF-RIV5 and pXFAS01 do not carry homologues of known accessory modules that confer selective advantage on host bacteria. However, both plasmids encode seven hypothetical proteins of unknown function and possess a small transposon-associated region encoding a putative transposase and associated factor. Vegetative replication of pXF-RIV5 and pXFAS01 appears to be under control of RepA protein and both plasmids have an origin of DNA replication (oriV similar to that of pRP4 and pR751 from Escherichia coli. In contrast, conjugative plasmids commonly encode TrfA and have an oriV similar to those found in IncP-1 incompatibility group plasmids. The presence of nearly identical plasmids in single strains from two distinct subspecies of X. fastidiosa is indicative of recent horizontal transfer, probably subsequent to the introduction of subspecies fastidiosa to the United States in the late 19(th century.

  20. Paracetamol - toxicity and microbial utilization. Pseudomonas moorei KB4 as a case study for exploring degradation pathway.

    Science.gov (United States)

    Żur, Joanna; Wojcieszyńska, Danuta; Hupert-Kocurek, Katarzyna; Marchlewicz, Ariel; Guzik, Urszula

    2018-09-01

    Paracetamol, a widely used analgesic and antipyretic drug, is currently one of the most emerging pollutants worldwide. Besides its wide prevalence in the literature only several bacterial strains able to degrade this compound have been described. In this study, we isolated six new bacterial strains able to remove paracetamol. The isolated strains were identified as the members of Pseudomonas, Bacillus, Acinetobacter and Sphingomonas genera and characterized phenotypically and biochemically using standard methods. From the isolated strains, Pseudomonas moorei KB4 was able to utilize 50 mg L -1 of paracetamol. As the main degradation products, p-aminophenol and hydroquinone were identified. Based on the measurements of specific activity of acyl amidohydrolase, deaminase and hydroquinone 1,2-dioxygenase and the results of liquid chromatography analyses, we proposed a mechanism of paracetamol degradation by KB4 strain under co-metabolic conditions with glucose. Additionally, toxicity bioassays and the influence of various environmental factors, including pH, temperature, heavy metals at no-observed-effective-concentrations, and the presence of aromatic compounds on the efficiency and mechanism of paracetamol degradation by KB4 strain were determined. This comprehensive study about paracetamol biodegradation will be helpful in designing a treatment systems of wastewaters contaminated with paracetamol. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Ornithine aminotransferase (OAT): recombination between an X-linked OAT sequence (7.5 kb) and the Norrie disease locus.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Spence, M A; Cortessis, V; Sparkes, R S; Kivlin, J D; Mohandas, T; Inana, G

    1990-01-01

    A human ornithine aminotransferase (OAT) locus has been mapped to the Xp11.2, as has the Norrie disease locus. We used a cDNA probe to investigate a 3-generation UCLA family with Norrie disease; a 4.2-kb RFLP was detected and a maximum lod score of 0.602 at zero recombination fraction was calculated. We used the same probe to study a second multigeneration family with Norrie disease from Utah. A different RFLP of 7.5 kb in size was identified and a recombinational event between the OAT locus represented by this RFLP and the disease loci was observed. Linkage analysis of these two loci in this family revealed a maximum load score of 1.88 at a recombination fraction of 0.10. Although both families have affected members with the same disease, the lod scores are reported separately because the 4.2- and 7.5-kb RFLPs may represent two different loci for the X-linked OAT.

  2. A putative autonomous 20.5 kb-CACTA transposon insertion in an F3'H allele identifies a new CACTA transposon subfamily in Glycine max

    Directory of Open Access Journals (Sweden)

    Vodkin Lila

    2008-12-01

    in the gray trichome allele t*. Conclusion The molecular characterization of a 20.5 kb insertion in the flavonoid 3'-hydroxylase (F3'H gene of a soybean gray pubescence allele (t* identified the structure of a CACTA transposon designated Tgmt*. Besides the terminal inverted repeats and subterminal repeated motifs,Tgmt* encoded a large gene with two putative functions that are required for excision and transposition of a CACTA element, a transposase and the DNA binding protein known to associate to the subterminal repeated motifs. The degree of dissimilarity between Tgmt* transposase and subterminal repeated motifs with those of previously characterized defective CACTA elements (Tgm1-7 were evidence of the existence of two subfamilies of CACTA transposons in soybean, an observation not previously reported in other plants. In addition, our analyses of a genetically active and potentially autonomous element sheds light on the complete structure of a soybean element that is useful for annotation of the repetitive fraction of the soybean genome sequence and may prove useful for transposon tagging or transposon display experiments in different genetic lines.

  3. Evolution of the solar constant

    International Nuclear Information System (INIS)

    Newman, M.J.

    1978-01-01

    The ultimate source of the energy utilized by life on Earth is the Sun, and the behavior of the Sun determines to a large extent the conditions under which life originated and continues to thrive. What can be said about the history of the Sun. Has the solar constant, the rate at which energy is received by the Earth from the Sun per unit area per unit time, been constant at its present level since Archean times. Three mechanisms by which it has been suggested that the solar energy output can vary with time are discussed, characterized by long (approx. 10 9 years), intermediate (approx. 10 8 years), and short (approx. years to decades) time scales

  4. Calculation of magnetic hyperfine constants

    International Nuclear Information System (INIS)

    Bufaical, R.F.; Maffeo, B.; Brandi, H.S.

    1975-01-01

    The magnetic hyperfine constants of the V sub(K) center in CaF 2 , SrF 2 and BaF 2 have been calculated assuming a phenomenological model, based on the F 2 - 'central molucule', to describe the wavefunction of the defect. Calculations have shown that introduction of a small degree of covalence, between this central molecule and neighboring ions, is necessary to improve the electronic structure description of the defect. It was also shown that the results for the hyperfine constants are strongly dependent on the relaxations of the ions neighboring the central molecule; these relaxations have been determined by fitting the experimental data. The present results are compared with other previous calculations where similar and different theoretical methods have been used

  5. On the gravitational constant change

    International Nuclear Information System (INIS)

    Milyukov, V.K.

    1986-01-01

    The nowadays viewpoint on the problem of G gravitational constant invariability is presented in brief. The methods and results of checking of the G dependence on the nature of substance (checking of the equivalence principle), G dependepce on distance (checking of Newton gravity law) and time (cosmological experiments) are presented. It is pointed out that all performed experiments don't give any reasons to have doubts in G constancy in space and time and G independence on the nature of the substance

  6. Photodissociation constant of NO2

    International Nuclear Information System (INIS)

    Nootebos, M.A.; Bange, P.

    1992-01-01

    The velocity of the dissociation of NO 2 into ozone and NO mainly depends on the ultraviolet sunlight quantity, and with that the cloudiness. A correct value for this reaction constant is important for the accurate modelling of O 3 - and NO 2 -concentrations in plumes of electric power plants, in particular in the case of determination of the amount of photochemical summer smog. An advanced signal processing method (deconvolution, correlation) was applied on the measurements. The measurements were carried out from aeroplanes

  7. KB-R7943, a plasma membrane Na(+)/Ca(2+) exchanger inhibitor, blocks opening of the mitochondrial permeability transition pore.

    Science.gov (United States)

    Wiczer, Brian M; Marcu, Raluca; Hawkins, Brian J

    2014-01-31

    The isothiourea derivative, KB-R7943, inhibits the reverse-mode of the plasma membrane sodium/calcium exchanger and protects against ischemia/reperfusion injury. The mechanism through which KB-R7943 confers protection, however, remains controversial. Recently, KB-R7943 has been shown to inhibit mitochondrial calcium uptake and matrix overload, which may contribute to its protective effects. While using KB-R7943 for this purpose, we find here no evidence that KB-R7943 directly blocks mitochondrial calcium uptake. Rather, we find that KB-R7943 inhibits opening of the mitochondrial permeability transition pore in permeabilized cells and isolated liver mitochondria. Furthermore, we find that this observation correlates with protection against calcium ionophore-induced mitochondrial membrane potential depolarization and cell death, without detrimental effects to basal mitochondrial membrane potential or complex I-dependent mitochondrial respiration. Our data reveal another mechanism through which KB-R7943 may protect against calcium-induced injury, as well as a novel means to inhibit the mitochondrial permeability transition pore. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. The protective effect of Na+/Ca2+ exchange blocker kb-r7943 on myocardial ischemia-reperfusion injury in hypercholesterolemic rat.

    Science.gov (United States)

    Ren, Yongkui; Deng, Liju; Cai, Yunfei; Lv, Yan; Jia, Dalin

    2014-11-01

    KB-R7943 reduces lethal reperfusion injury under normal conditions, but its effectiveness under certain pathological states is in dispute. In the present study, we sought to determine the effect of KB-R7943 in hyperlipidemic animals and assess if the K ATP (+) are involved in the protective mechanisms. In group 1 (G1), isolated rat hearts underwent 25 min global ischemia (GI) and 120 min reperfusion (R). In group 2 (G2), G1 was repeated but the animals were subjected to a 1.5 % cholesterol-enriched diet during 6 weeks (hypercholesterolemic animals). In group 3 (G3), G2 was repeated but 1 μM KB-R7943 was added to the perfusate for 10 min from the start of reperfusion. In group 4 (G4), G3 was repeated, and glibenclamide (K ATP (+) , blocker, 0.3 μM) was administered. The infarct size was measured by triphenyltetrazolium. The infarct size was 35 ± 5.0 % in G1 and 46 ± 8.7 % in G2 (P KB-R7943 reduced the infarct size (28.6 ± 3.3 % in G3 vs. G2, P KB-R7943 attenuated apoptotic cell (G3 vs. G2, P KB-R7943. Thus, diet-induced hypercholesterolemia enhances myocardial injury; KB-R7943 reduces infarct size and apoptosis in hyperlipidemic animals through the activation of K(+)ATP channels.

  9. Fine-structure constant: Is it really a constant

    International Nuclear Information System (INIS)

    Bekenstein, J.D.

    1982-01-01

    It is often claimed that the fine-structure ''constant'' α is shown to be strictly constant in time by a variety of astronomical and geophysical results. These constrain its fractional rate of change alpha-dot/α to at least some orders of magnitude below the Hubble rate H 0 . We argue that the conclusion is not as straightforward as claimed since there are good physical reasons to expect alpha-dot/α 0 . We propose to decide the issue by constructing a framework for a variability based on very general assumptions: covariance, gauge invariance, causality, and time-reversal invariance of electromagnetism, as well as the idea that the Planck-Wheeler length (10 -33 cm) is the shortest scale allowable in any theory. The framework endows α with well-defined dynamics, and entails a modification of Maxwell electrodynamics. It proves very difficult to rule it out with purely electromagnetic experiments. In a cosmological setting, the framework predicts an alpha-dot/α which can be compatible with the astronomical constraints; hence, these are too insensitive to rule out α variability. There is marginal conflict with the geophysical constraints: however, no firm decision is possible because of uncertainty about various cosmological parameters. By contrast the framework's predictions for spatial gradients of α are in fatal conflict with the results of the Eoetvoes-Dicke-Braginsky experiments. Hence these tests of the equivalence principle rule out with confidence spacetime variability of α at any level

  10. [Effect of smokers'sera on Porphyromonas gingivalis internalizing KB cells and the expression of matrix metalloproteinase-1, -9 and tissue inhibitor of metalloproteinase-1].

    Science.gov (United States)

    Wang, Hongyan; Tan, Lisi; Liu, Junchao; Li, Qian; Pan, Yaping; Zhong, Ming

    2014-01-01

    To investigate the effects of serum from smoking individuals or non-smoking individuals with periodontitis on Porphyromonas gingivalis (Pg) internalizing KB cells, and the expression of matrix metalloproteinase(MMP)-1, MMP-9, tissue inhibitor of metalloproteinase-1 (TIMP-1) in the culture supernatant of KB cells. The venous blood of 20 periodontitis patients' (10 smoking and 10 non-smoking) was extracted under the informed consent and centrifuged for serum. The smoking-individual serum (Y group) and non-smoking-individual (N group) serum were added to the model of Pg internalizing KB cells for 12 hours, plated on brain-heart infusion (BHI) and incubated anaerobically at 37 °C for 5 days. The colony forming units (CFU) of cell-invasive bacteria were estimated by colony counting. MMP-1, MMP-9 and TIMP-1 protein levels in culture supernatant were determined by enzyme-linked immunosorbent assay(ELISA) in the two groups following co-culture of Pg with KB cells for 12 hours. The CFU were (11.2 ± 1.1)×10(4), (12.6 ± 1.2)×10(4), (44.7 ± 1.3)×10(4) CFU/ml when adding 200, 400, 800 µl Y-group serum to the model of Pg co-culture with KB cells and when the serum was extracted from N group, the CFU were (33.6 ± 1.4)×10(4),(38.9 ± 1.1)×10(4), (11.2 ± 1.2)×10(4) CFU/ml respectively. When 200, 400, 800 µl Y group-serum was added to co-culture fluid of Pg internalizing KB cells, the concentrations of MMP-1 secreted from KB cells were (107.2 ± 21.5), (165.9 ± 20.2), (434.4 ± 48.0) µg/L respectively, the concentrations of MMP-9 were (3.99 ± 0.29), (4.21 ± 0.61), (5.62 ± 0.47) µg/L respectively, the concentrations of TIMP-1 were (401.3 ± 12.7), (418.3 ± 28.5), (637.3 ± 37.3) µg/L. When the serum (200, 400, 800 µl) extracted from N group, the concentration of MMP-1 and MMP-9 secreted by KB cell were (77.6 ± 10.8), (84.7 ± 10.2) and (98.2 ± 9.7) µg/L and (3.84 ± 0.52), (4.02 ± 0.68), (4.25 ± 0.37) µg/L, respectively. The concentration of TIMP-1 were

  11. Chandra Independently Determines Hubble Constant

    Science.gov (United States)

    2006-08-01

    A critically important number that specifies the expansion rate of the Universe, the so-called Hubble constant, has been independently determined using NASA's Chandra X-ray Observatory. This new value matches recent measurements using other methods and extends their validity to greater distances, thus allowing astronomers to probe earlier epochs in the evolution of the Universe. "The reason this result is so significant is that we need the Hubble constant to tell us the size of the Universe, its age, and how much matter it contains," said Max Bonamente from the University of Alabama in Huntsville and NASA's Marshall Space Flight Center (MSFC) in Huntsville, Ala., lead author on the paper describing the results. "Astronomers absolutely need to trust this number because we use it for countless calculations." Illustration of Sunyaev-Zeldovich Effect Illustration of Sunyaev-Zeldovich Effect The Hubble constant is calculated by measuring the speed at which objects are moving away from us and dividing by their distance. Most of the previous attempts to determine the Hubble constant have involved using a multi-step, or distance ladder, approach in which the distance to nearby galaxies is used as the basis for determining greater distances. The most common approach has been to use a well-studied type of pulsating star known as a Cepheid variable, in conjunction with more distant supernovae to trace distances across the Universe. Scientists using this method and observations from the Hubble Space Telescope were able to measure the Hubble constant to within 10%. However, only independent checks would give them the confidence they desired, considering that much of our understanding of the Universe hangs in the balance. Chandra X-ray Image of MACS J1149.5+223 Chandra X-ray Image of MACS J1149.5+223 By combining X-ray data from Chandra with radio observations of galaxy clusters, the team determined the distances to 38 galaxy clusters ranging from 1.4 billion to 9.3 billion

  12. Cryptography in constant parallel time

    CERN Document Server

    Applebaum, Benny

    2013-01-01

    Locally computable (NC0) functions are 'simple' functions for which every bit of the output can be computed by reading a small number of bits of their input. The study of locally computable cryptography attempts to construct cryptographic functions that achieve this strong notion of simplicity and simultaneously provide a high level of security. Such constructions are highly parallelizable and they can be realized by Boolean circuits of constant depth.This book establishes, for the first time, the possibility of local implementations for many basic cryptographic primitives such as one-way func

  13. Low power constant fraction discriminator

    International Nuclear Information System (INIS)

    Krishnan, Shanti; Raut, S.M.; Mukhopadhyay, P.K.

    2001-01-01

    This paper describes the design of a low power ultrafast constant fraction discriminator, which significantly reduces the power consumption. A conventional fast discriminator consumes about 1250 MW of power whereas this low power version consumes about 440 MW. In a multi detector system, where the number of discriminators is very large, reduction of power is of utmost importance. This low power discriminator is being designed for GRACE (Gamma Ray Atmospheric Cerenkov Experiments) telescope where 1000 channels of discriminators are required. A novel method of decreasing power consumption has been described. (author)

  14. Can coupling constants be related

    International Nuclear Information System (INIS)

    Nandi, Satyanarayan; Ng, Wing-Chiu.

    1978-06-01

    We analyze the conditions under which several coupling constants in field theory can be related to each other. When the relation is independent of the renormalization point, the relation between any g and g' must satisfy a differential equation as follows from the renormalization group equations. Using this differential equation, we investigate the criteria for the feasibility of a power-series relation for various theories, especially the Weinberg-Salam type (including Higgs bosons) with an arbitrary number of quark and lepton flavors. (orig./WL) [de

  15. Exact constants in approximation theory

    CERN Document Server

    Korneichuk, N

    1991-01-01

    This book is intended as a self-contained introduction for non-specialists, or as a reference work for experts, to the particular area of approximation theory that is concerned with exact constants. The results apply mainly to extremal problems in approximation theory, which in turn are closely related to numerical analysis and optimization. The book encompasses a wide range of questions and problems: best approximation by polynomials and splines; linear approximation methods, such as spline-approximation; optimal reconstruction of functions and linear functionals. Many of the results are base

  16. Hydrodynamic constants from cosmic censorship

    International Nuclear Information System (INIS)

    Nakamura, Shin

    2008-01-01

    We study a gravity dual of Bjorken flow of N=4 SYM-theory plasma. We point out that the cosmic censorship hypothesis may explain why the regularity of the dual geometry constrains the hydrodynamic constants. We also investigate the apparent horizon of the dual geometry. We find that the dual geometry constructed on Fefferman-Graham (FG) coordinates is not appropriate for examination of the apparent horizon since the coordinates do not cover the trapped region. However, the preliminary analysis on FG coordinates suggests that the location of the apparent horizon is very sensitive to the hydrodynamic parameters. (author)

  17. Comparative In Vitro Binding Studies of TiCl2(dpme2, Ti(ada2(bzac2, and TiCl2(bzac(bpme Titanium Complexes with Calf-Thymus DNA

    Directory of Open Access Journals (Sweden)

    Pamita Awasthi

    2015-01-01

    Full Text Available The binding of TiCl2(dpme2 (1, (dpme = 6,6′-dimethyl-2,2′-bipyridine, Ti(ada2(bzac2 (2, (ada = adamantylamine; bzac = benzoylacetone, and TiCl2(bzac(bpme (3, (bpme = 4,4′-dimethyl-2,2′-bipyrdine with calf thymus (ct DNA has been studied by UV-visible spectroscopy, thermal denaturation, and circular dichroism spectroscopy. In UV-visible study complexes 1, 2, and 3 showed red, blue, and red shifts, respectively, upon the addition of ct-DNA along with a significant hyperchromism. The intrinsic binding constants (Kb calculated from UV-visible absorption studies were 2.3 × 103 M−1, 3.3 × 103 M−1 and, 7.1 × 103 M−1 for complexes 1, 2, and 3, respectively. The change in melting temperature (ΔTm was calculated to be 2-3°C for each complex. Circular dichroism (CD study showed blue shift for complex 2 and red shift for complexes 1 and 3 along with rise in molecular ellipticity upon the addition of complexes. Results suggest a binding mode of complex 2 different than 1 and 3.

  18. Investigation of the complex structure, comparative DNA-binding and DNA cleavage of two water-soluble mono-nuclear lanthanum(III) complexes and cytotoxic activity of chitosan-coated magnetic nanoparticles as drug delivery for the complexes

    Science.gov (United States)

    Asadi, Zahra; Nasrollahi, Neda; Karbalaei-Heidari, Hamidreza; Eigner, Vaclav; Dusek, Michal; Mobaraki, Nabiallah; Pournejati, Roya

    2017-05-01

    Two water-soluble mono-nuclear macrocyclic lanthanum(III) complexes of 2,6-diformyl-4-methylphenol with 1,3-diamino-2-propanol (C1) or 1,3-propylenediamine (C2) were synthesized and characterized by UV-Vis, FT-IR, 13C and 1H NMR spectroscopy and elemental analysis. C1 complex was structurally characterized by single-crystal X-ray diffraction, which revealed that the complex was mononuclear and ten-coordinated. The coordination sites around lanthanum(III) were occupied with a five-dentate ligand, two bidentate nitrates, and one water molecule. The interaction of complexes with DNA was studied in buffered aqueous solution at pH 7.4. UV-Vis absorption spectroscopy, emission spectroscopy, circular dichroism (CD) and viscometric measurements provided clear evidence of the intercalation mechanism of binding. The obtained intrinsic binding constants (Kb) 9.3 × 103 and 1.2 × 103 M- 1 for C1 and C2, respectively confirmed that C1 is better intercalator than C2. The DNA docking studies suggested that the complexes bind with DNA in a groove binding mode with the binding affinity of C1 > C2. Moreover, agarose gel electrophoresis study of the DNA-complex for both compounds revealed that the C1 intercalation cause ethidium bromide replacement in a competitive manner which confirms the suggested mechanism of binding. Finally, the anticancer experiments for the treated cancerous cell lines with both synthesized compounds show that these hydrophilic molecules need a suitable carrier to pass through the hydrophobic nature of cell membrane efficiently.

  19. DNA binding studies of Sunset Yellow FCF using spectroscopy, viscometry and electrochemical techniques

    Science.gov (United States)

    Asaadi, Sara; Hajian, Reza

    2017-10-01

    Color is one of the important factors in food industry. All food companies use synthetic pigments to improve the aesthetic of products. Studies on the interaction between deoxyribonucleic acid (DNA) and food dye molecules is important because DNA is responsible for some processes including replication and transcription of cells, mutations, genetic diseases, and some synthetic chemical nucleases. In this study, the molecular interaction between Sunset Yellow FCF (SY) as a common food coloring additive and calf thymus DNA (ct-DNA) has been studied using UV-Vis spectrophotometry, spectrofluorometry, Fourier transform infrared (FTIR) spectroscopy, cyclic voltammetry and viscometry techniques. The binding constant between ct-DNA and SY in phosphate buffer solution (pH 7.4) was calculated as 2.09 × 103 L mol-1. The non-electrostatic bonding constant (K0t) was almost consistent and the ratio of K0t/Kb increased by increasing the ionic strength in the range of 0.01-0.1 mol L-1 of KCl. This observation shows that, the molecular bonding of SY to ct-DNA is a combination of electrostatic and intercalation interactions. In the electrochemical studies, an oxidation peak at 0.71 V and a reduction peak at about 0.63 V was observed with the peak potential difference (ΔEp) of 0.08 V, showing a reversible process. The oxidation and reduction peaks were significantly decreased in the presence of ct-DNA and the reduction peak current shifted to negative values. In spectrofluorometric study, the fluorescence intensity of SY increased dramatically after successive addition of DNA due to the increasing of molecular surface area and decreasing of impact frequency between solvent and SY-DNA adduct. Moreover, viscometric study shows that the increasing of viscosity for SY solution in the presence of DNA is due to the intercalation mechanism with double strand DNA (ds-DNA).

  20. Relaxing a large cosmological constant

    International Nuclear Information System (INIS)

    Bauer, Florian; Sola, Joan; Stefancic, Hrvoje

    2009-01-01

    The cosmological constant (CC) problem is the biggest enigma of theoretical physics ever. In recent times, it has been rephrased as the dark energy (DE) problem in order to encompass a wider spectrum of possibilities. It is, in any case, a polyhedric puzzle with many faces, including the cosmic coincidence problem, i.e. why the density of matter ρ m is presently so close to the CC density ρ Λ . However, the oldest, toughest and most intriguing face of this polyhedron is the big CC problem, namely why the measured value of ρ Λ at present is so small as compared to any typical density scale existing in high energy physics, especially taking into account the many phase transitions that our Universe has undergone since the early times, including inflation. In this Letter, we propose to extend the field equations of General Relativity by including a class of invariant terms that automatically relax the value of the CC irrespective of the initial size of the vacuum energy in the early epochs. We show that, at late times, the Universe enters an eternal de Sitter stage mimicking a tiny positive cosmological constant. Thus, these models could be able to solve the big CC problem without fine-tuning and have also a bearing on the cosmic coincidence problem. Remarkably, they mimic the ΛCDM model to a large extent, but they still leave some characteristic imprints that should be testable in the next generation of experiments.

  1. Formas estructurales de fuerza constante

    Directory of Open Access Journals (Sweden)

    Zalewski, Waclaw

    1963-05-01

    Full Text Available The author seeks to prove the need to obtain the most essential form in the various types of structures by applying a number of rational principles, of which the constant stress principle is one of the most decisive. The structural form should be a logical consequence of all its functional circumstances, and this requires a clear understanding of the general behaviour of each part of the structure, and also of the main stresses which operate on it, considered as a unitary whole. To complete his theoretical argument, the author gives some examples, in the design of which the criterion of constant stress has been adopted. The author considers the various aspects which are involved in obtaining a structural design that satisfies given functional and aesthetic requirements. In doing so he refers to his personal experience within Poland, and infers technical principles of general validity which should determine the rational design of the form, as an integrated aspect of the structural pattern. The projects which illustrate this paper are Polish designs of undoubted constructive significance, in which the principle of constant stress has been applied. Finally the author condenses his whole theory in a simple and straightforward practical formula, which should be followed if a truly rational form is to be achieved: the constancy of stress in the various structural elements.El autor se esfuerza en mostrar la necesidad de llegar a la forma real en las distintas estructuras siguiendo una serie de principios racionales, entre los que domina el criterio de la fuerza constante. La forma ha de ser una consecuencia lógica en todos sus aspectos, y esto exige un claro conocimiento del comportamiento general de cada una de las partes de la estructura, y de los esfuerzos generales que dominan en la misma al considerarla como un todo. Para completar la exposición de orden teórico, el autor presenta algunos ejemplos en cuyo proyecto se ha seguido el criterio de

  2. Dwarfism and Altered Craniofacial Development in Rabbits Is Caused by a 12.1 kb Deletion at the HMGA2 Locus.

    Science.gov (United States)

    Carneiro, Miguel; Hu, Dou; Archer, John; Feng, Chungang; Afonso, Sandra; Chen, Congying; Blanco-Aguiar, José A; Garreau, Hervé; Boucher, Samuel; Ferreira, Paula G; Ferrand, Nuno; Rubin, Carl-Johan; Andersson, Leif

    2017-02-01

    The dwarf phenotype characterizes the smallest of rabbit breeds and is governed largely by the effects of a single dwarfing allele with an incompletely dominant effect on growth. Dwarf rabbits typically weigh under 1 kg and have altered craniofacial morphology. The dwarf allele is recessive lethal and dwarf homozygotes die within a few days of birth. The dwarf phenotype is expressed in heterozygous individuals and rabbits from dwarf breeds homozygous for the wild-type allele are normal, although smaller when compared to other breeds. Here, we show that the dwarf allele constitutes a ∼12.1 kb deletion overlapping the promoter region and first three exons of the HMGA2 gene leading to inactivation of this gene. HMGA2 has been frequently associated with variation in body size across species. Homozygotes for null alleles are viable in mice but not in rabbits and probably not in humans. RNA-sequencing analysis of rabbit embryos showed that very few genes (4-29 genes) were differentially expressed among the three HMGA2/dwarf genotypes, suggesting that dwarfism and inviability in rabbits are caused by modest changes in gene expression. Our results show that HMGA2 is critical for normal expression of IGF2BP2, which encodes an RNA-binding protein. Finally, we report a catalog of regions of elevated genetic differentiation between dwarf and normal-size rabbits, including LCORL-NCAPG, STC2, HOXD cluster, and IGF2BP2 Levels and patterns of genetic diversity at the LCORL-NCAPG locus further suggest that small size in dwarf breeds was enhanced by crosses with wild rabbits. Overall, our results imply that small size in dwarf rabbits results from a large effect, loss-of-function (LOF) mutation in HMGA2 combined with polygenic selection. Copyright © 2017 by the Genetics Society of America.

  3. Pro-dopamine regulator, KB220Z, attenuates hoarding and shopping behavior in a female, diagnosed with SUD and ADHD.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Steinberg, Bruce; Modestino, Edward J; Fried, Lyle; Baron, David; Siwicki, David; Braverman, Eric R; Badgaiyan, Rajendra D

    2018-03-01

    Background Addictive-like behaviors (e.g., hoarding and shopping) may be the result of the cumulative effects of dopaminergic and other neurotransmitter genetic variants as well as elevated stress levels. We, therefore, propose that dopamine homeostasis may be the preferred goal in combating such challenging and unwanted behaviors, when simple dopaminergic activation through potent agonists may not provide any resolution. Case presentation C.J. is a 38-year-old, single, female, living with her mother. She has a history of substance use disorder as well as attention deficit hyperactivity disorder, inattentive type. She had been stable on buprenorphine/naloxone combination and amphetamine, dextroamphetamine mixed salts for many years when unexpectedly she lost her job for oversleeping and not calling into work. KB200z (a pro-dopamine compound) was added to her regimen for complaints of low drive and motivation. After taking this nutraceutical for 4 weeks, she noticed a marked improvement in her mental status and many behaviors. She noted that her shopping and hoarding addictions had appreciably decreased. Furthermore, her lifelong history of terrifying lucid dreams was eliminated. Finally, she felt more in control; her locus of control shifted from external to more internal. Discussion The hypothesis is that C.J.'s reported, behavioral, and psychological benefits resulted from the pro-dopamine-regulating effect of KB220Z across the brain reward system. Conclusions This effect, we surmise, could be the result of a new dopamine balance, across C.J.'s brain reward system. Dopamine homeostasis is an effect of KB220Z seen in both animal and human placebo-controlled fMRI experiments.

  4. Constitutive Activation of NF-KB in Prostate Carcinoma Cells Through a Positive Feedback Loop: Implication of Inducible IKK-Related Kinase (IKKi)

    National Research Council Canada - National Science Library

    Budunova, Irina V

    2005-01-01

    The overall goal of this project is to understand the role of inducible IKK-related kinase IKKi in constitutive activation of anti-apoptotic transcription factor NF-KB prostate carcinoma (PC) cells...

  5. Binding of tritiated corticosterone in brain sections of adrenalectomized rat

    International Nuclear Information System (INIS)

    Sarrieau, A.; Vial, M.; Dussaillant, M.; Rostene, W.; Philibert, P.

    1983-01-01

    A new technique which permits to study the specific binding of tritiated corticosterone in brain sections of adrenalectomized rats is described. Under these conditions, the specific binding of the glucocorticoid represents 60 to 70% of the initial binding. The apparent dissociation constant and the number of binding sites, determined by Scatchard analysis, are in the range of 10 -8 M and 100 fmoles/mg of protein respectively [fr

  6. The effect of Lactobacillus brevis KB290 against irritable bowel syndrome: a placebo-controlled double-blind crossover trial

    Directory of Open Access Journals (Sweden)

    Murakami Katsumi

    2012-08-01

    Full Text Available Abstract Background Irritable bowel syndrome (IBS is a functional disorder of the digestive tract that causes chronic abdominal symptoms. We evaluated the effects of Lactobacillus brevis KB290 (KB290, which has been demonstrated to be effective at improving bowel movements and the composition of intestinal microflora, on IBS symptoms. Methods We performed a placebo control double-blind cross matched trial. Thirty-five males and females (aged 6 years and above who had been diagnosed with IBS according to the Rome III criteria were divided into 2 groups, and after a 4-week pre-trial observation period, they were administered test capsules containing KB290 or placebo for 4 weeks (consumption period I. Then, the capsule administration was suspended for 4 weeks in both groups (washout period, before the opposite capsules were administered for a further 4 weeks (consumption period II. Fecal samples were collected on the first day of the pre-consumption observation period, the last day of consumption period I, the last day of the washout period, and the last day of consumption period II. In addition, the subjects’ IBS symptoms and quality of life (QOL and any adverse events that they experienced were evaluated. Results No significant difference in IBS symptoms was noted among the various periods. However, the mean QOL scores were improved during the test capsule consumption. The frequencies of watery and mushy feces were significantly lower in the test capsule consumption period than during the pre-consumption observation period, and the frequency of abdominal pain was significantly reduced in the test capsule consumption period compared with the other periods. The frequency of the genus Bifidobacterium was significantly higher, and that of the genus Clostridium was significantly lower, after the test capsule consumption than after the placebo consumption. The frequencies of the genera Lactobacillus, Bacteroides, and Enterococcus were also

  7. Alpinia pricei Rhizome Extracts Induce Cell Cycle Arrest in Human Squamous Carcinoma KB Cells and Suppress Tumor Growth in Nude Mice

    Directory of Open Access Journals (Sweden)

    You-Cheng Hseu

    2011-01-01

    Full Text Available Alpinia pricei has been shown to induce apoptosis in human squamous carcinoma (KB cells. In this study, we report the effectiveness of the ethanol (70% extracts of A. pricei rhizome (AP extracts in terms of tumor regression as determined using both in vitro cell culture and in vivo athymic nude mice models of KB cells. We found that the AP extract (25–200 μg/mL treatment decreased the proliferation of KB cells by arresting progression through the G2/M phase of the cell cycle. This cell cycle blockade was associated with reductions in cyclin A and B1, Cdc2, and Cdc25C, and increased p21/WAF1, Wee1, p53 and phospho-p53 (p-p53 in a dose- and time-dependent manner. Moreover, we found that AP extract treatment decreased metalloproteinase-9 (MMP-9 and urokinase plasminogen activator (u-PA expression, while expression of their endogenous inhibitors, tissue inhibitor of MMP-1 (TIMP-1 and plasminogen activator inhibitor-1 (PAI-1, were increased in KB cells. Furthermore, AP extract treatment effectively delayed tumor incidence in nude mice inoculated with KB cells and reduced the tumor burden. AP extract treatment also induced apoptotic DNA fragmentation, as detected by in situ TUNEL staining. Thus, A. pricei may possess antitumor activity in human squamous carcinoma (KB cells.

  8. Umbelliferone arrest cell cycle at G0/G1 phase and induces apoptosis in human oral carcinoma (KB) cells possibly via oxidative DNA damage.

    Science.gov (United States)

    Vijayalakshmi, Annamalai; Sindhu, Ganapathy

    2017-08-01

    Umbelliferone (UMB) has widespread pharmacological activity, comprising anti-inflammatory, anti-oxidant, anti-genotoxic and anti-immunomodulatory but the anticancer activity remains unknown in human oral carcinoma (HOC) KB cells. MTT assay determinations was revealed that treatment of KB cells with UMB, prevent and reduce the cell proliferation with the IC 50 - 200μM as well as induces loss of cell viability, morphology change and internucleosomal DNA fragmentation in a concentration dependent manner. Acridine orange and ethidium bromide dual staining assay established that UMB induced apoptosis in KB cells in a dose dependent manner. Alkaline comet assay determination revealed UMB has the potential to increase oxidative DNA damage in KB cells through DNA tail formation significantly (pKB cells. Similarly, we observed increased DNA damage stimulated apoptotic morphological changes in UMB treated cells. Taken together, the present study suggests that UMB exhibits anticancer effect on KB cell line with the increased generation of intracellular ROS, triggered oxidative stress mediated depolarization of mitochondria, which contributes cell death via DNA damage as well as cell cycle arrest at G0/G1 phase. The results have also provided us insight in the pharmacological backgrounds for the potential use of UMB, to target divergent pathways of cell survival and cell death. To conclude UMB could develop as a novel candidate for cancer chemoprevention and therapy, which is our future focus and to develop a connectivity map between in vivo and in vitro activity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Measuring Binding Affinity of Protein-Ligand Interaction Using Spectrophotometry: Binding of Neutral Red to Riboflavin-Binding Protein

    Science.gov (United States)

    Chenprakhon, Pirom; Sucharitakul, Jeerus; Panijpan, Bhinyo; Chaiyen, Pimchai

    2010-01-01

    The dissociation constant, K[subscript d], of the binding of riboflavin-binding protein (RP) with neutral red (NR) can be determined by titrating RP to a fixed concentration of NR. Upon adding RP to the NR solution, the maximum absorption peak of NR shifts to 545 nm from 450 nm for the free NR. The change of the absorption can be used to determine…

  10. Constant Proportion Debt Obligations (CPDOs)

    DEFF Research Database (Denmark)

    Cont, Rama; Jessen, Cathrine

    2012-01-01

    be made arbitrarily small—and thus the credit rating arbitrarily high—by increasing leverage, but the ratings obtained strongly depend on assumptions on the credit environment (high spread or low spread). More importantly, CPDO loss distributions are found to exhibit a wide range of tail risk measures......Constant Proportion Debt Obligations (CPDOs) are structured credit derivatives that generate high coupon payments by dynamically leveraging a position in an underlying portfolio of investment-grade index default swaps. CPDO coupons and principal notes received high initial credit ratings from...... the major rating agencies, based on complex models for the joint transition of ratings and spreads for all names in the underlying portfolio. We propose a parsimonious model for analysing the performance of CPDO strategies using a top-down approach that captures the essential risk factors of the CPDO. Our...

  11. Energy, stability and cosmological constant

    International Nuclear Information System (INIS)

    Deser, S.

    1982-01-01

    The definition of energy and its use in studying stability in general relativity are extended to the case when there is a nonvanishing cosmological constant Λ. Existence of energy is first demonstrated for any model (with arbitrary Λ). It is defined with respect to sets of solutions tending asymptotically to any background space possessing timelike Killing symmetry, and is both conserved and of flux integral form. When Λ O, small excitations about De Sitter space are stable inside the event horizon. Outside excitations can contribute negatively due to the Killing vector's flip at the horizon. This is a universal phenomenon associated with the possibility of Hawking radiation. Apart from this effect, the Λ>O theory appears to be stable, also at the semi-classical level. (author)

  12. Filament instability under constant loads

    Science.gov (United States)

    Monastra, A. G.; Carusela, M. F.; D’Angelo, M. V.; Bruno, L.

    2018-04-01

    Buckling of semi-flexible filaments appears in different systems and scales. Some examples are: fibers in geophysical applications, microtubules in the cytoplasm of eukaryotic cells and deformation of polymers freely suspended in a flow. In these examples, instabilities arise when a system’s parameter exceeds a critical value, being the Euler force the most known. However, the complete time evolution and wavelength of buckling processes are not fully understood. In this work we solve analytically the time evolution of a filament under a constant compressive force in the small amplitude approximation. This gives an insight into the variable force scenario in terms of normal modes. The evolution is highly sensitive to the initial configuration and to the magnitude of the compressive load. This model can be a suitable approach to many different real situations.

  13. Evolution of the solar 'constant'

    Energy Technology Data Exchange (ETDEWEB)

    Newman, M J

    1980-06-01

    Variations in solar luminosity over geological time are discussed in light of the effect of the solar constant on the evolution of life on earth. Consideration is given to long-term (5 - 7% in a billion years) increases in luminosity due to the conversion of hydrogen into helium in the solar interior, temporary enhancements to solar luminosity due to the accretion of matter from the interstellar medium at intervals on the order of 100 million years, and small-amplitude rapid fluctuations of luminosity due to the stochastic nature of convection on the solar surface. It is noted that encounters with dense interstellar clouds could have had serious consequences for life on earth due to the peaking of the accretion-induced luminosity variation at short wavelengths.

  14. Asympotics with positive cosmological constant

    Science.gov (United States)

    Bonga, Beatrice; Ashtekar, Abhay; Kesavan, Aruna

    2014-03-01

    Since observations to date imply that our universe has a positive cosmological constant, one needs an extension of the theory of isolated systems and gravitational radiation in full general relativity from the asymptotically flat to asymptotically de Sitter space-times. In current definitions, one mimics the boundary conditions used in asymptotically AdS context to conclude that the asymptotic symmetry group is the de Sitter group. However, these conditions severely restricts radiation and in fact rules out non-zero flux of energy, momentum and angular momentum carried by gravitational waves. Therefore, these formulations of asymptotically de Sitter space-times are uninteresting beyond non-radiative spacetimes. The situation is compared and contrasted with conserved charges and fluxes at null infinity in asymptotically flat space-times.

  15. The fundamental constants a mystery of physics

    CERN Document Server

    Fritzsch, Harald

    2009-01-01

    The speed of light, the fine structure constant, and Newton's constant of gravity — these are just three among the many physical constants that define our picture of the world. Where do they come from? Are they constant in time and across space? In this book, physicist and author Harald Fritzsch invites the reader to explore the mystery of the fundamental constants of physics in the company of Isaac Newton, Albert Einstein, and a modern-day physicist

  16. Europium (III) and americium (III) stability constants with humic acid

    International Nuclear Information System (INIS)

    Torres, R.A.; Choppin, G.R.

    1984-01-01

    The stability constants for tracer concentrations of Eu(III) and Am(III) complexes with a humic acid extracted from a lake-bottom sediment were measured using a solvent extraction system. The organic extractant was di(2-ethylhexyl)-phosphoric acid in toluene while the humate aqueous phase had a constant ionic strength of 0.1 M (NaClO 4 ). Aqueous humic acid concentrations were monitored by measuring uv-visible absorbances at approx.= 380 nm. The total carboxylate capacity of the humic acid was determined by direct potentiometric titration to be 3.86 +- 0.03 meq/g. The humic acid displayed typical characteristics of a polyelectrolyte - the apparent pKsub(a), as well as the calculated metal ion stability constants increased as the degree of ionization (α) increased. The binding data required a fit of two stability constants, β 1 and β 2 , such that for Eu, log β 1 = 8.86 α + 4.39, log β 2 = 3.55 α + 11.06 while for Am, log β 1 = 10.58 α + 3.84, log β 2 = 5.32 α + 10.42. With hydroxide, carbonate, and humate as competing ligands, the humate complex associated with the β 1 constant is calculated to be the dominant species for the trivalent actinides and lanthanides under conditions present in natural waters. (orig.)

  17. The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia.

    Science.gov (United States)

    Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei

    2014-04-01

    α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.

  18. Effects and mechanism of GA-13315 on the proliferation and apoptosis of KB cells in oral cancer.

    Science.gov (United States)

    Shen, Shan; Tang, Jingxia

    2017-08-01

    The present study describes the effects and mechanism of GA-13315 on the proliferation and apoptosis of KB cells in oral cancer. Oral cancer is twice as common in men than women. More than 90% of oral cancers in men and 85% in women are linked to lifestyle and environmental factors. PPP2R2B methylation may be associated with survival and prognosis in patients with gliomas. In tumor cell proliferation and apoptosis, the mechanism of PPP2R2B remains unclear. In the present study, we found that PPP2R2B expression of H1299 cells is significantly decreased after being treated by GA-13315. KB cells were isolated from patients with oral cancer and treated with GA-13315 (5 µM). Cells without GA-13315 treatment served as the control group. An MTT experiment was performed to detect the post-treatment cell growth between the groups. A flow cytometry was used to detect cell apoptosis. Western blot analysis and quantitative polymerase chain reaction methods were used for detecting the expression of PPP2R2B. Compared with the control group, the cell proliferation of the treatment group slowed after being treated with GA-13315. The difference was statistically significant (Poral cancer were weakened after being treated by GA-13315. GA-13315 can accelerate the apoptosis of oral cancer cells and presents a dose correlation. The biological effect is exerted through the decrease of PPP2R2B.

  19. Effect of surface charge and agglomerate degree of magnetic iron oxide nanoparticles on KB cellular uptake in vitro.

    Science.gov (United States)

    Ge, Yuqing; Zhang, Yu; Xia, Jingguang; Ma, Ming; He, Shiying; Nie, Fang; Gu, Ning

    2009-10-15

    We synthesized three types of magnetic iron oxide nanoparticles (MNPs), which were meso-2,3-dimercaptosuccinic acid (DMSA) coated MNPs (DMSA@MNPs, 17.3+/-4.8 nm, negative charge), chitosan (CS) coated MNPs (CS@MNPs, 16.5+/-6.1 nm, positive charge) and magnetic nanoparticles agglomerates, formed by electronic aggregation between DMSA@MNPs and CS (CS-DMSA@MNPs, 85.7+/-72.9 nm, positive charge) respectively. The interactions of these MNPs with Oral Squamous Carcinoma Cell KB were investigated. The results showed that cellular uptakes of MNPs were on the dependence of incubation time, nanoparticles concentration and nanoparticles properties such as surface charge, size, etc. The cellular uptake was enhanced with the increase of incubation time and nanoparticles concentration. Although all MNPs could enter to cells, we observed apparent differences in the magnitude of nanoparticles uptaken. The cellular uptake of CS-DMSA@MNPs by KB cells was the highest and that of DMSA@MNPs was the lowest among the three types of MNPs. The same conclusions were drawn via the reduction of water proton relaxation times T(2)(*), resulting from the different iron load of labeled cells using a 1.5T clinical MR imager. The finding of this study will have implications in the chemical design of nanomaterials for biomedical applications.

  20. Insulin binding to individual rat skeletal muscles

    International Nuclear Information System (INIS)

    Koerker, D.J.; Sweet, I.R.; Baskin, D.G.

    1990-01-01

    Studies of insulin binding to skeletal muscle, performed using sarcolemmal membrane preparations or whole muscle incubations of mixed muscle or typical red (soleus, psoas) or white [extensor digitorum longus (EDL), gastrocnemius] muscle, have suggested that red muscle binds more insulin than white muscle. We have evaluated this hypothesis using cryostat sections of unfixed tissue to measure insulin binding in a broad range of skeletal muscles; many were of similar fiber-type profiles. Insulin binding per square millimeter of skeletal muscle slice was measured by autoradiography and computer-assisted densitometry. We found a 4.5-fold range in specific insulin tracer binding, with heart and predominantly slow-twitch oxidative muscles (SO) at the high end and the predominantly fast-twitch glycolytic (FG) muscles at the low end of the range. This pattern reflects insulin sensitivity. Evaluation of displacement curves for insulin binding yielded linear Scatchard plots. The dissociation constants varied over a ninefold range (0.26-2.06 nM). Binding capacity varied from 12.2 to 82.7 fmol/mm2. Neither binding parameter was correlated with fiber type or insulin sensitivity; e.g., among three muscles of similar fiber-type profile, the EDL had high numbers of low-affinity binding sites, whereas the quadriceps had low numbers of high-affinity sites. In summary, considerable heterogeneity in insulin binding was found among hindlimb muscles of the rat, which can be attributed to heterogeneity in binding affinities and the numbers of binding sites. It can be concluded that a given fiber type is not uniquely associated with a set of insulin binding parameters that result in high or low binding

  1. Differential dissociation micromethod for the investigation of binding of metandrostenolone (Nerobol) to plasma proteins

    International Nuclear Information System (INIS)

    Bojadzsieva, Milka; Kocsar, Laszlo; Kremmer, Tibor

    1985-01-01

    A micromethod was developed to determine the binding of anabolic streoids to plasma proteins. The new procedure combines precipitation with ammonium sulphate and differential dissociation. The binding parameters (association constant, specific binding capacity) are calculated on the basis of dissociation curves of sup(3)H-metandrostenolone from the precipitated sexual binding globuline. (L.E.)

  2. Differential dissociation micromethod for the investigation of binding of metandrostenolone (Nerobol) to plasma proteins

    Energy Technology Data Exchange (ETDEWEB)

    Bojadzsieva, M.; Kocsar, L. (Orszagos Frederic Joliot-Curie Sugarbiologiai es Sugaregeszseguegyi Kutato Intezet, Budapest (Hungary)); Kremmer, T. (Orszagos Onkologiai Intezet, Budapest (Hungary))

    1985-01-01

    A micromethod was developed to determine the binding of anabolic steroids to plasma proteins. The new procedure combines precipitation with ammonium sulphate and differential dissociation. The binding parameters (association constant, specific binding capacity) are calculated on the basis of dissociation curves of sup(3)H-metandrostenolone from the precipitated sexual binding globuline.

  3. Arrhenius Rate: constant volume burn

    Energy Technology Data Exchange (ETDEWEB)

    Menikoff, Ralph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-12-06

    A constant volume burn occurs for an idealized initial state in which a large volume of reactants at rest is suddenly raised to a high temperature and begins to burn. Due to the uniform spatial state, there is no fluid motion and no heat conduction. This reduces the time evolu tion to an ODE for the reaction progress variable. With an Arrhenius reaction rate, two characteristics of thermal ignition are illustrated: induction time and thermal runaway. The Frank-Kamenetskii approximation then leads to a simple expression for the adiabatic induction time. For a first order reaction, the analytic solution is derived and used to illustrate the effect of varying the activation temperature; in particular, on the induction time. In general, the ODE can be solved numerically. This is used to illustrate the effect of varying the reaction order. We note that for a first order reaction, the time evolution of the reaction progress variable has an exponential tail. In contrast, for a reaction order less than one, the reaction completes in a nite time. The reaction order also affects the induction time.

  4. Molecular characterization of Rhodococcus equi isolates from horses in Poland: pVapA characteristics and plasmid new variant, 85-kb type V.

    Science.gov (United States)

    Witkowski, Lucjan; Rzewuska, Magdalena; Takai, Shinji; Chrobak-Chmiel, Dorota; Kizerwetter-Świda, Magdalena; Feret, Małgorzata; Gawryś, Marta; Witkowski, Maciej; Kita, Jerzy

    2017-01-26

    Rhodococcus equi is one of the most significant bacterial pathogens affecting foals up to 6 months of age worldwide. Rhodococcosis is present in Poland however information about molecular characterization of R. equi isolates is scarce. This study describes molecular characterization of Rhodococcus equi infection on 13 horse breeding farms in Poland between 2001 and 2012. Samples were collected by tracheobronchial aspiration from pneumonic foals or during necropsy. The R. equi isolates were genotyped by plasmid profiling and pulsed-field gel electrophoresis. Totally, 58 R. equi isolates were investigated. One isolate lost its plasmid. Among the 57 VapA-positive isolates, 48 contained 85-kb type I plasmid (82.8%), 8 contained 87-kb type I plasmid (13.8%). One isolate (1.7%) had a unique restriction cleavage pattern and the 2nd fragment of EcoRI digests of this plasmid DNA was about 2600 bases smaller than that of the 85 kb type I. This new plasmid variant was designated as the "85-kb type V". Among the 58 isolates typeable with VspI-PFGE, ten PFGE clusters were detected. The majority of foals were infected mostly with isolates of low genetic diversity. Most of clinical isolates of R. equi from foals in Poland contain pVapA 85-kb type I and 87-kb type I similarly to the other European countries and the United States. However, the new variant of pVapA 85-kb type V was identified. The chromosomal variability was detected among some of the investigated isolates and the presence of farm-specific isolates might be possible.

  5. Giant panda BAC library construction and assembly of a 650-kb contig spanning major histocompatibility complex class II region

    Directory of Open Access Journals (Sweden)

    Pan Hui-Juan

    2007-09-01

    Full Text Available Abstract Background Giant panda is rare and endangered species endemic to China. The low rates of reproductive success and infectious disease resistance have severely hampered the development of captive and wild populations of the giant panda. The major histocompatibility complex (MHC plays important roles in immune response and reproductive system such as mate choice and mother-fetus bio-compatibility. It is thus essential to understand genetic details of the giant panda MHC. Construction of a bacterial artificial chromosome (BAC library will provide a new tool for panda genome physical mapping and thus facilitate understanding of panda MHC genes. Results A giant panda BAC library consisting of 205,800 clones has been constructed. The average insert size was calculated to be 97 kb based on the examination of 174 randomly selected clones, indicating that the giant panda library contained 6.8-fold genome equivalents. Screening of the library with 16 giant panda PCR primer pairs revealed 6.4 positive clones per locus, in good agreement with an expected 6.8-fold genomic coverage of the library. Based on this BAC library, we constructed a contig map of the giant panda MHC class II region from BTNL2 to DAXX spanning about 650 kb by a three-step method: (1 PCR-based screening of the BAC library with primers from homologous MHC class II gene loci, end sequences and BAC clone shotgun sequences, (2 DNA sequencing validation of positive clones, and (3 restriction digest fingerprinting verification of inter-clone overlapping. Conclusion The identifications of genes and genomic regions of interest are greatly favored by the availability of this giant panda BAC library. The giant panda BAC library thus provides a useful platform for physical mapping, genome sequencing or complex analysis of targeted genomic regions. The 650 kb sequence-ready BAC contig map of the giant panda MHC class II region from BTNL2 to DAXX, verified by the three-step method, offers a

  6. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    Science.gov (United States)

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of

  7. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    Directory of Open Access Journals (Sweden)

    Person Alexandra M

    2011-11-01

    Full Text Available Abstract Background Along with high affinity binding of epibatidine (Kd1≈10 pM to α4β2 nicotinic acetylcholine receptor (nAChR, low affinity binding of epibatidine (Kd2≈1-10 nM to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after

  8. Capacitive Cells for Dielectric Constant Measurement

    Science.gov (United States)

    Aguilar, Horacio Munguía; Maldonado, Rigoberto Franco

    2015-01-01

    A simple capacitive cell for dielectric constant measurement in liquids is presented. As an illustrative application, the cell is used for measuring the degradation of overheated edible oil through the evaluation of their dielectric constant.

  9. The Dielectric Constant of Lubrication Oils

    National Research Council Canada - National Science Library

    Carey, A

    1998-01-01

    The values of the dielectric constant of simple molecules is discussed first, along with the relationship between the dielectric constant and other physical properties such as boiling point, melting...

  10. Globally Coupled Chaotic Maps with Constant Force

    International Nuclear Information System (INIS)

    Li Jinghui

    2008-01-01

    We investigate the motion of the globally coupled maps (logistic map) with a constant force. It is shown that the constant force can cause multi-synchronization for the globally coupled chaotic maps studied by us.

  11. STABILITY CONSTANT OF THE TRISGLYCINATO METAL ...

    African Journals Online (AJOL)

    DR. AMINU

    overall stability constants of the complexes were found to be similar. Keywords: Glycinato, titration ... +. −. = 1 where Ka = dissociation constant of the amino acid. [ ]+. H = concentration of the .... Synthesis and techniques in inorganic chemistry.

  12. KB-R7943, an inhibitor of the reverse Na+/Ca2+ exchanger, blocks N-methyl-D-aspartate receptor and inhibits mitochondrial complex I

    Science.gov (United States)

    Brustovetsky, Tatiana; Brittain, Matthew K; Sheets, Patrick L; Cummins, Theodore R; Pinelis, Vsevolod; Brustovetsky, Nickolay

    2011-01-01

    BACKGROUND AND PURPOSE An isothiourea derivative (2-[2-[4-(4-nitrobenzyloxy)phenyl]ethyl]isothiourea methane sulfonate (KB-R7943), a widely used inhibitor of the reverse Na+/Ca2+ exchanger (NCXrev), was instrumental in establishing the role of NCXrev in glutamate-induced Ca2+ deregulation in neurons. Here, the effects of KB-R7943 on N-methyl-D-aspartate (NMDA) receptors and mitochondrial complex I were tested. EXPERIMENTAL APPROACH Fluorescence microscopy, electrophysiological patch-clamp techniques and cellular respirometry with Seahorse XF24 analyzer were used with cultured hippocampal neurons; membrane potential imaging, respirometry and Ca2+ flux measurements were made in isolated rat brain mitochondria. KEY RESULTS KB-R7943 inhibited NCXrev with IC50= 5.7 ± 2.1 µM, blocked NMDAR-mediated ion currents, and inhibited NMDA-induced increase in cytosolic Ca2+ with IC50= 13.4 ± 3.6 µM but accelerated calcium deregulation and mitochondrial depolarization in glutamate-treated neurons. KB-R7943 depolarized mitochondria in a Ca2+-independent manner. Stimulation of NMDA receptors caused NAD(P)H oxidation that was coupled or uncoupled from ATP synthesis depending on the presence of Ca2+ in the bath solution. KB-R7943, or rotenone, increased NAD(P)H autofluorescence under resting conditions and suppressed NAD(P)H oxidation following glutamate application. KB-R7943 inhibited 2,4-dinitrophenol-stimulated respiration of cultured neurons with IC50= 11.4 ± 2.4 µM. With isolated brain mitochondria, KB-R7943 inhibited respiration, depolarized organelles and suppressed Ca2+ uptake when mitochondria oxidized complex I substrates but was ineffective when mitochondria were supplied with succinate, a complex II substrate. CONCLUSIONS AND IMPLICATIONS KB-R7943, in addition to NCXrev, blocked NMDA receptors in cultured hippocampal neurons and inhibited complex I in the mitochondrial respiratory chain. These findings are critical for the correct interpretation of experimental

  13. Antiproliferative activity of flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the MCF7, KB, and NIH/3T3 cell lines.

    Science.gov (United States)

    Nedel, Fernanda; Begnini, Karine; Carvalho, Pedro Henrique de Azambuja; Lund, Rafael Guerra; Beira, Fátima T A; Del Pino, Francisco Augusto B

    2012-11-01

    This study assessed the antiproliferative effect in vitro of the flower hexane extract obtained from Mentha spicata associated with Mentha rotundifolia against the human breast adenocarcinoma (MCF-7), human mouth epidermal carcinoma (KB), and mouse embryonic fibroblast (NIH 3T3) cell lines, using sulforhodamine B (SRB) assay. A cell density of 2×10(4)/well was seeded in 96-well plates, and samples at different concentrations ranging from 10 to 500 mg/mL were tested. The optical density was determined in an ELISA multiplate reader (Thermo Plate TP-Reader). Results demonstrated that the hexane extract presented antiproliferative activity against both the tumor cell lines KB and MCF-7, presenting a GI(50) (MCF-7=13.09 mg/mL), TGI (KB=37.76 mg/mL), and IL(50) (KB=291.07 mg/mL). Also, the hexane extract presented antiproliferative activity toward NIH 3T3 cells GI(50) (183.65 mg/mL), TGI (280.54 mg/mL), and IL(50) (384.59 mg/mL). The results indicate that the flower hexane extract obtained from M. spicata associated with M. rotundifolia presents an antineoplastic activity against KB and MCF-7, although an antiproliferative effect at a high concentration of the extract was observed toward NIH 3T3.

  14. Alteration in Inflammation-related miR-146a Expression in NF-KB Signaling Pathway in Diabetic Rat Hippocampus.

    Science.gov (United States)

    Habibi, Fatemeh; Ghadiri Soufi, Farhad; Ghiasi, Rafighe; Khamaneh, Amir Mahdi; Alipour, Mohammad Reza

    2016-03-01

    The purpose of the present study is to evaluate the expression of miR-146a gene, its adaptor genes (TRAF6, NF-KB, and IRAK1), and possible changes in the cellular signaling pathway in diabetic hippocampus tissue. Male Sprague-Dawley rats are randomly selected and divided into control and diabetic (n=6) groups. Diabetes induced by the single-dose injection of nicotinamide [110 mg/kg, (i.p.)], 15 min before streptozotocin (50 mg/kg; i.p.) in 12-h fasted rats. The rats are kept at the laboratory for two months. After anaesthetization, hippocampus of the rats was removed in order to measure the expression of miR-146a, NFK-B, IRAK1, and TRAF6 genes using real-time PCR and activity of NF-KB as well as amount of apoptosis rate using ELISA. The results indicated a reduction in expression of miR-146a and an increase in expression of IRAK1, NF-KB, and TRAF6 genes in the hippocampus of diabetic rats compared to control. Also it reveals an increase in the activity of NF-KB and apoptosis rate in the hippocampus of diabetic rats. Our results report the probability that reduction of miR-146a expression in the negative feedback loop between miR-146a and NF-KB increases NF-kB expression and thus intensifies inflammation and apoptosis in hippocampus.

  15. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  16. Analysis of agonist dissociation constants as assessed by functional antagonism in guinea pig left atria

    International Nuclear Information System (INIS)

    Molenaar, P.; Malta, E.

    1986-01-01

    In electrically driven guinea pig left atria, positive inotropic responses to (-)-isoprenaline and the selective beta 1-adrenoceptor agonist RO363 were obtained in the absence and in the presence of the functional antagonists adenosine, carbachol, gallopamil, nifedipine, and Ro 03-7894. Each of the functional antagonists reduced the maximum response to both agonists and produced nonparallel rightward shifts in the cumulative concentration effect curves. For both agonists, dissociation constants (KA) were calculated using the equation described by Furchgott (1966) for irreversible antagonism. For RO363, which is a partial agonist with high agonist activity, the equations outlined for functional interaction by Mackay (1981) were also employed to calculate KA values. The KA values obtained by each method were compared with the dissociation constants (KD) for the two agonists determined from their ability to displace the radioligand (-)-[ 125 I]iodocyanopindolol from beta 1-adrenoceptors in guinea pig left atrial membrane preparations. The estimates of KA varied substantially from KD values. The KD values were taken as more accurate estimates of the true values for the dissociation constants because a high degree of correlation exists between pKD and pD2 values for a number of other beta-adrenoceptor agonists that behave as partial agonists and between pKD and pKB values for a number of beta-adrenoceptor antagonists. Thus, it appears that there are serious limitations in the current theory for using functional antagonism as a means of obtaining agonist dissociation constants

  17. Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny.

    Directory of Open Access Journals (Sweden)

    Dorcas J Orengo

    Full Text Available The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO. We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription.

  18. Melting relations and elemental distribution of portion of the system Fe-S-Si-O to 32 KB with planetary application

    Science.gov (United States)

    Huang, W. L.

    1980-01-01

    The melting relations and distribution of K and Cs in portions of the system was determined at high pressures. Ferrosilite is stable as a primary phase at high pressures because of the incongruent melting of ferrosilite to quartz plus liquid and the boundary between the one and two liquid fields on the joint Fe(1-x) O-FeS-SiO2 shifts away from silica with increasing pressures. Potassium K was found to have limited solubility in metal sulfide liquids at pressures up to 45 kb. The speculation that K may dissolve significantly in metal-metal sulfide liquids after undergoing first order isomorphic transition was tested by determining the distribution of Cs between sulfide and silicate liquids as an analogy to K. At 45 kb, 1400 C and 27 kb, 1300 C only limited amounts of Cs were detected in quench sulfide liquids even at pressures beyond the isomorphic transition of Cs.

  19. Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models*

    Science.gov (United States)

    Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart

    2016-01-01

    Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers. PMID:26912662

  20. Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models.

    Science.gov (United States)

    Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart

    2016-05-06

    Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Improved assay for measuring heparin binding to bull sperm

    International Nuclear Information System (INIS)

    Miller, D.J.; Ax, R.L.

    1988-01-01

    The binding of heparin to sperm has been used to study capacitation and to rank relative fertility of bulls. Previous binding assays were laborious, used 10 7 sperm per assay point, and required large amounts of radiolabeled heparin. A modified heparin-binding assay is described that used only 5 x 10 4 cells per incubation well and required reduced amounts of [ 3 H] heparin. The assay was performed in 96-well Millititer plates, enabling easy incubation and filtering. Dissociation constants and concentrations of binding sites did not differ if analyzed by Scatchard plots, Woolf plots, or by log-logit transformed weighted nonlinear least squares regression, except in the case of outliers. In such cases, Scatchard analysis was more sensitive to outliers. Nonspecific binding was insignificant using nonlinear logistic fit regression and a proportion graph. The effects were tested of multiple free-thawing of sperm in either a commercial egg yolk extender, 40 mM Tris buffer with 8% glycerol, or 40 mM Tris buffer without glycerol. Freeze-thawing in extender did not affect the dissociation constant or the concentration of binding sites. However, freeze-thawing three times in 40 mM Tris reduced the concentration of binding sites and lowered the dissociation constant (raised the affinity). The inclusion of glycerol in the 40 mM Tris did not significantly affect the estimated dissociation constant or the concentration of binding sites as compared to 40 mM Tris without glycerol

  2. Determination of diffuse double layer protonation constants for hydrous ferric oxide (HFO): supporting evidence for the Dzombak and Morel compilation

    CSIR Research Space (South Africa)

    Pretorius, PJ

    1998-01-01

    Full Text Available of the experimental system suggests that titration points below pH 4 should not be used for the determination of protonation constants because of potential HFO dissolution. Surface protonation constant, PZC and binding site estimates agree excellently with currently...

  3. CODATA recommended values of the fundamental constants

    International Nuclear Information System (INIS)

    Mohr, Peter J.; Taylor, Barry N.

    2000-01-01

    A review is given of the latest Committee on Data for Science and Technology (CODATA) adjustment of the values of the fundamental constants. The new set of constants, referred to as the 1998 values, replaces the values recommended for international use by CODATA in 1986. The values of the constants, and particularly the Rydberg constant, are of relevance to the calculation of precise atomic spectra. The standard uncertainty (estimated standard deviation) of the new recommended value of the Rydberg constant, which is based on precision frequency metrology and a detailed analysis of the theory, is approximately 1/160 times the uncertainty of the 1986 value. The new set of recommended values as well as a searchable bibliographic database that gives citations to the relevant literature is available on the World Wide Web at physics.nist.gov/constants and physics.nist.gov/constantsbib, respectively

  4. Combination of Aloe vera and xenograft induction on decreasing of NF-kb of tooth extraction socket preservation in Cavia cobaya

    Directory of Open Access Journals (Sweden)

    Utari Kresnoadi

    2014-03-01

    Full Text Available Background: Tooth extraction can naturally cause inflammation triggering osteoclast proliferation and alveolar bone resorption. Preservation of the tooth extraction sockets is needed for patients in order to reduce alveolar bone resorption risks. Aloe vera is known to have anthraquinones components, namely Aloin, Aloe emedin, and barbaloin, considered as anti-inflammation. Therefore, to overcome the inflammation, the role of NF-kb is very significant to decrease nuclear factor kappa b (NF-kb. As a result, inflammation risks will be decreased. Purpose: The study was aimed to determine the induction effect of combination of Aloe vera and XCB into tooth extraction sockets to reduce inflammation by reducing NF-kb expression, osteoclasts and osteoblasts. Methods: Forty-eight Cavia cobaya were divided into eight groups, each group consisted of six animals. The mandibular incisors of those Cavia cobaya were extracted and induced with either PEG, XCB, Aloe vera, or the combination of Aloe vera + XCB. Those animals were sacrificed on day 7 and day 30 after the extraction. Then immunohistochemical and histopathology examinations were conducted to observe NF-kb expression, osteoblasts and osteoclasts. Results: It was known that in group induced with the combination of Aloe vera and xenograft concelous bovine, the growth of osteoblasts was high, while NF-kb expression and osteoclasts reduced. Conclusion: It can be concluded that the induction of the combination of Aloe vera and XCB into the tooth extraction sockets can reduce NF-kb expression and osteoclast, as a result, alveolar bone resorption risks decrease, and osteoblast increase.Latar belakang: Trauma mekanis akibat pencabutan gigi asli menyebabkan keradangan. Keradangan memicu proliferasi osteoklas sehingga menyebabkan resorpsi tulang alveolararis. Pada pembuatan gigi tiruan, resorpsi tulang alveolar yang terjadi, sangat tidak diinginkan, sebab resorpsi tulang alveolar mengurangi keberhasilan

  5. Effects of taxol and ionizing radiation on cytotoxicity and prostaglandin production in KB, RPMI-2650, SW-13 and L929

    International Nuclear Information System (INIS)

    Lee, Keon Il; Yoo, Dong Soo

    1998-01-01

    The author evaluated the effects of taxol, a microtubular inhibitor, as a possible radiation sensitizer and the production of prostaglandins on three human cancer cell lines (KB, RPMI-2650 and SW-13) and one murine cell line (L929). Each cell line was divided into four groups (control, taxol only, radiation only and combination of taxol and radiation). The treatment consisted of a single irradiation of 10 Gy and graded doses (5, 50, 100, 200, 300, 500 nM) of taxol for a 24-h period. The cytotoxicity of taxol alone was measured at 1 day after (1-day group) and 4 days after (4-day group) the treatment. The survival ratio of cell was analyzed by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyl tetrazolium bromide) test. Prostaglandins (PGE2 and PGI2) were measured in the culture medium by a radioimmunoassay. The results obtained were as follows ; 1. There was a significantly in creased cytotoxicity of KB cells in 4-day group than those in 1-day group. There was a high correlation between doses of taxol and cell viability in both groups (1-day group R=0.82741, 4-day group R=0.84655). 2. There was a significantly increased cytotoxicity of RPMI-2650 cells treated with high concentration of taxol in 4-day group than those in 1-day group. Also there was a high correlation between doses of taxol and cell viability in 4-day group (R=0.93917). 3. There was a significantly increased cytotoxicity of SW-13 cell treated with high concentration of taxol in 4-day group than those in 1-day group. However no high correlation was observed between doses of taxol and cell viability in both groups (1-day group R=0.46362, 4-day group R=0.65425). 4. There was a significantly increased cytotoxicity of L929 cells treated with low concentration of taxol in 4-day group than those in 1-day group. At the same time, there was a low correlation between doses of taxol and cell viability in both groups (1-day group R=0.34237, 4-day group R=0.23381). 5. In 1-day group of L929 cells, higher

  6. Stability constants of scandium complexes, 1

    International Nuclear Information System (INIS)

    Itoh, Hisako; Itoh, Naomi; Suzuki, Yasuo

    1984-01-01

    The stability constants of scandium complexes with some carboxylate ligands were determined potentiometrically at 25.0 and 40.0 0 C and at an ionic strength of 0.10 with potassium nitrate as supporting electrolyte. The constants of the scandium complexes were appreciably greater than those of the corresponding lanthanoid complexes, as expected. The changes in free energy, enthalpy, and entropy for the formation of the scandium complexes were calculated from the stability constants at two temperatures. (author)

  7. Constant exposure technique in industrial radiography

    International Nuclear Information System (INIS)

    Domanus, J.C.

    1983-08-01

    The principles and advantages of the constant exposure technique are explained. Choice of exposure factors is analyzed. Film, paper and intensifying screens used throughout the investigation and film and paper processing are described. Exposure technique and the use of image quality indicators are given. Methods of determining of radiographic image quality are presented. Conclusions about the use of constant exposure vs. constant kilovoltage technique are formulated. (author)

  8. Dose rate constants for new dose quantities

    International Nuclear Information System (INIS)

    Tschurlovits, M.; Daverda, G.; Leitner, A.

    1992-01-01

    Conceptual changes and new quantities made is necessary to reassess dose rate quantities. Calculations of the dose rate constant were done for air kerma, ambient dose equivalent and directional dose equivalent. The number of radionuclides is more than 200. The threshold energy is selected as 20 keV for the dose equivalent constants. The dose rate constant for the photon equivalent dose as used mainly in German speaking countries as a temporary quantity is also included. (Author)

  9. A natural cosmological constant from chameleons

    International Nuclear Information System (INIS)

    Nastase, Horatiu; Weltman, Amanda

    2015-01-01

    We present a simple model where the effective cosmological constant appears from chameleon scalar fields. For a Kachru–Kallosh–Linde–Trivedi (KKLT)-inspired form of the potential and a particular chameleon coupling to the local density, patches of approximately constant scalar field potential cluster around regions of matter with density above a certain value, generating the effect of a cosmological constant on large scales. This construction addresses both the cosmological constant problem (why Λ is so small, yet nonzero) and the coincidence problem (why Λ is comparable to the matter density now)

  10. A natural cosmological constant from chameleons

    Directory of Open Access Journals (Sweden)

    Horatiu Nastase

    2015-07-01

    Full Text Available We present a simple model where the effective cosmological constant appears from chameleon scalar fields. For a Kachru–Kallosh–Linde–Trivedi (KKLT-inspired form of the potential and a particular chameleon coupling to the local density, patches of approximately constant scalar field potential cluster around regions of matter with density above a certain value, generating the effect of a cosmological constant on large scales. This construction addresses both the cosmological constant problem (why Λ is so small, yet nonzero and the coincidence problem (why Λ is comparable to the matter density now.

  11. A natural cosmological constant from chameleons

    Energy Technology Data Exchange (ETDEWEB)

    Nastase, Horatiu, E-mail: nastase@ift.unesp.br [Instituto de Física Teórica, UNESP-Universidade Estadual Paulista, R. Dr. Bento T. Ferraz 271, Bl. II, Sao Paulo 01140-070, SP (Brazil); Weltman, Amanda, E-mail: amanda.weltman@uct.ac.za [Astrophysics, Cosmology & Gravity Center, Department of Mathematics and Applied Mathematics, University of Cape Town, Private Bag, Rondebosch 7700 (South Africa)

    2015-07-30

    We present a simple model where the effective cosmological constant appears from chameleon scalar fields. For a Kachru–Kallosh–Linde–Trivedi (KKLT)-inspired form of the potential and a particular chameleon coupling to the local density, patches of approximately constant scalar field potential cluster around regions of matter with density above a certain value, generating the effect of a cosmological constant on large scales. This construction addresses both the cosmological constant problem (why Λ is so small, yet nonzero) and the coincidence problem (why Λ is comparable to the matter density now)

  12. Titration ELISA as a Method to Determine the Dissociation Constant of Receptor Ligand Interaction.

    Science.gov (United States)

    Eble, Johannes A

    2018-02-15

    The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial parameter to compare different ligands, e.g., competitive inhibitors, protein isoforms and mutants, for their binding strength to a binding partner. Dissociation constants are determined by plotting concentrations of bound versus free ligand as binding curves. In contrast, titration curves, in which a signal that is proportional to the concentration of bound ligand is plotted against the total concentration of added ligand, are much easier to record. The signal can be detected spectroscopically and by enzyme-linked immunosorbent assay (ELISA). This is exemplified in a protocol for a titration ELISA that measures the binding of the snake venom-derived rhodocetin to its immobilized target domain of α2β1 integrin. Titration ELISAs are versatile and widely used. Any pair of interacting proteins can be used as immobilized receptor and soluble ligand, provided that both proteins are pure, and their concentrations are known. The difficulty so far has been to determine the dissociation constant from a titration curve. In this study, a mathematical function underlying titration curves is introduced. Without any error-prone graphical estimation of a saturation yield, this algorithm allows processing of the raw data (signal intensities at different concentrations of added ligand) directly by mathematical evaluation via non-linear regression. Thus, several titration curves can be recorded simultaneously and transformed into a set of characteristic parameters, among them the dissociation constant and the concentration of binding-active receptor, and they can be evaluated statistically. When combined with this algorithm, titration ELISAs gain the advantage of directly presenting the dissociation constant. Therefore, they may be used more efficiently in the future.

  13. Apparent non-statistical binding in a ditopic receptor for guanosine

    NARCIS (Netherlands)

    Likhitsup, Asawin; Deeth, Robert J.; Otto, Sijbren; Marsh, Andrew

    2009-01-01

    Analysis of stepwise association constants for guests binding to more than one site in a receptor is expected to give a ratio of the first association constant to the second of about 4 : 1 on statistical grounds (since a second guest should have an equal chance of binding to a different site on the

  14. Determination of association constants between steroid compounds and albumins by partial-filling ACE.

    Science.gov (United States)

    Amundsen, Lotta K; Sirén, Heli

    2007-10-01

    ACE is a popular technique for evaluating association constants between drugs and proteins. However, ACE has not previously been applied to study the association between electrically neutral biomolecules and plasma proteins. We studied the affinity between human and bovine serum albumins (HSA and BSA, respectively) and three neutral endogenous steroid hormones (testosterone, epitestosterone and androstenedione) and two synthetic analogues (methyltestosterone and fluoxymesterone) by applying the partial-filling technique in ACE (PF-ACE). From the endocrinological point of view, the distribution of endogenous steroids among plasma components is of great interest. Strong interactions with albumins suppress the biological activity of steroids. Notable differences in the association constants were observed. In the case of the endogenous steroids, the interactions between testosterone and the albumins were strongest, and those between androstenedione and the albumins were substantially weaker. The association constants, K(b), for testosterone, epitestosterone and androstenedione and HSA at 37 degrees C were 32 100 +/- 3600, 21 600 +/- 1500 and 13 300 +/- 1300 M(-1), respectively, while the corresponding values for the steroids and BSA were 18 800 +/- 1500, 14 000 +/- 400 and 7800 +/- 900 M(-1). Methyltestosterone was bound even more strongly than testosterone, while fluoxymesterone was only weakly bound by the albumins. Finally, the steroids were separated by PF-ACE with HSA and BSA used as resolving components.

  15. One in Four Individuals of African-American Ancestry Harbors a 5.5kb Deletion at chromosome 11q13.1

    Science.gov (United States)

    Zainabadi, Kayvan; Jain, Anuja V.; Donovan, Frank X.; Elashoff, David; Rao, Nagesh P.; Murty, Vundavalli V.; Chandrasekharappa, Settara C.; Srivatsan, Eri S.

    2014-01-01

    Cloning and sequencing of 5.5kb deletion at chromosome 11q13.1 from the HeLa cells, tumorigenic hybrids and two fibroblast cell lines has revealed homologous recombination between AluSx and AluY resulting in the deletion of intervening sequences. Long-range PCR of the 5.5kb sequence in 494 normal lymphocyte samples showed heterozygous deletion in 28.3% of African- American ancestry samples but only in 4.8% of Caucasian samples (pdeletion occurs in 27% of YRI (Yoruba – West African) population but none in non-African populations. The HapMap analysis further identified strong linkage disequilibrium between 5 single nucleotide polymorphisms and the 5.5kb deletion in the people of African ancestry. Computational analysis of 175kb sequence surrounding the deletion site revealed enhanced flexibility, low thermodynamic stability, high repetitiveness, and stable stem-loop/hairpin secondary structures that are hallmarks of common fragile sites. PMID:24412158

  16. A potential contributory role for ciliary dysfunction in the 16p11.2 600 kb BP4-BP5 pathology

    NARCIS (Netherlands)

    Migliavacca, Eugenia; Golzio, Christelle; Männik, Katrin; Blumenthal, Ian; Oh, Edwin C.; Harewood, Louise; Kosmicki, Jack A.; Loviglio, Maria Nicla; Giannuzzi, Giuliana; Hippolyte, Loyse; Maillard, Anne M.; Alfaiz, Ali Abdullah; Witwicki, Robert; Didelot, Gérard; Van Der Werf, Ilse; Alfaiz, Ali A.; Zazhytska, Marianna; Chrast, Jacqueline; Macé, Aurélien; Bergmann, Sven; Kutalik, Zoltan; Siffredi, Vanessa; Zufferey, Flore; Martinet, Danielle; Bena, Frédérique; Rauch, Anita; Bouquillon, Sonia; Delobel, Bruno; Boute, Odile; Duban-Bedu, Bénédicte; Le Caignec, Cédric; Isidor, Bertrand; Chiesa, Jean; Keren, Boris; Gilbert-Dussardier, Brigitte; Touraine, Renaud; Campion, Dominique; Thambo, Caroline Rooryck; Mathieu-Dramard, Michèle; Plessis, Ghislaine; Kooy, Frank; Peeters, Hilde; Ounap, Katrin; Vulto-Van Silfhout, Anneke T.; De Vries, Bert B.; Van Binsbergen, Ellen; Nordgren, Ann; Mucciolo, Mafalda; Renieri, Alessandra; Rajcan-Separovic, Evica; Philipps, John A.; Ellis, Richard J.; Van Haelst, Mieke M.; Andrieux, Joris; Gusella, James F.; Daly, Mark J.; Beckmann, Jacques S.; Jacquemont, Sébastien; Talkowski, Michael E.; Katsanis, Nicholas; Reymond, Alexandre

    2015-01-01

    The 16p11.2 600 kb copy-number variants (CNVs) are associated with mirror phenotypes on BMI, head circumference, and brain volume and represent frequent genetic lesions in autism spectrum disorders (ASDs) and schizophrenia. Here we interrogated the transcriptome of individuals carrying reciprocal

  17. UniProtKB/Swiss-Prot, the Manually Annotated Section of the UniProt KnowledgeBase: How to Use the Entry View.

    Science.gov (United States)

    Boutet, Emmanuel; Lieberherr, Damien; Tognolli, Michael; Schneider, Michel; Bansal, Parit; Bridge, Alan J; Poux, Sylvain; Bougueleret, Lydie; Xenarios, Ioannis

    2016-01-01

    The Universal Protein Resource (UniProt, http://www.uniprot.org ) consortium is an initiative of the SIB Swiss Institute of Bioinformatics (SIB), the European Bioinformatics Institute (EBI) and the Protein Information Resource (PIR) to provide the scientific community with a central resource for protein sequences and functional information. The UniProt consortium maintains the UniProt KnowledgeBase (UniProtKB), updated every 4 weeks, and several supplementary databases including the UniProt Reference Clusters (UniRef) and the UniProt Archive (UniParc).The Swiss-Prot section of the UniProt KnowledgeBase (UniProtKB/Swiss-Prot) contains publicly available expertly manually annotated protein sequences obtained from a broad spectrum of organisms. Plant protein entries are produced in the frame of the Plant Proteome Annotation Program (PPAP), with an emphasis on characterized proteins of Arabidopsis thaliana and Oryza sativa. High level annotations provided by UniProtKB/Swiss-Prot are widely used to predict annotation of newly available proteins through automatic pipelines.The purpose of this chapter is to present a guided tour of a UniProtKB/Swiss-Prot entry. We will also present some of the tools and databases that are linked to each entry.

  18. Chronic myeloid leukemia may be associated with several bcr-abl transcripts including the acute lymphoid leukemia-type 7 kb transcript

    NARCIS (Netherlands)

    Selleri, L.; von Lindern, M.; Hermans, A.; Meijer, D.; Torelli, G.; Grosveld, G.

    1990-01-01

    In the majority of Philadelphia (Ph)-positive chronic myeloid leukemia (CML) patients, the c-abl gene is fused to the bcr gene, resulting in the transcription of an 8.5 kb chimeric bcr-abl mRNA, which is translated into a p210bcr-abl fusion protein. In about 50% of the Ph-positive acute lymphoid

  19. A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

    Science.gov (United States)

    Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

    2013-12-01

    The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. 3,3′,4,4′,5-Pentachlorobiphenyl Inhibits Drug Efflux Through P-Glycoprotein in KB-3 Cells Expressing Mutant Human P-Glycoprotein

    Directory of Open Access Journals (Sweden)

    Hiroshi Fujise

    2004-01-01

    Full Text Available The effects on the drug efflux of 3,3′,4,4′,5-pentachlorobiphenyl (PCB-126, the most toxic of all coplanar polychlorinated biphenyls (Co-PCBs, were examined in KB-3 cells expressing human wild-type and mutant P-glycoprotein in which the 61st amino acid was substituted for serine or phenylalanine (KB3-Phe61. In the cells expressing P-glycoproteins, accumulations of vinblastine and colchicine decreased form 85% to 92% and from 62% to 91%, respectively, and the drug tolerances for these chemicals were increased. In KB3-Phe61, the decreases in drug accumulation were inhibited by adding PCB-126 in a way similar to that with cyclosporine A: by adding 1 μM PCB-126, the accumulations of vinblastine and colchicine increased up to 3.3- and 2.3-fold, respectively. It is suggested that PCB-126 decreased the drug efflux by inhibiting the P-glycoprotein in KB3-Phe61. Since there were various P-glycoproteins and many congeners of Co-PCBs, this inhibition has to be considered a new cause of the toxic effects of Co-PCBs.

  1. Male infertility is significantly associated with multiple deletions in an 8.7-kb segment of sperm mtDNA in Pakistan.

    Science.gov (United States)

    Mughal, Irfan Afzal; Irfan, Asma; Jahan, Sarwat; Hameed, Abdul

    2017-06-12

    This study aimed to find a link between sperm mitochondrial DNA mutations and male infertility in Pakistan. DNA from semen samples was extracted and amplified by PCR using 7.8-kb deletion-specific primers. The PCR products were separated on agarose gel, visualized under UV-illumination, and then photographed. The results were genotyped and the data were analyzed using SPSS. Deletion analysis of the 8.7-kb fragment by long PCR revealed multiple deletions. The frequency of deletion was much higher in infertile groups as compared to the control group. Further, on comparison between different subtypes of infertile groups, the deletions were highest in the oligoasthenoteratozoospermia (OAT) group. The statistical analysis of case and control groups showed a significant association of the 8.7-kb deletion with human male infertile groups (P = 0.031), and particularly a very significant association with the OAT subgroup (P = 0.019). A significant association has been found between human male infertility and mtDNA deletions in an 8.7-kb segment of sperm mtDNA in a Pakistani population.

  2. One-step FPLC-size-exclusion chromatography procedure for purification of rDMBT1 6 kb with increased biological activity

    DEFF Research Database (Denmark)

    Tuttolomondo, Martina; Hansen, Pernille Lund; Mollenhauer, Jan

    2018-01-01

    from saliva or produced in vitro and purified by a multistep affinity purification procedure using bacteria, followed by FPLC. Here, we compared a simple, one-step FPLC-SEC protocol for purification of recombinant DMBT1 6 kb, with that of the standard bacteria affinity purification-based protocol. Our...

  3. A method for sensible heat flux model parameterization based on radiometric surface temperature and environmental factors without involving the parameter KB-1

    Science.gov (United States)

    Zhuang, Qifeng; Wu, Bingfang; Yan, Nana; Zhu, Weiwei; Xing, Qiang

    2016-05-01

    Sensible heat flux is a key component of land-atmosphere interaction. In most parameterizations it is calculated with surface-air temperature differences and total aerodynamic resistance to heat transfer (Rae) that is related to the KB-1 parameter. Suitable values are hard to obtain since KB-1 is related both to canopy characteristics and environmental conditions. In this paper, a parameterize method for sensible heat flux over vegetated surfaces (maize field and grass land in the Heihe river basin of northwest China) was proposed based on the radiometric surface temperature, surface resistance (Rs) and vapor pressures (saturated and actual) at the surface and the atmosphere above the canopy. A biophysics-based surface resistance model was revised to compute surface resistance with several environmental factors. The total aerodynamic resistance to heat transfer is directly calculated by combining the biophysics-based surface resistance and vapor pressures. One merit of this method is that the calculation of KB-1 can be avoided. The method provides a new way to estimate sensible heat flux over vegetated surfaces and its performance compares well to the LAS measured sensible heat and other empirical or semi-empirical KB-1 based estimations.

  4. A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH.

    Directory of Open Access Journals (Sweden)

    Birte Möhlendick

    Full Text Available Comprehensive genome wide analyses of single cells became increasingly important in cancer research, but remain to be a technically challenging task. Here, we provide a protocol for array comparative genomic hybridization (aCGH of single cells. The protocol is based on an established adapter-linker PCR (WGAM and allowed us to detect copy number alterations as small as 56 kb in single cells. In addition we report on factors influencing the success of single cell aCGH downstream of the amplification method, including the characteristics of the reference DNA, the labeling technique, the amount of input DNA, reamplification, the aCGH resolution, and data analysis. In comparison with two other commercially available non-linear single cell amplification methods, WGAM showed a very good performance in aCGH experiments. Finally, we demonstrate that cancer cells that were processed and identified by the CellSearch® System and that were subsequently isolated from the CellSearch® cartridge as single cells by fluorescence activated cell sorting (FACS could be successfully analyzed using our WGAM-aCGH protocol. We believe that even in the era of next-generation sequencing, our single cell aCGH protocol will be a useful and (cost- effective approach to study copy number alterations in single cells at resolution comparable to those reported currently for single cell digital karyotyping based on next generation sequencing data.

  5. Dual AAV Gene Therapy for Duchenne Muscular Dystrophy with a 7-kb Mini-Dystrophin Gene in the Canine Model.

    Science.gov (United States)

    Kodippili, Kasun; Hakim, Chady H; Pan, Xiufang; Yang, Hsiao T; Yue, Yongping; Zhang, Yadong; Shin, Jin-Hong; Yang, N Nora; Duan, Dongsheng

    2018-03-01

    Dual adeno-associated virus (AAV) technology was developed in 2000 to double the packaging capacity of the AAV vector. The proof of principle has been demonstrated in various mouse models. Yet, pivotal evidence is lacking in large animal models of human diseases. Here we report expression of a 7-kb canine ΔH2-R15 mini-dystrophin gene using a pair of dual AAV vectors in the canine model of Duchenne muscular dystrophy (DMD). The ΔH2-R15 minigene is by far the most potent synthetic dystrophin gene engineered for DMD gene therapy. We packaged minigene dual vectors in Y731F tyrosine-modified AAV-9 and delivered to the extensor carpi ulnaris muscle of a 12-month-old affected dog at the dose of 2 × 10 13 viral genome particles/vector/muscle. Widespread mini-dystrophin expression was observed 2 months after gene transfer. The missing dystrophin-associated glycoprotein complex was restored. Treatment also reduced muscle degeneration and fibrosis and improved myofiber size distribution. Importantly, dual AAV therapy greatly protected the muscle from eccentric contraction-induced force loss. Our data provide the first clear evidence that dual AAV therapy can be translated to a diseased large mammal. Further development of dual AAV technology may lead to effective therapies for DMD and many other diseases in human patients.

  6. Immobilization of Cellulase from Bacillus subtilis UniMAP-KB01 on Multi-walled Carbon Nanotubes for Biofuel Production

    Science.gov (United States)

    Naresh, Sandrasekaran; Hoong Shuit, Siew; Kunasundari, Balakrishnan; Hoo Peng, Yong; Qi, Hwa Ng; Teoh, Yi Peng

    2018-03-01

    Bacillus subtilis UniMAP-KB01, a cellulase producer was isolated from Malaysian mangrove soil. Through morphological identification it was observed that the B. subtilis appears to be in rod shaped and identified as a gram positive bacterium. Growth profile of isolated B. subtilis was established by measuring optical density (OD) at 600 nm for every 1 hour intervals. Polymath software was employed to plot the growth profile and the non-linear plot established gave the precision value of linear regression, R2 of 0.9602, root mean square deviation (RMSD) of 0.0176 and variance of 0.0025. The hydrolysis capacity testing revealed the cellulolytic index of 2.83 ± 0.46 after stained with Gram’s Iodine. The harvested crude enzyme after 24 hours incubation in carboxymethylcellulose (CMC) broth at 45°C and 100 RPM, was tested for enzyme activity. Through Filter Paper Assay (FPA), the cellulase activity was calculated to be 0.05 U/mL. The hydrolysis capacity testing and FPA shown an acceptable value for thermophilic bacterial enzyme activity. Thus, this isolated strain reasoned to be potential for producing thermostable cellulase which will be immobilized onto multi-walled carbon nanotubes and the cellulolytic activity will be characterized for biofuel production.

  7. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  8. Equilibrium-constant expressions for aqueous plutonium

    International Nuclear Information System (INIS)

    Silver, G.L.

    2010-01-01

    Equilibrium-constant expressions for Pu disproportionation reactions traditionally contain three or four terms representing the concentrations or fractions of the oxidation states. The expressions can be rewritten so that one of the oxidation states is replaced by a term containing the oxidation number of the plutonium. Experimental estimations of the numerical values of the constants can then be checked in several ways. (author)

  9. A null test of the cosmological constant

    International Nuclear Information System (INIS)

    Chiba, Takeshi; Nakamura, Takashi

    2007-01-01

    We provide a consistency relation between cosmological observables in general relativity with the cosmological constant. Breaking of this relation at any redshift would imply the breakdown of the hypothesis of the cosmological constant as an explanation of the current acceleration of the universe. (author)

  10. A stringy nature needs just two constants

    International Nuclear Information System (INIS)

    Veneziano, G.

    1986-01-01

    Dual string theories of everything, being purely geometrical, contain only two fundamental constants: c, for relativistic invariance, and a length lambda, for quantization. Planck's and Newton's constants appear only through Planck's length, a ''calculable'' fraction of lambda. Only the existence of a light sector breaks a ''reciprocity'' principle and unification at lambda, which is also the theory's cut-off

  11. On special relativity with cosmological constant

    International Nuclear Information System (INIS)

    Guo Hanying; Huang Chaoguang; Xu Zhan; Zhou Bin

    2004-01-01

    Based on the principle of relativity and the postulate of invariant speed and length, we propose the theory of special relativity with cosmological constant SRc,R, in which the cosmological constant is linked with the invariant length. Its relation with the doubly special relativity is briefly mentioned

  12. DETERMINATION OF STABILITY CONSTANTS OF MANGANESE (II ...

    African Journals Online (AJOL)

    DR. AMINU

    Keywords: Amino acids, dissociation constant, potentiometry, stability constant. INTRODUCTION. Acids – base titration involves the gradual addition or removal of protons for example using the deprotic form of glycine. The plot has two distinct stages corresponding to the deprotonation of the two different groups on glycine.

  13. Shapley Value for Constant-sum Games

    NARCIS (Netherlands)

    Khmelnitskaya, A.B.

    2002-01-01

    It is proved that Young's axiomatization for the Shapley value by marginalism, efficiency, and symmetry is still valid for the Shapley value defined on the class of nonnegative constant-sum games and on the entire class of constant-sum games as well. To support an interest to study the class of

  14. Constant Width Planar Computation Characterizes ACC0

    DEFF Research Database (Denmark)

    Hansen, Kristoffer Arnsfelt

    2006-01-01

    We obtain a characterization of ACC0 in terms of a natural class of constant width circuits, namely in terms of constant width polynomial size planar circuits. This is shown via a characterization of the class of acyclic digraphs which can be embedded on a cylinder surface in such a way that all...

  15. Experimental Determination of the Avogadro Constant

    Indian Academy of Sciences (India)

    mental physical constant such as charge of an electron or the. Boltzmann constant ... ideas was that the number of particles or molecules in a gas of given volume could not ... knowledge of at least one property of a single molecule. Loschmidt ...

  16. The time constant of the somatogravic illusion.

    Science.gov (United States)

    Correia Grácio, B J; de Winkel, K N; Groen, E L; Wentink, M; Bos, J E

    2013-02-01

    Without visual feedback, humans perceive tilt when experiencing a sustained linear acceleration. This tilt illusion is commonly referred to as the somatogravic illusion. Although the physiological basis of the illusion seems to be well understood, the dynamic behavior is still subject to discussion. In this study, the dynamic behavior of the illusion was measured experimentally for three motion profiles with different frequency content. Subjects were exposed to pure centripetal accelerations in the lateral direction and were asked to indicate their tilt percept by means of a joystick. Variable-radius centrifugation during constant angular rotation was used to generate these motion profiles. Two self-motion perception models were fitted to the experimental data and were used to obtain the time constant of the somatogravic illusion. Results showed that the time constant of the somatogravic illusion was on the order of two seconds, in contrast to the higher time constant found in fixed-radius centrifugation studies. Furthermore, the time constant was significantly affected by the frequency content of the motion profiles. Motion profiles with higher frequency content revealed shorter time constants which cannot be explained by self-motion perception models that assume a fixed time constant. Therefore, these models need to be improved with a mechanism that deals with this variable time constant. Apart from the fundamental importance, these results also have practical consequences for the simulation of sustained accelerations in motion simulators.

  17. The universal statistical distributions of the affinity, equilibrium constants, kinetics and specificity in biomolecular recognition.

    Directory of Open Access Journals (Sweden)

    Xiliang Zheng

    2015-04-01

    Full Text Available We uncovered the universal statistical laws for the biomolecular recognition/binding process. We quantified the statistical energy landscapes for binding, from which we can characterize the distributions of the binding free energy (affinity, the equilibrium constants, the kinetics and the specificity by exploring the different ligands binding with a particular receptor. The results of the analytical studies are confirmed by the microscopic flexible docking simulations. The distribution of binding affinity is Gaussian around the mean and becomes exponential near the tail. The equilibrium constants of the binding follow a log-normal distribution around the mean and a power law distribution in the tail. The intrinsic specificity for biomolecular recognition measures the degree of discrimination of native versus non-native binding and the optimization of which becomes the maximization of the ratio of the free energy gap between the native state and the average of non-native states versus the roughness measured by the variance of the free energy landscape around its mean. The intrinsic specificity obeys a Gaussian distribution near the mean and an exponential distribution near the tail. Furthermore, the kinetics of binding follows a log-normal distribution near the mean and a power law distribution at the tail. Our study provides new insights into the statistical nature of thermodynamics, kinetics and function from different ligands binding with a specific receptor or equivalently specific ligand binding with different receptors. The elucidation of distributions of the kinetics and free energy has guiding roles in studying biomolecular recognition and function through small-molecule evolution and chemical genetics.

  18. KB23 METAR

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — METAR is a routine scheduled observation and is the primary observation code used in the United States to satisfy requirements for reporting surface meteorological...

  19. KB21 METAR

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — METAR is a routine scheduled observation and is the primary observation code used in the United States to satisfy requirements for reporting surface meteorological...

  20. Zero cosmological constant from normalized general relativity

    International Nuclear Information System (INIS)

    Davidson, Aharon; Rubin, Shimon

    2009-01-01

    Normalizing the Einstein-Hilbert action by the volume functional makes the theory invariant under constant shifts in the Lagrangian. The associated field equations then resemble unimodular gravity whose otherwise arbitrary cosmological constant is now determined as a Machian universal average. We prove that an empty space-time is necessarily Ricci tensor flat, and demonstrate the vanishing of the cosmological constant within the scalar field paradigm. The cosmological analysis, carried out at the mini-superspace level, reveals a vanishing cosmological constant for a universe which cannot be closed as long as gravity is attractive. Finally, we give an example of a normalized theory of gravity which does give rise to a non-zero cosmological constant.

  1. Graviton fluctuations erase the cosmological constant

    Science.gov (United States)

    Wetterich, C.

    2017-10-01

    Graviton fluctuations induce strong non-perturbative infrared renormalization effects for the cosmological constant. The functional renormalization flow drives a positive cosmological constant towards zero, solving the cosmological constant problem without the need to tune parameters. We propose a simple computation of the graviton contribution to the flow of the effective potential for scalar fields. Within variable gravity, with effective Planck mass proportional to the scalar field, we find that the potential increases asymptotically at most quadratically with the scalar field. The solutions of the derived cosmological equations lead to an asymptotically vanishing cosmological "constant" in the infinite future, providing for dynamical dark energy in the present cosmological epoch. Beyond a solution of the cosmological constant problem, our simplified computation also entails a sizeable positive graviton-induced anomalous dimension for the quartic Higgs coupling in the ultraviolet regime, substantiating the successful prediction of the Higgs boson mass within the asymptotic safety scenario for quantum gravity.

  2. Solar constant values for estimating solar radiation

    International Nuclear Information System (INIS)

    Li, Huashan; Lian, Yongwang; Wang, Xianlong; Ma, Weibin; Zhao, Liang

    2011-01-01

    There are many solar constant values given and adopted by researchers, leading to confusion in estimating solar radiation. In this study, some solar constant values collected from literature for estimating solar radiation with the Angstroem-Prescott correlation are tested in China using the measured data between 1971 and 2000. According to the ranking method based on the t-statistic, a strategy to select the best solar constant value for estimating the monthly average daily global solar radiation with the Angstroem-Prescott correlation is proposed. -- Research highlights: → The effect of the solar constant on estimating solar radiation is investigated. → The investigation covers a diverse range of climate and geography in China. → A strategy to select the best solar constant for estimating radiation is proposed.

  3. Correcting binding parameters for interacting ligand-lattice systems

    Science.gov (United States)

    Hervy, Jordan; Bicout, Dominique J.

    2017-07-01

    Binding of ligands to macromolecules is central to many functional and regulatory biological processes. Key parameters characterizing ligand-macromolecule interactions are the stoichiometry, inducing the number of ligands per macromolecule binding site, and the dissociation constant, quantifying the ligand-binding site affinity. Both these parameters can be obtained from analyses of classical saturation experiments using the standard binding equation that offers the great advantage of mathematical simplicity but becomes an approximation for situations of interest when a ligand binds and covers more than one single binding site on the macromolecule. Using the framework of car-parking problem with latticelike macromolecules where each ligand can cover simultaneously several consecutive binding sites, we showed that employing the standard analysis leads to underestimation of binding parameters, i.e., ligands appear larger than they actually are and their affinity is also greater than it is. Therefore, we have derived expressions allowing to determine the ligand size and true binding parameters (stoichiometry and dissociation constant) as a function of apparent binding parameters retrieved from standard saturation experiments.

  4. Increased thyrotropin binding in hyperfunctioning thyroid nodules.

    Science.gov (United States)

    Müller-Gärtner, H W; Schneider, C; Bay, V; Tadt, A; Rehpenning, W; de Heer, K; Jessel, M

    1987-08-01

    The object of this study was to investigate TSH receptors in hyperfunctioning thyroid nodules (HFN). In HFN, obtained from seven patients, 125-I-TSH binding as determined by equilibrium binding analysis on particulate membrane preparations, was found to be significantly increased as compared with normal thyroid tissues (five patients; P less than 0.001). Scatchard analysis of TSH-binding revealed two kinds of binding sites for both normal thyroid tissue and HFN, and displayed significantly increased association constants of high- and low-affinity binding sites in HFN (Ka = 11.75 +/- 6.8 10(9) M-1, P less than 0.001 and Ka = 2.1 +/- 1.0 10(7) M-1, P less than 0.025; x +/- SEM) as compared with normal thyroid tissue (Ka = 0.25 +/- 0.06 10(9) M-1, Ka = 0.14 +/- 0.03 10(7) M-1; x +/- SEM). The capacity of the high-affinity binding sites in HFN was found to be decreased (1.8 +/- 1.1 pmol/mg protein, x +/- SEM) in comparison with normal thyroid tissue (4.26 +/- 1.27 pmol/mg protein; x +/- SEM). TSH-receptor autoradiography applied to cryostatic tissue sections confirmed increased TSH binding of the follicular epithelium in HFN. These data suggest that an increased affinity of TSH-receptor sites in HFN in iodine deficient areas may be an important event in thyroid autonomy.

  5. Total iron binding capacity

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003489.htm Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  6. Statistical orientation fluctuations: constant angular momentum versus constant rotational frequency constraints

    Energy Technology Data Exchange (ETDEWEB)

    Goodman, A L [Tulane Univ., New Orleans, LA (United States)

    1992-08-01

    Statistical orientation fluctuations are calculated with two alternative assumptions: the rotational frequency remains constant as the shape orientation fluctuates; and, the average angular momentum remains constant as the shape orientation fluctuates. (author). 2 refs., 3 figs.

  7. Comparison of solute-binding properties of plastic materials used as pharmaceutical product containers.

    Science.gov (United States)

    Jenke, Dennis; Couch, Tom; Gillum, Amy

    2010-01-01

    Material/water equilibrium binding constants (E(b)) were determined for 11 organic solutes and 2 plastic materials commonly used in pharmaceutical product containers (plasticized polyvinyl chloride and polyolefin). In general, solute binding by the plasticized polyvinyl chloride material was greater, by nearly an order of magnitude, than the binding by the polyolefin (on an equal weight basis). The utilization of the binding constants to facilitate container compatibility assessments (e.g., drug loss by container binding) for drug-containing products is discussed.

  8. On the constants for some Sobolev imbeddings

    Directory of Open Access Journals (Sweden)

    Pizzocchero Livio

    2001-01-01

    Full Text Available We consider the imbedding inequality is the Sobolev space (or Bessel potential space of type and (integer or fractional order . We write down upper bounds for the constants , using an argument previously applied in the literature in particular cases. We prove that the upper bounds computed in this way are in fact the sharp constants if , , and exhibit the maximising functions. Furthermore, using convenient trial functions, we derive lower bounds on for in many cases these are close to the previous upper bounds, as illustrated by a number of examples, thus characterizing the sharp constants with little uncertainty.

  9. On the constant-roll inflation

    Science.gov (United States)

    Yi, Zhu; Gong, Yungui

    2018-03-01

    The primordial power spectra of scalar and tensor perturbations during slow-roll inflation are usually calculated with the method of Bessel function approximation. For constant-roll or ultra slow-roll inflation, the method of Bessel function approximation may be invalid. We compare the numerical results with the analytical results derived from the Bessel function approximation, and we find that they differ significantly on super-horizon scales if the constant slow-roll parameter ηH is not small. More accurate method is needed for calculating the primordial power spectrum for constant-roll inflation.

  10. Scalar-tensor cosmology with cosmological constant

    International Nuclear Information System (INIS)

    Maslanka, K.

    1983-01-01

    The equations of scalar-tensor theory of gravitation with cosmological constant in the case of homogeneous and isotropic cosmological model can be reduced to dynamical system of three differential equations with unknown functions H=R/R, THETA=phi/phi, S=e/phi. When new variables are introduced the system becomes more symmetrical and cosmological solutions R(t), phi(t), e(t) are found. It is shown that when cosmological constant is introduced large class of solutions which depend also on Dicke-Brans parameter can be obtained. Investigations of these solutions give general limits for cosmological constant and mean density of matter in plane model. (author)

  11. Cosmological constant and advanced gravitational wave detectors

    International Nuclear Information System (INIS)

    Wang, Y.; Turner, E.L.

    1997-01-01

    Interferometric gravitational wave detectors could measure the frequency sweep of a binary inspiral (characterized by its chirp mass) to high accuracy. The observed chirp mass is the intrinsic chirp mass of the binary source multiplied by (1+z), where z is the redshift of the source. Assuming a nonzero cosmological constant, we compute the expected redshift distribution of observed events for an advanced LIGO detector. We find that the redshift distribution has a robust and sizable dependence on the cosmological constant; the data from advanced LIGO detectors could provide an independent measurement of the cosmological constant. copyright 1997 The American Physical Society

  12. Constant strength fuel-fuel cell

    International Nuclear Information System (INIS)

    Vaseen, V.A.

    1980-01-01

    A fuel cell is an electrochemical apparatus composed of both a nonconsumable anode and cathode; and electrolyte, fuel oxidant and controls. This invention guarantees the constant transfer of hydrogen atoms and their respective electrons, thus a constant flow of power by submergence of the negative electrode in a constant strength hydrogen furnishing fuel; when said fuel is an aqueous absorbed hydrocarbon, such as and similar to ethanol or methnol. The objective is accomplished by recirculation of the liquid fuel, as depleted in the cell through specific type membranes which pass water molecules and reject the fuel molecules; thus concentrating them for recycle use

  13. Reactor group constants and benchmark test

    Energy Technology Data Exchange (ETDEWEB)

    Takano, Hideki [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-08-01

    The evaluated nuclear data files such as JENDL, ENDF/B-VI and JEF-2 are validated by analyzing critical mock-up experiments for various type reactors and assessing applicability for nuclear characteristics such as criticality, reaction rates, reactivities, etc. This is called Benchmark Testing. In the nuclear calculations, the diffusion and transport codes use the group constant library which is generated by processing the nuclear data files. In this paper, the calculation methods of the reactor group constants and benchmark test are described. Finally, a new group constants scheme is proposed. (author)

  14. Multiple binding of bilirubin to human serum albumin and cobinding with laurate

    DEFF Research Database (Denmark)

    Sato, H; Honoré, B; Brodersen, R

    1988-01-01

    Numerical analysis of multiple binding of two ligands to one carrier has been accomplished, using the principle of several sets of acceptable binding constants, with bilirubin-laurate-albumin as an example. Binding of bilirubin to defatted human serum albumin was investigated by a spectroscopic...

  15. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  16. Whole transcriptomic and proteomic analyses of an isogenic M. tuberculosis clinical strain with a naturally occurring 15 Kb genomic deletion.

    Directory of Open Access Journals (Sweden)

    Carla Duncan

    Full Text Available Tuberculosis remains one of the most difficult to control infectious diseases in the world. Many different factors contribute to the complexity of this disease. These include the ability of the host to control the infection which may directly relate to nutritional status, presence of co-morbidities and genetic predisposition. Pathogen factors, in particular the ability of different Mycobacterium tuberculosis strains to respond to the harsh environment of the host granuloma, which includes low oxygen and nutrient availability and the presence of damaging radical oxygen and nitrogen species, also play an important role in the success of different strains to cause disease. In this study we evaluated the impact of a naturally occurring 12 gene 15 Kb genomic deletion on the physiology and virulence of M. tuberculosis. The strains denominated ON-A WT (wild type and ON-A NM (natural mutant were isolated from a previously reported TB outbreak in an inner city under-housed population in Toronto, Canada. Here we subjected these isogenic strains to transcriptomic (via RNA-seq and proteomic analyses and identified several gene clusters with differential expression in the natural mutant, including the DosR regulon and the molybdenum cofactor biosynthesis genes, both of which were found in lower abundance in the natural mutant. We also demonstrated lesser virulence of the natural mutant in the guinea pig animal model. Overall, our findings suggest that the ON-A natural mutant is less fit to cause disease, but nevertheless has the potential to cause extended transmission in at-risk populations.

  17. Relationship between electrophilicity index, Hammett constant and ...

    Indian Academy of Sciences (India)

    Unknown

    Inter-relationships between the electrophilicity index (ω), Hammett constant (óp) and nucleus- independent chemical ... cess of DFT is that it provides simple working equa- tions to elucidate ... compasses both the ability of an electrophile to ac-.

  18. Canonoid transformations and constants of motion

    International Nuclear Information System (INIS)

    Negri, L.J.; Oliveira, L.C.; Teixeira, J.M.

    1986-01-01

    The necessary and sufficient conditions for a canonoid transformation with respect to a given Hamiltonian are obtained in terms of the Lagrange brackets of the trasformation. The relation of these conditions with the constants of motion is discussed. (Author) [pt

  19. An improved dosimeter having constant flow pump

    International Nuclear Information System (INIS)

    Baker, W.B.

    1980-01-01

    A dosemeter designed for individual use which can be used to monitor toxic radon gas and toxic related products of radon gas in mines and which incorporates a constant air stream flowing through the dosimeter is described. (U.K.)

  20. Interacting universes and the cosmological constant

    International Nuclear Information System (INIS)

    Alonso-Serrano, A.; Bastos, C.; Bertolami, O.; Robles-Pérez, S.

    2013-01-01

    In this Letter it is studied the effects that an interaction scheme among universes can have in the values of their cosmological constants. In the case of two interacting universes, the value of the cosmological constant of one of the universes becomes very close to zero at the expense of an increasing value of the cosmological constant of the partner universe. In the more general case of a chain of N interacting universes with periodic boundary conditions, the spectrum of the Hamiltonian splits into a large number of levels, each of them associated with a particular value of the cosmological constant, that can be occupied by single universes revealing a collective behavior that plainly shows that the multiverse is much more than the mere sum of its parts

  1. Interacting universes and the cosmological constant

    Energy Technology Data Exchange (ETDEWEB)

    Alonso-Serrano, A. [Centro de Física “Miguel Catalán”, Instituto de Física Fundamental, Consejo Superior de Investigaciones Científicas, Serrano 121, 28006 Madrid (Spain); Estación Ecológica de Biocosmología, Pedro de Alvarado 14, 06411 Medellín (Spain); Bastos, C. [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Avenida Rovisco Pais 1, 1049-001 Lisboa (Portugal); Bertolami, O. [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Avenida Rovisco Pais 1, 1049-001 Lisboa (Portugal); Departamento de Física e Astronomia, Faculdade de Ciências da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Robles-Pérez, S., E-mail: salvarp@imaff.cfmac.csic.es [Centro de Física “Miguel Catalán”, Instituto de Física Fundamental, Consejo Superior de Investigaciones Científicas, Serrano 121, 28006 Madrid (Spain); Estación Ecológica de Biocosmología, Pedro de Alvarado 14, 06411 Medellín (Spain); Física Teórica, Universidad del País Vasco, Apartado 644, 48080 Bilbao (Spain)

    2013-02-12

    In this Letter it is studied the effects that an interaction scheme among universes can have in the values of their cosmological constants. In the case of two interacting universes, the value of the cosmological constant of one of the universes becomes very close to zero at the expense of an increasing value of the cosmological constant of the partner universe. In the more general case of a chain of N interacting universes with periodic boundary conditions, the spectrum of the Hamiltonian splits into a large number of levels, each of them associated with a particular value of the cosmological constant, that can be occupied by single universes revealing a collective behavior that plainly shows that the multiverse is much more than the mere sum of its parts.

  2. Constant conditional entropy and related hypotheses

    International Nuclear Information System (INIS)

    Ferrer-i-Cancho, Ramon; Dębowski, Łukasz; Moscoso del Prado Martín, Fermín

    2013-01-01

    Constant entropy rate (conditional entropies must remain constant as the sequence length increases) and uniform information density (conditional probabilities must remain constant as the sequence length increases) are two information theoretic principles that are argued to underlie a wide range of linguistic phenomena. Here we revise the predictions of these principles in the light of Hilberg’s law on the scaling of conditional entropy in language and related laws. We show that constant entropy rate (CER) and two interpretations for uniform information density (UID), full UID and strong UID, are inconsistent with these laws. Strong UID implies CER but the reverse is not true. Full UID, a particular case of UID, leads to costly uncorrelated sequences that are totally unrealistic. We conclude that CER and its particular cases are incomplete hypotheses about the scaling of conditional entropies. (letter)

  3. New perspectives on constant-roll inflation

    Science.gov (United States)

    Cicciarella, Francesco; Mabillard, Joel; Pieroni, Mauro

    2018-01-01

    We study constant-roll inflation using the β-function formalism. We show that the constant rate of the inflaton roll is translated into a first order differential equation for the β-function which can be solved easily. The solutions to this equation correspond to the usual constant-roll models. We then construct, by perturbing these exact solutions, more general classes of models that satisfy the constant-roll equation asymptotically. In the case of an asymptotic power law solution, these corrections naturally provide an end to the inflationary phase. Interestingly, while from a theoretical point of view (in particular in terms of the holographic interpretation) these models are intrinsically different from standard slow-roll inflation, they may have phenomenological predictions in good agreement with present cosmological data.

  4. Hydrolysis and formation constants at 250C

    International Nuclear Information System (INIS)

    Phillips, S.L.

    1982-05-01

    A database consisting of hydrolysis and formation constants for about 20 metals associated with the disposal of nuclear waste is given. Complexing ligands for the various ionic species of these metals include OH, F, Cl, SO 4 , PO 4 and CO 3 . Table 1 consists of tabulated calculated and experimental values of log K/sub xy/, mainly at 25 0 C and various ionic strengths together with references to the origin of the data. Table 2 consists of a column of recommended stability constants at 25 0 C and zero ionic strength tabulated in the column headed log K/sub xy/(0); other columns contain coefficients for an extended Debye-Huckel equation to permit calculations of stability constants up to 3 ionic strength, and up to 0.7 ionic strength using the Davies equation. Selected stability constants calculated with these coefficients for various ionic strengths agree to an average of +- 2% when compared with published experimental and calculated values

  5. Wormholes and the cosmological constant problem.

    Science.gov (United States)

    Klebanov, I.

    The author reviews the cosmological constant problem and the recently proposed wormhole mechanism for its solution. Summation over wormholes in the Euclidean path integral for gravity turns all the coupling parameters into dynamical variables, sampled from a probability distribution. A formal saddle point analysis results in a distribution with a sharp peak at the cosmological constant equal to zero, which appears to solve the cosmological constant problem. He discusses the instabilities of the gravitational Euclidean path integral and the difficulties with its interpretation. He presents an alternate formalism for baby universes, based on the "third quantization" of the Wheeler-De Witt equation. This approach is analyzed in a minisuperspace model for quantum gravity, where it reduces to simple quantum mechanics. Once again, the coupling parameters become dynamical. Unfortunately, the a priori probability distribution for the cosmological constant and other parameters is typically a smooth function, with no sharp peaks.

  6. A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH

    DEFF Research Database (Denmark)

    Becher, Naja; Gjørup, Vibike; Christensen, Rikke

    2012-01-01

    A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH......A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH...

  7. Cordyceps militaris Fraction induces apoptosis and G2/M Arrest via c-Jun N-Terminal kinase signaling pathway in oral squamous carcinoma KB Cells.

    Science.gov (United States)

    Xie, Wangshi; Zhang, Zhang; Song, Liyan; Huang, Chunhua; Guo, Zhongyi; Hu, Xianjing; Bi, Sixue; Yu, Rongmin

    2018-01-01

    Cordyceps militaris fraction (CMF) has been shown to possess in vitro antitumor activity against human chronic myeloid leukemia K562 cells in our previous research. The in vitro inhibitory activities of CMF on the growth of KB cells were evaluated by viability assay. The apoptotic and cell cycle influences of CMF were detected by 4',6-diamidino-2-phenylindole staining and flow cytometry assay. The expression of different apoptosis-associated proteins and cell cycle regulatory proteins was examined by Western blot assay. The nuclear localization of c-Jun was observed by fluorescence staining. The objective of this study was to investigate the antiproliferative effect of CMF as well as the mechanism underlying the apoptosis and cell cycle arrest it induces in KB cells. CMF suppressed KB cells' proliferation in a dose- and time-dependent manner. Flow cytometric analysis indicated that CMF induced G2/M cell cycle arrest and apoptosis. Western blot analysis revealed that CMF induced caspase-3, caspase-9, and PARP cleavages, and increased the Bax/Bcl-2 ratio. CMF also led to increased expression of p21, decreased expression of cyclin B1, mitotic phosphatase cdc25c, and mitotic kinase cdc2, as well as unchanged expression of p53. In addition, CMF stimulated c-Jun N-terminal kinases (JNK) protein phosphorylations, resulting in upregulated expression of c-Jun and nuclear localization of c-Jun. Pretreatment with JNK inhibitor SP600125 suppressed CMF-induced apoptosis and G2/M arrest. CMF is capable of modulating c-Jun caspase and Bcl-2 family proteins through JNK-dependent apoptosis, which results in G2/M phase arrest in KB cells. CMF could be developed as a promising candidate for the new antitumor agents. CMF exhibited strong anticancer activity against oral squamous carcinoma KB cellsCMF inhibited KB cells' proliferation via induction of apoptosis and G2/M cell cycle arrestCMF activated JNK signaling pathway and promoted the nuclear localization of c-JunCMF regulated the

  8. Building evolutionary architectures support constant change

    CERN Document Server

    Ford, Neal; Kua, Patrick

    2017-01-01

    The software development ecosystem is constantly changing, providing a constant stream of new tools, frameworks, techniques, and paradigms. Over the past few years, incremental developments in core engineering practices for software development have created the foundations for rethinking how architecture changes over time, along with ways to protect important architectural characteristics as it evolves. This practical guide ties those parts together with a new way to think about architecture and time.

  9. Nuclei quadrupole coupling constants in diatomic molecule

    International Nuclear Information System (INIS)

    Ivanov, A.I.; Rebane, T.K.

    1993-01-01

    An approximate relationship between the constants of quadrupole interaction of nuclei in a two-atom molecule is found. It enabled to establish proportionality of oscillatory-rotation corrections to these constants for both nuclei in the molecule. Similar results were obtained for the factors of electrical dipole-quadrupole screening of nuclei. Applicability of these relationships is proven by the example of lithium deuteride molecule. 4 refs., 1 tab

  10. Parametrised Constants and Replication for Spatial Mobility

    DEFF Research Database (Denmark)

    Hüttel, Hans; Haagensen, Bjørn

    2009-01-01

    Parametrised replication and replication are common ways of expressing infinite computation in process calculi. While parametrised constants can be encoded using replication in the π-calculus, this changes in the presence of spatial mobility as found in e.g. the distributed π- calculus...... of the distributed π-calculus with parametrised constants and replication are incomparable. On the other hand, we shall see that there exists a simple encoding of recursion in mobile ambients....

  11. A model for solar constant secular changes

    Science.gov (United States)

    Schatten, Kenneth H.

    1988-01-01

    In this paper, contrast models for solar active region and global photospheric features are used to reproduce the observed Active Cavity Radiometer and Earth Radiation Budget secular trends in reasonably good fashion. A prediction for the next decade of solar constant variations is made using the model. Secular trends in the solar constant obtained from the present model support the view that the Maunder Minimum may be related to the Little Ice Age of the 17th century.

  12. A quadri-constant fraction discriminator

    International Nuclear Information System (INIS)

    Wang Wei; Gu Zhongdao

    1992-01-01

    A quad Constant Fraction (Amplitude and Rise Time Compensation) Discriminator Circuit is described, which is based on the ECL high-speed dual comparator AD 9687. The CFD (ARCD) is of the constant fraction timing type (the amplitude and rise time compensation timing type) employing a leading edge discriminator to eliminate error triggers caused by noises. A timing walk measurement indicates a timing walk of less than +- 150 ps from -50 mV to -5 V

  13. Renormalization group equations with multiple coupling constants

    International Nuclear Information System (INIS)

    Ghika, G.; Visinescu, M.

    1975-01-01

    The main purpose of this paper is to study the renormalization group equations of a renormalizable field theory with multiple coupling constants. A method for the investigation of the asymptotic stability is presented. This method is applied to a gauge theory with Yukawa and self-quartic couplings of scalar mesons in order to find the domains of asymptotic freedom. An asymptotic expansion for the solutions which tend to the origin of the coupling constants is given

  14. Inflation with a constant rate of roll

    International Nuclear Information System (INIS)

    Motohashi, Hayato; Starobinsky, Alexei A.; Yokoyama, Jun'ichi

    2015-01-01

    We consider an inflationary scenario where the rate of inflaton roll defined by ·· φ/H φ-dot remains constant. The rate of roll is small for slow-roll inflation, while a generic rate of roll leads to the interesting case of 'constant-roll' inflation. We find a general exact solution for the inflaton potential required for such inflaton behaviour. In this model, due to non-slow evolution of background, the would-be decaying mode of linear scalar (curvature) perturbations may not be neglected. It can even grow for some values of the model parameter, while the other mode always remains constant. However, this always occurs for unstable solutions which are not attractors for the given potential. The most interesting particular cases of constant-roll inflation remaining viable with the most recent observational data are quadratic hilltop inflation (with cutoff) and natural inflation (with an additional negative cosmological constant). In these cases even-order slow-roll parameters approach non-negligible constants while the odd ones are asymptotically vanishing in the quasi-de Sitter regime

  15. RNA structure and scalar coupling constants

    Energy Technology Data Exchange (ETDEWEB)

    Tinoco, I. Jr.; Cai, Z.; Hines, J.V.; Landry, S.M.; SantaLucia, J. Jr.; Shen, L.X.; Varani, G. [Univ. of California, Berkeley, CA (United States)

    1994-12-01

    Signs and magnitudes of scalar coupling constants-spin-spin splittings-comprise a very large amount of data that can be used to establish the conformations of RNA molecules. Proton-proton and proton-phosphorus splittings have been used the most, but the availability of {sup 13}C-and {sup 15}N-labeled molecules allow many more coupling constants to be used for determining conformation. We will systematically consider the torsion angles that characterize a nucleotide unit and the coupling constants that depend on the values of these torsion angles. Karplus-type equations have been established relating many three-bond coupling constants to torsion angles. However, one- and two-bond coupling constants can also depend on conformation. Serianni and coworkers measured carbon-proton coupling constants in ribonucleosides and have calculated their values as a function of conformation. The signs of two-bond coupling can be very useful because it is easier to measure a sign than an accurate magnitude.

  16. Thermodynamic model of binding of flexible bivalent haptens to antibody

    Energy Technology Data Exchange (ETDEWEB)

    Dembo, M; Goldstein, B

    1978-01-01

    Studies by Wilder et al. of the binding of Fab' fragments to small haptens have shown that the cross-linking constant (the equilibrium constant for binding an additional Fab' fragment to a hapten-Fab' complex) is strongly dependent on the length of the hapten. We present a simple model for predicting the relationship between the intermolecular cross-linking constant and the monovalent hapten-antibody binding constant. In particular we used the model to obtain the dependence of the cross-linking constant on the length of th hapten, the depth to which the hapten fills th Fab' binding site, and the size of the Fab' fragment. To test the model, we devised expressions which allowed us to analyze the data of Wilder et al. From their data we determined the values of two parameters which we took to be unknown in the theory, the size of the Fab' fragment and the depth to which the hapten fills the Fab' binding site. The values arrived at in this way agreed well with published measurements of these parameters.

  17. Identification of herpes simplex virus type 1 proteins encoded within the first 1.5 kb of the latency-associated transcript.

    Science.gov (United States)

    Henderson, Gail; Jaber, Tareq; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2009-09-01

    Expression of the first 1.5 kb of the latency-associated transcript (LAT) that is encoded by herpes simplex virus type 1 (HSV-1) is sufficient for wild-type (wt) levels of reactivation from latency in small animal models. Peptide-specific immunoglobulin G (IgG) was generated against open reading frames (ORFs) that are located within the first 1.5 kb of LAT coding sequences. Cells stably transfected with LAT or trigeminal ganglionic neurons of mice infected with a LAT expressing virus appeared to express the L2 or L8 ORF. Only L2 ORF expression was readily detected in trigeminal ganglionic neurons of latently infected mice.

  18. Identification of two small RNAs within the first 1.5-kb of the herpes simplex virus type 1-encoded latency-associated transcript.

    Science.gov (United States)

    Peng, Weiping; Vitvitskaia, Olga; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

    2008-01-01

    The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is abundantly expressed in latently infected neurons. In the rabbit or mouse ocular models of infection, expression of the first 1.5 kb of LAT coding sequences is sufficient for and necessary for wild-type levels of spontaneous reactivation from latency. The antiapoptosis functions of LAT, which maps to the same 1.5 kb of LAT, are important for the latency-reactivation cycle because replacement of LAT with other antiapoptosis genes (the baculovirus IAP gene or the bovine herpesvirus type 1 latency-related gene) restores wild-type levels of reactivation to a LAT null mutant. A recent study identified a micro-RNA within LAT that can inhibit apoptosis (Gupta et al, Nature 442: 82-85). In this study, the authors analyzed the first 1.5 kb of LAT for additional small RNAs that may have regulatory functions. Two LAT-specific small RNAs were detected in productively infected human neuroblastoma cells within the first 1.5 kb of LAT, in a region that is important for inhibiting apoptosis. Although these small RNAs possess extensive secondary structure and a stem-loop structure, bands migrating near 23 bases were not detected suggesting these small RNAs are not true micro-RNAs. Both of the small LAT-specific RNAs have the potential to base pair with the ICP4 mRNA. These two small LAT RNAs may play a role in the latency-reactivation cycle by reducing apoptosis and/or by reducing ICP4 RNA expression.

  19. Induction of necrosis and apoptosis to KB cancer cells by sanguinarine is associated with reactive oxygen species production and mitochondrial membrane depolarization

    International Nuclear Information System (INIS)

    Chang, M.-C.; Chan, C.-P.; Wang, Y.-J.; Lee, P.-H.; Chen, L.-I; Tsai, Y.-L.; Lin, B.-R.; Wang, Y.-L.; Jeng, J.-H.

    2007-01-01

    Sanguinarine is a benzopheanthridine alkaloid present in the root of Sanguinaria canadensis L. and Chellidonium majus L. In this study, sanguinarine (2 and 3 μM) exhibited cytotoxicity to KB cancer cells by decreasing MTT reduction to 83% and 52% of control after 24-h of exposure. Sanguinarine also inhibited the colony forming capacity (> 52-58%) and growth of KB cancer cells at concentrations higher than 0.5-1 μM. Short-term exposure to sanguinarine (> 0.5 μM) effectively suppressed the adhesion of KB cells to collagen and fibronectin (FN). Sanguinarine (2 and 3 μM) induced evident apoptosis as indicated by an increase in sub-G0/G1 populations, which was detected after 6-h of exposure. Only a slight increase in cells arresting in S-phase and G2/M was noted. Induction of KB cell apoptosis and necrosis by sanguinarine (2 and 3 μM) was further confirmed by Annexin V-PI dual staining flow cytometry and the presence of DNA fragmentation. The cytotoxicity by sanguinarine was accompanied by an increase in production of reactive oxygen species (ROS) and depolarization of mitochondrial membrane potential as indicated by single cell flow cytometric analysis of DCF and rhodamine fluorescence. NAC (1 and 3 mM) and catalase (2000 U/ml) prevented the sanguinarine-induced ROS production and cytotoxicity, whereas dimethylthiourea (DMT) showed no marked preventive effect. These results suggest that sanguinarine has anticarcinogenic properties with induction of ROS production and mitochondrial membrane depolarization, which mediate cancer cell death

  20. CLCNKB mutations causing mild Bartter syndrome profoundly alter the pH and Ca2+ dependence of ClC-Kb channels.

    Science.gov (United States)

    Andrini, Olga; Keck, Mathilde; L'Hoste, Sébastien; Briones, Rodolfo; Mansour-Hendili, Lamisse; Grand, Teddy; Sepúlveda, Francisco V; Blanchard, Anne; Lourdel, Stéphane; Vargas-Poussou, Rosa; Teulon, Jacques

    2014-09-01

    ClC-Kb, a member of the ClC family of Cl(-) channels/transporters, plays a major role in the absorption of NaCl in the distal nephron. CLCNKB mutations cause Bartter syndrome type 3, a hereditary renal salt-wasting tubulopathy. Here, we investigate the functional consequences of a Val to Met substitution at position 170 (V170M, α helix F), which was detected in eight patients displaying a mild phenotype. Conductance and surface expression were reduced by ~40-50 %. The regulation of channel activity by external H(+) and Ca(2+) is a characteristic property of ClC-Kb. Inhibition by external H(+) was dramatically altered, with pKH shifting from 7.6 to 6.0. Stimulation by external Ca(2+) on the other hand was no longer detectable at pH 7.4, but was still present at acidic pH values. Functionally, these regulatory modifications partly counterbalance the reduced surface expression by rendering V170M hyperactive. Pathogenic Met170 seems to interact with another methionine on α helix H (Met227) since diverse mutations at this site partly removed pH sensitivity alterations of V170M ClC-Kb. Exploring other disease-associated mutations, we found that a Pro to Leu substitution at position 124 (α helix D, Simon et al., Nat Genet 1997, 17:171-178) had functional consequences similar to those of V170M. In conclusion, we report here for the first time that ClC-Kb disease-causing mutations located around the selectivity filter can result in both reduced surface expression and hyperactivity in heterologous expression systems. This interplay must be considered when analyzing the mild phenotype of patients with type 3 Bartter syndrome.

  1. Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex.

    Science.gov (United States)

    Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua

    2017-06-01

    The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

  2. The 29.5 kb APOBEC3B Deletion Polymorphism Is Not Associated with Clinical Outcome of Breast Cancer.

    Science.gov (United States)

    Liu, Jingjing; Sieuwerts, Anieta M; Look, Maxime P; van der Vlugt-Daane, Michelle; Meijer-van Gelder, Marion E; Foekens, John A; Hollestelle, Antoinette; Martens, John W M

    2016-01-01

    Increased APOBEC3B mRNA levels are associated with a hypermutator phenotype and poor prognosis in ER-positive breast cancer patients. In addition, a 29.5 kb deletion polymorphism of APOBEC3B, resulting in an APOBEC3A-B hybrid transcript, has been associated with an increased breast cancer risk and the hypermutator phenotype. Here we evaluated whether the APOBEC3B deletion polymorphism also associates with clinical outcome of breast cancer. Copy number analysis was performed by quantitative PCR (qPCR) in primary tumors of 1,756 Dutch breast cancer patients. The APOBEC3B deletion was found in 187 patients of whom 16 carried a two-copy deletion and 171 carried a one-copy deletion. The prognostic value of the APOBEC3B deletion for the natural course of the disease was evaluated among 1,076 lymph-node negative (LNN) patients who did not receive adjuvant systemic treatment. No association was found between APOBEC3B copy number values and the length of metastasis-free survival (MFS; hazard ratio (HR) = 1.00, 95% confidence interval (CI) = 0.90-1.11, P = 0.96). Subgroup analysis by ER status also did not reveal an association between APOBEC3B copy number values and the length of MFS. The predictive value of the APOBEC3B deletion was assessed among 329 ER-positive breast cancer patients who received tamoxifen as the first-line therapy for recurrent disease and 226 breast cancer patients who received first-line chemotherapy for recurrent disease. No association between APOBEC3B copy number values and the overall response rate (ORR) to either tamoxifen (odds ratio (OR) = 0.88, 95% CI = 0.69-1.13, P = 0.31) or chemotherapy (OR = 0.97, 95% CI = 0.71-1.33, P = 0.87) was found. Thus, in contrast to APOBEC3B mRNA levels, the APOBEC3B deletion polymorphism has neither a prognostic nor a predictive value for breast cancer patients. Although a correlation exists between APOBEC3B copy number and mRNA expression, it is relatively weak. This suggests that other mechanisms exist that may

  3. FACTOR NUCLEAR kB (NF-kB: SIGNALOSOMA Y SU IMPORTANCIA EN ENFERMEDADES INFLAMATORIAS Y CÁNCER

    Directory of Open Access Journals (Sweden)

    Nancy P. Echeverry R.L

    2008-04-01

    Full Text Available El factor nuclear kB (NF-kB es un dímero constituido por proteínas de la familia Rel. El NF-kB se encuentra en el citoplasma unido a proteínas inhibidoras (IkB. Las IkB son fosforiladas por diferentes cinasas que hacen parte del signalosoma como las cinasas de IKKa e IKKb y el modulador esencial de NF-kB (NEMO, la proteína cinasa activadora de mitosis (MAPK o p38 y la cinasa inductora de NF-kB (NIK. Estas cinasas al ser activadas por señales dependientes de citocinas y luz ultravioleta, fosforilan las IkB provocando su ubiquitinación, su degradación por proteosoma y la subsecuente liberación y translocación al núcleo de NF-kB. Recientemente se le ha dado una gran importancia al NF-kB en la vía de señalización desencadenada por estrés oxidativo, estrés genotóxico y daño en el DNA. A diferencia de la vía denominada clásica, en esta ruta ocurre una SUMOilación de NEMO y translocación al núcleo. En el núcleo NEMO interactúa con la proteína de la ataxia telangiectasia mutada (ATM activada en respuesta a modificaciones en la cromatina y daño en el DNA. El complejo ATM/NEMO es translocado al citoplasma donde la ATM fosforila a las IKK llevando a la ubiquitinación y posterior liberación de NF-kB que es translocado al núcleo. NF-kB desencadena procesos de supervivencia incluyendo el aumento de la transcripción de enzimas antioxidantes como la superóxido dismutasa, catalasa y glutatión. Estas enzimas participan en el control de los niveles de especies reactivas de oxígeno en la célula. La sobreactivación de NF-kB se relaciona con inflamación y cáncer. En la actualidad se desarrolla una búsqueda de fármacos que actúen sobre moléculas del signalosoma de NF-kB, no sólo para el manejo de enfermedades inflamatorias sino también para el uso durante el tratamiento de tumores resistentes a radio y quimioterapia.

  4. HLA-C -35kb expression SNP is associated with differential control of β-HPV infection in squamous cell carcinoma cases and controls.

    Directory of Open Access Journals (Sweden)

    Karin A Vineretsky

    Full Text Available A single nucleotide polymorphism (SNP 35 kb upstream of the HLA-C gene is associated with HLA-C expression, and the high expressing genotype (CC has been associated with HIV-I control. HLA-C is unique among the classical MHC class I molecules for its role in the control of viral infections and recognition of abnormal or missing self. This immunosurveillance is central to the pathogenesis of non-melanoma skin cancer (NMSC, and of squamous cell carcinoma (SCC in particular. While sun exposure is a major risk factor for these cancers, cutaneous infections with genus β-HPV have been implicated in the development of SCC. We hypothesized that the high expression HLA-C genotype is associated with β-HPV infections. Therefore, we investigated the association between β-HPV serology and the -35 kb SNP (rs9264942 in a population-based case-control study of 510 SCC cases and 608 controls. Among controls, the high expression -35 kb SNP genotype (CC reduced the likelihood of positive serology for multiple (≥2 β-HPV infections (OR = 0.49, 95% CI: 0.25-0.97, and β-HPV species 2 infection (OR = 0.43, 95% CI: 0.23-0.79. However, no association with β-HPV status was observed among SCC cases. Our findings suggest that underlying immunogenotype plays an important role in differential control of β-HPV in SCC cases and controls.

  5. The binding of Np to rat bone

    International Nuclear Information System (INIS)

    Ramounet, B.; Taylor, D.M.

    1997-01-01

    Neptunium has been shown to massively deposit in bone, after intravenous or intramuscular injections. Initially, it was uniformly distributed on periosteal and endosteal bone surfaces. The nature of the binding molecules, for this actinide, in the skeleton, has not yet been identified. The aim of this work was to characterize the ligands of neptunium by selective extractions of bone components. The preliminary results displayed the binding of 237 Np(IV) in the organic phase of bone, after intravenous or intramuscular contamination. Further studies are in progress, to quantify the fraction of Np bound to the organic and mineral compartment of bone, and to determine the affinity constant and the turn-over of the binding proteins. (authors)

  6. Binding of poly(amidoamine), carbosilane, phosphorus and hybrid dendrimers to thrombin-Constants and mechanisms.

    Science.gov (United States)

    Shcharbin, Dzmitry; Pedziwiatr-Werbicka, Elzbieta; Vcherashniaya, Aliaksandra; Janaszewska, Anna; Marcinkowska, Monika; Goska, Piotr; Klajnert-Maculewicz, Barbara; Ionov, Maksim; Abashkin, Viktar; Ihnatsyeu-Kachan, Aliaksei; de la Mata, F Javier; Ortega, Paula; Gomez-Ramirez, Rafael; Majoral, Jean-Pierre; Bryszewska, Maria

    2017-07-01

    Thrombin is an essential part of the blood coagulation system; it is a serine protease that converts soluble fibrinogen into insoluble strands of fibrin, and catalyzes many other coagulation-related reactions. Absorption at its surface of small nanoparticles can completely change the biological properties of thrombin. We have analyzed the influence on thrombin of 3 different kinds of small nanoparticles: dendrimers (phosphorus-based, carbosilane based and polyamidoamine) and 2 hybrid systems containing carbosilane, viologen and phosphorus dendritic scaffolds in one single molecule, bearing different flexibility, size and surface charge. There was significant alteration in the rigidity of the rigid dendrimers in contrast to flexible dendrimers. These differences in their action are important in understanding interactions taking place at a bio-nanointerface. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Constant-roll (quasi-)linear inflation

    Science.gov (United States)

    Karam, A.; Marzola, L.; Pappas, T.; Racioppi, A.; Tamvakis, K.

    2018-05-01

    In constant-roll inflation, the scalar field that drives the accelerated expansion of the Universe is rolling down its potential at a constant rate. Within this framework, we highlight the relations between the Hubble slow-roll parameters and the potential ones, studying in detail the case of a single-field Coleman-Weinberg model characterised by a non-minimal coupling of the inflaton to gravity. With respect to the exact constant-roll predictions, we find that assuming an approximate slow-roll behaviour yields a difference of Δ r = 0.001 in the tensor-to-scalar ratio prediction. Such a discrepancy is in principle testable by future satellite missions. As for the scalar spectral index ns, we find that the existing 2-σ bound constrains the value of the non-minimal coupling to ξphi ~ 0.29–0.31 in the model under consideration.

  8. Cosmological constant is a conserved charge

    Science.gov (United States)

    Chernyavsky, Dmitry; Hajian, Kamal

    2018-06-01

    Cosmological constant can always be considered as the on-shell value of a top form in gravitational theories. The top form is the field strength of a gauge field, and the theory enjoys a gauge symmetry. We show that cosmological constant is the charge of the global part of the gauge symmetry, and is conserved irrespective of the dynamics of the metric and other fields. In addition, we introduce its conjugate chemical potential, and prove the generalized first law of thermodynamics which includes variation of cosmological constant as a conserved charge. We discuss how our new term in the first law is related to the volume–pressure term. In parallel with the seminal Wald entropy, this analysis suggests that pressure can also be considered as a conserved charge.

  9. Fast optimization algorithms and the cosmological constant

    Science.gov (United States)

    Bao, Ning; Bousso, Raphael; Jordan, Stephen; Lackey, Brad

    2017-11-01

    Denef and Douglas have observed that in certain landscape models the problem of finding small values of the cosmological constant is a large instance of a problem that is hard for the complexity class NP (Nondeterministic Polynomial-time). The number of elementary operations (quantum gates) needed to solve this problem by brute force search exceeds the estimated computational capacity of the observable Universe. Here we describe a way out of this puzzling circumstance: despite being NP-hard, the problem of finding a small cosmological constant can be attacked by more sophisticated algorithms whose performance vastly exceeds brute force search. In fact, in some parameter regimes the average-case complexity is polynomial. We demonstrate this by explicitly finding a cosmological constant of order 10-120 in a randomly generated 1 09-dimensional Arkani-Hamed-Dimopoulos-Kachru landscape.

  10. Conformally invariant braneworld and the cosmological constant

    International Nuclear Information System (INIS)

    Guendelman, E.I.

    2004-01-01

    A six-dimensional braneworld scenario based on a model describing the interaction of gravity, gauge fields and 3+1 branes in a conformally invariant way is described. The action of the model is defined using a measure of integration built of degrees of freedom independent of the metric. There is no need to fine tune any bulk cosmological constant or the tension of the two (in the scenario described here) parallel branes to obtain zero cosmological constant, the only solutions are those with zero 4D cosmological constant. The two extra dimensions are compactified in a 'football' fashion and the branes lie on the two opposite poles of the compact 'football-shaped' sphere

  11. Vanishing cosmological constant in elementary particles theory

    International Nuclear Information System (INIS)

    Pisano, F.; Tonasse, M.D.

    1997-01-01

    The quest of a vanishing cosmological constant is considered in the simplest anomaly-free chiral gauge extension of the electroweak standard model where the new physics is limited to a well defined additional flavordynamics above the Fermi scale, namely up to a few TeVs by matching the gauge coupling constants at the electroweak scale, and with an extended Higgs structure. In contrast to the electroweak standard model, it is shown how the extended scalar sector of the theory allows a vanishing or a very small cosmological constant. the details of the cancellation mechanism are presented. At accessible energies the theory is indistinguishable from the standard model of elementary particles and it is in agreement with all existing data. (author). 32 refs

  12. Stability constants for silicate adsorbed to ferrihydrite

    DEFF Research Database (Denmark)

    Hansen, Hans Christian Bruun; Wetche, T.P.; Raulund-Rasmussen, Karsten

    1994-01-01

    Intrinsic surface acidity constants (K(a1)intr, K(a2)intr) and surface complexation constant for adsorption of orthosilicate onto synthetic ferrihydrite (K(Si) for the complex = FeOSi(OH)3) have been determined from acid/base titrations in 0.001-0.1 m NaClO4 electrolytes and silicate adsorption...... experiments in 0.01 m NaNO3 electrolyte (pH 3-6). The surface equilibrium constants were calculated according to the two-layer model by Dzombak & Morel (1990). Near equilibrium between protons/hydroxyls in solution and the ferrihydrite surface was obtained within minutes while equilibration with silicate...

  13. Derivation of the optical constants of anisotropic

    Science.gov (United States)

    Aronson, J. R.; Emslie, A. G.; Smith, E. M.; Strong, P. F.

    1985-07-01

    This report concerns the development of methods for obtaining the optical constants of anisotropic crystals of the triclinic and monoclinic systems. The principal method used, classical dispersion theory, is adapted to these crystal systems by extending the Lorentz line parameters to include the angles characterizing the individual resonances, and by replacing the dielectric constant by a dielectric tensor. The sample crystals are gypsium, orthoclase and chalcanthite. The derived optical constants are shown to be suitable for modeling the optical properties of particulate media in the infrared spectral region. For those materials where suitable size single crystals are not available, an extension of a previously used method is applied to alabaster, a polycrystalline material of the monoclinic crystal system.

  14. Effects of quantum entropy on bag constant

    International Nuclear Information System (INIS)

    Miller, D.E.; Tawfik, A.

    2012-01-01

    The effects of quantum entropy on the bag constant are studied at low temperatures and for small chemical potentials. The inclusion of the quantum entropy of the quarks in the equation of state provides the hadronic bag with an additional heat which causes a decrease in the effective latent heat inside the bag. We have considered two types of baryonic bags, Δ and Ω - . In both cases we have found that the bag constant without the quantum entropy almost does not change with temperature and quark chemical potential. The contribution from the quantum entropy to the equation of state clearly decreases the value of the bag constant. Furthermore, we construct states densities for quarks using the 'Thomas Fermi model' and take into consideration a thermal potential for the interaction. (author)

  15. The Cosmological Constant Problem (1/2)

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    I will review the cosmological constant problem as a serious challenge to our notion of naturalness in Physics. Weinberg’s no go theorem is worked through in detail. I review a number of proposals possibly including Linde's universe multiplication, Coleman's wormholes, the fat graviton, and SLED, to name a few. Large distance modifications of gravity are also discussed, with causality considerations pointing towards a global modification as being the most sensible option. The global nature of the cosmological constant problem is also emphasized, and as a result, the sequestering scenario is reviewed in some detail, demonstrating the cancellation of the Standard Model vacuum energy through a global modification of General Relativity.

  16. The Cosmological Constant Problem (2/2)

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    I will review the cosmological constant problem as a serious challenge to our notion of naturalness in Physics. Weinberg’s no go theorem is worked through in detail. I review a number of proposals possibly including Linde's universe multiplication, Coleman's wormholes, the fat graviton, and SLED, to name a few. Large distance modifications of gravity are also discussed, with causality considerations pointing towards a global modification as being the most sensible option. The global nature of the cosmological constant problem is also emphasized, and as a result, the sequestering scenario is reviewed in some detail, demonstrating the cancellation of the Standard Model vacuum energy through a global modification of General Relativity.

  17. Atomic weights: no longer constants of nature

    Science.gov (United States)

    Coplen, Tyler B.; Holden, Norman E.

    2011-01-01

    Many of us were taught that the standard atomic weights we found in the back of our chemistry textbooks or on the Periodic Table of the Chemical Elements hanging on the wall of our chemistry classroom are constants of nature. This was common knowledge for more than a century and a half, but not anymore. The following text explains how advances in chemical instrumentation and isotopic analysis have changed the way we view atomic weights and why they are no longer constants of nature

  18. Dendrimers bind antioxidant polyphenols and cisplatin drug.

    Directory of Open Access Journals (Sweden)

    Amine Abderrezak

    Full Text Available Synthetic polymers of a specific shape and size play major role in drug delivery systems. Dendrimers are unique synthetic macromolecules of nanometer dimensions with a highly branched structure and globular shape with potential applications in gene and drug delivery. We examine the interaction of several dendrimers of different compositions mPEG-PAMAM (G3, mPEG-PAMAM (G4 and PAMAM (G4 with hydrophilic and hydrophobic drugs cisplatin, resveratrol, genistein and curcumin at physiological conditions. FTIR and UV-visible spectroscopic methods as well as molecular modeling were used to analyse drug binding mode, the binding constant and the effects of drug complexation on dendrimer stability and conformation. Structural analysis showed that cisplatin binds dendrimers in hydrophilic mode via Pt cation and polymer terminal NH(2 groups, while curcumin, genistein and resveratrol are located mainly in the cavities binding through both hydrophobic and hydrophilic contacts. The overall binding constants of durg-dendrimers are ranging from 10(2 M(-1 to 10(3 M(-1. The affinity of dendrimer binding was PAMAM-G4>mPEG-PAMAM-G4>mPEG-PAMAM-G3, while the order of drug-polymer stability was curcumin>cisplatin>genistein>resveratrol. Molecular modeling showed larger stability for genisten-PAMAM-G4 (ΔG = -4.75 kcal/mol than curcumin-PAMAM-G4 ((ΔG = -4.53 kcal/mol and resveratrol-PAMAM-G4 ((ΔG = -4.39 kcal/mol. Dendrimers might act as carriers to transport hydrophobic and hydrophilic drugs.

  19. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri

    2012-07-01

    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  20. Pyramidatine (Z88) Sensitizes Vincristine-Resistant Human Oral Cancer (KB/VCR) Cells to Chemotherapeutic Agents by Inhibition of P-glycoprotein.

    Science.gov (United States)

    Liu, Zulong; Zhu, Hengrui; Qu, Shijin; Tang, Lisha; Cao, Lihuan; Yu, Wenbo; Yang, Xianmei; Jiang, Songmin; Zhu, Dayuan; Tan, Changheng; Yu, Long

    2018-01-01

    Multi-drug resistance (MDR) remains a major impediment in cancer therapy. A major goal for scientists is to discover more effective compounds that are able to circumvent MDR and simultaneously have minimal adverse side effects. In the present study, we aim to determine the anti-MDR effects of pyramidatine (Z88), a cinnamic acid-derived bisamide compound isolated from the leaves of Aglaia perviridis, on KB/VCR (vincristineresistant human oral cancer cells) and MCF-7/ADR (adriamycin-resistant human breast adenocarcinoma) cells. Cell viability and average resistant fold (RF) of Z88 were examined by Cell Counting Kit-8 (CCK-8) assay. Flow cytometry, western blot, RT-PCR, Rhodamine 123 accumulation assay and P-glycoprotein (P-gp) ATPase assay were used to demonstrate the anti-MDR activity and mechanism of Z88. The average RF of Z88 is 0.09 and 0.51 in KB/VCR and MCF-7/ADR cells. A CCK-8 assay showed that Z88 could enhance the cytotoxicity of VCR toward KB/VCR cells. A FACS analysis revealed that Z88 could enhance the VCR-induced apoptosis as well as G2/M arrest in a dose-dependent manner in KB/VCR cells. Western blot results showed that the expression levels of PARP, Bax, and cyclin B1 all increased after treatment with 0.2 µmol/L (µM) of VCR combined with 10 µM of Z88 for 24 h in KB/VCR cells. Z88 also could enhance the accumulation of rhodamine 123. Further studies showed that Z88 could inhibit the verapamil stimulated Pgp ATPase activity. Additionally, qPCR detection and western blot assays revealed that Z88 could decrease the expression of P-gp at both RNA and protein level. Z88 exerted potent anti-MDR activity in vitro and its mechanisms are associated with dualinhibition of the function and expression of P-gp. These findings encourage efforts to develop more effective reversal agents to circumvent MDR based on Z88. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  1. Glaucarubinone sensitizes KB cells to paclitaxel by inhibiting ABC transporters via ROS-dependent and p53-mediated activation of apoptotic signaling pathways.

    Science.gov (United States)

    Karthikeyan, Subburayan; Hoti, Sugeerappa Laxmanappa; Nazeer, Yasin; Hegde, Harsha Vasudev

    2016-07-05

    Multidrug resistance (MDR) is considered to be the major contributor to failure of chemotherapy in oral squamous cell carcinoma (SCC). This study was aimed to explore the effects and mechanisms of glaucarubinone (GLU), one of the major quassinoids from Simarouba glauca DC, in potentiating cytotoxicity of paclitaxel (PTX), an anticancer drug in KB cells. Our data showed that the administration of GLU pre-treatment significantly enhanced PTX anti-proliferative effect in ABCB1 over-expressing KB cells. The Rh 123 drug efflux studies revealed that there was a significant transport function inhibition by GLU-PTX treatment. Interestingly, it was also found that this enhanced anticancer efficacy of GLU was associated with PTX-induced cell arrest in the G2/M phase of cell cycle. Further, the combined treatment of GLU-PTX had significant decrease in the expression levels of P-gp, MRPs, and BCRP in resistant KB cells at both mRNA and protein levels. Furthermore, the combination treatments showed significant reactive oxygen species (ROS) production, chromatin condensation and reduced mitochondrial membrane potential in resistant KB cells. The results from DNA fragmentation analysis also demonstrated the GLU induced apoptosis in KB cells and its synergy with PTX. Importantly, GLU and/or PTX triggered apoptosis through the activation of pro-apoptotic proteins such as p53, Bax, and caspase-9. Our findings demonstrated for the first time that GLU causes cell death in human oral cancer cells via the ROS-dependent suppression of MDR transporters and p53-mediated activation of the intrinsic mitochondrial pathway of apoptosis. Additionally, the present study also focussed on investigation of the protective effect of GLU and combination drugs in human normal blood lymphocytes. Normal blood lymphocytes assay indicated that GLU is able to induce selective toxicity in cancer cells and in silico molecular docking studies support the choice of GLU as ABC inhibitor to enhance PTX efficacy

  2. Mimicking the cosmological constant: Constant curvature spherical solutions in a nonminimally coupled model

    International Nuclear Information System (INIS)

    Bertolami, Orfeu; Paramos, Jorge

    2011-01-01

    The purpose of this study is to describe a perfect fluid matter distribution that leads to a constant curvature region, thanks to the effect of a nonminimal coupling. This distribution exhibits a density profile within the range found in the interstellar medium and an adequate matching of the metric components at its boundary. By identifying this constant curvature with the value of the cosmological constant and superimposing the spherical distributions arising from different matter sources throughout the universe, one is able to mimic a large-scale homogeneous cosmological constant solution.

  3. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    Energy Technology Data Exchange (ETDEWEB)

    Botcheva K.; McCorkle S. R.; McCombie W. R.; Dunn J. J.; Anderson C. W.

    2011-12-15

    We report here genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands, in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIPseq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells.

  4. The expressions of NF-kb and TGFb-1 on odontoblast-like cells of human dental pulp injected with propolis extracts

    Directory of Open Access Journals (Sweden)

    Ira Widjiastuti

    2014-03-01

    Full Text Available Background: Propolis is known to have beneficial effects, namely anti- bacterial, anti-viral, anti-inflammatory, antioxidant, and immunomodulatory. Propolis extracts with anti-inflammatory properties are expected to be useful in treating inflamed pulp tissue with a diagnosis of reversible pulpitis. The inflammation of pulp tissue is caused by bacteria, namely Lactobacillus acidophilus. This research used odontoblast like cells derived from pulp tissue of human third molars. Odontoblast like cells exposed to Lactobacillus achidophilus were used as a model of proinflammatory cytokine signaling. This research examined the effects of propolis extracts on odontoblast like cells exposed to Lactobacillus acidophilus. Purpose: This research was aimed to determine the effectiveness of propolis extracts on the activities of odontoblast-like cells exposed to Lactobacillus acidophillus by measuring the expressions of NFkb and TGF- b1. Methods: First, pulp odontoblast cultures were derived from human dental pulp tissues of impacted third molars removed by using digestion method. Next, odontoblast-like cells exposed to inactive Lactobacillus acidophilus bacteria were given propolis extract. Finally, the activities of odontoblast-like cells were monitored by measuring the expressions of NF-kb and TGFb-1 with immunocytochemistry technique. Results: A decline NF-kb expression and on increase of TGFb-1 expression on odontoblast like cells exposed to inactive Lactobacillus acidophilus. Conclusion: Propolis extracts inhibit the expression of NF-kb, and increase the expression of TGF-b1 in pulp odontoblast-like cells exposed to inactive Lactobacillus acidophillus.Latar belakang: Propolis dilaporkan mempunyai efek menguntungkan yaitu bersifat anti bakteri, anti virus, anti inflamasi, anti oksidan, dan imunomodulator. Ekstrak propolis dengan sifat anti inflamasi diharapkan bermanfaat untuk mengobati jaringan pulpa yang mengalami inflamasi dengan diagnosis pulpitis

  5. Time constant of logarithmic creep and relaxation

    CSIR Research Space (South Africa)

    Nabarro, FRN

    2001-07-15

    Full Text Available length and hardness which vary logarithmically with time. For dimensional reasons, a logarithmic variation must involve a time constant tau characteristic of the process, so that the deformation is proportional to ln(t/tau). Two distinct mechanisms...

  6. The Nature of the Cosmological Constant Problem

    Science.gov (United States)

    Maia, M. D.; Capistrano, A. J. S.; Monte, E. M.

    General relativity postulates the Minkowski space-time as the standard (flat) geometry against which we compare all curved space-times and also as the gravitational ground state where particles, quantum fields and their vacua are defined. On the other hand, experimental evidences tell that there exists a non-zero cosmological constant, which implies in a deSitter ground state, which not compatible with the assumed Minkowski structure. Such inconsistency is an evidence of the missing standard of curvature in Riemann's geometry, which in general relativity manifests itself in the form of the cosmological constant problem. We show how the lack of a curvature standard in Riemann's geometry can be fixed by Nash's theorem on metric perturbations. The resulting higher dimensional gravitational theory is more general than general relativity, similar to brane-world gravity, but where the propagation of the gravitational field along the extra dimensions is a mathematical necessity, rather than a postulate. After a brief introduction to Nash's theorem, we show that the vacuum energy density must remain confined to four-dimensional space-times, but the cosmological constant resulting from the contracted Bianchi identity represents a gravitational term which is not confined. In this case, the comparison between the vacuum energy and the cosmological constant in general relativity does not make sense. Instead, the geometrical fix provided by Nash's theorem suggests that the vacuum energy density contributes to the perturbations of the gravitational field.

  7. A Memorandum Report: Physical Constants of MCE

    Science.gov (United States)

    2016-08-01

    the density and surface tension. In effect, this constant is a corrected molar volume = P = MS / = S / where P = Parachor M = molar volume ...3 3. Vapor Pressure of MCE Calculated from the Experimental Data by Method of Least Squares...values were obtained by averaging the determinations for each sample separately, and then averaging those values. **No average was calculated due to

  8. Study on electromagnetic constants of rotational bands

    International Nuclear Information System (INIS)

    Abdurazakov, A.A.; Adib, Yu.Sh.; Karakhodzhaev, A.K.

    1991-01-01

    Values of electromagnetic constant S and rotation bands of odd nuclei with Z=64-70 within the mass number change interval A=153-173 are determined. Values of γ-transition mixing parameter with M1+E2 multipolarity are presented. ρ parameter dependence on mass number A is discussed

  9. On the determination of the Hubble constant

    International Nuclear Information System (INIS)

    Gurzadyan, V.G.; Harutyunyan, V.V.; Kocharyan, A.A.

    1990-10-01

    The possibility of an alternative determination of the distance scale of the Universe and the Hubble constant based on the numerical analysis of the hierarchical nature of the large scale Universe (galaxies, clusters and superclusters) is proposed. The results of computer experiments performed by means of special numerical algorithms are represented. (author). 9 refs, 7 figs

  10. Dissociative electron attachment to ozone: rate constant

    International Nuclear Information System (INIS)

    Skalny, J.D.; Cicman, P.; Maerk, T.D.

    2002-01-01

    The rate constant for dissociative electron attachment to ozone has been derived over the energy range of 0-10 eV by using previously measured cross section data revisited here in regards to discrimination effect occurring during the extraction of ions. The obtained data for both possible channels exhibit the maximum at mean electron energies close to 1 eV. (author)

  11. Running coupling constants of the Luttinger liquid

    International Nuclear Information System (INIS)

    Boose, D.; Jacquot, J.L.; Polonyi, J.

    2005-01-01

    We compute the one-loop expressions of two running coupling constants of the Luttinger model. The obtained expressions have a nontrivial momentum dependence with Landau poles. The reason for the discrepancy between our results and those of other studies, which find that the scaling laws are trivial, is explained

  12. Constant force linear permanent magnet actuators

    NARCIS (Netherlands)

    Paulides, J.J.H.; Encica, L.; Meessen, K.J.; Lomonova, E.A.

    2009-01-01

    In applications, such as vibration isolation, gravity compensation, pick-and-place machines, etc., there is a need for (long-stroke) passive constant force actuators combined with tubular permanent magnet actuators to minimize the power consumption, hence, passively counteract the gravitational

  13. Lifetime of titanium filament at constant current

    International Nuclear Information System (INIS)

    Chou, T.S.; Lanni, C.

    1981-01-01

    Titanium Sublimation Pump (TSP) represents the most efficient and the least expensive method to produce Ultra High Vacuum (UHV) in storage rings. In ISABELLE, a proton storage accelerator under construction at Brookhaven National Laboratory, for example, TSP provides a pumping speed for hydrogen of > 2 x 10 6 l/s. Due to the finite life of titanium filaments, new filaments have to be switched in before the end of filament burn out, to ensure smooth operation of the accelerator. Therefore, several operational modes that can be used to activate the TSP were studied. The constant current mode is a convenient way of maintaining constant evaporating rate by increasing the power input while the filament diameter decreases as titanium evaporates. The filaments used in this experiment were standard Varian 916-0024 filaments made of Ti 85%, Mo 15% alloy. During their lifetime at a constant current of 48 amperes, the evaporation rate rose to a maximum at about 10% of their life and then flattened out to a constant value, 0.25 g/hr. The maximum evaporation rate occurs coincidently with the recrystallization of 74% Ti 26% Mo 2 from microstructure crystalline at higher titanium concentration to macrostructure crystalline at lower titanium concentration. As the macrocrystal grows, the slip plane develops at the grain boundary resulting in high resistance at the slip plane which will eventually cause the filament burn out due to local heating

  14. Derivation of the fine-structure constant

    International Nuclear Information System (INIS)

    Samec, A.

    1980-01-01

    The fine-structure constant is derived as a dynamical property of quantum electrodynamics. Single-particle solutions of the coupled Maxwell and Dirac equations have a physical charge spectrum. The solutions are used to construct lepton-and quark-like particles. The strong, weak, electromagnetic, and gravitational forces are described as the interactions of complex charges in multiple combinations

  15. Temperature-dependent binding of cyclosporine to an erythrocyte protein

    International Nuclear Information System (INIS)

    Agarwal, R.P.; Threatte, G.A.; McPherson, R.A.

    1987-01-01

    In this competitive binding assay to measure endogenous binding capacity for cyclosporine (CsA) in erythrocyte lysates, a fixed amount of [ 3 H]CsA plus various concentrations of unlabeled CsA is incubated with aliquots of a test hemolysate. Free CsA is then adsorbed onto charcoal and removed by centrifugation; CsA complexed with a cyclosporine-binding protein (CsBP) remains in the supernate. We confirmed the validity of this charcoal-separation mode of binding analysis by comparison with equilibrium dialysis. Scatchard plot analysis of the results at 4 degrees C yielded a straight line with slope corresponding to a binding constant of 1.9 X 10(7) L/mol and a saturation capacity of approximately 4 mumol per liter of packed erythrocytes. Similar analysis of binding data at 24 degrees C and 37 degrees C showed that the binding constant decreased with increasing temperature, but the saturation capacity did not change. CsBP was not membrane bound but appeared to be freely distributed within erythrocytes. 125 I-labeled CsA did not complex with the erythrocyte CsBP. Several antibiotics and other drugs did not inhibit binding between CsA and CsBP. These findings may explain the temperature-dependent uptake of CsA by erythrocytes in whole blood and suggest that measurement of CsBP in erythrocytes or lymphocytes may help predict therapeutic response or toxicity after administration of CsA

  16. Construction of Lines of Constant Density and Constant Refractive Index for Ternary Liquid Mixtures.

    Science.gov (United States)

    Tasic, Aleksandar Z.; Djordjevic, Bojan D.

    1983-01-01

    Demonstrates construction of density constant and refractive index constant lines in triangular coordinate system on basis of systematic experimental determinations of density and refractive index for both homogeneous (single-phase) ternary liquid mixtures (of known composition) and the corresponding binary compositions. Background information,…

  17. Melanin-binding radiopharmaceuticals

    International Nuclear Information System (INIS)

    Packer, S.; Fairchild, R.G.; Watts, K.P.; Greenberg, D.; Hannon, S.J.

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed

  18. Competitive protein binding assay

    International Nuclear Information System (INIS)

    Kaneko, Toshio; Oka, Hiroshi

    1975-01-01

    The measurement of cyclic GMP (cGMP) by competitive protein binding assay was described and discussed. The principle of binding assay was represented briefly. Procedures of our method by binding protein consisted of preparation of cGMP binding protein, selection of 3 H-cyclic GMP on market, and measurement procedures. In our method, binding protein was isolated from the chrysalis of silk worm. This method was discussed from the points of incubation medium, specificity of binding protein, the separation of bound cGMP from free cGMP, and treatment of tissue from which cGMP was extracted. cGMP existing in the tissue was only one tenth or one scores of cGMP, and in addition, cGMP competed with cGMP in binding with binding protein. Therefore, Murad's technique was applied to the isolation of cGMP. This method provided the measurement with sufficient accuracy; the contamination by cAMP was within several per cent. (Kanao, N.)

  19. Molecular equilibrium structures from experimental rotational constants and calculated vibration-rotation interaction constants

    DEFF Research Database (Denmark)

    Pawlowski, F; Jorgensen, P; Olsen, Jeppe

    2002-01-01

    A detailed study is carried out of the accuracy of molecular equilibrium geometries obtained from least-squares fits involving experimental rotational constants B(0) and sums of ab initio vibration-rotation interaction constants alpha(r)(B). The vibration-rotation interaction constants have been...... calculated for 18 single-configuration dominated molecules containing hydrogen and first-row atoms at various standard levels of ab initio theory. Comparisons with the experimental data and tests for the internal consistency of the calculations show that the equilibrium structures generated using Hartree......-Fock vibration-rotation interaction constants have an accuracy similar to that obtained by a direct minimization of the CCSD(T) energy. The most accurate vibration-rotation interaction constants are those calculated at the CCSD(T)/cc-pVQZ level. The equilibrium bond distances determined from these interaction...

  20. Assessment of the binding properties of granuloszint

    International Nuclear Information System (INIS)

    Schubiger, P.A.; Hasler, P.H.; Novak-Hofer, I.; Blaeuenstein, P.

    1989-01-01

    123 I-granuloszint (a murine monoclonal antibody - called AK-47 - against NCA-95 glycoprotein of granulocytes) has been proved to be a very convenient and successful radiopharmaceutical for visualizing infectious diseases. For a broad introduction in routine nuclear medicine it was necessary to optimize the labelling method and to determine in vitro exactly those biological and binding parameters which are relevant for an effective application in vivo. Binding to granulocytes has been shown to be specific and saturable (nonspecific binding about 10%) and is not via the Fc part of the antibody. The investigation of the binding properties of 125 I-labelled AK-47 gave the following results: Affinity constant 5x10 8 , 20,000-100,000 epitopes per granulocyte and an immunoreactivity of more than 90%. Labelling with 123 I reduced the immunoreactivity to 40%. The Lindmo method and immunoblotting are used as quality control to check the likely in vivo behaviour of the labelled antibody. There is a good correspondence between the results from the two methods. With our special labelling method and the different in vitro checks we have found a reliable way to control the production and to assure an optimal binding behaviour of 123 I-granuloszint. (orig.)

  1. Assessment of the binding properties of granuloszint

    Energy Technology Data Exchange (ETDEWEB)

    Schubiger, P.A.; Hasler, P.H.; Novak-Hofer, I.; Blaeuenstein, P.

    1989-09-01

    /sup 123/I-granuloszint (a murine monoclonal antibody - called AK-47 - against NCA-95 glycoprotein of granulocytes) has been proved to be a very convenient and successful radiopharmaceutical for visualizing infectious diseases. For a broad introduction in routine nuclear medicine it was necessary to optimize the labelling method and to determine in vitro exactly those biological and binding parameters which are relevant for an effective application in vivo. Binding to granulocytes has been shown to be specific and saturable (nonspecific binding about 10%) and is not via the Fc part of the antibody. The investigation of the binding properties of /sup 125/I-labelled AK-47 gave the following results: Affinity constant 5x10/sup 8/, 20,000-100,000 epitopes per granulocyte and an immunoreactivity of more than 90%. Labelling with /sup 123/I reduced the immunoreactivity to 40%. The Lindmo method and immunoblotting are used as quality control to check the likely in vivo behaviour of the labelled antibody. There is a good correspondence between the results from the two methods. With our special labelling method and the different in vitro checks we have found a reliable way to control the production and to assure an optimal binding behaviour of /sup 123/I-granuloszint. (orig.).

  2. Nuclear thyroid hormone receptors in rabbit heart: reduced triiodothyronine binding in atrium compared with ventricle

    International Nuclear Information System (INIS)

    Banerjee, S.K.; Ulrich, J.M.; Kaldor, G.J.

    1988-01-01

    Radiolabeled triiodothyronine (T3) binding to isolated nuclei was measured to compare the binding characteristics of the nuclear receptors in rabbit ventricular and atrial muscle cells. Scatchard analysis of the binding data yielded a maximum binding capacity of 170 +/- 20 fmol per mg DNA and apparent dissociation constant of 525 +/- 100 pM for ventricular nuclei. The binding capacity and the dissociation constant for the atrial muscle cell nuclei were 55 +/- 10 fmol per mg DNA and 500 +/- 75 pM, respectively. The results suggest that the binding capacity for T3 receptor in the atrium is considerably lower than that found in the ventricle. The reduced binding capacity of the T3 receptor in the atrium might reflect differences in the nuclear T3 receptors between ventricle and atrium

  3. Constant force extensional rheometry of polymer solutions

    DEFF Research Database (Denmark)

    Szabo, Peter; McKinley, Gareth H.; Clasen, Christian

    2012-01-01

    We revisit the rapid stretching of a liquid filament under the action of a constant imposed tensile force, a problem which was first considered by Matta and Tytus [J. Non-Newton. Fluid Mech. 35 (1990) 215–229]. A liquid bridge formed from a viscous Newtonian fluid or from a dilute polymer solution...... is first established between two cylindrical disks. The upper disk is held fixed and may be connected to a force transducer while the lower cylinder falls due to gravity. By varying the mass of the falling cylinder and measuring its resulting acceleration, the viscoelastic nature of the elongating fluid...... filament can be probed. In particular, we show that with this constant force pull (CFP) technique it is possible to readily impose very large material strains and strain rates so that the maximum extensibility of the polymer molecules may be quantified. This unique characteristic of the experiment...

  4. f(R) constant-roll inflation

    Energy Technology Data Exchange (ETDEWEB)

    Motohashi, Hayato [Universidad de Valencia-CSIC, Instituto de Fisica Corpuscular (IFIC), Valencia (Spain); Starobinsky, Alexei A. [L.D. Landau Institute for Theoretical Physics, RAS, Moscow (Russian Federation); National Research University Higher School of Economics, Moscow (Russian Federation)

    2017-08-15

    The previously introduced class of two-parametric phenomenological inflationary models in general relativity in which the slow-roll assumption is replaced by the more general, constant-roll condition is generalized to the case of f(R) gravity. A simple constant-roll condition is defined in the original Jordan frame, and exact expressions for a scalaron potential in the Einstein frame, for a function f(R) (in the parametric form) and for inflationary dynamics are obtained. The region of the model parameters permitted by the latest observational constraints on the scalar spectral index and the tensor-to-scalar ratio of primordial metric perturbations generated during inflation is determined. (orig.)

  5. Benjamin Constant. Libertad, democracia y pluralismo

    Directory of Open Access Journals (Sweden)

    Claudia Patricia Fonnegra Osorio

    2015-12-01

    Full Text Available A partir de un enfoque interpretativo, en este artículo se aborda por qué para Benjamin Constant la democracia solo puede darse en donde se presenta una relación necesaria entre la libertad entendida como defensa de los derechos individuales -libertad como independencia o negativa- y la libertad concebida como principio de la participación pública -libertad como autonomía o positiva-. Asimismo, se presenta la importancia que atribuye el autor a las tradiciones que dan vida a la configuración del universo cultural de un pueblo. Se concluye que en la obra de Constant se encuentra una clara defensa del Estado de derecho y del pluralismo, la cual puede iluminar la comprensión de los problemas políticos de la contemporaneidad.

  6. Varying constants, black holes, and quantum gravity

    International Nuclear Information System (INIS)

    Carlip, S.

    2003-01-01

    Tentative observations and theoretical considerations have recently led to renewed interest in models of fundamental physics in which certain 'constants' vary in time. Assuming fixed black hole mass and the standard form of the Bekenstein-Hawking entropy, Davies, Davis and Lineweaver have argued that the laws of black hole thermodynamics disfavor models in which the fundamental electric charge e changes. I show that with these assumptions, similar considerations severely constrain 'varying speed of light' models, unless we are prepared to abandon cherished assumptions about quantum gravity. Relaxation of these assumptions permits sensible theories of quantum gravity with ''varying constants,'' but also eliminates the thermodynamic constraints, though the black hole mass spectrum may still provide some restrictions on the range of allowable models

  7. Cosmological constant in the quantum multiverse

    International Nuclear Information System (INIS)

    Larsen, Grant; Nomura, Yasunori; Roberts, Hannes L. L.

    2011-01-01

    Recently, a new framework for describing the multiverse has been proposed which is based on the principles of quantum mechanics. The framework allows for well-defined predictions, both regarding global properties of the universe and outcomes of particular experiments, according to a single probability formula. This provides complete unification of the eternally inflating multiverse and many worlds in quantum mechanics. In this paper, we elucidate how cosmological parameters can be calculated in this framework, and study the probability distribution for the value of the cosmological constant. We consider both positive and negative values, and find that the observed value is consistent with the calculated distribution at an order of magnitude level. In particular, in contrast to the case of earlier measure proposals, our framework prefers a positive cosmological constant over a negative one. These results depend only moderately on how we model galaxy formation and life evolution therein.

  8. On determining dose rate constants spectroscopically

    International Nuclear Information System (INIS)

    Rodriguez, M.; Rogers, D. W. O.

    2013-01-01

    Purpose: To investigate several aspects of the Chen and Nath spectroscopic method of determining the dose rate constants of 125 I and 103 Pd seeds [Z. Chen and R. Nath, Phys. Med. Biol. 55, 6089–6104 (2010)] including the accuracy of using a line or dual-point source approximation as done in their method, and the accuracy of ignoring the effects of the scattered photons in the spectra. Additionally, the authors investigate the accuracy of the literature's many different spectra for bare, i.e., unencapsulated 125 I and 103 Pd sources. Methods: Spectra generated by 14 125 I and 6 103 Pd seeds were calculated in vacuo at 10 cm from the source in a 2.7 × 2.7 × 0.05 cm 3 voxel using the EGSnrc BrachyDose Monte Carlo code. Calculated spectra used the initial photon spectra recommended by AAPM's TG-43U1 and NCRP (National Council of Radiation Protection and Measurements) Report 58 for the 125 I seeds, or TG-43U1 and NNDC(2000) (National Nuclear Data Center, 2000) for 103 Pd seeds. The emitted spectra were treated as coming from a line or dual-point source in a Monte Carlo simulation to calculate the dose rate constant. The TG-43U1 definition of the dose rate constant was used. These calculations were performed using the full spectrum including scattered photons or using only the main peaks in the spectrum as done experimentally. Statistical uncertainties on the air kerma/history and the dose rate/history were ⩽0.2%. The dose rate constants were also calculated using Monte Carlo simulations of the full seed model. Results: The ratio of the intensity of the 31 keV line relative to that of the main peak in 125 I spectra is, on average, 6.8% higher when calculated with the NCRP Report 58 initial spectrum vs that calculated with TG-43U1 initial spectrum. The 103 Pd spectra exhibit an average 6.2% decrease in the 22.9 keV line relative to the main peak when calculated with the TG-43U1 rather than the NNDC(2000) initial spectrum. The measured values from three different

  9. Some Dynamical Effects of the Cosmological Constant

    Science.gov (United States)

    Axenides, M.; Floratos, E. G.; Perivolaropoulos, L.

    Newton's law gets modified in the presence of a cosmological constant by a small repulsive term (antigravity) that is proportional to the distance. Assuming a value of the cosmological constant consistent with the recent SnIa data (Λ~=10-52 m-2), we investigate the significance of this term on various astrophysical scales. We find that on galactic scales or smaller (less than a few tens of kpc), the dynamical effects of the vacuum energy are negligible by several orders of magnitude. On scales of 1 Mpc or larger however we find that the vacuum energy can significantly affect the dynamics. For example we show that the velocity data in the local group of galaxies correspond to galactic masses increased by 35% in the presence of vacuum energy. The effect is even more important on larger low density systems like clusters of galaxies or superclusters.

  10. Daylight calculations using constant luminance curves

    Energy Technology Data Exchange (ETDEWEB)

    Betman, E. [CRICYT, Mendoza (Argentina). Laboratorio de Ambiente Humano y Vivienda

    2005-02-01

    This paper presents a simple method to manually estimate daylight availability and to make daylight calculations using constant luminance curves calculated with local illuminance and irradiance data and the all-weather model for sky luminance distribution developed in the Atmospheric Science Research Center of the University of New York (ARSC) by Richard Perez et al. Work with constant luminance curves has the advantage that daylight calculations include the problem's directionality and preserve the information of the luminous climate of the place. This permits accurate knowledge of the resource and a strong basis to establish conclusions concerning topics related to the energy efficiency and comfort in buildings. The characteristics of the proposed method are compared with the method that uses the daylight factor. (author)

  11. Understanding fine structure constants and three generations

    International Nuclear Information System (INIS)

    Bennett, D.L.; Nielsen, H.B.

    1988-02-01

    We put forward a model inspired by random dynamics that relates the smallness of the gauge coupling constants to the number of generations being 'large'. The new element in the present version of our model is the appearance of a free parameter χ that is a measure of the (presumably relatively minor) importance of a term in the plaquette action proportional to the trace in the (1/6, 2, 3) representation of the Standard Model. Calling N gen the number of generations, the sets of allowed (N gen , χN gen )-pairs obtained by imposing the three measured coupling constant values of the Standard Model form three lines. In addition to finding that these lines cross at a single point (as needed for a consistent fit), the intersection occurs with surprising accuracy at the integer N gen = 3 (thereby predicting exactly three generations). It is also encouraging that the parameter χ turns out to be small and positive as expected. (orig.)

  12. Bardeen-Cooper-Schrieffer universal constants generalized

    International Nuclear Information System (INIS)

    Hazaimeh, A.H.

    1992-01-01

    Weak- and moderate-coupling BCS superconductivity theory is shown to admit a more general T c formula, wherein T c approaches zero somewhat faster than with the familiar BCS T c -formula. This theory leads to a departure from the universal behavior of the gap-to-T c ratio and is consistent with some recent empirical values for exotic superconductors. This ratio is smaller than the universal BCS value of 3.53 in a way which is consistent with weak electron-boson coupling. Similarly, other universal constants related to specific heat and critical magnetic field are modified. In this dissertation, The author investigates the latter constants for weak-coupling and moderate-coupling and carry out detailed comparisons with experimental data for the cuprates and with the corresponding predictions of strong-coupling theory. This effort is to elucidate the nature of these superconductors with regards to coupling strength within an electron-boson mechanism

  13. Multiphoton amplitude in a constant background field

    Science.gov (United States)

    Ahmad, Aftab; Ahmadiniaz, Naser; Corradini, Olindo; Kim, Sang Pyo; Schubert, Christian

    2018-01-01

    In this contribution, we present our recent compact master formulas for the multiphoton amplitudes of a scalar propagator in a constant background field using the worldline fomulation of quantum field theory. The constant field has been included nonperturbatively, which is crucial for strong external fields. A possible application is the scattering of photons by electrons in a strong magnetic field, a process that has been a subject of great interest since the discovery of astrophysical objects like radio pulsars, which provide evidence that magnetic fields of the order of 1012G are present in nature. The presence of a strong external field leads to a strong deviation from the classical scattering amplitudes. We explicitly work out the Compton scattering amplitude in a magnetic field, which is a process of potential relevance for astrophysics. Our final result is compact and suitable for numerical integration.

  14. Piezooptical constants of Rochelle salt crystals

    OpenAIRE

    V.Yo. Stadnyk; M.O. Romanyuk; V.Yu. Kurlyak; V.F.Vachulovych

    2000-01-01

    The influence of uniaxial mechanical pressure applied along the principal axes and the corresponding bisectors on the birefringent properties of Rochelle salt (RS) crystals are studied. The temperature (77-300 K) and spectral (300-700 nm) dependencies of the effective and absolute piezooptical constants of the RS crystals are calculated. The intercept of dispersion curves of is revealed in the region of the birefringence sign inversion. This testifies that the anizotropy of the piezooptical ...

  15. Simulated annealing with constant thermodynamic speed

    International Nuclear Information System (INIS)

    Salamon, P.; Ruppeiner, G.; Liao, L.; Pedersen, J.

    1987-01-01

    Arguments are presented to the effect that the optimal annealing schedule for simulated annealing proceeds with constant thermodynamic speed, i.e., with dT/dt = -(v T)/(ε-√C), where T is the temperature, ε- is the relaxation time, C ist the heat capacity, t is the time, and v is the thermodynamic speed. Experimental results consistent with this conjecture are presented from simulated annealing on graph partitioning problems. (orig.)

  16. A noteworthy dimensionless constant in gravitation theory

    International Nuclear Information System (INIS)

    Fayos, F.; Lobo, J.A.; Llanta, E.

    1986-01-01

    A simple problem of gravitation is studied classically and in the Schwarzchild framework. A relationship is found between the parameters that define the trajectories of two particles (the first in radial motion and the second in a circular orbit) which are initially together and meet again after one revolution of particle 2. Dimensional analysis is the clue to explain the appearance of a dimensionless constant in the Newtonian case. (author)

  17. Electromagnetic corrections to pseudoscalar decay constants

    Energy Technology Data Exchange (ETDEWEB)

    Glaessle, Benjamin Simon

    2017-03-06

    First principles Lattice quantum chromodynamics (LQCD) calculations enable the determination of low energy hadronic amplitudes. Precision LQCD calculations with relative errors smaller than approximately 1% require the inclusion of electromagnetic effects. We demonstrate that including (quenched) quantum electrodynamics effects in the LQCD calculation effects the values obtained for pseudoscalar decay constants in the per mille range. The importance of systematic effects, including finite volume effects and the charge dependence of renormalization and improvement coefficients, is highlighted.

  18. Cosmological Constant and the Final Anthropic Hypothesis

    OpenAIRE

    Cirkovic, Milan M.; Bostrom, Nick

    1999-01-01

    The influence of recent detections of a finite vacuum energy ("cosmological constant") on our formulation of anthropic conjectures, particularly the so-called Final Anthropic Principle is investigated. It is shown that non-zero vacuum energy implies the onset of a quasi-exponential expansion of our causally connected domain ("the universe") at some point in the future, a stage similar to the inflationary expansion at the very beginning of time. The transition to this future inflationary phase...

  19. Singlet axial constant from QCD sum rules

    International Nuclear Information System (INIS)

    Belitskij, A.V.; Teryaev, O.V.

    1995-01-01

    We analyze the singlet axial form factor of the proton for small momentum transferred in the framework of QCD sum rules using the interpolating nucleon current which explicitly accounts for the gluonic degrees of freedom. As the result we come to the quantitative prediction of the singlet axial constant. It is shown that the bilocal power corrections play the most important role in the analysis. 21 refs., 3 figs

  20. Lattice Paths and the Constant Term

    International Nuclear Information System (INIS)

    Brak, R; Essam, J; Osborn, J; Owczarek, A L; Rechnitzer, A

    2006-01-01

    We firstly review the constant term method (CTM), illustrating its combinatorial connections and show how it can be used to solve a certain class of lattice path problems. We show the connection between the CTM, the transfer matrix method (eigenvectors and eigenvalues), partial difference equations, the Bethe Ansatz and orthogonal polynomials. Secondly, we solve a lattice path problem first posed in 1971. The model stated in 1971 was only solved for a special case - we solve the full model

  1. Elastic constants from microscopic strain fluctuations

    Science.gov (United States)

    Sengupta; Nielaba; Rao; Binder

    2000-02-01

    Fluctuations of the instantaneous local Lagrangian strain epsilon(ij)(r,t), measured with respect to a static "reference" lattice, are used to obtain accurate estimates of the elastic constants of model solids from atomistic computer simulations. The measured strains are systematically coarse-grained by averaging them within subsystems (of size L(b)) of a system (of total size L) in the canonical ensemble. Using a simple finite size scaling theory we predict the behavior of the fluctuations as a function of L(b)/L and extract elastic constants of the system in the thermodynamic limit at nonzero temperature. Our method is simple to implement, efficient, and general enough to be able to handle a wide class of model systems, including those with singular potentials without any essential modification. We illustrate the technique by computing isothermal elastic constants of "hard" and "soft" disk triangular solids in two dimensions from Monte Carlo and molecular dynamics simulations. We compare our results with those from earlier simulations and theory.

  2. Emergent gravity in spaces of constant curvature

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez, Orlando; Haddad, Matthew [Department of Physics, University of Miami,1320 Campo Sano Ave, Coral Gables, FL 33146 (United States)

    2017-03-07

    In physical theories where the energy (action) is localized near a submanifold of a constant curvature space, there is a universal expression for the energy (or the action). We derive a multipole expansion for the energy that has a finite number of terms, and depends on intrinsic geometric invariants of the submanifold and extrinsic invariants of the embedding of the submanifold. This is the second of a pair of articles in which we try to develop a theory of emergent gravity arising from the embedding of a submanifold into an ambient space equipped with a quantum field theory. Our theoretical method requires a generalization of a formula due to by Hermann Weyl. While the first paper discussed the framework in Euclidean (Minkowski) space, here we discuss how this framework generalizes to spaces of constant sectional curvature. We focus primarily on anti de Sitter space. We then discuss how such a theory can give rise to a cosmological constant and Planck mass that are within reasonable bounds of the experimental values.

  3. Planck Constant Determination from Power Equivalence

    Science.gov (United States)

    Newell, David B.

    2000-04-01

    Equating mechanical to electrical power links the kilogram, the meter, and the second to the practical realizations of the ohm and the volt derived from the quantum Hall and the Josephson effects, yielding an SI determination of the Planck constant. The NIST watt balance uses this power equivalence principle, and in 1998 measured the Planck constant with a combined relative standard uncertainty of 8.7 x 10-8, the most accurate determination to date. The next generation of the NIST watt balance is now being assembled. Modification to the experimental facilities have been made to reduce the uncertainty components from vibrations and electromagnetic interference. A vacuum chamber has been installed to reduce the uncertainty components associated with performing the experiment in air. Most of the apparatus is in place and diagnostic testing of the balance should begin this year. Once a combined relative standard uncertainty of one part in 10-8 has been reached, the power equivalence principle can be used to monitor the possible drift in the artifact mass standard, the kilogram, and provide an accurate alternative definition of mass in terms of fundamental constants. *Electricity Division, Electronics and Electrical Engineering Laboratory, Technology Administration, U.S. Department of Commerce. Contribution of the National Institute of Standards and Technology, not subject to copyright in the U.S.

  4. The 253-kb inversion and deep intronic mutations in UNC13D are present in North American patients with familial hemophagocytic lymphohistiocytosis 3.

    Science.gov (United States)

    Qian, Yaping; Johnson, Judith A; Connor, Jessica A; Valencia, C Alexander; Barasa, Nathaniel; Schubert, Jeffery; Husami, Ammar; Kissell, Diane; Zhang, Ge; Weirauch, Matthew T; Filipovich, Alexandra H; Zhang, Kejian

    2014-06-01

    The mutations in UNC13D are responsible for familial hemophagocytic lymphohistiocytosis (FHL) type 3. A 253-kb inversion and two deep intronic mutations, c.118-308C > T and c.118-307G > A, in UNC13D were recently reported in European and Asian FHL3 patients. We sought to determine the prevalence of these three non-coding mutations in North American FHL patients and evaluate the significance of examining these new mutations in genetic testing. We performed DNA sequencing of UNC13D and targeted analysis of these three mutations in 1,709 North American patients with a suspected clinical diagnosis of hemophagocytic lymphohistiocytosis (HLH). The 253-kb inversion, intronic mutations c.118-308C > T and c.118-307G > A were found in 11, 15, and 4 patients, respectively, in which the genetic basis (bi-allelic mutations) explained 25 additional patients. Taken together with previously diagnosed FHL3 patients in our HLH patient registry, these three non-coding mutations were found in 31.6% (25/79) of the FHL3 patients. The 253-kb inversion, c.118-308C > T and c.118-307G > A accounted for 7.0%, 8.9%, and 1.3% of mutant alleles, respectively. Significantly, eight novel mutations in UNC13D are being reported in this study. To further evaluate the expression level of the newly reported intronic mutation c.118-307G > A, reverse transcription PCR and Western blot analysis revealed a significant reduction of both RNA and protein levels suggesting that the c.118-307G > A mutation affects transcription. These specified non-coding mutations were found in a significant number of North American patients and inclusion of them in mutation analysis will improve the molecular diagnosis of FHL3. © 2014 Wiley Periodicals, Inc.

  5. Putative dopamine agonist (KB220Z) attenuates lucid nightmares in PTSD patients: role of enhanced brain reward functional connectivity and homeostasis redeeming joy.

    Science.gov (United States)

    McLaughlin, Thomas; Blum, Kenneth; Oscar-Berman, Marlene; Febo, Marcelo; Agan, Gozde; Fratantonio, James L; Simpatico, Thomas; Gold, Mark S

    2015-06-01

    Lucid dreams are frequently pleasant and training techniques have been developed to teach dreamers to induce them. In addition, the induction of lucid dreams has also been used as a way to ameliorate nightmares. On the other hand, lucid dreams may be associated with psychiatric conditions, including Post-Traumatic Stress Disorder (PTSD) and Reward Deficiency Syndrome-associated diagnoses. In the latter conditions, lucid dreams can assume an unpleasant and frequently terrifying character. We present two cases of dramatic alleviation of terrifying lucid dreams in patients with PTSD. In the first case study, a 51-year-old, obese woman, diagnosed with PTSD and depression, had attempted suicide and experienced terrifying lucid nightmares linked to sexual/physical abuse from early childhood by family members including her alcoholic father. Her vivid "bad dreams" remained refractory in spite of 6 months of treatment with Dialectical Behavioral Therapy (DBT) and standard pharmaceutical agents which included prazosin, clonidie and Adderall. The second 39-year-old PTSD woman patient had also suffered from lucid nightmares. The medication visit notes reveal changes in the frequency, intensity and nature of these dreams after the complex putative dopamine agonist KB220Z was added to the first patient's regimen. The patient reported her first experience of an extended period of happy dreams. The second PTSD patient, who had suffered from lucid nightmares, was administered KB220Z to attenuate methadone withdrawal symptoms and incidentally reported dreams full of happiness and laughter. These cases are discussed with reference to the known effects of KB220Z including enhanced dopamine homeostasis and functional connectivity of brain reward circuitry in rodents and humans. Their understanding awaits intensive investigation involving large-population, double-blinded studies.

  6. Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

    Science.gov (United States)

    Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

    1998-08-01

    Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

  7. Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

    Science.gov (United States)

    Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

    2016-03-14

    Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

  8. In vitro binding of germanium to proteins of rice shoots

    International Nuclear Information System (INIS)

    Matsumoto, Hideaki; Takahashi, Eiichi

    1976-01-01

    The possibility of in vitro binding between proteins of rice shoots and germanium (Ge) was investigated. The proteins in mixtures of aqueous extracts of rice shoots and radioactive germanium ( 68 GeO 2 ) were fractionated. The binding of radioactivity to the proteins was observed even after 5 successive fractionation steps from the original mixtures. At the final fractionation step using polyacrylamide gel electrophoresis, a constant proportionality between protein concentration and associated radioactivity was found in most samples although not all. These results indicate that the binding of 68 Ge to proteins is not due to the simple adsorption by proteins. (auth.)

  9. Imipramine binding in subpopulations of normal human blood platelets

    International Nuclear Information System (INIS)

    Arora, R.C.; Meltzer, H.Y.

    1984-01-01

    Imipramine binding was studied in platelet membranes isolated with different proportions of heavy (young) and light (old) platelets. The B/sub max/, a measure of the number of binding sites, was greater in the heavier platelets than in the light platelets. However, the dissociation constant K/sub d/ (a reflection of the affinity of imipramine binding) was greater in the lighter platelets compared to the heavy platelets. These results indicate that differences in K/sub d/ and B/sub max/ in particular membrane preparation, could be due to the differences in the relative proportion of heavy and light platelets

  10. Constant leverage and constant cost of capital : A common knowledge half-truth

    OpenAIRE

    Vélez Pareja, Ignacio; Ibragimov, Rauf; Tham , Joseph

    2008-01-01

    Un enfoque típico para valorar flujos de caja finitos es suponer que el endeudamiento es constante (generalmente como un endeudamiento objetivo o deseado) y que por tanto, el costo del patrimonio, Ke y el costo promedio ponderado de capital CPPC, también son constantes. Para los flujos de caja perpetuos, y con el costo de la deuda, Kd como la tasa de descuento para el ahorro en impuestos o escudo fiscal, Ke y el CPPC aplicado al flujo de caja libre FCL son constantes si el endeudamiento es co...

  11. Fine Mapping Suggests that the Goat Polled Intersex Syndrome and the Human Blepharophimosis Ptosis Epicanthus Syndrome Map to a 100-kb Homologous Region

    OpenAIRE

    Schibler, Laurent; Cribiu, Edmond P.; Oustry-Vaiman, Anne; Furet, Jean-Pierre; Vaiman, Daniel

    2000-01-01

    To clone the goat Polled Intersex Syndrome (PIS) gene(s), a chromosome walk was performed from six entry points at 1q43. This enabled 91 BACs to be recovered from a recently constructed goat BAC library. Six BAC contigs of goat chromosome 1q43 (ICC1–ICC6) were thus constructed covering altogether 4.5 Mb. A total of 37 microsatellite sequences were isolated from this 4.5-Mb region (16 in this study), of which 33 were genotyped and mapped. ICC3 (1500 kb) was shown by genetic analysis to encompa...

  12. Identification of a 3.0-kb Major Recombination Hotspot in Patients with Sotos Syndrome Who Carry a Common 1.9-Mb Microdeletion

    Science.gov (United States)

    Visser, Remco; Shimokawa, Osamu; Harada, Naoki; Kinoshita, Akira; Ohta, Tohru; Niikawa, Norio; Matsumoto, Naomichi

    2005-01-01

    Sotos syndrome (SoS) is a congenital dysmorphic disorder characterized by overgrowth in childhood, distinctive craniofacial features, and mental retardation. Haploinsufficiency of the NSD1 gene owing to either intragenic mutations or microdeletions is known to be the major cause of SoS. The common ∼2.2-Mb microdeletion encompasses the whole NSD1 gene and neighboring genes and is flanked by low-copy repeats (LCRs). Here, we report the identification of a 3.0-kb major recombination hotspot within these LCRs, in which we mapped deletion breakpoints in 78.7% (37/47) of patients with SoS who carry the common microdeletion. The deletion size was subsequently refined to 1.9 Mb. Sequencing of breakpoint fragments from all 37 patients revealed junctions between a segment of the proximal LCR (PLCR-B) and the corresponding region of the distal LCR (DLCR-2B). PLCR-B and DLCR-2B are the only directly oriented regions, whereas the remaining regions of the PLCR and DLCR are in inverted orientation. The PLCR, with a size of 394.0 kb, and the DLCR, with a size of of 429.8 kb, showed high overall homology (∼98.5%), with an increased sequence similarity (∼99.4%) within the 3.0-kb breakpoint cluster. Several recombination-associated motifs were identified in the hotspot and/or its vicinity. Interestingly, a 10-fold average increase of a translin motif, as compared with the normal distribution within the LCRs, was recognized. Furthermore, a heterozygous inversion of the interval between the LCRs was detected in all fathers of the children carrying a deletion in the paternally derived chromosome. The functional significance of these findings remains to be elucidated. Segmental duplications of the primate genome play a major role in chromosomal evolution. Evolutionary study showed that the duplication of the SoS LCRs occurred 23.3–47.6 million years ago, before the divergence of Old World monkeys. PMID:15580547

  13. KB-R7943 reduces 4-aminopyridine-induced epileptiform activity in adult rats after neuronal damage induced by neonatal monosodium glutamate treatment.

    Science.gov (United States)

    Hernandez-Ojeda, Mariana; Ureña-Guerrero, Monica E; Gutierrez-Barajas, Paola E; Cardenas-Castillo, Jazmin A; Camins, Antoni; Beas-Zarate, Carlos

    2017-05-09

    Neonatal monosodium glutamate (MSG) treatment triggers excitotoxicity and induces a degenerative process that affects several brain regions in a way that could lead to epileptogenesis. Na + /Ca 2+ exchangers (NCX1-3) are implicated in Ca 2+ brain homeostasis; normally, they extrude Ca 2+ to control cell inflammation, but after damage and in epilepsy, they introduce Ca 2+ by acting in the reverse mode, amplifying the damage. Changes in NCX3 expression in the hippocampus have been reported immediately after neonatal MSG treatment. In this study, the expression level of NCX1-3 in the entorhinal cortex (EC) and hippocampus (Hp); and the effects of blockade of NCXs on the seizures induced by 4-Aminopyridine (4-AP) were analysed in adult rats after neonatal MSG treatment. KB-R7943 was applied as NCXs blocker, but is more selective to NCX3 in reverse mode. Neonatal MSG treatment was applied to newborn male rats at postnatal days (PD) 1, 3, 5, and 7 (4 g/kg of body weight, s.c.). Western blot analysis was performed on total protein extracts from the EC and Hp to estimate the expression level of NCX1-3 proteins in relative way to the expression of β-actin, as constitutive protein. Electrographic activity of the EC and Hp were acquired before and after intracerebroventricular (i.c.v.) infusion of 4-AP (3 nmol) and KB-R7943 (62.5 pmol), alone or in combination. All experiments were performed at PD60. Behavioural alterations were also recorder. Neonatal MSG treatment significantly increased the expression of NCX3 protein in both studied regions, and NCX1 protein only in the EC. The 4-AP-induced epileptiform activity was significantly higher in MSG-treated rats than in controls, and KB-R7943 co-administered with 4-AP reduced the epileptiform activity in more prominent way in MSG-treated rats than in controls. The long-term effects of neonatal MSG treatment include increases on functional expression of NCXs (mainly of NCX3) in the EC and Hp, which seems to contribute to

  14. Photochemical Microscale Electrophoresis Allows Fast Quantification of Biomolecule Binding.

    Science.gov (United States)

    Möller, Friederike M; Kieß, Michael; Braun, Dieter

    2016-04-27

    Intricate spatiotemporal patterns emerge when chemical reactions couple to physical transport. We induce electrophoretic transport by a confined photochemical reaction and use it to infer the binding strength of a second, biomolecular binding reaction under physiological conditions. To this end, we use the photoactive compound 2-nitrobenzaldehyde, which releases a proton upon 375 nm irradiation. The charged photoproducts locally perturb electroneutrality due to differential diffusion, giving rise to an electric potential Φ in the 100 μV range on the micrometer scale. Electrophoresis of biomolecules in this field is counterbalanced by back-diffusion within seconds. The biomolecule concentration is measured by fluorescence and settles proportionally to exp(-μ/D Φ). Typically, binding alters either the diffusion coefficient D or the electrophoretic mobility μ. Hence, the local biomolecule fluorescence directly reflects the binding state. A fit to the law of mass action reveals the dissociation constant of the binding reaction. We apply this approach to quantify the binding of the aptamer TBA15 to its protein target human-α-thrombin and to probe the hybridization of DNA. Dissociation constants in the nanomolar regime were determined and match both results in literature and in control experiments using microscale thermophoresis. As our approach is all-optical, isothermal and requires only nanoliter volumes at nanomolar concentrations, it will allow for the fast screening of biomolecule binding in low volume multiwell formats.

  15. In vitro DNA binding studies of Aspartame, an artificial sweetener.

    Science.gov (United States)

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

    2013-03-05

    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Kinetics of fatty acid binding ability of glycated human serum albumin

    Indian Academy of Sciences (India)

    Unknown

    1-anilino-8-naphtharene sulphonic acid; diabetes, dissociation constant; fatty acids binding; fluorescence displacement ... thought to play an important role in the complications of ..... concentration of serum fatty acid level in type 2 diabetes,.

  17. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  18. Determination of protonation constants of hydroquinone and stability constants of Th(IV) hydroquinone complex

    International Nuclear Information System (INIS)

    Sawant, R.M.; Ramakumar, K.L.; Sharma, R.S.

    2003-01-01

    Protonation constants of hydroquinone and stability constants of thorium hydroquinone complexes were determined in 1 M NaClO 4 medium at 25 ± 0.5 degC, by varying concentration of thorium, using pH titration technique. Protonation constants of hydroquinone (β 1H = [HQ]/[H][Q] and β 2H = [H 2 Q]/[H] 2 [Q]) were found to be β 1H = 11.404 ± 0.014 and β 2H = 21.402 ± 0.012. The analysis of titration data of thorium-hydroquinone system appears to indicate the formation of species Th(H 2 Q) 3 (OH) and Th(H 2 O) 4 (OH). Equilibrium constants obtained for these species are -log β 13-I = 48.51 ± 0.67 and -log β 14-1 64.86 ± 1.25 respectively which are not reported in the literature. (author)

  19. SHBG (Sex Hormone Binding Globulin)

    Science.gov (United States)

    ... Links Patient Resources For Health Professionals Subscribe Search Sex Hormone Binding Globulin (SHBG) Send Us Your Feedback ... As Testosterone-estrogen Binding Globulin TeBG Formal Name Sex Hormone Binding Globulin This article was last reviewed ...

  20. Constant load and constant displacement stress corrosion in simulated water reactor environments

    International Nuclear Information System (INIS)

    Lloyd, G.J.

    1987-02-01

    The stress corrosion behaviour of selected water reactor constructional materials, as determined by constant load or constant displacement test techniques, is reviewed. Experimental results obtained using a very wide range of conditions have been collected in a form for easy reference. A discussion is given of some apparent trends in these data. The possible reasons for these trends are considered together with a discussion of how the observed discrepancies may be resolved. (author)

  1. Determination of intrinsic equilibrium constants at an alumina/electrolyte interface

    Directory of Open Access Journals (Sweden)

    SLOBODAN K. MILONJIC

    2004-12-01

    Full Text Available Intrinsic ionization and complexation constants at an alumina/electrolyte interface were studied by the site binding model, while the sorption of alkali cations from aqueous solutions was interpreted by the triple-layer model. The surface properties of alumina were investigated by the potentiometric acid-base titration method. The point of zero charge (pHpzc of alumina obtained by this method was found to be 7.2. The obtained mean values of the intrinsic protonation and ionization constants of the surface hydroxyl groups and the intrinsic surface complexation constant, in different electrolytes, are pKinta1 = 4.4, pKinta2 = 9.6 and pKintM+ = 9.5, respectively.

  2. CONSTANT LEVERAGE AND CONSTANT COST OF CAPITAL: A COMMON KNOWLEDGE HALF-TRUTH

    Directory of Open Access Journals (Sweden)

    IGNACIO VÉLEZ-PAREJA

    2008-01-01

    Full Text Available Un enfoque típico para valorar flujos de caja finitos es suponer que el endeudamiento es constante (generalmente como un endeudamiento objetivo o deseado y que por tanto, el costo del patrimonio, Ke y el costo promedio ponderado de capital CPPC, también son constantes. Para los flujos de caja perpetuos, y con el costo de la deuda, Kd como la tasa de descuento para el ahorro en impuestos o escudo fiscal, Ke y el CPPC aplicado al flujo de caja libre FCL son constantes si el endeudamiento es constante. Sin embargo esto no es verdad para los flujos de caja finitos. En este documento mostramos que para flujos de caja finitos, Ke y por lo tanto el CPPC dependen de la tasa de descuento que se utiliza para valorar el ahorro en impuestos, AI y según lo esperado, Ke y el CPPC no son constantes con Kd como la tasa de descuento para el ahorro en impuestos, aunque el endeudamiento sea constante. Ilustramos esta situación con un ejemplo simple. Analizamos cinco métodos: el flujo de caja descontado, FCD, usando APV, el FCD y la formulación tradicional y general del CPPC, el valor presente del flujo de caja del accionista, FCA más deuda y el flujo de caja de capital, FCC.

  3. Inflation with a smooth constant-roll to constant-roll era transition

    Science.gov (United States)

    Odintsov, S. D.; Oikonomou, V. K.

    2017-07-01

    In this paper, we study canonical scalar field models, with a varying second slow-roll parameter, that allow transitions between constant-roll eras. In the models with two constant-roll eras, it is possible to avoid fine-tunings in the initial conditions of the scalar field. We mainly focus on the stability of the resulting solutions, and we also investigate if these solutions are attractors of the cosmological system. We shall calculate the resulting scalar potential and, by using a numerical approach, we examine the stability and attractor properties of the solutions. As we show, the first constant-roll era is dynamically unstable towards linear perturbations, and the cosmological system is driven by the attractor solution to the final constant-roll era. As we demonstrate, it is possible to have a nearly scale-invariant power spectrum of primordial curvature perturbations in some cases; however, this is strongly model dependent and depends on the rate of the final constant-roll era. Finally, we present, in brief, the essential features of a model that allows oscillations between constant-roll eras.

  4. TASI Lectures on the cosmological constant

    Energy Technology Data Exchange (ETDEWEB)

    Bousso, Raphael; Bousso, Raphael

    2007-08-30

    The energy density of the vacuum, Lambda, is at least 60 orders of magnitude smaller than several known contributions to it. Approaches to this problem are tightly constrained by data ranging from elementary observations to precision experiments. Absent overwhelming evidence to the contrary, dark energy can only be interpreted as vacuum energy, so the venerable assumption that Lambda=0 conflicts with observation. The possibility remains that Lambda is fundamentally variable, though constant over large spacetime regions. This can explain the observed value, but only in a theory satisfying a number of restrictive kinematic and dynamical conditions. String theory offers a concrete realization through its landscape of metastable vacua.

  5. Theoretical isochrones with decreasing gravitational constant

    International Nuclear Information System (INIS)

    Vandenberg, D.A.

    1976-01-01

    Van Flandern has postulated a variation of the gravitational constant at the rate approximately -8 x 10 -11 /yr. This variation, consistent with Hoyle-Narlikar and Dirac cosmologies, has been assumed in the computation of a 5 x 10 9 yr theoretical isochrone. Present results show that, even for this age, theory predicts a cluster turn-off luminosity approximately 0.5 to 1.0 mag fainter than the observed turn-offs of globular clusters. Unsatisfactory agreement between theoretical and observed luminosity functions is also indicated. (author)

  6. Quantum black holes and Planck's constant

    International Nuclear Information System (INIS)

    Ross, D.K.

    1987-01-01

    It is shown that the Planck-scale black holes of quantum gravity must obey a consistency condition relating Planck's constant to the integral of the mass of the black holes over time, if the usual path integral formulation of quantum mechanics is to make sense on physical spacetime. It is also shown, using time-dependent perturbation theory in ordinary quantum mechanics, that a massless particle will not propagate on physical spacetime with the black holes present unless the same condition is met. (author)

  7. Constant displacement rate testing at elevated temperatures

    International Nuclear Information System (INIS)

    Pepe, J.J.; Gonyea, D.C.

    1989-01-01

    A short time test has been developed which is capable of determining the long time notch sensitivity tendencies of CrMoV rotor forging materials. This test is based on Constant Displacement Rate (CDR) testing of a specific notch bar specimen at 1200 0 F at 2 mils/in/hour displacement rate. These data were correlated to conventional smooth and notch bar rupture behavior for a series of CrMoV materials with varying long time ductility tendencies. The purpose of this paper is to describe the details of this new test procedure and some of the relevant mechanics of material information generated during its development

  8. Radiation balances and the solar constant

    Science.gov (United States)

    Crommelynck, D.

    1981-01-01

    The radiometric concepts are defined in order to consider various types of radiation balances and relate them to the diabetic form of the energy balance. Variability in space and time of the components of the radiation field are presented. A specific concept for sweeping which is tailored to the requirements is proposed. Finally, after establishing the truncated character of the present knowledge of the radiation balance. The results of the last observations of the solar constant are given. Ground and satellite measurement techniques are discussed.

  9. O(4) texture with a cosmological constant

    International Nuclear Information System (INIS)

    Cho, Inyong

    2002-01-01

    We investigate O(4) textures in a background with a positive cosmological constant. We find static solutions which comove with the expanding background. There exists a solution in which the scalar field is regular at the horizon. This solution has a noninteger winding number smaller than 1. There also exist solutions in which scalar-field derivatives are singular at the horizon. Such solutions can complete one winding within the horizon. If the winding number is larger than some critical value, static solutions including the regular one are unstable under perturbations

  10. Can the cosmological constant undergo abrupt changes?

    CERN Document Server

    Cabo-Montes de Oca, Alejandro; Rosabal, A; Cabo, Alejandro; Garcia-Chung, Alejandro; Rosabal, Alejandro

    2005-01-01

    The existence of a simple spherically symmetric and static solution of the Einstein equations in the presence of a cosmological constant vanishing outside a definite value of the radial distance is investigated. A particular succession of field configurations, which are solutions of the Einstein equations in the presence of the considered cosmological term and auxiliary external sources, is constructed. Then, it is shown that the associated succession of external sources tend to zero in the sense of the generalized functions. The type of weak solution that is found becomes the deSitter homogeneous space-time for the interior region, and the Schwartzschild space in the outside zone.

  11. The Boltzmann constant from a snifter

    International Nuclear Information System (INIS)

    Tyukodi, B; Sárközi, Zs; Néda, Z; Tunyagi, A; Györke, E

    2012-01-01

    Evaporation of a small glass of ethylic alcohol is studied both experimentally and through an elementary thermal physics approach. For a cylindrical beaker and no air flow in the room, a simple quadratic relation is found between the evaporation time and the mass of evaporated liquid. This problem and the obtained results offer excellent possibilities for simple student experiments and for testing basic principles of thermal physics. As an example, we use the obtained results for estimating the value of the Boltzmann constant from evaporation experiments. (paper)

  12. Asymptotics with a positive cosmological constant II

    Science.gov (United States)

    Kesavan, Aruna; Ashtekar, Abhay; Bonga, Beatrice

    2015-04-01

    The study of isolated systems has been vastly successful in the context of vanishing cosmological constant, Λ = 0 . However, there is no physically useful notion of asymptotics for the universe we inhabit with Λ > 0 . This means that presently there is no fundamental understanding of gravitational waves in our own universe. The full non-linear framework is still under development, but some interesting results at the linearized level have been obtained. In particular, I will discuss the quadrupole formula for gravitational radiation and its implications.

  13. Isolation of a 97-kb minimal essential MHC B locus from a new reverse-4D BAC library of the golden pheasant.

    Directory of Open Access Journals (Sweden)

    Qing Ye

    Full Text Available The bacterial artificial chromosome (BAC system is widely used in isolation of large genomic fragments of interest. Construction of a routine BAC library requires several months for picking clones and arraying BACs into superpools in order to employ 4D-PCR to screen positive BACs, which might be time-consuming and laborious. The major histocompatibility complex (MHC is a cluster of genes involved in the vertebrate immune system, and the classical avian MHC-B locus is a minimal essential one, occupying a 100-kb genomic region. In this study, we constructed a more effective reverse-4D BAC library for the golden pheasant, which first creates sub-libraries and then only picks clones of positive sub-libraries, and identified several MHC clones within thirty days. The full sequencing of a 97-kb reverse-4D BAC demonstrated that the golden pheasant MHC-B locus contained 20 genes and showed good synteny with that of the chicken. The notable differences between these two species were the numbers of class II B loci and NK genes and the inversions of the TAPBP gene and the TAP1-TAP2 region. Furthermore, the inverse TAP2-TAP1 was unique in the golden pheasant in comparison with that of chicken, turkey, and quail. The newly defined genomic structure of the golden pheasant MHC will give an insight into the evolutionary history of the avian MHC.

  14. Early Intervention of Intravenous KB220IV- Neuroadaptagen Amino-Acid Therapy (NAAT)™ Improves Behavioral Outcomes in a Residential Addiction Treatment Program: A Pilot Study

    Science.gov (United States)

    Miller, Merlene; Chen, Amanda LC; Stokes, Stan D.; Silverman, Susan; Bowirrat, Abdalla; Manka, Matthew; Manka, Debra; Miller, David K.; Perrine, Kenneth; Chen, Thomas JH; Bailey, John A.; Downs, William; Waite, Roger L.; Madigan, Margaret A.; Braverman, Eric R.; Damle, Uma; Kerner, Mallory; Giordano, John; Morse, Siobhan; Oscar-Berman, Marlene; Barh, Debmalya; Blum, Kenneth

    2014-01-01

    Substance use disorders (SUD) are inheritable and the culprit is hypodopaminergic function regulated by reward genes. We evaluated a natural dopaminergic agonist; KB220 intravenous (IV) and oral variants, to improve dopaminergic function in SUD. Our pilot experiment found a significant reduction of chronic symptoms, measured by the Chronic Abstinence Symptom Severity (CASS) Scale. The combined group (IV and oral) did significantly better than the oral-only group over the first week and 30-day follow-up period. Next, the combination was given to129 subjects and three factors; Emotion, Somatic, and Impaired Cognition, with eigenvalues greater than one were extracted for baseline CASS-Revised (CASS-R) variables. Paired sample t-tests for pre and post-treatment scales showed significant declines (p = .00001) from pre- to post-treatment: t = 19.1 for Emotion, t = 16.1 for Somatic, and t = 14.9 for Impaired Cognition. In a two-year follow-up of 23 subjects who underwent KB220IV therapy (at least five IV treatments over seven days) plus orals for 30+ days: 21 (91%) were sober at six months, 19 (82%) having no relapse; 19 (82%) were sober at one year, 18 (78%) having no relapse; and 21 (91%) were sober two-years post-treatment, 16 (70%) having no relapse. We await additional research and advise caution in interpreting these encouraging results. PMID:23457891

  15. The interaction of parsing rules and argument – Predicate constructions: implications for the structure of the Grammaticon in FunGramKB

    Directory of Open Access Journals (Sweden)

    María del Carmen Fumero Pérez

    2017-07-01

    Full Text Available The Functional Grammar Knowledge Base (FunGramKB, (Periñán-Pascual and Arcas-Túnez 2010 is a multipurpose lexico-conceptual knowledge base designed to be used in different Natural Language Processing (NLP tasks. It is complemented with the ARTEMIS (Automatically Representing Text Meaning via an Interlingua–based System application, a parsing device linguistically grounded on Role and Reference Grammar (RRG that transduces natural language fragments into their corresponding grammatical and semantic structures. This paper unveils the different phases involved in its parsing routine, paying special attention to the treatment of argumental constructions. As an illustrative case, we will follow all the steps necessary to effectively parse a For-Benefactive structure within ARTEMIS. This methodology will reveal the necessity to distinguish between Kernel constructs and L1-constructions, since the latter involve a modification of the lexical template of the verb. Our definition of L1-constructions leads to the reorganization of the catalogue of FunGramKB L1-constructions, formerly based on Levin’s (1993 alternations. Accordingly, a rearrangement of the internal configuration of the L1-Constructicon within the Grammaticon is proposed.

  16. The human interactome knowledge base (hint-kb): An integrative human protein interaction database enriched with predicted protein–protein interaction scores using a novel hybrid technique

    KAUST Repository

    Theofilatos, Konstantinos A.

    2013-07-12

    Proteins are the functional components of many cellular processes and the identification of their physical protein–protein interactions (PPIs) is an area of mature academic research. Various databases have been developed containing information about experimentally and computationally detected human PPIs as well as their corresponding annotation data. However, these databases contain many false positive interactions, are partial and only a few of them incorporate data from various sources. To overcome these limitations, we have developed HINT-KB (http://biotools.ceid.upatras.gr/hint-kb/), a knowledge base that integrates data from various sources, provides a user-friendly interface for their retrieval, cal-culatesasetoffeaturesofinterest and computesaconfidence score for every candidate protein interaction. This confidence score is essential for filtering the false positive interactions which are present in existing databases, predicting new protein interactions and measuring the frequency of each true protein interaction. For this reason, a novel machine learning hybrid methodology, called (Evolutionary Kalman Mathematical Modelling—EvoKalMaModel), was used to achieve an accurate and interpretable scoring methodology. The experimental results indicated that the proposed scoring scheme outperforms existing computational methods for the prediction of PPIs.

  17. Synthesis and structural characterization of ternary Cu (II) complexes of glycine with 2,2'-bipyridine and 2,2'-dipyridylamine. The DNA-binding studies and biological activity.

    Science.gov (United States)

    Mohamed, Mervat S; Shoukry, Azza A; Ali, Ayat G

    2012-02-01

    In this study two new complexes [Cu(bpy)(Gly)Cl]·2H(2)O (1) and [Cu(dpa)(Gly)Cl]·2H(2)O (2) (bpy=2,2'-bipyridine; dpa=2,2'-dipyridylamine, Gly=glycine) have been synthesized and characterized by elemental analysis, IR, TGA, UV-vis and magnetic susceptibility measurements. The binding properties of the complexes with CT-DNA were investigated by electronic absorption spectra. The intrinsic binding constants (K(b)) calculated from UV-vis absorption studies were 1.84 × 10(3) M(-1) and 3.1 × 10(3) M(-1) for complexes 1 and 2 respectively. Thermal denaturation has been systematically studied by spectrophotometric method and the calculated ΔT(m) was nearly 5 °C for each complex. All the results suggest that the interaction modes between the complexes and CT-DNA were electrostatic and/or groove binding. The redox behavior of the two complexes was investigated by cyclic voltammetry. Both complexes, in presence and absence of CT-DNA show a quasi-reversible wave corresponding to Cu(II)/Cu(I) redox couple. The change in E(1/2), ΔE and I(pc)/I(pa) ascertain the interaction of complexes 1 and 2 with CT-DNA. Further insight into the binding of complexes with CT-DNA has been made by gel electrophoresis, where the binding of complexes is confirmed through decreasing the mobility and intensity of DNA bands. In addition, the antitumor activity of the complexes was tested on two cancer cell lines; the breast cancer (MCF7) and the human hepatocellular carcinoma (HEPG2), as well as one normal cell line; the human normal melanocytes (HFB4). The results showed that complex 1 was more potent antitumor agent than complex 2. The in-vitro antimicrobial activity of the two complexes was carried out using the disc diffusion method against different species of pathogenic bacteria and fungi. The activity data showed that complex 2 was more active in inhibiting the growth of the tested organisms. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Characterization of 6-mercaptopurine binding to bovine serum albumin and its displacement from the binding sites by quercetin and rutin

    Energy Technology Data Exchange (ETDEWEB)

    Ehteshami, Mehdi [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rasoulzadeh, Farzaneh [Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Mahboob, Soltanali [Nutrition Research Center, School of Health and Nutrition, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of); Rashidi, Mohammad-Reza, E-mail: rashidi@tbzmed.ac.ir [Research Center for Pharmaceutical Nanotechnology, Tabriz University of Medical Sciences, Tabriz 51644-14766 (Iran, Islamic Republic of)

    2013-03-15

    Binding of a drug to the serum albumins as major serum transport proteins can be influenced by other ligands leading to alteration of its pharmacological properties. In the present study, binding characteristics of 6-mercaptopurine (6-MP) with bovine serum albumin (BSA) together with its displacement from its binding site by quercetin and rutin have been investigated by the spectroscopic method. According to the binding parameters, a static quenching component in overall dynamic quenching process is operative in the interaction between 6-MP and BSA. The binding of 6-MP to BSA occurred spontaneously due to entropy-driven hydrophobic interactions. The synchronous fluorescence spectroscopy study revealed that the secondary structure of BSA is changed in the presence of 6-MP and both Tyr and Trp residues participate in the interaction between 6-MP and BSA with the later one being more dominant. The binding constant value of 6-MP-BSA in the presence of quercetin and rutin increased. 6-MP was displaced by ibuprofen indicating that the binding site of 6-MP on albumin is site II. Therefore, the change of the pharmacokinetic and pharmacodynamic properties of 6-MP by quercetin and rutin through alteration of binding capacity of 6-MP to the serum albumin cannot be ruled out. In addition, the displacement study showed that 6-MP is located in site II of BSA. - Highlights: Black-Right-Pointing-Pointer Participation of both Tyr and particularly Trp residues in the interaction between 6-MP and BSA. Black-Right-Pointing-Pointer Involvement of a static quenching component in an overall dynamic quenching process. Black-Right-Pointing-Pointer Ability of quercetin and rutin to change the binding constants of 6-MP-BSA complex. Black-Right-Pointing-Pointer Binding of 6-MP to BSA through entropy-driven hydrophobic interactions.

  19. Positive Cosmological Constant and Quantum Theory

    Directory of Open Access Journals (Sweden)

    Felix M. Lev

    2010-11-01

    Full Text Available We argue that quantum theory should proceed not from a spacetime background but from a Lie algebra, which is treated as a symmetry algebra. Then the fact that the cosmological constant is positive means not that the spacetime background is curved but that the de Sitter (dS algebra as the symmetry algebra is more relevant than the Poincare or anti de Sitter ones. The physical interpretation of irreducible representations (IRs of the dS algebra is considerably different from that for the other two algebras. One IR of the dS algebra splits into independent IRs for a particle and its antiparticle only when Poincare approximation works with a high accuracy. Only in this case additive quantum numbers such as electric, baryon and lepton charges are conserved, while at early stages of the Universe they could not be conserved. Another property of IRs of the dS algebra is that only fermions can be elementary and there can be no neutral elementary particles. The cosmological repulsion is a simple kinematical consequence of dS symmetry on quantum level when quasiclassical approximation is valid. Therefore the cosmological constant problem does not exist and there is no need to involve dark energy or other fields for explaining this phenomenon (in agreement with a similar conclusion by Bianchi and Rovelli.

  20. Advances in constant-velocity Moessbauer instrumentation

    International Nuclear Information System (INIS)

    Veiga, A.; Martinez, N.; Zelis, P. Mendoza; Pasquevich, G. A.; Sanchez, F. H.

    2006-01-01

    A prototype of a programmable constant-velocity scaler is presented. This instrument allows the acquisition of partial Moessbauer spectra in selected energy regions using standard drivers and transducers. It can be fully operated by a remote application, thus data acquisition can be automated. The instrument consists of a programmable counter and a constant-velocity reference. The reference waveform generator is amplitude modulated with 13-bit resolution, and is programmable in a wide range of frequencies and waveforms in order to optimize the performance of the transducer. The counter is compatible with most standard SCA, and is configured as a rate-meter that provides counts per selectable time slice at the programmed velocity. As a demonstration of the instrument applications, a partial Moessbauer spectrum of a natural iron foil was taken. Only positive energies were studied in 512 channels, accumulating 20 s per channel. A line width of 0.20 mm/s was achieved, performing with an efficiency of 80%.

  1. Local Pain Dynamics during Constant Exhaustive Exercise.

    Directory of Open Access Journals (Sweden)

    Agne Slapsinskaite

    Full Text Available The purpose of this study was to delineate the topological dynamics of pain and discomfort during constant exercise performed until volitional exhaustion. Eleven physical education students were tested while cycling and running at a "hard" intensity level (e.g., corresponding to Borg's RPE (6-20 = 15. During the tests, participants reported their discomfort and pain on a body map every 15s. "Time on task" for each participant was divided into five equal non-overlapping temporal windows within which their ratings were considered for analysis. The analyses revealed that the number of body locations with perceived pain and discomfort increased throughout the five temporal windows until reaching the mean (± SE values of 4.2 ± 0.7 and 4.1 ± 0.6 in cycling and running, respectively. The dominant locations included the quadriceps and hamstrings during cycling and quadriceps and chest during running. In conclusion, pain seemed to spread throughout the body during constant cycling and running performed up to volitional exhaustion with differences between cycling and running in the upper body but not in the lower body dynamics.

  2. Ventricular fibrillation time constant for swine

    International Nuclear Information System (INIS)

    Wu, Jiun-Yan; Sun, Hongyu; Nimunkar, Amit J; Webster, John G; O'Rourke, Ann; Huebner, Shane; Will, James A

    2008-01-01

    The strength–duration curve for cardiac excitation can be modeled by a parallel resistor–capacitor circuit that has a time constant. Experiments on six pigs were performed by delivering current from the X26 Taser dart at a distance from the heart to cause ventricular fibrillation (VF). The X26 Taser is an electromuscular incapacitation device (EMD), which generates about 50 kV and delivers a pulse train of about 15–19 pulses s −1 with a pulse duration of about 150 µs and peak current about 2 A. Similarly a continuous 60 Hz alternating current of the amplitude required to cause VF was delivered from the same distance. The average current and duration of the current pulse were estimated in both sets of experiments. The strength–duration equation was solved to yield an average time constant of 2.87 ms ± 1.90 (SD). Results obtained may help in the development of safety standards for future electromuscular incapacitation devices (EMDs) without requiring additional animal tests

  3. Simple liquid models with corrected dielectric constants

    Science.gov (United States)

    Fennell, Christopher J.; Li, Libo; Dill, Ken A.

    2012-01-01

    Molecular simulations often use explicit-solvent models. Sometimes explicit-solvent models can give inaccurate values for basic liquid properties, such as the density, heat capacity, and permittivity, as well as inaccurate values for molecular transfer free energies. Such errors have motivated the development of more complex solvents, such as polarizable models. We describe an alternative here. We give new fixed-charge models of solvents for molecular simulations – water, carbon tetrachloride, chloroform and dichloromethane. Normally, such solvent models are parameterized to agree with experimental values of the neat liquid density and enthalpy of vaporization. Here, in addition to those properties, our parameters are chosen to give the correct dielectric constant. We find that these new parameterizations also happen to give better values for other properties, such as the self-diffusion coefficient. We believe that parameterizing fixed-charge solvent models to fit experimental dielectric constants may provide better and more efficient ways to treat solvents in computer simulations. PMID:22397577

  4. Holographic dark energy with cosmological constant

    Science.gov (United States)

    Hu, Yazhou; Li, Miao; Li, Nan; Zhang, Zhenhui

    2015-08-01

    Inspired by the multiverse scenario, we study a heterotic dark energy model in which there are two parts, the first being the cosmological constant and the second being the holographic dark energy, thus this model is named the ΛHDE model. By studying the ΛHDE model theoretically, we find that the parameters d and Ωhde are divided into a few domains in which the fate of the universe is quite different. We investigate dynamical behaviors of this model, and especially the future evolution of the universe. We perform fitting analysis on the cosmological parameters in the ΛHDE model by using the recent observational data. We find the model yields χ2min=426.27 when constrained by Planck+SNLS3+BAO+HST, comparable to the results of the HDE model (428.20) and the concordant ΛCDM model (431.35). At 68.3% CL, we obtain -0.07<ΩΛ0<0.68 and correspondingly 0.04<Ωhde0<0.79, implying at present there is considerable degeneracy between the holographic dark energy and cosmological constant components in the ΛHDE model.

  5. Holographic dark energy with cosmological constant

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Yazhou; Li, Nan; Zhang, Zhenhui [State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, Chinese Academy of Sciences, Beijing, 100190 (China); Li, Miao, E-mail: asiahu@itp.ac.cn, E-mail: mli@itp.ac.cn, E-mail: linan@itp.ac.cn, E-mail: zhangzhh@mail.ustc.edu.cn [School of Astronomy and Space Science, Sun Yat-Sen University, Guangzhou 510275 (China)

    2015-08-01

    Inspired by the multiverse scenario, we study a heterotic dark energy model in which there are two parts, the first being the cosmological constant and the second being the holographic dark energy, thus this model is named the ΛHDE model. By studying the ΛHDE model theoretically, we find that the parameters d and Ω{sub hde} are divided into a few domains in which the fate of the universe is quite different. We investigate dynamical behaviors of this model, and especially the future evolution of the universe. We perform fitting analysis on the cosmological parameters in the ΛHDE model by using the recent observational data. We find the model yields χ{sup 2}{sub min}=426.27 when constrained by Planck+SNLS3+BAO+HST, comparable to the results of the HDE model (428.20) and the concordant ΛCDM model (431.35). At 68.3% CL, we obtain −0.07<Ω{sub Λ0}<0.68 and correspondingly 0.04<Ω{sub hde0}<0.79, implying at present there is considerable degeneracy between the holographic dark energy and cosmological constant components in the ΛHDE model.

  6. Holographic dark energy with cosmological constant

    International Nuclear Information System (INIS)

    Hu, Yazhou; Li, Nan; Zhang, Zhenhui; Li, Miao

    2015-01-01

    Inspired by the multiverse scenario, we study a heterotic dark energy model in which there are two parts, the first being the cosmological constant and the second being the holographic dark energy, thus this model is named the ΛHDE model. By studying the ΛHDE model theoretically, we find that the parameters d and Ω hde are divided into a few domains in which the fate of the universe is quite different. We investigate dynamical behaviors of this model, and especially the future evolution of the universe. We perform fitting analysis on the cosmological parameters in the ΛHDE model by using the recent observational data. We find the model yields χ 2 min =426.27 when constrained by Planck+SNLS3+BAO+HST, comparable to the results of the HDE model (428.20) and the concordant ΛCDM model (431.35). At 68.3% CL, we obtain −0.07<Ω Λ0 <0.68 and correspondingly 0.04<Ω hde0 <0.79, implying at present there is considerable degeneracy between the holographic dark energy and cosmological constant components in the ΛHDE model

  7. Modified large number theory with constant G

    International Nuclear Information System (INIS)

    Recami, E.

    1983-01-01

    The inspiring ''numerology'' uncovered by Dirac, Eddington, Weyl, et al. can be explained and derived when it is slightly modified so to connect the ''gravitational world'' (cosmos) with the ''strong world'' (hadron), rather than with the electromagnetic one. The aim of this note is to show the following. In the present approach to the ''Large Number Theory,'' cosmos and hadrons are considered to be (finite) similar systems, so that the ratio R-bar/r-bar of the cosmos typical length R-bar to the hadron typical length r-bar is constant in time (for instance, if both cosmos and hadrons undergo an expansion/contraction cycle: according to the ''cyclical big-bang'' hypothesis: then R-bar and r-bar can be chosen to be the maximum radii, or the average radii). As a consequence, then gravitational constant G results to be independent of time. The present note is based on work done in collaboration with P.Caldirola, G. D. Maccarrone, and M. Pavsic

  8. Lepton Collider Operation with Constant Currents

    CERN Document Server

    Wienands, Ulrich

    2005-01-01

    Traditionally, electron-positron colliders have been operating in a top-off-and-coast fashion with a cycle time depending on the beam life time, typically on the order of an hour. Each top-off involves ramping detector systems in addition to the actual filling time. The loss in accumulated luminosity is typically 20-50%. During the last year, both B-Factories have commissioned a continuous-injection mode of operation in which beam is injected without ramping the detector, thus raising luminosity integration by constant operation at peak luminosity. Constant beam currents reduce thermal drift and trips caused by change in beam loading. To achieve this level of operation, special efforts were made to reduce the injection losses and also to implement special gating procedures in the detectors, minimizing dead time. Bunch-injection control decides which bunch to inject into next while maintaining small charge variation between bunches. Beam collimation can reduce injection noise but also cause an increase in back...

  9. PREFACE: Fundamental Constants in Physics and Metrology

    Science.gov (United States)

    Klose, Volkmar; Kramer, Bernhard

    1986-01-01

    This volume contains the papers presented at the 70th PTB Seminar which, the second on the subject "Fundamental Constants in Physics and Metrology", was held at the Physikalisch-Technische Bundesanstalt in Braunschweig from October 21 to 22, 1985. About 100 participants from the universities and various research institutes of the Federal Republic of Germany participated in the meeting. Besides a number of review lectures on various broader subjects there was a poster session which contained a variety of topical contributed papers ranging from the theory of the quantum Hall effect to reports on the status of the metrological experiments at the PTB. In addition, the participants were also offered the possibility to visit the PTB laboratories during the course of the seminar. During the preparation of the meeting we noticed that even most of the general subjects which were going to be discussed in the lectures are of great importance in connection with metrological experiments and should be made accessible to the scientific community. This eventually resulted in the idea of the publication of the papers in a regular journal. We are grateful to the editor of Metrologia for providing this opportunity. We have included quite a number of papers from basic physical research. For example, certain aspects of high-energy physics and quantum optics, as well as the many-faceted role of Sommerfeld's fine-structure constant, are covered. We think that questions such as "What are the intrinsic fundamental parameters of nature?" or "What are we doing when we perform an experiment?" can shed new light on the art of metrology, and do, potentially, lead to new ideas. This appears to be especially necessary when we notice the increasing importance of the role of the fundamental constants and macroscopic quantum effects for the definition and the realization of the physical units. In some cases we have reached a point where the limitations of our knowledge of a fundamental constant and

  10. Antioxidant flavonoids bind human serum albumin

    Science.gov (United States)

    Kanakis, C. D.; Tarantilis, P. A.; Polissiou, M. G.; Diamantoglou, S.; Tajmir-Riahi, H. A.

    2006-10-01

    Human serum albumin (HSA) is a principal extracellular protein with a high concentration in blood plasma and carrier for many drugs to different molecular targets. Flavonoids are powerful antioxidants and prevent DNA damage. The antioxidative protections are related to their binding modes to DNA duplex and complexation with free radicals in vivo. However, flavonoids are known to inhibit the activities of several enzymes such as calcium phospholipid-dependent protein kinase, tyrosine protein kinase from rat lung, phosphorylase kinase, phosphatidylinositol 3-kinase and DNA topoisomerases that exhibit the importance of flavonoid-protein interaction. This study was designed to examine the interaction of human serum albumin (HSA) with quercetin (que), kaempferol (kae) and delphinidin (del) in aqueous solution at physiological conditions, using constant protein concentration of 0.25 mM (final) and various drug contents of 1 μM-1 mM. FTIR and UV-vis spectroscopic methods were used to determine the polyphenolic binding mode, the binding constant and the effects of flavonoid complexation on protein secondary structure. The spectroscopic results showed that flavonoids are located along the polypeptide chains through H-bonding interactions with overall affinity constant of Kque = 1.4 × 10 4 M -1, Kkae = 2.6 × 10 5 M -1 and Kdel = 4.71 × 10 5 M -1. The protein secondary structure showed no alterations at low pigment concentration (1 μM), whereas at high flavonoid content (1 mM), major reduction of α-helix from 55% (free HSA) to 42-46% and increase of β-sheet from 15% (free HSA) to 17-19% and β-anti from 7% (free HSA) to 10-20% occurred in the flavonoid-HSA adducts. The major reduction of HSA α-helix is indicative of a partial protein unfolding upon flavonoid interaction.

  11. Characteristics of high affinity and low affinity adenosine binding sites in human cerebral cortex

    International Nuclear Information System (INIS)

    John, D.; Fox, I.V.

    1986-01-01

    The binding characteristics of human brain cortical membrane fractions were evaluated to test the hypothesis that there are A 1 and A 2 adenosine binding sites. The ligands used were 2-chloro(8- 3 H) adenosine and N 6 -(adenine-2, 8- 3 H) cyclohexayladenosine. Binding of chloroadenosine to human brain cortical membranes was time dependent, reversible and concentration dependent. The kinetic constant determinations from binding studies of the adenosine receptor are presented. Utilizing tritium-cyclohexyladenosine as ligand the authors observed evidence for a high affinity binding site in human brain cortical membranes with a kd of 5 nM

  12. CARBOHYDRATE-CONTAINING COMPOUNDS WHICH BIND TO CARBOHYDRATE BINDING RECEPTORS

    DEFF Research Database (Denmark)

    1995-01-01

    Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases.......Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases....

  13. Determination, at equilibrium, of association constants of labelled or unlabelled ligands by a non-graphical method

    International Nuclear Information System (INIS)

    Goertz, G.; Longchampt, J.; Crepy, O.; Judas, O.; Jayle, M.-F.

    1976-01-01

    Determination, at equilibrium of association constants of labelled or unlabelled ligands by a non-graphical method are described. This work deals with the determination of association constants at equilibrium by a non-graphical method in binding systems containing one specific receptor. Equations have been derived from that originally described by Lea (Biochim. Biophys. Acta, 322, 68-74), the terms of which are obtained from the data of simple displacement curves of a bound radioactive ligand by unlabelled competitors identical or different in nature. By knowing the function relating the variations of the bound ligand (B) to the affinity constant (Ksub(i)) and the quantity (Msub(i)) of competitor for a given system, it is possible to calculate any of these parameters when the two others are measured. Thus, it becomes easy to compare the relative affinities of different receptors for the same ligand or that of one receptor for various labelled or unlabelled ligands. Furthermore, theoretical displacement curves can be drawn and compared to experimental data, only when knowing the affinity constant of a specific binding system in given conditions. These modes of calculation have been tested in a study of interactions between various steroids and a fraction of human serum proteins precipitated by ammonium sulfate (30-45%) and containing the sex hormone-binding globulin. Association constants thus obtained agree well with those reported in the literature and determined by graphical procedures

  14. Search for a Variation of Fundamental Constants

    Science.gov (United States)

    Ubachs, W.

    2013-06-01

    Since the days of Dirac scientists have speculated about the possibility that the laws of nature, and the fundamental constants appearing in those laws, are not rock-solid and eternal but may be subject to change in time or space. Such a scenario of evolving constants might provide an answer to the deepest puzzle of contemporary science, namely why the conditions in our local Universe allow for extreme complexity: the fine-tuning problem. In the past decade it has been established that spectral lines of atoms and molecules, which can currently be measured at ever-higher accuracies, form an ideal test ground for probing drifting constants. This has brought this subject from the realm of metaphysics to that of experimental science. In particular the spectra of molecules are sensitive for probing a variation of the proton-electron mass ratio μ, either on a cosmological time scale, or on a laboratory time scale. A comparison can be made between spectra of molecular hydrogen observed in the laboratory and at a high redshift (z=2-3), using the Very Large Telescope (Paranal, Chile) and the Keck telescope (Hawaii). This puts a constraint on a varying mass ratio Δμ/μ at the 10^{-5} level. The optical work can also be extended to include CO molecules. Further a novel direction will be discussed: it was discovered that molecules exhibiting hindered internal rotation have spectral lines in the radio-spectrum that are extremely sensitive to a varying proton-electron mass ratio. Such lines in the spectrum of methanol were recently observed with the radio-telescope in Effelsberg (Germany). F. van Weerdenburg, M.T. Murphy, A.L. Malec, L. Kaper, W. Ubachs, Phys. Rev. Lett. 106, 180802 (2011). A. Malec, R. Buning, M.T. Murphy, N. Milutinovic, S.L. Ellison, J.X. Prochaska, L. Kaper, J. Tumlinson, R.F. Carswell, W. Ubachs, Mon. Not. Roy. Astron. Soc. 403, 1541 (2010). E.J. Salumbides, M.L. Niu, J. Bagdonaite, N. de Oliveira, D. Joyeux, L. Nahon, W. Ubachs, Phys. Rev. A 86, 022510

  15. Statistical Modelling of the Soil Dielectric Constant

    Science.gov (United States)

    Usowicz, Boguslaw; Marczewski, Wojciech; Bogdan Usowicz, Jerzy; Lipiec, Jerzy

    2010-05-01

    The dielectric constant of soil is the physical property being very sensitive on water content. It funds several electrical measurement techniques for determining the water content by means of direct (TDR, FDR, and others related to effects of electrical conductance and/or capacitance) and indirect RS (Remote Sensing) methods. The work is devoted to a particular statistical manner of modelling the dielectric constant as the property accounting a wide range of specific soil composition, porosity, and mass density, within the unsaturated water content. Usually, similar models are determined for few particular soil types, and changing the soil type one needs switching the model on another type or to adjust it by parametrization of soil compounds. Therefore, it is difficult comparing and referring results between models. The presented model was developed for a generic representation of soil being a hypothetical mixture of spheres, each representing a soil fraction, in its proper phase state. The model generates a serial-parallel mesh of conductive and capacitive paths, which is analysed for a total conductive or capacitive property. The model was firstly developed to determine the thermal conductivity property, and now it is extended on the dielectric constant by analysing the capacitive mesh. The analysis is provided by statistical means obeying physical laws related to the serial-parallel branching of the representative electrical mesh. Physical relevance of the analysis is established electrically, but the definition of the electrical mesh is controlled statistically by parametrization of compound fractions, by determining the number of representative spheres per unitary volume per fraction, and by determining the number of fractions. That way the model is capable covering properties of nearly all possible soil types, all phase states within recognition of the Lorenz and Knudsen conditions. In effect the model allows on generating a hypothetical representative of

  16. Development code for group constant processing

    International Nuclear Information System (INIS)

    Su'ud, Z.

    1997-01-01

    In this paper methods, formalism and algorithm related to group constant processing problem from basic library such as ENDF/B VI will be described. Basically the problems can be grouped as follows; the treatment of resolved resonance using NR approximation, the treatment of unresolved resonance using statistical method, the treatment of low lying resonance using intermediate resonance approximation, the treatment of thermal energy regions, and the treatment group transfer matrices cross sections. it is necessary to treat interference between resonance properly especially in the unresolved region. in this paper the resonance problems are treated based on Breit-wigner method, and doppler function is treated using Pade approximation for calculation efficiency. finally, some samples of calculational result for some nuclei, mainly for comparison between many methods are discussed in this paper

  17. Hawking temperature of constant curvature black holes

    International Nuclear Information System (INIS)

    Cai Ronggen; Myung, Yun Soo

    2011-01-01

    The constant curvature (CC) black holes are higher dimensional generalizations of Banados-Teitelboim-Zanelli black holes. It is known that these black holes have the unusual topology of M D-1 xS 1 , where D is the spacetime dimension and M D-1 stands for a conformal Minkowski spacetime in D-1 dimensions. The unusual topology and time-dependence for the exterior of these black holes cause some difficulties to derive their thermodynamic quantities. In this work, by using a globally embedding approach, we obtain the Hawking temperature of the CC black holes. We find that the Hawking temperature takes the same form when using both the static and global coordinates. Also, it is identical to the Gibbons-Hawking temperature of the boundary de Sitter spaces of these CC black holes.

  18. Dielectric Constant Measurements of Solid 4He

    Science.gov (United States)

    Yin, L.; Xia, J. S.; Huan, C.; Sullivan, N. S.; Chan, M. H. W.

    2011-03-01

    Careful measurements of the dielectric properties of solid 4He have been carried out down to 35 mK, considerably lower than the temperature range of previous studies. The sample was prepared from high purity gas with 3He concentrations of the order of 200 ppb and were formed by the blocked capillary method. The molar volume of the sample was 20.30 cm3. The dielectric constant of the samples was found to be independent of temperature down to 120 mK before showing a continuous increase with decreasing temperature and saturating below 50 mK. The total increase in ɛ is 2 parts in 10-5. The temperature dependence of ɛ mimics the increase in the resonant frequency found in the torsional oscillator studies and also the increase found in the shear modulus measurements.

  19. Parallel computational in nuclear group constant calculation

    International Nuclear Information System (INIS)

    Su'ud, Zaki; Rustandi, Yaddi K.; Kurniadi, Rizal

    2002-01-01

    In this paper parallel computational method in nuclear group constant calculation using collision probability method will be discuss. The main focus is on the calculation of collision matrix which need large amount of computational time. The geometry treated here is concentric cylinder. The calculation of collision probability matrix is carried out using semi analytic method using Beckley Naylor Function. To accelerate computation speed some computer parallel used to solve the problem. We used LINUX based parallelization using PVM software with C or fortran language. While in windows based we used socket programming using DELPHI or C builder. The calculation results shows the important of optimal weight for each processor in case there area many type of processor speed

  20. Cosmological constant and general isocurvature initial conditions

    International Nuclear Information System (INIS)

    Trotta, R.; Riazuelo, A.; Durrer, R.

    2003-01-01

    We investigate in detail the question of whether a nonvanishing cosmological constant is required by the present-day cosmic microwave background and large scale structure data when general isocurvature initial conditions are taken into account. We also discuss the differences between the usual Bayesian and the frequentist approaches in data analysis. We show that the Cosmic Background Explorer (COBE)-normalized matter power spectrum is dominated by the adiabatic mode and therefore breaks the degeneracy between initial conditions which is present in the cosmic microwave background anisotropies. We find that in a flat universe the Bayesian analysis requires Ω Λ =e0 to more than 3σ, while in the frequentist approach Ω Λ =0 is still within 3σ for a value of h≤0.48. Both conclusions hold regardless of the initial conditions

  1. Constant-parameter capture-recapture models

    Science.gov (United States)

    Brownie, C.; Hines, J.E.; Nichols, J.D.

    1986-01-01

    Jolly (1982, Biometrics 38, 301-321) presented modifications of the Jolly-Seber model for capture-recapture data, which assume constant survival and/or capture rates. Where appropriate, because of the reduced number of parameters, these models lead to more efficient estimators than the Jolly-Seber model. The tests to compare models given by Jolly do not make complete use of the data, and we present here the appropriate modifications, and also indicate how to carry out goodness-of-fit tests which utilize individual capture history information. We also describe analogous models for the case where young and adult animals are tagged. The availability of computer programs to perform the analysis is noted, and examples are given using output from these programs.

  2. Lepton Collider Operation With Constant Currents

    International Nuclear Information System (INIS)

    Wienands, U.

    2006-01-01

    Electron-positron colliders have been operating in a top-up-and-coast fashion with a cycle time depending on the beam life time, typically one or more hours. Each top-up involves ramping detector systems in addition to the actual filling time. The loss in accumulated luminosity may be 20-50%. During the last year, both B-Factories have commissioned a continuous-injection mode of operation in which beam is injected without ramping the detector, thus raising luminosity integration by always operating at peak luminosity. Constant beam currents also reduce thermal drift and trips caused by change in beam loading. To achieve this level of operation, special efforts were made to reduce the injection losses and also to implement gating procedures in the detectors, minimizing dead time. Beam collimation can reduce injection noise but also cause an increase in background rates. A challenge can be determining beam lifetime, important to maintain tuning of the beams

  3. Binding of streptomycin with bovine serum albumin: Energetics and conformational aspects

    International Nuclear Information System (INIS)

    Jha, Niki S.; Kishore, Nand

    2009-01-01

    Thermodynamics of the binding of antibiotic streptomycin to bovine serum albumin have been studied using isothermal titration calorimetry in combination with fluorescence, UV-vis and circular dichroism spectroscopies. The values of van't Hoff enthalpy calculated from the temperature dependence of the binding constant do not agree with the calorimetric enthalpies indicating temperature dependent conformational changes in the protein upon binding. With increase in the ionic strength, reduction in the binding affinity of streptomycin to BSA is observed suggesting the predominance of electrostatic interactions in the binding. The contribution of hydrophobic interactions in the binding is also demonstrated by decrease in binding affinity in the presence of tetrabutylammonium bromide (TBAB). The value of binding affinity in the presence of sucrose indicates that hydrogen bonding is not a significant contribution in complexation. The results have permitted quantitative evaluation of the interaction of streptomycin with bovine serum albumin

  4. Higgs inflation and the cosmological constant

    Energy Technology Data Exchange (ETDEWEB)

    Jegerlehner, Fred [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)

    2014-02-15

    The Higgs not only induces the masses of all SM particles, the Higgs, given its special mass value, is the natural candidate for the inflaton and in fact is ruling the evolution of the early universe, by providing the necessary dark energy which remains the dominant energy density. SM running couplings not only allow us to extrapolate SM physics up to the Planck scale, but equally important they are triggering the Higgs mechanism. This is possible by the fact that the bare mass term in the Higgs potential changes sign at about μ{sub 0}≅1.40 x 10{sup 16} GeV and in the symmetric phase is enhanced by quadratic terms in the Planck mass. Such a huge Higgs mass term is able to play a key role in triggering inflation in the early universe. In this article we extend our previous investigation by working out the details of a Higgs inflation scenario. We show how different terms contributing to the Higgs Lagrangian are affecting inflation. Given the SM and its extrapolation to scales μ>μ{sub 0} we find a calculable cosmological constant V(0) which is weakly scale dependent and actually remains large during inflation. This is different to the Higgs fluctuation field dependent ΔV(φ), which decays exponentially during inflation, and actually would not provide a sufficient amount of inflation. The fluctuation field has a different effective mass which shifts the bare Higgs transition point to a lower value μ'{sub 0} ≅7.7 x 10{sup 14} GeV. The vacuum energy V(0) being proportional to M{sub Pl}{sup 4} has a coefficient which vanishes near the Higgs transition point, such that the bare and the renormalized cosmological constant match at this point. The role of the Higgs in reheating and baryogenesis is emphasized.

  5. Universal equations and constants of turbulent motion

    International Nuclear Information System (INIS)

    Baumert, H Z

    2013-01-01

    This paper presents a parameter-free theory of shear-generated turbulence at asymptotically high Reynolds numbers in incompressible fluids. It is based on a two-fluids concept. Both components are materially identical and inviscid. The first component is an ensemble of quasi-rigid dipole-vortex tubes (vortex filaments, excitations) as quasi-particles in chaotic motion. The second is a superfluid performing evasive motions between the tubes. The local dipole motions follow Helmholtz' law. The vortex radii scale with the energy-containing length scale. Collisions between quasi-particles lead either to annihilation (likewise rotation, turbulent dissipation) or to scattering (counterrotation, turbulent diffusion). There are analogies with birth and death processes of population dynamics and their master equations and with Landau's two-fluid theory of liquid helium. For free homogeneous decay the theory predicts the turbulent kinetic energy to follow t −1 . With an adiabatic wall condition it predicts the logarithmic law with von Kármán's constant as 1/√(2 π)= 0.399. Likewise rotating couples form localized dissipative patches almost at rest (→ intermittency) wherein under local quasi-steady conditions the spectrum evolves into an ‘Apollonian gear’ as discussed first by Herrmann (1990 Correlation and Connectivity (Dordrecht: Kluwer) pp 108–20). Dissipation happens exclusively at scale zero and at finite scales this system is frictionless and reminds of Prigogine's (1947 Etude Thermodynamique des Phenomenes Irreversibles (Liege: Desoer) p 143) law of minimum (here: zero) entropy production. The theory predicts further the prefactor of the 3D-wavenumber spectrum (a Kolmogorov constant) as 1/3 (4 π) 2/3 =1.802, well within the scatter range of observational, experimental and direct numerical simulation results. (paper)

  6. Universal equations and constants of turbulent motion

    Science.gov (United States)

    Baumert, H. Z.

    2013-07-01

    This paper presents a parameter-free theory of shear-generated turbulence at asymptotically high Reynolds numbers in incompressible fluids. It is based on a two-fluids concept. Both components are materially identical and inviscid. The first component is an ensemble of quasi-rigid dipole-vortex tubes (vortex filaments, excitations) as quasi-particles in chaotic motion. The second is a superfluid performing evasive motions between the tubes. The local dipole motions follow Helmholtz' law. The vortex radii scale with the energy-containing length scale. Collisions between quasi-particles lead either to annihilation (likewise rotation, turbulent dissipation) or to scattering (counterrotation, turbulent diffusion). There are analogies with birth and death processes of population dynamics and their master equations and with Landau's two-fluid theory of liquid helium. For free homogeneous decay the theory predicts the turbulent kinetic energy to follow t-1. With an adiabatic wall condition it predicts the logarithmic law with von Kármán's constant as 1/\\sqrt {2\\,\\pi }= 0.399 . Likewise rotating couples form localized dissipative patches almost at rest (→ intermittency) wherein under local quasi-steady conditions the spectrum evolves into an ‘Apollonian gear’ as discussed first by Herrmann (1990 Correlation and Connectivity (Dordrecht: Kluwer) pp 108-20). Dissipation happens exclusively at scale zero and at finite scales this system is frictionless and reminds of Prigogine's (1947 Etude Thermodynamique des Phenomenes Irreversibles (Liege: Desoer) p 143) law of minimum (here: zero) entropy production. The theory predicts further the prefactor of the 3D-wavenumber spectrum (a Kolmogorov constant) as \\frac {1}{3}(4\\,\\pi )^{2/3}=1.802 , well within the scatter range of observational, experimental and direct numerical simulation results.

  7. Characterization and immunohistochemical localization of rat salivary cobalamin-binding protein and comparison with human salivary haptocorrin

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier

    1985-01-01

    Rat saliva contains a cobalamin-binding protein that binds cobalamin as well as cobinamide. The protein binds cobalamin with an affinity constant of 8 X 10(10) l X mol-1, and it binds cobalamin over a more narrow pH range (pH 7.5-10) than does human haptocorrin. It has a Stokes radius of 2.45 nm...

  8. Binding of rare earths to serum proteins and DNA

    International Nuclear Information System (INIS)

    Rosoff, B.; Spencer, H.

    1979-01-01

    In order to investigate further the physiological behavior of rare earths and rare earth chelates, studies of the binding of 46 Sc, 91 Y, and 140 La to serum proteins and to nucleic acids were performed using the methods of equilibrium dialysis and ultrafiltration. The binding of lanthanum and yttrium as the chlorides to α-globulin increased as the free rare earth concentration increased. When scandium and lanthanum were chelated in nitrilotriacetate (NTA) the binding to α-globulin was considerably less and there was no binding to albumin. The binding of 46 Sc chelated to ethylenediamine di(O-hydroxyphenylacetate) (EDDHA) was five times greater than of 46 Sc chloride. When the free scandium concentration was increased, the moles bound per mole of protein increased proportionally and the binding was reversible. Scandium was 100% filterable from a mixture of human serum and from the scandium chelates with high stability constants scandium diethylenetriaminepentaacetate (ScDTPA), scandium ethylenediaminetetraacetate (ScEDTA) and scandium cyclohexane trans-1,2-diaminetetraacetate (ScCDTA) respectively. In contrast, only 2% of the scandium was filterable when scandium nitrilotriacetate, a scandium chelate of low stability constant, was used. (Auth.)

  9. Constant Leverage And Constant Cost Of Capital: A Common Knowledge Half-Truth

    Directory of Open Access Journals (Sweden)

    Ignacio Vélez–Pareja

    2008-04-01

    In this document we show that for finite cash flows, Ke and hence WACC depend on the discount rate that is used to value the tax shield, TS and as expected, Ke and WACC are not constant with Kd as the discount rate for the tax shield, even if the leverage is constant. We illustrate this situation with a simple example. We analyze five methods: DCF using APV, FCF and traditional and general formulation for WACC, present value of CFE plus debt and Capital Cash Flow, CCF.

  10. Neuropsychological phenotype of a patient with a de novo 970 kb interstitial deletion in the distal 16p11.2 region

    Directory of Open Access Journals (Sweden)

    Egger JI

    2014-03-01

    Full Text Available Jos I M Egger,1–3 Willem M A Verhoeven,1,4 Wim Verbeeck,5 Nicole de Leeuw61Vincent van Gogh Institute for Psychiatry, Centre of Excellence for Neuropsychiatry, Venray, the Netherlands; 2Donders Institute for Brain, Cognition and Behaviour, Radboud University Nijmegen, Nijmegen, the Netherlands; 3Behavioural Science Institute, Radboud University Nijmegen, Nijmegen, the Netherlands; 4Erasmus University Medical Centre, Department of Psychiatry, Rotterdam, the Netherlands; 5Vincent van Gogh Institute for Psychiatry, Centre for Autism and ADHD, Venray, the Netherlands; 6Department of Human Genetics, Radboud University Medical Centre, Nijmegen, the NetherlandsAbstract: The 16p11.2 microdeletion syndrome is characterized by a wide range of phenotypic expressions and is frequently associated with developmental delay, symptoms from the autism spectrum, epilepsy, congenital anomalies, and obesity. These phenotypes are often related to a proximal 16p11.2 deletion of approximately 600 kb (BP4–BP5 that includes the SH2B1 gene that is reported to be causative for morbid obesity. This more centromeric deletion is most strongly related to autism spectrum susceptibility and is functionally different from the more distal 16p12.2p11.2 region, which includes the so-called atypical 16p11.2 BP2–BP3 deletion (approximately 220 kb presenting with developmental delay, behavioral problems and mild facial dysmorphisms. Here, an adult male with a long history of maladaptive behaviors is described who was referred for diagnostic assessment of his amotivational features. Extensive neuropsychological examination demonstrated rigid thinking, anxious beliefs, and ideas of reference in the presence of normal intelligence. Microarray analysis demonstrated a de novo 970 kb 16p11.2 BP1–BP4 microdeletion that can be regarded as explanatory for his behavioral profile. It is concluded that microdeletion syndromes are not exclusively related to intellectual disabilities and

  11. The 0.3-kb fragment containing the R-U5-5'leader sequence of Friend murine leukemia virus influences the level of protein expression from spliced mRNA.

    Science.gov (United States)

    Choo, Yeng Cheng; Seki, Yohei; Machinaga, Akihito; Ogita, Nobuo; Takase-Yoden, Sayaka

    2013-04-19

    A neuropathogenic variant of Friend murine leukemia virus (Fr-MLV) clone A8 induces spongiform neurodegeneration when infected into neonatal rats. Studies with chimeras constructed from the A8 virus and the non-neuropathogenic Fr-MLV clone 57 identified a 0.3-kb KpnI-AatII fragment containing a R-U5-5'leader sequence as an important determinant for inducing spongiosis, in addition to the env gene of A8 as the primary determinant. This 0.3-kb fragment contains a 17-nucleotide difference between the A8 and 57 sequences. We previously showed that the 0.3-kb fragment influences expression levels of Env protein in both cultured cells and rat brain, but the corresponding molecular mechanisms are not well understood. Studies with expression vectors constructed from the full-length proviral genome of Fr-MLV that incorporated the luciferase (luc) gene instead of the env gene found that the vector containing the A8-0.3-kb fragment yielded a larger amount of spliced luc-mRNA and showed higher expression of luciferase when compared to the vector containing the 57-0.3-kb fragment. The amount of total transcripts from the vectors, the poly (A) tail length of their mRNAs, and the nuclear-cytoplasm distribution of luc-mRNA in transfected cells were also evaluated. The 0.3-kb fragment did not influence transcription efficiency, mRNA polyadenylation or nuclear export of luc-mRNA. Mutational analyses were carried out to determine the importance of nucleotides that differ between the A8 and 57 sequences within the 0.3-kb fragment. In particular, seven nucleotides upstream of the 5'splice site (5'ss) were found to be important in regulating the level of protein expression from spliced messages. Interestingly, these nucleotides reside within the stem-loop structure that has been speculated to limit the recognition of 5'ss. The 0.3-kb fragment containing the R-U5-5'leader sequence of Fr-MLV influences the level of protein expression from the spliced-mRNA by regulating the splicing

  12. Equilibrium and kinetics of Sin Nombre hantavirus binding at DAF/CD55 functionalized bead surfaces.

    Science.gov (United States)

    Buranda, Tione; Swanson, Scarlett; Bondu, Virginie; Schaefer, Leah; Maclean, James; Mo, Zhenzhen; Wycoff, Keith; Belle, Archana; Hjelle, Brian

    2014-03-10

    Decay accelerating factor (DAF/CD55) is targeted by many pathogens for cell entry. It has been implicated as a co-receptor for hantaviruses. To examine the binding of hantaviruses to DAF, we describe the use of Protein G beads for binding human IgG Fc domain-functionalized DAF ((DAF)₂-Fc). When mixed with Protein G beads the resulting DAF beads can be used as a generalizable platform for measuring kinetic and equilibrium binding constants of DAF binding targets. The hantavirus interaction has high affinity (24-30 nM; k(on) ~ 10⁵ M⁻¹ s⁻¹, k(off) ~ 0.0045 s⁻¹). The bivalent (DAF)₂-Fc/SNV data agree with hantavirus binding to DAF expressed on Tanoue B cells (K(d) = 14.0 nM). Monovalent affinity interaction between SNV and recombinant DAF of 58.0 nM is determined from competition binding. This study serves a dual purpose of presenting a convenient and quantitative approach of measuring binding affinities between DAF and the many cognate viral and bacterial ligands and providing new data on the binding constant of DAF and Sin Nombre hantavirus. Knowledge of the equilibrium binding constant allows for the determination of the relative fractions of bound and free virus particles in cell entry assays. This is important for drug discovery assays for cell entry inhibitors.

  13. Some aspects of preparation and testing of group constants group constant system ABBN-90

    International Nuclear Information System (INIS)

    Nikolaev, M.N.; Tsiboulia, A.M.; Manturov, G.N.

    1996-01-01

    This paper presents an overview of activities performed to prepare and test the group constants ABBN-90. The ABBN-90 set is designed for application calculations of fast, intermediate and thermal nuclear reactors. The calculations of subgroup parameters are discussed. The processing code system GRUCON is mentioned in comparison to the NJOY code system. Proposals are made for future activities. (author). Figs, tabs

  14. A 725 kb deletion at 22q13.1 chromosomal region including SOX10 gene in a boy with a neurologic variant of Waardenburg syndrome type 2.

    Science.gov (United States)

    Siomou, Elisavet; Manolakos, Emmanouil; Petersen, Michael; Thomaidis, Loretta; Gyftodimou, Yolanda; Orru, Sandro; Papoulidis, Ioannis

    2012-11-01

    Waardenburg syndrome (WS) is a rare (1/40,000) autosomal dominant disorder resulting from melanocyte defects, with varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair, skin, and inner ear. WS is classified into four clinical subtypes (WS1-S4). Six genes have been identified to be associated with the different subtypes of WS, among which SOX10, which is localized within the region 22q13.1. Lately it has been suggested that whole SOX10 gene deletions can be encountered when testing for WS. In this study we report a case of a 13-year-old boy with a unique de novo 725 kb deletion within the 22q13.1 chromosomal region, including the SOX10 gene and presenting clinical features of a neurologic variant of WS2. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  15. Sequential memory: Binding dynamics

    Science.gov (United States)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail

    2015-10-01

    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  16. Cellulose binding domain proteins

    Science.gov (United States)

    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc; Doi, Roy

    1998-01-01

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  17. Binding and Bulgarian

    NARCIS (Netherlands)

    Schürcks-Grozeva, Lilia Lubomirova

    2003-01-01

    In haar proefschrift analyseert Lilia Schürcks de anaforische verschijnselen in de Bulgaarse taal. Het gaat dan om wederkerende aspecten, uitgedrukt bij woorden als ‘zich’ en ‘elkaar’. De situatie in het Bulgaars blijkt moeilijk in te passen in de klassieke Binding Theory van Noam Chomsky. Bron: RUG

  18. In Vivo Deletion of the Cebpa +37 kb Enhancer Markedly Reduces Cebpa mRNA in Myeloid Progenitors but Not in Non-Hematopoietic Tissues to Impair Granulopoiesis

    Science.gov (United States)

    Guo, Hong; Cooper, Stacy; Friedman, Alan D.

    2016-01-01

    The murine Cebpa gene contains a +37 kb, evolutionarily conserved 440 bp enhancer that directs high-level expression to myeloid progenitors in transgenic mice. The enhancer is bound and activated by Runx1, Scl, GATA2, C/EBPα, c-Myb, Pu.1, and additional Ets factors in myeloid cells. CRISPR/Cas9-mediated replacement of the wild-type enhancer with a variant mutant in its seven Ets sites leads to 20-fold reduction of Cebpa mRNA in the 32Dcl3 myeloid cell line. To determine the effect of deleting the enhancer in vivo, we now characterize C57BL/6 mice in which loxP sites flank a 688 bp DNA segment containing the enhancer. CMV-Cre mediated germline deletion resulted in diminution of the expected number of viable Enh(f/f);CMV-Cre offspring, with 28-fold reduction in marrow Cebpa mRNA but normal levels in liver, lung, adipose, intestine, muscle, and kidney. Cre-transduction of lineage-negative marrow cells in vitro reduced Cebpa mRNA 12-fold, with impairment of granulocytic maturation, morphologic blast accumulation, and IL-3 dependent myeloid colony replating for >12 generations. Exposure of Enh(f/f);Mx1-Cre mice to pIpC led to 14-fold reduction of Cebpa mRNA in GMP or CMP, 30-fold reduction in LSK, and deletion and confirmed marrow-intrinsic impairment of granulopoiesis and B cell generation with LSK and monocyte lineage expansion. These findings demonstrate a critical role for the +37 kb Cebpa enhancer for hematopoietic-specific Cebpa expression, with enhancer deletion leading to impaired myelopoiesis and potentially preleukemic progenitor expansion. PMID:26937964

  19. PMS2 inactivation by a complex rearrangement involving an HERV retroelement and the inverted 100-kb duplicon on 7p22.1.

    Science.gov (United States)

    Vogt, Julia; Wernstedt, Annekatrin; Ripperger, Tim; Pabst, Brigitte; Zschocke, Johannes; Kratz, Christian; Wimmer, Katharina

    2016-11-01

    Biallelic PMS2 mutations are responsible for more than half of all cases of constitutional mismatch repair deficiency (CMMRD), a recessively inherited childhood cancer predisposition syndrome. The mismatch repair gene PMS2 is partly embedded within one copy of an inverted 100-kb low-copy repeat (LCR) on 7p22.1. In an individual with CMMRD syndrome, PMS2 was found to be homozygously inactivated by a complex chromosomal rearrangement, which separates the 5'-part from the 3'-part of the gene. The rearrangement involves sequences of the inverted 100-kb LCR and a human endogenous retrovirus element and may be associated with an inversion that is indistinguishable from the known inversion polymorphism affecting the ~0.7-Mb sequence intervening the LCR. Its formation is best explained by a replication-based mechanism (RBM) such as fork stalling and template switching/microhomology-mediated break-induced replication (FoSTeS/MMBIR). This finding supports the hypothesis that the inverted LCR can not only facilitate the formation of the non-allelic homologous recombination-mediated inversion polymorphism but it also promotes the occurrence of more complex rearrangements that can be associated with a large inversion, as well, but are mediated by a RBM. This further suggests that among the inversion polymorphism on 7p22.1, more complex rearrangements might be hidden. Furthermore, as the locus is embedded in a common fragile site (CFS) region, this rearrangement also supports the recently raised hypothesis that CFS sequence motifs may facilitate replication-based rearrangement mechanisms.

  20. Spherical α-MnO2 Supported on N-KB as Efficient Electrocatalyst for Oxygen Reduction in Al–Air Battery

    Directory of Open Access Journals (Sweden)

    Kui Chen

    2018-04-01

    Full Text Available Traditional noble metal platinum (Pt is regarded as a bifunctional oxygen catalyst due to its highly catalytic efficiency, but its commercial availability and application is often restricted by high cost. Herein, a cheap and effective catalyst mixed with α-MnO2 and nitrogen-doped Ketjenblack (N-KB (denoted as MnO2-SM150-0.5 is examined as a potential electrocatalyst in oxygen reduction reactions (ORR and oxygen evolution reactions (OER. This α-MnO2 is prepared by redox reaction between K2S2O8 and MnSO4 in acid conditions with a facile hydrothermal process (named the SM method. As a result, MnO2-SM150-0.5 exhibits a good catalytic performance for ORR in alkaline solution, and this result is comparable to a Pt/C catalyst. Moreover, this catalyst also shows superior durability and methanol tolerance compared with a Pt/C catalyst. It also displays a discharge voltage (~1.28 V at a discharge density of 50 mA cm−2 in homemade Al–air batteries that is higher than commercial 20% Pt/C (~1.19 V. The superior electrocatalytic performance of MnO2-SM150-0.5 could be attributed to its higher Mn3+/Mn4+ ratio and the synergistic effect between MnO2 and the nitrogen-doped KB. This study provides a novel strategy for the preparation of an MnO2-based composite electrocatalyst.

  1. Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others

    1994-09-01

    The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.

  2. Price of shifting the Hubble constant

    Science.gov (United States)

    Evslin, Jarah; Sen, Anjan A.; Ruchika

    2018-05-01

    An anisotropic measurement of the baryon acoustic oscillation (BAO) feature fixes the product of the Hubble constant and the acoustic scale H0rd. Therefore, regardless of the dark energy dynamics, to accommodate a higher value of H0 one needs a lower rd and so necessarily a modification of early time cosmology. One must either reduce the age of the Universe at the drag epoch or else the speed of sound in the primordial plasma. The first can be achieved, for example, with dark radiation or very early dark energy, automatically preserving the angular size of the acoustic scale in the cosmic microwave background (CMB) with no modifications to post-recombination dark energy. However, it is known that the simplest such modifications fall afoul of CMB constraints at higher multipoles. As an example, we combine anisotropic BAO with geometric measurements from strong lensing time delays from H0LiCOW and megamasers from the Megamaser Cosmology Project to measure rd, with and without the local distance ladder measurement of H0. We find that the best fit value of rd is indeed quite insensitive to the dark energy model and is also hardly affected by the inclusion of the local distance ladder data.

  3. Trinucleon asymptotic normalization constants including Coulomb effects

    International Nuclear Information System (INIS)

    Friar, J.L.; Gibson, B.F.; Lehman, D.R.; Payne, G.L.

    1982-01-01

    Exact theoretical expressions for calculating the trinucleon S- and D-wave asymptotic normalization constants, with and without Coulomb effects, are presented. Coordinate-space Faddeev-type equations are used to generate the trinucleon wave functions, and integral relations for the asymptotic norms are derived within this framework. The definition of the asymptotic norms in the presence of the Coulomb interaction is emphasized. Numerical calculations are carried out for the s-wave NN interaction models of Malfliet and Tjon and the tensor force model of Reid. Comparison with previously published results is made. The first estimate of Coulomb effects for the D-wave asymptotic norm is given. All theoretical values are carefully compared with experiment and suggestions are made for improving the experimental situation. We find that Coulomb effects increase the 3 He S-wave asymptotic norm by less than 1% relative to that of 3 H, that Coulomb effects decrease the 3 He D-wave asymptotic norm by approximately 8% relative to that of 3 H, and that the distorted-wave Born approximation D-state parameter, D 2 , is only 1% smaller in magnitude for 3 He than for 3 H due to compensating Coulomb effects

  4. Magnetically modified biocells in constant magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Abramov, E.G.; Panina, L.K. [Saint Petersburg State University, St. Petersburg (Russian Federation); Kolikov, V.A., E-mail: kolikov1@yandex.ru [Institute for Electrophysics and Electric Power of the RAS, St. Petersburg (Russian Federation); Bogomolova, E.V. [Botanical Institute of the RAS after V.L.Komarov, St. Petersburg (Russian Federation); Snetov, V.N. [Institute for Electrophysics and Electric Power of the RAS, St. Petersburg (Russian Federation); Cherepkova, I.A. [Saint Petersburg State Institute of Technology, St. Petersburg (Russian Federation); Kiselev, A.A. [Institute for Electrophysics and Electric Power of the RAS, St. Petersburg (Russian Federation)

    2017-02-01

    Paper addresses the inverse problem in determining the area, where the external constant magnetic field captures the biological cells modified by the magnetic nanoparticles. Zero velocity isolines, in area where the modified cells are captured by the magnetic field were determined by numerical method for two locations of the magnet. The problem was solved taking into account the gravitational field, magnetic induction, density of medium, concentration and size of cells, and size and magnetization of nanoparticles attached to the cell. Increase in the number of the nanoparticles attached to the cell and decrease in the cell’ size, enlarges the area, where the modified cells are captured and concentrated by the magnet. Solution is confirmed by the visible pattern formation of the modified cells Saccharomyces cerevisiae. - Highlights: • The inverse problem was solved for finding zero velocity isolines of magnetically modified biological cells. • Solution of the inverse problem depends on the size of cells and the number of nanoparticles attached to the single cell. • The experimental data are in agreement with theoretical solution.

  5. Analysis of the chemical equilibrium of combustion at constant volume

    Directory of Open Access Journals (Sweden)

    Marius BREBENEL

    2014-04-01

    Full Text Available Determining the composition of a mixture of combustion gases at a given temperature is based on chemical equilibrium, when the equilibrium constants are calculated on the assumption of constant pressure and temperature. In this paper, an analysis of changes occurring when combustion takes place at constant volume is presented, deriving a specific formula of the equilibrium constant. The simple reaction of carbon combustion in pure oxygen in both cases (constant pressure and constant volume is next considered as example of application, observing the changes occurring in the composition of the combustion gases depending on temperature.

  6. Investigation of three flavonoids binding to bovine serum albumin using molecular fluorescence technique

    International Nuclear Information System (INIS)

    Bi Shuyun; Yan Lili; Pang Bo; Wang Yu

    2012-01-01

    The three flavonoids including naringenin, hesperetin and apigenin binding to bovine serum albumin (BSA) at pH 7.4 was studied by fluorescence quenching, synchronous fluorescence and UV-vis absorption spectroscopic techniques. The results obtained revealed that naringenin, hesperetin and apigenin strongly quenched the intrinsic fluorescence of BSA. The Stern-Volmer curves suggested that these quenching processes were all static quenching processes. At 291 K, the value and the order of the binding constant were K A n aringenin) =4.08x10 4 A(hesperetin) =5.40x10 4 ∼K A(apigenin) =5.32x10 4 L mol -1 . The main binding force between the flavonoid and BSA was hydrophobic and electrostatic force. According to the Foerster theory of non-radiation energy transfer, the binding distances (r 0 ) were obtained as 3.36, 3.47 and 3.30 nm for naringenin-BSA, hesperetin-BSA and apigenin-BSA, respectively. The effect of some common ions such as Fe 3+ , Cu 2+ , Mg 2+ , Mn 2+ , Zn 2+ and Ca 2+ on the binding was also studied in detail. The competition binding was also performed. The apparent binding constant (K' A ) obtained suggested that one flavonoid had an obvious effect on the binding of another flavonoid to protein when they coexisted in BSA solution. - Highlights: → Quenchings of BSA fluorescence by the flavonoids was all static quenchings. → Synchronous fluorescence was applied to study the structural change of BSA. → Binding constant, binding site and binding force were determined. → Competition binding experiments were performed. → One flavonoid had an obvious effect on the binding of another one to BSA.

  7. Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

    Science.gov (United States)

    Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

    2011-01-01

    Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

  8. The binding of cytochrome c to neuroglobin: A docking and surface plasmon resonance study

    DEFF Research Database (Denmark)

    Bønding, Signe Helbo; Henty, K.; Dingley, A.J.

    2008-01-01

    is associated with a small unfavourable enthalpy change (1.9 kcal mol-1) and a moderately large, favourable entropy change (14.8 cal mol-1 deg-1). The sensitivity of the binding constant to the presence of salt suggests that the complex formation involves electrostatic interactions....... one major binding site for cytochrome c to neuroglobin. The results yield a plausible structure for the most likely complex structure in which the hemes of each protein are in close contact. NMR analysis identifies the formation of a weak complex in which the heme group of cytochrome c is involved....... surface plasmon resonance studies provide a value of 45 μM for the equilibrium constant for cytochrome c binding to neuroglobin, which increases significantly as the ionic strength of the solution increases. The temperature dependence of the binding constant indicates that the complex formation...

  9. Kinetics and equilibria of cyanide binding to prostaglandin H synthase.

    Science.gov (United States)

    MacDonald, I D; Dunford, H B

    1989-09-01

    Cyanide binding to prostaglandin H (PGH) synthase results in a spectral shift in the Soret region. This shift was exploited to determine equilibrium and kinetic parameters of the cyanide binding process. At pH 8.0, ionic strength 0.22 M, 4 degrees C, the cyanide dissociation constant, determined from equilibrium experiments, is (65 +/- 10) microM. The binding rate constant is (2.8 +/- 0.2) x 10(3) M-1 s-1, and the dissociation rate constant is zero within experimental error. Through a kinetic study of the binding process as a function of pH, from pH 3.96 to 8.00, it was possible to determine the pKa of a heme-linked acid group on the enzyme of 4.15 +/- 0.10 with citrate buffer. An apparent pKa of 4.75 +/- 0.03 was determined with acetate buffer; this different value is attributed to complexation of the enzyme with one of the components of the acetate buffer.

  10. Binding of resveratrol with sodium caseinate in aqueous solutions.

    Science.gov (United States)

    Acharya, Durga P; Sanguansri, Luz; Augustin, Mary Ann

    2013-11-15

    The interaction between resveratrol (Res) and sodium caseinate (Na-Cas) has been studied by measuring fluorescence quenching of the protein by resveratrol. Quenching constants were determined using Stern-Volmer equation, which suggests that both dynamic and static quenching occur between Na-Cas and Res. Binding constants for the complexation between Na-Cas and Res were determined at different temperatures. The large binding constants (3.7-5.1×10(5)M(-1)) suggest that Res has strong affinity for Na-Cas. This affinity decreases as the temperature is raised from 25 to 37°C. The binding involves both hydrogen bonding and hydrophobic interaction, as suggested by negative enthalpy change and positive entropy change for the binding reaction. The present study indicates that Na-Cas, a common food protein, may be used as a carrier of Res, a bioactive polyphenol which is insoluble in both water and oils. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  12. Bondi mass with a cosmological constant

    Science.gov (United States)

    Saw, Vee-Liem

    2018-04-01

    The mass loss of an isolated gravitating system due to energy carried away by gravitational waves with a cosmological constant Λ ∈R was recently worked out, using the Newman-Penrose-Unti approach. In that same article, an expression for the Bondi mass of the isolated system, MΛ, for the Λ >0 case was proposed. The stipulated mass MΛ would ensure that in the absence of any incoming gravitational radiation from elsewhere the emitted gravitational waves must carry away a positive-definite energy. That suggested quantity, however, introduced a Λ -correction term to the Bondi mass MB (where MB is the usual Bondi mass for asymptotically flat spacetimes), which would involve information not just on the state of the system at that moment but ostensibly also its past history. In this paper, we derive the identical mass-loss equation using an integral formula on a hypersurface formulated by Frauendiener based on the Nester-Witten identity and argue that one may adopt a generalization of the Bondi mass with Λ ∈R without any correction, viz., MΛ=MB for any Λ ∈R . Furthermore, with MΛ=MB, we show that for purely quadrupole gravitational waves given off by the isolated system (i.e., when the "Bondi news" σo comprises only the l =2 components of the spherical harmonics with spin-weight 2) the energy carried away is manifestly positive definite for the Λ >0 case. For a general σo having higher multipole moments, this perspicuous property in the Λ >0 case still holds if those l >2 contributions are weak—more precisely, if they satisfy any of the inequalities given in this paper.

  13. Computing the Gromov hyperbolicity constant of a discrete metric space

    KAUST Repository

    Ismail, Anas

    2012-01-01

    , and many other areas of research. The Gromov hyperbolicity constant of several families of graphs and geometric spaces has been determined. However, so far, the only known algorithm for calculating the Gromov hyperbolicity constant δ of a discrete metric

  14. Retrospective analysis in oculocutaneous albinism patients for the 2.7 kb deletion in the OCA2 gene revealed a co-segregation of the controversial variant, p.R305W.

    Science.gov (United States)

    Gao, Jackson; D'Souza, Leera; Wetherby, Keith; Antolik, Christian; Reeves, Melissa; Adams, David R; Tumminia, Santa; Wang, Xinjing

    2017-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. A significant portion of OCA patients has been found with a single pathogenic variant either in the TYR or the OCA2 gene. Diagnostic sequencing of the TYR and OCA2 genes is routinely used for molecular diagnosis of OCA subtypes. To study the possibility that genomic abnormalities with single or multiple exon involvement may account for a portion of the potential missing pathogenic variants (the second), we retrospectively analyzed the TYR gene by long range PCR and analyzed the target 2.7 kb deletion in the OCA2 gene spanning exon 7 in OCA patients with a single pathogenic variant in the target genes. In the 108 patients analyzed, we found that one patient was heterozygous for the 2.7 kb OCA2 gene deletion and this patient was positive with one pathogenic variant and one possibly pathogenic variant [c.1103C>T (p.Ala368Val) + c.913C>T (p.R305W)]. Further analysis of maternal DNA, and two additional OCA DNA homozygous for the 2.7 kb deletion, revealed that the phenotypically normal mother is heterozygous of the 2.7 kb deletion and homozygous of the p.R305W. The two previously reported patients with homozygous of the 2.7 kb deletion are also homozygous of p.R305W. Among the reported pathogenic variants, the pathogenicity of the p.R305W has been discussed intensively in literature. Our results indicate that p.R305W is unlikely a pathogenic variant. The possibility of linkage disequilibrium between p.R305W with the 2.7 kb deletion in OCA2 gene is also suggested.

  15. Constant voltage and constant current control implementation for electric vehicles (evs) wireless charger

    Science.gov (United States)

    Tampubolon, Marojahan; Pamungkas, Laskar; Hsieh, Yao Ching; Chiu, Huang Jen

    2018-04-01

    This paper presents the implementation of Constant Voltage (CV) and Constant Current (CC) control for a wireless charger system. A battery charging system needs these control modes to ensure the safety of the battery and the effectiveness of the charging system. Here, the wireless charger system does not employ any post-regulator stage to control the output voltage and output current of the charger. But, it uses a variable frequency control incorporated with a conventional PI control. As a result, the size and the weight of the system are reduced. This paper discusses the brief review of the SS-WPT, control strategy and implementation of the CV and CC control. Experimental hardware with 2kW output power has been performed and tested. The results show that the proposed CV and CC control method works well with the system.

  16. Articles translated from journal Yadernye Konstanty (Nuclear Constants). Series: Nuclear Constants, Issue No. 2, 1999

    International Nuclear Information System (INIS)

    2001-02-01

    This report contains translations of eleven papers published in the Nuclear Constants journal (Voprosy Atomnoj Nauki I Teknniki, seriya: Yadernye Konstanty (YK), vypusk 2, 1999). They are marked as ''Translated from Russian''. Four original papers published in YK in English are included with correction of found misprints and small format changes. As a result the report contains all papers presented in YK, 2 (1999). (author)

  17. Articles translated from Journal Yadernye Konstanty (Nuclear Constants). Series: Nuclear Constants, Issue No. 1, 2001

    International Nuclear Information System (INIS)

    2002-12-01

    This report contains translations of eight papers published in the Nuclear Constants journal (Voprosy Atomnoj Nauki I Teknniki, seriya: Yadernye Konstanty (YK), vypusk 1, 2001). They are marked as 'Translated from Russian'. Six original papers published in YK in English are included with correction of found misprints and small format changes. As a result the report contains all papers presented in YK, 1 (2001). (author)

  18. Articles translated from Journal Yadernye Konstanty (Nuclear Constants). Series: Nuclear Constants, Issue No. 2, 2000

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-10-01

    This report contains translations of five papers published in the Nuclear Constants journal (Voprosy Atomnoj Nauki I Teknniki, seriya: Yadernye Konstanty (YK), vypusk 2, 2000). They are marked as 'Translated from Russian'. Two original papers published in YK in English are included with correction of found misprints and small format changes. As a result, the report contains all papers presented in YK, 2 (2000). (author)

  19. Articles translated from Journal Yadernye Konstanty (Nuclear Constants). Series: Nuclear Constants, Issue No. 1, 2000

    International Nuclear Information System (INIS)

    2001-12-01

    This report contains translations of seven papers published in the Nuclear Constants journal (Voprosy Atomnoj Nauki I Teknniki, seriya: Yadernye Konstanty (YK), vypusk 1, 2000). They are marked as 'Translated from Russian'. Two original papers published in YK in English are included with correction of found misprints and small format changes. As a result the report contains all papers presented in YK, 1 (2000). (author)

  20. Determination of constants of factorized pairing force from conservation laws

    International Nuclear Information System (INIS)

    Voronkov, Yu.P.; Mikhajlov, V.M.

    1975-01-01

    The constants of a factorized interaction in the particle-particle channel are evaluated on the basis of average field parameters and Cooper pairing. The relations between the constants of multipole particle-particle forces are derived for the spherical nuclei. The constants of the quadrupole pairing are obtained for deformed nuclei from the angular momentum conservation law. The calculated constants are compared with empiricalones