Search for Binary Black Hole Candidates from the VLBI Images of ...

Indian Academy of Sciences (India)

2016-01-27

Jan 27, 2016 ... We have searched the core-jet pairs in the VLBI scales (< 1 kpc), from several VLBI catalogues, and found out 5 possible Binary Black Hole (BBH) candidates. We present here the search results and analyse the candidates preliminarily. We plan to study with multi-band VLBI observation. We also plan to ...

Caenorhabditis elegans HIM-18/SLX-4 interacts with SLX-1 and XPF-1 and maintains genomic integrity in the germline by processing recombination intermediates.

Science.gov (United States)

Saito, Takamune T; Youds, Jillian L; Boulton, Simon J; Colaiácovo, Monica P

2009-11-01

Homologous recombination (HR) is essential for the repair of blocked or collapsed replication forks and for the production of crossovers between homologs that promote accurate meiotic chromosome segregation. Here, we identify HIM-18, an ortholog of MUS312/Slx4, as a critical player required in vivo for processing late HR intermediates in Caenorhabditis elegans. DNA damage sensitivity and an accumulation of HR intermediates (RAD-51 foci) during premeiotic entry suggest that HIM-18 is required for HR-mediated repair at stalled replication forks. A reduction in crossover recombination frequencies-accompanied by an increase in HR intermediates during meiosis, germ cell apoptosis, unstable bivalent attachments, and subsequent chromosome nondisjunction-support a role for HIM-18 in converting HR intermediates into crossover products. Such a role is suggested by physical interaction of HIM-18 with the nucleases SLX-1 and XPF-1 and by the synthetic lethality of him-18 with him-6, the C. elegans BLM homolog. We propose that HIM-18 facilitates processing of HR intermediates resulting from replication fork collapse and programmed meiotic DSBs in the C. elegans germline.

Caenorhabditis elegans HIM-18/SLX-4 interacts with SLX-1 and XPF-1 and maintains genomic integrity in the germline by processing recombination intermediates.

Directory of Open Access Journals (Sweden)

Takamune T Saito

2009-11-01

Full Text Available Homologous recombination (HR is essential for the repair of blocked or collapsed replication forks and for the production of crossovers between homologs that promote accurate meiotic chromosome segregation. Here, we identify HIM-18, an ortholog of MUS312/Slx4, as a critical player required in vivo for processing late HR intermediates in Caenorhabditis elegans. DNA damage sensitivity and an accumulation of HR intermediates (RAD-51 foci during premeiotic entry suggest that HIM-18 is required for HR-mediated repair at stalled replication forks. A reduction in crossover recombination frequencies-accompanied by an increase in HR intermediates during meiosis, germ cell apoptosis, unstable bivalent attachments, and subsequent chromosome nondisjunction-support a role for HIM-18 in converting HR intermediates into crossover products. Such a role is suggested by physical interaction of HIM-18 with the nucleases SLX-1 and XPF-1 and by the synthetic lethality of him-18 with him-6, the C. elegans BLM homolog. We propose that HIM-18 facilitates processing of HR intermediates resulting from replication fork collapse and programmed meiotic DSBs in the C. elegans germline.

A Multi-wavelength Analysis of Binary-AGN Candidate PSO J334.2028+01.4075

OpenAIRE

Foord, Adi; Gultekin, Kayhan; Reynolds, Mark; Ayers, Megan; Liu, Tingting; Gezari, Suvi; Runnoe, Jessie

2017-01-01

We present analysis of the first Chandra observation of PSO J334.2028+01.4075 (PSO J334), targeted as a binary-AGN candidate based on periodic variations of the optical flux. With no prior targeted X-ray coverage for PSO J334, our new 40 ksec Chandra observation allows for the opportunity to differentiate between a single or binary-AGN system, and if a binary, can characterize the mode of accretion. Simulations show that the two expected accretion disk morphologies for binary-AGN systems are ...

Near-Earth Asteroid 2005 CR37: Radar Images and Photometry of a Candidate Contact Binary

Science.gov (United States)

Benner, Lance A. M.; Nolan, Michael C.; Ostro, Steven J.; Giorgini, Jon D.; Pray, Donald P.; Harris, Alan W.; Magri, Christopher; Margot, Jean-Luc

2006-01-01

Arecibo (2380 MHz, 13 cm) radar observations of 2005 CR37 provide detailed images of a candidate contact binary: a 1.8-km-long, extremely bifurcated object. Although the asteroid's two lobes are round, there are regions of modest topographic relief, such as an elevated, 200-m-wide facet, that suggest that the lobes are geologically more complex than either coherent fragments or homogeneous rubble piles. Since January 1999, about 9% of NEAs larger than approx.200 m imaged by radar can be described as candidate contact binaries.

[Liivimaa valgustaja August Wilhelm Hupel 1737- 1819] / Kai Reemann

Index Scriptorium Estoniae

Reemann, Kai

2010-01-01

Eesti Looduseuurijate Selts raamatukogu juhataja Kai Reemann tutvustab nii raamatukogu kui ka 2004. aastal parimaks ajalooraamatuks tunnistatud teost "Liivimaa valgustaja August Wilhelm Hupel 1737- 1819" (Tallinn, 2004)

The Gaia-ESO Survey: double-, triple-, and quadruple-line spectroscopic binary candidates

Science.gov (United States)

Merle, T.; Van Eck, S.; Jorissen, A.; Van der Swaelmen, M.; Masseron, T.; Zwitter, T.; Hatzidimitriou, D.; Klutsch, A.; Pourbaix, D.; Blomme, R.; Worley, C. C.; Sacco, G.; Lewis, J.; Abia, C.; Traven, G.; Sordo, R.; Bragaglia, A.; Smiljanic, R.; Pancino, E.; Damiani, F.; Hourihane, A.; Gilmore, G.; Randich, S.; Koposov, S.; Casey, A.; Morbidelli, L.; Franciosini, E.; Magrini, L.; Jofre, P.; Costado, M. T.; Jeffries, R. D.; Bergemann, M.; Lanzafame, A. C.; Bayo, A.; Carraro, G.; Flaccomio, E.; Monaco, L.; Zaggia, S.

2017-12-01

Context. The Gaia-ESO Survey (GES) is a large spectroscopic survey that provides a unique opportunity to study the distribution of spectroscopic multiple systems among different populations of the Galaxy. Aims: Our aim is to detect binarity/multiplicity for stars targeted by the GES from the analysis of the cross-correlation functions (CCFs) of the GES spectra with spectral templates. Methods: We developed a method based on the computation of the CCF successive derivatives to detect multiple peaks and determine their radial velocities, even when the peaks are strongly blended. The parameters of the detection of extrema (DOE) code have been optimized for each GES GIRAFFE and UVES setup to maximize detection. The DOE code therefore allows to automatically detect multiple line spectroscopic binaries (SBn, n ≥ 2). Results: We apply this method on the fourth GES internal data release and detect 354 SBn candidates (342 SB2, 11 SB3, and even one SB4), including only nine SBs known in the literature. This implies that about 98% of these SBn candidates are new because of their faint visual magnitude that can reach V = 19. Visual inspection of the SBn candidate spectra reveals that the most probable candidates have indeed a composite spectrum. Among the SB2 candidates, an orbital solution could be computed for two previously unknown binaries: CNAME 06404608+0949173 (known as V642 Mon) in NGC 2264 and CNAME 19013257-0027338 in Berkeley 81 (Be 81). A detailed analysis of the unique SB4 (four peaks in the CCF) reveals that CNAME 08414659-5303449 (HD 74438) in the open cluster IC 2391 is a physically bound stellar quadruple system. The SB candidates belonging to stellar clusters are reviewed in detail to discard false detections. We suggest that atmospheric parameters should not be used for these system components; SB-specific pipelines should be used instead. Conclusions: Our implementation of an automatic detection of spectroscopic binaries within the GES has allowed the

SpeX Spectroscopy of Unresolved Very Low-Mass Binaries. I. Identification of Seventeen Candidate Binaries Straddling the L Dwarf/T Dwarf Transition

OpenAIRE

Burgasser, Adam J.; Cruz, Kelle L.; Cushing, Michael C.; Gelino, Christopher R.; Looper, Dagny L.; Faherty, Jacqueline K.; Kirkpatrick, J. Davy; Reid, I. Neill

2009-01-01

We report the identification of 17 candidate brown dwarf binaries whose components straddle the L dwarf/T dwarf transition. These sources were culled from a large near-infrared spectral sample of L and T dwarfs observed with the Infrared Telescope Facility SpeX spectrograph. Candidates were selected on the basis of spectral ratios which segregate known (resolved) L dwarf/T dwarf pairs from presumably single sources. Composite templates, constructed by combining 13581 pairs of absolute flux-ca...

7 CFR 1737.41 - Procedure for obtaining approval.

Science.gov (United States)

2010-01-01

... RUS financing. (3) The proposed interim financing presents unacceptable loan security risks to RUS, or..., DEPARTMENT OF AGRICULTURE PRE-LOAN POLICIES AND PROCEDURES COMMON TO INSURED AND GUARANTEED TELECOMMUNICATIONS LOANS Interim Financing of Construction of Telephone Facilities § 1737.41 Procedure for obtaining...

Testing the relativistic Doppler boost hypothesis for supermassive black hole binary candidates

Science.gov (United States)

Charisi, Maria; Haiman, Zoltán; Schiminovich, David; D'Orazio, Daniel J.

2018-06-01

Supermassive black hole binaries (SMBHBs) should be common in galactic nuclei as a result of frequent galaxy mergers. Recently, a large sample of sub-parsec SMBHB candidates was identified as bright periodically variable quasars in optical surveys. If the observed periodicity corresponds to the redshifted binary orbital period, the inferred orbital velocities are relativistic (v/c ≈ 0.1). The optical and ultraviolet (UV) luminosities are expected to arise from gas bound to the individual BHs, and would be modulated by the relativistic Doppler effect. The optical and UV light curves should vary in tandem with relative amplitudes which depend on the respective spectral slopes. We constructed a control sample of 42 quasars with aperiodic variability, to test whether this Doppler colour signature can be distinguished from intrinsic chromatic variability. We found that the Doppler signature can arise by chance in ˜20 per cent (˜37 per cent) of quasars in the nUV (fUV) band. These probabilities reflect the limited quality of the control sample and represent upper limits on how frequently quasars mimic the Doppler brightness+colour variations. We performed separate tests on the periodic quasar candidates, and found that for the majority, the Doppler boost hypothesis requires an unusually steep UV spectrum or an unexpectedly large BH mass and orbital velocity. We conclude that at most approximately one-third of these periodic candidates can harbor Doppler-modulated SMBHBs.

RED GIANTS IN ECLIPSING BINARY AND MULTIPLE-STAR SYSTEMS: MODELING AND ASTEROSEISMIC ANALYSIS OF 70 CANDIDATES FROM KEPLER DATA

International Nuclear Information System (INIS)

Gaulme, P.; McKeever, J.; Rawls, M. L.; Jackiewicz, J.; Mosser, B.; Guzik, J. A.

2013-01-01

Red giant stars are proving to be an incredible source of information for testing models of stellar evolution, as asteroseismology has opened up a window into their interiors. Such insights are a direct result of the unprecedented data from space missions CoRoT and Kepler as well as recent theoretical advances. Eclipsing binaries are also fundamental astrophysical objects, and when coupled with asteroseismology, binaries provide two independent methods to obtain masses and radii and exciting opportunities to develop highly constrained stellar models. The possibility of discovering pulsating red giants in eclipsing binary systems is therefore an important goal that could potentially offer very robust characterization of these systems. Until recently, only one case has been discovered with Kepler. We cross-correlate the detected red giant and eclipsing-binary catalogs from Kepler data to find possible candidate systems. Light-curve modeling and mean properties measured from asteroseismology are combined to yield specific measurements of periods, masses, radii, temperatures, eclipse timing variations, core rotation rates, and red giant evolutionary state. After using three different techniques to eliminate false positives, out of the 70 systems common to the red giant and eclipsing-binary catalogs we find 13 strong candidates (12 previously unknown) to be eclipsing binaries, one to be a non-eclipsing binary with tidally induced oscillations, and 10 more to be hierarchical triple systems, all of which include a pulsating red giant. The systems span a range of orbital eccentricities, periods, and spectral types F, G, K, and M for the companion of the red giant. One case even suggests an eclipsing binary composed of two red giant stars and another of a red giant with a δ-Scuti star. The discovery of multiple pulsating red giants in eclipsing binaries provides an exciting test bed for precise astrophysical modeling, and follow-up spectroscopic observations of many of the

7 CFR 1737.31 - Area Coverage Survey (ACS).

Science.gov (United States)

2010-01-01

... an ACS are provided in RUS Telecommunications Engineering and Construction Manual section 205. (e... Studies-Area Coverage Survey and Loan Design § 1737.31 Area Coverage Survey (ACS). (a) The Area Coverage... the borrower's records contain sufficient information as to subscriber development to enable cost...

7 CFR 1737.80 - Description of characteristics letter.

Science.gov (United States)

2010-01-01

... the amount of the proposed loan, its purposes, rate of interest, loan security requirements, and other... SERVICE, DEPARTMENT OF AGRICULTURE PRE-LOAN POLICIES AND PROCEDURES COMMON TO INSURED AND GUARANTEED TELECOMMUNICATIONS LOANS Characteristics Letter § 1737.80 Description of characteristics letter. (a) After all of the...

49 CFR 173.7 - Government operations and materials.

Science.gov (United States)

2010-10-01

...) Determining the airworthiness and directing maintenance of the aircraft; and (3) Dispatching the aircraft... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS General § 173.7 Government operations and materials. (a) Hazardous... regulations in this subchapter or in packagings of equal or greater strength and efficiency as certified by...

Giant Planet Candidates, Brown Dwarfs, and Binaries from the SDSS-III MARVELS Planet Survey.

Science.gov (United States)

Thomas, Neil; Ge, Jian; Li, Rui; de Lee, Nathan M.; Heslar, Michael; Ma, Bo; SDSS-Iii Marvels Team

2015-01-01

We report the discoveries of giant planet candidates, brown dwarfs, and binaries from the SDSS-III MARVELS survey. The finalized 1D pipeline has provided 18 giant planet candidates, 16 brown dwarfs, and over 500 binaries. An additional 96 targets having RV variability indicative of a giant planet companion are also reported for future investigation. These candidates are found using the advanced MARVELS 1D data pipeline developed at UF from scratch over the past three years. This pipeline carefully corrects most of the instrument effects (such as trace, slant, distortion, drifts and dispersion) and observation condition effects (such as illumination profile, fiber degradation, and tracking variations). The result is long-term RV precisions that approach the photon limits in many cases for the ~89,000 individual stellar observations. A 2D version of the pipeline that uses interferometric information is nearing completion and is demonstrating a reduction of errors to half the current levels. The 2D processing will be used to increase the robustness of the detections presented here and to find new candidates in RV regions not confidently detectable with the 1D pipeline. The MARVELS survey has produced the largest homogeneous RV measurements of 3300 V=7.6-12 FGK stars with a well defined cadence of 27 RV measurements over 2 years. The MARVELS RV data and other follow-up data (photometry, high contrast imaging, high resolution spectroscopy and RV measurements) will explore the diversity of giant planet companion formation and evolution around stars with a broad range in metallicity (Fe/H -1.5-0.5), mass ( 0.6-2.5M(sun)), and environment (thin disk and thick disk), and will help to address the key scientific questions identified for the MARVELS survey including, but not limited to: Do metal poor stars obey the same trends for planet occurrence as metal rich stars? What is the distribution of giant planets around intermediate-mass stars and binaries? Is the 'planet desert

Supermassive Black Hole Binary Candidates from the Pan-STARRS1 Medium Deep Survey

Science.gov (United States)

Liu, Tingting; Gezari, Suvi

2018-01-01

Supermassive black hole binaries (SMBHBs) should be a common product of the hierarchal growth of galaxies and gravitational wave sources at nano-Hz frequencies. We have performed a systematic search in the Pan-STARRS1 Medium Deep Survey for periodically varying quasars, which are predicted manifestations of SMBHBs, and identified 26 candidates that are periodically varying on the timescale of ~300-1000 days over the 4-year baseline of MDS. We continue to monitor them with the Discovery Channel Telescope and the LCO network telescopes and thus are able to extend the baseline to 3-8 cycles and break false positive signals due to stochastic, normal quasar variability. From our imaging campaign, five candidates show persistent periodic variability and remain strong SMBHB candidates for follow-up observations. We calculate the cumulative number rate of SMBHBs and compare with previous work. We also compare the gravitational wave strain amplitudes of the candidates with the capability of pulsar timing arrays and discuss the future capabilities to detect periodic quasar and SMBHB candidates with the Large Synoptic Survey Telescope.

Tratamiento de la litiasis piélica con el litotritor MODULITH SLX-MX (STORZ Treatment of the pyelic lithiasis using the MODULITH SLX-NX (STORZ lithotriptor

Directory of Open Access Journals (Sweden)

María Victoria Labrada

2010-09-01

Full Text Available INTRODUCCIÓN. La litiasis urinaria es una enfermedad de alta prevalencia y recurrencia, a la que los hospitales no pueden dar solución quirúrgica con la celeridad necesaria. La litotricia extracorpórea por ondas de choque (LEC es la primera opción de tratamiento y las tasas de resolución fluctúan del 33 al 90 %. El objetivo de este estudio fue analizar nuestros resultados con la utilización del litotritor MODULITH SLX-MX (STORZ para el tratamiento monoterápico de la litiasis de la pelvis renal. MÉTODOS. Se incluyeron pacientes con litiasis piélica que no hubieran recibido otro tratamiento. Se conformaron 4 grupos según la superficie litiásica y se relacionaron con la terapéutica (sesiones, ondas de choque, energía, complicaciones, aplicación de procedimientos auxiliares, maniobras complementarias y evolución. RESULTADOS. El mayor número de pacientes tenía cálculos de hasta 2 cm², y más del 92 % fueron resueltos con una sola sesión. Más del 94 % no presentó complicaciones y no se necesitaron procedimientos auxiliares en más del 97 % de los casos. CONCLUSIONES. Se lograron buenos resultados en más del 97 % de los casos mediante LEC monoterápica de la litiasis piélica de hasta 4 cm² utilizando el litotritor MODULITH SLX-MX (STORZ. Los mejores resultados se obtuvieron en los cálculos de hasta 3 cm² y más del 99 % de éstos correspondieron a los cálculos de hasta 2 cm². Las ventajas de este equipo se deben, sobre todo, a su alta eficacia y al hecho de que logra una fragmentación fina que facilita la eliminación total de los cálculos. Por esta razón, se consigue una alta tasa de resolución, sin restos de la litiasis en más del 97 % de los casos y con un mínimo de maniobras complementarias.INTRODUCTION. The urinary lithiasis is a disease with a high prevalence and recurrence and the hospitals can not give a surgical solution as quickly as possible. The shock waves extracorporeal lithotripsy (SWEL is the first

Photometric Follow-up of Eclipsing Binary Candidates from KELT and Kepler

Science.gov (United States)

Garcia Soto, Aylin; Rodriguez, Joseph E.; Bieryla, Allyson; KELT survey

2018-01-01

Eclipsing binaries (EBs) are incredibly valuable, as they provide the opportunity to precisely measure fundamental stellar parameters without the need for stellar models. Therefore, we can use EBs to directly test stellar evolution models. Constraining the stellar properties of stars is important since they directly influence our understanding of any planets orbiting them. Using the Harvard University's Clay 0.4m telescope and Fred Lawrence Whipple Observatory’s 1.2m telescope on Mount Hopkins, Arizona, we conducted follow-up multi-band photometric observations of EB candidates from the Kilodegree Extremely Little Telescope (KELT) survey and the Kepler mission. We will present our follow-up observations and AstroImageJ analysis on these 5 EB systems.

18 CFR 284.282 - Definitions.

Science.gov (United States)

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions. 284.282 Section 284.282 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... Blanket Certificates Authorizing Certain Natural Gas Sales by Interstate Pipelines § 284.282 Definitions...

30 CFR 282.3 - Definitions.

Science.gov (United States)

2010-07-01

... from such activity. Contingency Plan means a plan for action to be taken in emergency situations. Data... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Definitions. 282.3 Section 282.3 Mineral... CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR General § 282.3 Definitions. When used in this...

Dicty_cDB: SLH282 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH282 (Link to dictyBase) - - - Contig-U10985-1 | Contig-U15908-1 SLH2...82P (Link to Original site) SLH282F 506 SLH282Z 455 SLH282P 961 - - Show SLH282 Library SL (Link to library) Clone ID SLH2...85-1 | Contig-U15908-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH2...82Q.Seq.d/ Representative seq. ID SLH282P (Link to Original site) Representative DNA sequence >SLH282 (SLH2...82Q) /CSM/SL/SLH2-D/SLH282Q.Seq.d/ GGTTTTTAAAACTATTGATACTGAAGAGAATGGAATTATATCAATAACACAATTAAGACA

30 CFR 282.23 - Testing Plan.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Testing Plan. 282.23 Section 282.23 Mineral... § 282.23 Testing Plan. All testing activities shall be conducted in accordance with a Testing Plan... detailed Mining Plan than is obtainable under an approved Delineation Plan, to prepare feasibility studies...

30 CFR 282.22 - Delineation Plan.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Delineation Plan. 282.22 Section 282.22 Mineral... § 282.22 Delineation Plan. All exploration activities shall be conducted in accordance with a Delineation Plan submitted by the lessee and approved by the Director. The Delineation Plan shall describe the...

30 CFR 282.24 - Mining Plan.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Mining Plan. 282.24 Section 282.24 Mineral... § 282.24 Mining Plan. All OCS mineral development and production activities shall be conducted in accordance with a Mining Plan submitted by the lessee and approved by the Director. A Mining Plan shall...

30 CFR 282.26 - Contingency Plan.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Contingency Plan. 282.26 Section 282.26 Mineral... § 282.26 Contingency Plan. (a) When required by the Director, a lessee shall include a Contingency Plan as part of its request for approval of a Delineation, Testing, or Mining Plan. The Contingency Plan...

Optimized reversible binary-coded decimal adders

DEFF Research Database (Denmark)

Thomsen, Michael Kirkedal; Glück, Robert

2008-01-01

Abstract Babu and Chowdhury [H.M.H. Babu, A.R. Chowdhury, Design of a compact reversible binary coded decimal adder circuit, Journal of Systems Architecture 52 (5) (2006) 272-282] recently proposed, in this journal, a reversible adder for binary-coded decimals. This paper corrects and optimizes...... their design. The optimized 1-decimal BCD full-adder, a 13 × 13 reversible logic circuit, is faster, and has lower circuit cost and less garbage bits. It can be used to build a fast reversible m-decimal BCD full-adder that has a delay of only m + 17 low-power reversible CMOS gates. For a 32-decimal (128-bit....... Keywords: Reversible logic circuit; Full-adder; Half-adder; Parallel adder; Binary-coded decimal; Application of reversible logic synthesis...

Did ASAS-SN Kill the Supermassive Black Hole Binary Candidate PG1302-102?

Science.gov (United States)

Liu, Tingting; Gezari, Suvi; Miller, M. Coleman

2018-05-01

Graham et al. reported a periodically varying quasar and supermassive black hole binary candidate, PG1302-102 (hereafter PG1302), which was discovered in the Catalina Real-time Transient Survey (CRTS). Its combined Lincoln Near-Earth Asteroid Research (LINEAR) and CRTS optical light curve is well fitted to a sinusoid of an observed period of ≈1884 days and well modeled by the relativistic Doppler boosting of the secondary mini-disk. However, the LINEAR+CRTS light curve from MJD ≈52,700 to MJD ≈56,400 covers only ∼2 cycles of periodic variation, which is a short baseline that can be highly susceptible to normal, stochastic quasar variability. In this Letter, we present a reanalysis of PG1302 using the latest light curve from the All-sky Automated Survey for Supernovae (ASAS-SN), which extends the observational baseline to the present day (MJD ≈58,200), and adopting a maximum likelihood method that searches for a periodic component in addition to stochastic quasar variability. When the ASAS-SN data are combined with the previous LINEAR+CRTS data, the evidence for periodicity decreases. For genuine periodicity one would expect that additional data would strengthen the evidence, so the decrease in significance may be an indication that the binary model is disfavored.

KEPLER OBSERVATIONS OF THREE PRE-LAUNCH EXOPLANET CANDIDATES: DISCOVERY OF TWO ECLIPSING BINARIES AND A NEW EXOPLANET

International Nuclear Information System (INIS)

Howell, Steve B.; Rowe, Jason F.; Bryson, Stephen T.; Sherry, William; Von Braun, Kaspar; Ciardi, David R.; Feldmeier, John J.; Horch, Elliott; Van Belle, Gerard T.

2010-01-01

Three transiting exoplanet candidate stars were discovered in a ground-based photometric survey prior to the launch of NASA's Kepler mission. Kepler observations of them were obtained during Quarter 1 of the Kepler mission. All three stars are faint by radial velocity follow-up standards, so we have examined these candidates with regard to eliminating false positives and providing high confidence exoplanet selection. We present a first attempt to exclude false positives for this set of faint stars without high-resolution radial velocity analysis. This method of exoplanet confirmation will form a large part of the Kepler mission follow-up for Jupiter-sized exoplanet candidates orbiting faint stars. Using the Kepler light curves and pixel data, as well as medium-resolution reconnaissance spectroscopy and speckle imaging, we find that two of our candidates are binary stars. One consists of a late-F star with an early M companion, while the other is a K0 star plus a late M-dwarf/brown dwarf in a 19 day elliptical orbit. The third candidate (BOKS-1) is an r = 15 G8V star hosting a newly discovered exoplanet with a radius of 1.12 R Jupiter in a 3.9 day orbit.

Designing defect-based qubit candidates in wide-gap binary semiconductors for solid-state quantum technologies

Science.gov (United States)

Seo, Hosung; Ma, He; Govoni, Marco; Galli, Giulia

2017-12-01

The development of novel quantum bits is key to extending the scope of solid-state quantum-information science and technology. Using first-principles calculations, we propose that large metal ion-vacancy pairs are promising qubit candidates in two binary crystals: 4 H -SiC and w -AlN. In particular, we found that the formation of neutral Hf- and Zr-vacancy pairs is energetically favorable in both solids; these defects have spin-triplet ground states, with electronic structures similar to those of the diamond nitrogen-vacancy center and the SiC divacancy. Interestingly, they exhibit different spin-strain coupling characteristics, and the nature of heavy metal ions may allow for easy defect implantation in desired lattice locations and ensure stability against defect diffusion. To support future experimental identification of the proposed defects, we report predictions of their optical zero-phonon line, zero-field splitting, and hyperfine parameters. The defect design concept identified here may be generalized to other binary semiconductors to facilitate the exploration of new solid-state qubits.

27 CFR 28.282 - Beer.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Beer. 28.282 Section 28.282 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE... Beer. When beer has been laden on board the aircraft for use as supplies, the customs officer shall...

46 CFR 282.30 - Payment of subsidy.

Science.gov (United States)

2010-10-01

... include for payment in such voucher the amount of ODS accrued for the voyages terminated during the period. ... 46 Shipping 8 2010-10-01 2010-10-01 false Payment of subsidy. 282.30 Section 282.30 Shipping... COMMERCE OF THE UNITED STATES Subsidy Payment and Billing Procedures § 282.30 Payment of subsidy...

46 CFR 282.11 - Ranking of flags.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Ranking of flags. 282.11 Section 282.11 Shipping... COMMERCE OF THE UNITED STATES Foreign-Flag Competition § 282.11 Ranking of flags. The operators under each... priority of costs which are representative of the flag. For liner cargo vessels, the ranking of operators...

L1{sub 0} stacked binaries as candidates for hard-magnets. FePt, MnAl and MnGa

Energy Technology Data Exchange (ETDEWEB)

Matsushita, Yu-ichiro [Max-Planck Institut fuer Microstrukture Physics, Halle (Germany); Department of Applied Physics, The University of Tokyo (Japan); Madjarova, Galia [Max-Planck Institut fuer Microstrukture Physics, Halle (Germany); Department of Physical Chemistry, Faculty of Chemistry and Pharmacy, Sofia University (Bulgaria); Flores-Livas, Jose A. [Department of Physics, Universitaet Basel (Switzerland); Dewhurst, J.K.; Gross, E.K.U. [Max-Planck Institut fuer Microstrukture Physics, Halle (Germany); Felser, C. [Max Planck Institute for Chemical Physics of Solids, Dresden (Germany); Sharma, S. [Max-Planck Institut fuer Microstrukture Physics, Halle (Germany); Department of Physics, Indian Institute of Technology, Roorkee, Uttarkhand (India)

2017-08-15

We present a novel approach for designing new hard magnets by forming stacks of existing binary magnets to enhance the magneto crystalline anisotropy. This is followed by an attempt at reducing the amount of expensive metal in these stacks by replacing it with cheaper metal with similar ionic radius. This strategy is explored using examples of FePt, MnAl and MnGa. In this study a few promising materials are suggested as good candidates for hard magnets: stacked binary FePt{sub 2}MnGa{sub 2} in structure where each magnetic layer is separated by two non-magnetic layers, FePtMnGa and FePtMnAl in hexagonally distorted Heusler structures and FePt{sub 0.5}Ti{sub 0.5}MnAl. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

27 CFR 24.282 - Multiple transfers.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Multiple transfers. 24.282 Section 24.282 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... transfer record for all wine (including distilling material and vinegar stock) transferred by pipeline to...

Binary classification of items of interest in a repeatable process

Science.gov (United States)

Abell, Jeffrey A.; Spicer, John Patrick; Wincek, Michael Anthony; Wang, Hui; Chakraborty, Debejyo

2014-06-24

A system includes host and learning machines in electrical communication with sensors positioned with respect to an item of interest, e.g., a weld, and memory. The host executes instructions from memory to predict a binary quality status of the item. The learning machine receives signals from the sensor(s), identifies candidate features, and extracts features from the candidates that are more predictive of the binary quality status relative to other candidate features. The learning machine maps the extracted features to a dimensional space that includes most of the items from a passing binary class and excludes all or most of the items from a failing binary class. The host also compares the received signals for a subsequent item of interest to the dimensional space to thereby predict, in real time, the binary quality status of the subsequent item of interest.

46 CFR 282.23 - Hull and machinery insurance.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 282.23 Section 282.23... COMMERCE OF THE UNITED STATES Calculation of Subsidy Rates § 282.23 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery...

30 CFR 282.11 - Director's authority.

Science.gov (United States)

2010-07-01

... CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR Jurisdiction and Responsibilities of Director § 282.11 Director's authority. (a) In the exercise of jurisdiction under § 282.10, the Director is... of two or more OCS mineral leases or portions of two or more OCS mineral leases into a single mining...

Kepler eclipsing binary stars. IV. Precise eclipse times for close binaries and identification of candidate three-body systems

International Nuclear Information System (INIS)

Conroy, Kyle E.; Stassun, Keivan G.; Prša, Andrej; Orosz, Jerome A.; Welsh, William F.; Fabrycky, Daniel C.

2014-01-01

We present a catalog of precise eclipse times and analysis of third-body signals among 1279 close binaries in the latest Kepler Eclipsing Binary Catalog. For these short-period binaries, Kepler's 30 minute exposure time causes significant smearing of light curves. In addition, common astrophysical phenomena such as chromospheric activity, as well as imperfections in the light curve detrending process, can create systematic artifacts that may produce fictitious signals in the eclipse timings. We present a method to measure precise eclipse times in the presence of distorted light curves, such as in contact and near-contact binaries which exhibit continuously changing light levels in and out of eclipse. We identify 236 systems for which we find a timing variation signal compatible with the presence of a third body. These are modeled for the light travel time effect and the basic properties of the third body are derived. This study complements J. A. Orosz et al. (in preparation), which focuses on eclipse timing variations of longer period binaries with flat out-of-eclipse regions. Together, these two papers provide comprehensive eclipse timings for all binaries in the Kepler Eclipsing Binary Catalog, as an ongoing resource freely accessible online to the community.

Microlensing Signature of Binary Black Holes

Science.gov (United States)

Schnittman, Jeremy; Sahu, Kailash; Littenberg, Tyson

2012-01-01

We calculate the light curves of galactic bulge stars magnified via microlensing by stellar-mass binary black holes along the line-of-sight. We show the sensitivity to measuring various lens parameters for a range of survey cadences and photometric precision. Using public data from the OGLE collaboration, we identify two candidates for massive binary systems, and discuss implications for theories of star formation and binary evolution.

40 CFR 265.282 - Special requirements for incompatible wastes.

Science.gov (United States)

2010-07-01

..., STORAGE, AND DISPOSAL FACILITIES Land Treatment § 265.282 Special requirements for incompatible wastes... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Special requirements for incompatible wastes. 265.282 Section 265.282 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED...

40 CFR 264.282 - Special requirements for incompatible wastes.

Science.gov (United States)

2010-07-01

... DISPOSAL FACILITIES Land Treatment § 264.282 Special requirements for incompatible wastes. The owner or... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Special requirements for incompatible wastes. 264.282 Section 264.282 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED...

47 CFR 25.282 - Orbit raising maneuvers.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 2 2010-10-01 2010-10-01 false Orbit raising maneuvers. 25.282 Section 25.282 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS... geostationary satellite orbit under this part is also authorized to transmit in connection with short-term...

The True Ultracool Binary Fraction Using Spectral Binaries

Science.gov (United States)

Bardalez Gagliuffi, Daniella; Burgasser, Adam J.; Schmidt, Sarah J.; Gagné, Jonathan; Faherty, Jacqueline K.; Cruz, Kelle; Gelino, Chris

2018-01-01

Brown dwarfs bridge the gap between stars and giant planets. While the essential mechanisms governing their formation are not well constrained, binary statistics are a direct outcome of the formation process, and thus provide a means to test formation theories. Observational constraints on the brown dwarf binary fraction place it at 10 ‑ 20%, dominated by imaging studies (85% of systems) with the most common separation at 4 AU. This coincides with the resolution limit of state-of-the-art imaging techniques, suggesting that the binary fraction is underestimated. We have developed a separation-independent method to identify and characterize tightly-separated (dwarfs as spectral binaries by identifying traces of methane in the spectra of late-M and early-L dwarfs. Imaging follow-up of 17 spectral binaries yielded 3 (18%) resolved systems, corroborating the observed binary fraction, but 5 (29%) known binaries were missed, reinforcing the hypothesis that the short-separation systems are undercounted. In order to find the true binary fraction of brown dwarfs, we have compiled a volume-limited, spectroscopic sample of M7-L5 dwarfs and searched for T dwarf companions. In the 25 pc volume, 4 candidates were found, three of which are already confirmed, leading to a spectral binary fraction of 0.95 ± 0.50%, albeit for a specific combination of spectral types. To extract the true binary fraction and determine the biases of the spectral binary method, we have produced a binary population simulation based on different assumptions of the mass function, age distribution, evolutionary models and mass ratio distribution. Applying the correction fraction resulting from this method to the observed spectral binary fraction yields a true binary fraction of 27 ± 4%, which is roughly within 1σ of the binary fraction obtained from high resolution imaging studies, radial velocity and astrometric monitoring. This method can be extended to identify giant planet companions to young brown

Searching for Signatures of Supermassive Black Hole Binaries

Science.gov (United States)

Ayers, Megan; Gezari, Suvi; Liu, Tingting

2018-01-01

Theoretical studies suggest that supermassive black hole binaries (SMBHBs) are an inevitable consequence of major galaxy mergers. Additionally, as SMBHBs coalesce they are expected to be sources of tremendous gravitational wave emission. Interest in these sources motivates the search for detection of the first definitive SMBHB and observational signatures to methodize the search. We present spectral energy distributions (SEDs) for a sample of candidate SMBHBs selected from quasars demonstrating optical periodic variability from the Pan-STARRS1 Medium Deep Survey. The SEDs were constructed using existing archival data spanning from radio to X-ray emission. For each candidate SMBHB, we also present models of the theoretical spectrum emitted from the circumbinary and minidisks of the SMBHB system using the predictions of Roedig et al. (2014) and inferred parameters of the candidates (combined mass, mass ratio, binary separation, accretion rate). We compare the observational SED for each source to its respective binary model as well as to the expected mean SED of a normal non-binary system quasar to look for supporting evidence of a SMBHB system. This project was supported in part by the NSF REU grant AST-1358980 and by the Nantucket Maria Mitchell Association.

A Catalog of 1022 Bright Contact Binary Stars

Science.gov (United States)

Gettel, S. J.; Geske, M. T.; McKay, T. A.

2006-01-01

In this work we describe a large new sample of contact binary stars extracted in a uniform manner from sky patrol data taken by the ROTSE-I telescope. Extensive ROTSE-I light-curve data are combined with J-, H-, and K-band near-infrared data taken from the Two Micron All Sky Survey to add color information. Contact binary candidates are selected using the observed period-color relation. Candidates are confirmed by visual examination of the light curves. To enhance the utility of this catalog, we derive a new J-H period-color-luminosity relation and use this to estimate distances for the entire catalog. From these distance estimates we derive an estimated contact binary space density of (1.7+/-0.6)×10-5 pc-3.

Resultados de la litotricia extracorpórea utilizando el litotritor MODULITH SLX-MX (STORZ para el tratamiento de la litiasis ureteral Results of the shock waves extracorporeal lithotripsy using the MODULITH SLX-MX (STORZ lithotriptor for treatment or ureteral lithiasis

Directory of Open Access Journals (Sweden)

María Victoria Labrada

2010-09-01

Full Text Available INTRODUCCIÓN. La litiasis del uréter constituye una gran preocupación para los médicos debido a que frecuentemente ocasiona una uropatía obstructiva y el deterioro progresivo de la función renal ipsolateral, estado patológico de alta prevalencia, por lo que los hospitales con frecuencia no pueden dar solución quirúrgica con la celeridad necesaria. El objetivo de esta investigación fue conocer los resultados de la litotricia extracorpórea por ondas de choque (LEC con el litotritor MODULITH SLX-MX (STORZ para el tratamiento de la litiasis ureteral. MÉTODOS. Se incluyeron 598 pacientes con litiasis radiopaca del uréter, atendidos en el Hospital «Hermanos Ameijeiras» entre enero de 2007 y diciembre de 2008. Se conformaron 4 grupos según la localización del cálculo: en la unión pieloureteral (UPU (96, uréter lumbar (UL (263, iliaco (UI (40, pelviano (UP (199 y se analizó su relación con la superficie litiásica, sesiones de tratamiento, maniobras complementarias previas a la litotricia, aplicación de procedimientos auxiliares posteriores, resolución definitiva por otra técnica quirúrgica y eficacia terapéutica. La colimación se realizó por fluoroscopia. RESULTADOS. El mayor número de cálculos se localizó en el uréter lumbar, y en segundo lugar, en el uréter pelviano. El tamaño medio de la litiasis fue de 0,8 ± 0,5233 cm², en rango de 0,09-4 cm². La media de sesiones utilizadas fue de 1,24 ± 0,531, rango de 1-4. Se realizaron maniobras complementarias previas en 72 pacientes (12,04 % y la más utilizada fue la nefrostomía percutánea (40; 6,6 %. Después de la LEC fue necesaria la conversión a otro procedimiento para la solución del 4,68 % de los casos. La LEC fue eficaz en el 95,32 %, con mejores resultados en el UP (96,99 % y peores en el UI (92,50 %. CONCLUSIONES. Los resultados fueron buenos utilizando el litotritor MODULITH SLX-MX (STORZ. Los mejores resultados se obtuvieron en el uréter pelviano y en

7 CFR 282.2 - Funding.

Science.gov (United States)

2010-01-01

... of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM DEMONSTRATION, RESEARCH, AND EVALUATION PROJECTS § 282.2 Funding. Federal financial participation may be made available to demonstration, research, and evaluation...

DOUBLE-LINED SPECTROSCOPIC BINARY STARS IN THE RAVE SURVEY

International Nuclear Information System (INIS)

Matijevic, G.; Zwitter, T.; Munari, U.; Siviero, A.; Bienayme, O.; Siebert, A.; Binney, J.; Bland-Hawthorn, J.; Boeche, C.; Steinmetz, M.; Campbell, R.; Freeman, K. C.; Gibson, B.; Gilmore, G.; Grebel, E. K.; Helmi, A.; Navarro, J. F.; Parker, Q. A.; Seabroke, G. M.; Watson, F. G.

2010-01-01

We devise a new method for the detection of double-lined binary stars in a sample of the Radial Velocity Experiment (RAVE) survey spectra. The method is both tested against extensive simulations based on synthetic spectra and compared to direct visual inspection of all RAVE spectra. It is based on the properties and shape of the cross-correlation function, and is able to recover ∼80% of all binaries with an orbital period of order 1 day. Systems with periods up to 1 yr are still within the detection reach. We have applied the method to 25,850 spectra of the RAVE second data release and found 123 double-lined binary candidates, only eight of which are already marked as binaries in the SIMBAD database. Among the candidates, there are seven that show spectral features consistent with the RS CVn type (solar type with active chromosphere) and seven that might be of W UMa type (over-contact binaries). One star, HD 101167, seems to be a triple system composed of three nearly identical G-type dwarfs. The tested classification method could also be applicable to the data of the upcoming Gaia mission.

MARVELS Radial Velocity Solutions to Seven Kepler Eclipsing Binaries

Science.gov (United States)

Heslar, Michael Francis; Thomas, Neil B.; Ge, Jian; Ma, Bo; Herczeg, Alec; Reyes, Alan; SDSS-III MARVELS Team

2016-01-01

Eclipsing binaries serve momentous purposes to improve the basis of understanding aspects of stellar astrophysics, such as the accurate calculation of the physical parameters of stars and the enigmatic mass-radius relationship of M and K dwarfs. We report the investigation results of 7 eclipsing binary candidates, initially identified by the Kepler mission, overlapped with the radial velocity observations from the SDSS-III Multi-Object APO Radial-Velocity Exoplanet Large-Area Survey (MARVELS). The RV extractions and spectroscopic solutions of these eclipsing binaries were generated by the University of Florida's 1D data pipeline with a median RV precision of ~60-100 m/s, which was utilized for the DR12 data release. We performed the cross-reference fitting of the MARVELS RV data and the Kepler photometric fluxes obtained from the Kepler Eclipsing Binary Catalog (V2) and modelled the 7 eclipsing binaries in the BinaryMaker3 and PHOEBE programs. This analysis accurately determined the absolute physical and orbital parameters of each binary. Most of the companion stars were determined to have masses of K and M dwarf stars (0.3-0.8 M⊙), and allowed for an investigation into the mass-radius relationship of M and K dwarfs. Among the cases are KIC 9163796, a 122.2 day period "heartbeat star", a recently-discovered class of eccentric binaries known for tidal distortions and pulsations, with a high eccentricity (e~0.75) and KIC 11244501, a 0.29 day period, contact binary with a double-lined spectrum and mass ratio (q~0.45). We also report on the possible reclassification of 2 Kepler eclipsing binary candidates as background eclipsing binaries based on the analysis of the flux measurements, flux ratios of the spectroscopic and photometric solutions, the differences in the FOVs, the image processing of Kepler, and RV and spectral analysis of MARVELS.

32 CFR 282.4 - Policy.

Science.gov (United States)

2010-07-01

... certain claim settlement and advance decision functions that, by statute or delegation, are vested in the... SETTLING PERSONNEL AND GENERAL CLAIMS AND PROCESSING ADVANCE DECISION REQUESTS § 282.4 Policy. It is DoD policy that: (a) Claims shall be settled and advance decisions rendered in accordance with all pertinent...

Hemochromatosis C282Y gene mutation as a potential susceptibility ...

African Journals Online (AJOL)

G.M. Mokhtar

2017-08-12

Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

Binaries discovered by the SPY project V. GD 687 - a massive double degenerate binary progenitor that will merge within a Hubble time

OpenAIRE

Geier, S.; Heber, U.; Kupfer, T.; Napiwotzki, R.

2010-01-01

Aims. The ESO SN Ia Progenitor Survey (SPY) aims at finding merging double degenerate binaries as candidates for supernova type Ia (SN Ia) explosions. A white dwarf merger has also been suggested to explain the formation of rare types of stars like R CrB, extreme helium or He sdO stars. Here we present the hot subdwarf B binary GD 687, which will merge in less than a Hubble time. Methods. The orbital parameters of the close binary have been determined from time resolved spectroscopy. Since GD...

A CAUTIONARY TALE: MARVELS BROWN DWARF CANDIDATE REVEALS ITSELF TO BE A VERY LONG PERIOD, HIGHLY ECCENTRIC SPECTROSCOPIC STELLAR BINARY

Energy Technology Data Exchange (ETDEWEB)

Mack, Claude E. III; Stassun, Keivan G.; De Lee, Nathan [Department of Physics and Astronomy, Vanderbilt University, Nashville, TN 37235 (United States); Ge, Jian; Fleming, Scott W. [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, Gainesville, FL, 32611-2055 (United States); Deshpande, Rohit; Mahadevan, Suvrath [Department of Astronomy and Astrophysics, The Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Wisniewski, John P. [Homer L Dodge Department of Physics and Astronomy, University of Oklahoma, 440 W Brooks St, Norman, OK 73019 (United States); Gaudi, B. Scott; Eastman, Jason; Beatty, Thomas G. [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Ghezzi, Luan [Observatorio Nacional, Rua Gal. Jose Cristino 77, Rio de Janeiro, RJ 20921-400 (Brazil); Gonzalez Hernandez, Jonay I.; Femenia, Bruno; Mata Sanchez, Daniel [Instituto de Astrofisica de Canarias (IAC), E-38205 La Laguna, Tenerife (Spain); Ferreira, Leticia; Porto de Mello, Gustavo [Laboratorio Interinstitucional de e-Astronomia-LIneA, Rua Gal. Jose Cristino 77, Rio de Janeiro, RJ 20921-400 (Brazil); Crepp, Justin R. [Department of Physics, University of Notre Dame, 225 Nieuwland Science Hall, Notre Dame, IN 46556 (United States); Agol, Eric [Astronomy Department, University of Washington, Box 351580, Seattle, WA 98195 (United States); Bizyaev, Dmitry, E-mail: claude.e.mack@vanderbilt.edu [Apache Point Observatory, P.O. Box 59, Sunspot, NM 88349-0059 (United States); and others

2013-05-15

We report the discovery of a highly eccentric, double-lined spectroscopic binary star system (TYC 3010-1494-1), comprising two solar-type stars that we had initially identified as a single star with a brown dwarf companion. At the moderate resolving power of the MARVELS spectrograph and the spectrographs used for subsequent radial-velocity (RV) measurements (R {approx}< 30, 000), this particular stellar binary mimics a single-lined binary with an RV signal that would be induced by a brown dwarf companion (Msin i {approx} 50 M{sub Jup}) to a solar-type primary. At least three properties of this system allow it to masquerade as a single star with a very-low-mass companion: its large eccentricity (e {approx} 0.8), its relatively long period (P {approx} 238 days), and the approximately perpendicular orientation of the semi-major axis with respect to the line of sight ({omega} {approx} 189 Degree-Sign ). As a result of these properties, for {approx}95% of the orbit the two sets of stellar spectral lines are completely blended, and the RV measurements based on centroiding on the apparently single-lined spectrum is very well fit by an orbit solution indicative of a brown dwarf companion on a more circular orbit (e {approx} 0.3). Only during the {approx}5% of the orbit near periastron passage does the true, double-lined nature and large RV amplitude of {approx}15 km s{sup -1} reveal itself. The discovery of this binary system is an important lesson for RV surveys searching for substellar companions; at a given resolution and observing cadence, a survey will be susceptible to these kinds of astrophysical false positives for a range of orbital parameters. Finally, for surveys like MARVELS that lack the resolution for a useful line bisector analysis, it is imperative to monitor the peak of the cross-correlation function for suspicious changes in width or shape, so that such false positives can be flagged during the candidate vetting process.

HIGH-ENERGY ELECTROMAGNETIC OFFLINE FOLLOW-UP OF LIGO-VIRGO GRAVITATIONAL-WAVE BINARY COALESCENCE CANDIDATE EVENTS

Energy Technology Data Exchange (ETDEWEB)

Blackburn, L.; Camp, J. [NASA/Goddard Space Flight Center, Greenbelt, MD (United States); Briggs, M. S.; Connaughton, V.; Jenke, P. [University of Alabama in Huntsville, Huntsville, AL (United States); Christensen, N. [Carleton College, Northfield, MN (United States); Remillard, R. A. [Massachussetts Institute of Technology, Cambridge, MA (United States); Veitch, J. [University of Birmingham, Birmingham (United Kingdom)

2015-03-15

We present two different search methods for electromagnetic counterparts to gravitational-wave (GW) events from ground-based detectors using archival NASA high-energy data from the Fermi Gamma-ray Burst Monitor (GBM) and RXTE All-sky Monitor (ASM) instruments. To demonstrate the methods, we use a limited number of representative GW background noise events produced by a search for binary neutron star coalescence over the last two months of the LIGO-Virgo S6/VSR3 joint science run. Time and sky location provided by the GW data trigger a targeted search in the high-energy photon data. We use two custom pipelines: one to search for prompt gamma-ray counterparts in GBM, and the other to search for a variety of X-ray afterglow model signals in ASM. We measure the efficiency of the joint pipelines to weak gamma-ray burst counterparts, and a family of model X-ray afterglows. By requiring a detectable signal in either electromagnetic instrument coincident with a GW event, we are able to reject a large majority of GW candidates. This reduces the signal-to-noise ratio of the loudest surviving GW background event by around 15–20%.

High-Energy Electromagnetic Offline Follow-Up of Ligo-Virgo Gravitational-Wave Binary Coalescence Candidate Events

Science.gov (United States)

Blackburn, L.; Briggs, M. S.; Camp, J.; Christensen, N.; Connaughton, V.; Jenke, P.; Remillard, R. A.; Veitch, J.

2015-01-01

We present two different search methods for electromagnetic counterparts to gravitational-wave (GW) events from ground-based detectors using archival NASA high-energy data from the Fermi Gamma-ray Burst Monitor (GBM) and RXTE All-sky Monitor (ASM) instruments. To demonstrate the methods, we use a limited number of representative GW background noise events produced by a search for binary neutron star coalescence over the last two months of the LIGO-Virgo S6/VSR3 joint science run. Time and sky location provided by the GW data trigger a targeted search in the high-energy photon data. We use two custom pipelines: one to search for prompt gamma-ray counterparts in GBM, and the other to search for a variety of X-ray afterglow model signals in ASM. We measure the efficiency of the joint pipelines to weak gamma-ray burst counterparts, and a family of model X-ray afterglows. By requiring a detectable signal in either electromagnetic instrument coincident with a GW event, we are able to reject a large majority of GW candidates. This reduces the signal-to-noise ratio of the loudest surviving GW background event by around 15-20 percent.

MICROLENSING BINARIES DISCOVERED THROUGH HIGH-MAGNIFICATION CHANNEL

Energy Technology Data Exchange (ETDEWEB)

Shin, I.-G.; Choi, J.-Y.; Park, S.-Y.; Han, C. [Department of Physics, Institute for Astrophysics, Chungbuk National University, Cheongju 371-763 (Korea, Republic of); Gould, A.; Gaudi, B. S. [Department of Astronomy, Ohio State University, 140 W. 18th Ave., Columbus, OH 43210 (United States); Sumi, T. [Department of Earth and Space Science, Osaka University, Osaka 560-0043 (Japan); Udalski, A. [Warsaw University Observatory, Al. Ujazdowskie 4, 00-478 Warszawa (Poland); Beaulieu, J.-P. [Institut d' Astrophysique de Paris, UMR7095 CNRS-Universite Pierre and Marie Curie, 98 bis Boulevard Arago, 75014 Paris (France); Dominik, M. [School of Physics and Astronomy, SUPA, University of St. Andrews, North Haugh, St. Andrews, KY16 9SS (United Kingdom); Allen, W. [Vintage Lane Observatory, Blenheim (New Zealand); Bos, M. [Molehill Astronomical Observatory, North Shore (New Zealand); Christie, G. W. [Auckland Observatory, P.O. Box 24-180, Auckland (New Zealand); Depoy, D. L. [Department of Physics, Texas A and M University, College Station, TX (United States); Dong, S. [Institute for Advanced Study, Einstein Drive, Princeton, NJ 08540 (United States); Drummond, J. [Possum Observatory, Patutahi (New Zealand); Gal-Yam, A. [Benoziyo Center for Astrophysics, the Weizmann Institute (Israel); Hung, L.-W. [Department of Physics and Astronomy, University of California Los Angeles, Los Angeles, CA 90095 (United States); Janczak, J. [Department of Physics, Ohio State University, 191 W. Woodruff, Columbus, OH 43210 (United States); Kaspi, S. [School of Physics and Astronomy, Tel-Aviv University, Tel Aviv 69978 (Israel); Collaboration: muFUN Collaboration; MOA Collaboration; OGLE Collaboration; PLANET Collaboration; RoboNet Collaboration; MiNDSTEp Consortium; and others

2012-02-20

Microlensing can provide a useful tool to probe binary distributions down to low-mass limits of binary companions. In this paper, we analyze the light curves of eight binary-lensing events detected through the channel of high-magnification events during the seasons from 2007 to 2010. The perturbations, which are confined near the peak of the light curves, can be easily distinguished from the central perturbations caused by planets. However, the degeneracy between close and wide binary solutions cannot be resolved with a 3{sigma} confidence level for three events, implying that the degeneracy would be an important obstacle in studying binary distributions. The dependence of the degeneracy on the lensing parameters is consistent with a theoretical prediction that the degeneracy becomes severe as the binary separation and the mass ratio deviate from the values of resonant caustics. The measured mass ratio of the event OGLE-2008-BLG-510/MOA-2008-BLG-369 is q {approx} 0.1, making the companion of the lens a strong brown dwarf candidate.

Relativistic boost as the cause of periodicity in a massive black-hole binary candidate.

Science.gov (United States)

D'Orazio, Daniel J; Haiman, Zoltán; Schiminovich, David

2015-09-17

Because most large galaxies contain a central black hole, and galaxies often merge, black-hole binaries are expected to be common in galactic nuclei. Although they cannot be imaged, periodicities in the light curves of quasars have been interpreted as evidence for binaries, most recently in PG 1302-102, which has a short rest-frame optical period of four years (ref. 6). If the orbital period of the black-hole binary matches this value, then for the range of estimated black-hole masses, the components would be separated by 0.007-0.017 parsecs, implying relativistic orbital speeds. There has been much debate over whether black-hole orbits could be smaller than one parsec (ref. 7). Here we report that the amplitude and the sinusoid-like shape of the variability of the light curve of PG 1302-102 can be fitted by relativistic Doppler boosting of emission from a compact, steadily accreting, unequal-mass binary. We predict that brightness variations in the ultraviolet light curve track those in the optical, but with a two to three times larger amplitude. This prediction is relatively insensitive to the details of the emission process, and is consistent with archival ultraviolet data. Follow-up ultraviolet and optical observations in the next few years can further test this prediction and confirm the existence of a binary black hole in the relativistic regime.

7 CFR 28.2 - Terms defined.

Science.gov (United States)

2010-01-01

... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing..., TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Definitions § 28.2 Terms... to act for the Secretary. (e) Service. The Agricultural Marketing Service of the U.S. Department of...

Light equation in eclipsing binary CV Boo: third body candidate in elliptical orbit

Science.gov (United States)

Bogomazov, A. I.; Kozyreva, V. S.; Satovskii, B. L.; Krushevska, V. N.; Kuznyetsova, Y. G.; Ehgamberdiev, S. A.; Karimov, R. G.; Khalikova, A. V.; Ibrahimov, M. A.; Irsmambetova, T. R.; Tutukov, A. V.

2016-12-01

A short period eclipsing binary star CV Boo is tested for the possible existence of additional bodies in the system with a help of the light equation method. We use data on the moments of minima from the literature as well as from our observations during 2014 May-July. A variation of the CV Boo's orbital period is found with a period of {≈}75 d. This variation can be explained by the influence of a third star with a mass of {≈}0.4 M_{⊙} in an eccentric orbit with e≈0.9. A possibility that the orbital period changes on long time scales is discussed. The suggested tertiary companion is near the chaotic zone around the central binary, so CV Boo represents an interesting example to test its dynamical evolution. A list of 14 minima moments of the binary obtained from our observations is presented.

Reference: 282 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available 282 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16214903i Kasahara Ryushiro...abidopsis. 11 2981-92 16214903 2005 Nov The Plant cell Drews Gary N|Kasahara Ryushiro D|Portereiko Michael F|Rabiger David S|Sandaklie-Nikolova Linda

SLoWPoKES-II: 100,000 WIDE BINARIES IDENTIFIED IN SDSS WITHOUT PROPER MOTIONS

Energy Technology Data Exchange (ETDEWEB)

Dhital, Saurav [Department of Physical Sciences, Embry-Riddle Aeronautical University, 600 South Clyde Morris Blvd., Daytona Beach, FL 32114 (United States); West, Andrew A.; Schluns, Kyle J.; Massey, Angela P. [Department of Astronomy, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Stassun, Keivan G., E-mail: dhitals@erau.edu [Department of Physics and Astronomy, Vanderbilt University, 6301 Stevenson Center, Nashville, TN, 37235 (United States)

2015-08-15

We present the Sloan Low-mass Wide Pairs of Kinematically Equivalent Stars (SLoWPoKES)-II catalog of low-mass visual binaries identified from the Sloan Digital Sky Survey (SDSS) by matching photometric distances. The candidate pairs are vetted by comparing the stellar information. The candidate pairs are vetted by comparing the stellar density at their respective Galactic positions to Monte Carlo realizations of a simulated Milky Way. In this way, we are able to identify large numbers of bona fide wide binaries without the need for proper motions. Here, 105,537 visual binaries with angular separations of ∼1–20″ were identified, each with a probability of chance alignment of ≤5%. This is the largest catalog of bona fide wide binaries to date, and it contains a diversity of systems—in mass, mass ratios, binary separations, metallicity, and evolutionary states—that should facilitate follow-up studies to characterize the properties of M dwarfs and white dwarfs. There is a subtle but definitive suggestion of multiple populations in the physical separation distribution, supporting earlier findings. We suggest that wide binaries are composed of multiple populations, most likely representing different formation modes. There are 141 M7 or later wide binary candidates, representing a seven-fold increase over the number currently known. These binaries are too wide to have been formed via the ejection mechanism. Finally, we found that 6% of spectroscopically confirmed M dwarfs are not included in the SDSS STAR catalog; they are misclassified as extended sources due to the presence of a nearby or partially resolved companion. The SLoWPoKES-II catalog is publicly available to the entire community on the World Wide Web via the Filtergraph data visualization portal.

Investigation of the binary fraction among candidate A-F type hybrid stars detected by Kepler

Directory of Open Access Journals (Sweden)

Lampens P.

2015-01-01

Full Text Available We are currently monitoring up to 40 Kepler candidate δ Scuti-γ Doradus (resp. γ Doradus-δ Scuti hybrid stars in radial velocity in order to identify the physical cause behind the low frequencies observed in the periodograms based on the ultra-high accuracy Kepler space photometry. The presence of low frequency variability in unevolved or slightly evolved oscillating A/F-type stars can generally be explained in three ways: either 1 the star is an (undetected binary or multiple system, or 2 the star is a g-mode pulsator (i.e. a genuine hybrid, or 3 the star’s atmosphere displays an asymmetric intensity distribution (caused by spots, i.e. chemical anomalies, or by (very high rotation, which is detected through rotational modulation. Our targets were selected from the globally characterized variable A/F-type stars of the Kepler mission [7]. We observe each star at least 4 times unevenly spread over a time lapse up to 2 months with the HERMES spectrograph [6]. In the case of composite, multiple-lined spectra, these observations also provide the atmospheric properties of each component. Our principal goal is to estimate the fraction of short-period, spectroscopic systems in the sample.

CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients.

Science.gov (United States)

Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

2012-12-01

Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on

ALMOST ALL OF KEPLER'S MULTIPLE-PLANET CANDIDATES ARE PLANETS

International Nuclear Information System (INIS)

Lissauer, Jack J.; Rowe, Jason F.; Bryson, Stephen T.; Howell, Steve B.; Jenkins, Jon M.; Kinemuchi, Karen; Koch, David G.; Marcy, Geoffrey W.; Adams, Elisabeth; Fressin, Francois; Geary, John; Holman, Matthew J.; Ragozzine, Darin; Buchhave, Lars A.; Ciardi, David R.; Cochran, William D.; Fabrycky, Daniel C.; Ford, Eric B.; Morehead, Robert C.; Gilliland, Ronald L.

2012-01-01

We present a statistical analysis that demonstrates that the overwhelming majority of Kepler candidate multiple transiting systems (multis) indeed represent true, physically associated transiting planets. Binary stars provide the primary source of false positives among Kepler planet candidates, implying that false positives should be nearly randomly distributed among Kepler targets. In contrast, true transiting planets would appear clustered around a smaller number of Kepler targets if detectable planets tend to come in systems and/or if the orbital planes of planets encircling the same star are correlated. There are more than one hundred times as many Kepler planet candidates in multi-candidate systems as would be predicted from a random distribution of candidates, implying that the vast majority are true planets. Most of these multis are multiple-planet systems orbiting the Kepler target star, but there are likely cases where (1) the planetary system orbits a fainter star, and the planets are thus significantly larger than has been estimated, or (2) the planets orbit different stars within a binary/multiple star system. We use the low overall false-positive rate among Kepler multis, together with analysis of Kepler spacecraft and ground-based data, to validate the closely packed Kepler-33 planetary system, which orbits a star that has evolved somewhat off of the main sequence. Kepler-33 hosts five transiting planets, with periods ranging from 5.67 to 41 days.

Performance analysis and binary working fluid selection of combined flash-binary geothermal cycle

International Nuclear Information System (INIS)

Zeyghami, Mehdi

2015-01-01

Performance of the combined flash-binary geothermal power cycle for geofluid temperatures between 150 and 250 °C is studied. A thermodynamic model is developed, and the suitable binary working fluids for different geofluid temperatures are identified from a list of thirty working fluid candidates, consisting environmental friendly refrigerants and hydrocarbons. The overall system exergy destruction and Vapor Expansion Ratio across the binary cycle turbine are selected as key performance indicators. The results show that for low-temperature heat sources using refrigerants as binary working fluids result in higher overall cycle efficiency and for medium and high-temperature resources, hydrocarbons are more suitable. For combined flash-binary cycle, secondary working fluids; R-152a, Butane and Cis-butane show the best performances at geofluid temperatures 150, 200 and 250 °C respectively. The overall second law efficiency is calculated as high as 0.48, 0.55 and 0.58 for geofluid temperatures equal 150, 200 and 250 °C respectively. The flash separator pressure found to has important effects on cycle operation and performance. Separator pressure dictates the work production share of steam and binary parts of the system. And there is an optimal separator pressure at which overall exergy destruction of the cycle achieves its minimum value. - Highlights: • Performance of the combined flash-binary geothermal cycle is investigated. • Thirty different fluids are screened to find the most suitable ORC working fluid. • Optimum cycle operation conditions presented for geofluids between 150 °C and 250 °C. • Refrigerants are more suitable for the ORC at geothermal sources temperature ≤200 °C. • Hydrocarbons are more suitable for the ORC at geothermal sources temperature >200 °C

Massive Black Hole Binaries: Dynamical Evolution and Observational Signatures

Directory of Open Access Journals (Sweden)

M. Dotti

2012-01-01

Full Text Available The study of the dynamical evolution of massive black hole pairs in mergers is crucial in the context of a hierarchical galaxy formation scenario. The timescales for the formation and the coalescence of black hole binaries are still poorly constrained, resulting in large uncertainties in the expected rate of massive black hole binaries detectable in the electromagnetic and gravitational wave spectra. Here, we review the current theoretical understanding of the black hole pairing in galaxy mergers, with a particular attention to recent developments and open issues. We conclude with a review of the expected observational signatures of massive binaries and of the candidates discussed in literature to date.

WHITE-DWARF-MAIN-SEQUENCE BINARIES IDENTIFIED FROM THE LAMOST PILOT SURVEY

International Nuclear Information System (INIS)

Ren Juanjuan; Luo Ali; Li Yinbi; Wei Peng; Zhao Jingkun; Zhao Yongheng; Song Yihan; Zhao Gang

2013-01-01

We present a set of white-dwarf-main-sequence (WDMS) binaries identified spectroscopically from the Large sky Area Multi-Object fiber Spectroscopic Telescope (LAMOST, also called the Guo Shou Jing Telescope) pilot survey. We develop a color selection criteria based on what is so far the largest and most complete Sloan Digital Sky Survey (SDSS) DR7 WDMS binary catalog and identify 28 WDMS binaries within the LAMOST pilot survey. The primaries in our binary sample are mostly DA white dwarfs except for one DB white dwarf. We derive the stellar atmospheric parameters, masses, and radii for the two components of 10 of our binaries. We also provide cooling ages for the white dwarf primaries as well as the spectral types for the companion stars of these 10 WDMS binaries. These binaries tend to contain hot white dwarfs and early-type companions. Through cross-identification, we note that nine binaries in our sample have been published in the SDSS DR7 WDMS binary catalog. Nineteen spectroscopic WDMS binaries identified by the LAMOST pilot survey are new. Using the 3σ radial velocity variation as a criterion, we find two post-common-envelope binary candidates from our WDMS binary sample

Dynamic strain aging in Haynes 282 superalloy

Directory of Open Access Journals (Sweden)

Hörnqvist Magnus

2014-01-01

Full Text Available Haynes 282 is a newly introduced Ni-based superallony, developed to provide a combination of high-temperature mechanical properties, thermal stability and processability. The present contribution investigates the effect of dynamic strain aging (DSA on the deformation behaviour of Haynes 282 during monotonic and cyclic loading. It is shown that DSA (presumably related to carbon diffusion based on rough estimates of the activation energy completely dominates the development of the stress during cycling at intermediate temperatures, leading to extensive cyclic hardening and serrated yielding. However, no clear effects on the fatigue life or the resulting dislocation structure could be observed. The tensile properties were not severely affected, in spite of the presence of extensive serrated yielding, although a reduction in ductility was observed in the DSA temperature regime. During monotonic loading at lower strain rates indications of an additional DSA mechanism due to substitutional elements were observed.

[ALLELES C282Y AND H63D HFE GENE, INSULIN RESISTANCE AND SUSCEPTIBILITY TO DISTURBANCE OF PORPHYRIN METABOLISM IN NON-ALCOHOLIC FATTY LIVER DISEASE].

Science.gov (United States)

Krivosheev, A B; Maximov, V N; Voevoda, M I; Kuimov, A D; Kondratova, M A; Tuguleva, T A; Koval, O N; Bezrukova, A A; Bogorianova, P A; Rybina, O V

2015-01-01

The aim of the present work was to study the frequency of genotypes and alleles of C282Y and H63D HFE gene that may be associated with impaired porphyrin metabolism, as well as possible reasons for the formation of dysmetabolism porphyrins with NAFLD. The study involved 65 patients (52 men and 13 women) aged 21 to 69 years (mean age 48.5±1.5 years). Excretion uroporphyrin, coproporphyrin, 6-aminolevulinic acid of porphobilinogen in urine was determined by chromatography and spectrophotometry calculated total excretion of porphyrins. Allele frequencies C282Y and H63D were determined during the molecular genetic analysis of DNA using the polymerase chain reaction followed by analysis of length polymorphism restraktsionnyh fragments. Condition of carbohydrate metabolism was evaluated by the level of fasting blood glucose and standard glucose tolerance test. Diagnosis of insulin resistance was performed according to the criteria proposed by the European Group for the Study of insulin resistance (EGIR). Skill test for the C282Y mutation carriage and H63D in the HFE gene in 65 patients with non-alcoholic fatty liver disease. Disturbances in the metabolism of porphyrins were recorded in 43 (66.2%) patients. H63D and C282Y mutations were found in 18 (27.7%) patients, of whom 13 (72.2%) people with different options dismetabolism porphyrins and signs of insulin resistance. In 47 (72.3%) patients without mutations studied porphyrin metabolism disorders were detected in 30 (63.8 %), of which insulin resistance is registered only in 16 (34.0 %). Detection of mutations C282Y and H63D in the HFE gene in combination with disorders of porphyrin metabolism on the background of insulin resistance is likely to allow such patients considered as candidates for inclusion in the higher risk of formation of diabetes.

Prevalence of the N-Acetyltransferase (NAT2 gene polymorphism 282C>T in Peruvian population and health implications

Directory of Open Access Journals (Sweden)

Salazar-Granara Alberto

2016-03-01

Full Text Available Objective: To determine the frequency of the C282T polymorphism of the NAT2 gene (N acetyltransferase in Peruvian populations. Field work, focused on exploring genetic risk factor in Peruvian populations, which has influence in the response to drugs and malignancies aetiology. Material and Methods: Cross-sectional study. 166 voluntaries from Lima, Lambayeque, Apurimac, Puno, San Martin, Amazonas and Loreto were enrolled. The sampling was done by convenience and it was use the RFLP-PCR conventional technique was used. Results: The allele frequency were 54% (n=126 for C282 and 46% (n=106 for T282. For the T allele, by its orign , stand out 2 those which origins were Lima 42% (n=25, Amazonas 47% (n=16, San Martin 74% (n=28 and Apurimac 50% (n=13 (X , p>0.05. A global genotype frequency were 26.7% (n=31 for C282/C282, 56.0% (n=65 for C282/T282 and 17.2% (n=20 for T282/T282 (Hardy Weinberg Test p>0.05. By origin, Puno presented allelic imbalance (Hardy Weinberg test p0.05. Conclusion: The overall frequency of NAT2 allele T282 was 46%; San Martin had the highest prevalence (74%. The T282 allele is linked to neoplastic diseases and adverse reactions to anti-TB drugs, these results will be used for the application of pharmacogenetics in Peru

Wide Binaries in TGAS: Search Method and First Results

Science.gov (United States)

Andrews, Jeff J.; Chanamé, Julio; Agüeros, Marcel A.

2018-04-01

Half of all stars reside in binary systems, many of which have orbital separations in excess of 1000 AU. Such binaries are typically identified in astrometric catalogs by matching the proper motions vectors of close stellar pairs. We present a fully Bayesian method that properly takes into account positions, proper motions, parallaxes, and their correlated uncertainties to identify widely separated stellar binaries. After applying our method to the >2 × 106 stars in the Tycho-Gaia astrometric solution from Gaia DR1, we identify over 6000 candidate wide binaries. For those pairs with separations less than 40,000 AU, we determine the contamination rate to be ~5%. This sample has an orbital separation (a) distribution that is roughly flat in log space for separations less than ~5000 AU and follows a power law of a -1.6 at larger separations.

Exploring Aquaculture. Curriculum Guide for Agriscience 282.

Science.gov (United States)

Texas A and M Univ., College Station. Dept. of Agricultural Education.

This curriculum guide provides materials for teachers to use in developing a course in "Exploring Aquaculture, Agriscience 282," one of 28 semester courses in agricultural science and technology for Texas high schools. This introductory course is designed to acquaint students with the growing industry of aquaculture; it includes…

Phosphorylation of connexin43 on S279/282 may contribute to laminopathy-associated conduction defects

Energy Technology Data Exchange (ETDEWEB)

Chen, Steven C., E-mail: bug@uw.edu [Fred Hutchinson Cancer Research Center (FHCRC), Public Health Sciences Division, 1100 Fairview Ave. N., Seattle, WA 98109 (United States); University of Washington Department of Biochemistry, 1959 NE Pacific St., Seattle, WA 98195 (United States); Kennedy, Brian K., E-mail: bkennedy@buckinstitute.org [University of Washington Department of Biochemistry, 1959 NE Pacific St., Seattle, WA 98195 (United States); Buck Institute for Research on Aging, 8001 Redwood Boulevard, Novato, CA 94945 (United States); Lampe, Paul D., E-mail: plampe@fhcrc.org [Fred Hutchinson Cancer Research Center (FHCRC), Public Health Sciences Division, 1100 Fairview Ave. N., Seattle, WA 98109 (United States)

2013-04-01

An understanding of the molecular mechanism behind the arrhythmic phenotype associated with laminopathies has yet to emerge. A-type lamins have been shown to interact and sequester activated phospho-ERK1/2(pERK1/2) at the nucleus. The gap junction protein connexin43 (Cx43) can be phosphorylated by pERK1/2 on S279/282 (pS279/282), inhibiting intercellular communication. We hypothesized that without A-type lamins, pS279/282 Cx43 will increase due to inappropriate phosphorylation by pERK1/2, resulting in decreased gap junction function. We observed a 1.6-fold increase in pS279/282 Cx43 levels in Lmna{sup −/−} mouse embryonic fibroblasts (MEFs) compared to Lmna{sup +/+}, and 1.8-fold more pERK1/2 co-precipitated from Lmna{sup −/−} MEFs with Cx43 antibodies. We found a 3-fold increase in the fraction of non-nuclear pERK1/2 and a concomitant 2-fold increase in the fraction of pS279/282 Cx43 in Lmna{sup −/−} MEFs by immunofluorescence. In an assay of gap junctional function, Lmna{sup −/−} MEFs transferred dye to 60% fewer partners compared to Lmna{sup +/+} controls. These results are mirrored in 5–6 week-old Lmna{sup −/−} mice compared to their Lmna{sup +/+} littermates as we detect increased pS279/282 Cx43 in gap junctions by immunofluorescence and 1.7-fold increased levels by immunoblot. We conclude that increased pS279/282 Cx43 in the Lmna{sup −/−} background results in decreased cell communication and may contribute to the arrhythmic pathology in vivo. - Highlights: ► Connexin43 phosphorylation plays a role in laminopathy-associated conduction defects. ► Loss of A-type lamin activity results in release of pERK1/2 from the nucleus. ► Increased cytoplasmic localization of pERK1/2 acts to phosphorylate S279/282 of Cx43. ► Phosphorylation of S279/282 on Cx43 decreases gap junction activity in cell culture. ► Mice lacking A-type lamins have increased phosphorylation on S279/282 of Cx43.

Very Low-mass Stellar and Substellar Companions to Solar-like Stars from MARVELS. VI. A Giant Planet and a Brown Dwarf Candidate in a Close Binary System HD 87646

Science.gov (United States)

Ma, Bo; Ge, Jian; Wolszczan, Alex; Muterspaugh, Matthew W.; Lee, Brian; Henry, Gregory W.; Schneider, Donald P.; Martín, Eduardo L.; Niedzielski, Andrzej; Xie, Jiwei; Fleming, Scott W.; Thomas, Neil; Williamson, Michael; Zhu, Zhaohuan; Agol, Eric; Bizyaev, Dmitry; Nicolaci da Costa, Luiz; Jiang, Peng; Martinez Fiorenzano, A. F.; González Hernández, Jonay I.; Guo, Pengcheng; Grieves, Nolan; Li, Rui; Liu, Jane; Mahadevan, Suvrath; Mazeh, Tsevi; Nguyen, Duy Cuong; Paegert, Martin; Sithajan, Sirinrat; Stassun, Keivan; Thirupathi, Sivarani; van Eyken, Julian C.; Wan, Xiaoke; Wang, Ji; Wisniewski, John P.; Zhao, Bo; Zucker, Shay

2016-11-01

We report the detections of a giant planet (MARVELS-7b) and a brown dwarf (BD) candidate (MARVELS-7c) around the primary star in the close binary system, HD 87646. To the best of our knowledge, it is the first close binary system with more than one substellar circumprimary companion that has been discovered. The detection of this giant planet was accomplished using the first multi-object Doppler instrument (KeckET) at the Sloan Digital Sky Survey (SDSS) telescope. Subsequent radial velocity observations using the Exoplanet Tracker at the Kitt Peak National Observatory, the High Resolution Spectrograph at the Hobby Eberley telescope, the “Classic” spectrograph at the Automatic Spectroscopic Telescope at the Fairborn Observatory, and MARVELS from SDSS-III confirmed this giant planet discovery and revealed the existence of a long-period BD in this binary. HD 87646 is a close binary with a separation of ˜22 au between the two stars, estimated using the Hipparcos catalog and our newly acquired AO image from PALAO on the 200 inch Hale Telescope at Palomar. The primary star in the binary, HD 87646A, has {T}{eff} = 5770 ± 80 K, log g = 4.1 ± 0.1, and [Fe/H] = -0.17 ± 0.08. The derived minimum masses of the two substellar companions of HD 87646A are 12.4 ± 0.7 {M}{Jup} and 57.0 ± 3.7 {M}{Jup}. The periods are 13.481 ± 0.001 days and 674 ± 4 days and the measured eccentricities are 0.05 ± 0.02 and 0.50 ± 0.02 respectively. Our dynamical simulations show that the system is stable if the binary orbit has a large semimajor axis and a low eccentricity, which can be verified with future astrometry observations.

Gravitational waves from double white dwarfs and AM CVn binaries

International Nuclear Information System (INIS)

Nelemans, Gijs

2003-01-01

I give a brief overview of our model for the galactic population of compact binaries that is used to predict the low-frequency gravitational wave signal from the galaxy, and discuss recent observational developments that will enable us to test and improve this model. The SPY project will discover some 150 new close double white dwarfs and, recently, two ROSAT sources turned out to be new AM CVn candidates, one with an orbital period of only 5 min. I give an update on the expected binaries that will be resolved by LISA and discuss what we can learn about the galactic population of compact binaries once LISA gives her first results

EXTRASOLAR BINARY PLANETS. II. DETECTABILITY BY TRANSIT OBSERVATIONS

International Nuclear Information System (INIS)

Lewis, K. M.; Ida, S.; Ochiai, H.; Nagasawa, M.

2015-01-01

We discuss the detectability of gravitationally bound pairs of gas-giant planets (which we call “binary planets”) in extrasolar planetary systems that are formed through orbital instability followed by planet–planet dynamical tides during their close encounters, based on the results of N-body simulations by Ochiai et al. (Paper I). Paper I showed that the formation probability of a binary is as much as ∼10% for three giant planet systems that undergo orbital instability, and after post-capture long-term tidal evolution, the typical binary separation is three to five times the sum of the physical radii of the planets. The binary planets are stable during the main-sequence lifetime of solar-type stars, if the stellarcentric semimajor axis of the binary is larger than 0.3 AU. We show that detecting modulations of transit light curves is the most promising observational method to detect binary planets. Since the likely binary separations are comparable to the stellar diameter, the shape of the transit light curve is different from transit to transit, depending on the phase of the binary’s orbit. The transit durations and depth for binary planet transits are generally longer and deeper than those for the single planet case. We point out that binary planets could exist among the known inflated gas-giant planets or objects classified as false positive detections at orbital radii ≳0.3 AU, propose a binary planet explanation for the CoRoT candidate SRc01 E2 1066, and show that binary planets are likely to be present in, and could be detected using, Kepler-quality data

Humoral Responses to Rv1733c, Rv0081, Rv1735c, and Rv1737c DosR Regulon-Encoded Proteins of Mycobacterium tuberculosis in Individuals with Latent Tuberculosis Infection

Directory of Open Access Journals (Sweden)

Simon G. Kimuda

2017-01-01

Full Text Available Latent tuberculosis infection (LTBI is evidence of immunological control of tuberculosis. Dormancy survival regulator (DosR regulon-encoded proteins may have a role in the maintenance of LTBI. T cell responses to Rv1733c, Rv0081, Rv1735c, and Rv1737c DosR regulon-encoded proteins were found to be most frequent among household contacts of TB cases from Uganda compared to other DosR proteins, but antibody responses were not described. We characterized antibody responses to these proteins in individuals from Uganda. Antibodies to Rv1733c, Rv0081, Rv1735c, and Rv1737c DosR regulon-encoded proteins were measured in 68 uninfected individuals, 62 with LTBI, and 107 with active pulmonary tuberculosis (APTB cases. There were no differences in the concentrations of antibodies to Rv0081, Rv1735c, and Rv1737c DosR regulon-encoded proteins between individuals with LTBI and APTB and those who were uninfected. LTBI was associated with higher concentrations of antibodies to Rv1733c in female participants [adjusted geometric mean ratio: 1.812, 95% confidence interval (CI: 1.105 2.973, and p=0.019] but not in males (p value for interaction = 0.060. Antibodies to the four DosR regulon-encoded proteins investigated may not serve as good biomarkers of LTBI in the general population. More of the M.tb proteome needs to be screened to identify proteins that induce strong antibody responses in LTBI.

ALMOST ALL OF KEPLER'S MULTIPLE-PLANET CANDIDATES ARE PLANETS

Energy Technology Data Exchange (ETDEWEB)

Lissauer, Jack J.; Rowe, Jason F.; Bryson, Stephen T.; Howell, Steve B.; Jenkins, Jon M.; Kinemuchi, Karen; Koch, David G. [NASA Ames Research Center, Moffett Field, CA 94035 (United States); Marcy, Geoffrey W. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Adams, Elisabeth; Fressin, Francois; Geary, John; Holman, Matthew J.; Ragozzine, Darin [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Buchhave, Lars A. [Niels Bohr Institute, University of Copenhagen, DK-2100, Copenhagen (Denmark); Ciardi, David R. [Exoplanet Science Institute/Caltech, Pasadena, CA 91125 (United States); Cochran, William D. [Department of Astronomy, University of Texas, Austin, TX 78712 (United States); Fabrycky, Daniel C. [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Ford, Eric B.; Morehead, Robert C. [University of Florida, 211 Bryant Space Science Center, Gainesville, FL 32611 (United States); Gilliland, Ronald L., E-mail: Jack.Lissauer@nasa.gov [Space Telescope Science Institute, Baltimore, MD 21218 (United States); and others

2012-05-10

We present a statistical analysis that demonstrates that the overwhelming majority of Kepler candidate multiple transiting systems (multis) indeed represent true, physically associated transiting planets. Binary stars provide the primary source of false positives among Kepler planet candidates, implying that false positives should be nearly randomly distributed among Kepler targets. In contrast, true transiting planets would appear clustered around a smaller number of Kepler targets if detectable planets tend to come in systems and/or if the orbital planes of planets encircling the same star are correlated. There are more than one hundred times as many Kepler planet candidates in multi-candidate systems as would be predicted from a random distribution of candidates, implying that the vast majority are true planets. Most of these multis are multiple-planet systems orbiting the Kepler target star, but there are likely cases where (1) the planetary system orbits a fainter star, and the planets are thus significantly larger than has been estimated, or (2) the planets orbit different stars within a binary/multiple star system. We use the low overall false-positive rate among Kepler multis, together with analysis of Kepler spacecraft and ground-based data, to validate the closely packed Kepler-33 planetary system, which orbits a star that has evolved somewhat off of the main sequence. Kepler-33 hosts five transiting planets, with periods ranging from 5.67 to 41 days.

C282Y-HFE gene variant affects cholesterol metabolism in human neuroblastoma cells.

Science.gov (United States)

Ali-Rahmani, Fatima; Huang, Michael A; Schengrund, C-L; Connor, James R; Lee, Sang Y

2014-01-01

Although disruptions in the maintenance of iron and cholesterol metabolism have been implicated in several cancers, the association between variants in the HFE gene that is associated with cellular iron uptake and cholesterol metabolism has not been studied. The C282Y-HFE variant is a risk factor for different cancers, is known to affect sphingolipid metabolism, and to result in increased cellular iron uptake. The effect of this variant on cholesterol metabolism and its possible relevance to cancer phenotype was investigated using wild type (WT) and C282Y-HFE transfected human neuroblastoma SH-SY5Y cells. Expression of C282Y-HFE in SH-SY5Y cells resulted in a significant increase in total cholesterol as well as increased transcription of a number of genes involved in its metabolism compared to cells expressing WT-HFE. The marked increase in expression of NPC1L1 relative to that of most other genes, was accompanied by a significant increase in expression of NPC1, a protein that functions in cholesterol uptake by cells. Because inhibitors of cholesterol metabolism have been proposed to be beneficial for treating certain cancers, their effect on the viability of C282Y-HFE neuroblastoma cells was ascertained. C282Y-HFE cells were significantly more sensitive than WT-HFE cells to U18666A, an inhibitor of desmosterol Δ24-reductase the enzyme catalyzing the last step in cholesterol biosynthesis. This was not seen for simvastatin, ezetimibe, or a sphingosine kinase inhibitor. These studies indicate that cancers presenting in carriers of the C282Y-HFE allele might be responsive to treatment designed to selectively reduce cholesterol content in their tumor cells.

THE PALOMAR TRANSIENT FACTORY ORION PROJECT: ECLIPSING BINARIES AND YOUNG STELLAR OBJECTS

International Nuclear Information System (INIS)

Van Eyken, Julian C.; Ciardi, David R.; Akeson, Rachel L.; Beichman, Charles A.; Von Braun, Kaspar; Gelino, Dawn M.; Kane, Stephen R.; Plavchan, Peter; RamIrez, Solange V.; Rebull, Luisa M.; Stauffer, John R.; Hoard, D. W.; Boden, Andrew F.; Howell, Steve B.; Bloom, Joshua S.; Cenko, S. Bradley; Kasliwal, Mansi M.; Kulkarni, Shrinivas R.; Law, Nicholas M.; Nugent, Peter E.

2011-01-01

The Palomar Transient Factory (PTF) Orion project is one of the experiments within the broader PTF survey, a systematic automated exploration of the sky for optical transients. Taking advantage of the wide (3. 0 5 x 2. 0 3) field of view available using the PTF camera installed at the Palomar 48 inch telescope, 40 nights were dedicated in 2009 December to 2010 January to perform continuous high-cadence differential photometry on a single field containing the young (7-10 Myr) 25 Ori association. Little is known empirically about the formation of planets at these young ages, and the primary motivation for the project is to search for planets around young stars in this region. The unique data set also provides for much ancillary science. In this first paper, we describe the survey and the data reduction pipeline, and present some initial results from an inspection of the most clearly varying stars relating to two of the ancillary science objectives: detection of eclipsing binaries and young stellar objects. We find 82 new eclipsing binary systems, 9 of which are good candidate 25 Ori or Orion OB1a association members. Of these, two are potential young W UMa type systems. We report on the possible low-mass (M-dwarf primary) eclipsing systems in the sample, which include six of the candidate young systems. Forty-five of the binary systems are close (mainly contact) systems, and one of these shows an orbital period among the shortest known for W UMa binaries, at 0.2156509 ± 0.0000071 days, with flat-bottomed primary eclipses, and a derived distance that appears consistent with membership in the general Orion association. One of the candidate young systems presents an unusual light curve, perhaps representing a semi-detached binary system with an inflated low-mass primary or a star with a warped disk, and may represent an additional young Orion member. Finally, we identify 14 probable new classical T-Tauri stars in our data, along with one previously known (CVSO 35) and

Merger rate of primordial black-hole binaries

Science.gov (United States)

Ali-Haïmoud, Yacine; Kovetz, Ely D.; Kamionkowski, Marc

2017-12-01

Primordial black holes (PBHs) have long been a candidate for the elusive dark matter (DM), and remain poorly constrained in the ˜20 - 100 M⊙ mass range. PBH binaries were recently suggested as the possible source of LIGO's first detections. In this paper, we thoroughly revisit existing estimates of the merger rate of PBH binaries. We compute the probability distribution of orbital parameters for PBH binaries formed in the early Universe, accounting for tidal torquing by all other PBHs, as well as standard large-scale adiabatic perturbations. We then check whether the orbital parameters of PBH binaries formed in the early Universe can be significantly affected between formation and merger. Our analytic estimates indicate that the tidal field of halos and interactions with other PBHs, as well as dynamical friction by unbound standard DM particles, do not do significant work on nor torque PBH binaries. We estimate the torque due to baryon accretion to be much weaker than previous calculations, albeit possibly large enough to significantly affect the eccentricity of typical PBH binaries. We also revisit the PBH-binary merger rate resulting from gravitational capture in present-day halos, accounting for Poisson fluctuations. If binaries formed in the early Universe survive to the present time, as suggested by our analytic estimates, they dominate the total PBH merger rate. Moreover, this merger rate would be orders of magnitude larger than LIGO's current upper limits if PBHs make a significant fraction of the dark matter. As a consequence, LIGO would constrain ˜10 - 300 M⊙ PBHs to constitute no more than ˜1 % of the dark matter. To make this conclusion fully robust, though, numerical study of several complex astrophysical processes—such as the formation of the first PBH halos and how they may affect PBH binaries, as well as the accretion of gas onto an extremely eccentric binary—is needed.

Gaia Assorted Mass Binaries Long Excluded from SLoWPoKES (GAMBLES): Identifying Ultra-wide Binary Pairs with Components of Diverse Mass

Energy Technology Data Exchange (ETDEWEB)

Oelkers, Ryan J.; Stassun, Keivan G.; Dhital, Saurav, E-mail: ryan.j.oelkers@vanderbilt.edu [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN 37235 (United States)

2017-06-01

The formation and evolution of binary star systems are some of the remaining key questions in modern astronomy. Wide binary pairs (separations >10{sup 3} au) are particularly intriguing because their low binding energies make it difficult for the stars to stay gravitationally bound over extended timescales, and thus to probe the dynamics of binary formation and dissolution. Our previous SLoWPoKES catalogs, I and II, provided the largest and most complete sample of wide-binary pairs of low masses. Here we present an extension of these catalogs to a broad range of stellar masses: the Gaia Assorted Mass Binaries Long Excluded from SloWPoKES (GAMBLES), comprising 8660 statistically significant wide pairs that we make available in a living online database. Within this catalog we identify a subset of 543 long-lived (dissipation timescale >1.5 Gyr) candidate binary pairs, of assorted mass, with typical separations between 10{sup 3} and 10{sup 5.5} au (0.002–1.5 pc), using the published distances and proper motions from the Tycho -Gaia Astrometric Solution and Sloan Digital Sky Survey photometry. Each pair has at most a false positive probability of 0.05; the total expectation is 2.44 false binaries in our sample. Among these, we find 22 systems with 3 components, 1 system with 4 components, and 15 pairs consisting of at least 1 possible red giant. We find the largest long-lived binary separation to be nearly 3.2 pc; even so, >76% of GAMBLES long-lived binaries have large binding energies and dissipation lifetimes longer than 1.5 Gyr. Finally, we find that the distribution of binary separations is clearly bimodal, corroborating the findings from SloWPoKES and suggesting multiple pathways for the formation and dissipation of the widest binaries in the Galaxy.

Gaia Assorted Mass Binaries Long Excluded from SLoWPoKES (GAMBLES): Identifying Ultra-wide Binary Pairs with Components of Diverse Mass

International Nuclear Information System (INIS)

Oelkers, Ryan J.; Stassun, Keivan G.; Dhital, Saurav

2017-01-01

The formation and evolution of binary star systems are some of the remaining key questions in modern astronomy. Wide binary pairs (separations >10 3 au) are particularly intriguing because their low binding energies make it difficult for the stars to stay gravitationally bound over extended timescales, and thus to probe the dynamics of binary formation and dissolution. Our previous SLoWPoKES catalogs, I and II, provided the largest and most complete sample of wide-binary pairs of low masses. Here we present an extension of these catalogs to a broad range of stellar masses: the Gaia Assorted Mass Binaries Long Excluded from SloWPoKES (GAMBLES), comprising 8660 statistically significant wide pairs that we make available in a living online database. Within this catalog we identify a subset of 543 long-lived (dissipation timescale >1.5 Gyr) candidate binary pairs, of assorted mass, with typical separations between 10 3 and 10 5.5 au (0.002–1.5 pc), using the published distances and proper motions from the Tycho -Gaia Astrometric Solution and Sloan Digital Sky Survey photometry. Each pair has at most a false positive probability of 0.05; the total expectation is 2.44 false binaries in our sample. Among these, we find 22 systems with 3 components, 1 system with 4 components, and 15 pairs consisting of at least 1 possible red giant. We find the largest long-lived binary separation to be nearly 3.2 pc; even so, >76% of GAMBLES long-lived binaries have large binding energies and dissipation lifetimes longer than 1.5 Gyr. Finally, we find that the distribution of binary separations is clearly bimodal, corroborating the findings from SloWPoKES and suggesting multiple pathways for the formation and dissipation of the widest binaries in the Galaxy.

Multi-technique investigation of the binary fraction of A-F type candidate hybrid variable stars discovered by Kepler

Science.gov (United States)

Lampens, P.; Frémat, Y.; Vermeylen, L.; Sódor, Á.; Skarka, M.; De Cat, P.; Bognár, Zs.; De Nutte, R.; Dumortier, L.; Escorza, A.; Oomen, G. M.; Van de Steene, G.; Kamath, D.; Laverick, M.; Samadi, A.; Triana, S.; Lehmann, H.

2018-02-01

Context. Hundreds of candidate hybrid pulsators of intermediate type A-F were revealed by recent space missions. Hybrid pulsators allow us to study the full stellar interiors, where both low-order p- and high-order g-modes are simultaneously excited. The true hybrid stars must be identified since other processes, related to stellar multiplicity or rotation, might explain the presence of (some) low frequencies observed in their periodograms. Aims: We measured the radial velocities of 50 candidate δ Scuti -γ Doradus hybrid stars from the Kepler mission with the Hermes and ACE spectrographs over a time span of months to years. We aim to derive the fraction of binary and multiple systems and to provide an independent and homogeneous determination of the atmospheric properties and v sin i for all targets. The long(er)-term objective is to identify the (probable) physical cause of the low frequencies. Methods: We computed one-dimensional cross-correlation functions (CCFs) in order to find the best set of parameters in terms of the number of components, spectral type(s), and v sin i for each target. Radial velocities were measured using spectrum synthesis and a two-dimensional cross-correlation technique in the case of double- and triple-lined systems. Fundamental parameters were determined by fitting (composite) synthetic spectra to the normalised median spectra corrected for the appropriate Doppler shifts. Results: We report on the analysis of 478 high-resolution Hermes and 41 ACE spectra of A/F-type candidate hybrid pulsators from the Kepler field. We determined their radial velocities, projected rotational velocities, and atmospheric properties and classified our targets based on the shape of the CCFs and the temporal behaviour of the radial velocities. We derived orbital solutions for seven new systems. Three preliminary long-period orbital solutions are confirmed by a photometric time-delay analysis. Finally, we determined a global multiplicity fraction of 27% in

30 CFR 282.4 - Opportunities for review and comment.

Science.gov (United States)

2010-07-01

... OPERATIONS IN THE OUTER CONTINENTAL SHELF FOR MINERALS OTHER THAN OIL, GAS, AND SULPHUR General § 282.4... potential impacts on the environment and to provide comments and recommendations for the disposition of the...

Multi-messenger Observations of a Binary Neutron Star Merger

NARCIS (Netherlands)

Scholten, Olaf; van den Berg, Adriaan

2017-01-01

On 2017 August 17 a binary neutron star coalescence candidate (later designated GW170817) with merger time 12:41:04 UTC was observed through gravitational waves by the Advanced LIGO and Advanced Virgo detectors. The Fermi Gamma-ray Burst Monitor independently detected a gamma-ray burst (GRB 170817A)

Multi-messenger Observations of a Binary Neutron Star Merger

DEFF Research Database (Denmark)

Abbott, B. P.; Abbott, R.; Abbott, T. D.

2017-01-01

On 2017 August 17 a binary neutron star coalescence candidate (later designated GW170817) with merger time 12:41:04 UTC was observed through gravitational waves by the Advanced LIGO and Advanced Virgo detectors. The Fermi Gamma-ray Burst Monitor independently detected a gamma-ray burst (GRB 17081...

Multi-messenger observations of a binary neutron star merger

NARCIS (Netherlands)

LIGO Scientific Collaboration and Virgo Collaboration; Fermi GBM; INTEGRAL; IceCube Collaboration; AstroSat Cadmium Zinc Telluride Imager Team; IPN Collaboration; The Insight-HXMT Collaboration; ANTARES Collaboration; The Swift Collaboration; AGILE Team; The 1M2H Team; The Dark Energy Camera GW-EM Collaboration and the DES Collaboration; The DLT40 Collaboration; GRAWITA: GRAvitational Wave Inaf TeAm; The Fermi Large Area Telescope Collaboration; ATCA: Australia Telescope Compact Array; ASKAP: Australian SKA Path finder; Las Cumbres Observatory Group; OzGrav; DWF (Deeper, Wider, Faster Program); AST3; CAASTRO Collaborations; The VINROUGE Collaboration; MASTER Collaboration; J-GEM; GROWTH; JAGWAR; Caltech- NRAO; TTU-NRAO; NuSTAR Collaborations; Pan-STARR; The MAXI Team; TZAC Consortium; KU Collaboration; Nordic Optical Telescope; ePESSTO; GROND; Texas Tech University; SALT Group; TOROS: Transient Robotic Observatory of the South Collaboration; The BOOTES Collaboration; MWA: Murchison Wide field Array; The CALET Collaboration; IKI-GW Follow-up Collaboration; H.E.S.S. Collaboration; LOFAR Collaboration; LWA: Long Wavelength Array; HAWC Collaboration; The Pierre Auger Collaboration; ALMA Collaboration; Euro VLBI Team; Pi of the Sky Collaboration; The Chandra Team at McGill University; DFN: Desert Fireball Network; ATLAS; High Time Resolution Universe Survey; RIMAS and RATIR; SKA South Africa / MeerKAT

2017-01-01

On 2017 August 17 a binary neutron star coalescence candidate (later designated GW170817) with merger time 12:41:04 UTC was observed through gravitational waves by the Advanced LIGO and Advanced Virgo detectors. The Fermi Gamma-ray Burst Monitor independently detected a gamma-ray burst (GRB 170817A)

Receptive fields selection for binary feature description.

Science.gov (United States)

Fan, Bin; Kong, Qingqun; Trzcinski, Tomasz; Wang, Zhiheng; Pan, Chunhong; Fua, Pascal

2014-06-01

Feature description for local image patch is widely used in computer vision. While the conventional way to design local descriptor is based on expert experience and knowledge, learning-based methods for designing local descriptor become more and more popular because of their good performance and data-driven property. This paper proposes a novel data-driven method for designing binary feature descriptor, which we call receptive fields descriptor (RFD). Technically, RFD is constructed by thresholding responses of a set of receptive fields, which are selected from a large number of candidates according to their distinctiveness and correlations in a greedy way. Using two different kinds of receptive fields (namely rectangular pooling area and Gaussian pooling area) for selection, we obtain two binary descriptors RFDR and RFDG .accordingly. Image matching experiments on the well-known patch data set and Oxford data set demonstrate that RFD significantly outperforms the state-of-the-art binary descriptors, and is comparable with the best float-valued descriptors at a fraction of processing time. Finally, experiments on object recognition tasks confirm that both RFDR and RFDG successfully bridge the performance gap between binary descriptors and their floating-point competitors.

10 CFR 205.282 - Evaluation of petition by the Office of Hearings and Appeals.

Science.gov (United States)

2010-01-01

... 10 Energy 3 2010-01-01 2010-01-01 false Evaluation of petition by the Office of Hearings and Appeals. 205.282 Section 205.282 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS... and Appeals or his designee shall issue a final Decision and Order which shall govern the disposition...

Black holes in massive close binaries - observational data and evolutionary status

International Nuclear Information System (INIS)

Tutukov, A.V.; Cherepashchuk, A.M.; Moskovskii Gosudarstvennyi Universitet, Moscow, USSR)

1985-01-01

The available information on the mass of four candidate black holes in X-ray binary systems is summarized; these systems are compared with neutron star binaries with regard to the mass of their components. In mass, the relativistic objects form two distinct groups, neutron stars with masses equal to about 1-2 solar masses and black hole candidates with masses equal to about 10-60 solar masses (there seem to be no intermediate cases), but there is no correlation with the mass of the optical star. Mass exchange between the optical component of a close binary and its neutron star companion would be unlikely to produce a black hole more massive than 5-7 solar masses. Instead, the black holes having masses greater than about 10 solar masses might result from core collapse in stars of initial mass equating 20-100 solar masses through either a rise in the presupernova core mass or weakness of the magnetic field. The (10-30)-fold disparity in the incidence of black holes coupled with OB stars and with radio pulsars could indicate that black holes tend to form in pairs. 36 references

Radial-velocity measures and the existence of astrophysical binaries in late-type dwarf stars

Science.gov (United States)

Bopp, B. W.; Meredith, R.

1986-01-01

Radial velocities with errors of 1-2 km/s are presented based on CCD scans obtained with the Kitt Peak National Observatory coude feed telescope between 1982 and 1985 of 48 dK-M stars that lack Balmer emission. Comparison with Gliese's (1969) values shows only two stars to be spectroscopic binary candidates with small velocity amplitudes. No evidence for any short period (less than 10 days) binaries is found, supporting the conclusions of Young et al. (1986) that there are no astrophysical binaries among these chromosherically inactive dM stars.

Formation of the wide asynchronous binary asteroid population

International Nuclear Information System (INIS)

Jacobson, Seth A.; Scheeres, Daniel J.; McMahon, Jay

2014-01-01

We propose and analyze a new mechanism for the formation of the wide asynchronous binary population. These binary asteroids have wide semimajor axes relative to most near-Earth and main belt asteroid systems. Confirmed members have rapidly rotating primaries and satellites that are not tidally locked. Previously suggested formation mechanisms from impact ejecta, from planetary flybys, and directly from rotational fission events cannot satisfy all of the observations. The newly hypothesized mechanism works as follows: (1) these systems are formed from rotational fission, (2) their satellites are tidally locked, (3) their orbits are expanded by the binary Yarkovsky-O'Keefe-Radzievskii-Paddack (BYORP) effect, (4) their satellites desynchronize as a result of the adiabatic invariance between the libration of the secondary and the mutual orbit, and (5) the secondary avoids resynchronization because of the YORP effect. This seemingly complex chain of events is a natural pathway for binaries with satellites that have particular shapes, which define the BYORP effect torque that acts on the system. After detailing the theory, we analyze each of the wide asynchronous binary members and candidates to assess their most likely formation mechanism. Finally, we suggest possible future observations to check and constrain our hypothesis.

FORMATION OF BLACK HOLE X-RAY BINARIES IN GLOBULAR CLUSTERS

International Nuclear Information System (INIS)

Ivanova, N.; Heinke, C. O.; Woods, T. E.; Chaichenets, S.; Fregeau, J.; Lombardi, J. C.

2010-01-01

Inspired by the recent identification in extragalactic globular clusters of the first candidate black hole-white dwarf (BH-WD) X-ray binaries, where the compact accretors may be stellar-mass black holes (BHs), we explore how such binaries could be formed in a dynamical environment. We provide analyses of the formation rates via well-known formation channels like binary exchange and physical collisions and propose that the only possibility of forming BH-WD binaries is via coupling these usual formation channels with subsequent hardening and/or triple formation. In particular, we find that the most important mechanism for the creation of a BH-WD X-ray binary from an initially dynamically formed BH-WD binary is mass transfer induced in a triple system via the Kozai mechanism. Furthermore, we find that BH-WD binaries that evolve into X-ray sources can be formed by exchanges of a BH into a WD-WD binary or possibly by collisions of a BH and a giant star. If BHs undergo significant evaporation from the cluster or form a completely detached subcluster of BHs, then we cannot match the observationally inferred production rates even using the most optimistic estimates of formation rates. To explain the observations with stellar-mass BH-WD binaries, at least 1% of all formed BHs, or presumably 10% of the BHs present in the core now, must be involved in interactions with the rest of the core stellar population.

7 CFR 282.1 - Legislative authority and notice requirements.

Science.gov (United States)

2010-01-01

... Section 282.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM DEMONSTRATION, RESEARCH, AND... 17 of the Act authorizes the Secretary to conduct demonstration, research, and evaluation projects...

Thermo-Viscoplastic Behavior of Ni-Based Superalloy Haynes 282 and Its Application to Machining Simulation

Directory of Open Access Journals (Sweden)

Marcos Rodríguez-Millán

2017-12-01

Full Text Available Ni-based superalloys are extensively used in high-responsibility applications in components of aerospace engines and gas turbines with high temperature service lives. The wrought, γ’-strengthened superalloy Haynes 282 has been recently developed for applications similar to other common superalloys, such as Waspaloy or Inconel 718, with improved creep behavior, thermal stability, and fabrication ability. Despite the potential of Haynes 282, there are still important gaps in the knowledge of the mechanical behavior of this alloy. In fact, it was not possible to find information concerning the mechanical behavior of the alloy under impulsive loading. This paper focuses on the mechanical characterization of the Haynes 282 at strain rates ranging from 0.1 to 2800 s−1 and high temperatures ranging from 293 to 523 K using Hopkinson bar compression tests. The experimental results from the thermo-mechanical characterization allowed for calibration of the Johnson–Cook model widely used in modeling metallic alloy’s responses under dynamic loading. Moreover, the behavior of Haynes 282 was compared to that reported for Inconel 718, and the results were used to successfully model the orthogonal cutting of Haynes 282, being a typical case of dynamic loading requiring previous characterization of the alloy.

The cool surfaces of binary near-Earth asteroids

Science.gov (United States)

Delbo, Marco; Walsh, Kevin; Mueller, Michael; Harris, Alan W.; Howell, Ellen S.

2011-03-01

Here we show results from thermal-infrared observations of km-sized binary near-Earth asteroids (NEAs). We combine previously published thermal properties for NEAs with newly derived values for three binary NEAs. The η value derived from the near-Earth asteroid thermal model (NEATM) for each object is then used to estimate an average thermal inertia for the population of binary NEAs and compared against similar estimates for the population of non-binaries. We find that these objects have, in general, surface temperatures cooler than the average values for non-binary NEAs as suggested by elevated η values. We discuss how this may be evidence of higher-than-average surface thermal inertia. This latter physical parameter is a sensitive indicator of the presence or absence of regolith: bodies covered with fine regolith, such as the Earth’s moon, have low thermal inertia, whereas a surface with little or no regolith displays high thermal inertia. Our results are suggestive of a binary formation mechanism capable of altering surface properties, possibly removing regolith: an obvious candidate is the YORP effect. We present also newly determined sizes and geometric visible albedos derived from thermal-infrared observations of three binary NEAs: (5381) Sekhmet, (153591) 2001 SN263, and (164121) 2003 YT1. The diameters of these asteroids are 1.41 ± 0.21 km, 1.56 ± 0.31 km, and 2.63 ± 0.40 km, respectively. Their albedos are 0.23 ± 0.13, 0.24 ± 0.16, and 0.048 ± 0.015, respectively.

Modeling AGN outbursts from supermassive black hole binaries

Directory of Open Access Journals (Sweden)

Tanaka T.

2012-12-01

Full Text Available When galaxies merge to assemble more massive galaxies, their nuclear supermassive black holes (SMBHs should form bound binaries. As these interact with their stellar and gaseous environments, they will become increasingly compact, culminating in inspiral and coalescence through the emission of gravitational radiation. Because galaxy mergers and interactions are also thought to fuel star formation and nuclear black hole activity, it is plausible that such binaries would lie in gas-rich environments and power active galactic nuclei (AGN. The primary difference is that these binaries have gravitational potentials that vary – through their orbital motion as well as their orbital evolution – on humanly tractable timescales, and are thus excellent candidates to give rise to coherent AGN variability in the form of outbursts and recurrent transients. Although such electromagnetic signatures would be ideally observed concomitantly with the binary’s gravitational-wave signatures, they are also likely to be discovered serendipitously in wide-field, high-cadence surveys; some may even be confused for stellar tidal disruption events. I discuss several types of possible “smoking gun” AGN signatures caused by the peculiar geometry predicted for accretion disks around SMBH binaries.

A CAUTIONARY TALE: MARVELS BROWN DWARF CANDIDATE REVEALS ITSELF TO BE A VERY LONG PERIOD, HIGHLY ECCENTRIC SPECTROSCOPIC STELLAR BINARY

International Nuclear Information System (INIS)

Mack, Claude E. III; Stassun, Keivan G.; De Lee, Nathan; Ge, Jian; Fleming, Scott W.; Deshpande, Rohit; Mahadevan, Suvrath; Wisniewski, John P.; Gaudi, B. Scott; Eastman, Jason; Beatty, Thomas G.; Ghezzi, Luan; González Hernández, Jonay I.; Femenía, Bruno; Mata Sánchez, Daniel; Ferreira, Letícia; Porto de Mello, Gustavo; Crepp, Justin R.; Agol, Eric; Bizyaev, Dmitry

2013-01-01

We report the discovery of a highly eccentric, double-lined spectroscopic binary star system (TYC 3010-1494-1), comprising two solar-type stars that we had initially identified as a single star with a brown dwarf companion. At the moderate resolving power of the MARVELS spectrograph and the spectrographs used for subsequent radial-velocity (RV) measurements (R ∼ Jup ) to a solar-type primary. At least three properties of this system allow it to masquerade as a single star with a very-low-mass companion: its large eccentricity (e ∼ 0.8), its relatively long period (P ∼ 238 days), and the approximately perpendicular orientation of the semi-major axis with respect to the line of sight (ω ∼ 189°). As a result of these properties, for ∼95% of the orbit the two sets of stellar spectral lines are completely blended, and the RV measurements based on centroiding on the apparently single-lined spectrum is very well fit by an orbit solution indicative of a brown dwarf companion on a more circular orbit (e ∼ 0.3). Only during the ∼5% of the orbit near periastron passage does the true, double-lined nature and large RV amplitude of ∼15 km s –1 reveal itself. The discovery of this binary system is an important lesson for RV surveys searching for substellar companions; at a given resolution and observing cadence, a survey will be susceptible to these kinds of astrophysical false positives for a range of orbital parameters. Finally, for surveys like MARVELS that lack the resolution for a useful line bisector analysis, it is imperative to monitor the peak of the cross-correlation function for suspicious changes in width or shape, so that such false positives can be flagged during the candidate vetting process.

WIYN Open Cluster Study: Binary Orbits and Tidal Circularization in NGC 6819

Science.gov (United States)

Morscher, Meagan B.; Mathieu, R. D.; Kaeppler, S.; Hole, K. T.; Meibom, S.

2006-12-01

We are conducting a comprehensive stellar radial-velocity survey in NGC 6819, a rich, intermediate age ( 2.4 Gyr) open cluster with [Fe/H] -0.05. As of October 2006, we have obtained 7065 radial-velocity measurements of 1409 stars using the WIYN Hydra Multi-Object Spectrograph, with typical velocity measurement precisions of 0.4 km/s. Using an E/I criterion of 3, we have identified 282 velocity variables. In the past year we have expanded the number of final orbital solutions by 45 to a total of more than 80 solutions. In coeval stellar populations, circular binaries tend to have the shortest orbital periods, while longer period binaries show a distribution of non-zero eccentricities. The circularization of the shortest period orbits is the result of an exchange of stellar and orbital angular momentum due to tidal interactions. We defined a population’s tidal circularization period as the longest orbital period at which a binary of typical initial eccentricity has become circularized (e.g., has evolved to an eccentricity e = 0.01) over the lifetime of the cluster (Meibom & Mathieu, 2005, ApJ, 620, 970). We are studying the trend of increasing tidal circularization periods with population age. Preliminary results in NGC 6819 indicate a tidal circularization period of 7.5 days, which is consistent with this overall trend. We will recalculate the tidal circularization period in order to include the latest sample of orbital solutions. This comprehensive survey also allows us to investigate the relative spatial distributions of spectroscopic binaries and other constant-velocity cluster members of similar mass. We find the spectroscopic binaries to be more centrally concentrated at a statistically significant level, which we attribute to energy equipartition processes. MM was supported by REU NSF grant AST-0453442. RDM, SK, KTH, and SM were supported by NSF grant AST-0406615.

30 CFR 282.10 - Jurisdiction and responsibilities of Director.

Science.gov (United States)

2010-07-01

... part and are under the jurisdiction of the Director: Exploration, testing, and mining operations... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Jurisdiction and responsibilities of Director... Jurisdiction and Responsibilities of Director § 282.10 Jurisdiction and responsibilities of Director. Subject...

FIRST LONG-TERM OPTICAL SPECTRAL MONITORING OF A BINARY BLACK HOLE CANDIDATE E1821+643. I. VARIABILITY OF SPECTRAL LINES AND CONTINUUM

International Nuclear Information System (INIS)

Shapovalova, A. I.; Burenkov, A. N.; Zhdanova, V. E.; Popović, L. Č.; Chavushyan, V. H.; Valdés, J. R.; Patiño-Álvarez, V.; León-Tavares, J.; Torrealba, J.; Ilić, D.; Kovačević, A.; Kollatschny, W.

2016-01-01

We report the results of the first long-term (1990–2014) optical spectrophotometric monitoring of a binary black hole candidate QSO E1821+643, a low-redshift, high-luminosity, radio-quiet quasar. In the monitored period, the continua and Hγ fluxes changed about two times, while the Hβ flux changed about 1.4 times. We found periodical variations in the photometric flux with periods of 1200, 1850, and 4000 days, and 4500-day periodicity in the spectroscopic variations. However, the periodicity of 4000–4500 days covers only one cycle of variation and should be confirmed with a longer monitoring campaign. There is an indication of the period around 1300 days in the spectroscopic light curves, buts with small significance level, while the 1850-day period could not be clearly identified in the spectroscopic light curves. The line profiles have not significantly changed, showing an important red asymmetry and broad line peak redshifted around +1000 km s −1 . However, Hβ shows a broader mean profile and has a larger time lag (τ ∼ 120 days) than Hγ (τ ∼ 60 days). We estimate that the mass of the black hole is ∼2.6 × 10 9 M ⊙ . The obtained results are discussed in the frame of the binary black hole hypothesis. To explain the periodicity in the flux variability and high redshift of the broad lines, we discuss a scenario where dense, gas-rich, cloudy-like structures are orbiting around a recoiling black hole

UNUSUALLY WIDE BINARIES: ARE THEY WIDE OR UNUSUAL?

International Nuclear Information System (INIS)

Kraus, Adam L.; Hillenbrand, Lynne A.

2009-01-01

We describe an astrometric and spectroscopic campaign to confirm the youth and association of a complete sample of candidate wide companions in Taurus and Upper Sco. Our survey found 15 new binary systems (three in Taurus and 12 in Upper Sco) with separations of 3''-30'' (500-5000 AU) among all of the known members with masses of 2.5-0.012 M sun . The total sample of 49 wide systems in these two regions conforms to only some expectations from field multiplicity surveys. Higher mass stars have a higher frequency of wide binary companions, and there is a marked paucity of wide binary systems near the substellar regime. However, the separation distribution appears to be log-flat, rather than declining as in the field, and the mass ratio distribution is more biased toward similar-mass companions than the initial mass function or the field G-dwarf distribution. The maximum separation also shows no evidence of a limit at ∼ sun . We attribute this result to the post-natal dynamical sculpting that occurs for most field systems; our binary systems will escape to the field intact, but most field stars are formed in denser clusters and undergo significant dynamical evolution. In summary, only wide binary systems with total masses ∼ sun appear to be 'unusually wide'.

Effect of C282Y genotype on self-reported musculoskeletal complications in hereditary hemochromatosis.

Science.gov (United States)

Camacho, António; Funck-Brentano, Thomas; Simão, Márcio; Cancela, Leonor; Ottaviani, Sébastien; Cohen-Solal, Martine; Richette, Pascal

2015-01-01

Arthropathy that mimics osteoarthritis (OA) and osteoporosis (OP) is considered a complication of hereditary hemochromatosis (HH). We have limited data comparing OA and OP prevalence among HH patients with different hemochromatosis type 1 (HFE) genotypes. We investigated the prevalence of OA and OP in patients with HH by C282Y homozygosity and compound heterozygosity (C282Y/H63D) genotype. A total of 306 patients with HH completed a questionnaire. Clinical and demographic characteristics and presence of OA, OP and related complications were compared by genotype, adjusting for age, sex, body mass index (BMI), current smoking and menopausal status. In total, 266 of the 306 patients (87%) were homozygous for C282Y, and 40 (13%) were compound heterozygous. The 2 groups did not differ by median age [60 (interquartile range [IQR] 53 to 68) vs. 61 (55 to 67) years, P=0.8], sex (female: 48.8% vs. 37.5%, P=0.18) or current smoking habits (12.4% vs. 10%, P=0.3). As compared with compound heterozygous patients, C282Y homozygous patients had higher median serum ferritin concentration at diagnosis [1090 (IQR 610 to 2210) vs. 603 (362 to 950) µg/L, P<0.001], higher median transferrin saturation [80% (IQR 66 to 91%) vs. 63% (55 to 72%), P<0.001]) and lower median BMI [24.8 (22.1 to 26.9) vs. 26.2 (23.5 to 30.3) kg/m2, P<0.003]. The overall prevalence of self-reported OA was significantly higher with C282Y homozygosity than compound heterozygosity (53.4% vs. 32.5%; adjusted odds ratio [aOR] 2.4 [95% confidence interval 1.2-5.0]), as was self-reported OP (25.6% vs. 7.5%; aOR 3.5 [1.1-12.1]). Patients with C282Y homozygosity may be at increased risk of musculoskeletal complications of HH.

Surface segregation in binary alloy first wall candidate materials

International Nuclear Information System (INIS)

Gruen, D.M.; Krauss, A.R.; Mendelsohn, M.H.; Susman, S.; Argonne National Lab., IL

1982-01-01

We have been studying the conditions necessary to produce a self-sustaining stable lithium monolayer on a metal substrate as a means of creating a low-Z film which sputters primarily as secondary ions. It is expected that because of the toroidal field, secondary ions originating at the first wall will be returned and contribute little to the plasma impurity influx. Aluminum and copper have, because of their high thermal conductivity and low induced radioactivity, been proposed as first wall candidate materials. The mechanical properties of the pure metals are very poorly suited to structural applications and an alloy must be used to obtain adequate hardness and tensile strength. In the case of aluminum, mechanical properties suitable for aircraft manufacture are obtained by the addition of a few at% Li. In order to investigate alloys of a similar nature as candidate structural materials for fusion machines we have prepared samples of Li-doped aluminum using both a pyro-metallurgical and a vapor-diffusion technique. The sputtering properties and surface composition have been studied as a function of sample temperature and heating time, and ion beam mass. The erosion rate and secondary ion yield of both the sputtered Al and Li have been monitored by secondary ion mass spectroscopy and Auger analysis providing information on surface segregation, depth composition profiles, and diffusion rates. The surface composition ahd lithium depth profiles are compared with previously obtained computational results based on a regular solution model of segregation, while the partial sputtering yields of Al and Li are compared with results obtained with a modified version of the TRIM computer program. (orig.)

Microstructural analysis of laser weld fusion zone in Haynes 282 superalloy

Energy Technology Data Exchange (ETDEWEB)

Osoba, L.O. [Department of Mechanical and Manufacturing Engineering, University of Manitoba, Winnipeg, Manitoba, R3T 5V6 (Canada); Ding, R.G. [Department of Metallurgy and Materials Engineering, University of Birmingham, Birmingham B15 2TT (United Kingdom); Ojo, O.A., E-mail: ojo@cc.umanitoba.ca [Department of Mechanical and Manufacturing Engineering, University of Manitoba, Winnipeg, Manitoba, R3T 5V6 (Canada)

2012-03-15

Analytical electron microscopy and spectroscopy analyses of the fusion zone (FZ) microstructure in autogenous laser beam welded Haynes 282 (HY 282) superalloy were performed. The micro-segregation patterns observed in the FZ indicate that Co, Cr and Al exhibited a nearly uniform distribution between the dendrite core and interdendritic regions while Ti and Mo were rejected into the interdendritic liquid during the weld solidification. Transmission electron diffraction analysis and energy dispersive X-ray microanalysis revealed the second phase particles formed along the FZ interdendritic region to be Ti-Mo rich MC-type carbide particles. Weld FZ solidification cracking, which is sometimes associated with the formation of {gamma}-{gamma}' eutectic in {gamma}' precipitation strengthened nickel-base superalloys, was not observed in the HY 282 superalloy. Modified primary solidification path due to carbon addition in the newly developed superalloy is used to explain preclusion of weld FZ solidification cracking in the material. - Highlights: Black-Right-Pointing-Pointer A newly developed superalloy was welded by CO{sub 2} laser beam joining technique. Black-Right-Pointing-Pointer Electron microscopy characterization of the weld microstructure was performed. Black-Right-Pointing-Pointer Identified interdendritic microconstituents consist of MC-type carbides. Black-Right-Pointing-Pointer Modification of primary solidification path is used to explain cracking resistance.

Microstructural analysis of laser weld fusion zone in Haynes 282 superalloy

International Nuclear Information System (INIS)

Osoba, L.O.; Ding, R.G.; Ojo, O.A.

2012-01-01

Analytical electron microscopy and spectroscopy analyses of the fusion zone (FZ) microstructure in autogenous laser beam welded Haynes 282 (HY 282) superalloy were performed. The micro-segregation patterns observed in the FZ indicate that Co, Cr and Al exhibited a nearly uniform distribution between the dendrite core and interdendritic regions while Ti and Mo were rejected into the interdendritic liquid during the weld solidification. Transmission electron diffraction analysis and energy dispersive X-ray microanalysis revealed the second phase particles formed along the FZ interdendritic region to be Ti–Mo rich MC-type carbide particles. Weld FZ solidification cracking, which is sometimes associated with the formation of γ–γ' eutectic in γ' precipitation strengthened nickel-base superalloys, was not observed in the HY 282 superalloy. Modified primary solidification path due to carbon addition in the newly developed superalloy is used to explain preclusion of weld FZ solidification cracking in the material. - Highlights: ► A newly developed superalloy was welded by CO 2 laser beam joining technique. ► Electron microscopy characterization of the weld microstructure was performed. ► Identified interdendritic microconstituents consist of MC-type carbides. ► Modification of primary solidification path is used to explain cracking resistance.

Planet Candidate Validation in K2 Crowded Fields

Science.gov (United States)

Rampalli, Rayna; Vanderburg, Andrew; Latham, David; Quinn, Samuel

2018-01-01

In just three years, the K2 mission has yielded some remarkable outcomes with the discovery of over 100 confirmed planets and 500 reported planet candidates to be validated. One challenge with this mission is the search for planets located in star-crowded regions. Campaign 13 is one such example, located towards the galactic plane in the constellation of Taurus. We subject the potential planetary candidates to a validation process involving spectroscopy to derive certain stellar parameters. Seeing-limited on/off imaging follow-up is also utilized in order to rule out false positives due to nearby eclipsing binaries. Using Markov chain Monte Carlo analysis, the best-fit parameters for each candidate are generated. These will be suitable for finding a candidate’s false positive probability through methods including feeding such parameters into the Validation of Exoplanet Signals using a Probabilistic Algorithm (VESPA). These techniques and results serve as important tools for conducting candidate validation and follow-up observations for space-based missions such as the upcoming TESS mission since TESS’s large camera pixels resemble K2’s star-crowded fields.

Benchmark ultra-cool dwarfs in widely separated binary systems

Directory of Open Access Journals (Sweden)

Jones H.R.A.

2011-07-01

Full Text Available Ultra-cool dwarfs as wide companions to subgiants, giants, white dwarfs and main sequence stars can be very good benchmark objects, for which we can infer physical properties with minimal reference to theoretical models, through association with the primary stars. We have searched for benchmark ultra-cool dwarfs in widely separated binary systems using SDSS, UKIDSS, and 2MASS. We then estimate spectral types using SDSS spectroscopy and multi-band colors, place constraints on distance, and perform proper motions calculations for all candidates which have sufficient epoch baseline coverage. Analysis of the proper motion and distance constraints show that eight of our ultra-cool dwarfs are members of widely separated binary systems. Another L3.5 dwarf, SDSS 0832, is shown to be a companion to the bright K3 giant η Cancri. Such primaries can provide age and metallicity constraints for any companion objects, yielding excellent benchmark objects. This is the first wide ultra-cool dwarf + giant binary system identified.

An Extremely Red and Two Other Nearby L Dwarf Candidates Previously Overlooked in 2MASS, WISE, and Other Surveys

Science.gov (United States)

Scholz, Ralf-Dieter; Bell, Cameron P. M.

2018-02-01

We present three new nearby L dwarf candidates, found in a continued combined color/proper motion search using WISE, 2MASS, and other survey data, where we included extended WISE sources and looked closer to the Galactic plane region. Their spectral types and distances were estimated from photometric comparisons to well-known L dwarfs with trigonometric parallaxes. The first object, 2MASS J07555430-3259589, is an extremely red L7.5p dwarf candidate at a photometric distance of about 16 pc. Its position, proper motion and distance are consistent with membership in the Carina-Near young moving group. The second one, 2MASS J07414279-0506464, is resolved in Gaia DR1 as a close binary (separation 0.3 arcsec), and we classify it as a equal-mass binary candidate consisting of two L5 dwarfs at 19 pc. Our nearest new neighbor, 2MASS J19251275+0700362, is an L7 dwarf candidate at 10 pc.

CRISPR/Cas9 Promotes Functional Study of Testis Specific X-Linked Gene In Vivo.

Directory of Open Access Journals (Sweden)

Minyan Li

Full Text Available Mammalian spermatogenesis is a highly regulated multistage process of sperm generation. It is hard to uncover the real function of a testis specific gene in vitro since the in vitro model is not yet mature. With the development of the CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 system, we can now rapidly generate knockout mouse models of testis specific genes to study the process of spermatogenesis in vivo. SYCP3-like X-linked 2 (SLX2 is a germ cell specific component, which contains a Cor1 domain and belongs to the XLR (X-linked, lymphocyte regulated family. Previous studies suggested that SLX2 might play an important role in mouse spermatogenesis based on its subcellular localization and interacting proteins. However, the function of SLX2 in vivo is still elusive. Here, to investigate the functions of SLX2 in spermatogenesis, we disrupted the Slx2 gene by using the CRISPR/Cas9 system. Since Slx2 is a testis specific X-linked gene, we obtained knockout male mice in the first generation and accelerated the study process. Compared with wild-type mice, Slx2 knockout mice have normal testis and epididymis. Histological observation of testes sections showed that Slx2 knockout affected none of the three main stages of spermatogenesis: mitosis, meiosis and spermiogenesis. In addition, we further confirmed that disruption of Slx2 did not affect the number of spermatogonial stem cells, meiosis progression or XY body formation by immunofluorescence analysis. As spermatogenesis was normal in Slx2 knockout mice, these mice were fertile. Taken together, we showed that Slx2 itself is not an essential gene for mouse spermatogenesis and CRISPR/Cas9 technique could speed up the functional study of testis specific X-linked gene in vivo.

O recrutamento militar na América Portuguesa: o esforço conjunto para a defesa da Colônia do Sacramento (1735-1737

Directory of Open Access Journals (Sweden)

Paulo César Possamai

2004-12-01

Full Text Available In their effort to defend the Colônia de Sacramento, besieged by the Spanish from October 1735 to September 1737, the Portuguese Crown ordered the mobilization of all human and material resources available in the State of Brazil. This article examines the compulsory recruitment that occurred on this occasion and discusses the living conditions of those men who were taken by force from their homes to be sent to the River Platte area, from where few would return.

HFE Mutations C282Y and H63D in Iranian Population With Type 2 Diabetes

Directory of Open Access Journals (Sweden)

Golchin

2015-04-01

Full Text Available Background Type 2 diabetes (T2D is a common metabolic disease caused by insulin secretion defects, which is associated with a variety of complications such as retinopathy, nephropathy, and neuropathy. Objectives Regarding the relationship between type 2 diabetes and hereditary chromatists, we conducted a genetic analysis on two previously reported mutations C282Y and H63D related to the HFE gene in our population. Patients and Methods Altogether, 145 patients with type 2 diabetes and 145 healthy controls were examined. A genotyping assay performed using electrophoresis of the DNA digestion products from MboI and RsaI for H63D and C282Y, respectively. Results Results showed a significant difference between case and controls regarding C282Y (P value < 0.001 and H63D genotypes (P value = 0.013. We also found a relationship between both mutations and nephropathy. Moreover, the difference between C282Y genotypes of patients with retinopathy and healthy controls were statistically significant (P value = 0.020 while there was no association between H63D and retinopathy. In addition, observed differences of both mutations were significant when nephropathic patients compared to the controls. Conclusions Our study showed a significant association between H63D and C282Y mutations and the risk of type 2 diabetes in Iranian population.

Low-mass X-ray binaries from black hole retaining globular clusters

Science.gov (United States)

Giesler, Matthew; Clausen, Drew; Ott, Christian D.

2018-06-01

Recent studies suggest that globular clusters (GCs) may retain a substantial population of stellar-mass black holes (BHs), in contrast to the long-held belief of a few to zero BHs. We model the population of BH low-mass X-ray binaries (BH-LMXBs), an ideal observable proxy for elusive single BHs, produced from a representative group of Milky Way GCs with variable BH populations. We simulate the formation of BH binaries in GCs through exchange interactions between binary and single stars in the company of tens to hundreds of BHs. Additionally, we consider the impact of the BH population on the rate of compact binaries undergoing gravitational wave driven mergers. The characteristics of the BH-LMXB population and binary properties are sensitive to the GCs structural parameters as well as its unobservable BH population. We find that GCs retaining ˜1000 BHs produce a galactic population of ˜150 ejected BH-LMXBs, whereas GCs retaining only ˜20 BHs produce zero ejected BH-LMXBs. Moreover, we explore the possibility that some of the presently known BH-LMXBs might have originated in GCs and identify five candidate systems.

Low-mass X-ray binaries from black-hole retaining globular clusters

Science.gov (United States)

Giesler, Matthew; Clausen, Drew; Ott, Christian D.

2018-03-01

Recent studies suggest that globular clusters (GCs) may retain a substantial population of stellar-mass black holes (BHs), in contrast to the long-held belief of a few to zero BHs. We model the population of BH low-mass X-ray binaries (BH-LMXBs), an ideal observable proxy for elusive single BHs, produced from a representative group of Milky Way GCs with variable BH populations. We simulate the formation of BH-binaries in GCs through exchange interactions between binary and single stars in the company of tens to hundreds of BHs. Additionally, we consider the impact of the BH population on the rate of compact binaries undergoing gravitational wave driven mergers. The characteristics of the BH-LMXB population and binary properties are sensitive to the GCs structural parameters as well as its unobservable BH population. We find that GCs retaining ˜1000 BHs produce a galactic population of ˜150 ejected BH-LMXBs whereas GCs retaining only ˜20 BHs produce zero ejected BH-LMXBs. Moreover, we explore the possibility that some of the presently known BH-LMXBs might have originated in GCs and identify five candidate systems.

C282Y polymorphism in the HFE gene is associated with risk of breast cancer.

Science.gov (United States)

Liu, Xiaoyan; Lv, Chunlei; Luan, Xiaorong; Lv, Ming

2013-10-01

The C282Y and H63D polymorphisms in the HFE gene have been implicated in susceptibility of breast cancer, but a number of studies have reported inconclusive results. The aim of this study is to investigate the association between the C282Y and H63D polymorphisms in the HFE gene and breast cancer risk by meta-analysis. We searched PubMed and Embase databases, covering all related studies until March 2, 2013. Statistical analysis was performed using STATA 10.0. A total of 7 studies including 1,720 cases and 18,296 controls for HFE C282Y polymorphism and 5 studies including 942 cases and 1,571 controls for HFE H63D polymorphism were included in the meta-analysis. The results showed that HFE C282Y polymorphism was significantly associated with increased risk of breast cancer under homozygotes vs. wild-type model (OR = 2.06, 95%CI = 1.19-3.58) and recessive model (OR = 1.98, 95%CI = 1.14-3.44) but not under heterozygotes vs. wild-type model (OR = 0.97, 95%CI = 0.70-1.35), dominant model (OR = 1.00, 95%CI = 0.72-1.40) and multiplicative model (OR = 1.04, 95%CI = 0.76-1.42). However, we did not find any association between HFE H63D polymorphism and breast cancer risk under all genetic models. This current meta-analysis suggested that C282Y polymorphism rather than H63D might be associated with increased risk of breast cancer.

Frequency of the hemochromatosis HFE mutations C282Y, H63D, and S65C in blood donors in the Faroe Islands

DEFF Research Database (Denmark)

Milman, Nils; á Steig, Torkil; Koefoed, Pernille

2004-01-01

on the HFE gene was assessed by genotyping using the polymerase chain reaction (PCR) technique and calculated from direct allele counting. We found no C282Y homozygous subjects; 28 (14.0%) subjects were C282Y heterozygous and four subjects were C282Y/H63D compound heterozygous (2.0%). The C282Y allele......The aim of the study was to assess the frequencies of the hereditary hemochromatosis HFE mutations C282Y, H63D, and S65C in the population in the Faroe Islands. The series comprised 200 randomly selected blood donors of Faroese heritage. The frequency of the C282Y, H63D, and S65C mutations.......6%. Screening of larger groups of the Faroese population for HFE mutations especially C282Y should be considered in order to establish the penetrance....

HFE Cys282Tyr homozygotes with serum ferritin concentrations below 1000 microg/L are at low risk of hemochromatosis.

Science.gov (United States)

Allen, Katrina J; Bertalli, Nadine A; Osborne, Nicholas J; Constantine, Clare C; Delatycki, Martin B; Nisselle, Amy E; Nicoll, Amanda J; Gertig, Dorota M; McLaren, Christine E; Giles, Graham G; Hopper, John L; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Gurrin, Lyle C

2010-09-01

Hemochromatosis gene (HFE)-associated hereditary hemochromatosis (HH) is a genetic predisposition to iron overload and subsequent signs and symptoms of disease that potentially affects approximately 80,000 persons in Australia and almost 1 million persons in the United States. Most clinical cases are homozygous for the Cys282Tyr (C282Y) mutation in the HFE gene, with serum ferritin (SF) concentration >1000 microg/L as the strongest predictor of cirrhosis. The optimal treatment regimen for those with SF concentrations above the normal range but aged 40-69 years. An HFE-stratified random sample of 1438 participants including all C282Y homozygotes with iron studies 12 years apart were examined by physicians blinded to participants' HFE genotype. All previously undiagnosed C282Y homozygotes (35 male, 67 female) and all HFE wild-types (131 male, 160 female) with baseline and follow-up SF concentrations age when disease would be expected to have developed. These observations have implications for the management of C282Y homozygotes.

Analysis of HLA-A antigens and C282Y and H63D mutations of the HFE gene in Brazilian patients with hemochromatosis

Directory of Open Access Journals (Sweden)

Bittencourt P.L.

2002-01-01

Full Text Available The hemochromatosis gene, HFE, is located on chromosome 6 in close proximity to the HLA-A locus. Most Caucasian patients with hereditary hemochromatosis (HH are homozygous for HLA-A3 and for the C282Y mutation of the HFE gene, while a minority are compound heterozygotes for C282Y and H63D. The prevalence of these mutations in non-Caucasian patients with HH is lower than expected. The objective of the present study was to evaluate the frequencies of HLA-A antigens and the C282Y and H63D mutations of the HFE gene in Brazilian patients with HH and to compare clinical and laboratory profiles of C282Y-positive and -negative patients with HH. The frequencies of HLA-A and C282Y and H63D mutations were determined by PCR-based methods in 15 male patients (median age 44 (20-72 years with HH. Eight patients (53% were homozygous and one (7% was heterozygous for the C282Y mutation. None had compound heterozygosity for C282Y and H63D mutations. All but three C282Y homozygotes were positive for HLA-A3 and three other patients without C282Y were shown to be either heterozygous (N = 2 or homozygous (N = 1 for HLA-A3. Patients homozygous for the C282Y mutation had higher ferritin levels and lower age at onset, but the difference was not significant. The presence of C282Y homozygosity in roughly half of the Brazilian patients with HH, together with the findings of HLA-A homozygosity in C282Y-negative subjects, suggest that other mutations in the HFE gene or in other genes involved in iron homeostasis might also be linked to HH in Brazil.

The evolutionary adaptation of the C282Y mutation to culture and climate during the European Neolithic.

Science.gov (United States)

Heath, Kathleen M; Axton, Jacob H; McCullough, John M; Harris, Nathan

2016-05-01

The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronutrient for effective thermoregulation. We argue that the C282Y allele was an adaptation to this novel environment. To address our hypothesis, we compiled C282Y allele frequencies, known Neolithic sites in Europe and climatic data on temperature and rainfall for statistical analysis. Our findings indicate that the geographic cline for C282Y frequency in Europe increases as average temperatures decrease below 16°C, a critical threshold for thermoregulation, with rainy days intensifying the trend. The results indicate that the deleterious C282Y allele, responsible for most cases of hemochromatosis, may have evolved as a selective advantage to culture and climate during the European Neolithic. © 2016 The Authors American Journal of Physical Anthropology Published by Wiley Periodicals, Inc.

Interacting binaries

International Nuclear Information System (INIS)

Eggleton, P.P.; Pringle, J.E.

1985-01-01

This volume contains 15 review articles in the field of binary stars. The subjects reviewed span considerably, from the shortest period of interacting binaries to the longest, symbiotic stars. Also included are articles on Algols, X-ray binaries and Wolf-Rayet stars (single and binary). Contents: Preface. List of Participants. Activity of Contact Binary Systems. Wolf-Rayet Stars and Binarity. Symbiotic Stars. Massive X-ray Binaries. Stars that go Hump in the Night: The SU UMa Stars. Interacting Binaries - Summing Up

HFE C282Y and H63D in adults with malignancies in a community medical oncology practice

International Nuclear Information System (INIS)

Barton, James C; Bertoli, Luigi F; Acton, Ronald T

2004-01-01

We sought to compare frequencies of HFE C282Y and H63D alleles and associated odds ratios (OR) in 100 consecutive unrelated white adults with malignancy to those in 318 controls. Data from patients with more than one malignancy were analyzed according to each primary malignancy. For the present study, OR ≥2.0 or ≤0.5 was defined to be increased or decreased, respectively. There were 110 primary malignancies (52 hematologic neoplasms, 58 carcinomas) in the 100 adult patients. Allele frequencies were similar in patients and controls (C282Y: 0.0850 vs. 0.0896, respectively (OR = 0.9); H63D: 0.1400 vs. 0.1447, respectively (OR = 0.9)). Two patients had hemochromatosis and C282Y homozygosity. With C282Y, increased OR occurred in non-Hodgkin lymphoma, myeloproliferative disorders, and adenocarcinoma of prostate (2.0, 2.8, and 3.4, respectively); OR was decreased in myelodysplasia (0.4). With H63D, increased OR occurred in myeloproliferative disorders and adenocarcinomas of breast and prostate (2.4, 2.0, and 2.0, respectively); OR was decreased in non-Hodgkin lymphoma and B-chronic lymphocytic leukemia (0.5 and 0.4, respectively). In 100 consecutive adults with malignancy evaluated in a community medical oncology practice, frequencies of HFE C282Y or H63D were similar to those in the general population. This suggests that C282Y or H63D is not associated with an overall increase in cancer risk. However, odds ratios computed in the present study suggest that increased (or decreased) risk for developing specific types of malignancy may be associated with the inheritance of HFE C282Y or H63D. Study of more patients with these specific types of malignancies is needed to determine if trends described herein would remain and yield significant differences

The white dwarf binary pathways survey - II. Radial velocities of 1453 FGK stars with white dwarf companions from LAMOST DR 4

Science.gov (United States)

Rebassa-Mansergas, A.; Ren, J. J.; Irawati, P.; García-Berro, E.; Parsons, S. G.; Schreiber, M. R.; Gänsicke, B. T.; Rodríguez-Gil, P.; Liu, X.; Manser, C.; Nevado, S. P.; Jiménez-Ibarra, F.; Costero, R.; Echevarría, J.; Michel, R.; Zorotovic, M.; Hollands, M.; Han, Z.; Luo, A.; Villaver, E.; Kong, X.

2017-12-01

We present the second paper of a series of publications aiming at obtaining a better understanding regarding the nature of type Ia supernovae (SN Ia) progenitors by studying a large sample of detached F, G and K main-sequence stars in close orbits with white dwarf companions (i.e. WD+FGK binaries). We employ the Large Sky Area Multi-Object Fibre Spectroscopic Telescope (LAMOST) data release 4 spectroscopic data base together with Galaxy Evolution Explorer (GALEX) ultraviolet fluxes to identify 1549 WD+FGK binary candidates (1057 of which are new), thus doubling the number of known sources. We measure the radial velocities of 1453 of these binaries from the available LAMOST spectra and/or from spectra obtained by us at a wide variety of different telescopes around the globe. The analysis of the radial velocity data allows us to identify 24 systems displaying more than 3σ radial velocity variation that we classify as close binaries. We also discuss the fraction of close binaries among WD+FGK systems, which we find to be ∼10 per cent, and demonstrate that high-resolution spectroscopy is required to efficiently identify double-degenerate SN Ia progenitor candidates.

White dwarf-main sequence binaries from LAMOST: the DR5 catalogue

Science.gov (United States)

Ren, J.-J.; Rebassa-Mansergas, A.; Parsons, S. G.; Liu, X.-W.; Luo, A.-L.; Kong, X.; Zhang, H.-T.

2018-03-01

We present the data release (DR) 5 catalogue of white dwarf-main sequence (WDMS) binaries from the Large Area Multi-Object fiber Spectroscopic Telescope (LAMOST). The catalogue contains 876 WDMS binaries, of which 757 are additions to our previous LAMOST DR1 sample and 357 are systems that have not been published before. We also describe a LAMOST-dedicated survey that aims at obtaining spectra of photometrically-selected WDMS binaries from the Sloan Digital Sky Survey (SDSS) that are expected to contain cool white dwarfs and/or early type M dwarf companions. This is a population under-represented in previous SDSS WDMS binary catalogues. We determine the stellar parameters (white dwarf effective temperatures, surface gravities and masses, and M dwarf spectral types) of the LAMOST DR5 WDMS binaries and make use of the parameter distributions to analyse the properties of the sample. We find that, despite our efforts, systems containing cool white dwarfs remain under-represented. Moreover, we make use of LAMOST DR5 and SDSS DR14 (when available) spectra to measure the Na I λλ 8183.27, 8194.81 absorption doublet and/or Hα emission radial velocities of our systems. This allows identifying 128 binaries displaying significant radial velocity variations, 76 of which are new. Finally, we cross-match our catalogue with the Catalina Surveys and identify 57 systems displaying light curve variations. These include 16 eclipsing systems, two of which are new, and nine binaries that are new eclipsing candidates. We calculate periodograms from the photometric data and measure (estimate) the orbital periods of 30 (15) WDMS binaries.

RESOLVED COMPANIONS OF CEPHEIDS: TESTING THE CANDIDATES WITH X-RAY OBSERVATIONS

Energy Technology Data Exchange (ETDEWEB)

Evans, Nancy Remage; Pillitteri, Ignazio; Wolk, Scott; Karovska, Margarita; Tingle, Evan [Smithsonian Astrophysical Observatory, MS 4, 60 Garden St., Cambridge, MA 02138 (United States); Guinan, Edward; Engle, Scott [Department of Astronomy and Astrophysics, Villanova University, 800 Lancaster Ave., Villanova, PA 19085 (United States); Bond, Howard E. [Department of Astronomy and Astrophysics, Pennsylvania State University, University Park, PA 16802 (United States); Schaefer, Gail H. [The CHARA Array of Georgia State University, Mount Wilson, California 91023 (United States); Mason, Brian D., E-mail: nevans@cfa.harvard.edu, E-mail: heb11@psu.edu, E-mail: schaefer@chara-array.org [US Naval Observatory, 3450 Massachusetts Ave., NW, Washington, DC 20392-5420 (United States)

2016-04-15

We have made XMM-Newton observations of 14 Galactic Cepheids that have candidate resolved (≥5″) companion stars based on our earlier HST Wide Field Camera 3 (WFC3) imaging survey. Main-sequence stars that are young enough to be physical companions of Cepheids are expected to be strong X-ray producers in contrast to field stars. XMM-Newton exposures were set to detect essentially all companions hotter than spectral type M0 (corresponding to 0.5 M{sub ⊙}). The large majority of our candidate companions were not detected in X-rays, and hence are not confirmed as young companions. One resolved candidate (S Nor #4) was unambiguously detected, but the Cepheid is a member of a populous cluster. For this reason, it is likely that S Nor #4 is a cluster member rather than a gravitationally bound companion. Two further Cepheids (S Mus and R Cru) have X-ray emission that might be produced by either the Cepheid or the candidate resolved companion. A subsequent Chandra observation of S Mus shows that the X-rays are at the location of the Cepheid/spectroscopic binary. R Cru and also V659 Cen (also X-ray bright) have possible companions closer than 5″ (the limit for this study) which are the likely sources of X-rays. One final X-ray detection (V473 Lyr) has no known optical companion, so the prime suspect is the Cepheid itself. It is a unique Cepheid with a variable amplitude. The 14 stars that we observed with XMM constitute 36% of the 39 Cepheids found to have candidate companions in our HST/WFC3 optical survey. No young probable binary companions were found with separations of ≥5″ or 4000 au.

RESOLVED COMPANIONS OF CEPHEIDS: TESTING THE CANDIDATES WITH X-RAY OBSERVATIONS

International Nuclear Information System (INIS)

Evans, Nancy Remage; Pillitteri, Ignazio; Wolk, Scott; Karovska, Margarita; Tingle, Evan; Guinan, Edward; Engle, Scott; Bond, Howard E.; Schaefer, Gail H.; Mason, Brian D.

2016-01-01

We have made XMM-Newton observations of 14 Galactic Cepheids that have candidate resolved (≥5″) companion stars based on our earlier HST Wide Field Camera 3 (WFC3) imaging survey. Main-sequence stars that are young enough to be physical companions of Cepheids are expected to be strong X-ray producers in contrast to field stars. XMM-Newton exposures were set to detect essentially all companions hotter than spectral type M0 (corresponding to 0.5 M ⊙ ). The large majority of our candidate companions were not detected in X-rays, and hence are not confirmed as young companions. One resolved candidate (S Nor #4) was unambiguously detected, but the Cepheid is a member of a populous cluster. For this reason, it is likely that S Nor #4 is a cluster member rather than a gravitationally bound companion. Two further Cepheids (S Mus and R Cru) have X-ray emission that might be produced by either the Cepheid or the candidate resolved companion. A subsequent Chandra observation of S Mus shows that the X-rays are at the location of the Cepheid/spectroscopic binary. R Cru and also V659 Cen (also X-ray bright) have possible companions closer than 5″ (the limit for this study) which are the likely sources of X-rays. One final X-ray detection (V473 Lyr) has no known optical companion, so the prime suspect is the Cepheid itself. It is a unique Cepheid with a variable amplitude. The 14 stars that we observed with XMM constitute 36% of the 39 Cepheids found to have candidate companions in our HST/WFC3 optical survey. No young probable binary companions were found with separations of ≥5″ or 4000 au

The natural history of serum iron indices for HFE C282Y homozygosity associated with hereditary hemochromatosis.

Science.gov (United States)

Gurrin, Lyle C; Osborne, Nicholas J; Constantine, Clare C; McLaren, Christine E; English, Dallas R; Gertig, Dorota M; Delatycki, Martin B; Southey, Melissa C; Hopper, John L; Giles, Graham G; Anderson, Gregory J; Olynyk, John K; Powell, Laurie W; Allen, Katrina J

2008-12-01

There are few longitudinal studies of serum ferritin (SF) and transferrin saturation (TS) levels in individuals homozygous for the C282Y mutation. We characterized the development of elevated iron measures in C282Y homozygotes followed for 12 years. From 31,192 people aged 40-69 years at baseline, we identified 203 C282Y homozygotes (95 males), of whom 116 had SF and fasting TS levels measured at baseline (mean age, 55 years) and 86 were untreated and had iron measures at follow-up (mean, 12 years later). The probabilities of SF at follow-up exceeding clinical thresholds were predicted from baseline SF and TS under a multivariate normal model. For C282Y homozygotes, at baseline, 84% of males and 65% of females had elevated SF and 37% of males and 3% of females had SF >1000 microg/L. For males with SF 300-1000 microg/L at baseline, the predicted probability of progressing to SF >1000 microg/L at follow-up was between 13% and 35% and, for females, between 16% and 22%. For C282Y homozygotes with normal baseline SF, 1000 microg/L if left untreated. The majority of C282Y homozygotes who are likely to develop SF levels sufficient to place them at risk of iron overload-related disease will have done so by mean age 55 years. TS >95% at mean age 55 years in males increases the likelihood that SF levels will be elevated at mean age 65 years, but this effect is absent in females, most likely because of physiologic blood loss associated with menstruation.

The Ultracompact Nature of the Black Hole Candidate X-Ray Binary 47 Tuc X9

Science.gov (United States)

Bahramian, Arash; Heinke, Craig O.; Tudor, Vlad; Miller-Jones, James C. A.; Bogdanov, Slavko; Maccarone, Thomas J.; Knigge, Christian; Sivakoff, Gregory R.; Chomiuk, Laura; Strader, J.;

Yeast Interacting Proteins Database: YBR228W, YLR135W [Yeast Interacting Proteins Database

Lifescience Database Archive (English)

Full Text Available YBR228W SLX1 Subunit of a complex, with Slx4p, that hydrolyzes 5' branches from duplex...of a complex, with Slx4p, that hydrolyzes 5' branches from duplex DNA in response to stalled or converging r

Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population.

Science.gov (United States)

Juzėnas, Simonas; Kupčinskas, Juozas; Valantienė, Irena; Šumskienė, Jolanta; Petrenkienė, Vitalija; Kondrackienė, Jūrate; Kučinskas, Laimutis; Kiudelis, Gediminas; Skiecevičienė, Jurgita; Kupčinskas, Limas

2016-01-01

Liver cirrhosis is the end-stage disease of chronic liver injury. Due to differences in the natural course of chronic liver diseases, identification of genetic factors that influence individual outcomes is warranted. HFE-linked hereditary hemochromatosis (HH) predisposes disease progression to cirrhosis; however, the role of heterozygous C282Y or H63D mutations in the development of cirrhosis in the presence of other etiological factors is still debated. The aim of this study was to determine the association between heterozygous C282Y and H63D mutations and non-HH liver cirrhosis in Lithuanian population. The patient cohort consisted of 209 individuals. Diagnosis of cirrhosis was confirmed by clinical, laboratory parameters, liver biopsy, and radiological imaging. Control samples were obtained from 1005 randomly selected unrelated healthy individuals. HFE gene mutations were determined using the PCR-RFLP method. The most common causes of cirrhosis were hepatitis C (33.9%), hepatitis B (13.6%), and alcohol (25.8%). C282Y allele was associated with the presence of cirrhosis (OR=2.07; P=0.005); this was also observed under recessive model for C282Y (OR=2.06, P=0.008). The prevalence of C282Y allele was higher in cirrhotic men than in controls (7.0% vs. 2.8%, P=0.002). The carriage of H63D risk allele (OR=1.54; P=0.02), heterozygous C282Y/wt and homozygous H63D/H63D genotypes were associated with liver cirrhosis in males (OR=2.48, P=0.008, and OR=4.13, P=0.005, respectively). Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women. Copyright © 2016 The Lithuanian University of Health Sciences. Production and hosting by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Learning to assign binary weights to binary descriptor

Science.gov (United States)

Huang, Zhoudi; Wei, Zhenzhong; Zhang, Guangjun

2016-10-01

Constructing robust binary local feature descriptors are receiving increasing interest due to their binary nature, which can enable fast processing while requiring significantly less memory than their floating-point competitors. To bridge the performance gap between the binary and floating-point descriptors without increasing the computational cost of computing and matching, optimal binary weights are learning to assign to binary descriptor for considering each bit might contribute differently to the distinctiveness and robustness. Technically, a large-scale regularized optimization method is applied to learn float weights for each bit of the binary descriptor. Furthermore, binary approximation for the float weights is performed by utilizing an efficient alternatively greedy strategy, which can significantly improve the discriminative power while preserve fast matching advantage. Extensive experimental results on two challenging datasets (Brown dataset and Oxford dataset) demonstrate the effectiveness and efficiency of the proposed method.

HFE gene C282Y, H63D and S65C mutations frequency in the Transylvania region, Romania.

Science.gov (United States)

Trifa, Adrian P; Popp, Radu A; Militaru, Mariela S; Farcaş, Marius F; Crişan, Tania O; Gana, Ionuţ; Cucuianu, Andrei; Pop, Ioan V

2012-06-01

HFE-associated haemochromatosis is one of the most frequent autosomal recessive disorders in the Caucasian population. Although most of the cases are homozygous individuals for the C282Y mutation, another two mutations, H63D and S65C, have been reported to be associated with milder forms of the disease. This study was a first attempt to evaluate the distribution of these HFE gene mutations in the Transylvania region. Two-hundred and twenty-five healthy, unrelated volunteers originating from the Transylvania region, Romania, were screened for the HFE gene C282Y, H63D and S65C mutations, using molecular genetics assays (Polymerase Chain Reaction-Restriction Fragments Length Polymorphism). For the C282Y mutation, 7 heterozygotes (3.1%) were found, but no homozygous individual. In the case of the H63D mutation, 40 heterozygotes (17.8%) and 4 homozygotes (1.75%) for the mutant allele were evidenced. We found a compound heterozygous genotype (C282Y/H63D) in one individual (0.45%). Thus, the allele frequencies of the C282Y and H63D were 1.75% and 10.9%, respectively. Three individuals (1.3%) were found to harbour the S65C mutation in a heterozygous state, but none in a homozygous state: the allele frequency of the mutant allele was 0.75%. The distribution of the HFE gene C282Y, H63D and S65C mutations found in our group matches the tendencies observed in other European countries: a decreasing gradient from Northern to Southern Europe for the C282Y mutation; high frequency for the H63D mutation, and low frequency for the S65C mutation in most of the countries.

Binary Linear-Time Erasure Decoding for Non-Binary LDPC codes

OpenAIRE

Savin, Valentin

2009-01-01

In this paper, we first introduce the extended binary representation of non-binary codes, which corresponds to a covering graph of the bipartite graph associated with the non-binary code. Then we show that non-binary codewords correspond to binary codewords of the extended representation that further satisfy some simplex-constraint: that is, bits lying over the same symbol-node of the non-binary graph must form a codeword of a simplex code. Applied to the binary erasure channel, this descript...

DISCOVERY OF AN ULTRACOMPACT GAMMA-RAY MILLISECOND PULSAR BINARY CANDIDATE

Energy Technology Data Exchange (ETDEWEB)

Kong, Albert K. H.; Jin, Ruolan; Yen, T.-C.; Tam, P. H. T.; Lin, L. C. C. [Institute of Astronomy and Department of Physics, National Tsing Hua University, Hsinchu 30013, Taiwan (China); Hu, C.-P. [Graduate Institute of Astronomy, National Central University, Jhongli 32001, Taiwan (China); Hui, C. Y.; Park, S. M. [Department of Astronomy and Space Science, Chungnam National University, Daejeon (Korea, Republic of); Takata, J.; Cheng, K. S. [Department of Physics, University of Hong Kong, Pokfulam Road (Hong Kong); Kim, C. L., E-mail: akong@phys.nthu.edu.tw [Department of Physics and Astronomy, Seoul National University (Korea, Republic of)

2014-10-20

We report multi-wavelength observations of the unidentified Fermi object 2FGL J1653.6-0159. With the help of high-resolution X-ray observations, we have identified an X-ray and optical counterpart to 2FGL J1653.6-0159. The source exhibits a periodic modulation of 75 minutes in the optical and possibly also in the X-ray. We suggest that 2FGL J1653.6-0159 is a compact binary system with an orbital period of 75 minutes. Combining the gamma-ray and X-ray properties, 2FGL J1653.6-0159 is potentially a black-widow-/redback-type gamma-ray millisecond pulsar (MSP). The optical and X-ray light curve profiles show that the companion is mildly heated by the high-energy emission and that the X-rays are from intrabinary shock. Although no radio pulsation has yet been detected, we estimated that the spin period of the MSP is ∼ 2 ms based on a theoretical model. If pulsation can be confirmed in the future, 2FGL J1653.6-0159 will become the first ultracompact rotation-powered MSP.

Binary effectivity rules

DEFF Research Database (Denmark)

Keiding, Hans; Peleg, Bezalel

2006-01-01

is binary if it is rationalized by an acyclic binary relation. The foregoing result motivates our definition of a binary effectivity rule as the effectivity rule of some binary SCR. A binary SCR is regular if it satisfies unanimity, monotonicity, and independence of infeasible alternatives. A binary...

Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population

Directory of Open Access Journals (Sweden)

Simonas Juzėnas

2016-01-01

Conclusions: Heterozygous C282Y mutation of the HFE gene was associated with liver cirrhosis in the Lithuanian population. In gender-related analysis, heterozygous C282Y and homozygous H63D mutations were linked to liver cirrhosis in men, not in women.

Prevalence of C282Y, H63D, and S65C mutations in hereditary HFE-hemochromatosis gene in Lithuanian population.

Science.gov (United States)

Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas

2012-04-01

HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).

Massive Black-Hole Binary Mergers: Dynamics, Environments & Expected Detections

Science.gov (United States)

Kelley, Luke Zoltan

2018-05-01

current surveys, and indeed, we expect many candidates recently identified to be true binaries - though a significant fraction are likely false positives. Overall, this thesis finds the science of MBH binaries at an exciting cusp: just before incredible breakthroughs in observations, both electromagnetically and in the new age of gravitational wave astrophysics.

Experiment data report for semiscale Mod-1 test S-28-2 (steam generator tube rupture test)

International Nuclear Information System (INIS)

Patton, M.L.; Sackett, K.E.

1977-10-01

Recorded test data are presented for Test S-28-2 of the Semiscale Mod-1 steam generator tube rupture test series. These tests are among several Semiscale Mod-1 experiments conducted to investigate the thermal and hydraulic phenomena accompanying a hypothesized loss-of-coolant accident in a pressurized water reactor (PWR) system. Test S-28-2 was conducted from initial conditions of 15 936 kPa and 558 K to investigate the response of the Semiscale Mod-1 system to a depressurization and reflood transient following a simulated double-ended offset shear of the broken loop cold leg piping. During the test, cooling water was injected into the cold leg of the intact and broken loops to simulate emergency core coolant injection in a PWR. For Test S-28-2, accumulator injection into the intact loop hot leg was provided to simulate simulate the rupture of six steam generator tubes

BINARY QUASARS AT HIGH REDSHIFT. I. 24 NEW QUASAR PAIRS AT z ∼ 3-4

International Nuclear Information System (INIS)

Hennawi, Joseph F.; Myers, Adam D.; Shen, Yue; Strauss, Michael A.; Djorgovski, S. G.; Glikman, Eilat; Mahabal, Ashish; Fan Xiaohui; Martin, Crystal L.; Richards, Gordon T.; Schneider, Donald P.; Shankar, Francesco

2010-01-01

The clustering of quasars on small scales yields fundamental constraints on models of quasar evolution and the buildup of supermassive black holes. This paper describes the first systematic survey to discover high-redshift binary quasars. Using color-selection and photometric redshift techniques, we searched 8142 deg 2 of Sloan Digital Sky Survey imaging data for binary quasar candidates, and confirmed them with follow-up spectroscopy. Our sample of 27 high-redshift binaries (24 of them new discoveries) at redshifts 2.9 perpendicular perpendicular 3.5. The completeness and efficiency of our well-defined selection algorithm are quantified using simulated photometry and we find that our sample is ∼50% complete. Our companion paper uses this knowledge to make the first measurement of the small-scale clustering (R -1 Mpc comoving) of high-redshift quasars. High-redshift binaries constitute exponentially rare coincidences of two extreme (M ∼> 10 9 M sun ) supermassive black holes. At z ∼ 4, there is about one close binary per 10 Gpc 3 , thus these could be the highest sigma peaks, the analogs of superclusters, in the early universe.

HFE p.C282Y homozygosity predisposes to rapid serum ferritin rise after menopause: A genotype-stratified cohort study of hemochromatosis in Australian women.

Science.gov (United States)

Warne, Charles D; Zaloumis, Sophie G; Bertalli, Nadine A; Delatycki, Martin B; Nicoll, Amanda J; McLaren, Christine E; Hopper, John L; Giles, Graham G; Anderson, Greg J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J; Gurrin, Lyle C

2017-04-01

Women who are homozygous for the p.C282Y mutation in the HFE gene are at much lower risk of iron overload-related disease than p.C282Y homozygous men, presumably because of the iron-depleting effects of menstruation and pregnancy. We used data from a population cohort study to model the impact of menstruation cessation at menopause on serum ferritin (SF) levels in female p.C282Y homozygotes, with p.C282Y/p.H63D simple or compound heterozygotes and those with neither p.C282Y nor p.H63D mutations (HFE wild types) as comparison groups. A sample of the Melbourne Collaborative Cohort Study was selected for the "HealthIron" study (n = 1438) including all HFE p.C282Y homozygotes plus a random sample stratified by HFE-genotype (p.C282Y and p.H63D). The relationship between the natural logarithm of SF and time since menopause was examined using linear mixed models incorporating spline smoothing. For p.C282Y homozygotes, SF increased by a factor of 3.6 (95% CI (1.8, 7.0), P HFE genotype groups increase more gradually and did not show a distinction between premenopausal and postmenopausal SF levels. Only p.C282Y homozygotes had predicted SF exceeding 200 μg/L postmenopause, but the projected SF did not increase the risk of iron overload-related disease. These data provide the first documented evidence that physiological blood loss is a major factor in determining the marked gender difference in expression of p.C282Y homozygosity. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

X-ray reflection in oxygen-rich accretion discs of ultracompact X-ray binaries

DEFF Research Database (Denmark)

Madej, O. K.; Garcia, Jeronimo; Jonker, P. G.

2014-01-01

We present spectroscopic X-ray data of two candidate ultracompact X-ray binaries (UCXBs): 4U 0614+091 and 4U 1543-624. We confirm the presence of a broad O viii Ly alpha reflection line (at a parts per thousand 18 angstrom) using XMM-Newton and Chandra observations obtained in 2012 and 2013. The ...

Binary similarity measures for fingerprint analysis of qualitative metabolomic profiles.

Science.gov (United States)

Rácz, Anita; Andrić, Filip; Bajusz, Dávid; Héberger, Károly

2018-01-01

Contemporary metabolomic fingerprinting is based on multiple spectrometric and chromatographic signals, used either alone or combined with structural and chemical information of metabolic markers at the qualitative and semiquantitative level. However, signal shifting, convolution, and matrix effects may compromise metabolomic patterns. Recent increase in the use of qualitative metabolomic data, described by the presence (1) or absence (0) of particular metabolites, demonstrates great potential in the field of metabolomic profiling and fingerprint analysis. The aim of this study is a comprehensive evaluation of binary similarity measures for the elucidation of patterns among samples of different botanical origin and various metabolomic profiles. Nine qualitative metabolomic data sets covering a wide range of natural products and metabolomic profiles were applied to assess 44 binary similarity measures for the fingerprinting of plant extracts and natural products. The measures were analyzed by the novel sum of ranking differences method (SRD), searching for the most promising candidates. Baroni-Urbani-Buser (BUB) and Hawkins-Dotson (HD) similarity coefficients were selected as the best measures by SRD and analysis of variance (ANOVA), while Dice (Di1), Yule, Russel-Rao, and Consonni-Todeschini 3 ranked the worst. ANOVA revealed that concordantly and intermediately symmetric similarity coefficients are better candidates for metabolomic fingerprinting than the asymmetric and correlation based ones. The fingerprint analysis based on the BUB and HD coefficients and qualitative metabolomic data performed equally well as the quantitative metabolomic profile analysis. Fingerprint analysis based on the qualitative metabolomic profiles and binary similarity measures proved to be a reliable way in finding the same/similar patterns in metabolomic data as that extracted from quantitative data.

Prevalence of H63D, S65C, and C282Y hereditary hemochromatosis gene variants in Madeira Island (Portugal).

Science.gov (United States)

Spínola, Carla; Brehm, António; Spínola, Hélder

2011-01-01

Hereditary HFE Hemochromatosis is an inherited disorder of iron metabolism that results from mutations in the HFE gene. Almost all patients with hereditary hemochromatosis show a C282Y mutation in homozygosity or in compound heterozygosity with H63D. Also, the mutation S65C has been shown to be associated to a milder iron overload. Since allele and genotype frequencies of these three variants of the HFE gene vary between populations, the determination of their prevalence in Madeira Island will clarify the population susceptibility to hereditary hemochromatosis. One hundred and fifty-four samples from Madeira Island were genotyped for the three most common HFE gene mutations, H63D, C282Y, and S65C, by polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results have shown a prevalence of 20.5%, 0.33%, and 1% for H63D, C282Y, and S65C, respectively. Accordingly to our estimates, both genotypes associated to hereditary hemochromatosis, C282Y homozygotes and C282/H63D compound heterozygotes, could be present in Madeira Island population in 1,648 individuals, which represents 0.65% of the total population.

Hemochromatosis C282Y gene mutation as a potential susceptibility factor for iron-overload in Egyptian beta-thalassemia patients

Directory of Open Access Journals (Sweden)

G.M. Mokhtar

2018-04-01

Full Text Available Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene’s mutation especially the C282Y mutation. The interaction between hemoglobin chain synthesis’ disorders and the C282Y mutation may worsen the clinical picture of beta-thalassemia major (β-TM. Aim: To establish the prevalence of the C282Y mutations in Egyptian β-TM patients and to address its adverse effects. Methods: Two-hundred and five β-TM patients were recruited and divided into two groups based on their serum ferritin (SF; group I (N = 125 (SF ≤ 2500 ng/dl and group II (N = 80 (SF > 2500 ng/dl. All patients were subjected to clinical and laboratory assessment with special emphasis on iron overload complications. Genotyping was assessed by polymerase chain reaction for detection of C282Y mutation in HFE gene. Results: The C282Y mutation was not detected in the studied β-TM neither in homozygous nor heterozygous state. There were several iron overload complications including cardiac complication (9.1%, liver disease (36.6%, delayed puberty (56.6%, primary (35.71% and secondary amenorrhea (21.42%, short stature (27.3%, diabetes (3.4%, neutropenia (9.7%, arthralgia (10.2%, gastrointestinal (21.1%, depression (2.9% and others (12.05%. Group I showed a statistically significant lower rate of taking iron-rich diet when compared to group II. Group II showed significant longer mean duration of disease, higher total transfusion rate per life, lower mean HbF% level, higher mean HbA% level, and higher rate of elevated liver enzymes than patients with SF ≤ 2500 ng/dl. Conclusion: The C282Y mutation was not detected in the studied cohort of Egyptian β-TM patients neither in homozygous nor heterozygous state in spite of manifestations of iron overload complications. Keywords: Beta-thalassemia major, Hereditary hemochromatosis, The C282Y mutation, Iron overload complications, Egyptian

Resolved Companions of Cepheids: Testing the Candidates with X-Ray Observations

Science.gov (United States)

Evans, Nancy Remage; Pillitteri, Ignazio; Wolk, Scott; Karovska, Margarita; Tingle, Evan; Guinan, Edward; Engle, Scott; Bond, Howard E.; Schaefer, Gail H.; Mason, Brian D.

2016-04-01

We have made XMM-Newton observations of 14 Galactic Cepheids that have candidate resolved (≥5″) companion stars based on our earlier HST Wide Field Camera 3 (WFC3) imaging survey. Main-sequence stars that are young enough to be physical companions of Cepheids are expected to be strong X-ray producers in contrast to field stars. XMM-Newton exposures were set to detect essentially all companions hotter than spectral type M0 (corresponding to 0.5 M⊙). The large majority of our candidate companions were not detected in X-rays, and hence are not confirmed as young companions. One resolved candidate (S Nor #4) was unambiguously detected, but the Cepheid is a member of a populous cluster. For this reason, it is likely that S Nor #4 is a cluster member rather than a gravitationally bound companion. Two further Cepheids (S Mus and R Cru) have X-ray emission that might be produced by either the Cepheid or the candidate resolved companion. A subsequent Chandra observation of S Mus shows that the X-rays are at the location of the Cepheid/spectroscopic binary. R Cru and also V659 Cen (also X-ray bright) have possible companions closer than 5″ (the limit for this study) which are the likely sources of X-rays. One final X-ray detection (V473 Lyr) has no known optical companion, so the prime suspect is the Cepheid itself. It is a unique Cepheid with a variable amplitude. The 14 stars that we observed with XMM constitute 36% of the 39 Cepheids found to have candidate companions in our HST/WFC3 optical survey. No young probable binary companions were found with separations of ≥5″ or 4000 au. Based on observations obtained with XMM-Newton, an ESA science mission with instruments and contributions directly funded by ESA Member States and the USA (NASA).

Accreting Binary Populations in the Earlier Universe

Science.gov (United States)

Hornschemeier, Ann

2010-01-01

It is now understood that X-ray binaries dominate the hard X-ray emission from normal star-forming galaxies. Thanks to the deepest (2-4 Ms) Chandra surveys, such galaxies are now being studied in X-rays out to z approximates 4. Interesting X-ray stacking results (based on 30+ galaxies per redshift bin) suggest that the mean rest-frame 2-10 keV luminosity from z=3-4 Lyman break galaxies (LBGs), is comparable to the most powerful starburst galaxies in the local Universe. This result possibly indicates a similar production mechanism for accreting binaries over large cosmological timescales. To understand and constrain better the production of X-ray binaries in high-redshift LBGs, we have utilized XMM-Newton observations of a small sample of z approximates 0.1 GALEX-selected Ultraviolet-Luminous Galaxies (UVLGs); local analogs to high-redshift LBGs. Our observations enable us to study the X-ray emission from LBG-like galaxies on an individual basis, thus allowing us to constrain object-to-object variances in this population. We supplement these results with X-ray stacking constraints using the new 3.2 Ms Chandra Deep Field-South (completed spring 2010) and LBG candidates selected from HST, Swift UVOT, and ground-based data. These measurements provide new X-ray constraints that sample well the entire z=0-4 baseline

A FIRST COMPARISON OF KEPLER PLANET CANDIDATES IN SINGLE AND MULTIPLE SYSTEMS

International Nuclear Information System (INIS)

Latham, David W.; Quinn, Samuel N.; Carter, Joshua A.; Holman, Matthew J.; Rowe, Jason F.; Borucki, William J.; Bryson, Stephen T.; Howell, Steve B.; Batalha, Natalie M.; Brown, Timothy M.; Buchhave, Lars A.; Caldwell, Douglas A.; Christiansen, Jessie L.; Ciardi, David R.; Cochran, William D.; Dunham, Edward W.; Fabrycky, Daniel C.; Ford, Eric B.; Gautier, Thomas N. III; Gilliland, Ronald L.

2011-01-01

In this Letter, we present an overview of the rich population of systems with multiple candidate transiting planets found in the first four months of Kepler data. The census of multiples includes 115 targets that show two candidate planets, 45 with three, eight with four, and one each with five and six, for a total of 170 systems with 408 candidates. When compared to the 827 systems with only one candidate, the multiples account for 17% of the total number of systems, and one-third of all the planet candidates. We compare the characteristics of candidates found in multiples with those found in singles. False positives due to eclipsing binaries are much less common for the multiples, as expected. Singles and multiples are both dominated by planets smaller than Neptune; 69 +2 -3 % for singles and 86 +2 -5 % for multiples. This result, that systems with multiple transiting planets are less likely to include a transiting giant planet, suggests that close-in giant planets tend to disrupt the orbital inclinations of small planets in flat systems, or maybe even prevent the formation of such systems in the first place.

HFE p.C282Y gene variant is associated with varicose veins in Russian population.

Science.gov (United States)

Sokolova, Ekaterina A; Shadrina, Alexandra S; Sevost'ianova, Kseniya S; Shevela, Andrey I; Soldatsky, Evgenii Yu; Seliverstov, Evgenii I; Demekhova, Marina Yu; Shonov, Oleg A; Ilyukhin, Evgenii A; Smetanina, Mariya A; Voronina, Elena N; Zolotukhin, Igor A; Filipenko, Maxim L

2016-08-01

Recently, the association of polymorphism rs1800562 (p.C282Y) in the hemochromatosis (HFE) gene with the increased risk of venous ulceration was shown. We hypothesized that HFE gene polymorphism might be involved not only in ulceration process, but also in susceptibility to primary varicose veins. We genotyped HFE p.C282Y (rs1800562) and p.H63D (rs1799945) variants in patients with primary varicose veins (n = 463) and in the control group (n = 754). In our study, p.282Y variant (rs1800562 A allele) was significantly associated with the risk of varicose veins (OR 1.79, 95 % CI = 1.11-2.89, P = 0.02). A borderline significant reverse association of p.63D variant (rs1799945 G allele) with venous leg ulcer development was revealed in Russians (OR 0.25, 95 % CI = 0.06-1.00, P = 0.05), but not in the meta-analysis (P = 0.56). We conclude that the HFE gene polymorphism can affect the risk of developing primary varicose veins.

Anti-adipogenic effects of KD025 (SLx-2119), a ROCK2-specific inhibitor, in 3T3-L1 cells.

Science.gov (United States)

Diep, Duy Trong Vien; Hong, Kyungki; Khun, Triyeng; Zheng, Mei; Ul-Haq, Asad; Jun, Hee-Sook; Kim, Young-Bum; Chun, Kwang-Hoon

2018-02-06

Adipose tissue is a specialized organ that synthesizes and stores fat. During adipogenesis, Rho and Rho-associated kinase (ROCK) 2 are inactivated, which enhances the expression of pro-adipogenic genes and induces the loss of actin stress fibers. Furthermore, pan ROCK inhibitors enhance adipogenesis in 3T3-L1 cells. Here, we show that KD025 (formerly known as SLx-2119), a ROCK2-specific inhibitor, suppresses adipogenesis in 3T3-L1 cells partially through a ROCK2-independent mechanism. KD025 downregulated the expression of key adipogenic transcription factors PPARγ and C/EBPα during adipogenesis in addition to lipogenic factors FABP4 and Glut4. Interestingly, adipogenesis was blocked by KD025 during days 1~3 of differentiation; after differentiation terminated, lipid accumulation was unaffected. Clonal expansion occurred normally in KD025-treated cells. These results suggest that KD025 could function during the intermediate stage after clonal expansion. Data from depletion of ROCKs showed that KD025 suppressed cell differentiation partially independent of ROCK's activity. Furthermore, no further loss of actin stress fibers emerged in KD025-treated cells during and after differentiation compared to control cells. These results indicate that in contrast to the pro-adipogenic effect of pan-inhibitors, KD025 suppresses adipogenesis in 3T3-L1 cells by regulating key pro-adipogenic factors. This outcome further implies that KD025 could be a potential anti-adipogenic/obesity agent.

A massive binary black-hole system in OJ 287 and a test of general relativity.

Science.gov (United States)

Valtonen, M J; Lehto, H J; Nilsson, K; Heidt, J; Takalo, L O; Sillanpää, A; Villforth, C; Kidger, M; Poyner, G; Pursimo, T; Zola, S; Wu, J-H; Zhou, X; Sadakane, K; Drozdz, M; Koziel, D; Marchev, D; Ogloza, W; Porowski, C; Siwak, M; Stachowski, G; Winiarski, M; Hentunen, V-P; Nissinen, M; Liakos, A; Dogru, S

2008-04-17

Tests of Einstein's general theory of relativity have mostly been carried out in weak gravitational fields where the space-time curvature effects are first-order deviations from Newton's theory. Binary pulsars provide a means of probing the strong gravitational field around a neutron star, but strong-field effects may be best tested in systems containing black holes. Here we report such a test in a close binary system of two candidate black holes in the quasar OJ 287. This quasar shows quasi-periodic optical outbursts at 12-year intervals, with two outburst peaks per interval. The latest outburst occurred in September 2007, within a day of the time predicted by the binary black-hole model and general relativity. The observations confirm the binary nature of the system and also provide evidence for the loss of orbital energy in agreement (within 10 per cent) with the emission of gravitational waves from the system. In the absence of gravitational wave emission the outburst would have happened 20 days later.

Three candidate double clusters in the LMC: truth or dare?

Science.gov (United States)

Dalessandro, Emanuele; Zocchi, Alice; Varri, Anna Lisa; Mucciarelli, Alessio; Bellazzini, Michele; Ferraro, Francesco R.; Lanzoni, Barbara; Lapenna, Emilio; Origlia, Livia

2018-02-01

The Large Magellanic Cloud (LMC) hosts a large number of candidate stellar cluster pairs. Binary stellar clusters provide important clues about cluster formation processes and the evolutionary history of the host galaxy. However, to properly extract and interpret this information, it is crucial to fully constrain the fraction of real binary systems and their physical properties. Here we present a detailed photometric analysis based on ESO-FORS2 images of three candidate cluster multiplets in the LMC, namely SL349-SL353, SL385-SL387-NGC 1922 and NGC 1836-BRHT4b-NGC 1839. For each cluster, we derived ages, structural parameters and morphological properties. We have also estimated the degree of filling of their Roche lobe, as an approximate tool to measure the strength of the tidal perturbations induced by the LMC. We find that the members of the possible pairs SL349-SL353 and BRHT4b-NGC 1839 have a similar age (t = 1.00 ± 0.12 Gyr and t = 140 ± 15 Myr, respectively), thus possibly hinting at a common origin of their member systems. We also find that all candidate pairs in our sample show evidence of intracluster overdensities that can be a possible indication of real binarity. Particularly interesting is the case of SL349-SL353. In fact, SL353 is relatively close to the condition of critical filling, thus suggesting that these systems might actually constitute an energetically bound pair. It is therefore key to pursue a detailed kinematic screening of such clusters, without which, at present, we do not dare making a conclusive statement about the true nature of this putative pair.

HFE gene C282Y variant is associated with colorectal cancer in Caucasians: a meta-analysis.

Science.gov (United States)

Chen, Weidong; Zhao, Hua; Li, Tiegang; Yao, Hongliang

2013-08-01

The HFE gene has been suggested to play an important role in the pathogenesis of colorectal cancer. However, the results have been conflicting. In this study, we performed a meta-analysis to clarify the association of HFE gene C282Y variant with colorectal cancer. PubMed and Embase were retrieved to identify the potential literature. Pooled odds ratio (OR) with 95 % confidence interval (CI) was calculated using fixed- or random-effects model. A total of eight papers including nine studies (7,588 colorectal cancer cases and 81,571 controls) for HFE gene C282Y variant were included in the meta-analysis. The result indicated that HFE gene C282Y variant was significantly associated with colorectal cancer under recessive model (OR = 2.00, 95 % CI = 1.32-3.04), with no evidence of between-study heterogeneity (I (2) = 0.2 %, p = 0.432). Further subgroup analysis by number of cases suggested the effect was significant in studies with more than 500 cases (OR = 2.51, 95 % CI = 1.58-3.98, I (2) = 0.0 %, p = 0.921), but not in studies with less than 500 cases (OR = 0.75, 95 % CI = 0.28-1.97, I (2) = 0.0 %, p = 0.622). The current meta-analysis supported the positive association of HFE gene C282Y variant with colorectal cancer. Further large-scale studies with the consideration for gene-gene/gene-environment interactions should be conducted to investigate the association.

Diverse Long-term Variability of Five Candidate High-mass X-Ray Binaries from Swift Burst Alert Telescope Observations

Energy Technology Data Exchange (ETDEWEB)

Corbet, Robin H. D. [University of Maryland, Baltimore County, MD 21250 (United States); Coley, Joel B. [NASA Postdoctoral Program, and Astroparticle Physics Laboratory, Code 661 NASA Goddard Space Flight Center, Greenbelt Road, MD 20771 (United States); Krimm, Hans A., E-mail: corbet@umbc.edu [Universities Space Research Association, 10211 Wincopin Circle, Suite 500, Columbia, MD 21044 (United States)

2017-09-10

We present an investigation of long-term modulation in the X-ray light curves of five little-studied candidate high-mass X-ray binaries using the Swift Burst Alert Telescope. IGR J14488-5942 and AX J1700.2-4220 show strong modulation at periods of 49.6 and 44 days, respectively, which are interpreted as orbital periods of Be star systems. For IGR J14488-5942, observations with the Swift X-ray Telescope show a hint of pulsations at 33.4 s. For AX J1700.2-4220, 54 s pulsations were previously found with XMM-Newton . Swift J1816.7-1613 exhibits complicated behavior. The strongest peak in the power spectrum is at a period near 150 days, but this conflicts with a determination of a period of 118.5 days by La Parola et al. AX J1820.5-1434 has been proposed to exhibit modulation near 54 days, but the extended BAT observations suggest modulation at slightly longer than double this at approximately 111 days. There appears to be a long-term change in the shape of the modulation near 111 days, which may explain the apparent discrepancy. The X-ray pulsar XTE J1906+090, which was previously proposed to be a Be star system with an orbital period of ∼30 days from pulse timing, shows peaks in the power spectrum at 81 and 173 days. The origins of these periods are unclear, although they might be the orbital period and a superorbital period respectively. For all five sources, the long-term variability, together with the combination of orbital and proposed pulse periods, suggests that the sources contain Be star mass donors.

Was the C282Y mutation an Irish Gaelic mutation that the Vikings helped disseminate?

DEFF Research Database (Denmark)

Olsson, Karl Sigvard; Konar, Jan; Dufva, Inge Hoegh

2011-01-01

The HLA-related hemochromatosis mutation C282Y is thought to have originated in Ireland in a person with HLA-A3-B14 and was spread by Vikings. Irish people with two HLA-A3 alleles had a high risk of hemochromatosis. In this study, from west Sweden, we wanted to test these hypotheses.......The HLA-related hemochromatosis mutation C282Y is thought to have originated in Ireland in a person with HLA-A3-B14 and was spread by Vikings. Irish people with two HLA-A3 alleles had a high risk of hemochromatosis. In this study, from west Sweden, we wanted to test these hypotheses....

Acetylcholinesterase Reactivators (HI-6, Obidoxime, Trimedoxime, K027, K075, K127, K203, K282: Structural Evaluation of Human Serum Albumin Binding and Absorption Kinetics

Directory of Open Access Journals (Sweden)

Filip Zemek

2013-08-01

Full Text Available Acetylcholinesterase (AChE reactivators (oximes are compounds predominantly targeting the active site of the enzyme. Toxic effects of organophosphates nerve agents (OPNAs are primarily related to their covalent binding to AChE and butyrylcholinesterase (BChE, critical detoxification enzymes in the blood and in the central nervous system (CNS. After exposure to OPNAs, accumulation of acetylcholine (ACh overstimulates receptors and blocks neuromuscular junction transmission resulting in CNS toxicity. Current efforts at treatments for OPNA exposure are focused on non-quaternary reactivators, monoisonitrosoacetone oximes (MINA, and diacylmonoxime reactivators (DAM. However, so far only quaternary oximes have been approved for use in cases of OPNA intoxication. Five acetylcholinesterase reactivator candidates (K027, K075, K127, K203, K282 are presented here, together with pharmacokinetic data (plasma concentration, human serum albumin binding potency. Pharmacokinetic curves based on intramuscular application of the tested compounds are given, with binding information and an evaluation of structural relationships. Human Serum Albumin (HSA binding studies have not yet been performed on any acetylcholinesterase reactivators, and correlations between structure, concentration curves and binding are vital for further development. HSA bindings of the tested compounds were 1% (HI-6, 7% (obidoxime, 6% (trimedoxime, and 5%, 10%, 4%, 15%, and 12% for K027, K075, K127, K203, and K282, respectively.

Reflection Spectra of the Black Hole Binary Candidate MAXI J1535-571 in the Hard State Observed by NuSTAR

Science.gov (United States)

Xu, Yanjun; Harrison, Fiona A.; García, Javier A.; Fabian, Andrew C.; Fürst, Felix; Gandhi, Poshak; Grefenstette, Brian W.; Madsen, Kristin K.; Miller, Jon M.; Parker, Michael L.; Tomsick, John A.; Walton, Dominic J.

2018-01-01

We report on a Nuclear Spectroscopic Telescope Array (NuSTAR) observation of the recently discovered bright black hole candidate MAXI J1535-571. NuSTAR observed the source on MJD 58003 (five days after the outburst was reported). The spectrum is characteristic of a black hole binary in the hard state. We observe clear disk reflection features, including a broad Fe Kα line and a Compton hump peaking around 30 keV. Detailed spectral modeling reveals a narrow Fe Kα line complex centered around 6.5 keV on top of the strong relativistically broadened Fe Kα line. The narrow component is consistent with distant reflection from moderately ionized material. The spectral continuum is well described by a combination of cool thermal disk photons and a Comptonized plasma with the electron temperature {{kT}}{{e}}=19.7+/- 0.4 keV. An adequate fit can be achieved for the disk reflection features with a self-consistent relativistic reflection model that assumes a lamp-post geometry for the coronal illuminating source. The spectral fitting measures a black hole spin a> 0.84, inner disk radius {R}{in}lamp-post height h={7.2}-2.0+0.8 {r}{{g}} (statistical errors, 90% confidence), indicating no significant disk truncation and a compact corona. Although the distance and mass of this source are not currently known, this suggests the source was likely in the brighter phases of the hard state during this NuSTAR observation.

Yeast Interacting Proteins Database: YPL022W, YLR135W [Yeast Interacting Proteins Database

Lifescience Database Archive (English)

Full Text Available repair; cleaves branched structures in a complex with Slx1p; involved in Rad1p/Rad10p-dependent removal of ... Prey gene name SLX4 Prey description Endonuclease involved in processing DNA during recombination and repair; cleaves branched struc...tures in a complex with Slx1p; involved in Rad1p/Rad10p-dependent removal of 3'-non

Rare HFE variants are the most frequent cause of hemochromatosis in non-c282y homozygous patients with hemochromatosis.

Science.gov (United States)

Hamdi-Rozé, Houda; Beaumont-Epinette, Marie-Pascale; Ben Ali, Zeineb; Le Lan, Caroline; Loustaud-Ratti, Véronique; Causse, Xavier; Loreal, Olivier; Deugnier, Yves; Brissot, Pierre; Jouanolle, Anne-Marie; Bardou-Jacquet, Edouard

2016-12-01

p.Cys282Tyr (C282Y) homozygosity explains most cases of HFE-related hemochromatosis, but a significant number of patients presenting with typical type I hemochromatosis phenotype remain unexplained. We sought to describe the clinical relevance of rare HFE variants in non-C282Y homozygotes. Patients referred for hemochromatosis to the National Reference Centre for Rare Iron Overload Diseases from 2004 to 2010 were studied. Sequencing was performed for coding region and intronic flanking sequences of HFE, HAMP, HFE2, TFR2, and SLC40A1. Nine private HFE variants were identified in 13 of 206 unrelated patients. Among those, five have not been previously described: p.Leu270Argfs*4, p.Ala271Valfs*25, p.Tyr52*, p.Lys166Asn, and p.Asp141Tyr. Our results show that rare HFE variants are identified more frequently than variants in the other genes associated with iron overload. Rare HFE variants are therefore the most frequent cause of hemochromatosis in non-C282Y homozygote HFE patients. Am. J. Hematol. 91:1202-1205, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

HFE C282Y/H63D Compound Heterozygotes Are at Low Risk of Hemochromatosis-Related Morbidity

OpenAIRE

Gurrin, Lyle C.; Bertalli, Nadine A.; Dalton, Gregory W.; Osborne, Nicholas J.; Constantine, Clare C.; McLaren, Christine E.; English, Dallas R.; Gertig, Dorota M.; Delatycki, Martin B.; Nicoll, Amanda J.; Southey, Melissa C.; Hopper, John L.; Giles, Graham G.; Anderson, Gregory J.; Olynyk, John K.

2009-01-01

The risk of hemochromatosis-related morbidity is unknown among HFE compound heterozygotes (C282Y/H63D). We used a prospective population-based cohort study to estimate the prevalence of elevated iron indices and hemochromatosis-related morbidity for compound heterozygotes. In all, 31,192 subjects of northern European descent were genotyped for HFE C282Y and H63D. An HFE-genotype stratified random sample of 1,438 subjects, followed for an average of 12 years to a mean age of 65 years, complete...

Auto-Vetting Transiting Planet Candidates Identified by the Kepler Pipeline

Science.gov (United States)

Jenkins, Jon M.; McCauliff, Sean; Burke, Christopher; Seader, Shawn; Twicken, Joseph; Klaus, Todd; Sanderfer, Dwight; Srivastava, Ashok; Haas, Michael R.

2014-04-01

The Kepler Mission simultaneously measures the brightness of more than 150,000 stars every 29.4 minutes primarily for the purpose of transit photometry. Over the course of its 3.5-year primary mission Kepler has observed over 190,000 distinct stars, announcing 2,321 planet candidates, 2,165 eclipsing binaries, and 105 confirmed planets. As Kepler moves into its 4-year extended mission, the total number of transit-like features identified in the light curves has increased to as many as ~18,000. This number of signals has become intractable for human beings to inspect by eye in a thorough and timely fashion. To mitigate this problem we are developing machine learning approaches to perform the task of reviewing the diagnostics for each transit signal candidate to establish a preliminary list of planetary candidates ranked from most credible to least credible. Our preliminary results indicate that random forests can classify potential transiting planet signatures with an accuracy of more than 98.6% as measured by the area under a receiver-operating curve.

Iron overload in HFE C282Y heterozygotes at first genetic testing: a strategy for identifying rare HFE variants.

Science.gov (United States)

Aguilar-Martinez, Patricia; Grandchamp, Bernard; Cunat, Séverine; Cadet, Estelle; Blanc, François; Nourrit, Marlène; Lassoued, Kaiss; Schved, Jean-François; Rochette, Jacques

2011-04-01

Heterozygotes for the p.Cys282Tyr (C282Y) mutation of the HFE gene do not usually express a hemochromatosis phenotype. Apart from the compound heterozygous state for C282Y and the widespread p.His63Asp (H63D) variant allele, other rare HFE mutations can be found in trans on chromosome 6. We performed molecular investigation of the genes implicated in hereditary hemochromatosis in six patients who presented with iron overload but were simple heterozygotes for the HFE C282Y mutation at first genetic testing. Functional impairment of new variants was deduced from computational methods including molecular modeling studies. We identified four rare HFE mutant alleles, three of which have not been previously described. One mutation is a 13-nucleotide deletion in exon 6 (c.1022_1034del13, p.His341_Ala345 > LeufsX119), which is predicted to lead to an elongated and unstable protein. The second one is a substitution of the last nucleotide of exon 2 (c.340G > A, p.Glu114Lys) which modifies the relative solvent accessibility in a loop interface. The third mutation, p.Arg67Cys, also lies in exon 2 and introduces a destabilization of the secondary structure within a loop of the α1 domain. We also found the previously reported c.548T > C (p.Leu183Pro) missense mutation in exon 3. No other known iron genes were mutated. We present an algorithm at the clinical and genetic levels for identifying patients deserving further investigation. Conclusions Our results suggest that additional mutations in HFE may have a clinical impact in C282Y carriers. In conjunction with results from previously described cases we conclude that an elevated transferrin saturation level and elevated hepatic iron index should indicate the utility of searching for further HFE mutations in C282Y heterozygotes prior to other iron gene studies.

Unsupervised learning of binary vectors: A Gaussian scenario

International Nuclear Information System (INIS)

Copelli, Mauro; Van den Broeck, Christian

2000-01-01

We study a model of unsupervised learning where the real-valued data vectors are isotropically distributed, except for a single symmetry-breaking binary direction B(set-membership sign){-1,+1} N , onto which the projections have a Gaussian distribution. We show that a candidate vector J undergoing Gibbs learning in this discrete space, approaches the perfect match J=B exponentially. In addition to the second-order ''retarded learning'' phase transition for unbiased distributions, we show that first-order transitions can also occur. Extending the known result that the center of mass of the Gibbs ensemble has Bayes-optimal performance, we show that taking the sign of the components of this vector (clipping) leads to the vector with optimal performance in the binary space. These upper bounds are shown generally not to be saturated with the technique of transforming the components of a special continuous vector, except in asymptotic limits and in a special linear case. Simulations are presented which are in excellent agreement with the theoretical results. (c) 2000 The American Physical Society

A fast search strategy for gravitational waves from low-mass x-ray binaries

International Nuclear Information System (INIS)

Messenger, C; Woan, G

2007-01-01

We present a new type of search strategy designed specifically to find continuously emitting gravitational wave sources in known binary systems. A component of this strategy is based on the incoherent summation of frequency-modulated binary signal sidebands, a method previously employed in the detection of electromagnetic pulsar signals from radio observations. The search pipeline can be divided into three stages: the first is a wide bandwidth, F-statistic search demodulated for sky position. This is followed by a fast second stage in which areas in frequency space are identified as signal candidates through the frequency domain convolution of the F-statistic with an approximate signal template. For this second stage only precise information on the orbit period and approximate information on the orbital semi-major axis are required a priori. For the final stage we propose a fully coherent Markov chain Monte Carlo based follow-up search on the frequency subspace defined by the candidates identified by the second stage. This search is particularly suited to the low-mass x-ray binaries, for which orbital period and sky position are typically well known and additional orbital parameters and neutron star spin frequency are not. We note that for the accreting x-ray millisecond pulsars, for which spin frequency and orbital parameters are well known, the second stage can be omitted and the fully coherent search stage can be performed. We describe the search pipeline with respect to its application to a simplified phase model and derive the corresponding sensitivity of the search

A LUMINOUS GAMMA-RAY BINARY IN THE LARGE MAGELLANIC CLOUD

Energy Technology Data Exchange (ETDEWEB)

Corbet, R. H. D. [University of Maryland, Baltimore County, and X-ray Astrophysics Laboratory, Code 662 NASA Goddard Space Flight Center, Greenbelt Rd., MD 20771 (United States); Chomiuk, L.; Strader, J. [Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824 (United States); Coe, M. J. [University of Southampton, School of Physics and Astronomy, Southampton SO17 1BJ (United Kingdom); Coley, J. B. [NASA Postdoctoral Program, and Astroparticle Physics Laboratory, Code 661 NASA Goddard Space Flight Center, Greenbelt Rd., MD 20771 (United States); Dubus, G. [Institut de Planétologie et d’Astrophysique de Grenoble, Univ. Grenoble Alpes, CNRS, F-38000 Grenoble (France); Edwards, P. G.; Stevens, J. [Commonwealth Scientific and Industrial Research Organisation Astronomy and Space Science, P.O. Box 76, Epping, New South Wales 1710 (Australia); Martin, P. [Institut de Recherche en Astrophysique et Planétologie, Université de Toulouse, CNRS, F-31028 Toulouse cedex 4 (France); McBride, V. A.; Townsend, L. J. [Department of Astronomy, University of Cape Town, Private Bag X3, Rondebosch 7701 (South Africa); Udalski, A. [Warsaw University Observatory, Al. Ujazdowskie 4, 00-478 Warszawa (Poland)

2016-10-01

Gamma-ray binaries consist of a neutron star or a black hole interacting with a normal star to produce gamma-ray emission that dominates the radiative output of the system. Only a handful of such systems have been previously discovered, all within our Galaxy. Here, we report the discovery of a luminous gamma-ray binary in the Large Magellanic Cloud, found with the Fermi Large Area Telescope (LAT), from a search for periodic modulation in all sources in the third Fermi LAT catalog. This is the first such system to be found outside the Milky Way. The system has an orbital period of 10.3 days, and is associated with a massive O5III star located in the supernova remnant DEM L241, previously identified as the candidate high-mass X-ray binary (HMXB) CXOU J053600.0–673507. X-ray and radio emission are also modulated on the 10.3 day period, but are in anti-phase with the gamma-ray modulation. Optical radial velocity measurements suggest that the system contains a neutron star. The source is significantly more luminous than similar sources in the Milky Way, at radio, optical, X-ray, and gamma-ray wavelengths. The detection of this extra-galactic system, but no new Galactic systems, raises the possibility that the predicted number of gamma-ray binaries in our Galaxy has been overestimated, and that HMXBs may be born containing relatively slowly rotating neutron stars.

Design of lead-free candidate alloys for high-temperature soldering based on the Au–Sn system

DEFF Research Database (Denmark)

Chidambaram, Vivek; Hattel, Jesper Henri; Hald, John

2010-01-01

of the Au–Sn binary system were explored in this work. Furthermore, the effects of thermal aging on the microstructure and microhardness of these promising Au–Sn based ternary alloys were investigated. For this purpose, the candidate alloys were aged at a lower temperature, 150°C for up to 1week...

Multi-messenger Observations of a Binary Neutron Star Merger

DEFF Research Database (Denmark)

Abbott, B. P.; Abbott, R.; Abbott, T. D.

2017-01-01

On 2017 August 17 a binary neutron star coalescence candidate (later designated GW170817) with merger time 12:41:04 UTC was observed through gravitational waves by the Advanced LIGO and Advanced Virgo detectors. The Fermi Gamma-ray Burst Monitor independently detected a gamma-ray burst (GRB 170817A...... Telescope. The optical transient was independently detected by multiple teams within an hour. Subsequent observations targeted the object and its environment. Early ultraviolet observations revealed a blue transient that faded within 48 hours. Optical and infrared observations showed a redward evolution....../optical/near-infrared emission. No ultra-high-energy gamma-rays and no neutrino candidates consistent with the source were found in follow-up searches. These observations support the hypothesis that GW170817 was produced by the merger of two neutron stars in NGC 4993 followed by a short gamma-ray burst (GRB 170817A...

White blood cells and subtypes in HFE p.C282Y and wild-type homozygotes in the Hemochromatosis and Iron Overload Screening Study.

Science.gov (United States)

Barton, James C; Barton, J Clayborn; Acton, Ronald T

2017-03-01

The major histocompatibility complex is linked to white blood cell (WBC) and lymphocyte counts in subjects unselected for HFE genotypes. We compared age, sex, body mass index, total WBC and subtypes (neutrophils, lymphocytes, monocytes, eosinophils, basophils) (Beckman Coulter® Gen-S), transferrin saturation, and serum ferritin of HFE p.C282Y and wild-type (p.C282Y, p.H63D negative) homozygotes without acquired conditions that influence WBC counts. We performed regressions on WBC and subtypes. There were 161 p.C282Y homozygotes (45.3% men) and 221 wild-type homozygotes (40.3% men). Mean WBC of men and women and between HFE genotypes were similar. Mean lymphocytes were higher in male p.C282Y homozygotes: 1.6×10 9 /L [95% confidence interval: 1.5,1.7] vs. 1.4 [1.3,1.5], p=0.0002. Mean lymphocytes and basophils were higher in female p.C282Y homozygotes: 1.6 [1.5,1.7] vs. 1.4 [1.3,1.5], p=0.0002; and 0.065 [0.059,0.071] vs. 0.052 [0.051,0.054], p=0.0001, respectively. Transferrin saturation was associated with neutrophils (negative; p=0.0163). Age was associated with lymphocytes (negative; p=0.0003) and monocytes (positive; p<0.0001). Regressions on lymphocytes and basophils revealed positive associations with p.C282Y homozygosity (p=0.0043 and 0.0003, respectively). There were significant positive associations of neutrophils, lymphocytes, monocytes, and eosinophils. We conclude that HFE p.C282Y homozygosity is significantly associated with lymphocyte and basophil counts. Copyright © 2016 Elsevier Inc. All rights reserved.

Decreased iron burden in overweight C282Y homozygous women: Putative role of increased hepcidin production.

Science.gov (United States)

Desgrippes, Romain; Lainé, Fabrice; Morcet, Jeff; Perrin, Michèle; Manet, Ghislain; Jezequel, Caroline; Bardou-Jacquet, Edouard; Ropert, Martine; Deugnier, Yves

2013-05-01

An excess of visceral adipose tissue could be involved as a modulator of the penetrance of HFE hemochromatosis since fat mass is associated with overexpression of hepcidin and low transferrin saturation was found to be associated with being overweight in women. This study was aimed at assessing the relationship between body mass index (BMI), a surrogate marker of insulin resistance, and iron burden in HFE hemochromatosis. In all, 877 patients from a cohort of C282Y homozygotes were included in the study when BMI at diagnosis and amount of iron removed (AIR) by phlebotomy were available. No relationship between AIR and BMI was found in men, whereas 15.1% (52/345) of women with AIR lean (7.9 mmoL/L ± 4.3) women (P = 0.0005). In C282Y homozygous women, BMI ≥28 kg/m(2) is independently associated with a lower amount of iron removed by phlebotomy. BMI is likely a modulator factor of the phenotypic expression of C282Y homozygosity, likely through an increase of circulating levels of hepcidin. Copyright © 2013 American Association for the Study of Liver Diseases.

COMMON PROPER-MOTION WIDE WHITE DWARF BINARIES SELECTED FROM THE SLOAN DIGITAL SKY SURVEY

International Nuclear Information System (INIS)

Andrews, Jeff J.; Agüeros, Marcel A.; Belczynski, Krzysztof; Dhital, Saurav; Kleinman, S. J.; West, Andrew A.

2012-01-01

Wide binaries made up of two white dwarfs (WDs) receive far less attention than their tight counterparts. However, our tests using the binary population synthesis code StarTrack indicate that, for any set of reasonable initial conditions, there exists a significant observable population of double white dwarfs (WDWDs) with orbital separations of 10 2 -10 5 AU. We adapt the technique of Dhital et al. to search for candidate common proper-motion WD companions separated by 12,000 spectroscopically confirmed hydrogen-atmosphere WDs recently identified in the Sloan Digital Sky Survey. Using two techniques to separate random alignments from high-confidence pairs, we find nine new high-probability wide WDWDs and confirm three previously identified candidate wide WDWDs. This brings the number of known wide WDWDs to 45; our new pairs are a significant addition to the sample, especially at small proper motions ( –1 ) and large angular separations (>10''). Spectroscopic follow-up and an extension of this method to a larger, photometrically selected set of SDSS WDs may eventually produce a large enough dataset for WDWDs to realize their full potential as testbeds for theories of stellar evolution.

Pulsars in binary systems: probing binary stellar evolution and general relativity.

Science.gov (United States)

Stairs, Ingrid H

2004-04-23

Radio pulsars in binary orbits often have short millisecond spin periods as a result of mass transfer from their companion stars. They therefore act as very precise, stable, moving clocks that allow us to investigate a large set of otherwise inaccessible astrophysical problems. The orbital parameters derived from high-precision binary pulsar timing provide constraints on binary evolution, characteristics of the binary pulsar population, and the masses of neutron stars with different mass-transfer histories. These binary systems also test gravitational theories, setting strong limits on deviations from general relativity. Surveys for new pulsars yield new binary systems that increase our understanding of all these fields and may open up whole new areas of physics, as most spectacularly evidenced by the recent discovery of an extremely relativistic double-pulsar system.

On the Convergence of Biogeography-Based Optimization for Binary Problems

Directory of Open Access Journals (Sweden)

Haiping Ma

2014-01-01

Full Text Available Biogeography-based optimization (BBO is an evolutionary algorithm inspired by biogeography, which is the study of the migration of species between habitats. A finite Markov chain model of BBO for binary problems was derived in earlier work, and some significant theoretical results were obtained. This paper analyzes the convergence properties of BBO on binary problems based on the previously derived BBO Markov chain model. Analysis reveals that BBO with only migration and mutation never converges to the global optimum. However, BBO with elitism, which maintains the best candidate in the population from one generation to the next, converges to the global optimum. In spite of previously published differences between genetic algorithms (GAs and BBO, this paper shows that the convergence properties of BBO are similar to those of the canonical GA. In addition, the convergence rate estimate of BBO with elitism is obtained in this paper and is confirmed by simulations for some simple representative problems.

Trojan Binaries

Science.gov (United States)

Noll, K. S.

2017-12-01

The Jupiter Trojans, in the context of giant planet migration models, can be thought of as an extension of the small body populations found beyond Neptune in the Kuiper Belt. Binaries are a distinctive feature of small body populations in the Kuiper Belt with an especially high fraction apparent among the brightest Cold Classicals. The binary fraction, relative sizes, and separations in the dynamically excited populations (Scattered, Resonant) reflects processes that may have eroded a more abundant initial population. This trend continues in the Centaurs and Trojans where few binaries have been found. We review new evidence including a third resolved Trojan binary and lightcurve studies to understand how the Trojans are related to the small body populations that originated in the outer protoplanetary disk.

Short gamma-ray bursts and gravitational-wave observations from eccentric compact binaries

Science.gov (United States)

Tan, Wei-Wei; Fan, Xi-Long; Wang, F. Y.

2018-03-01

Mergers of compact binaries, such as binary neutron stars (BNSs), neutron star-black hole binaries (NSBHs) and binary black holes (BBHs), are expected to be the best candidates for sources of gravitational waves (GWs) and the leading theoretical models for short gamma-ray bursts (SGRBs). Based on observations of SGRBs, we can derive the merger rates of these compact binaries and study stochastic GW backgrounds (SGWBs) or the co-detection rates of GWs associated with SGRBs (GW-SGRBs). Before that, however, the most important thing is to derive the GW spectrum from a single GW source. Usually, a GW spectrum from a circular-orbit binary is assumed. However, observations of the large spatial offsets of SGRBs from their host galaxies imply that SGRB progenitors may be formed by dynamical processes and will merge with residual eccentricities (er). The orbital eccentricity has an important effect on GW spectra and therefore on the SGWB and GW-SGRB co-detection rate. Our results show that the power spectra of SGWBs from eccentric compact binaries are greatly suppressed at low frequencies (e.g. f ≲ 1 Hz). In particular, SGWBs from binaries with high residual eccentricities (e.g. er ≳ 0.1 for BNSs) will be hard to detect (above the detection frequency of ˜ 100 Hz). Regarding the co-detection rates of GW-SGRB events, they could be ˜1.4 times higher than the circular case within some particular ranges of er (e.g. 0.01 ≲ er ≲ 0.1 for BBHs), but greatly reduced for high residual eccentricities (e.g. er > 0.1 for BNSs). In general, BBH progenitors produce 200 and 10 times higher GW-SGRB events than BNS and NSBH progenitors, respectively. Therefore, binaries with low residual eccentricities (e.g. 0.001 ≲ er ≲ 0.1) and high total masses will be easier to detect by Advanced LIGO (aLIGO). However, only a small fraction of BBHs can be SGRB progenitors (if they can produce SGRBs), because the predicted GW-SGRB event rate (60˜100 per year) is too high compared with recent

Estudo das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro Study of C282Y, H63D and S65C mutations in the HFE gene in Brazilian patients with iron overload

Directory of Open Access Journals (Sweden)

Rodolfo D. Cançado

2007-12-01

Full Text Available Hemocromatose é uma das doenças genéticas mais freqüentes no ser humano e uma das causas mais importantes de sobrecarga de ferro. Os objetivos deste estudo foram determinar a freqüência das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro, verificar a coexistência de anemia hemolítica hereditária, hepatite C e consumo excessivo de bebida alcoólica nestes doentes e avaliar a influência destas variáveis sobre os depósitos de ferro do organismo. Saturação da transferrina, ferritina sérica e análise das mutações C282Y, H63D e S65C do gene HFE, pelo método da PCR, foram determinadas em cinqüenta doentes com sobrecarga de ferro atendidos no Hemocentro da Santa Casa de São Paulo entre janeiro de 2000 e maio de 2004. A freqüência de mutação do gene HFE nos doentes com sobrecarga de ferro foi de 76,0% (38/50. Saturação da transferrina e ferritina foram significativamente maiores nos doentes homozigotos para a mutação C282Y confirmando a correlação entre genótipo C282Y/C282Y e maior risco de sobrecarga de ferro. A coexistência de hepatite C, consumo excessivo de bebida alcoólica ou anemia hemolítica hereditária estão implicados em aumento dos estoques de ferro e constituem fator de risco adicional em pacientes com mutação do gene HFE para a condição de sobrecarga de ferro.Hemochromatosis is one of the most frequent genetic diseases in humans and one of the most important causes of iron overload. The aims of this study were to determine the frequency of C282Y, H63D and S65C mutations of the HFE gene in Brazilian patients with iron overload, to verify the coexistence of chronic hemolytic anemia, hepatitis C and excessive alcohol consumption and to evaluate the influence of these variables on body iron deposits. Transferrin saturation, serum ferritin and C282Y, H63D and S65C HFE gene mutations (by PCR method were determined in 50 patients with iron overload in the Hemocentro da

Testing the Binary Black Hole Nature of a Compact Binary Coalescence.

Science.gov (United States)

Krishnendu, N V; Arun, K G; Mishra, Chandra Kant

2017-09-01

We propose a novel method to test the binary black hole nature of compact binaries detectable by gravitational wave (GW) interferometers and, hence, constrain the parameter space of other exotic compact objects. The spirit of the test lies in the "no-hair" conjecture for black holes where all properties of a Kerr black hole are characterized by its mass and spin. The method relies on observationally measuring the quadrupole moments of the compact binary constituents induced due to their spins. If the compact object is a Kerr black hole (BH), its quadrupole moment is expressible solely in terms of its mass and spin. Otherwise, the quadrupole moment can depend on additional parameters (such as the equation of state of the object). The higher order spin effects in phase and amplitude of a gravitational waveform, which explicitly contains the spin-induced quadrupole moments of compact objects, hence, uniquely encode the nature of the compact binary. Thus, we argue that an independent measurement of the spin-induced quadrupole moment of the compact binaries from GW observations can provide a unique way to distinguish binary BH systems from binaries consisting of exotic compact objects.

Binary Masking & Speech Intelligibility

DEFF Research Database (Denmark)

Boldt, Jesper

The purpose of this thesis is to examine how binary masking can be used to increase intelligibility in situations where hearing impaired listeners have difficulties understanding what is being said. The major part of the experiments carried out in this thesis can be categorized as either experime......The purpose of this thesis is to examine how binary masking can be used to increase intelligibility in situations where hearing impaired listeners have difficulties understanding what is being said. The major part of the experiments carried out in this thesis can be categorized as either...... experiments under ideal conditions or as experiments under more realistic conditions useful for real-life applications such as hearing aids. In the experiments under ideal conditions, the previously defined ideal binary mask is evaluated using hearing impaired listeners, and a novel binary mask -- the target...... binary mask -- is introduced. The target binary mask shows the same substantial increase in intelligibility as the ideal binary mask and is proposed as a new reference for binary masking. In the category of real-life applications, two new methods are proposed: a method for estimation of the ideal binary...

Interacting binary stars

CERN Document Server

Sahade, Jorge; Ter Haar, D

1978-01-01

Interacting Binary Stars deals with the development, ideas, and problems in the study of interacting binary stars. The book consolidates the information that is scattered over many publications and papers and gives an account of important discoveries with relevant historical background. Chapters are devoted to the presentation and discussion of the different facets of the field, such as historical account of the development in the field of study of binary stars; the Roche equipotential surfaces; methods and techniques in space astronomy; and enumeration of binary star systems that are studied

Clinical penetrance in hereditary hemochromatosis: estimates of the cumulative incidence of severe liver disease among HFE C282Y homozygotes.

Science.gov (United States)

Grosse, Scott D; Gurrin, Lyle C; Bertalli, Nadine A; Allen, Katrina J

2018-04-01

Iron overload (hemochromatosis) can cause serious, symptomatic disease that is preventable if detected early and managed appropriately. The leading cause of hemochromatosis in populations of predominantly European ancestry is homozygosity of the C282Y variant in the HFE gene. Screening of adults for iron overload or associated genotypes is controversial, largely because of a belief that severe phenotypes are uncommon, although cascade testing of first-degree relatives of patients is widely endorsed. We contend that severe liver disease (cirrhosis or hepatocellular cancer) is not at all uncommon among older males with hereditary hemochromatosis. Our review of the published data from a variety of empirical sources indicates that roughly 1 in 10 male HFE C282Y homozygotes is likely to develop severe liver disease during his lifetime unless iron overload is detected early and treated. New evidence from a randomized controlled trial of treatment allows for evidence-based management of presymptomatic patients. Although population screening for HFE C282Y homozygosity faces multiple barriers, a potentially effective strategy for increasing the early detection and prevention of clinical iron overload and severe disease is to include HFE C282Y homozygosity in lists of medically actionable gene variants when reporting the results of genome or exome sequencing.

Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia.

Science.gov (United States)

Rodriguez, Libia M; Giraldo, Mabel C; Velasquez, Laura I; Alvarez, Cristiam M; Garcia, Luis F; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos

2015-03-01

A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D) mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis ("HH") and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD) with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

Ancestral association between HLA and HFE H63D and C282Y gene mutations from northwest Colombia

Directory of Open Access Journals (Sweden)

Libia M Rodriguez

2015-03-01

Full Text Available A significant association between HFE gene mutations and the HLA-A*03-B*07 and HLA-A*29-B*44 haplotypes has been reported in the Spanish population. It has been proposed that these mutations are probably connected with Celtic and North African ancestry, respectively. We aimed to find the possible ancestral association between HLA alleles and haplotypes associated with the HFE gene (C282Y and H63D mutations in 214 subjects from Antioquia, Colombia. These were 18 individuals with presumed hereditary hemochromatosis (“HH” and 196 controls. The HLA-B*07 allele was in linkage disequilibrium (LD with C282Y, while HLA-A*23, A*29, HLA-B*44, and B*49 were in LD with H63D. Altogether, our results show that, although the H63D mutation is more common in the Antioquia population, it is not associated with any particular HLA haplotype, whereas the C282Y mutation is associated with HLA-A*03-B*07, this supporting a northern Spaniard ancestry.

CFX-10 Analysis of the High Temperature Thermal- Chemical Experiment (CS28-2)

Energy Technology Data Exchange (ETDEWEB)

Kim, Hyoung Tae; Park, Joo Hwan; Rhee, Bo Wook

2008-02-15

A Computational Fluid Dynamics (CFD) model of a post-blowdown fuel channel analysis for aged CANDU reactors with crept pressure tube has been developed, and validated against a high temperature thermal-chemical experiment: CS28-2. The CS28-2 experiment is one of three series of experiments to simulate the thermal-chemical behavior of a 28-element fuel channel at a high temperature and a low steam flow rate which may occur in severe accident conditions such as a LBLOCA (Large Break Loss of Coolant Accident) of CANDU reactors. Pursuant to the objective of this study, the current study has focused on understanding the involved phenomena such as the thermal radiation and convection heat transfer, and the high temperature zirconium-steam reaction in a multi-ring geometry. Therefore, a zirconium-steam oxidation model based on a parabolic rate law was implemented into the CFX-10 code, which is a commercial CFD code offered from ANSYS Inc., and other heat transfer mechanisms in the 28-element fuel channel were modeled by the original CFX-10 heat transfer packages. To assess the capability of the CFX-10 code to model the thermal-chemical behavior of the 28-element fuel channel, the measured temperatures of the Fuel Element Simulators (FES) of three fuel rings in the test bundle and the pressure tube, and the hydrogen production in the CS28-2 experiment were compared with the CFX-10 predictions. In spite of some discrepancy between the measurement data and CFX results, it was found that the CFX-10 prediction based on the Urbanic-Heidrick correlation of the zirconium-steam reaction as well as the Discrete Transfer Model for a radiation heat transfer among the FES of three rings and the pressure tube are quite accurate and sound even for the offset a cluster fuel bundle of an aged fuel channel.

CFX-10 Analysis of the High Temperature Thermal- Chemical Experiment (CS28-2)

International Nuclear Information System (INIS)

Kim, Hyoung Tae; Park, Joo Hwan; Rhee, Bo Wook

2008-02-01

A Computational Fluid Dynamics (CFD) model of a post-blowdown fuel channel analysis for aged CANDU reactors with crept pressure tube has been developed, and validated against a high temperature thermal-chemical experiment: CS28-2. The CS28-2 experiment is one of three series of experiments to simulate the thermal-chemical behavior of a 28-element fuel channel at a high temperature and a low steam flow rate which may occur in severe accident conditions such as a LBLOCA (Large Break Loss of Coolant Accident) of CANDU reactors. Pursuant to the objective of this study, the current study has focused on understanding the involved phenomena such as the thermal radiation and convection heat transfer, and the high temperature zirconium-steam reaction in a multi-ring geometry. Therefore, a zirconium-steam oxidation model based on a parabolic rate law was implemented into the CFX-10 code, which is a commercial CFD code offered from ANSYS Inc., and other heat transfer mechanisms in the 28-element fuel channel were modeled by the original CFX-10 heat transfer packages. To assess the capability of the CFX-10 code to model the thermal-chemical behavior of the 28-element fuel channel, the measured temperatures of the Fuel Element Simulators (FES) of three fuel rings in the test bundle and the pressure tube, and the hydrogen production in the CS28-2 experiment were compared with the CFX-10 predictions. In spite of some discrepancy between the measurement data and CFX results, it was found that the CFX-10 prediction based on the Urbanic-Heidrick correlation of the zirconium-steam reaction as well as the Discrete Transfer Model for a radiation heat transfer among the FES of three rings and the pressure tube are quite accurate and sound even for the offset a cluster fuel bundle of an aged fuel channel

Thermal Analysis in the Technological “Step” Test of H282 Nickel Alloy

Directory of Open Access Journals (Sweden)

Pirowski Z.

2015-03-01

Full Text Available Superalloys show a good combination of mechanical strength and resistance to surface degradation under the influence of chemically active environments at high temperature. They are characterized by very high heat and creep resistance. Their main application is in gas turbines, chemical industry, and in all those cases where resistance to creep and the aggressive corrosion environment is required. Modern jet engines could never come into use if not for progress in the development of superalloys. Superalloys are based on iron, nickel and cobalt. The most common and the most interesting group includes superalloys based on nickel. They carry loads at temperatures well in excess of the eighty percent of the melting point. This group includes the H282 alloy, whose nominal chemical composition is as follows (wt%: Ni - base, Fe - max. 1.5%, Al - 1.5% Ti - 2.1%, C - 0.06% Co - 10% Cr - 20% Mo - 8.5%. This study shows the results of thermal analysis of the H282 alloy performed on a cast step block with different wall thickness. Using the results of measurements, changes in the temperature of H282 alloy during its solidification were determined, and the relationship dT / dt = f (t was derived. The results of the measurements taken at different points in the cast step block allowed identifying a number of thermal characteristics of the investigated alloy and linking the size of the dendrites formed in a metal matrix (DAS with the thermal effect of solidification. It was found that the time of solidification prolonged from less than ome minute at 10 mm wall thickness to over seven minutes at the wall thickness of 44 mm doubled the value of DAS.

Search for high-energy neutrinos from gravitational wave event GW151226 and candidate LVT151012 with ANTARES and IceCube

NARCIS (Netherlands)

Albert, A.; Andre, M.; Anghinolfi, M.; Anton, G.; Ardid, M.; Aubert, J. -J.; Avgitas, T.; Baret, B.; Barrios-Marti, J.; Basa, S.; Bertin, V.; Biagi, S.; Bormuth, R.; Bourret, S.; Bouwhuis, M. C.; Bruijn, R.; Brunner, J.; Busto, J.; Capone, A.; Caramete, L.; Carr, J.; Celli, S.; Chiarusi, T.; Circella, M.; Coelho, J. A. B.; Coleiro, A.; Coniglione, R.; Costantini, H.; Coyle, P.; Creusot, A.; Deschamps, A.; De Bonis, G.; Distefano, C.; Di Palma, I.; Donzaud, C.; Dornic, D.; Drouhin, D.; Eberl, T.; El Bojaddaini, I.; Elsaesser, D.; Enzenhofer, A.; Felis, I.; Fusco, L. A.; Galata, S.; Gay, P.; Giordano, V.; Glotin, H.; Gregoire, T.; Ruiz, R. Gracia; Graf, K.; Hallmann, S.; van Haren, H.; Heijboer, A. J.; Hello, Y.; Hernandez-Rey, J. J.; Hoessl, J.; Hofestaedt, J.; Hugon, C.; Illuminati, G.; James, C. W.; de Jong, M.; Jongen, M.; Kadler, M.; Kalekin, O.; Katz, U.; Kiessling, D.; Kouchner, A.; Kreter, M.; Kreykenbohm, I.; Kulikovskiy, V.; Lachaud, C.; Lahmann, R.; Lefevre, D.; Leonora, E.; Lotze, M.; Loucatos, S.; Marcelin, M.; Margiotta, A.; Marinelli, A.; Martinez-Mora, J. A.; Mathieu, A.; Mele, R.; Melis, K.; Michael, T.; Migliozzi, P.; Moussa, A.; Nezri, E.; Pavalas, G. E.; Pellegrino, C.; Perrina, C.; Piattelli, P.; Popa, V.; Pradier, T.; Quinn, L.; Racca, C.; Riccobene, G.; Sanchez-Losa, A.; Saldana, M.; Salvadori, I.; Samtleben, D. F. E.; Sanguineti, M.; Sapienza, P.; Schussler, F.; Sieger, C.; Spurio, M.; Stolarczyk, Th.; Taiuti, M.; Tayalati, Y.; Trovato, A.; Turpin, D.; Tonnis, C.; Vallage, B.; Vallee, C.; Van Elewyck, V.; Versari, F.; Vivolo, D.; Vizzoca, A.; Wilms, J.; Zornoza, J. D.; Zuniga, J.; Aartsen, M. G.; Ackermann, M.; Adams, J.; Aguilar, J. A.; Ahlers, M.; Ahrens, M.; Al Samarai, I.; Altmann, D.; Andeen, K.; Anderson, T.; Ansseau, I.; Anton, G.; Archinger, M.; Arguelles, C.; Auffenberg, J.; Axani, S.; Bagherpour, H.; Bai, X.; Barwick, S. W.; Baum, V.; Bay, R.; Beatty, J. J.; Tjus, J. Becker; Becker, K. -H.; BenZvi, S.; Berley, D.; Bernardini, E.; Besson, D. Z.; Binder, G.; Bindig, D.; Blaufuss, E.; Blot, S.; Bohm, C.; Borner, M.; Bos, F.; Bose, D.; Boser, S.; Botner, O.; Bradascio, F.; Braun, J.; Brayeur, L.; Bretz, H. -P.; Bron, S.; Burgman, A.; Carver, T.; Casier, M.; Cheung, E.; Chirkin, D.; Christov, A.; Clark, K.; Classen, L.; Coenders, S.; Collin, G. H.; Conrad, J. M.; Cowen, D. F.; Cross, R.; Day, M.; de Andre, J. P. A. M.; De Clercq, C.; Rosendo, E. del Pino; Dembinski, H.; De Ridder, S.; Desiati, P.; de Vries, K. D.; de Wasseige, G.; de With, M.; DeYoung, T.; Diaz-Velez, J. C.; di Lorenzo, V.; Dujmovic, H.; Dumm, J. P.; Dunkman, M.; Eberhardt, B.; Ehrhardt, T.; Eichmann, B.; Eller, P.; Euler, S.; Evenson, P. A.; Fahey, S.; Fazely, A. R.; Feintzeig, J.; Felde, J.; Filimonov, K.; Finley, C.; Flis, S.; Fosig, C. -C.; Franckowiak, A.; Friedman, E.; Fuchs, T.; Gaisser, T. K.; Gallagher, J.; Gerhardt, L.; Ghorbani, K.; Giang, W.; Gladstone, L.; Glauch, T.; Gluesenkamp, T.; Goldschmidt, A.; Gonzalez, J. G.; Grant, D.; Griffith, Z.; Haack, C.; Hallgren, A.; Halzen, F.; Hansen, E.; Hansmann, T.; Hanson, K.; Hebecker, D.; Heereman, D.; Helbing, K.; Hellauer, R.; Hickford, S.; Hignight, J.; Hill, G. C.; Hoffman, K. D.; Hoffmann, R.; Hoshina, K.; Huang, F.; Huber, M.; Hultqvist, K.; In, S.; Ishihara, A.; Jacobi, E.; Japaridze, G. S.; Jeong, M.; Jero, K.; Jones, B. J. P.; Kang, W.; Kappes, A.; Karg, T.; Karle, A.; Katz, U.; Kauer, M.; Keivani, A.; Kelley, J. L.; Kheirandish, A.; Kim, J.; Kim, M.; Kintscher, T.; Kiryluk, J.; Kittler, T.; Klein, S. R.; Kohnen, G.; Koirala, R.; Kolanoski, H.; Konietz, R.; Kopke, L.; Kopper, C.; Kopper, S.; Koskinen, D. J.; Kowalski, M.; Krings, K.; Kroll, M.; Kruckl, G.; Kruger, C.; Kunnen, J.; Kunwar, S.; Kurahashi, N.; Kuwabara, T.; Kyriacou, A.; Labare, M.; Lanfranchi, J. L.; Larson, M. J.; Lauber, F.; Lennarz, D.; Lesiak-Bzdak, M.; Leuermann, M.; Lu, L.; Lunemann, J.; Madsen, J.; Maggi, G.; Mahn, K. B. M.; Mancina, S.; Maruyama, R.; Mase, K.; Maunu, R.; McNally, F.; Meagher, K.; Medici, M.; Meier, M.; Menne, T.; Merino, G.; Meures, T.; Miarecki, S.; Micallef, J.; Momente, G.; Montaruli, T.; Moulai, M.; Nahnhauer, R.; Naumann, U.; Neer, G.; Niederhausen, H.; Nowicki, S. C.; Nygren, D. R.; Pollmann, A. Obertacke; Olivas, A.; O'Murchadha, A.; Palczewski, T.; Pandya, H.; Pankova, D. V.; Peiffer, P.; Penek, O.; Pepper, J. A.; de los Heros, C. Perez; Pieloth, D.; Pinat, E.; Price, P. B.; Przybylski, G. T.; Quinnan, M.; Raab, C.; Raedel, L.; Rameez, M.; Rawlins, K.; Reimann, R.; Relethford, B.; Relich, M.; Resconi, E.; Rhode, W.; Richman, M.; Riedel, B.; Robertson, S.; Rongen, M.; Rott, C.; Ruhe, T.; Ryckbosch, D.; Rysewyk, D.; Sabbatini, L.; Herrera, S. E. Sanchez; Sandrock, A.; Sandroos, J.; Sarkar, S.; Satalecka, K.; Schlunder, P.; Schmidt, T.; Schoenen, S.; Schoeneberg, S.; Schumacher, L.; Seckel, D.; Seunarine, S.; Soldin, D.; Song, M.; Spiczak, G. M.; Spiering, C.; Stachurska, J.; Stanev, T.; Stasik, A.; Stettner, J.; Steuer, A.; Stezelberger, T.; Stokstad, R. G.; Stossl, A.; Strom, R.; Strotjohann, N. L.; Sullivan, G. W.; Sutherland, M.; Taavola, H.; Taboada, I.; Tatar, J.; Tenholt, F.; Ter-Antonyan, S.; Terliuk, A.; Tesic, G.; Tilav, S.; Toale, P. A.; Tobin, M. N.; Toscano, S.; Tosi, D.; Tselengidou, M.; Tung, C. F.; Turcati, A.; Unger, E.; Usner, M.; Vandenbroucke, J.; van Eijndhoven, N.; Vanheule, S.; van Rossem, M.; van Santen, J.; Vehring, M.; Voge, M.; Vogel, E.; Vraeghe, M.; Walck, C.; Wallace, A.; Wallraff, M.; Wandkowsky, N.; Waza, A.; Weaver, Ch.; Weiss, M. J.; Wendt, C.; Westerhoff, S.; Whelan, B. J.; Wickmann, S.; Wiebe, K.; Wiebusch, C. H.; Wille, L.; Williams, D. R.; Wills, L.; Wolf, M.; Wood, T. R.; Woolsey, E.; Woschnagg, K.; Xu, D. L.; Xu, X. W.; Xu, Y.; Yanez, J. P.; Yodh, G.; Yoshida, S.; Zoll, M.; Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Adams, T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Altin, P. A.; Ananyeva, A.; Anderson, S. B.; Anderson, W. G.; Appert, S.; Arai, K.; Araya, M. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Avila-Alvarez, A.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; D. Barta,; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Beer, C.; Bejger, M.; Belahcene, I.; Belgin, M.; Bell, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Billman, C. R.; Birch, J.; Birney, R.; Birnholtz, O.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blackman, J.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Boer, M.; Bogaert, G.; Bohe, A.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Bouffanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Canepa, M.; Cannon, K. C.; Cao, H.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y.; Cheng, H. -P.; Chincarini, A.; Chiummo, A.; Chmiel, T.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, A. J. K.; Chua, S.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Cocchieri, C.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conti, L.; Cooper, S. J.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Covas, P. B.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cullen, T. J.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Davis, D.; Daw, E. J.; Day, B.; Day, R.; De, S.; DeBra, D.; G. Debreczeni,; Degallaix, J.; De Laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.; De Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Di Giovanni, M.; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Doctor, Z.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Dorrington, I.; Douglas, R.; Alvarez, M. Dovale; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Eisenstein, R. A.; Essick, R. C.; Etienne, Z.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.; Farinon, S.; Farr, B.; Farr, W. M.; Fauchon-Jones, E. J.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Galiana, A. Fernandez; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M.; Fong, H.; Forsyth, S. S.; Fournier, J. -D.; Frasca, S.; Frasconi, F.; Z. Frei,; Freise, A.; Frey, R.; Frey, V.; Fries, E. M.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H.; Gadre, B. U.; Gaebel, S. M.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gaur, G.; Gayathri, V.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; George, J.; L. Gergely,; Germain, V.; Ghonge, S.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.; Glaefke, A.; Goetz, E.; Goetz, R.; L. Gondan,; Gonzalez, G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gorodetsky, M. L.; Gossan, S. E.; Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Healy, J.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Henry, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howell, E. J.; Hu, Y. M.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W. W.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Junker, J.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kefelian, F.; Keitel, D.; Kelley, D. B.; Kennedy, R.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chunglee; Kim, J. C.; Kim, Whansun; Kim, W.; Kim, Y. -M.; Kimbrell, S. J.; King, E. J.; King, P. J.; Kirchhoff, R.; Kissel, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koch, P.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kraemer, C.; Kringel, V.; Krolak, A.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lang, R. N.; Lange, J.; Lantz, B.; Lanza, R. K.; Lartaux-Vollard, A.; Lasky, P. D.; Laxen, M.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C. H.; Lee, H. K.; Lee, H. M.; Lee, K.; Lehmann, J.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Liu, J.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lovelace, G.; Lueck, H.; Lundgren, A. P.; Lynch, R.; Ma, Y.; Macfoy, S.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGrath, C.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; Mcrae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B. C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Muniz, E. A. M.; Murray, P. G.; Mytidis, A.; Napier, K.; Nardecchia, I.; Naticchioni, L.; Nelemans, G.; Nelson, T. J. N.; Neri, M.; Nery, M.; Neunzert, A.; Newport, J. M.; Newton, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Noack, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pace, A. E.; Page, J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perez, C. J.; Perreca, A.; Perri, L. M.; Pfeiffer, H. P.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powell, J.; Prasad, J.; Pratt, J. W. W.; Predoi, V.; Prestegard, T.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Puncken, O.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; P. Raffai,; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Rhoades, E.; Ricci, F.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.; Sachdev, S.; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sampson, L. M.; Sanchez, E. J.; Sandberg, V.; Sanders, J. R.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Scheuer, J.; Schmidt, E.; Schmidt, J.; Schmidt, P.; Schnabel, R.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, E.; Schuette, D.; Schutz, B. F.; Schwalbe, S. G.; Scott, J.; Scott, S. M.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, A. D.; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, B.; Smith, R. J. E.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Spencer, A. P.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stevenson, S. P.; Stone, R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sunil, S.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; M. Tapai,; Taracchini, A.; Taylor, R.; Theeg, T.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tippens, T.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tornasi, Z.; Torrie, C. I.; Toyra, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Trinastic, J.; Tringali, M. C.; Trozzo, L.; Tse, M.; Tso, R.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; van Beuzekom, M.; van den Brand, J. F. J.; Van Den Broeck, C.; Vander-Hyde, D. C.; van der Schaaf, L.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Varma, V.; Vass, S.; M. Vasuth,; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Venugopalan, G.; Verkindt, D.; Vetrano, F.; Vicere, A.; Viets, A. D.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, M.; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Watchi, J.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Whittle, C.; Williams, D.; Williams, R. D.; Williamson, A. R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J. L.; Wu, D. S.; Wu, G.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yap, M. J.; Yu, Hang; Yu, Haocun; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, T.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S. J.; Zhu, X. J.; Zucker, M. E.; Zweizig, J.

2017-01-01

The Advanced LIGO observatories detected gravitational waves from two binary black hole mergers during their first observation run (O1). We present a high-energy neutrino follow-up search for the second gravitational wave event, GW151226, as well as for gravitational wave candidate LVT151012. We

Full Ionisation In Binary-Binary Encounters With Small Positive Energies

Science.gov (United States)

Sweatman, W. L.

2006-08-01

Interactions between binary stars and single stars and binary stars and other binary stars play a key role in the dynamics of a dense stellar system. Energy can be transferred between the internal dynamics of a binary and the larger scale dynamics of the interacting objects. Binaries can be destroyed and created by the interaction. In a binary-binary encounter, full ionisation occurs when both of the binary stars are destroyed in the interaction to create four single stars. This is only possible when the total energy of the system is positive. For very small energies the probability of this occurring is very low and it tends towards zero as the total energy tends towards zero. Here the case is considered for which all the stars have equal masses. An asymptotic power law is predicted relating the probability of full ionisation with the total energy when this latter quantity is small. The exponent, which is approximately 2.31, is compared with the results from numerical scattering experiments. The theoretical approach taken is similar to one used previously in the three-body problem. It makes use of the fact that the most dramatic changes in scale and energies of a few-body system occur when its components pass near to a central configuration. The position, and number, of these configurations is not known for the general four-body problem, however, with equal masses there are known to be exactly five different cases. Separate consideration and comparison of the properties of orbits close to each of these five central configurations enables the prediction of the form of the cross-section for full ionisation for the case of small positive total energy. This is the relation between total energy and the probability of total ionisation described above.

CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. I. S-TYPE BINARIES

Energy Technology Data Exchange (ETDEWEB)

Kaltenegger, Lisa [MPIA, Koenigstuhl 17, D-69117 Heidelberg (Germany); Haghighipour, Nader, E-mail: kaltenegger@mpia.de [Institute for Astronomy and NASA Astrobiology Institute, University of Hawaii-Manoa, Honolulu, HI 96822 (United States)

2013-11-10

We have developed a comprehensive methodology for calculating the boundaries of the habitable zone (HZ) of planet-hosting S-type binary star systems. Our approach is general and takes into account the contribution of both stars to the location and extent of the binary HZ with different stellar spectral types. We have studied how the binary eccentricity and stellar energy distribution affect the extent of the HZ. Results indicate that in binaries where the combination of mass-ratio and orbital eccentricity allows planet formation around a star of the system to proceed successfully, the effect of a less luminous secondary on the location of the primary's HZ is generally negligible. However, when the secondary is more luminous, it can influence the extent of the HZ. We present the details of the derivations of our methodology and discuss its application to the binary HZ around the primary and secondary main-sequence stars of an FF, MM, and FM binary, as well as two known planet-hosting binaries α Cen AB and HD 196886.

CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. I. S-TYPE BINARIES

International Nuclear Information System (INIS)

Kaltenegger, Lisa; Haghighipour, Nader

2013-01-01

We have developed a comprehensive methodology for calculating the boundaries of the habitable zone (HZ) of planet-hosting S-type binary star systems. Our approach is general and takes into account the contribution of both stars to the location and extent of the binary HZ with different stellar spectral types. We have studied how the binary eccentricity and stellar energy distribution affect the extent of the HZ. Results indicate that in binaries where the combination of mass-ratio and orbital eccentricity allows planet formation around a star of the system to proceed successfully, the effect of a less luminous secondary on the location of the primary's HZ is generally negligible. However, when the secondary is more luminous, it can influence the extent of the HZ. We present the details of the derivations of our methodology and discuss its application to the binary HZ around the primary and secondary main-sequence stars of an FF, MM, and FM binary, as well as two known planet-hosting binaries α Cen AB and HD 196886

Global blending optimization of laminated composites with discrete material candidate selection and thickness variation

DEFF Research Database (Denmark)

Sørensen, Søren N.; Stolpe, Mathias

2015-01-01

rate. The capabilities of the method and the effect of active versus inactive manufacturing constraints are demonstrated on several numerical examples of limited size, involving at most 320 binary variables. Most examples are solved to guaranteed global optimality and may constitute benchmark examples...... but is, however, convex in the original mixed binary nested form. Convexity is the foremost important property of optimization problems, and the proposed method can guarantee the global or near-global optimal solution; unlike most topology optimization methods. The material selection is limited...... for popular topology optimization methods and heuristics based on solving sequences of non-convex problems. The results will among others demonstrate that the difficulty of the posed problem is highly dependent upon the composition of the constitutive properties of the material candidates....

COMMON PROPER-MOTION WIDE WHITE DWARF BINARIES SELECTED FROM THE SLOAN DIGITAL SKY SURVEY

Energy Technology Data Exchange (ETDEWEB)

Andrews, Jeff J.; Agueeros, Marcel A. [Department of Astronomy, Columbia University, 550 West 120th Street, New York, NY 10027 (United States); Belczynski, Krzysztof [Astronomical Observatory, University of Warsaw, Al. Ujazdowskie 4, 00-478 Warsaw (Poland); Dhital, Saurav [Department of Physics and Astronomy, Vanderbilt University, 6301 Stevenson Center, Nashville, TN 37235 (United States); Kleinman, S. J. [Gemini Observatory, Northern Operations Center, Hilo, HI 96720 (United States); West, Andrew A. [Department of Astronomy, Boston University, 725 Commonwealth Ave, Boston, MA 02215 (United States)

2012-10-01

Wide binaries made up of two white dwarfs (WDs) receive far less attention than their tight counterparts. However, our tests using the binary population synthesis code StarTrack indicate that, for any set of reasonable initial conditions, there exists a significant observable population of double white dwarfs (WDWDs) with orbital separations of 10{sup 2}-10{sup 5} AU. We adapt the technique of Dhital et al. to search for candidate common proper-motion WD companions separated by <10' around the >12,000 spectroscopically confirmed hydrogen-atmosphere WDs recently identified in the Sloan Digital Sky Survey. Using two techniques to separate random alignments from high-confidence pairs, we find nine new high-probability wide WDWDs and confirm three previously identified candidate wide WDWDs. This brings the number of known wide WDWDs to 45; our new pairs are a significant addition to the sample, especially at small proper motions (<200 mas yr{sup -1}) and large angular separations (>10''). Spectroscopic follow-up and an extension of this method to a larger, photometrically selected set of SDSS WDs may eventually produce a large enough dataset for WDWDs to realize their full potential as testbeds for theories of stellar evolution.

A test of the massive binary black hole hypothesis - Arp 102B

Science.gov (United States)

Helpern, J. P.; Filippenko, Alexei V.

1988-01-01

The emission-line spectra of several AGN have broad peaks which are significantly displaced in velocity with respect to the host galaxy. An interpretation of this effect in terms of orbital motion of a binary black hole predicts periods of a few centuries. It is pointed out here that recent measurements of the masses and sizes of many low-luminosity AGN imply orbital periods much shorter than this. In particular, it is found that the elliptical galaxy Arp 102B is the most likely candidate for observation of radial velocity variations; its period is expected to be about 3 yr. The H-alpha line profile of Arp 102B has been measured for 5 yr without detecting any change in velocity, and it is thus found that a rather restrictive observational test of the massive binary black hole hypothesis already exists, albeit for this one object.

Quasi-periodic oscillations and noise in low-mass X-ray binaries

International Nuclear Information System (INIS)

Van der Klis, M.

1989-01-01

The phenomenology of quasi-periodic oscillations (QPOs) and noise in low-mass X-ray binaries (LMXBs) is discussed. Signal analysis aspects of QPO and noise are addressed along with the relationship between LMXBs and millisecond radio pulsars. The history and prehistory of QPOs and noise in LMXBs are examined. Universal noise components and normal and flaring branch QPOs in Z sources are described and the phenomenology of Z sources is discussed. Bright LMXBs known as atoll sources are considered, as are nonpersistently bright LMXBs accreting pulsars and black hole candidates. 162 refs

Dwarf carbon stars are likely metal-poor binaries and unlikely hosts to carbon planets

Science.gov (United States)

Whitehouse, Lewis J.; Farihi, J.; Green, P. J.; Wilson, T. G.; Subasavage, J. P.

2018-06-01

Dwarf carbon stars make up the largest fraction of carbon stars in the Galaxy with ≈1200 candidates known to date primarily from the Sloan Digital Sky Survey. They either possess primordial carbon-enhancements, or are polluted by mass transfer from an evolved companion such that C/O is enhanced beyond unity. To directly test the binary hypothesis, a radial velocity monitoring survey has been carried out on 28 dwarf carbon stars, resulting in the detection of variations in 21 targets. Using Monte Carlo simulations,this detection fraction is found to be consistent with a 100% binary population and orbital periods on the order of hundreds of days. This result supports the post-mass transfer nature of dwarf carbon stars, and implies they are not likely hosts to carbon planets.

Unmasking the hidden NGTS-3Ab: a hot Jupiter in an unresolved binary system

Science.gov (United States)

Günther, Maximilian N.; Queloz, Didier; Gillen, Edward; Delrez, Laetitia; Bouchy, François; McCormac, James; Smalley, Barry; Almleaky, Yaseen; Armstrong, David J.; Bayliss, Daniel; Burdanov, Artem; Burleigh, Matthew; Cabrera, Juan; Casewell, Sarah L.; Cooke, Benjamin F.; Csizmadia, Szilárd; Ducrot, Elsa; Eigmüller, Philipp; Erikson, Anders; Gänsicke, Boris T.; Gibson, Neale P.; Gillon, Michaël; Goad, Michael R.; Jehin, Emmanuël; Jenkins, James S.; Louden, Tom; Moyano, Maximiliano; Murray, Catriona; Pollacco, Don; Poppenhaeger, Katja; Rauer, Heike; Raynard, Liam; Smith, Alexis M. S.; Sohy, Sandrine; Thompson, Samantha J.; Udry, Stéphane; Watson, Christopher A.; West, Richard G.; Wheatley, Peter J.

2018-05-01

We present the discovery of NGTS-3Ab, a hot Jupiter found transiting the primary star of an unresolved binary system. We develop a joint analysis of multi-colour photometry, centroids, radial velocity (RV) cross-correlation function (CCF) profiles and their bisector inverse slopes (BIS) to disentangle this three-body system. Data from the Next Generation Transit Survey (NGTS), SPECULOOS and HARPS are analysed and modelled with our new BLENDFITTER software. We find that the binary consists of NGTS-3A (G6V-dwarf) and NGTS-3B (K1V-dwarf) at 5") and are prone to contamination by blended objects. With TESS on the horizon, it is pivotal for the candidate vetting to incorporate all available follow-up information from multi-colour photometry and RV CCF profiles.

A SYSTEMATIC SEARCH FOR MASSIVE BLACK HOLE BINARIES IN THE SLOAN DIGITAL SKY SURVEY SPECTROSCOPIC SAMPLE

International Nuclear Information System (INIS)

Tsalmantza, P.; Decarli, R.; Hogg, David W.; Dotti, M.

2011-01-01

We present the results of a systematic search for massive black hole binaries in the Sloan Digital Sky Survey (SDSS) spectroscopic database. We focus on bound binaries, under the assumption that one of the black holes is active. In this framework, the broad lines associated with the accreting black hole are expected to show systematic velocity shifts with respect to the narrow lines, which trace the rest frame of the galaxy. For a sample of 54,586 quasars and 3929 galaxies at redshifts 0.1 < z < 1.5, we brute-force model each spectrum as a mixture of two quasars at two different redshifts. The spectral model is a data-driven dimensionality reduction of the SDSS quasar spectra based on a matrix factorization. We identified 32 objects with peculiar spectra. Nine of them can be interpreted as black hole binaries. This doubles the number of known black hole binary candidates. We also report on the discovery of a new class of extreme double-peaked emitters with exceptionally broad and faint Balmer lines. For all the interesting sources, we present detailed analysis of the spectra and discuss possible interpretations.

Interacting binaries

CERN Document Server

Shore, S N; van den Heuvel, EPJ

1994-01-01

This volume contains lecture notes presented at the 22nd Advanced Course of the Swiss Society for Astrophysics and Astronomy. The contributors deal with symbiotic stars, cataclysmic variables, massive binaries and X-ray binaries, in an attempt to provide a better understanding of stellar evolution.

A genetic basis for a postmeiotic X versus Y chromosome intragenomic conflict in the mouse.

Directory of Open Access Journals (Sweden)

Julie Cocquet

2012-09-01

Full Text Available Intragenomic conflicts arise when a genetic element favours its own transmission to the detriment of others. Conflicts over sex chromosome transmission are expected to have influenced genome structure, gene regulation, and speciation. In the mouse, the existence of an intragenomic conflict between X- and Y-linked multicopy genes has long been suggested but never demonstrated. The Y-encoded multicopy gene Sly has been shown to have a predominant role in the epigenetic repression of post meiotic sex chromatin (PMSC and, as such, represses X and Y genes, among which are its X-linked homologs Slx and Slxl1. Here, we produced mice that are deficient for both Sly and Slx/Slxl1 and observed that Slx/Slxl1 has an opposite role to that of Sly, in that it stimulates XY gene expression in spermatids. Slx/Slxl1 deficiency rescues the sperm differentiation defects and near sterility caused by Sly deficiency and vice versa. Slx/Slxl1 deficiency also causes a sex ratio distortion towards the production of male offspring that is corrected by Sly deficiency. All in all, our data show that Slx/Slxl1 and Sly have antagonistic effects during sperm differentiation and are involved in a postmeiotic intragenomic conflict that causes segregation distortion and male sterility. This is undoubtedly what drove the massive gene amplification on the mouse X and Y chromosomes. It may also be at the basis of cases of F1 male hybrid sterility where the balance between Slx/Slxl1 and Sly copy number, and therefore expression, is disrupted. To the best of our knowledge, our work is the first demonstration of a competition occurring between X and Y related genes in mammals. It also provides a biological basis for the concept that intragenomic conflict is an important evolutionary force which impacts on gene expression, genome structure, and speciation.

Transport properties of binary liquid mixtures - candidate solvents for optimized flue gas cleaning processes

Directory of Open Access Journals (Sweden)

Stanimirović Andrej M.

2016-01-01

Full Text Available Thermal conductivities and viscosities of three pure chemicals, monoethanol amine (MEA, tetraethylene glycol dimethyl ether (TEGDME and polyethylene glycol 200 (PEG 200 and two binary mixtures (MEA + + TEGDME and MEA + PEG 200 were measured at six temperatures: 298.15, 303.15, 308.15, 313.15, 318.15 and 323.15 K and atmospheric pressure. Measurement of thermal conductivities was based on a transient hot wire measurement setup, while viscosities were measured with a digital Stabinger SVM 3000/G2 viscometer. From these data, deviations in thermal conductivity and viscosity were calculated and fitted to the Redlich-Kister equation. Thermal conductivities of mixtures were correlated using Filippov, Jamieson, Baroncini and Rowley models, while viscosity data were correlated with the Eyring-UNIQUAC, Eyring-NRTL and McAlistermodels. [Projekat Ministarstva nauke Republike Srbije, br. 172063

PLANETARY CANDIDATES OBSERVED BY KEPLER IV: PLANET SAMPLE FROM Q1-Q8 (22 MONTHS)

International Nuclear Information System (INIS)

Burke, Christopher J.; Mullally, F.; Rowe, Jason F.; Thompson, Susan E.; Coughlin, Jeffrey L.; Caldwell, Douglas A.; Jenkins, Jon M.; Bryson, Stephen T.; Haas, Michael R.; Batalha, Natalie M.; Borucki, William J.; Christiansen, Jessie L.; Ciardi, David R.; Still, Martin; Barclay, Thomas; Chaplin, William J.; Clarke, Bruce D.; Cochran, William D.; Demory, Brice-Olivier; Esquerdo, Gilbert A.

2014-01-01

We provide updates to the Kepler planet candidate sample based upon nearly two years of high-precision photometry (i.e., Q1-Q8). From an initial list of nearly 13,400 threshold crossing events, 480 new host stars are identified from their flux time series as consistent with hosting transiting planets. Potential transit signals are subjected to further analysis using the pixel-level data, which allows background eclipsing binaries to be identified through small image position shifts during transit. We also re-evaluate Kepler Objects of Interest (KOIs) 1-1609, which were identified early in the mission, using substantially more data to test for background false positives and to find additional multiple systems. Combining the new and previous KOI samples, we provide updated parameters for 2738 Kepler planet candidates distributed across 2017 host stars. From the combined Kepler planet candidates, 472 are new from the Q1-Q8 data examined in this study. The new Kepler planet candidates represent ∼40% of the sample with R P ∼ 1 R ⊕ and represent ∼40% of the low equilibrium temperature (T eq < 300 K) sample. We review the known biases in the current sample of Kepler planet candidates relevant to evaluating planet population statistics with the current Kepler planet candidate sample

Eclipsing binaries in open clusters

DEFF Research Database (Denmark)

Southworth, John; Clausen, J.V.

2006-01-01

Stars: fundamental parameters - Stars : binaries : eclipsing - Stars: Binaries: spectroscopic - Open clusters and ass. : general Udgivelsesdato: 5 August......Stars: fundamental parameters - Stars : binaries : eclipsing - Stars: Binaries: spectroscopic - Open clusters and ass. : general Udgivelsesdato: 5 August...

CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. II. P-TYPE BINARIES

International Nuclear Information System (INIS)

Haghighipour, Nader; Kaltenegger, Lisa

2013-01-01

We have developed a comprehensive methodology for calculating the circumbinary habitable zone (HZ) in planet-hosting P-type binary star systems. We present a general formalism for determining the contribution of each star of the binary to the total flux received at the top of the atmosphere of an Earth-like planet and use the Sun's HZ to calculate the inner and outer boundaries of the HZ around a binary star system. We apply our calculations to the Kepler's currently known circumbinary planetary systems and show the combined stellar flux that determines the boundaries of their HZs. We also show that the HZ in P-type systems is dynamic and, depending on the luminosity of the binary stars, their spectral types, and the binary eccentricity, its boundaries vary as the stars of the binary undergo their orbital motion. We present the details of our calculations and discuss the implications of the results

CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. II. P-TYPE BINARIES

Energy Technology Data Exchange (ETDEWEB)

Haghighipour, Nader [Institute for Astronomy and NASA Astrobiology Institute, University of Hawaii-Manoa, Honolulu, HI 96822 (United States); Kaltenegger, Lisa [MPIA, Koenigstuhl 17, Heidelberg, D-69117 (Germany)

2013-11-10

We have developed a comprehensive methodology for calculating the circumbinary habitable zone (HZ) in planet-hosting P-type binary star systems. We present a general formalism for determining the contribution of each star of the binary to the total flux received at the top of the atmosphere of an Earth-like planet and use the Sun's HZ to calculate the inner and outer boundaries of the HZ around a binary star system. We apply our calculations to the Kepler's currently known circumbinary planetary systems and show the combined stellar flux that determines the boundaries of their HZs. We also show that the HZ in P-type systems is dynamic and, depending on the luminosity of the binary stars, their spectral types, and the binary eccentricity, its boundaries vary as the stars of the binary undergo their orbital motion. We present the details of our calculations and discuss the implications of the results.

Peste en una ciudad novohispana. El matlazahuatl de 1737 en la Puebla de los Ángeles

Directory of Open Access Journals (Sweden)

Cuenya, Miguel Ángel

1996-12-01

Full Text Available Not available.

En 1737-1738 la Nueva España se vio sacudida por la peste. Mortífera enfermedad denominada con el nombre de “matlazahuatl”, que atacaba sin distinción de edad, sexo, grupo étnico o económico, ocasionando estragos difíciles de olvidar y consecuencias económicas, demográficas y sociales que perduraban durante largo tiempo. En Puebla, como en todo centro urbano colonial, sus habitantes estaban acostumbrados a convivir diariamente con la muerte, y desde la fundación de la ciudad diversas pandemias y epidemias habían afectado a su población. A pesar de ello, los poblanos no recordaban una enfermedad tan letal como el matlazahuatl, que ocasionara un número tan elevado de víctimas, ya que en sólo ocho meses se registró el entierro de 7.167 personas adultas (15% de su población. A diferencia de la viruela, el sarampión y otras enfermedades, la peste superó barreras étnicas y socioeconómicas: indígenas y castas fueron los grupos que sintieron con mayor intensidad los efectos de la terrible enfermedad y el golpe fue tan severo que las consecuencias se sintieron durante muchos años, mientras que mestizos y españoles se recuperaron rápidamente.

Association between C282Y and H63D mutations of the HFE gene with hepatocellular carcinoma in European populations: a meta-analysis

Directory of Open Access Journals (Sweden)

Shen Xi-Zhong

2010-03-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is an autosomal recessive disorder mainly associated with homozygosity for the C282Y and H63D mutations in the hemochromatosis (HFE gene. The reports about the C282Y and H63D mutations and hepatocellular carninoma (HCC were controversial. To clarify the relationship between C282Y and H63D mutations and HCC, a meta-analysis including nine studies (1102 HCC cases and 3766 controls, mainly came from European populations was performed. Methods The association was measured using random-effect (RE or fixed-effect (FE odds ratios (ORs combined with 95% confidence intervals (CIs according to the studies' heterogeneity. Results Meta-analysis of nine studies showed that Y allele of C282Y was associated with HCC risk: RE OR reached 1.50 (95%CI: 1.05-2.14, p for heterogeneity = 0.02, I2 = 0.57. Subgroup analysis of seven studies also showed Y allele was associated with HCC risk in healthy populations: RE OR reached 1.61 (95%CI: 1.08-2.39, p for heterogeneity = 0.04, I2 = 0.55. We further did subgroup analysis in alcoholic liver cirrhosis (LC patients of four studies (224 cases and 380 controls and found that both the dominant model and Y allele of C282Y were associated with HCC risk (FE OR reached 4.06, 95%CI: 2.08-7.92 and 3.41, 95%CI: 1.81-6.41, respectively. There was no distinct heterogeneity among the studies (I2 = 0. Sensitivity analyses showed the results were robust in the subgroup analysis of alcoholic LC patients. Conclusions C282Y mutation was associated with HCC in European alcoholic LC patients.

C282Y and H63D Mutation Frequencies in a Population from Central Spain

Directory of Open Access Journals (Sweden)

S. Alvarez

2001-01-01

Full Text Available Objectives: To determine the frequency of hereditary hemochromatosis gene mutations, C282Y and H63D, from 125 autochthonous blood donors originating from a Central region of Spain, to provide epidemiological data about HFE gene in the Iberian Peninsula.

Recoiling Black Holes: Electromagnetic Signatures, Candidates, and Astrophysical Implications

Directory of Open Access Journals (Sweden)

S. Komossa

2012-01-01

Full Text Available Supermassive black holes (SMBHs may not always reside right at the centers of their host galaxies. This is a prediction of numerical relativity simulations, which imply that the newly formed single SMBH, after binary coalescence in a galaxy merger, can receive kick velocities up to several 1000 km/s due to anisotropic emission of gravitational waves. Long-lived oscillations of the SMBHs in galaxy cores, and in rare cases even SMBH ejections from their host galaxies, are the consequence. Observationally, accreting recoiling SMBHs would appear as quasars spatially and/or kinematically offset from their host galaxies. The presence of the “kicks” has a wide range of astrophysical implications which only now are beginning to be explored, including consequences for black hole and galaxy assembly at the epoch of structure formation, black hole feeding, and unified models of active galactic nuclei (AGN. Here, we review the observational signatures of recoiling SMBHs and the properties of the first candidates which have emerged, including follow-up studies of the candidate recoiling SMBH of SDSSJ092712.65+294344.0.

Close binary stars

International Nuclear Information System (INIS)

Larsson-Leander, G.

1979-01-01

Studies of close binary stars are being persued more vigorously than ever, with about 3000 research papers and notes pertaining to the field being published during the triennium 1976-1978. Many major advances and spectacular discoveries were made, mostly due to increased observational efficiency and precision, especially in the X-ray, radio, and ultraviolet domains. Progress reports are presented in the following areas: observational techniques, methods of analyzing light curves, observational data, physical data, structure and models of close binaries, statistical investigations, and origin and evolution of close binaries. Reports from the Coordinates Programs Committee, the Committee for Extra-Terrestrial Observations and the Working Group on RS CVn binaries are included. (Auth./C.F.)

Massive Black Hole Binary Evolution

Directory of Open Access Journals (Sweden)

Merritt David

2005-11-01

Full Text Available Coalescence of binary supermassive black holes (SBHs would constitute the strongest sources of gravitational waves to be observed by LISA. While the formation of binary SBHs during galaxy mergers is almost inevitable, coalescence requires that the separation between binary components first drop by a few orders of magnitude, due presumably to interaction of the binary with stars and gas in a galactic nucleus. This article reviews the observational evidence for binary SBHs and discusses how they would evolve. No completely convincing case of a bound, binary SBH has yet been found, although a handful of systems (e.g. interacting galaxies; remnants of galaxy mergers are now believed to contain two SBHs at projected separations of <~ 1kpc. N-body studies of binary evolution in gas-free galaxies have reached large enough particle numbers to reproduce the slow, “diffusive” refilling of the binary’s loss cone that is believed to characterize binary evolution in real galactic nuclei. While some of the results of these simulations - e.g. the binary hardening rate and eccentricity evolution - are strongly N-dependent, others - e.g. the “damage” inflicted by the binary on the nucleus - are not. Luminous early-type galaxies often exhibit depleted cores with masses of ~ 1-2 times the mass of their nuclear SBHs, consistent with the predictions of the binary model. Studies of the interaction of massive binaries with gas are still in their infancy, although much progress is expected in the near future. Binary coalescence has a large influence on the spins of SBHs, even for mass ratios as extreme as 10:1, and evidence of spin-flips may have been observed.

Elemental abundances of solar sibling candidates

International Nuclear Information System (INIS)

Ramírez, I.; Lambert, D. L.; Endl, M.; Cochran, W. D.; MacQueen, P. J.; Bajkova, A. T.; Bobylev, V. V.; Roederer, I. U.; Wittenmyer, R. A.

2014-01-01

Dynamical information along with survey data on metallicity and in some cases age have been used recently by some authors to search for candidates of stars that were born in the cluster where the Sun formed. We have acquired high-resolution, high signal-to-noise ratio spectra for 30 of these objects to determine, using detailed elemental abundance analysis, if they could be true solar siblings. Only two of the candidates are found to have solar chemical composition. Updated modeling of the stars' past orbits in a realistic Galactic potential reveals that one of them, HD 162826, satisfies both chemical and dynamical conditions for being a sibling of the Sun. Measurements of rare-element abundances for this star further confirm its solar composition, with the only possible exception of Sm. Analysis of long-term high-precision radial velocity data rules out the presence of hot Jupiters and confirms that this star is not in a binary system. We find that chemical tagging does not necessarily benefit from studying as many elements as possible but instead from identifying and carefully measuring the abundances of those elements that show large star-to-star scatter at a given metallicity. Future searches employing data products from ongoing massive astrometric and spectroscopic surveys can be optimized by acknowledging this fact.

Optimal statistic for detecting gravitational wave signals from binary inspirals with LISA

CERN Document Server

Rogan, A

2004-01-01

A binary compact object early in its inspiral phase will be picked up by its nearly monochromatic gravitational radiation by LISA. But even this innocuous appearing candidate poses interesting detection challenges. The data that will be scanned for such sources will be a set of three functions of LISA's twelve data streams obtained through time-delay interferometry, which is necessary to cancel the noise contributions from laser-frequency fluctuations and optical-bench motions to these data streams. We call these three functions pseudo-detectors. The sensitivity of any pseudo-detector to a given sky position is a function of LISA's orbital position. Moreover, at a given point in LISA's orbit, each pseudo-detector has a different sensitivity to the same sky position. In this work, we obtain the optimal statistic for detecting gravitational wave signals, such as from compact binaries early in their inspiral stage, in LISA data. We also present how the sensitivity of LISA, defined by this optimal statistic, vari...

Search for gravitational waves from galactic and extra-galactic binary neutron stars

International Nuclear Information System (INIS)

Abbott, B.; Anderson, S.B.; Araya, M.; Armandula, H.; Asiri, F.; Barish, B.C.; Barnes, M.; Barton, M.A.; Bhawal, B.; Billingsley, G.; Black, E.; Blackburn, K.; Bogue, L.; Bork, R.; Brown, D.A.; Busby, D.; Cardenas, L.; Chandler, A.; Chapsky, J.; Charlton, P.

2005-01-01

We use 373 hours (≅15 days) of data from the second science run of the LIGO gravitational-wave detectors to search for signals from binary neutron star coalescences within a maximum distance of about 1.5 Mpc, a volume of space which includes the Andromeda Galaxy and other galaxies of the Local Group of galaxies. This analysis requires a signal to be found in data from detectors at the two LIGO sites, according to a set of coincidence criteria. The background (accidental coincidence rate) is determined from the data and is used to judge the significance of event candidates. No inspiral gravitational-wave events were identified in our search. Using a population model which includes the Local Group, we establish an upper limit of less than 47 inspiral events per year per Milky Way equivalent galaxy with 90% confidence for nonspinning binary neutron star systems with component masses between 1 and 3M ·

Searching for Binary Systems Among Nearby Dwarfs Based on Pulkovo Observations and SDSS Data

Science.gov (United States)

Khovrichev, M. Yu.; Apetyan, A. A.; Roshchina, E. A.; Izmailov, I. S.; Bikulova, D. A.; Ershova, A. P.; Balyaev, I. A.; Kulikova, A. M.; Petyur, V. V.; Shumilov, A. A.; Os'kina, K. I.; Maksimova, L. A.

2018-02-01

Our goal is to find previously unknown binary systems among low-mass dwarfs in the solar neighborhood and to test the search technique. The basic ideas are to reveal the images of stars with significant ellipticities and/or asymmetries compared to the background stars on CCD frames and to subsequently determine the spatial parameters of the binary system and the magnitude difference between its components. For its realization we have developed a method based on an image shapelet decomposition. All of the comparatively faint stars with large proper motions ( V >13 m , μ > 300 mas yr-1) for which the "duplicate source" flag in the Gaia DR1 catalogue is equal to one have been included in the list of objects for our study. As a result, we have selected 702 stars. To verify our results, we have performed additional observations of 65 stars from this list with the Pulkovo 1-m "Saturn" telescope (2016-2017). We have revealed a total of 138 binary candidates (nine of them from the "Saturn" telescope and SDSS data). Six program stars are known binaries. The images of the primaries of the comparatively wide pairs WDS 14519+5147, WDS 11371+6022, and WDS 15404+2500 are shown to be resolved into components; therefore, we can talk about the detection of triple systems. The angular separation ρ, position angle, and component magnitude difference Δ m have been estimated for almost all of the revealed binary systems. For most stars 1.5'' < ρ < 2.5'', while Δ m <1.5m.

27 CFR 25.282 - Beer lost by fire, theft, casualty, or act of God.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Beer lost by fire, theft... TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Refund or Adjustment of Tax or Relief From Liability § 25.282 Beer lost by fire, theft, casualty, or act of God. (a) General. The tax paid by...

Association Studies of HFE C282Y and H63D Variants with Oral Cancer Risk and Iron Homeostasis Among Whites and Blacks

Directory of Open Access Journals (Sweden)

Nathan R. Jones

2015-12-01

Full Text Available Background: Polymorphisms in the hemochromatosis (HFE gene are associated with excessive iron absorption from the diet, and pro-oxidant effects of iron accumulation are thought to be a risk factor for several types of cancer. Methods: The C282Y (rs1800562 and H63D (rs1799945 polymorphisms were genotyped in 301 oral cancer cases and 437 controls and analyzed in relation to oral cancer risk, and serum iron biomarker levels from a subset of 130 subjects. Results: Individuals with the C282Y allele had lower total iron binding capacity (TIBC (321.2 ± 37.2 µg/dL vs. 397.7 ± 89.0 µg/dL, p = 0.007 and higher percent transferrin saturation (22.0 ± 8.7 vs. 35.6 ± 22.9, p = 0.023 than wild type individuals. Iron and ferritin levels approached significantly higher levels for the C282Y allele (p = 0.0632 and p = 0.0588, respectively. Conclusions: Iron biomarker levels were elevated by the C282Y allele, but neither (rs1800562 nor (rs1799945 was associated with oral cancer risk in blacks and whites.

Computer-assisted detection of colonic polyps with CT colonography using neural networks and binary classification trees

International Nuclear Information System (INIS)

Jerebko, Anna K.; Summers, Ronald M.; Malley, James D.; Franaszek, Marek; Johnson, C. Daniel

2003-01-01

Detection of colonic polyps in CT colonography is problematic due to complexities of polyp shape and the surface of the normal colon. Published results indicate the feasibility of computer-aided detection of polyps but better classifiers are needed to improve specificity. In this paper we compare the classification results of two approaches: neural networks and recursive binary trees. As our starting point we collect surface geometry information from three-dimensional reconstruction of the colon, followed by a filter based on selected variables such as region density, Gaussian and average curvature and sphericity. The filter returns sites that are candidate polyps, based on earlier work using detection thresholds, to which the neural nets or the binary trees are applied. A data set of 39 polyps from 3 to 25 mm in size was used in our investigation. For both neural net and binary trees we use tenfold cross-validation to better estimate the true error rates. The backpropagation neural net with one hidden layer trained with Levenberg-Marquardt algorithm achieved the best results: sensitivity 90% and specificity 95% with 16 false positives per study

The fate of close encounters between binary stars and binary supermassive black holes

Science.gov (United States)

Wang, Yi-Han; Leigh, Nathan; Yuan, Ye-Fei; Perna, Rosalba

2018-04-01

The evolution of main-sequence binaries that reside in the Galactic Centre can be heavily influenced by the central supermassive black hole (SMBH). Due to these perturbative effects, the stellar binaries in dense environments are likely to experience mergers, collisions, or ejections through secular and/or non-secular interactions. More direct interactions with the central SMBH are thought to produce hypervelocity stars (HVSs) and tidal disruption events (TDEs). In this paper, we use N-body simulations to study the dynamics of stellar binaries orbiting a central SMBH primary with an outer SMBH secondary orbiting this inner triple. The effects of the secondary SMBH on the event rates of HVSs, TDEs, and stellar mergers are investigated, as a function of the SMBH-SMBH binary mass ratio. Our numerical experiments reveal that, relative to the isolated SMBH case, the TDE and HVS rates are enhanced for, respectively, the smallest and largest mass ratio SMBH-SMBH binaries. This suggests that the observed event rates of TDEs and HVSs have the potential to serve as a diagnostic of the mass ratio of a central SMBH-SMBH binary. The presence of a secondary SMBH also allows for the creation of hypervelocity binaries. Observations of these systems could thus constrain the presence of a secondary SMBH in the Galactic Centre.

Solving a binary puzzle

NARCIS (Netherlands)

Utomo, P.H.; Makarim, R.H.

2017-01-01

A Binary puzzle is a Sudoku-like puzzle with values in each cell taken from the set {0,1} {0,1}. Let n≥4 be an even integer, a solved binary puzzle is an n×n binary array that satisfies the following conditions: (1) no three consecutive ones and no three consecutive zeros in each row and each

Planetary Candidates Observed by Kepler, III: Analysis of the First 16 Months of Data

Energy Technology Data Exchange (ETDEWEB)

Batalha, Natalie M.; /San Jose State U.; Rowe, Jason F.; /NASA, Ames; Bryson, Stephen T.; /NASA, Ames; Barclay, Thomas; /NASA, Ames; Burke, Christopher J.; /NASA, Ames; Caldwell, Douglas A.; /NASA, Ames; Christiansen, Jessie L.; /NASA, Ames; Mullally, Fergal; /NASA, Ames; Thompson, Susan E.; /NASA, Ames; Brown, Timothy M.; /Las Cumbres Observ.; Dupree, Andrea K.; /Harvard-Smithsonian Ctr. Astrophys. /UC, Santa Cruz

2012-02-01

New transiting planet candidates are identified in sixteen months (May 2009 - September 2010) of data from the Kepler spacecraft. Nearly five thousand periodic transit-like signals are vetted against astrophysical and instrumental false positives yielding 1091 viable new planet candidates, bringing the total count up to over 2,300. Improved vetting metrics are employed, contributing to higher catalog reliability. Most notable is the noise-weighted robust averaging of multiquarter photo-center offsets derived from difference image analysis which identifies likely background eclipsing binaries. Twenty-two months of photometry are used for the purpose of characterizing each of the new candidates. Ephemerides (transit epoch, T{sub 0}, and orbital period, P) are tabulated as well as the products of light curve modeling: reduced radius (R{sub P}/R{sub {star}}), reduced semi-major axis (d/R{sub {star}}), and impact parameter (b). The largest fractional increases are seen for the smallest planet candidates (197% for candidates smaller than 2R{sub {circle_plus}} compared to 52% for candidates larger than 2R{sub {circle_plus}}) and those at longer orbital periods (123% for candidates outside of 50 day orbits versus 85% for candidates inside of 50 day orbits). The gains are larger than expected from increasing the observing window from thirteen months (Quarter 1 - Quarter 5) to sixteen months (Quarter 1 - Quarter 6). This demonstrates the benefit of continued development of pipeline analysis software. The fraction of all host stars with multiple candidates has grown from 17% to 20%, and the paucity of short-period giant planets in multiple systems is still evident. The progression toward smaller planets at longer orbital periods with each new catalog release suggests that Earth-size planets in the Habitable Zone are forthcoming if, indeed, such planets are abundant.

A BINARY ORBIT FOR THE MASSIVE, EVOLVED STAR HDE 326823, A WR+O SYSTEM PROGENITOR

International Nuclear Information System (INIS)

Richardson, N. D.; Gies, D. R.; Williams, S. J.

2011-01-01

The hot star HDE 326823 is a candidate transition-phase object that is evolving into a nitrogen-enriched Wolf-Rayet star. It is also a known low-amplitude, photometric variable with a 6.123 day period. We present new, high- and moderate-resolution spectroscopy of HDE 326823, and we show that the absorption lines show coherent Doppler shifts with this period while the emission lines display little or no velocity variation. We interpret the absorption line shifts as the orbital motion of the apparently brighter star in a close, interacting binary. We argue that this star is losing mass to a mass gainer star hidden in a thick accretion torus and to a circumbinary disk that is the source of the emission lines. HDE 326823 probably belongs to a class of objects that produce short-period WR+O binaries.

ON-SKY DEMONSTRATION OF A LINEAR BAND-LIMITED MASK WITH APPLICATION TO VISUAL BINARY STARS

International Nuclear Information System (INIS)

Crepp, J.; Ge, J.; Kravchenko, I.; Serabyn, E.; Carson, J.

2010-01-01

We have designed and built the first band-limited coronagraphic mask used for ground-based high-contrast imaging observations. The mask resides in the focal plane of the near-infrared camera PHARO at the Palomar Hale telescope and receives a well-corrected beam from an extreme adaptive optics system. Its performance on-sky with single stars is comparable to current state-of-the-art instruments: contrast levels of ∼10 -5 or better at 0.''8 in K s after post-processing, depending on how well non-common-path errors are calibrated. However, given the mask's linear geometry, we are able to conduct additional unique science observations. Since the mask does not suffer from pointing errors down its long axis, it can suppress the light from two different stars simultaneously, such as the individual components of a spatially resolved binary star system, and search for faint tertiary companions. In this paper, we present the design of the mask, the science motivation for targeting binary stars, and our preliminary results, including the detection of a candidate M-dwarf tertiary companion orbiting the visual binary star HIP 48337, which we are continuing to monitor with astrometry to determine its association.

Relativistic Binaries in Globular Clusters

Directory of Open Access Journals (Sweden)

Matthew J. Benacquista

2013-03-01

Full Text Available Galactic globular clusters are old, dense star systems typically containing 10^4 – 10^6 stars. As an old population of stars, globular clusters contain many collapsed and degenerate objects. As a dense population of stars, globular clusters are the scene of many interesting close dynamical interactions between stars. These dynamical interactions can alter the evolution of individual stars and can produce tight binary systems containing one or two compact objects. In this review, we discuss theoretical models of globular cluster evolution and binary evolution, techniques for simulating this evolution that leads to relativistic binaries, and current and possible future observational evidence for this population. Our discussion of globular cluster evolution will focus on the processes that boost the production of tight binary systems and the subsequent interaction of these binaries that can alter the properties of both bodies and can lead to exotic objects. Direct N-body integrations and Fokker–Planck simulations of the evolution of globular clusters that incorporate tidal interactions and lead to predictions of relativistic binary populations are also discussed. We discuss the current observational evidence for cataclysmic variables, millisecond pulsars, and low-mass X-ray binaries as well as possible future detection of relativistic binaries with gravitational radiation.

The association between the C282Y and H63D polymorphisms of HFE gene and the risk of Parkinson's disease: A meta-analysis.

Science.gov (United States)

Xia, Jianjian; Xu, Huamin; Jiang, Hong; Xie, Junxia

2015-05-19

Impaired brain iron homeostasis has been considered as an important mechanism in Parkinson's diseases (PD). There are indications that C282Y and H63D polymorphisms of HFE genes involved in iron metabolism might contribute to the pathogenesis of PD in some cases. However, the investigation of the relationship between PD and the two polymorphisms had produced contradictory results. We performed a meta-analysis to assess the C282Y and H63D polymorphisms of HFE in PD susceptibility. PubMed, EMBASE and Web of Science were systematically searched to identify relevant researches. The strict selection criteria and exclusion standard were applied. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. A fixed-effect or random-effect model was selected, depending on the results of the heterogeneity test. Fifteen studies were included in the meta-analysis (eight studies with 1631 cases and 4548 controls for C282Y; seven studies with 1192 cases and 4065 controls for H63D). For the C282Y polymorphism, significant associations were observed in the Recessive model (YY vs CY+CC: OR=0.22, 95% CI=0.09-0.57, P=0.002). This indicated that the C282Y polymorphism in HFE might be a potential protective factor for PD. However, no significant associations were found for any genetic model for the H63D polymorphism, suggesting that the H63D polymorphism might not be associated with PD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Skewed Binary Search Trees

DEFF Research Database (Denmark)

Brodal, Gerth Stølting; Moruz, Gabriel

2006-01-01

It is well-known that to minimize the number of comparisons a binary search tree should be perfectly balanced. Previous work has shown that a dominating factor over the running time for a search is the number of cache faults performed, and that an appropriate memory layout of a binary search tree...... can reduce the number of cache faults by several hundred percent. Motivated by the fact that during a search branching to the left or right at a node does not necessarily have the same cost, e.g. because of branch prediction schemes, we in this paper study the class of skewed binary search trees....... For all nodes in a skewed binary search tree the ratio between the size of the left subtree and the size of the tree is a fixed constant (a ratio of 1/2 gives perfect balanced trees). In this paper we present an experimental study of various memory layouts of static skewed binary search trees, where each...

Planetary Candidates Observed by Kepler IV: Planet Sample from Q1-Q8 (22 Months)

OpenAIRE

Burke, Christopher J.; Christensen, Jessie L.; Ciardi, David R.; Morton, Timothy D.; Shporer, Avi

2014-01-01

We provide updates to the Kepler planet candidate sample based upon nearly two years of high-precision photometry (i.e., Q1-Q8). From an initial list of nearly 13,400 threshold crossing events, 480 new host stars are identified from their flux time series as consistent with hosting transiting planets. Potential transit signals are subjected to further analysis using the pixel-level data, which allows background eclipsing binaries to be identified through small image position shifts during tra...

Kilonova/Macronova Emission from Compact Binary Mergers

Directory of Open Access Journals (Sweden)

Masaomi Tanaka

2016-01-01

Full Text Available We review current understanding of kilonova/macronova emission from compact binary mergers (mergers of two neutron stars or a neutron star and a black hole. Kilonova/macronova is emission powered by radioactive decays of r-process nuclei and it is one of the most promising electromagnetic counterparts of gravitational wave sources. Emission from the dynamical ejecta of ~0.01M⊙ is likely to have a luminosity of ~1040–1041 erg s−1 with a characteristic timescale of about 1 week. The spectral peak is located in red optical or near-infrared wavelengths. A subsequent accretion disk wind may provide an additional luminosity or an earlier/bluer emission if it is not absorbed by the precedent dynamical ejecta. The detection of near-infrared excess in short GRB 130603B and possible optical excess in GRB 060614 supports the concept of the kilonova/macronova scenario. At 200 Mpc distance, a typical peak brightness of kilonova/macronova with 0.01M⊙ ejecta is about 22 mag and the emission rapidly fades to >24 mag within ~10 days. Kilonova/macronova candidates can be distinguished from supernovae by (1 the faster time evolution, (2 fainter absolute magnitudes, and (3 redder colors. Since the high expansion velocity (v~0.1–0.2c is a robust outcome of compact binary mergers, the detection of smooth spectra will be the smoking gun to conclusively identify the gravitational wave source.

Prevalence of C282Y and H63D mutations in the HFE gene of Brazilian individuals with clinical suspicion of hereditary hemochromatosis Prevalência das mutações C282Y e H63D no gene HFE em indivíduos brasileiros com suspeita clínica de hemocromatose hereditária

Directory of Open Access Journals (Sweden)

Alessandro C. S. Ferreira

2008-10-01

Full Text Available Classical hereditary hemochromatosis is a recessive autosomal disease related to a systemic iron overload that is frequently related to C282Y and H63D mutations in the HFE gene. In Brazil, reports on HFE gene mutation frequencies are rare, mainly in regards to a representative sample population. This study intended to determine the prevalence of C282Y and H63D mutations among individuals with clinical suspicion of hereditary hemochromatosis. A total of 1955 patients were studied with C282Y and H63D mutations being detected by the polymerase chain reaction technique followed by enzymatic restriction. The sample consisted of 76.6% men and 23.4% women. The highest percentage of analyzed individuals (56.9% was concentrated in the 41 to 60-year-old age group. Although there were no genic or genotypic differences between genders, a higher number of over 60-year-old women was observed. The C282Y mutation was found as homozygous in 2.9% of the cases and as heterozygous in 10.1%, while the H63D was homozygous in 4.3% and heterozygous in 30.6%. The C282Y and H63D mutant allele frequencies were 0.079 and 0.196, respectively. The highest frequency was observed for H63D which was in genetic equilibrium. This work is important to determine the genetic profile of the population with hereditary hemochromatosis in Brazi.A hemocromatose hereditária clássica (HH é uma doença autossômica recessiva caracterizada por uma sobrecarga sistêmica de ferro, a qual está freqüentemente relacionada às mutações C282Y e H63D no gene HFE. No Brasil, registros das freqüências das mutações no gene HFE são raros, principalmente envolvendo uma amostra representativa da população. Este estudo teve como objetivo a determinação da prevalência das mutações C282Y e H63D em indivíduos com suspeita clínica de HH. Para isto, foram estudados 1955 pacientes para os quais as mutações C282Y e H63D foram pesquisadas pela técnica de Reação em Cadeia da Polimerase

Dietary Iron Intake and Serum Ferritin Concentration in 213 Patients Homozygous for the HFEC282Y Hemochromatosis Mutation

Directory of Open Access Journals (Sweden)

Victor R Gordeuk

2012-01-01

Full Text Available BACKGROUND: HFEC282Y homozygotes have an increased risk for developing increased iron stores and related disorders. It is controversial whether dietary iron restrictions should be recommended to such individuals.

Binary optics: Trends and limitations

Science.gov (United States)

Farn, Michael W.; Veldkamp, Wilfrid B.

1993-01-01

We describe the current state of binary optics, addressing both the technology and the industry (i.e., marketplace). With respect to the technology, the two dominant aspects are optical design methods and fabrication capabilities, with the optical design problem being limited by human innovation in the search for new applications and the fabrication issue being limited by the availability of resources required to improve fabrication capabilities. With respect to the industry, the current marketplace does not favor binary optics as a separate product line and so we expect that companies whose primary purpose is the production of binary optics will not represent the bulk of binary optics production. Rather, binary optics' more natural role is as an enabling technology - a technology which will directly result in a competitive advantage in a company's other business areas - and so we expect that the majority of binary optics will be produced for internal use.

A randomized controlled trial of the efficacy and safety of CCX282-B, an orally-administered blocker of chemokine receptor CCR9, for patients with Crohn's disease

DEFF Research Database (Denmark)

Keshav, Satish; Vaňásek, Tomáš; Niv, Yaron

2013-01-01

CCX282-B, also called vercirnon, is a specific, orally-administered chemokine receptor CCR9 antagonist that regulates migration and activation of inflammatory cells in the intestine. This randomized, placebo-controlled trial was conducted to evaluate the safety and efficacy of CCX282-B in 436...

Black holes in binary stars

NARCIS (Netherlands)

Wijers, R.A.M.J.

1996-01-01

Introduction Distinguishing neutron stars and black holes Optical companions and dynamical masses X-ray signatures of the nature of a compact object Structure and evolution of black-hole binaries High-mass black-hole binaries Low-mass black-hole binaries Low-mass black holes Formation of black holes

Coevolution of Binaries and Circumbinary Gaseous Disks

Science.gov (United States)

Fleming, David; Quinn, Thomas R.

2018-04-01

The recent discoveries of circumbinary planets by Kepler raise questions for contemporary planet formation models. Understanding how these planets form requires characterizing their formation environment, the circumbinary protoplanetary disk, and how the disk and binary interact. The central binary excites resonances in the surrounding protoplanetary disk that drive evolution in both the binary orbital elements and in the disk. To probe how these interactions impact both binary eccentricity and disk structure evolution, we ran N-body smooth particle hydrodynamics (SPH) simulations of gaseous protoplanetary disks surrounding binaries based on Kepler 38 for 10^4 binary orbital periods for several initial binary eccentricities. We find that nearly circular binaries weakly couple to the disk via a parametric instability and excite disk eccentricity growth. Eccentric binaries strongly couple to the disk causing eccentricity growth for both the disk and binary. Disks around sufficiently eccentric binaries strongly couple to the disk and develop an m = 1 spiral wave launched from the 1:3 eccentric outer Lindblad resonance (EOLR). This wave corresponds to an alignment of gas particle longitude of periastrons. We find that in all simulations, the binary semi-major axis decays due to dissipation from the viscous disk.

BINARY CEPHEIDS: SEPARATIONS AND MASS RATIOS IN 5 M ☉ BINARIES

International Nuclear Information System (INIS)

Evans, Nancy Remage; Karovska, Margarita; Tingle, Evan; Bond, Howard E.; Schaefer, Gail H.; Mason, Brian D.

2013-01-01

Deriving the distribution of binary parameters for a particular class of stars over the full range of orbital separations usually requires the combination of results from many different observing techniques (radial velocities, interferometry, astrometry, photometry, direct imaging), each with selection biases. However, Cepheids—cool, evolved stars of ∼5 M ☉ —are a special case because ultraviolet (UV) spectra will immediately reveal any companion star hotter than early type A, regardless of the orbital separation. We have used International Ultraviolet Explorer UV spectra of a complete sample of all 76 Cepheids brighter than V = 8 to create a list of all 18 Cepheids with companions more massive than 2.0 M ☉ . Orbital periods of many of these binaries are available from radial-velocity studies, or can be estimated for longer-period systems from detected velocity variability. In an imaging survey with the Hubble Space Telescope Wide Field Camera 3, we resolved three of the companions (those of η Aql, S Nor, and V659 Cen), allowing us to make estimates of the periods out to the long-period end of the distribution. Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations, orbital periods, and mass ratios. The distribution of orbital periods shows that the 5 M ☉ binaries have systematically shorter periods than do 1 M ☉ stars. Our data also suggest that the distribution of mass ratios depends on both binary separation and system multiplicity. The distribution of mass ratios as a function of orbital separation, however, does not depend on whether a system is a binary or a triple

IGR J19294+1816: a new Be-X-ray binary revealed through infrared spectroscopy

Science.gov (United States)

Rodes-Roca, J. J.; Bernabeu, G.; Magazzù, A.; Torrejón, J. M.; Solano, E.

2018-05-01

The aim of this work is to characterize the counterpart to the INTErnational Gamma-Ray Astrophysics Laboratory high-mass X-ray binary candidate IGR J19294+1816 so as to establish its true nature. We obtained H-band spectra of the selected counterpart acquired with the Near Infrared Camera and Spectrograph instrument mounted on the Telescopio Nazionale Galileo 3.5-m telescope which represents the first infrared spectrum ever taken of this source. We complement the spectral analysis with infrared photometry from UKIDSS, 2MASS, WISE, and NEOWISE data bases. We classify the mass donor as a Be star. Subsequently, we compute its distance by properly taking into account the contamination produced by the circumstellar envelope. The findings indicate that IGR J19294+1816 is a transient source with a B1Ve donor at a distance of d = 11 ± 1 kpc, and luminosities of the order of 1036-37 erg s-1, displaying the typical behaviour of a Be-X-ray binary.

Light fragment preformation in cold fission of {sup 282}Cn

Energy Technology Data Exchange (ETDEWEB)

Poenaru, D.N.; Gherghescu, R.A. [Horia Hulubei National Institute of Physics and Nuclear Engineering (IFIN-HH), P.O. Box MG-6, Bucharest-Magurele (Romania); Johann Wolfgang Goethe University, Frankfurt Institute for Advanced Studies (FIAS), Frankfurt am Main (Germany)

2016-11-15

In a previous article, published in Phys. Rev. C 94, 014309 (2016), we have shown for the first time that the best dynamical trajectory during the deformation toward fission of the superheavy nucleus {sup 286}Fl is a linearly increasing radius of the light fragment, R{sub 2}. This macroscopic-microscopic result reminds us about the α or cluster preformation at the nuclear surface, assumed already in 1928, and proved microscopically many times. This time we give more detailed arguments for the nucleus {sup 282}Cn. Also similar figures are presented for heavy nuclei {sup 240}Pu and {sup 252} Cf. The deep minimum of the total deformation energy near the surface is shown for the first time as a strong argument for cluster preformation. (orig.)

Spectral properties of binary asteroids

Science.gov (United States)

Pajuelo, Myriam; Birlan, Mirel; Carry, Benoît; DeMeo, Francesca E.; Binzel, Richard P.; Berthier, Jérôme

2018-04-01

We present the first attempt to characterize the distribution of taxonomic class among the population of binary asteroids (15% of all small asteroids). For that, an analysis of 0.8-2.5{μ m} near-infrared spectra obtained with the SpeX instrument on the NASA/IRTF is presented. Taxonomic class and meteorite analog is determined for each target, increasing the sample of binary asteroids with known taxonomy by 21%. Most binary systems are bound in the S-, X-, and C- classes, followed by Q and V-types. The rate of binary systems in each taxonomic class agrees within uncertainty with the background population of small near-Earth objects and inner main belt asteroids, but for the C-types which are under-represented among binaries.

Customized binary and multi-level HfO2-x-based memristors tuned by oxidation conditions.

Science.gov (United States)

He, Weifan; Sun, Huajun; Zhou, Yaxiong; Lu, Ke; Xue, Kanhao; Miao, Xiangshui

2017-08-30

The memristor is a promising candidate for the next generation non-volatile memory, especially based on HfO 2-x , given its compatibility with advanced CMOS technologies. Although various resistive transitions were reported independently, customized binary and multi-level memristors in unified HfO 2-x material have not been studied. Here we report Pt/HfO 2-x /Ti memristors with double memristive modes, forming-free and low operation voltage, which were tuned by oxidation conditions of HfO 2-x films. As O/Hf ratios of HfO 2-x films increase, the forming voltages, SET voltages, and R off /R on windows increase regularly while their resistive transitions undergo from gradually to sharply in I/V sweep. Two memristors with typical resistive transitions were studied to customize binary and multi-level memristive modes, respectively. For binary mode, high-speed switching with 10 3 pulses (10 ns) and retention test at 85 °C (>10 4 s) were achieved. For multi-level mode, the 12-levels stable resistance states were confirmed by ongoing multi-window switching (ranging from 10 ns to 1 μs and completing 10 cycles of each pulse). Our customized binary and multi-level HfO 2-x -based memristors show high-speed switching, multi-level storage and excellent stability, which can be separately applied to logic computing and neuromorphic computing, further suitable for in-memory computing chip when deposition atmosphere may be fine-tuned.

Sn-Sb-Se based binary and ternary alloys for phase change memory applications

Energy Technology Data Exchange (ETDEWEB)

Chung, Kyung-Min

2008-10-28

In this work, the effect of replacing Ge by Sn and Te by Se was studied for a systematic understanding and prediction of new potential candidates for phase change random access memories applications. The temperature dependence of the electrical/structural properties and crystallization kinetics of the Sn-Se based binary and Sn-Sb-Se based ternary alloys were determined and compared with those of the GeTe and Ge-Sb-Te system. The temperature dependence of electrical and structural properties were investigated by van der Pauw measurements, X-ray diffraction, X-ray reflectometry. By varying the heating rate, the Kissinger analysis has been used to determine the combined activation barrier for crystallization. To screen the kinetics of crystallization, a static laser tester was employed. In case of binary alloys of the type Sn{sub x}Se{sub 1-x}, the most interesting candidate is SnSe{sub 2} since it crystallizes into a single crystalline phase and has high electrical contrast and reasonably high activation energy for crystallization. In addition, the SnSe{sub 2}-Sb{sub 2}Se{sub 3} pseudobinary alloy system also might be sufficient for data retention due to their higher transition temperature and activation energy for crystallization in comparison to GeTe-Sb{sub 2}Te{sub 3} system. Furthermore, SnSe{sub 2}-Sb{sub 2}Se{sub 3} pseudobinary alloys have a higher crystalline resistivity. The desired rapid crystallization speed can be obtained for Sn{sub 1}Sb{sub 2}Se{sub 5} and Sn{sub 2}Sb{sub 2}Se{sub 7} alloys. (orig.)

Prevalence of H63D, S65C and C282Y hereditary hemochromatosis gene mutations in Slovenian population by an improved high-throughput genotyping assay

Directory of Open Access Journals (Sweden)

Rupreht Ruth

2007-11-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common genetic disease characterized by excessive iron overload that leads to multi-organ failure. Although the most prevalent genotype in HH is homozygosity for C282Y mutation of the HFE gene, two additional mutations, H63D and S65C, appear to be associated with a milder form of HH. The aim of this study was to develop a high-throughput assay for HFE mutations screening based on TaqMan technology and to determine the frequencies of HFE mutations in the Slovenian population. Methods Altogether, 1282 randomly selected blood donors from different Slovenian regions and 21 HH patients were analyzed for the presence of HFE mutations by an in-house developed real-time PCR assay based on TaqMan technology using shorter non-interfering fluorescent single nucleotide polymorphism (SNP-specific MGB probes. The assay was validated by RFLP analysis and DNA sequencing. Results The genotyping assay of the H63D, S65C and C282Y mutations in the HFE gene, based on TaqMan technology proved to be fast, reliable, with a high-throughput capability and 100% concordant with genotypes obtained by RFLP and DNA sequencing. The observed frequency of C282Y homozygotes in the group of HH patients was only 48%, others were of the heterogeneous HFE genotype. Among 1282 blood donors tested, the observed H63D, S65C and C282Y allele frequency were 12.8% (95% confidence interval (CI 11.5 – 14.2%, 1.8% (95% CI 1.4 – 2.5% and 3.6% (95% CI 3.0 – 4.5%, respectively. Approximately 33% of the tested subjects had at least one of the three HH mutations, and 1% of them were C282Y homozygotes or compound heterozygotes C282Y/H63D or C282Y/S65C, presenting an increased risk for iron overload disease. A significant variation in H63D allele frequency was observed for one of the Slovenian regions. Conclusion The improved real-time PCR assay for H63D, S65C and C282Y mutations detection is accurate, fast, cost-efficient and ready for

Binary Cepheids: Separations and Mass Ratios in 5 M ⊙ Binaries

Science.gov (United States)

Evans, Nancy Evans; Bond, Howard E.; Schaefer, Gail H.; Mason, Brian D.; Karovska, Margarita; Tingle, Evan

2013-10-01

Deriving the distribution of binary parameters for a particular class of stars over the full range of orbital separations usually requires the combination of results from many different observing techniques (radial velocities, interferometry, astrometry, photometry, direct imaging), each with selection biases. However, Cepheids—cool, evolved stars of ~5 M ⊙—are a special case because ultraviolet (UV) spectra will immediately reveal any companion star hotter than early type A, regardless of the orbital separation. We have used International Ultraviolet Explorer UV spectra of a complete sample of all 76 Cepheids brighter than V = 8 to create a list of all 18 Cepheids with companions more massive than 2.0 M ⊙. Orbital periods of many of these binaries are available from radial-velocity studies, or can be estimated for longer-period systems from detected velocity variability. In an imaging survey with the Hubble Space Telescope Wide Field Camera 3, we resolved three of the companions (those of η Aql, S Nor, and V659 Cen), allowing us to make estimates of the periods out to the long-period end of the distribution. Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations, orbital periods, and mass ratios. The distribution of orbital periods shows that the 5 M ⊙ binaries have systematically shorter periods than do 1 M ⊙ stars. Our data also suggest that the distribution of mass ratios depends on both binary separation and system multiplicity. The distribution of mass ratios as a function of orbital separation, however, does not depend on whether a system is a binary or a triple. Based in part on observations made with the NASA/ESA Hubble Space Telescope, obtained by the Space Telescope Science Institute. STScI is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS5-26555.

The formation of eccentric compact binary inspirals and the role of gravitational wave emission in binary-single stellar encounters

International Nuclear Information System (INIS)

Samsing, Johan; MacLeod, Morgan; Ramirez-Ruiz, Enrico

2014-01-01

The inspiral and merger of eccentric binaries leads to gravitational waveforms distinct from those generated by circularly merging binaries. Dynamical environments can assemble binaries with high eccentricity and peak frequencies within the LIGO band. In this paper, we study binary-single stellar scatterings occurring in dense stellar systems as a source of eccentrically inspiraling binaries. Many interactions between compact binaries and single objects are characterized by chaotic resonances in which the binary-single system undergoes many exchanges before reaching a final state. During these chaotic resonances, a pair of objects has a non-negligible probability of experiencing a very close passage. Significant orbital energy and angular momentum are carried away from the system by gravitational wave (GW) radiation in these close passages, and in some cases this implies an inspiral time shorter than the orbital period of the bound third body. We derive the cross section for such dynamical inspiral outcomes through analytical arguments and through numerical scattering experiments including GW losses. We show that the cross section for dynamical inspirals grows with increasing target binary semi-major axis a and that for equal-mass binaries it scales as a 2/7 . Thus, we expect wide target binaries to predominantly contribute to the production of these relativistic outcomes. We estimate that eccentric inspirals account for approximately 1% of dynamically assembled non-eccentric merging binaries. While these events are rare, we show that binary-single scatterings are a more effective formation channel than single-single captures for the production of eccentrically inspiraling binaries, even given modest binary fractions.

Pathways for Holliday Junction Processing during Homologous Recombination in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Ashton, Thomas M; Mankouri, Hocine W; Heidenblut, Anna

2011-01-01

The Saccharomyces cerevisiae Rmi1 protein is a component of the highly conserved Sgs1-Top3-Rmi1 complex. Deletion of SGS1, TOP3, or RMI1 is synthetically lethal when combined with the loss of the Mus81-Mms4 or Slx1-Slx4 endonucleases, which have been implicated in Holliday junction (HJ) resolutio...

Spitzer Photometry of WISE-Selected Brown Dwarf and Hyper-Lumninous Infrared Galaxy Candidates

Science.gov (United States)

Griffith, Roger L.; Kirkpatrick, J. Davy; Eisenhardt, Peter R. M.; Gelino, Christopher R.; Cushing, Michael C.; Benford, Dominic; Blain, Andrew; Bridge, Carrie R.; Cohen, Martin; Cutri, Roc M.;

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

Directory of Open Access Journals (Sweden)

Selma Ünal

2014-09-01

Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

N-Bit Binary Resistor

Science.gov (United States)

Tcheng, Ping

1989-01-01

Binary resistors in series tailored to precise value of resistance. Desired value of resistance obtained by cutting appropriate traces across resistors. Multibit, binary-based, adjustable resistor with high resolution used in many applications where precise resistance required.

Testing Modified Gravity Theories via Wide Binaries and GAIA

Science.gov (United States)

Pittordis, Charalambos; Sutherland, Will

2018-06-01

The standard ΛCDM model based on General Relativity (GR) including cold dark matter (CDM) is very successful at fitting cosmological observations, but recent non-detections of candidate dark matter (DM) particles mean that various modified-gravity theories remain of significant interest. The latter generally involve modifications to GR below a critical acceleration scale ˜10-10 m s-2. Wide-binary (WB) star systems with separations ≳ 5 kAU provide an interesting test for modified gravity, due to being in or near the low-acceleration regime and presumably containing negligible DM. Here, we explore the prospects for new observations pending from the GAIA spacecraft to provide tests of GR against MOND or TeVes-like theories in a regime only partially explored to date. In particular, we find that a histogram of (3D) binary relative velocities, relative to equilibrium circular velocity predicted from the (2D) projected separation predicts a rather sharp feature in this distribution for standard gravity, with an 80th (90th) percentile value close to 1.025 (1.14) with rather weak dependence on the eccentricity distribution. However, MOND/TeVeS theories produce a shifted distribution, with a significant increase in these upper percentiles. In MOND-like theories without an external field effect, there are large shifts of order unity. With the external field effect included, the shifts are considerably reduced to ˜0.04 - 0.08, but are still potentially detectable statistically given reasonably large samples and good control of contaminants. In principle, followup of GAIA-selected wide binaries with ground-based radial velocities accurate to ≲ 0.03 { km s^{-1}} should be able to produce an interesting new constraint on modified-gravity theories.

Some properties of spectral binary stars

International Nuclear Information System (INIS)

Krajcheva, Z.T.; Popova, E.I.; Tutukov, A.V.; Yungel'son, L.R.; AN SSSR, Moscow. Astronomicheskij Sovet)

1978-01-01

Statistical investigations of spectra binary stars are carried out. Binary systems consisting of main sequence stars are considered. For 826 binary stars masses of components, ratios of component masses, semiaxes of orbits and orbital angular momenta are calculated. The distributions of these parameters and their correlations are analyzed. The dependences of statistical properties of spectral binary stars on their origin and evolution are discussed

Microlensing Binaries Discovered through High-magnification Channel

DEFF Research Database (Denmark)

Shin, I.-G.; Choi, J.-Y.; Park, S.-Y.

2012-01-01

Microlensing can provide a useful tool to probe binary distributions down to low-mass limits of binary companions. In this paper, we analyze the light curves of eight binary-lensing events detected through the channel of high-magnification events during the seasons from 2007 to 2010. The perturba......Microlensing can provide a useful tool to probe binary distributions down to low-mass limits of binary companions. In this paper, we analyze the light curves of eight binary-lensing events detected through the channel of high-magnification events during the seasons from 2007 to 2010...

Evolution of an electron-positron plasma produced by induced gravitational collapse in binary-driven hypernovae

Directory of Open Access Journals (Sweden)

Melon Fuksman J. D.

2018-01-01

Full Text Available The binary-driven hypernova (BdHN model has been introduced in the past years, to explain a subfamily of gamma-ray bursts (GRBs with energies Eiso ≥ 1052 erg associated with type Ic supernovae. Such BdHNe have as progenitor a tight binary system composed of a carbon-oxigen (CO core and a neutron star undergoing an induced gravitational collapse to a black hole, triggered by the CO core explosion as a supernova (SN. This collapse produces an optically-thick e+e- plasma, which expands and impacts onto the SN ejecta. This process is here considered as a candidate for the production of X-ray flares, which are frequently observed following the prompt emission of GRBs. In this work we follow the evolution of the e+e- plasma as it interacts with the SN ejecta, by solving the equations of relativistic hydrodynamics numerically. Our results are compatible with the Lorentz factors estimated for the sources that produce the flares, of typically Γ ≲ 4.

BINARY CEPHEIDS: SEPARATIONS AND MASS RATIOS IN 5 M {sub ☉} BINARIES

Energy Technology Data Exchange (ETDEWEB)

Evans, Nancy Remage; Karovska, Margarita; Tingle, Evan [Smithsonian Astrophysical Observatory, MS 4, 60 Garden Street, Cambridge, MA 02138 (United States); Bond, Howard E. [Department of Astronomy and Astrophysics, Pennsylvania State University, University Park, PA 16802 (United States); Schaefer, Gail H. [The CHARA Array, Georgia State University, P.O. Box 3965, Atlanta, GA 30302-3965 (United States); Mason, Brian D., E-mail: nevans@cfa.harvard.edu, E-mail: heb11@psu.edu, E-mail: schaefer@chara-array.org [US Naval Observatory, 3450 Massachusetts Avenue, NW, Washington, DC 20392-5420 (United States)

2013-10-01

Deriving the distribution of binary parameters for a particular class of stars over the full range of orbital separations usually requires the combination of results from many different observing techniques (radial velocities, interferometry, astrometry, photometry, direct imaging), each with selection biases. However, Cepheids—cool, evolved stars of ∼5 M {sub ☉}—are a special case because ultraviolet (UV) spectra will immediately reveal any companion star hotter than early type A, regardless of the orbital separation. We have used International Ultraviolet Explorer UV spectra of a complete sample of all 76 Cepheids brighter than V = 8 to create a list of all 18 Cepheids with companions more massive than 2.0 M {sub ☉}. Orbital periods of many of these binaries are available from radial-velocity studies, or can be estimated for longer-period systems from detected velocity variability. In an imaging survey with the Hubble Space Telescope Wide Field Camera 3, we resolved three of the companions (those of η Aql, S Nor, and V659 Cen), allowing us to make estimates of the periods out to the long-period end of the distribution. Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations, orbital periods, and mass ratios. The distribution of orbital periods shows that the 5 M {sub ☉} binaries have systematically shorter periods than do 1 M {sub ☉} stars. Our data also suggest that the distribution of mass ratios depends on both binary separation and system multiplicity. The distribution of mass ratios as a function of orbital separation, however, does not depend on whether a system is a binary or a triple.

Dissipative binary collisions

International Nuclear Information System (INIS)

Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.

1998-01-01

The binary character of the heavy ion collisions at intermediate energies in the exit channel has been observed under 30 MeV/n in medium and heavy systems. Measurements in light systems at energies approaching ∼ 100 MeV/nucleon as well as in very heavy systems have allowed to extend considerably the investigations of this binary process. Thus, the study of the Pb + Au system showed that the complete charge events indicated two distinct sources: the quasi-projectile and the quasi-target. The characteristics of these two sources are rather well reproduced by a trajectory computation which takes into account the Coulomb and nuclear forces and the friction appearing from the projectile-target interaction. The Wilczynski diagram is used to probe the correlation between the kinetic energy quenching and the deflecting angle. In case of the system Pb + Au at 29 MeV/nucleon the diagram indicate dissipative binary collisions typical for low energies. This binary aspect was also detected in the systems Xe + Ag at 44 MeV/nucleon, 36 Ar + 27 Al and 64 Zn + nat Ti. Thus, it was possible to reconstruct the quasi-projectile and to study its mass and excitation energy evolution as a function of the impact parameter. The dissipative binary collisions represent for the systems and energies under considerations the main contribution to the cross section. This does not implies that there are not other processes; particularly, the more or less complete fusion is also observed but with a low cross section which decreases with the increase of bombardment energy. More exclusive measurements with the INDRA detector on quasi-symmetric systems as Ar + KCl and Xe + Sn seem to confirm the importance of the binary collisions. The two source reconstruction of the Xe + Sn data at 50 MeV/nucleon reproduces the same behaviour as that observed in the system Pb + Au at 29 MeV/nucleon

Contact Binaries on Their Way Towards Merging

Science.gov (United States)

Gazeas, K.

2015-07-01

Contact binaries are the most frequently observed type of eclipsing star system. They are small, cool, low-mass binaries belonging to a relatively old stellar population. They follow certain empirical relationships that closely connect a number of physical parameters with each other, largely because of constraints coming from the Roche geometry. As a result, contact binaries provide an excellent test of stellar evolution, specifically for stellar merger scenarios. Observing campaigns by many authors have led to the cataloging of thousands of contact binaries and enabled statistical studies of many of their properties. A large number of contact binaries have been found to exhibit extraordinary behavior, requiring follow-up observations to study their peculiarities in detail. For example, a doubly-eclipsing quadruple system consisting of a contact binary and a detached binary is a highly constrained system offering an excellent laboratory to test evolutionary theories for binaries. A new observing project was initiated at the University of Athens in 2012 in order to investigate the possible lower limit for the orbital period of binary systems before coalescence, prior to merging.

Permutation Entropy for Random Binary Sequences

Directory of Open Access Journals (Sweden)

Lingfeng Liu

2015-12-01

Full Text Available In this paper, we generalize the permutation entropy (PE measure to binary sequences, which is based on Shannon’s entropy, and theoretically analyze this measure for random binary sequences. We deduce the theoretical value of PE for random binary sequences, which can be used to measure the randomness of binary sequences. We also reveal the relationship between this PE measure with other randomness measures, such as Shannon’s entropy and Lempel–Ziv complexity. The results show that PE is consistent with these two measures. Furthermore, we use PE as one of the randomness measures to evaluate the randomness of chaotic binary sequences.

Component masses of young, wide, non-magnetic white dwarf binaries in the Sloan Digital Sky Survey Data Release 7

Science.gov (United States)

Baxter, R. B.; Dobbie, P. D.; Parker, Q. A.; Casewell, S. L.; Lodieu, N.; Burleigh, M. R.; Lawrie, K. A.; Külebi, B.; Koester, D.; Holland, B. R.

2014-06-01

We present a spectroscopic component analysis of 18 candidate young, wide, non-magnetic, double-degenerate binaries identified from a search of the Sloan Digital Sky Survey Data Release 7 (DR7). All but two pairings are likely to be physical systems. We show SDSS J084952.47+471247.7 + SDSS J084952.87+471249.4 to be a wide DA + DB binary, only the second identified to date. Combining our measurements for the components of 16 new binaries with results for three similar, previously known systems within the DR7, we have constructed a mass distribution for the largest sample to date (38) of white dwarfs in young, wide, non-magnetic, double-degenerate pairings. This is broadly similar in form to that of the isolated field population with a substantial peak around M ˜ 0.6 M⊙. We identify an excess of ultramassive white dwarfs and attribute this to the primordial separation distribution of their progenitor systems peaking at relatively larger values and the greater expansion of their binary orbits during the final stages of stellar evolution. We exploit this mass distribution to probe the origins of unusual types of degenerates, confirming a mild preference for the progenitor systems of high-field-magnetic white dwarfs, at least within these binaries, to be associated with early-type stars. Additionally, we consider the 19 systems in the context of the stellar initial mass-final mass relation. None appear to be strongly discordant with current understanding of this relationship.

A new electromagnetic shock-wave generator "SLX-F2" with user-selectable dual focus size: ex vivo evaluation of renal injury.

Science.gov (United States)

Leistner, Rasmus; Wendt-Nordahl, Gunnar; Grobholz, Rainer; Michel, Maurice Stephan; Marlinghaus, Ernst; Köhrmann, Kai Uwe; Alken, Peter; Häcker, Axel

2007-08-01

Storz Medical AG (Kreutzlingen/Switzerland) has developed a new electromagnetic shockwave (SW) generator, the "SLX-F2", which allows the user to choose between a small-focus, high-pressure treatment regime or a wide-focus, low-pressure option. The aim of this study was to investigate, under standardized conditions, the impact of these two different treatment regimes on SW-induced renal injury. SW-induced renal injury was investigated by using the standardized model of the perfused ex vivo kidney. SWs were applied under ultrasound control in the parenchyma of a kidney pole. Different SW numbers (20, 50, 125, 250, 500, 1,000) were applied in three groups: group A was treated with a wider focus (80 MPa), groups B (60 MPa) and C (120 MPa) with a smaller focus (each parameter setting was repeated ten-fold). Disintegration capacity (measured by crater volume in cubes of plaster of Paris) was the same in groups A and C. After SW exposure, barium sulphate suspension was perfused through the renal artery. The maximum diameter (mm) of the extravasation in the cortex, representing the extent of vascular injury, was measured on X-ray mammography films. H&E staining was performed. In all three groups (A, B, C) a higher number of SWs caused the diameter of the extravasate to increase, with statistical significance appearing at 1,000 shots versus 20 shots (p generator at the same peak positive pressure and disintegration power. This confirms the in vivo findings that show renal injury caused by SW as being related to the number of SWs administered. Clinical studies are needed to investigate whether there is any advantage to offering both treatment regimes in one SW machine-for example, by using the "wide-focus, low-pressure" option for kidney stones and the "small-focus, high-pressure" regimen for stones in the ureter. The renal injury caused by either regime remains comparable.

Whole-exome sequencing of a rare case of familial childhood acute lymphoblastic leukemia reveals putative predisposing mutations in Fanconi anemia genes.

Science.gov (United States)

Spinella, Jean-François; Healy, Jasmine; Saillour, Virginie; Richer, Chantal; Cassart, Pauline; Ouimet, Manon; Sinnett, Daniel

2015-07-23

Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. While the multi-step model of pediatric leukemogenesis suggests interplay between constitutional and somatic genomes, the role of inherited genetic variability remains largely undescribed. Nonsyndromic familial ALL, although extremely rare, provides the ideal setting to study inherited contributions to ALL. Toward this goal, we sequenced the exomes of a childhood ALL family consisting of mother, father and two non-twinned siblings diagnosed with concordant pre-B hyperdiploid ALL and previously shown to have inherited a rare form of PRDM9, a histone H3 methyltransferase involved in crossing-over at recombination hotspots and Holliday junctions. We postulated that inheritance of additional rare disadvantaging variants in predisposing cancer genes could affect genomic stability and lead to increased risk of hyperdiploid ALL within this family. Whole exomes were captured using Agilent's SureSelect kit and sequenced on the Life Technologies SOLiD System. We applied a data reduction strategy to identify candidate variants shared by both affected siblings. Under a recessive disease model, we focused on rare non-synonymous or frame-shift variants in leukemia predisposing pathways. Though the family was nonsyndromic, we identified a combination of rare variants in Fanconi anemia (FA) genes FANCP/SLX4 (compound heterozygote - rs137976282/rs79842542) and FANCA (rs61753269) and a rare homozygous variant in the Holliday junction resolvase GEN1 (rs16981869). These variants, predicted to affect protein function, were previously identified in familial breast cancer cases. Based on our in-house database of 369 childhood ALL exomes, the sibs were the only patients to carry this particularly rare combination and only a single hyperdiploid patient was heterozygote at both FANCP/SLX4 positions, while no FANCA variant allele carriers were identified. FANCA is the most commonly mutated gene in FA and is essential for

Binary Systems and the Initial Mass Function

Science.gov (United States)

Malkov, O. Yu.

2017-07-01

In the present paper we discuss advantages and disadvantages of binary stars, which are important for star formation history determination. We show that to make definite conclusions of the initial mass function shape, it is necessary to study binary population well enough to correct the luminosity function for unresolved binaries; to construct the mass-luminosity relation based on wide binaries data, and to separate observational mass functions of primaries, of secondaries, and of unresolved binaries.

Spatially Resolved Imaging and Spectroscopy of Candidate Dual Active Galactic Nuclei

Science.gov (United States)

McGurk, R. C.; Max, C. E.; Medling, A. M.; Shields, G. A.; Comerford, J. M.

2015-09-01

When galaxies merge, both central supermassive black holes are immersed in a dense and chaotic environment. If there is sufficient gas in the nuclear regions, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O iii] emission lines has been proposed as a technique to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O iii] emitting AGNs from Sloan Digital Sky Survey (SDSS) DR7. By obtaining new and archival high spatial resolution images taken with the Keck II Laser Guide Star Adaptive Optics system and the near-infrared camera NIRC2, we show that 30% of 140 double-peaked [O iii] emission line SDSS AGNs have two spatial components within a 3″ radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up three spatially double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and 10 candidates with long-slit spectroscopy from the Shane Kast Double Spectrograph at Lick Observatory. We find that the double-peaked emission lines in our sample of 12 candidates are caused by: one dual AGN (SDSS J114642.47+511029.6), one confirmed outflow and four likely outflows, two pairs of star-forming galaxies, one candidate indeterminate due to sky line interference, and three AGNs with spatially coincident double [O iii] peaks, likely due to unresolved complex narrow line kinematics, outflows, binary AGN, or small-scale jets.

SPATIALLY RESOLVED IMAGING AND SPECTROSCOPY OF CANDIDATE DUAL ACTIVE GALACTIC NUCLEI

Energy Technology Data Exchange (ETDEWEB)

McGurk, R. C.; Max, C. E. [Astronomy Department and UCO-Lick Observatory, University of California, Santa Cruz, CA 95064 (United States); Medling, A. M. [Research School of Astronomy and Astrophysics, Australian National University, Mount Stromlo Observatory, Cotter Road, Weston Creek, ACT 2611 (Australia); Shields, G. A. [Laguna Falls Institute for Astrophysics, Austin, TX 78746 (United States); Comerford, J. M., E-mail: rosalie.mcgurk@gmail.com, E-mail: max@ucolick.org, E-mail: anne.medling@anu.edu.au, E-mail: shields@lfastro.org, E-mail: julie.comerford@colorado.edu [Department of Astrophysical and Planetary Sciences, University of Colorado, Boulder, CO 80309 (United States)

2015-09-20

When galaxies merge, both central supermassive black holes are immersed in a dense and chaotic environment. If there is sufficient gas in the nuclear regions, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O iii] emission lines has been proposed as a technique to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O iii] emitting AGNs from Sloan Digital Sky Survey (SDSS) DR7. By obtaining new and archival high spatial resolution images taken with the Keck II Laser Guide Star Adaptive Optics system and the near-infrared camera NIRC2, we show that 30% of 140 double-peaked [O iii] emission line SDSS AGNs have two spatial components within a 3″ radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up three spatially double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and 10 candidates with long-slit spectroscopy from the Shane Kast Double Spectrograph at Lick Observatory. We find that the double-peaked emission lines in our sample of 12 candidates are caused by: one dual AGN (SDSS J114642.47+511029.6), one confirmed outflow and four likely outflows, two pairs of star-forming galaxies, one candidate indeterminate due to sky line interference, and three AGNs with spatially coincident double [O iii] peaks, likely due to unresolved complex narrow line kinematics, outflows, binary AGN, or small-scale jets.

SPATIALLY RESOLVED IMAGING AND SPECTROSCOPY OF CANDIDATE DUAL ACTIVE GALACTIC NUCLEI

International Nuclear Information System (INIS)

McGurk, R. C.; Max, C. E.; Medling, A. M.; Shields, G. A.; Comerford, J. M.

2015-01-01

When galaxies merge, both central supermassive black holes are immersed in a dense and chaotic environment. If there is sufficient gas in the nuclear regions, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O iii] emission lines has been proposed as a technique to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O iii] emitting AGNs from Sloan Digital Sky Survey (SDSS) DR7. By obtaining new and archival high spatial resolution images taken with the Keck II Laser Guide Star Adaptive Optics system and the near-infrared camera NIRC2, we show that 30% of 140 double-peaked [O iii] emission line SDSS AGNs have two spatial components within a 3″ radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up three spatially double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and 10 candidates with long-slit spectroscopy from the Shane Kast Double Spectrograph at Lick Observatory. We find that the double-peaked emission lines in our sample of 12 candidates are caused by: one dual AGN (SDSS J114642.47+511029.6), one confirmed outflow and four likely outflows, two pairs of star-forming galaxies, one candidate indeterminate due to sky line interference, and three AGNs with spatially coincident double [O iii] peaks, likely due to unresolved complex narrow line kinematics, outflows, binary AGN, or small-scale jets

Accuracy of binary black hole waveform models for aligned-spin binaries

Science.gov (United States)

Kumar, Prayush; Chu, Tony; Fong, Heather; Pfeiffer, Harald P.; Boyle, Michael; Hemberger, Daniel A.; Kidder, Lawrence E.; Scheel, Mark A.; Szilagyi, Bela

2016-05-01

Coalescing binary black holes are among the primary science targets for second generation ground-based gravitational wave detectors. Reliable gravitational waveform models are central to detection of such systems and subsequent parameter estimation. This paper performs a comprehensive analysis of the accuracy of recent waveform models for binary black holes with aligned spins, utilizing a new set of 84 high-accuracy numerical relativity simulations. Our analysis covers comparable mass binaries (mass-ratio 1 ≤q ≤3 ), and samples independently both black hole spins up to a dimensionless spin magnitude of 0.9 for equal-mass binaries and 0.85 for unequal mass binaries. Furthermore, we focus on the high-mass regime (total mass ≳50 M⊙ ). The two most recent waveform models considered (PhenomD and SEOBNRv2) both perform very well for signal detection, losing less than 0.5% of the recoverable signal-to-noise ratio ρ , except that SEOBNRv2's efficiency drops slightly for both black hole spins aligned at large magnitude. For parameter estimation, modeling inaccuracies of the SEOBNRv2 model are found to be smaller than systematic uncertainties for moderately strong GW events up to roughly ρ ≲15 . PhenomD's modeling errors are found to be smaller than SEOBNRv2's, and are generally irrelevant for ρ ≲20 . Both models' accuracy deteriorates with increased mass ratio, and when at least one black hole spin is large and aligned. The SEOBNRv2 model shows a pronounced disagreement with the numerical relativity simulation in the merger phase, for unequal masses and simultaneously both black hole spins very large and aligned. Two older waveform models (PhenomC and SEOBNRv1) are found to be distinctly less accurate than the more recent PhenomD and SEOBNRv2 models. Finally, we quantify the bias expected from all four waveform models during parameter estimation for several recovered binary parameters: chirp mass, mass ratio, and effective spin.

Radial Velocities of 41 Kepler Eclipsing Binaries

Science.gov (United States)

Matson, Rachel A.; Gies, Douglas R.; Guo, Zhao; Williams, Stephen J.

2017-12-01

Eclipsing binaries are vital for directly determining stellar parameters without reliance on models or scaling relations. Spectroscopically derived parameters of detached and semi-detached binaries allow us to determine component masses that can inform theories of stellar and binary evolution. Here we present moderate resolution ground-based spectra of stars in close binary systems with and without (detected) tertiary companions observed by NASA’s Kepler mission and analyzed for eclipse timing variations. We obtain radial velocities and spectroscopic orbits for five single-lined and 35 double-lined systems, and confirm one false positive eclipsing binary. For the double-lined spectroscopic binaries, we also determine individual component masses and examine the mass ratio {M}2/{M}1 distribution, which is dominated by binaries with like-mass pairs and semi-detached classical Algol systems that have undergone mass transfer. Finally, we constrain the mass of the tertiary component for five double-lined binaries with previously detected companions.

Planets in Binary Star Systems

CERN Document Server

Haghighipour, Nader

2010-01-01

The discovery of extrasolar planets over the past decade has had major impacts on our understanding of the formation and dynamical evolution of planetary systems. There are features and characteristics unseen in our solar system and unexplainable by the current theories of planet formation and dynamics. Among these new surprises is the discovery of planets in binary and multiple-star systems. The discovery of such "binary-planetary" systems has confronted astrodynamicists with many new challenges, and has led them to re-examine the theories of planet formation and dynamics. Among these challenges are: How are planets formed in binary star systems? What would be the notion of habitability in such systems? Under what conditions can binary star systems have habitable planets? How will volatiles necessary for life appear on such planets? This volume seeks to gather the current research in the area of planets in binary and multistar systems and to familiarize readers with its associated theoretical and observation...

Activity and Kinematics of White Dwarf-M Dwarf Binaries from the SUPERBLINK Proper Motion Survey

International Nuclear Information System (INIS)

Skinner, Julie N.; Morgan, Dylan P.; West, Andrew A.; Lépine, Sébastien; Thorstensen, John R.

2017-01-01

We present an activity and kinematic analysis of high proper motion white dwarf-M dwarf binaries (WD+dMs) found in the SUPERBLINK survey, 178 of which are new identifications. To identify WD+dMs, we developed a UV–optical–IR color criterion and conducted a spectroscopic survey to confirm each candidate binary. For the newly identified systems, we fit the two components using model white dwarf spectra and M dwarf template spectra to determine physical parameters. We use H α chromospheric emission to examine the magnetic activity of the M dwarf in each system, and investigate how its activity is affected by the presence of a white dwarf companion. We find that the fraction of WD+dM binaries with active M dwarfs is significantly higher than their single M dwarf counterparts at early and mid-spectral types. We corroborate previous studies that find high activity fractions at both close and intermediate separations. At more distant separations, the binary fraction appears to approach the activity fraction for single M dwarfs. Using derived radial velocities and the proper motions, we calculate 3D space velocities for the WD+dMs in SUPERBLINK. For the entire SUPERBLINK WD+dMs, we find a large vertical velocity dispersion, indicating a dynamically hotter population compared to high proper motion samples of single M dwarfs. We compare the kinematics for systems with active M dwarfs and those with inactive M dwarfs, and find signatures of asymmetric drift in the inactive sample, indicating that they are drawn from an older population.

Activity and Kinematics of White Dwarf-M Dwarf Binaries from the SUPERBLINK Proper Motion Survey

Energy Technology Data Exchange (ETDEWEB)

Skinner, Julie N. [Institute for Astrophysical Research, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Morgan, Dylan P.; West, Andrew A. [Department of Astronomy, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Lépine, Sébastien [Department of Physics and Astronomy, Georgia State University, 25 Park Place NE, Atlanta, GA, 30303 (United States); Thorstensen, John R., E-mail: jskinner@bu.edu [Department of Physics and Astronomy, 6127 Wilder Laboratory, Dartmouth College, Hanover, NH 03755 (United States)

2017-09-01

We present an activity and kinematic analysis of high proper motion white dwarf-M dwarf binaries (WD+dMs) found in the SUPERBLINK survey, 178 of which are new identifications. To identify WD+dMs, we developed a UV–optical–IR color criterion and conducted a spectroscopic survey to confirm each candidate binary. For the newly identified systems, we fit the two components using model white dwarf spectra and M dwarf template spectra to determine physical parameters. We use H α chromospheric emission to examine the magnetic activity of the M dwarf in each system, and investigate how its activity is affected by the presence of a white dwarf companion. We find that the fraction of WD+dM binaries with active M dwarfs is significantly higher than their single M dwarf counterparts at early and mid-spectral types. We corroborate previous studies that find high activity fractions at both close and intermediate separations. At more distant separations, the binary fraction appears to approach the activity fraction for single M dwarfs. Using derived radial velocities and the proper motions, we calculate 3D space velocities for the WD+dMs in SUPERBLINK. For the entire SUPERBLINK WD+dMs, we find a large vertical velocity dispersion, indicating a dynamically hotter population compared to high proper motion samples of single M dwarfs. We compare the kinematics for systems with active M dwarfs and those with inactive M dwarfs, and find signatures of asymmetric drift in the inactive sample, indicating that they are drawn from an older population.

Theoretical studies of binaries in astrophysics

Science.gov (United States)

Dischler, Johann Sebastian

This thesis introduces and summarizes four papers dealing with computer simulations of astrophysical processes involving binaries. The first part gives the rational and theoretical background to these papers. In paper I and II a statistical approach to studying eclipsing binaries is described. By using population synthesis models for binaries the probabilities for eclipses are calculated for different luminosity classes of binaries. These are compared with Hipparcos data and they agree well if one uses a standard input distribution for the orbit sizes. If one uses a random pairing model, where both companions are independently picked from an IMF, one finds too feclipsing binaries by an order of magnitude. In paper III we investigate a possible scenario for the origin of the stars observed close to the centre of our galaxy, called S stars. We propose that a cluster falls radially cowards the central black hole. The binaries within the cluster can then, if they have small impact parameters, be broken up by the black hole's tidal held and one of the components of the binary will be captured by the black hole. Paper IV investigates how the onset of mass transfer in eccentric binaries depends on the eccentricity. To do this we have developed a new two-phase SPH scheme where very light particles are at tire outer edge of our simulated star. This enables us to get a much better resolution of the very small mass that is transferred in close binaries. Our simulations show that the minimum required distance between the stars to have mass transfer decreases with the eccentricity.

Mining frequent binary expressions

NARCIS (Netherlands)

Calders, T.; Paredaens, J.; Kambayashi, Y.; Mohania, M.K.; Tjoa, A.M.

2000-01-01

In data mining, searching for frequent patterns is a common basic operation. It forms the basis of many interesting decision support processes. In this paper we present a new type of patterns, binary expressions. Based on the properties of a specified binary test, such as reflexivity, transitivity

Survival of planets around shrinking stellar binaries.

Science.gov (United States)

Muñoz, Diego J; Lai, Dong

2015-07-28

The discovery of transiting circumbinary planets by the Kepler mission suggests that planets can form efficiently around binary stars. None of the stellar binaries currently known to host planets has a period shorter than 7 d, despite the large number of eclipsing binaries found in the Kepler target list with periods shorter than a few days. These compact binaries are believed to have evolved from wider orbits into their current configurations via the so-called Lidov-Kozai migration mechanism, in which gravitational perturbations from a distant tertiary companion induce large-amplitude eccentricity oscillations in the binary, followed by orbital decay and circularization due to tidal dissipation in the stars. Here we explore the orbital evolution of planets around binaries undergoing orbital decay by this mechanism. We show that planets may survive and become misaligned from their host binary, or may develop erratic behavior in eccentricity, resulting in their consumption by the stars or ejection from the system as the binary decays. Our results suggest that circumbinary planets around compact binaries could still exist, and we offer predictions as to what their orbital configurations should be like.

Close-binary central stars of planetary nebulae

International Nuclear Information System (INIS)

Bond, H.E.; Grauer, A.D.

1987-01-01

Recent observations of PN central stars identified as binary systems are reviewed. The theoretical significance of binary central stars is discussed, and the characteristics of UU Sge, V 477 Lyr, MT Ser, LSS 2018, VW Pyx, and the central star of HFG 1 are briefly summarized. All of these binaries are shown to have periods less than 1 day, and it is estimated that about 10 percent of all binary central stars are close binaries. 27 references

Bondi-Hoyle-Lyttleton Accretion onto Binaries

Science.gov (United States)

Antoni, Andrea; MacLeod, Morgan; Ramírez-Ruiz, Enrico

2018-01-01

Binary stars are not rare. While only close binary stars will eventually interact with one another, even the widest binary systems interact with their gaseous surroundings. The rates of accretion and the gaseous drag forces arising in these interactions are the key to understanding how these systems evolve. This poster examines accretion flows around a binary system moving supersonically through a background gas. We perform three-dimensional hydrodynamic simulations of Bondi-Hoyle-Lyttleton accretion using the adaptive mesh refinement code FLASH. We simulate a range of values of semi-major axis of the orbit relative to the gravitational focusing impact parameter of the pair. On large scales, gas is gravitationally focused by the center-of-mass of the binary, leading to dynamical friction drag and to the accretion of mass and momentum. On smaller scales, the orbital motion imprints itself on the gas. Notably, the magnitude and direction of the forces acting on the binary inherit this orbital dependence. The long-term evolution of the binary is determined by the timescales for accretion, slow down of the center-of-mass, and decay of the orbit. We use our simulations to measure these timescales and to establish a hierarchy between them. In general, our simulations indicate that binaries moving through gaseous media will slow down before the orbit decays.

Derivation of induced pluripotent stem cells from a familial Alzheimer's disease patient carrying the L282F mutation in presenilin 1

DEFF Research Database (Denmark)

Poon, Anna Fong-Yee; Li, Tong; Pires, Carlota

2016-01-01

Mutations in presenilin 1 (PSEN1) lead to the most aggressive form of familial Alzheimer's disease (AD). Human induced pluripotent stem cells (hiPSCs) derived from AD patients can be differentiated and used for disease modeling. Here, we derived hiPSC from skin fibroblasts obtained from an AD...... patient carrying a L282F mutation in PSEN1. We transfected skin fibroblasts with episomal iPSC reprogramming vectors targeting human OCT4, SOX2, L-MYC, KLF4, NANOG, LIN28, and short hairpin RNA against TP53. Our hiPSC line, L282F-hiPSC, displayed typical stem cell characteristics with consistent...... expression of pluripotency genes and the ability to differentiation into the three germ layers....

Baryons in the relativistic jets of the stellar-mass black-hole candidate 4U 1630-47.

Science.gov (United States)

Trigo, María Díaz; Miller-Jones, James C A; Migliari, Simone; Broderick, Jess W; Tzioumis, Tasso

2013-12-12

Accreting black holes are known to power relativistic jets, both in stellar-mass binary systems and at the centres of galaxies. The power carried away by the jets, and, hence, the feedback they provide to their surroundings, depends strongly on their composition. Jets containing a baryonic component should carry significantly more energy than electron-positron jets. Energetic considerations and circular-polarization measurements have provided conflicting circumstantial evidence for the presence or absence of baryons in jets, and the only system in which they have been unequivocally detected is the peculiar X-ray binary SS 433 (refs 4, 5). Here we report the detection of Doppler-shifted X-ray emission lines from a more typical black-hole candidate X-ray binary, 4U 1630-47, coincident with the reappearance of radio emission from the jets of the source. We argue that these lines arise from baryonic matter in a jet travelling at approximately two-thirds the speed of light, thereby establishing the presence of baryons in the jet. Such baryonic jets are more likely to be powered by the accretion disk than by the spin of the black hole, and if the baryons can be accelerated to relativistic speeds, the jets should be strong sources of γ-rays and neutrino emission.

Formation and Evolution of X-ray Binaries

Science.gov (United States)

Shao, Y.

2017-07-01

X-ray binaries are a class of binary systems, in which the accretor is a compact star (i.e., black hole, neutron star, or white dwarf). They are one of the most important objects in the universe, which can be used to study not only binary evolution but also accretion disks and compact stars. Statistical investigations of these binaries help to understand the formation and evolution of galaxies, and sometimes provide useful constraints on the cosmological models. The goal of this thesis is to investigate the formation and evolution processes of X-ray binaries including Be/X-ray binaries, low-mass X-ray binaries (LMXBs), ultraluminous X-ray sources (ULXs), and cataclysmic variables. In Chapter 1 we give a brief review on the basic knowledge of the binary evolution. In Chapter 2 we discuss the formation of Be stars through binary interaction. In this chapter we investigate the formation of Be stars resulting from mass transfer in binaries in the Galaxy. Using binary evolution and population synthesis calculations, we find that in Be/neutron star binaries the Be stars have a lower limit of mass ˜ 8 M⊙ if they are formed by a stable (i.e., without the occurrence of common envelope evolution) and nonconservative mass transfer. We demonstrate that the isolated Be stars may originate from both mergers of two main-sequence stars and disrupted Be binaries during the supernova explosions of the primary stars, but mergers seem to play a much more important role. Finally the fraction of Be stars produced by binary interactions in all B type stars can be as high as ˜ 13%-30% , implying that most of Be stars may result from binary interaction. In Chapter 3 we show the evolution of intermediate- and low-mass X-ray binaries (I/LMXBs) and the formation of millisecond pulsars. Comparing the calculated results with the observations of binary radio pulsars, we report the following results: (1) The allowed parameter space for forming binary pulsars in the initial orbital period

Modelling binary data

CERN Document Server

Collett, David

2002-01-01

INTRODUCTION Some Examples The Scope of this Book Use of Statistical Software STATISTICAL INFERENCE FOR BINARY DATA The Binomial Distribution Inference about the Success Probability Comparison of Two Proportions Comparison of Two or More Proportions MODELS FOR BINARY AND BINOMIAL DATA Statistical Modelling Linear Models Methods of Estimation Fitting Linear Models to Binomial Data Models for Binomial Response Data The Linear Logistic Model Fitting the Linear Logistic Model to Binomial Data Goodness of Fit of a Linear Logistic Model Comparing Linear Logistic Models Linear Trend in Proportions Comparing Stimulus-Response Relationships Non-Convergence and Overfitting Some other Goodness of Fit Statistics Strategy for Model Selection Predicting a Binary Response Probability BIOASSAY AND SOME OTHER APPLICATIONS The Tolerance Distribution Estimating an Effective Dose Relative Potency Natural Response Non-Linear Logistic Regression Models Applications of the Complementary Log-Log Model MODEL CHECKING Definition of Re...

Formation and evolution of compact binaries

NARCIS (Netherlands)

Sluijs, Marcel Vincent van der

2006-01-01

In this thesis we investigate the formation and evolution of compact binaries. Chapters 2 through 4 deal with the formation of luminous, ultra-compact X-ray binaries in globular clusters. We show that the proposed scenario of magnetic capture produces too few ultra-compact X-ray binaries to explain

Do stellar clusters form fewer binaries? Using moderate separation binaries to distinguish between nature and nurture

Science.gov (United States)

Reiter, Megan

2017-08-01

Fewer wide-separation binaries are found in dense stellar clusters than in looser stellar associations. It is therefore unclear whether feedback in clusters prevents the formation of multiple systems or dynamical interactions destroy them. Measuring the prevalence of close, bound binary systems provide a key test to distinguish between these possibilities. Systems with separations of 10-50 AU will survive interactions in the cluster environment, and therefore are more representative of the natal population of multiple systems. By fitting a double-star PSF, we will identify visual binaries in the Orion Nebula with separations as small as 0.03. At the distance of Orion, this corresponds to a physical separation of 12 AU, effectively closing the observational gap in the binary separation distribution left between known visual and spectroscopic binaries (>65 AU or PhD thesis.

High-energy observations of the state transition of the X-ray nova and black hole candidate XTE J1720-318

DEFF Research Database (Denmark)

Bel, M.C.; Rodriguez, J.; Sizun, P.

2004-01-01

We report the results of extensive high-energy observations of the X-ray transient and black hole candidate XTE J1720-318 performed with INTEGRAL, XMM-Newton and RXTE. The source, which underwent an X-ray outburst in 2003 January, was observed in February in a spectral state dominated by a soft......, typical of a black-hole binary in the so-called High/Soft State. We then followed the evolution of the source outburst over several months using the INTEGRAL Galactic Centre survey observations. The source became active again at the end of March: it showed a clear transition towards a much harder state...... of the black hole X-ray novae class which populate our galactic bulge and we discuss its properties in the frame of the spectral models used for transient black hole binaries....

Origin of very-short orbital-period binary systems

International Nuclear Information System (INIS)

Miyaji, S.

1983-01-01

Recent observations of four close binaries have established that there is a group of very-short orbital-period (VSOP) binaries whose orbital periods are less than 60 minutes. The VSOP binaries consist of both X-ray close binaries and cataclysmic variables. Their orbital periods are too short to have a main-sequence companion. However, four binaries, none of which belongs to any globular cluster, are too abundant to be explained by the capturing mechanism of a white dwarf. Therefore it seemed to be worthwhile to present an evolutionary scenario from an original binary system which can be applied for all VSOP binaries. (Auth.)

Separation in 5 Msun Binaries

Science.gov (United States)

Evans, Nancy R.; Bond, H. E.; Schaefer, G.; Mason, B. D.; Karovska, M.; Tingle, E.

2013-01-01

Cepheids (5 Msun stars) provide an excellent sample for determining the binary properties of fairly massive stars. International Ultraviolet Explorer (IUE) observations of Cepheids brighter than 8th magnitude resulted in a list of ALL companions more massive than 2.0 Msun uniformly sensitive to all separations. Hubble Space Telescope Wide Field Camera 3 (WFC3) has resolved three of these binaries (Eta Aql, S Nor, and V659 Cen). Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations for a sample of 18 Cepheids, and also a distribution of mass ratios. The distribution of orbital periods shows that the 5 Msun binaries prefer shorter periods than 1 Msun stars, reflecting differences in star formation processes.

HFE C282Y/H63D compound heterozygotes are at low risk of hemochromatosis-related morbidity.

Science.gov (United States)

Gurrin, Lyle C; Bertalli, Nadine A; Dalton, Gregory W; Osborne, Nicholas J; Constantine, Clare C; McLaren, Christine E; English, Dallas R; Gertig, Dorota M; Delatycki, Martin B; Nicoll, Amanda J; Southey, Melissa C; Hopper, John L; Giles, Graham G; Anderson, Gregory J; Olynyk, John K; Powell, Lawrie W; Allen, Katrina J

2009-07-01

The risk of hemochromatosis-related morbidity is unknown among HFE compound heterozygotes (C282Y/H63D). We used a prospective population-based cohort study to estimate the prevalence of elevated iron indices and hemochromatosis-related morbidity for compound heterozygotes. In all, 31,192 subjects of northern European descent were genotyped for HFE C282Y and H63D. An HFE-genotype stratified random sample of 1,438 subjects, followed for an average of 12 years to a mean age of 65 years, completed questionnaires and gave blood. Clinical examinations were blinded to HFE genotype. A total of 180 (84 males) clinically examined C282Y/H63D participants were compared with 330 (149 males) controls with neither HFE mutation; 132 (65 males) and 270 (122 males), respectively, had serum iron measures at both timepoints. Mean serum ferritin (SF) and transferrin saturation (TS) were significantly greater for male and female compound heterozygotes than for wild-types at baseline and follow-up (all P females who were premenopausal at baseline, where SF was similar in both genotype groups. For subjects with serum measures from both baseline and follow-up, mean SF and TS levels did not change significantly for men or for postmenopausal women, but for premenopausal women SF levels increased from 43 to 109 microg/L for compound heterozygotes and from 35 to 64 microg/L for wild-types (both P female compound heterozygotes had a similar prevalence of hemochromatosis-related morbidity to wild-types. One of 82 males and zero of 95 females had documented iron overload-related disease. For male compound heterozygotes, mean iron indices do not change during middle age but for female compound heterozygotes menopause results in increased mean SF. Although compound heterozygotes might maintain elevated iron indices during middle age, documented iron overload-related disease is rare.

Astronomy of binary and multiple stars

International Nuclear Information System (INIS)

Tokovinin, A.A.

1984-01-01

Various types of binary stars and methods for their observation are described in a popular form. Some models of formation and evolution of binary and multiple star systems are presented. It is concluded that formation of binary and multiple stars is a regular stage in the process of star production

NuSTAR Hard X-Ray Observation of the Gamma-Ray Binary Candidate HESS J1832–093

DEFF Research Database (Denmark)

Mori, Kaya; Gotthelf, E. V.; Hailey, Charles J.

2017-01-01

−093, is detected up to ~30 keV and is well-described by an absorbed power-law model with a best-fit photon index . A re-analysis of archival Chandra and XMM-Newton data finds that the long-term X-ray flux increase of XMMU J183245−0921539 is (90% C.L.), much less than previously reported. A search for a pulsar spin...... of XMMU J183245−0921539 are most consistent with a non-accreting binary generating synchrotron X-rays from particle acceleration in the shock formed as a result of the pulsar and stellar wind collision. We also report on three nearby hard X-ray sources, one of which may be associated with diffuse emission...

A ROSAT Survey of Contact Binary Stars

Science.gov (United States)

Geske, M. T.; Gettel, S. J.; McKay, T. A.

2006-01-01

Contact binary stars are common variable stars that are all believed to emit relatively large fluxes of X-rays. In this work we combine a large new sample of contact binary stars derived from the ROTSE-I telescope with X-ray data from the ROSAT All Sky Survey (RASS) to estimate the X-ray volume emissivity of contact binary stars in the Galaxy. We obtained X-ray fluxes for 140 contact binaries from the RASS, as well as two additional stars observed by the XMM-Newton observatory. From these data we confirm the emission of X-rays from all contact binary systems, with typical luminosities of approximately 1.0×1030 ergs s-1. Combining calculated luminosities with an estimated contact binary space density, we find that contact binaries do not have strong enough X-ray emission to account for a significant portion of the Galactic X-ray background.

GALAXY ROTATION AND RAPID SUPERMASSIVE BINARY COALESCENCE

Energy Technology Data Exchange (ETDEWEB)

Holley-Bockelmann, Kelly [Vanderbilt University, Nashville, TN (United States); Khan, Fazeel Mahmood, E-mail: k.holley@vanderbilt.edu [Institute of Space Technology (IST), Islamabad (Pakistan)

2015-09-10

Galaxy mergers usher the supermassive black hole (SMBH) in each galaxy to the center of the potential, where they form an SMBH binary. The binary orbit shrinks by ejecting stars via three-body scattering, but ample work has shown that in spherical galaxy models, the binary separation stalls after ejecting all the stars in its loss cone—this is the well-known final parsec problem. However, it has been shown that SMBH binaries in non-spherical galactic nuclei harden at a nearly constant rate until reaching the gravitational wave regime. Here we use a suite of direct N-body simulations to follow SMBH binary evolution in both corotating and counterrotating flattened galaxy models. For N > 500 K, we find that the evolution of the SMBH binary is convergent and is independent of the particle number. Rotation in general increases the hardening rate of SMBH binaries even more effectively than galaxy geometry alone. SMBH binary hardening rates are similar for co- and counterrotating galaxies. In the corotating case, the center of mass of the SMBH binary settles into an orbit that is in corotation resonance with the background rotating model, and the coalescence time is roughly a few 100 Myr faster than a non-rotating flattened model. We find that counterrotation drives SMBHs to coalesce on a nearly radial orbit promptly after forming a hard binary. We discuss the implications for gravitational wave astronomy, hypervelocity star production, and the effect on the structure of the host galaxy.

GALAXY ROTATION AND RAPID SUPERMASSIVE BINARY COALESCENCE

International Nuclear Information System (INIS)

Holley-Bockelmann, Kelly; Khan, Fazeel Mahmood

2015-01-01

Galaxy mergers usher the supermassive black hole (SMBH) in each galaxy to the center of the potential, where they form an SMBH binary. The binary orbit shrinks by ejecting stars via three-body scattering, but ample work has shown that in spherical galaxy models, the binary separation stalls after ejecting all the stars in its loss cone—this is the well-known final parsec problem. However, it has been shown that SMBH binaries in non-spherical galactic nuclei harden at a nearly constant rate until reaching the gravitational wave regime. Here we use a suite of direct N-body simulations to follow SMBH binary evolution in both corotating and counterrotating flattened galaxy models. For N > 500 K, we find that the evolution of the SMBH binary is convergent and is independent of the particle number. Rotation in general increases the hardening rate of SMBH binaries even more effectively than galaxy geometry alone. SMBH binary hardening rates are similar for co- and counterrotating galaxies. In the corotating case, the center of mass of the SMBH binary settles into an orbit that is in corotation resonance with the background rotating model, and the coalescence time is roughly a few 100 Myr faster than a non-rotating flattened model. We find that counterrotation drives SMBHs to coalesce on a nearly radial orbit promptly after forming a hard binary. We discuss the implications for gravitational wave astronomy, hypervelocity star production, and the effect on the structure of the host galaxy

Hidden slow pulsars in binaries

Science.gov (United States)

Tavani, Marco; Brookshaw, Leigh

1993-01-01

The recent discovery of the binary containing the slow pulsar PSR 1718-19 orbiting around a low-mass companion star adds new light on the characteristics of binary pulsars. The properties of the radio eclipses of PSR 1718-19 are the most striking observational characteristics of this system. The surface of the companion star produces a mass outflow which leaves only a small 'window' in orbital phase for the detection of PSR 1718-19 around 400 MHz. At this observing frequency, PSR 1718-19 is clearly observable only for about 1 hr out of the total 6.2 hr orbital period. The aim of this Letter is twofold: (1) to model the hydrodynamical behavior of the eclipsing material from the companion star of PSR 1718-19 and (2) to argue that a population of binary slow pulsars might have escaped detection in pulsar surveys carried out at 400 MHz. The possible existence of a population of partially or totally hidden slow pulsars in binaries will have a strong impact on current theories of binary evolution of neutron stars.

Perceptual biases for rhythm: The Mismatch Negativity latency indexes the privileged status of binary vs non-binary interval ratios.

Science.gov (United States)

Pablos Martin, X; Deltenre, P; Hoonhorst, I; Markessis, E; Rossion, B; Colin, C

2007-12-01

Rhythm perception appears to be non-linear as human subjects are better at discriminating, categorizing and reproducing rhythms containing binary vs non-binary (e.a. 1:2 vs 1:3) as well as metrical vs non-metrical (e.a. 1:2 vs 1:2.5) interval ratios. This study examined the representation of binary and non-binary interval ratios within the sensory memory, thus yielding a truly sensory, pre-motor, attention-independent neural representation of rhythmical intervals. Five interval ratios, one binary, flanked by four non-binary ones, were compared on the basis of the MMN they evoked when contrasted against a common standard interval. For all five intervals, the larger the contrast was, the larger the MMN amplitude was. The binary interval evoked a significantly much shorter (by at least 23 ms) MMN latency than the other intervals, whereas no latency difference was observed between the four non-binary intervals. These results show that the privileged perceptual status of binary rhythmical intervals is already present in the sensory representations found in echoic memory at an early, automatic, pre-perceptual and pre-motor level. MMN latency can be used to study rhythm perception at a truly sensory level, without any contribution from the motor system.

SECULAR EVOLUTION OF BINARIES NEAR MASSIVE BLACK HOLES: FORMATION OF COMPACT BINARIES, MERGER/COLLISION PRODUCTS AND G2-LIKE OBJECTS

International Nuclear Information System (INIS)

Prodan, Snezana; Antonini, Fabio; Perets, Hagai B.

2015-01-01

Here we discuss the evolution of binaries around massive black holes (MBHs) in nuclear stellar clusters. We focus on their secular evolution due to the perturbation by the MBHs, while simplistically accounting for their collisional evolution. Binaries with highly inclined orbits with respect to their orbits around MBHs are strongly affected by secular processes, which periodically change their eccentricities and inclinations (e.g., Kozai-Lidov cycles). During periapsis approach, dissipative processes such as tidal friction may become highly efficient, and may lead to shrinkage of a binary orbit and even to its merger. Binaries in this environment can therefore significantly change their orbital evolution due to the MBH third-body perturbative effects. Such orbital evolution may impinge on their later stellar evolution. Here we follow the secular dynamics of such binaries and its coupling to tidal evolution, as well as the stellar evolution of such binaries on longer timescales. We find that stellar binaries in the central parts of nuclear stellar clusters (NSCs) are highly likely to evolve into eccentric and/or short-period binaries, and become strongly interacting binaries either on the main sequence (at which point they may even merge), or through their later binary stellar evolution. The central parts of NSCs therefore catalyze the formation and evolution of strongly interacting binaries, and lead to the enhanced formation of blue stragglers, X-ray binaries, gravitational wave sources, and possible supernova progenitors. Induced mergers/collisions may also lead to the formation of G2-like cloud-like objects such as the one recently observed in the Galactic center

Galactic binaries with eLISA

OpenAIRE

Nelemans, G.

2013-01-01

I review what eLISA will see from Galactic binaries -- double stars with orbital periods less than a few hours and white dwarf (or neutron star/black hole) components. I discuss the currently known binaries that are guaranteed (or verification) sources and explain why the expected total number of eLISA Galactic binaries is several thousand, even though there are large uncertainties in our knowledge of this population, in particular that of the interacting AM CVn systems. I very briefly sketch...

The origin of the RS CVn binaries

International Nuclear Information System (INIS)

Biermann, P.

1976-01-01

Six possible origins for the RS CVn binaries are considered based on the following possibilities. RS CVn binaries might now be either pre-main-sequence or post-main-sequence. A pre-main-sequence binary might not always have been a binary but might have resulted from fission of a rapidly rotating single pre-main-sequence star. The main-sequence counterparts might be either single stars or binaries. To decide which of the six origins is possible, the following observed data for the RS CVn binaries are considered: total mass, total angular momentum, lack of observed connection with regions of star formation, large space density, kinematical age, and the visual companion of WW Dra. In addition lifetimes and space densities of single stars and other types of binaries are considered. The only origin possible is that the RS CVn binaries are in a thermal phase following fission of a main-sequence single star. In this explanation the single star had a rapidly rotating core which became unstable due to the core contraction which made it begin to evolve off the main sequence. The present Be stars might be examples of such parent single stars. (Auth.)

Evolution of dwarf binaries

International Nuclear Information System (INIS)

Tutukov, A.V.; Fedorova, A.V.; Yungel'son, L.R.

1982-01-01

The conditions of mass exchange in close binary systems with masses of components less or equal to one solar mass have been analysed for the case, when the system radiates gravitational waves. It has been shown that the mass exchange rate depends in a certain way on the mass ratio of components and on the mass of component that fills its inner critical lobe. The comparison of observed periods, masses of contact components, and mass exchange rates of observed cataclysmic binaries have led to the conclusion that the evolution of close binaries WZ Sge, OY Car, Z Cha, TT Ari, 2A 0311-227, and G 61-29 may be driven by the emission of gravitational waves [ru

EMISSION SIGNATURES FROM SUB-PARSEC BINARY SUPERMASSIVE BLACK HOLES. I. DIAGNOSTIC POWER OF BROAD EMISSION LINES

Energy Technology Data Exchange (ETDEWEB)

Nguyen, Khai; Bogdanović, Tamara [Center for Relativistic Astrophysics, School of Physics, Georgia Institute of Technology, Atlanta GA 30332 (United States)

2016-09-10

Motivated by advances in observational searches for sub-parsec supermassive black hole binaries (SBHBs) made in the past few years, we develop a semi-analytic model to describe spectral emission-line signatures of these systems. The goal of this study is to aid the interpretation of spectroscopic searches for binaries and to help test one of the leading models of binary accretion flows in the literature: SBHB in a circumbinary disk. In this work, we present the methodology and a comparison of the preliminary model with the data. We model SBHB accretion flows as a set of three accretion disks: two mini-disks that are gravitationally bound to the individual black holes and a circumbinary disk. Given a physically motivated parameter space occupied by sub-parsec SBHBs, we calculate a synthetic database of nearly 15 million broad optical emission-line profiles and explore the dependence of the profile shapes on characteristic properties of SBHBs. We find that the modeled profiles show distinct statistical properties as a function of the semimajor axis, mass ratio, eccentricity of the binary, and the degree of alignment of the triple disk system. This suggests that the broad emission-line profiles from SBHB systems can in principle be used to infer the distribution of these parameters and as such merit further investigation. Calculated profiles are more morphologically heterogeneous than the broad emission lines in observed SBHB candidates and we discuss improved treatment of radiative transfer effects, which will allow a direct statistical comparison of the two groups.

EMISSION SIGNATURES FROM SUB-PARSEC BINARY SUPERMASSIVE BLACK HOLES. I. DIAGNOSTIC POWER OF BROAD EMISSION LINES

International Nuclear Information System (INIS)

Nguyen, Khai; Bogdanović, Tamara

2016-01-01

Motivated by advances in observational searches for sub-parsec supermassive black hole binaries (SBHBs) made in the past few years, we develop a semi-analytic model to describe spectral emission-line signatures of these systems. The goal of this study is to aid the interpretation of spectroscopic searches for binaries and to help test one of the leading models of binary accretion flows in the literature: SBHB in a circumbinary disk. In this work, we present the methodology and a comparison of the preliminary model with the data. We model SBHB accretion flows as a set of three accretion disks: two mini-disks that are gravitationally bound to the individual black holes and a circumbinary disk. Given a physically motivated parameter space occupied by sub-parsec SBHBs, we calculate a synthetic database of nearly 15 million broad optical emission-line profiles and explore the dependence of the profile shapes on characteristic properties of SBHBs. We find that the modeled profiles show distinct statistical properties as a function of the semimajor axis, mass ratio, eccentricity of the binary, and the degree of alignment of the triple disk system. This suggests that the broad emission-line profiles from SBHB systems can in principle be used to infer the distribution of these parameters and as such merit further investigation. Calculated profiles are more morphologically heterogeneous than the broad emission lines in observed SBHB candidates and we discuss improved treatment of radiative transfer effects, which will allow a direct statistical comparison of the two groups.

Spectroscopic monitoring of bright A-F type candidate hybrid stars discovered by the Kepler mission

Science.gov (United States)

Lampens, Patricia; Frémat, Y.; Vermeylen, Lore; De Cat, Peter; Dumortier, Louis; Sódor, Ádám; Sharka, Marek; Bognár, Zsófia

2018-04-01

We report on a study of 250 optical spectra for 50 bright A/F-type candidate hybrid pulsating stars from the Kepler field. Most of the spectra have been collected with the high-resolution spectrograph HERMES attached to the Mercator telescope, La Palma. We determined the radial velocities (RVs), projected rotational velocities, fundamental atmospheric parameters and provide a classification based on the appearance of the cross-correlation profiles and the behaviour of the RVs with time in order to find true hybrid pulsators. Additionally, we also detected new spectroscopic binary and multiple systems in our sample and determined the fraction of spectroscopic systems. In order to be able to extend this investigation to the fainter A-F type candidate hybrid stars, various high-quality spectra collected with 3-4 m sized telescopes suitably equipped with a high-resolution spectrograph and furthermore located in the Northern hemisphere would be ideal. This programme could be done using the new instruments installed at the Devasthal Observatory.

Massive binaries in the vicinity of Sgr A*

Energy Technology Data Exchange (ETDEWEB)

Pfuhl, O.; Gillessen, S.; Genzel, R.; Eisenhauer, F.; Fritz, T. K.; Ott, T. [Max-Planck-Institut für Extraterrestrische Physik, D-85748 Garching (Germany); Alexander, T. [Faculty of Physics, Weizmann Institute of Science, P.O. Box 26, Rehovot 76100 (Israel); Martins, F., E-mail: pfuhl@mpe.mpg.de [LUPM, Université Montpelier 2, CNRS, Place Eugéne Bataillon, F-34095, Montpellier (France)

2014-02-20

A long-term spectroscopic and photometric survey of the most luminous and massive stars in the vicinity of the supermassive black hole Sgr A* revealed two new binaries: a long-period Ofpe/WN9 binary, IRS 16NE, with a modest eccentricity of 0.3 and a period of 224 days, and an eclipsing Wolf-Rayet binary with a period of 2.3 days. Together with the already identified binary IRS 16SW, there are now three confirmed OB/WR binaries in the inner 0.2 pc of the Galactic center. Using radial velocity change upper limits, we were able to constrain the spectroscopic binary fraction in the Galactic center to F{sub SB}=0.30{sub −0.21}{sup +0.34} at a confidence level of 95%, a massive binary fraction close to that observed in dense clusters. The fraction of eclipsing binaries with photometric amplitudes Δm > 0.4 is F{sub EB}{sup GC}=3%±2%, which is consistent with local OB star clusters (F {sub EB} = 1%). Overall, the Galactic center binary fraction seems to be similar to the binary fraction in comparable young clusters.

EVOLUTION OF THE BINARY FRACTION IN DENSE STELLAR SYSTEMS

International Nuclear Information System (INIS)

Fregeau, John M.; Ivanova, Natalia; Rasio, Frederic A.

2009-01-01

Using our recently improved Monte Carlo evolution code, we study the evolution of the binary fraction in globular clusters. In agreement with previous N-body simulations, we find generally that the hard binary fraction in the core tends to increase with time over a range of initial cluster central densities for initial binary fractions ∼<90%. The dominant processes driving the evolution of the core binary fraction are mass segregation of binaries into the cluster core and preferential destruction of binaries there. On a global scale, these effects and the preferential tidal stripping of single stars tend to roughly balance, leading to overall cluster binary fractions that are roughly constant with time. Our findings suggest that the current hard binary fraction near the half-mass radius is a good indicator of the hard primordial binary fraction. However, the relationship between the true binary fraction and the fraction of main-sequence stars in binaries (which is typically what observers measure) is nonlinear and rather complicated. We also consider the importance of soft binaries, which not only modify the evolution of the binary fraction, but can also drastically change the evolution of the cluster as a whole. Finally, we briefly describe the recent addition of single and binary stellar evolution to our cluster evolution code.

Activity coefficients of solutes in binary solvents

International Nuclear Information System (INIS)

Gokcen, N.A.

1982-01-01

The activity coefficients in dilute ternary systems are discussed in detail by using the Margules equations. Analyses of some relevant data at high temperatures show that the sparingly dissolved solutes in binary solvents follow complex behavior even when the binary solvents are very nearly ideal. It is shown that the activity data on the solute or the binary system cannot permit computation of the remaining activities except for the regular solutions. It is also shown that a fourth-order equation is usually adequate in expressing the activity coefficient of a solute in binary solvents at high temperatures. When the activity data for a binary solvent are difficult to obtain in a certain range of composition, the activity data for a sparingly dissolved solute can be used to supplement determination of the binary activities

CHANDRA IDENTIFICATION OF 26 NEW BLACK HOLE CANDIDATES IN THE CENTRAL REGION OF M31

Energy Technology Data Exchange (ETDEWEB)

Barnard, R.; Garcia, M. R.; Murray, S. S. [Harvard-Smithsonian Center for Astrophysics (CFA), Cambridge, MA 02138 (United States)

2013-06-20

We have previously identified 10 M31 black hole candidates (BHCs) in M31 from their X-ray properties alone. They exhibit ''hard state'' emission spectra that are seen at luminosities {approx}<10% Eddington in X-ray binaries (XBs) containing a neutron star (NS) or black hole, at luminosities that significantly exceed the NS threshold. Nine of these are associated with globular clusters (GCs); hence, these are most likely low mass X-ray binaries; eight are included in this survey. We have recently discovered that analysis of the long term 0.5-4.5 keV variability of XBs via structure functions allows us to separate XBs from active galactic nuclei, even though the emission spectra are often similar; this has enabled us to search for BHCs outside of GCs. We have identified 26 new BHCs (12 strong, 14 plausible) within 20' of the M31 nucleus (M31*), using 152 Chandra observations spaced over {approx}13 yr; some of our classifications were enhanced with XMM-Newton observations. Of these, seven appear within 100'' of M31*; this supports the theory suggesting that this region experiences enhanced XB production via dynamical processes similar to those seen in GCs. We have found a parameter space where our BHCs are separated from Galactic NS binaries: we show that modeling a simulated hard state spectrum with a disk blackbody + blackbody model yields parameters that lie outside the space occupied by NS binaries that are modeled this way. The probability that our BHCs all lie within the NS parameter space is {approx}3 Multiplication-Sign 10{sup -29}.

SDSS-III MARVELS Planet Candidate RV Follow-up

Science.gov (United States)

Ge, Jian; Thomas, Neil; Ma, Bo; Li, Rui; SIthajan, Sirinrat

2014-02-01

Planetary systems, discovered by the radial velocity (RV) surveys, reveal strong correlations between the planet frequency and stellar properties, such as metallicity and mass, and a greater diversity in planets than found in the solar system. However, due to the sample sizes of extant surveys (~100 to a few hundreds of stars) and their heterogeneity, many key questions remained to be addressed: Do metal poor stars obey the same trends for planet occurrence as metal rich stars? What is the distribution of giant planets around intermediate- mass stars and binaries? Is the ``planet desert'' within 0.6 AU in the planet orbital distribution of intermediate-mass stars real? The MARVELS survey has produced the largest homogeneous RV measurements of 3300 V=7.6-12 FGK stars. The latest data pipeline effort at UF has been able to remove long term systematic errors suffered in the earlier data pipeline. 18 high confident giant planet candidates have been identified among newly processed data. We propose to follow up these giant planet candidates with the KPNO EXPERT instrument to confirm the detection and also characterize their orbits. The confirmed planets will be used to measure occurrence rates, distributions and multiplicity of giants planets around F,G,K stars with a broad range of mass (~0.6-2.5 M_⊙) and metallicity ([Fe/H]~-1.5-0.5). The well defined MARVELS survey cadence allows robust determinations of completeness limits for rigorously testing giant planet formation theories and constraining models.

All-optical conversion scheme: Binary to quaternary and quaternary to binary number

Science.gov (United States)

Chattopadhyay, Tanay; Roy, Jitendra Nath

2009-04-01

To achieve the inherent parallelism in optics a suitable number system and efficient encoding/decoding scheme for handling the data are very much essential. Binary number is accepted as the best representing number system in almost all types of existing electronic computers. But, binary number (0 and 1) is insufficient in respect to the demand of the coming generation. Multi-valued logic (with radix >2) can be viewed as an alternative approach to solve many problems in transmission, storage and processing of large amount of information in digital signal processing. Here, in this paper all-optical scheme for the conversion of binary to quaternary number and vice versa have been proposed and described. Simulation has also been done. In this all-optical scheme the numbers are represented by different discrete polarized state of light.

COSMIC probes into compact binary formation and evolution

Science.gov (United States)

Breivik, Katelyn

2018-01-01

The population of compact binaries in the galaxy represents the final state of all binaries that have lived up to the present epoch. Compact binaries present a unique opportunity to probe binary evolution since many of the interactions binaries experience can be imprinted on the compact binary population. By combining binary evolution simulations with catalogs of observable compact binary systems, we can distill the dominant physical processes that govern binary star evolution, as well as predict the abundance and variety of their end products.The next decades herald a previously unseen opportunity to study compact binaries. Multi-messenger observations from telescopes across all wavelengths and gravitational-wave observatories spanning several decades of frequency will give an unprecedented view into the structure of these systems and the composition of their components. Observations will not always be coincident and in some cases may be separated by several years, providing an avenue for simulations to better constrain binary evolution models in preparation for future observations.I will present the results of three population synthesis studies of compact binary populations carried out with the Compact Object Synthesis and Monte Carlo Investigation Code (COSMIC). I will first show how binary-black-hole formation channels can be understood with LISA observations. I will then show how the population of double white dwarfs observed with LISA and Gaia could provide a detailed view of mass transfer and accretion. Finally, I will show that Gaia could discover thousands black holes in the Milky Way through astrometric observations, yielding view into black-hole astrophysics that is complementary to and independent from both X-ray and gravitational-wave astronomy.

Binary versus non-binary information in real time series: empirical results and maximum-entropy matrix models

Science.gov (United States)

Almog, Assaf; Garlaschelli, Diego

2014-09-01

The dynamics of complex systems, from financial markets to the brain, can be monitored in terms of multiple time series of activity of the constituent units, such as stocks or neurons, respectively. While the main focus of time series analysis is on the magnitude of temporal increments, a significant piece of information is encoded into the binary projection (i.e. the sign) of such increments. In this paper we provide further evidence of this by showing strong nonlinear relations between binary and non-binary properties of financial time series. These relations are a novel quantification of the fact that extreme price increments occur more often when most stocks move in the same direction. We then introduce an information-theoretic approach to the analysis of the binary signature of single and multiple time series. Through the definition of maximum-entropy ensembles of binary matrices and their mapping to spin models in statistical physics, we quantify the information encoded into the simplest binary properties of real time series and identify the most informative property given a set of measurements. Our formalism is able to accurately replicate, and mathematically characterize, the observed binary/non-binary relations. We also obtain a phase diagram allowing us to identify, based only on the instantaneous aggregate return of a set of multiple time series, a regime where the so-called ‘market mode’ has an optimal interpretation in terms of collective (endogenous) effects, a regime where it is parsimoniously explained by pure noise, and a regime where it can be regarded as a combination of endogenous and exogenous factors. Our approach allows us to connect spin models, simple stochastic processes, and ensembles of time series inferred from partial information.

Binary versus non-binary information in real time series: empirical results and maximum-entropy matrix models

International Nuclear Information System (INIS)

Almog, Assaf; Garlaschelli, Diego

2014-01-01

The dynamics of complex systems, from financial markets to the brain, can be monitored in terms of multiple time series of activity of the constituent units, such as stocks or neurons, respectively. While the main focus of time series analysis is on the magnitude of temporal increments, a significant piece of information is encoded into the binary projection (i.e. the sign) of such increments. In this paper we provide further evidence of this by showing strong nonlinear relations between binary and non-binary properties of financial time series. These relations are a novel quantification of the fact that extreme price increments occur more often when most stocks move in the same direction. We then introduce an information-theoretic approach to the analysis of the binary signature of single and multiple time series. Through the definition of maximum-entropy ensembles of binary matrices and their mapping to spin models in statistical physics, we quantify the information encoded into the simplest binary properties of real time series and identify the most informative property given a set of measurements. Our formalism is able to accurately replicate, and mathematically characterize, the observed binary/non-binary relations. We also obtain a phase diagram allowing us to identify, based only on the instantaneous aggregate return of a set of multiple time series, a regime where the so-called ‘market mode’ has an optimal interpretation in terms of collective (endogenous) effects, a regime where it is parsimoniously explained by pure noise, and a regime where it can be regarded as a combination of endogenous and exogenous factors. Our approach allows us to connect spin models, simple stochastic processes, and ensembles of time series inferred from partial information. (paper)

PERIODIC SIGNALS IN BINARY MICROLENSING EVENTS

International Nuclear Information System (INIS)

Guo, Xinyi; Stefano, Rosanne Di; Esin, Ann; Taylor, Jeffrey

2015-01-01

Gravitational microlensing events are powerful tools for the study of stellar populations. In particular, they can be used to discover and study a variety of binary systems. A large number of binary lenses have already been found through microlensing surveys and a few of these systems show strong evidence of orbital motion on the timescale of the lensing event. We expect that more binary lenses of this kind will be detected in the future. For binaries whose orbital period is comparable to the event duration, the orbital motion can cause the lensing signal to deviate drastically from that of a static binary lens. The most striking property of such light curves is the presence of quasi-periodic features, which are produced as the source traverses the same regions in the rotating lens plane. These repeating features contain information about the orbital period of the lens. If this period can be extracted, then much can be learned about the lensing system even without performing time-consuming, detailed light-curve modeling. However, the relative transverse motion between the source and the lens significantly complicates the problem of period extraction. To resolve this difficulty, we present a modification of the standard Lomb–Scargle periodogram analysis. We test our method for four representative binary lens systems and demonstrate its efficiency in correctly extracting binary orbital periods

Improving geothermal power plants with a binary cycle

Science.gov (United States)

Tomarov, G. V.; Shipkov, A. A.; Sorokina, E. V.

2015-12-01

The recent development of binary geothermal technology is analyzed. General trends in the introduction of low-temperature geothermal sources are summarized. The use of single-phase low-temperature geothermal fluids in binary power plants proves possible and expedient. The benefits of power plants with a binary cycle in comparison with traditional systems are shown. The selection of the working fluid is considered, and the influence of the fluid's physicochemical properties on the design of the binary power plant is discussed. The design of binary power plants is based on the chemical composition and energy potential of the geothermal fluids and on the landscape and climatic conditions at the intended location. Experience in developing a prototype 2.5 MW Russian binary power unit at Pauzhetka geothermal power plant (Kamchatka) is outlined. Most binary systems are designed individually for a specific location. Means of improving the technology and equipment at binary geothermal power plants are identified. One option is the development of modular systems based on several binary systems that employ the heat from the working fluid at different temperatures.

Activity and Kinematics of White Dwarf-M Dwarf Binaries from the SUPERBLINK Proper Motion Survey

Science.gov (United States)

Skinner, Julie N.; Morgan, Dylan P.; West, Andrew A.; Lépine, Sébastien; Thorstensen, John R.

2017-09-01

We present an activity and kinematic analysis of high proper motion white dwarf-M dwarf binaries (WD+dMs) found in the SUPERBLINK survey, 178 of which are new identifications. To identify WD+dMs, we developed a UV-optical-IR color criterion and conducted a spectroscopic survey to confirm each candidate binary. For the newly identified systems, we fit the two components using model white dwarf spectra and M dwarf template spectra to determine physical parameters. We use Hα chromospheric emission to examine the magnetic activity of the M dwarf in each system, and investigate how its activity is affected by the presence of a white dwarf companion. We find that the fraction of WD+dM binaries with active M dwarfs is significantly higher than their single M dwarf counterparts at early and mid-spectral types. We corroborate previous studies that find high activity fractions at both close and intermediate separations. At more distant separations, the binary fraction appears to approach the activity fraction for single M dwarfs. Using derived radial velocities and the proper motions, we calculate 3D space velocities for the WD+dMs in SUPERBLINK. For the entire SUPERBLINK WD+dMs, we find a large vertical velocity dispersion, indicating a dynamically hotter population compared to high proper motion samples of single M dwarfs. We compare the kinematics for systems with active M dwarfs and those with inactive M dwarfs, and find signatures of asymmetric drift in the inactive sample, indicating that they are drawn from an older population. Based on observations obtained at the MDM Observatory operated by Dartmouth College, Columbia University, The Ohio State University, and the University of Michigan.

Topological and categorical properties of binary trees

Directory of Open Access Journals (Sweden)

H. Pajoohesh

2008-04-01

Full Text Available Binary trees are very useful tools in computer science for estimating the running time of so-called comparison based algorithms, algorithms in which every action is ultimately based on a prior comparison between two elements. For two given algorithms A and B where the decision tree of A is more balanced than that of B, it is known that the average and worst case times of A will be better than those of B, i.e., ₸A(n ≤₸B(n and TWA (n≤TWB (n. Thus the most balanced and the most imbalanced binary trees play a main role. Here we consider them as semilattices and characterize the most balanced and the most imbalanced binary trees by topological and categorical properties. Also we define the composition of binary trees as a commutative binary operation, *, such that for binary trees A and B, A * B is the binary tree obtained by attaching a copy of B to any leaf of A. We show that (T,* is a commutative po-monoid and investigate its properties.

Optimally cloned binary coherent states

Science.gov (United States)

Müller, C. R.; Leuchs, G.; Marquardt, Ch.; Andersen, U. L.

2017-10-01

Binary coherent state alphabets can be represented in a two-dimensional Hilbert space. We capitalize this formal connection between the otherwise distinct domains of qubits and continuous variable states to map binary phase-shift keyed coherent states onto the Bloch sphere and to derive their quantum-optimal clones. We analyze the Wigner function and the cumulants of the clones, and we conclude that optimal cloning of binary coherent states requires a nonlinearity above second order. We propose several practical and near-optimal cloning schemes and compare their cloning fidelity to the optimal cloner.

Binaries and triples among asteroid pairs

Science.gov (United States)

Pravec, Petr; Scheirich, Peter; Kušnirák, Peter; Hornoch, Kamil; Galád, Adrián

2015-08-01

Despite major achievements obtained during the past two decades, our knowledge of the population and properties of small binary and multiple asteroid systems is still far from advanced. There is a numerous indirect evidence for that most small asteroid systems were formed by rotational fission of cohesionless parent asteroids that were spun up to the critical frequency presumably by YORP, but details of the process are lacking. Furthermore, as we proceed with observations of more and more binary and paired asteroids, we reveal new facts that substantially refine and sometimes change our understanding of the asteroid systems. One significant new finding we have recently obtained is that primaries of many asteroid pairs are actually binary or triple systems. The first such case found is (3749) Balam (Vokrouhlický, ApJL 706, L37, 2009). We have found 9 more binary systems among asteroid pairs within our ongoing NEOSource photometric project since October 2012. They are (6369) 1983 UC, (8306) Shoko, (9783) Tensho-kan, (10123) Fideoja, (21436) Chaoyichi, (43008) 1999 UD31, (44620) 1999 RS43, (46829) 1998 OS14 and (80218) 1999 VO123. We will review their characteristics. These paired binaries as we call them are mostly similar to binaries in the general ("background") population (of unpaired asteroids), but there are a few trends. The paired binaries tend to have larger secondaries with D_2/D_1 = 0.3 to 0.5 and they also tend to be wider systems with 8 of the 10 having orbital periods between 30 and 81 hours, than average among binaries in the general population. There may be also a larger fraction of triples; (3749) Balam is a confirmed triple, having a larger close and a smaller distant satellite, and (8306) Shoko and (10123) Fideoja are suspect triples as they show additional rotational lightcurve components with periods of 61 and 38.8 h that differ from the orbital period of 36.2 and 56.5 h, respectively. The unbound secondaries tend to be of the same size or

Detecting Malicious Code by Binary File Checking

Directory of Open Access Journals (Sweden)

Marius POPA

2014-01-01

Full Text Available The object, library and executable code is stored in binary files. Functionality of a binary file is altered when its content or program source code is changed, causing undesired effects. A direct content change is possible when the intruder knows the structural information of the binary file. The paper describes the structural properties of the binary object files, how the content can be controlled by a possible intruder and what the ways to identify malicious code in such kind of files. Because the object files are inputs in linking processes, early detection of the malicious content is crucial to avoid infection of the binary executable files.

Mass Transfer in Mira-Type Binaries

Directory of Open Access Journals (Sweden)

Mohamed S.

2012-06-01

Full Text Available Detached, symbiotic binaries are generally assumed to interact via Bondi-Hoyle-Littleton (BHL wind accretion. However, the accretion rates and outflow geometries that result from this mass-transfer mechanism cannot adequately explain the observations of the nearest and best studied symbiotic binary, Mira, or the formation of some post-AGB binaries, e.g. barium stars. We propose a new mass-transfer mode for Mira-type binaries, which we call ‘wind Roche-lobe overflow’ (WRLOF, and which we demonstrate with 3D hydrodynamic simulations. Importantly, we show that the circumstellar outflows which result from WRLOF tend to be highly aspherical and strongly focused towards the binary orbital plane. Furthermore, the subsequent mass-transfer rates are at least an order of magnitude greater than the analogous BHL values. We discuss the implications of these results for the shaping of bipolar (proto-planetary nebulae and other related systems.

RADIAL VELOCITY STUDIES OF CLOSE BINARY STARS. XIV

International Nuclear Information System (INIS)

Pribulla, Theodor; Rucinski, Slavek M.; DeBond, Heide; De Ridder, Archie; Karmo, Toomas; Thomson, J. R.; Croll, Bryce; Ogloza, Waldemar; Pilecki, Bogumil; Siwak, Michal

2009-01-01

Radial velocity (RV) measurements and sine curve fits to the orbital RV variations are presented for 10 close binary systems: TZ Boo, VW Boo, EL Boo, VZ CVn, GK Cep, RW Com, V2610 Oph, V1387 Ori, AU Ser, and FT UMa. Our spectroscopy revealed two quadruple systems, TZ Boo and V2610 Oph, while three stars showing small photometric amplitudes, EL Boo, V1387 Ori, and FT UMa, were found to be triple systems. GK Cep is a close binary with a faint third component. While most of the studied eclipsing systems are contact binaries, VZ CVn and GK Cep are detached or semidetached double-lined binaries, and EL Boo, V1387 Ori, and FT UMa are close binaries of uncertain binary type. The large fraction of triple and quadruple systems found in this sample supports the hypothesis of formation of close binaries in multiple stellar systems; it also demonstrates that low photometric amplitude binaries are a fertile ground for further discoveries of multiple systems.

Formation and Evolution of X-ray Binaries

Science.gov (United States)

Fragkos, Anastasios

X-ray binaries - mass-transferring binary stellar systems with compact object accretors - are unique astrophysical laboratories. They carry information about many complex physical processes such as star formation, compact object formation, and evolution of interacting binaries. My thesis work involves the study of the formation and evolution of Galactic and extra-galacticX-ray binaries using both detailed and realistic simulation tools, and population synthesis techniques. I applied an innovative analysis method that allows the reconstruction of the full evolutionary history of known black hole X-ray binaries back to the time of compact object formation. This analysis takes into account all the available observationally determined properties of a system, and models in detail four of its evolutionary evolutionary phases: mass transfer through the ongoing X-ray phase, tidal evolution before the onset of Roche-lobe overflow, motion through the Galactic potential after the formation of the black hole, and binary orbital dynamics at the time of core collapse. Motivated by deep extra-galactic Chandra survey observations, I worked on population synthesis models of low-mass X-ray binaries in the two elliptical galaxies NGC3379 and NGC4278. These simulations were targeted at understanding the origin of the shape and normalization of the observed X-ray luminosity functions. In a follow up study, I proposed a physically motivated prescription for the modeling of transient neutron star low-mass X-ray binary properties, such as duty cycle, outburst duration and recurrence time. This prescription enabled the direct comparison of transient low-mass X-ray binary population synthesis models to the Chandra X-ray survey of the two ellipticals NGC3379 and NGC4278. Finally, I worked on population synthesismodels of black holeX-ray binaries in the MilkyWay. This work was motivated by recent developments in observational techniques for the measurement of black hole spin magnitudes in

Detectability of Gravitational Waves from High-Redshift Binaries.

Science.gov (United States)

Rosado, Pablo A; Lasky, Paul D; Thrane, Eric; Zhu, Xingjiang; Mandel, Ilya; Sesana, Alberto

2016-03-11

Recent nondetection of gravitational-wave backgrounds from pulsar timing arrays casts further uncertainty on the evolution of supermassive black hole binaries. We study the capabilities of current gravitational-wave observatories to detect individual binaries and demonstrate that, contrary to conventional wisdom, some are, in principle, detectable throughout the Universe. In particular, a binary with rest-frame mass ≳10^{10}M_{⊙} can be detected by current timing arrays at arbitrarily high redshifts. The same claim will apply for less massive binaries with more sensitive future arrays. As a consequence, future searches for nanohertz gravitational waves could be expanded to target evolving high-redshift binaries. We calculate the maximum distance at which binaries can be observed with pulsar timing arrays and other detectors, properly accounting for redshift and using realistic binary waveforms.

IN-SYNC VI. Identification and Radial Velocity Extraction for 100+ Double-Lined Spectroscopic Binaries in the APOGEE/IN-SYNC Fields

Science.gov (United States)

Fernandez, M. A.; Covey, Kevin R.; De Lee, Nathan; Chojnowski, S. Drew; Nidever, David; Ballantyne, Richard; Cottaar, Michiel; Da Rio, Nicola; Foster, Jonathan B.; Majewski, Steven R.; Meyer, Michael R.; Reyna, A. M.; Roberts, G. W.; Skinner, Jacob; Stassun, Keivan; Tan, Jonathan C.; Troup, Nicholas; Zasowski, Gail

2017-08-01

We present radial velocity measurements for 70 high confidence, and 34 potential binary systems in fields containing the Perseus Molecular Cloud, Pleiades, NGC 2264, and the Orion A star-forming region. Eighteen of these systems have been previously identified as binaries in the literature. Candidate double-lined spectroscopic binaries (SB2s) are identified by analyzing the cross-correlation functions (CCFs) computed during the reduction of each APOGEE spectrum. We identify sources whose CCFs are well fit as the sum of two Lorentzians as likely binaries, and provide an initial characterization of the system based on the radial velocities indicated by that dual fit. For systems observed over several epochs, we present mass ratios and systemic velocities; for two systems with observations on eight or more epochs, and which meet our criteria for robust orbital coverage, we derive initial orbital parameters. The distribution of mass ratios for multi-epoch sources in our sample peaks at q = 1, but with a significant tail toward lower q values. Tables reporting radial velocities, systemic velocities, and mass ratios are provided online. We discuss future improvements to the radial velocity extraction method we employ, as well as limitations imposed by the number of epochs currently available in the APOGEE database. The Appendix contains brief notes from the literature on each system in the sample, and more extensive notes for select sources of interest.

Non-binary Entanglement-assisted Stabilizer Quantum Codes

OpenAIRE

Riguang, Leng; Zhi, Ma

2011-01-01

In this paper, we show how to construct non-binary entanglement-assisted stabilizer quantum codes by using pre-shared entanglement between the sender and receiver. We also give an algorithm to determine the circuit for non-binary entanglement-assisted stabilizer quantum codes and some illustrated examples. The codes we constructed do not require the dual-containing constraint, and many non-binary classical codes, like non-binary LDPC codes, which do not satisfy the condition, can be used to c...

Mesoscopic model for binary fluids

Science.gov (United States)

Echeverria, C.; Tucci, K.; Alvarez-Llamoza, O.; Orozco-Guillén, E. E.; Morales, M.; Cosenza, M. G.

2017-10-01

We propose a model for studying binary fluids based on the mesoscopic molecular simulation technique known as multiparticle collision, where the space and state variables are continuous, and time is discrete. We include a repulsion rule to simulate segregation processes that does not require calculation of the interaction forces between particles, so binary fluids can be described on a mesoscopic scale. The model is conceptually simple and computationally efficient; it maintains Galilean invariance and conserves the mass and energy in the system at the micro- and macro-scale, whereas momentum is conserved globally. For a wide range of temperatures and densities, the model yields results in good agreement with the known properties of binary fluids, such as the density profile, interface width, phase separation, and phase growth. We also apply the model to the study of binary fluids in crowded environments with consistent results.

ASASSN-16dt and ASASSN-16hg: Promising candidate period bouncers

Science.gov (United States)

Kimura, Mariko; Isogai, Keisuke; Kato, Taichi; Taguchi, Kenta; Wakamatsu, Yasuyuki; Hambsch, Franz-Josef; Monard, Berto; Myers, Gordon; Dvorak, Shawn; Starr, Peter; Brincat, Stephen M.; de Miguel, Enrique; Ulowetz, Joseph; Itoh, Hiroshi; Stone, Geoff; Nogami, Daisaku

2018-04-01

We present optical photometry of superoutbursts that occurred in 2016 of two WZ Sge-type dwarf novae (DNe), ASASSN-16dt and ASASSN-16hg. Their light curves showed a dip in brightness between the first plateau stage with no ordinary superhumps (or early superhumps) and the second plateau stage with ordinary superhumps. We find that the dip is produced by the slow evolution of the 3 : 1 resonance tidal instability and that it would likely be observed in low mass-ratio objects. An estimated mass ratio (q ≡ M2/M1) from the period of developing (stage A) superhumps [0.06420(3) d] was 0.036(2) in ASASSN-16dt. Additionally, its superoutburst has many properties similar to those in other low-q WZ Sge-type DNe: long-lasting stage-A superhumps, small superhump amplitudes, long delay of ordinary-superhump appearances, and a slow decline rate in the plateau stage with superhumps. Its very small mass ratio and observational characteristics suggest that this system is one of the best candidates for a period bouncer—a binary accounting for the missing population of post-period minimum cataclysmic variables. Although it is not clearly verified due to the lack of detection of stage-A superhumps, ASASSN-16hg might be a possible candidate for period bouncers on the basis of the morphology of its light curves and the small superhump amplitudes. Many outburst properties of period bouncer candidates would originate from the small tidal effects of their secondary stars.

Upregulated LINE-1 Activity in the Fanconi Anemia Cancer Susceptibility Syndrome Leads to Spontaneous Pro-inflammatory Cytokine Production.

Science.gov (United States)

Brégnard, Christelle; Guerra, Jessica; Déjardin, Stéphanie; Passalacqua, Frank; Benkirane, Monsef; Laguette, Nadine

2016-06-01

Fanconi Anemia (FA) is a genetic disorder characterized by elevated cancer susceptibility and pro-inflammatory cytokine production. Using SLX4(FANCP) deficiency as a working model, we questioned the trigger for chronic inflammation in FA. We found that absence of SLX4 caused cytoplasmic DNA accumulation, including sequences deriving from active Long INterspersed Element-1 (LINE-1), triggering the cGAS-STING pathway to elicit interferon (IFN) expression. In agreement, absence of SLX4 leads to upregulated LINE-1 retrotransposition. Importantly, similar results were obtained with the FANCD2 upstream activator of SLX4. Furthermore, treatment of FA cells with the Tenofovir reverse transcriptase inhibitor (RTi), that prevents endogenous retrotransposition, decreased both accumulation of cytoplasmic DNA and pro-inflammatory signaling. Collectively, our data suggest a contribution of endogenous RT activities to the generation of immunogenic cytoplasmic nucleic acids responsible for inflammation in FA. The additional observation that RTi decreased pro-inflammatory cytokine production induced by DNA replication stress-inducing drugs further demonstrates the contribution of endogenous RTs to sustaining chronic inflammation. Altogether, our data open perspectives in the prevention of adverse effects of chronic inflammation in tumorigenesis. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

CIRCUMBINARY MAGNETOHYDRODYNAMIC ACCRETION INTO INSPIRALING BINARY BLACK HOLES

Energy Technology Data Exchange (ETDEWEB)

Noble, Scott C.; Mundim, Bruno C.; Nakano, Hiroyuki; Campanelli, Manuela; Zlochower, Yosef [Center for Computational Relativity and Gravitation, Rochester Institute of Technology, Rochester, NY 14623 (United States); Krolik, Julian H. [Physics and Astronomy Department, Johns Hopkins University, Baltimore, MD 21218 (United States); Yunes, Nicolas, E-mail: scn@astro.rit.edu [Department of Physics, Montana State University, Bozeman, MT 59717 (United States)

2012-08-10

We have simulated the magnetohydrodynamic evolution of a circumbinary disk surrounding an equal-mass binary comprising two non-spinning black holes during the period in which the disk inflow time is comparable to the binary evolution time due to gravitational radiation. Both the changing spacetime and the binary orbital evolution are described by an innovative technique utilizing high-order post-Newtonian approximations. Prior to the beginning of the inspiral, the structure of the circumbinary disk is predicted well by extrapolation from Newtonian results: a gap of roughly two binary separation radii is cleared, and matter piles up at the outer edge of this gap as inflow is retarded by torques exerted by the binary; the accretion rate is roughly half its value at large radius. During inspiral, the inner edge of the disk initially moves inward in coordination with the shrinking binary, but-as the orbital evolution accelerates-the inward motion of the disk edge falls behind the rate of binary compression. In this stage, the binary torque falls substantially, but the accretion rate decreases by only 10%-20%. When the binary separation is tens of gravitational radii, the rest-mass efficiency of disk radiation is a few percent, suggesting that supermassive binary black holes could be very luminous at this stage of their evolution. Inner disk heating is modulated at a beat frequency comparable to the binary orbital frequency. However, a disk with sufficient surface density to be luminous may be optically thick, suppressing periodic modulation of the luminosity.

Binary and Millisecond Pulsars

Directory of Open Access Journals (Sweden)

Lorimer Duncan R.

2008-11-01

Full Text Available We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1800. There are now 83 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 140 pulsars in 26 of the Galactic globular clusters. Recent highlights include the discovery of the young relativistic binary system PSR J1906+0746, a rejuvination in globular cluster pulsar research including growing numbers of pulsars with masses in excess of 1.5M_⊙, a precise measurement of relativistic spin precession in the double pulsar system and a Galactic millisecond pulsar in an eccentric (e = 0.44 orbit around an unevolved companion.

Observations of new Wolf-Rayet binaries

International Nuclear Information System (INIS)

Niemela, V.S.

1982-01-01

The author reports here preliminary results of spectrographic observations for three southern WR stars, whose binary nature had not been previously verified: HDE 320102, CD -45 0 4482, HD 62910. The observations were carried out at the Cerro Tololo Inter-American Observatory, Chile, mostly with the Cassegrain spectrograph with IT attached to the 1-m reflector. These spectrograms were secured on Kodak IIIaJ emulsion, and have a dispersion of 45 A/mm. The results suggest that HDE 320102 must be a double-lined 05-7 + WN3 spectroscopic binary, that CD -45 0 4482 appears to be a single-lined spectroscopic binary and that HD 62910 may be a binary. (Auth.)

Orbital Dynamics of Candidate Transitional Millisecond Pulsar 3FGL J1544.6-1125: An unusually face-on system

Science.gov (United States)

Britt, Christopher T.; Strader, Jay; Chomiuk, Laura; Halpern, Jules P.; Tremou, Evangelina; Peacock, Mark; Salinas, Ricardo

2018-01-01

We present the orbital solution for the donor star of the candidate transitional millisecond pulsar 3FGL J1544.6-1125, currently observed as an accreting low-mass X-ray binary. The orbital period is 0.2415361(36) days, entirely consistent with the spectral classification of the donor star as a mid to late K dwarf. The semi-amplitude of the radial velocity curve is exceptionally low at K2=39.3+/-1.5 km s-1, implying a remarkably face-on inclination in the range 5-8o, depending on the neutron star and donor masses. After determining the veiling of the secondary, we derive a distance to the binary of 3.8+/-0.7 kpc, yielding a 0.3-10 keV X-ray luminosity of 6.1+/-1.9 x1033 erg s-1, similar to confirmed transitional millisecond pulsars. As face-on binaries rarely occur by chance, we discuss the possibility that Fermi-selected samples of transitional milli-second pulsars in the sub-luminous disk state are affected by beaming. By phasing emission line strength on the spectroscopic ephemeris, we find coherent variations, and argue that some optical light originates from emission from an asymmetric shock originating near the inner disk.

Asteroseismic effects in close binary stars

Science.gov (United States)

Springer, Ofer M.; Shaviv, Nir J.

2013-09-01

Turbulent processes in the convective envelopes of the Sun and stars have been shown to be a source of internal acoustic excitations. In single stars, acoustic waves having frequencies below a certain cut-off frequency propagate nearly adiabatically and are effectively trapped below the photosphere where they are internally reflected. This reflection essentially occurs where the local wavelength becomes comparable to the pressure scale height. In close binary stars, the sound speed is a constant on equipotentials, while the pressure scale height, which depends on the local effective gravity, varies on equipotentials and may be much greater near the inner Lagrangian point (L1). As a result, waves reaching the vicinity of L1 may propagate unimpeded into low-density regions, where they tend to dissipate quickly due to non-linear and radiative effects. We study the three-dimensional propagation and enhanced damping of such waves inside a set of close binary stellar models using a WKB approximation of the acoustic field. We find that these waves can have much higher damping rates in close binaries, compared to their non-binary counterparts. We also find that the relative distribution of acoustic energy density at the visible surface of close binaries develops a ring-like feature at specific acoustic frequencies and binary separations.

BANYAN. III. Radial velocity, rotation, and X-ray emission of low-mass star candidates in nearby young kinematic groups

Energy Technology Data Exchange (ETDEWEB)

Malo, Lison; Artigau, Étienne; Doyon, René; Lafrenière, David; Albert, Loïc; Gagné, Jonathan, E-mail: malo@astro.umontreal.ca, E-mail: doyon@astro.umontreal.ca [Département de physique and Observatoire du Mont-Mégantic, Université de Montréal, Montréal, QC H3C 3J7 (Canada)

2014-06-10

Based on high-resolution spectra obtained with PHOENIX at Gemini-South, CRIRES at VLT-UT1, and ESPaDOnS at the Canada-France-Hawaii Telescope, we present new measurements of the radial and projected rotational velocities of 219 low-mass stars. The target likely membership was initially established using the Bayesian analysis tool recently presented in Malo et al., taking into account only the position, proper motion, and photometry of the stars to assess their membership probability. In the present study, we include radial velocity as an additional input to our analysis, and in doing so we confirm the high membership probability for 130 candidates: 27 in β Pictoris, 22 in Tucana-Horologium, 25 in Columba, 7 in Carina, 18 in Argus and 18 in AB Doradus, and 13 with an ambiguous membership. Our analysis also confirms the membership of 57 stars proposed in the literature. A subsample of 16 candidates was observed at 3 or more epochs, allowing us to discover 6 new spectroscopic binaries. The fraction of binaries in our sample is 25%, consistent with values in the literature. Of the stars in our sample, 20% show projected rotational velocities (vsin i) higher than 30 km s{sup –1} and therefore are considered as fast rotators. A parallax and other youth indicators are still needed to fully confirm the 130 highly probable candidates identified here as new bona fide members. Finally, based on the X-ray emission of bona fide and highly probable group members, we show that for low-mass stars in the 12-120 Myr age range, the X-ray luminosity is an excellent indicator of youth and better than the more traditionally used R {sub X} parameter, the ratio of X-ray to bolometric luminosity.

Impact of low-frequency hotspot mutation R282Q on the structure of p53 DNA-binding domain as revealed by crystallography at 1.54 Å resolution

Energy Technology Data Exchange (ETDEWEB)

Tu, Chao [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Tan, Yu-Hong [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Shaw, Gary [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Zhou, Zheng; Bai, Yawen [Laboratory of Biochemistry and Molecular Biology, National Cancer Institute, Bethesda, MD 20892 (United States); Luo, Ray [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Ji, Xinhua, E-mail: jix@ncifcrf.gov [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States)

2008-05-01

The impact of hotspot mutation R282Q on the structure of human p53 DNA-binding domain has been characterized by X-ray crystallography and molecular-dynamics simulations. Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53.

Logistic chaotic maps for binary numbers generations

International Nuclear Information System (INIS)

Kanso, Ali; Smaoui, Nejib

2009-01-01

Two pseudorandom binary sequence generators, based on logistic chaotic maps intended for stream cipher applications, are proposed. The first is based on a single one-dimensional logistic map which exhibits random, noise-like properties at given certain parameter values, and the second is based on a combination of two logistic maps. The encryption step proposed in both algorithms consists of a simple bitwise XOR operation of the plaintext binary sequence with the keystream binary sequence to produce the ciphertext binary sequence. A threshold function is applied to convert the floating-point iterates into binary form. Experimental results show that the produced sequences possess high linear complexity and very good statistical properties. The systems are put forward for security evaluation by the cryptographic committees.

Converting optical scanning holograms of real objects to binary Fourier holograms using an iterative direct binary search algorithm.

Science.gov (United States)

Leportier, Thibault; Park, Min Chul; Kim, You Seok; Kim, Taegeun

2015-02-09

In this paper, we present a three-dimensional holographic imaging system. The proposed approach records a complex hologram of a real object using optical scanning holography, converts the complex form to binary data, and then reconstructs the recorded hologram using a spatial light modulator (SLM). The conversion from the recorded hologram to a binary hologram is achieved using a direct binary search algorithm. We present experimental results that verify the efficacy of our approach. To the best of our knowledge, this is the first time that a hologram of a real object has been reconstructed using a binary SLM.

Lack of association of C282Y and H63D mutations in the hemochromatosis (HFE) gene with diabetes mellitus type 2 in a case-control study of women in Brazil.

Science.gov (United States)

Gomes, K B; Carvalho, M G; Coelho, F F; Rodrigues, I F; Soares, A L; Guimarães, D A; Fernandes, A P

2009-10-27

Hereditary hemochromatosis is one of the most common autosomal recessive diseases; it is characterized by excess absorption of iron. Clinically, the major challenge is to diagnose increased iron deposition before irreversible tissue damage has occurred. C282Y and H63D are the main mutations related to hereditary hemochromatosis; these mutations have been reported to be associated with increased risk of developing diabetes mellitus type 2 (DM2). We investigated whether these mutations are associated with increased risk for the development of DM2 in women in Brazil. Seventy-two women with clinical diagnosis of DM2 under treatment with hypoglycemic agents and a control group composed of 72 women with no clinical history of diabetes were studied. The C282Y and H63D mutations were determined by PCR-RFLP. Significant differences were not observed for C282Y and H63D, when we compared diabetic and non-diabetic women. We suggest that mutations C282Y and H63D in the HFE gene are not significant risk factors for the development of DM2 in Brazilian women.

Adrenal venous sampling: the learning curve of a single interventionalist with 282 consecutive procedures.

Science.gov (United States)

Jakobsson, Hugo; Farmaki, Katerina; Sakinis, Augustinas; Ehn, Olof; Johannsson, Gudmundur; Ragnarsson, Oskar

2018-01-01

Primary aldosteronism (PA) is a common cause of secondary hypertension. Adrenal venous sampling (AVS) is the gold standard for assessing laterality of PA, which is of paramount importance to decide adequate treatment. AVS is a technically complicated procedure with success rates ranging between 30% and 96%. The aim of this study was to investigate the success rate of AVS over time, performed by a single interventionalist. This was a retrospective study based on consecutive AVS procedures performed by a single operator between September 2005 and June 2016. Data on serum concentrations of aldosterone and cortisol from right and left adrenal vein, inferior vena cava, and peripheral vein were collected and selectivity index (SI) calculated. Successful AVS was defined as SI > 5. In total, 282 AVS procedures were performed on 269 patients, 168 men (62%) and 101 women (38%), with a mean age of 55±11 years (range, 26-78 years). Out of 282 AVS procedures, 259 were successful, giving an overall success rate of 92%. The most common reason for failure was inability to localize the right adrenal vein (n=16; 76%). The success rates were 63%, 82%, and 94% during the first, second, and third years, respectively. During the last 8 years the success rate was 95%, and on average 27 procedures were performed annually. Satisfactory AVS success rate was achieved after approximately 36 procedures and satisfactory success rate was maintained by performing approximately 27 procedures annually. AVS should be limited to few operators that perform sufficiently large number of procedures to achieve, and maintain, satisfactory AVS success rate.

Interaction of Massive Black Hole Binaries with Their Stellar Environment. II. Loss Cone Depletion and Binary Orbital Decay

Science.gov (United States)

Sesana, Alberto; Haardt, Francesco; Madau, Piero

2007-05-01

We study the long-term evolution of massive black hole binaries (MBHBs) at the centers of galaxies using detailed scattering experiments to solve the full three-body problem. Ambient stars drawn from an isotropic Maxwellian distribution unbound to the binary are ejected by the gravitational slingshot. We construct a minimal, hybrid model for the depletion of the loss cone and the orbital decay of the binary and show that secondary slingshots-stars returning on small-impact parameter orbits to have a second superelastic scattering with the MBHB-may considerably help the shrinking of the pair in the case of large binary mass ratios. In the absence of loss cone refilling by two-body relaxation or other processes, the mass ejected before the stalling of a MBHB is half the binary reduced mass. About 50% of the ejected stars are expelled in a ``burst'' lasting ~104 yr M1/46, where M6 is the binary mass in units of 106 Msolar. The loss cone is completely emptied in a few bulge crossing timescales, ~107 yr M1/46. Even in the absence of two-body relaxation or gas dynamical processes, unequal mass and/or eccentric binaries with M6>~0.1 can shrink to the gravitational wave emission regime in less than a Hubble time and are therefore ``safe'' targets for the planned Laser Interferometer Space Antenna.

TESTING THE MAGNETAR MODEL VIA LATE-TIME RADIO OBSERVATIONS OF TWO MACRONOVA CANDIDATES

Energy Technology Data Exchange (ETDEWEB)

Horesh, Assaf [Benoziyo Center for Astrophysics, Weizmann Institute of Science, 76100 Rehovot (Israel); Hotokezaka, Kenta; Piran, Tsvi [Racah Institute of Physics, The Hebrew University, Jerusalem 91904 (Israel); Nakar, Ehud [Raymond and Beverly Sackler School of Physics and Astronomy, Tel Aviv University, Tel Aviv 69978 (Israel); Hancock, Paul [International Centre for Radio Astronomy Research (ICRAR), Curtin University, GPO Box U1987, Perth WA 6845 (Australia)

2016-03-10

Compact binary mergers may have already been observed as they are the leading model for short gamma-ray bursts (sGRBs). Radioactive decay within the ejecta from these mergers is expected to produce an infrared flare, dubbed macronova (or kilonova), on a timescale of a week. Recently, two such macronova candidates were identified in followup observations of sGRBs, strengthening the possibility that those indeed arise from mergers. The same ejecta will also produce long-term (months to years) radio emission due to its interaction with the surrounding interstellar medium. In the search for this emission, we observed the two macronova candidates, GRB 130603B and GRB 060614, with the Jansky Very Large Array (VLA) and the Australia Telescope Compact Array (ATCA). Our observations resulted in null-detections, putting strong upper limits on the kinetic energy and mass of the ejecta. A possible outcome of a merger is a highly magnetized neutron star (a magnetar), which has been suggested as the central engine for GRBs. Such a magnetar will deposit a significant fraction of its energy into the ejecta leading to a brighter radio flare. Our results, therefore, rule out magnetars in these two events.

Molecular epidemiology of HFE gene polymorphic variants (C282Y, H63D and S65C) in the population of Espírito Santo, Brazil.

Science.gov (United States)

Alves, L N R; Santos, E V W; Stur, E; Silva Conforti, A M A; Louro, I D

2016-04-27

Hereditary hemochromatosis (HH) is an autosomal recessive disorder that leads to progressive iron accumulation and may cause cirrhosis, hepatocellular carcinoma, diabetes, and heart failure. Most cases of HH have been linked to mutations in genes associated with iron homeostasis. There have been three major variants in the high Fe (HFE) gene associated with the disease: C282Y, H63D and S65C. In this context, we aimed to evaluate the prevalence of the polymorphic variants (C282Y, H63D and S65C) of the HFE gene in the population of the Espírito Santo State (ES), Brazil by analyzing three different groups: general population (N = 120), Pomeranian descendants (N = 59), and patients with HH (N = 20). Using genomic DNA extracted from peripheral blood, polymorphic variant identification was performed by polymerase chain reaction-restriction fragment length polymorphism. Statistically significant differences were observed for genotype distribution of C282Y (P HFE gene allele frequencies for the general population, Pomeranian subpopulation, and patients with HH of ES, Brazil.

WISE BROWN DWARF BINARIES: THE DISCOVERY OF A T5+T5 AND A T8.5+T9 SYSTEM

International Nuclear Information System (INIS)

Gelino, Christopher R.; Kirkpatrick, J. Davy; Griffith, Roger L.; Marsh, Kenneth A.; Cushing, Michael C.; Eisenhardt, Peter R.; Mainzer, Amanda K.; Skrutskie, Michael F.; Wright, Edward L.

2011-01-01

The multiplicity properties of brown dwarfs are critical empirical constraints for formation theories, while multiples themselves provide unique opportunities to test evolutionary and atmospheric models and examine empirical trends. Studies using high-resolution imaging cannot only uncover faint companions, but they can also be used to determine dynamical masses through long-term monitoring of binary systems. We have begun a search for the coolest brown dwarfs using preliminary processing of data from the Wide-field Infrared Survey Explorer and have confirmed many of the candidates as late-type T dwarfs. In order to search for companions to these objects, we are conducting observations using the Laser Guide Star Adaptive Optics system on Keck II. Here we present the first results of that search, including a T5 binary with nearly equal mass components and a faint companion to a T8.5 dwarf with an estimated spectral type of T9.

Binary and ternary systems

International Nuclear Information System (INIS)

Petrov, D.A.

1986-01-01

Conditions for thermodynamical equilibrium in binary and ternary systems are considered. Main types of binary and ternary system phase diagrams are sequently constructed on the basis of general regularities on the character of transition from one equilibria to others. New statements on equilibrium line direction in the diagram triple points and their isothermal cross sections are developed. New represenations on equilibria in case of monovariant curve minimum and maximum on three-phase equilibrium formation in ternary system are introduced

Planet formation in Binaries

OpenAIRE

Thebault, Ph.; Haghighipour, N.

2014-01-01

Spurred by the discovery of numerous exoplanets in multiple systems, binaries have become in recent years one of the main topics in planet formation research. Numerous studies have investigated to what extent the presence of a stellar companion can affect the planet formation process. Such studies have implications that can reach beyond the sole context of binaries, as they allow to test certain aspects of the planet formation scenario by submitting them to extreme environments. We review her...

Non-negative Matrix Factorization for Binary Data

DEFF Research Database (Denmark)

Larsen, Jacob Søgaard; Clemmensen, Line Katrine Harder

We propose the Logistic Non-negative Matrix Factorization for decomposition of binary data. Binary data are frequently generated in e.g. text analysis, sensory data, market basket data etc. A common method for analysing non-negative data is the Non-negative Matrix Factorization, though...... this is in theory not appropriate for binary data, and thus we propose a novel Non-negative Matrix Factorization based on the logistic link function. Furthermore we generalize the method to handle missing data. The formulation of the method is compared to a previously proposed method (Tome et al., 2015). We compare...... the performance of the Logistic Non-negative Matrix Factorization to Least Squares Non-negative Matrix Factorization and Kullback-Leibler (KL) Non-negative Matrix Factorization on sets of binary data: a synthetic dataset, a set of student comments on their professors collected in a binary term-document matrix...

Binary and Millisecond Pulsars.

Science.gov (United States)

Lorimer, Duncan R

2008-01-01

We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1800. There are now 83 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 140 pulsars in 26 of the Galactic globular clusters. Recent highlights include the discovery of the young relativistic binary system PSR J1906+0746, a rejuvination in globular cluster pulsar research including growing numbers of pulsars with masses in excess of 1.5 M ⊙ , a precise measurement of relativistic spin precession in the double pulsar system and a Galactic millisecond pulsar in an eccentric ( e = 0.44) orbit around an unevolved companion. Supplementary material is available for this article at 10.12942/lrr-2008-8.

Flip-flopping binary black holes.

Science.gov (United States)

Lousto, Carlos O; Healy, James

2015-04-10

We study binary spinning black holes to display the long term individual spin dynamics. We perform a full numerical simulation starting at an initial proper separation of d≈25M between equal mass holes and evolve them down to merger for nearly 48 orbits, 3 precession cycles, and half of a flip-flop cycle. The simulation lasts for t=20 000M and displays a total change in the orientation of the spin of one of the black holes from an initial alignment with the orbital angular momentum to a complete antialignment after half of a flip-flop cycle. We compare this evolution with an integration of the 3.5 post-Newtonian equations of motion and spin evolution to show that this process continuously flip flops the spin during the lifetime of the binary until merger. We also provide lower order analytic expressions for the maximum flip-flop angle and frequency. We discuss the effects this dynamics may have on spin growth in accreting binaries and on the observational consequences for galactic and supermassive binary black holes.

Binary Star Fractions from the LAMOST DR4

Science.gov (United States)

Tian, Zhi-Jia; Liu, Xiao-Wei; Yuan, Hai-Bo; Chen, Bing-Qiu; Xiang, Mao-Sheng; Huang, Yang; Wang, Chun; Zhang, Hua-Wei; Guo, Jin-Cheng; Ren, Juan-Juan; Huo, Zhi-Ying; Yang, Yong; Zhang, Meng; Bi, Shao-Lan; Yang, Wu-Ming; Liu, Kang; Zhang, Xian-Fei; Li, Tan-Da; Wu, Ya-Qian; Zhang, Jing-Hua

2018-05-01

Stellar systems composed of single, double, triple or higher-order systems are rightfully regarded as the fundamental building blocks of the Milky Way. Binary stars play an important role in formation and evolution of the Galaxy. Through comparing the radial velocity variations from multi-epoch observations, we analyze the binary fraction of dwarf stars observed with LAMOST. Effects of different model assumptions, such as orbital period distributions on the estimate of binary fractions, are investigated. The results based on log-normal distribution of orbital periods reproduce the previous complete analyses better than the power-law distribution. We find that the binary fraction increases with T eff and decreases with [Fe/H]. We first investigate the relation between α-elements and binary fraction in such a large sample as provided by LAMOST. The old stars with high [α/Fe] dominate with a higher binary fraction than young stars with low [α/Fe]. At the same mass, earlier forming stars possess a higher binary fraction than newly forming ones, which may be related with evolution of the Galaxy.

WHITE-LIGHT FLARES ON CLOSE BINARIES OBSERVED WITH KEPLER

International Nuclear Information System (INIS)

Gao, Qing; Xin, Yu; Liu, Ji-Feng; Zhang, Xiao-Bin; Gao, Shuang

2016-01-01

Based on Kepler data, we present the results of a search for white light flares on 1049 close binaries. We identify 234 flare binaries, of which 6818 flares are detected. We compare the flare-binary fraction in different binary morphologies (“detachedness”). The result shows that the fractions in over-contact and ellipsoidal binaries are approximately 10%–20% lower than those in detached and semi-detached systems. We calculate the binary flare activity level (AL) of all the flare binaries, and discuss its variations along the orbital period ( P orb ) and rotation period ( P rot , calculated for only detached binaries). We find that the AL increases with decreasing P orb or P rot , up to the critical values at P orb ∼ 3 days or P rot ∼ 1.5 days, and thereafter the AL starts decreasing no matter how fast the stars rotate. We examine the flaring rate as a function of orbital phase in two eclipsing binaries on which a large number of flares are detected. It appears that there is no correlation between flaring rate and orbital phase in these two binaries. In contrast, when we examine the function with 203 flares on 20 non-eclipse ellipsoidal binaries, bimodal distribution of amplitude-weighted flare numbers shows up at orbital phases 0.25 and 0.75. Such variation could be larger than what is expected from the cross section modification.

Evolution and merging of binaries with compact objects

International Nuclear Information System (INIS)

Bethe, Hans A.; Brown, Gerald E.; Lee, Chang-Hwan

2007-01-01

In the light of recent observations in which short γ-ray bursts are interpreted as arising from black-hole(BH), neutron-star(NS) or NS-NS mergings we would like to review our research on the evolution of compact binaries, especially those containing NS's. These were carried out with predictions for LIGO in mind, but are directly applicable to short γ-ray bursts in the interpretation above. Most important in our review is that we show that the standard scenario for evolving NS-NS binaries always ends up with a low-mass BH (LMBH), NS binary. Bethe and Brown [1998, Astrophys. J. 506, 780] showed that this fate could be avoided if the two giants in the progenitor binary burned He at the same time, and that in this way the binary could avoid the common envelope evolution of the NS with red giant companion which sends the first born NS into a BH in the standard scenario. The burning of He at the same time requires, for the more massive giants such as the progenitors of the Hulse-Taylor binary NS that the two giants be within 4% of each other in zero age main sequence (ZAMS) mass. Applying this criterion to all binaries results in a factor ∼5 of LMBH-NS binaries as compared with NS-NS binaries. Although this factor is substantially less than the originally claimed factor of 20 which Bethe and Brown (1998) estimated, largely because a careful evolution has been carried through here, our factor 5 is augmented by a factor of ∼8 arising from the higher rate of star formation in the earlier Galaxy from which the BH-NS binaries came from. Furthermore, here we calculate the mergers for short-hard gamma-ray bursts, whereas Bethe and Brown's factor 20 included a factor of 2 for the higher chirp masses in a BH-NS binary as compared with NS-NS one. In short, we end up with an estimate of factor ∼40 over that calculated with NS-NS binary mergers in our Galaxy alone. Our total rate is estimated to be about one merging of compact objects per year. Our scenario of NS-NS binaries

Rotational properties of the binary and non-binary populations in the Trans-Neptunian belt

Science.gov (United States)

Thirouin, Audrey; Noll, Keith S.; Ortiz Moreno, Jose Luis; Morales , Nicolas

2014-11-01

An exhaustive study about short-term variability as well as derived properties from lightcurves allowed us to draw some conclusions for the Trans-Neptunian belt binary population. Based on Maxwellian fit distributions of the spin rate, we suggested that the binary population rotates slower than the non-binary one. This slowing-down can be attributed to tidal effects between the satellite and the primary, as expected. We showed that no system in this work is tidally locked, but the primary despinning process may have already affected the primary rate (as well as the satellite rotational rate). We used the Gladman et al. (1996) formula to compute the time required to tidally lock the systems, but this formula is based on several assumptions and approximations that do not always hold. The computed times are reasonable in most cases and confirm that none of the systems is tidally locked, assuming that the satellite densities are low and have a high rigidity or have a higher dissipation than usually assumed. The rotational properties of small bodies provide information about important physical properties, such as shape, density, and cohesion (Pravec & Harris 2000; Holsapple 2001, 2004; Thirouin et al. 2010, 2012). For binaries it is also possible to derive several physical parameters of the system components, such as diameters of the primary/secondary and albedo under some assumptions. We compare our results as well as our technique for deriving this information from the lightcurve with other methods, such as: i) thermal or thermophysical modeling, ii) from the mutual orbit of the binary component, iii) from direct imaging or iv) from stellar occultation by Trans-Neptunian Objects (TNOs). Finally, by studying the specific angular momentum of the sample, we proposed possible formation models for several binary TNOs. In several cases, we obtained hints of the formation mechanism from the angular momentum, but for other cases we do not have enough information about the

Texture classification by texton: statistical versus binary.

Directory of Open Access Journals (Sweden)

Zhenhua Guo

Full Text Available Using statistical textons for texture classification has shown great success recently. The maximal response 8 (Statistical_MR8, image patch (Statistical_Joint and locally invariant fractal (Statistical_Fractal are typical statistical texton algorithms and state-of-the-art texture classification methods. However, there are two limitations when using these methods. First, it needs a training stage to build a texton library, thus the recognition accuracy will be highly depended on the training samples; second, during feature extraction, local feature is assigned to a texton by searching for the nearest texton in the whole library, which is time consuming when the library size is big and the dimension of feature is high. To address the above two issues, in this paper, three binary texton counterpart methods were proposed, Binary_MR8, Binary_Joint, and Binary_Fractal. These methods do not require any training step but encode local feature into binary representation directly. The experimental results on the CUReT, UIUC and KTH-TIPS databases show that binary texton could get sound results with fast feature extraction, especially when the image size is not big and the quality of image is not poor.

Absolute Dimensions of Contact Binary Stars in Baade Window

Directory of Open Access Journals (Sweden)

Young Woon Kang

1999-12-01

Full Text Available The light curves of the representative 6 contact binary stars observed by OGLE Project of searching for dark matter in our Galaxy have been analyzed by the method of the Wilson and Devinney Differential Correction to find photometric solutions. The orbital inclinations of these binaries are in the range of 52 deg - 69 deg which is lower than that of the solar neighborhood binaries. The Roche lobe filling factor of these binaries are distributed in large range of 0.12 - 0.90. Since absence of spectroscopic observations for these binaries we have found masses of the 6 binary systems based on the intersection between Kepler locus and locus derived from Vandenberg isochrones in the mass - luminosity plane. Then absolute dimensions and distances have been found by combining the masses and the photometric solutions. The distances of the 6 binary systems are distributed in the range of 1 kpc - 6 kpc. This distance range is the limiting range where the contact binaries which have period shorter than a day are visible. Most contact binaries discovered in the Baade window do not belong to the Galactic bulge.

Orbital motion in pre-main sequence binaries

Energy Technology Data Exchange (ETDEWEB)

Schaefer, G. H. [The CHARA Array of Georgia State University, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Prato, L. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Simon, M. [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States); Patience, J., E-mail: schaefer@chara-array.org [Astrophysics Group, School of Physics, University of Exeter, Exeter, EX4 4QL (United Kingdom)

2014-06-01

We present results from our ongoing program to map the visual orbits of pre-main sequence (PMS) binaries in the Taurus star forming region using adaptive optics imaging at the Keck Observatory. We combine our results with measurements reported in the literature to analyze the orbital motion for each binary. We present preliminary orbits for DF Tau, T Tau S, ZZ Tau, and the Pleiades binary HBC 351. Seven additional binaries show curvature in their relative motion. Currently, we can place lower limits on the orbital periods for these systems; full solutions will be possible with more orbital coverage. Five other binaries show motion that is indistinguishable from linear motion. We suspect that these systems are bound and might show curvature with additional measurements in the future. The observations reported herein lay critical groundwork toward the goal of measuring precise masses for low-mass PMS stars.

YSOVAR: SIX PRE-MAIN-SEQUENCE ECLIPSING BINARIES IN THE ORION NEBULA CLUSTER

Energy Technology Data Exchange (ETDEWEB)

Morales-Calderon, M.; Stauffer, J. R.; Rebull, L. M. [Spitzer Science Center, California Institute of Technology, 1200 E California Blvd., Pasadena, CA 91125 (United States); Stassun, K. G. [Physics and Astronomy Department, Vanderbilt University, 1807 Station B, Nashville, TN 37235 (United States); Vrba, F. J. [U. S. Naval Observatory, Flagstaff Station, 10391 W. Naval Observatory Road, Flagstaff, AZ 86001-8521 (United States); Prato, L. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A.; Carpenter, J. M. [Astronomy Department, California Institute of Technology, 1200 E California Blvd., Pasadena, CA 91125 (United States); Terebey, S.; Angione, J. [Department of Physics and Astronomy, California State University at Los Angeles, Los Angeles, CA 90032 (United States); Covey, K. R. [Department of Astronomy, Cornell University, 226 Space Sciences Building, Ithaca, NY 14853 (United States); Terndrup, D. M. [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Gutermuth, R. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Song, I. [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, Pasadena, CA 91125 (United States); Marchis, F. [SETI Institute, Carl Sagan Center, 189 N San Bernado Av, Mountain View, CA 94043 (United States); Garcia, E. V. [Department of Physics, Fisk University, 1000 17th Ave. N, Nashville, TN 37208 (United States); Margheim, S. [Gemini Observatory, Southern Operations Center, Casilla 603, La Serena (Chile); Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Irwin, J. M., E-mail: mariamc@cab.inta-csic.es [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States)

2012-07-10

Eclipsing binaries (EBs) provide critical laboratories for empirically testing predictions of theoretical models of stellar structure and evolution. Pre-main-sequence (PMS) EBs are particularly valuable, both due to their rarity and the highly dynamic nature of PMS evolution, such that a dense grid of PMS EBs is required to properly calibrate theoretical PMS models. Analyzing multi-epoch, multi-color light curves for {approx}2400 candidate Orion Nebula Cluster (ONC) members from our Warm Spitzer Exploration Science Program YSOVAR, we have identified 12 stars whose light curves show eclipse features. Four of these 12 EBs are previously known. Supplementing our light curves with follow-up optical and near-infrared spectroscopy, we establish two of the candidates as likely field EBs lying behind the ONC. We confirm the remaining six candidate systems, however, as newly identified ONC PMS EBs. These systems increase the number of known PMS EBs by over 50% and include the highest mass ({theta}{sup 1} Ori E, for which we provide a complete set of well-determined parameters including component masses of 2.807 and 2.797 M{sub Sun }) and longest-period (ISOY J053505.71-052354.1, P {approx} 20 days) PMS EBs currently known. In two cases ({theta}{sup 1} Ori E and ISOY J053526.88-044730.7), enough photometric and spectroscopic data exist to attempt an orbit solution and derive the system parameters. For the remaining systems, we combine our data with literature information to provide a preliminary characterization sufficient to guide follow-up investigations of these rare, benchmark systems.

YSOVAR: SIX PRE-MAIN-SEQUENCE ECLIPSING BINARIES IN THE ORION NEBULA CLUSTER

International Nuclear Information System (INIS)

Morales-Calderón, M.; Stauffer, J. R.; Rebull, L. M.; Stassun, K. G.; Vrba, F. J.; Prato, L.; Hillenbrand, L. A.; Carpenter, J. M.; Terebey, S.; Angione, J.; Covey, K. R.; Terndrup, D. M.; Gutermuth, R.; Song, I.; Plavchan, P.; Marchis, F.; García, E. V.; Margheim, S.; Luhman, K. L.; Irwin, J. M.

2012-01-01

Eclipsing binaries (EBs) provide critical laboratories for empirically testing predictions of theoretical models of stellar structure and evolution. Pre-main-sequence (PMS) EBs are particularly valuable, both due to their rarity and the highly dynamic nature of PMS evolution, such that a dense grid of PMS EBs is required to properly calibrate theoretical PMS models. Analyzing multi-epoch, multi-color light curves for ∼2400 candidate Orion Nebula Cluster (ONC) members from our Warm Spitzer Exploration Science Program YSOVAR, we have identified 12 stars whose light curves show eclipse features. Four of these 12 EBs are previously known. Supplementing our light curves with follow-up optical and near-infrared spectroscopy, we establish two of the candidates as likely field EBs lying behind the ONC. We confirm the remaining six candidate systems, however, as newly identified ONC PMS EBs. These systems increase the number of known PMS EBs by over 50% and include the highest mass (θ 1 Ori E, for which we provide a complete set of well-determined parameters including component masses of 2.807 and 2.797 M ☉ ) and longest-period (ISOY J053505.71–052354.1, P ∼ 20 days) PMS EBs currently known. In two cases (θ 1 Ori E and ISOY J053526.88–044730.7), enough photometric and spectroscopic data exist to attempt an orbit solution and derive the system parameters. For the remaining systems, we combine our data with literature information to provide a preliminary characterization sufficient to guide follow-up investigations of these rare, benchmark systems.

A measurement of π+p backward elastic differential cross-sections from 1.282 to 2.472 GeV/c

International Nuclear Information System (INIS)

Candlin, D.J.; Lowe, D.C.; Peach, K.J.

1984-02-01

New high statistics measurements of π + p elastic scattering differential cross-sections are presented at 30 momentum points between 1.282 and 2.472 GeV/c, covering most of the angular distribution outside the forward diffractive peak. These data show significant disagreements at some momenta with previous high statistics experiments and with current partial wave analyses. (author)

Binary catalogue of exoplanets

Science.gov (United States)

Schwarz, Richard; Bazso, Akos; Zechner, Renate; Funk, Barbara

2016-02-01

Since 1995 there is a database which list most of the known exoplanets (The Extrasolar Planets Encyclopaedia at http://exoplanet.eu/). With the growing number of detected exoplanets in binary and multiple star systems it became more important to mark and to separate them into a new database, which is not available in the Extrasolar Planets Encyclopaedia. Therefore we established an online database (which can be found at: http://www.univie.ac.at/adg/schwarz/multiple.html) for all known exoplanets in binary star systems and in addition for multiple star systems, which will be updated regularly and linked to the Extrasolar Planets Encyclopaedia. The binary catalogue of exoplanets is available online as data file and can be used for statistical purposes. Our database is divided into two parts: the data of the stars and the planets, given in a separate list. We describe also the different parameters of the exoplanetary systems and present some applications.

Serial binary interval ratios improve rhythm reproduction

Directory of Open Access Journals (Sweden)

Xiang eWu

2013-08-01

Full Text Available Musical rhythm perception is a natural human ability that involves complex cognitive processes. Rhythm refers to the organization of events in time, and musical rhythms have an underlying hierarchical metrical structure. The metrical structure induces the feeling of a beat and the extent to which a rhythm induces the feeling of a beat is referred to as its metrical strength. Binary ratios are the most frequent interval ratio in musical rhythms. Rhythms with hierarchical binary ratios are better discriminated and reproduced than rhythms with hierarchical non-binary ratios. However, it remains unclear whether a superiority of serial binary over non-binary ratios in rhythm perception and reproduction exists. In addition, how different types of serial ratios influence the metrical strength of rhythms remains to be elucidated. The present study investigated serial binary vs. non-binary ratios in a reproduction task. Rhythms formed with exclusively binary (1:2:4:8, non-binary integer (1:3:5:6, and non-integer (1:2.3:5.3:6.4 ratios were examined within a constant meter. The results showed that the 1:2:4:8 rhythm type was more accurately reproduced than the 1:3:5:6 and 1:2.3:5.3:6.4 rhythm types, and the 1:2.3:5.3:6.4 rhythm type was more accurately reproduced than the 1:3:5:6 rhythm type. Further analyses showed that reproduction performance was better predicted by the distribution pattern of event occurrences within an inter-beat interval, than by the coincidence of events with beats, or the magnitude and complexity of interval ratios. Whereas rhythm theories and empirical data emphasize the role of the coincidence of events with beats in determining metrical strength and predicting rhythm performance, the present results suggest that rhythm processing may be better understood when the distribution pattern of event occurrences is taken into account. These results provide new insights into the mechanisms underlining musical rhythm perception.

Serial binary interval ratios improve rhythm reproduction.

Science.gov (United States)

Wu, Xiang; Westanmo, Anders; Zhou, Liang; Pan, Junhao

2013-01-01

Musical rhythm perception is a natural human ability that involves complex cognitive processes. Rhythm refers to the organization of events in time, and musical rhythms have an underlying hierarchical metrical structure. The metrical structure induces the feeling of a beat and the extent to which a rhythm induces the feeling of a beat is referred to as its metrical strength. Binary ratios are the most frequent interval ratio in musical rhythms. Rhythms with hierarchical binary ratios are better discriminated and reproduced than rhythms with hierarchical non-binary ratios. However, it remains unclear whether a superiority of serial binary over non-binary ratios in rhythm perception and reproduction exists. In addition, how different types of serial ratios influence the metrical strength of rhythms remains to be elucidated. The present study investigated serial binary vs. non-binary ratios in a reproduction task. Rhythms formed with exclusively binary (1:2:4:8), non-binary integer (1:3:5:6), and non-integer (1:2.3:5.3:6.4) ratios were examined within a constant meter. The results showed that the 1:2:4:8 rhythm type was more accurately reproduced than the 1:3:5:6 and 1:2.3:5.3:6.4 rhythm types, and the 1:2.3:5.3:6.4 rhythm type was more accurately reproduced than the 1:3:5:6 rhythm type. Further analyses showed that reproduction performance was better predicted by the distribution pattern of event occurrences within an inter-beat interval, than by the coincidence of events with beats, or the magnitude and complexity of interval ratios. Whereas rhythm theories and empirical data emphasize the role of the coincidence of events with beats in determining metrical strength and predicting rhythm performance, the present results suggest that rhythm processing may be better understood when the distribution pattern of event occurrences is taken into account. These results provide new insights into the mechanisms underlining musical rhythm perception.

BHDD: Primordial black hole binaries code

Science.gov (United States)

Kavanagh, Bradley J.; Gaggero, Daniele; Bertone, Gianfranco

2018-06-01

BHDD (BlackHolesDarkDress) simulates primordial black hole (PBH) binaries that are clothed in dark matter (DM) halos. The software uses N-body simulations and analytical estimates to follow the evolution of PBH binaries formed in the early Universe.

Tidal and magnetic interactions in close binary stars

International Nuclear Information System (INIS)

Campbell, C.G.

1983-03-01

The thesis investigates the nature of non-synchronous motions in members of close binary stars under the influence of gravitational and magnetic fields existing in these systems, and the evolution of such motions in different classes of binaries. Largely convective stars are considered and a solution is found for the fluid flow associated with the non-synchronous rotation of such a secondary in a close binary system, taking tidal and rotational forces into account. The tidal velocity field is calculated for a low mass white dwarf secondary star in a twin - degenerate binary. It is found that the synchronisation times can be comparable to the lifetime of the binary so that some asynchronism may remain present. (U.K.)

Dynamical Formation and Merger of Binary Black Holes

Science.gov (United States)

Stone, Nicholas

2017-01-01

The advent of gravitational wave (GW) astronomy began with Advanced LIGO's 2015 discovery of GWs from coalescing black hole (BH) binaries. GW astronomy holds great promise for testing general relativity, but also for investigating open astrophysical questions not amenable to traditional electromagnetic observations. One such question concerns the origin of stellar mass BH binaries in the universe: do these form primarily from evolution of isolated binaries of massive stars, or do they form through more exotic dynamical channels? The best studied dynamical formation channel involves multibody interactions of BHs and stars in dense globular cluster environments, but many other dynamical scenarios have recently been proposed, ranging from the Kozai effect in hierarchical triple systems to BH binary formation in the outskirts of Toomre-unstable accretion disks surrounding supermassive black holes. The BH binaries formed through these processes will have different distributions of observable parameters (e.g. mass ratios, spins) than BH binaries formed through the evolution of isolated binary stars. In my talk I will overview these and other dynamical formation scenarios, and summarize the key observational tests that will enable Advanced LIGO or other future detectors to determine what formation pathway creates the majority of binary BHs in the universe. NCS thanks NASA, which has funded his work through Einstein postdoctoral grant PF5-160145.

Black Hole/Pulsar Binaries in the Galaxy

Science.gov (United States)

Shao, Yong; Li, Xiang-Dong

2018-04-01

We have performed population synthesis calculation on the formation of binaries containing a black hole (BH) and a neutron star (NS) in the Galactic disk. Some of important input parameters, especially for the treatment of common envelope evolution, are updated in the calculation. We have discussed the uncertainties from the star formation rate of the Galaxy and the velocity distribution of NS kicks on the birthrate (˜ 0.6-13 Myr^{-1}) of BH/NS binaries. From incident BH/NS binaries, by modelling the orbital evolution duo to gravitational wave radiation and the NS evolution as radio pulsars, we obtain the distributions of the observable parameters such as the orbital period, eccentricity and pulse period of the BH/pulsar binaries. We estimate that there may be ˜3 - 80 BH/pulsar binaries in the Galactic disk and around 10% of them could be detected by the Five-hundred-meter Aperture Spherical radio Telescope.

Investigating Dark Energy with Black Hole Binaries

International Nuclear Information System (INIS)

Mersini-Houghton, Laura; Kelleher, Adam

2009-01-01

The accelerated expansion of the universe is ascribed to the existence of dark energy. Black holes accrete dark energy. The accretion induces a mass change proportional to the energy density and pressure of the background dark energy fluid. The time scale during which the mass of black holes changes considerably is long relative to the age of the universe, thus beyond detection possibilities. We propose to take advantage of the modified black hole masses for exploring the equation of state w[z] of dark energy, by investigating the evolution of supermassive black hole binaries on a dark energy background. Deriving the signatures of dark energy accretion on the evolution of binaries, we find that dark energy imprints on the emitted gravitational radiation and on the changes in the orbital radius of the binary can be within detection limits for certain supermassive black hole binaries. This talk describes how binaries can provide a useful tool in obtaining complementary information on the nature of dark energy.

Black hole/pulsar binaries in the Galaxy

Science.gov (United States)

Shao, Yong; Li, Xiang-Dong

2018-06-01

We have performed population synthesis calculation on the formation of binaries containing a black hole (BH) and a neutron star (NS) in the Galactic disc. Some of important input parameters, especially for the treatment of common envelope evolution, are updated in the calculation. We have discussed the uncertainties from the star formation rate of the Galaxy and the velocity distribution of NS kicks on the birthrate (˜ 0.6-13 M yr^{-1}) of BH/NS binaries. From incident BH/NS binaries, by modelling the orbital evolution due to gravitational wave radiation and the NS evolution as radio pulsars, we obtain the distributions of the observable parameters such as the orbital period, eccentricity, and pulse period of the BH/pulsar binaries. We estimate that there may be ˜3-80 BH/pulsar binaries in the Galactic disc and around 10 per cent of them could be detected by the Five-hundred-metre Aperture Spherical radio Telescope.

Star formation history: Modeling of visual binaries

Science.gov (United States)

Gebrehiwot, Y. M.; Tessema, S. B.; Malkov, O. Yu.; Kovaleva, D. A.; Sytov, A. Yu.; Tutukov, A. V.

2018-05-01

Most stars form in binary or multiple systems. Their evolution is defined by masses of components, orbital separation and eccentricity. In order to understand star formation and evolutionary processes, it is vital to find distributions of physical parameters of binaries. We have carried out Monte Carlo simulations in which we simulate different pairing scenarios: random pairing, primary-constrained pairing, split-core pairing, and total and primary pairing in order to get distributions of binaries over physical parameters at birth. Next, for comparison with observations, we account for stellar evolution and selection effects. Brightness, radius, temperature, and other parameters of components are assigned or calculated according to approximate relations for stars in different evolutionary stages (main-sequence stars, red giants, white dwarfs, relativistic objects). Evolutionary stage is defined as a function of system age and component masses. We compare our results with the observed IMF, binarity rate, and binary mass-ratio distributions for field visual binaries to find initial distributions and pairing scenarios that produce observed distributions.

THE ELM SURVEY. V. MERGING MASSIVE WHITE DWARF BINARIES

International Nuclear Information System (INIS)

Brown, Warren R.; Kenyon, Scott J.; Kilic, Mukremin; Gianninas, A.; Allende Prieto, Carlos

2013-01-01

We present the discovery of 17 low-mass white dwarfs (WDs) in short-period (P ≤ 1 day) binaries. Our sample includes four objects with remarkable log g ≅ 5 surface gravities and orbital solutions that require them to be double degenerate binaries. All of the lowest surface gravity WDs have metal lines in their spectra implying long gravitational settling times or ongoing accretion. Notably, six of the WDs in our sample have binary merger times 0.9 M ☉ companions. If the companions are massive WDs, these four binaries will evolve into stable mass transfer AM CVn systems and possibly explode as underluminous supernovae. If the companions are neutron stars, then these may be millisecond pulsar binaries. These discoveries increase the number of detached, double degenerate binaries in the ELM Survey to 54; 31 of these binaries will merge within a Hubble time.

THE ELM SURVEY. V. MERGING MASSIVE WHITE DWARF BINARIES

Energy Technology Data Exchange (ETDEWEB)

Brown, Warren R.; Kenyon, Scott J. [Smithsonian Astrophysical Observatory, 60 Garden St, Cambridge, MA 02138 (United States); Kilic, Mukremin; Gianninas, A. [Homer L. Dodge Department of Physics and Astronomy, University of Oklahoma, 440 W. Brooks St., Norman, OK, 73019 (United States); Allende Prieto, Carlos, E-mail: wbrown@cfa.harvard.edu, E-mail: skenyon@cfa.harvard.edu, E-mail: kilic@ou.edu, E-mail: alexg@nhn.ou.edu, E-mail: callende@iac.es [Instituto de Astrofisica de Canarias, E-38205, La Laguna, Tenerife (Spain)

2013-05-20

We present the discovery of 17 low-mass white dwarfs (WDs) in short-period (P {<=} 1 day) binaries. Our sample includes four objects with remarkable log g {approx_equal} 5 surface gravities and orbital solutions that require them to be double degenerate binaries. All of the lowest surface gravity WDs have metal lines in their spectra implying long gravitational settling times or ongoing accretion. Notably, six of the WDs in our sample have binary merger times <10 Gyr. Four have {approx}>0.9 M{sub Sun} companions. If the companions are massive WDs, these four binaries will evolve into stable mass transfer AM CVn systems and possibly explode as underluminous supernovae. If the companions are neutron stars, then these may be millisecond pulsar binaries. These discoveries increase the number of detached, double degenerate binaries in the ELM Survey to 54; 31 of these binaries will merge within a Hubble time.

Broad-band monitoring tracing the evolution of the jet and disc in the black hole candidate X-ray binary MAXI J1659-152

NARCIS (Netherlands)

van der Horst, A.J.; Curran, P.A.; Miller-Jonis, J.C.A.; Linford, J.D.; Gorosabel, J.; Russell, D.M.; De Ugarte Postigo, A.; Lundgren, A.A.; Taylor, G.B.; Maitra, D.; Guziy, S.; Belloni, T.M.; Kouveliotou, C.; Jonker, P.G.; Kamble, A.; Paragi, Z.; Homan, J.; Kuulkers, E.; Granot, J.; Altamirano, D.; Buxton, M.M.; Castro-Tirado, A.; Fender, R.P.; Garret, M.A.; Gehrels, N.; Hartmann, D.H.; Kennea, J.A.; Krimm, H.A.; Mangano, V.; Ramirez-Ruiz, E.; Romano, P.; Wijers, R.A.M.J.; Wijnands, R.; Yang, Y.J.

2013-01-01

MAXI J1659−152 was discovered on 2010 September 25 as a new X-ray transient, initially identified as a gamma-ray burst, but was later shown to be a new X-ray binary with a black hole as the most likely compact object. Dips in the X-ray light curves have revealed that MAXI J1659−152 is the shortest

Constraining The Abundance Of Massive Black Hole Binaries By Spectroscopic Monitoring Of Quasars With Offset Broad Emission Lines

Science.gov (United States)

Liu, Xin; Shen, Y.

2012-05-01

A fraction of quasars have long been known to show significant bulk velocity offsets (of a few hundred to thousands of km/s) in the broad permitted emission lines with respect to host galaxy systemic redshift. Various scenarios may explain these features such as massive black hole binaries or broad line region gas kinematics. As previously demonstrated by the dedicated work of Eracleous and colleagues, long-term spectroscopic monitoring provides a promising test to discriminate between alternative scenarios. Here, we present a sample of 300 shifted-line quasars homogeneously selected from the SDSS DR7. For 60 of them, we have conducted second-epoch optical spectra using MMT/BCS, ARC 3.5m/DIS, and/or FLWO 1.5m/FAST. These new observations, combined with the existing SDSS spectra, enable us to constrain the velocity drifts of these shifted broad lines with time baselines of a few years up to a decade. Previous work has been focusing on objects with extreme velocity offsets: > 1000 km/s. Our work extends to the parameter space of smaller velocity offsets, where larger velocity drifts would be expected in the binary scenario. Our results may be used to identify strong candidates for and to constrain the abundance of massive black hole binaries, which are expected in the hierarchical universe, but have so far been illusive.

Eliciting Subjective Probabilities with Binary Lotteries

DEFF Research Database (Denmark)

Harrison, Glenn W.; Martínez-Correa, Jimmy; Swarthout, J. Todd

objective probabilities. Drawing a sample from the same subject population, we find evidence that the binary lottery procedure induces linear utility in a subjective probability elicitation task using the Quadratic Scoring Rule. We also show that the binary lottery procedure can induce direct revelation...

Variance in binary stellar population synthesis

Science.gov (United States)

Breivik, Katelyn; Larson, Shane L.

2016-03-01

In the years preceding LISA, Milky Way compact binary population simulations can be used to inform the science capabilities of the mission. Galactic population simulation efforts generally focus on high fidelity models that require extensive computational power to produce a single simulated population for each model. Each simulated population represents an incomplete sample of the functions governing compact binary evolution, thus introducing variance from one simulation to another. We present a rapid Monte Carlo population simulation technique that can simulate thousands of populations in less than a week, thus allowing a full exploration of the variance associated with a binary stellar evolution model.

"Binary" and "non-binary" detection tasks: are current performance measures optimal?

Science.gov (United States)

Gur, David; Rockette, Howard E; Bandos, Andriy I

2007-07-01

We have observed that a very large fraction of responses for several detection tasks during the performance of observer studies are in the extreme ranges of lower than 11% or higher than 89% regardless of the actual presence or absence of the abnormality in question or its subjectively rated "subtleness." This observation raises questions regarding the validity and appropriateness of using multicategory rating scales for such detection tasks. Monte Carlo simulation of binary and multicategory ratings for these tasks demonstrate that the use of the former (binary) often results in a less biased and more precise summary index and hence may lead to a higher statistical power for determining differences between modalities.

АЛЛЕЛИ 282Y И H63D ГЕНА HFE И ПРЕДРАСПОЛОЖЕННОСТЬ К СИНДРОМУ ХРОНИЧЕСКОЙ ПЕРЕГРУЗКИ ЖЕЛЕЗОМ И НАРУШЕНИЮ ПОРФИРИНОВОГО ОБМЕНА ПРИ НЕАЛКОГОЛЬНОЙ ЖИРОВОЙ БОЛЕЗНИ ПЕЧЕНИ

Directory of Open Access Journals (Sweden)

А. Б. Кривошеев

2012-01-01

Full Text Available Testing for carriers of mutations C282Y and H63D HFE gene in 57 patients with nonalcoholic fatty liver disease was completed. Abnormalities in the metabolism of porphyrins were detected in 39 (68.4% patients, mutations C282Y and H63D were detected in 16 (28.1% patients, of whom 12 patients with metabolic disorders of porphyrins and symptoms of the syndrome of chronic iron overload. In 41 (71.9% patients without the mutations found disorders metabolism of porphyrins were in 27 (65.8% patients. They had no symptoms of the syndrome of chronic iron overload. Detection of C282Y and H63D mutations in the gene HFE in conjunction with disorders of porphyrin metabolism in association with the syndrome of chronic iron overload, but the probability will consider these patients as candidates for inclusion in the higher risk of formation of liver fibrosis.

PRE-SPECTROSCOPIC FALSE-POSITIVE ELIMINATION OF KEPLER PLANET CANDIDATES

International Nuclear Information System (INIS)

Batalha, Natalie M.; Rowe, Jason F.; Borucki, William J.; Koch, David G.; Lissauer, Jack J.; Gilliland, Ronald L.; Jenkins, Jon J.; Caldwell, Douglas; Dunham, Edward W.; Gautier, Thomas N.; Howell, Steve B.; Latham, David W.; Marcy, Geoff W.; Prsa, Andrej

2010-01-01

Ten days of commissioning data (Quarter 0) and 33 days of science data (Quarter 1) yield instrumental flux time series of ∼150,000 stars that were combed for transit events, termed threshold crossing events(TCE), each having a total detection statistic above 7.1σ. TCE light curves are modeled as star+planet systems. Those returning a companion radius smaller than 2R J are assigned a Kepler Object of Interest (KOI) number. The raw flux, pixel flux, and flux-weighted centroids of every KOI are scrutinized to assess the likelihood of being an astrophysical false positive versus the likelihood of being a planetary companion. This vetting using Kepler data is referred to as data validation (DV). Herein, we describe the DV metrics and graphics used to identify viable planet candidates amongst the KOIs. Light curve modeling tests for (1) the difference in depth of the odd- versus even-numbered transits, (2) evidence of ellipsoidal variations, and (3) evidence of a secondary eclipse event at phase = 0.5. Flux-weighted centroids are used to test for signals correlated with transit events with a magnitude and direction indicative of a background eclipsing binary. Centroid time series are complimented by analysis of images taken in-transit versus out-of-transit, the difference often revealing the pixel contributing the most to the flux change during transit. Examples are shown to illustrate each test. Candidates passing DV are submitted to ground-based observers for further false-positive elimination or confirmation/characterization.

THE AGES OF HIGH-MASS X-RAY BINARIES IN NGC 2403 AND NGC 300

Energy Technology Data Exchange (ETDEWEB)

Williams, Benjamin F.; Binder, Breanna A.; Dalcanton, Julianne J. [Department of Astronomy, Box 351580, University of Washington, Seattle, WA 98195 (United States); Eracleous, Michael [Department of Astronomy and Astrophysics and Center for Gravitational Wave Physics, Pennsylvania State University, 525 Davey Lab, University Park, PA 16803 (United States); Dolphin, Andrew, E-mail: ben@astro.washington.edu, E-mail: bbinder@astro.washington.edu, E-mail: jd@astro.washington.edu, E-mail: mce@astro.psu.edu, E-mail: adolphin@raytheon.com [Raytheon Company, Tucson, AZ 85734 (United States)

2013-07-20

We have examined resolved stellar photometry from HST imaging surrounding 18 high-mass X-ray binary (HMXB) candidates in NGC 300 and NGC 2403 as determined from combined Chandra/HST analysis. We have fit the color-magnitude distribution of the surrounding stars with stellar evolution models. All but one region in NGC 300 and two in NGC 2403 contain a population with an age between 20 and 70 Myr. One of the candidates is the ultraluminous X-ray source in NGC 2403, which we associate with a 60 {+-} 5 Myr old population. These age distributions provide additional evidence that 16 of these 18 candidates are HMXBs. Furthermore, our results suggest that the most common HMXB age in these galaxies is 40-55 Myr. This preferred age is similar to observations of HMXBs in the Small Magellanic Cloud, providing new evidence of this formation timescale, but in higher metallicity populations. We suggest that this preferred HMXB age is the result of the fortuitous combination of two physical effects. First, this is the age of a population when the greatest rate of core-collapse events should be occurring, maximizing neutron star production. Second, this is the age when B stars are most likely to be actively losing mass. We also discuss our results in the context of HMXB feedback in galaxies, confirming HMXBs as a potentially important source of energy for the interstellar medium in low-mass galaxies.

Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

Science.gov (United States)

Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

2009-10-01

Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

Compact stars and the evolution of binary systems

NARCIS (Netherlands)

van den Heuvel, E.P.J.

2011-01-01

The Chandrasekhar limit is of key importance for the evolution of white dwarfs in binary systems and for the formation of neutron stars and black holes in binaries. Mass transfer can drive a white dwarf in a binary over the Chandrasekhar limit, which may lead to a Type Ia supernova (in case of a CO

BROWN DWARF BINARIES FROM DISINTEGRATING TRIPLE SYSTEMS

Energy Technology Data Exchange (ETDEWEB)

Reipurth, Bo [Institute for Astronomy and NASA Astrobiology Institute University of Hawaii, 640 N. Aohoku Place, Hilo, HI 96720 (United States); Mikkola, Seppo, E-mail: reipurth@ifa.hawaii.edu, E-mail: Seppo.Mikkola@utu.fi [Tuorla Observatory, University of Turku, Väisäläntie 20, Piikkiö (Finland)

2015-04-15

Binaries in which both components are brown dwarfs (BDs) are being discovered at an increasing rate, and their properties may hold clues to their origin. We have carried out 200,000 N-body simulations of three identical stellar embryos with masses drawn from a Chabrier IMF and embedded in a molecular core. The bodies are initially non-hierarchical and undergo chaotic motions within the cloud core, while accreting using Bondi–Hoyle accretion. The coupling of dynamics and accretion often leads to one or two dominant bodies controlling the center of the cloud core, while banishing the other(s) to the lower-density outskirts, leading to stunted growth. Eventually each system transforms either to a bound hierarchical configuration or breaks apart into separate single and binary components. The orbital motion is followed for 100 Myr. In order to illustrate 200,000 end-states of such dynamical evolution with accretion, we introduce the “triple diagnostic diagram,” which plots two dimensionless numbers against each other, representing the binary mass ratio and the mass ratio of the third body to the total system mass. Numerous freefloating BD binaries are formed in these simulations, and statistical properties are derived. The separation distribution function is in good correspondence with observations, showing a steep rise at close separations, peaking around 13 AU and declining more gently, reaching zero at separations greater than 200 AU. Unresolved BD triple systems may appear as wider BD binaries. Mass ratios are strongly peaked toward unity, as observed, but this is partially due to the initial assumptions. Eccentricities gradually increase toward higher values, due to the lack of viscous interactions in the simulations, which would both shrink the orbits and decrease their eccentricities. Most newborn triple systems are unstable and while there are 9209 ejected BD binaries at 1 Myr, corresponding to about 4% of the 200,000 simulations, this number has grown to

BROWN DWARF BINARIES FROM DISINTEGRATING TRIPLE SYSTEMS

International Nuclear Information System (INIS)

Reipurth, Bo; Mikkola, Seppo

2015-01-01

Binaries in which both components are brown dwarfs (BDs) are being discovered at an increasing rate, and their properties may hold clues to their origin. We have carried out 200,000 N-body simulations of three identical stellar embryos with masses drawn from a Chabrier IMF and embedded in a molecular core. The bodies are initially non-hierarchical and undergo chaotic motions within the cloud core, while accreting using Bondi–Hoyle accretion. The coupling of dynamics and accretion often leads to one or two dominant bodies controlling the center of the cloud core, while banishing the other(s) to the lower-density outskirts, leading to stunted growth. Eventually each system transforms either to a bound hierarchical configuration or breaks apart into separate single and binary components. The orbital motion is followed for 100 Myr. In order to illustrate 200,000 end-states of such dynamical evolution with accretion, we introduce the “triple diagnostic diagram,” which plots two dimensionless numbers against each other, representing the binary mass ratio and the mass ratio of the third body to the total system mass. Numerous freefloating BD binaries are formed in these simulations, and statistical properties are derived. The separation distribution function is in good correspondence with observations, showing a steep rise at close separations, peaking around 13 AU and declining more gently, reaching zero at separations greater than 200 AU. Unresolved BD triple systems may appear as wider BD binaries. Mass ratios are strongly peaked toward unity, as observed, but this is partially due to the initial assumptions. Eccentricities gradually increase toward higher values, due to the lack of viscous interactions in the simulations, which would both shrink the orbits and decrease their eccentricities. Most newborn triple systems are unstable and while there are 9209 ejected BD binaries at 1 Myr, corresponding to about 4% of the 200,000 simulations, this number has grown to

Maximum mass ratio of AM CVn-type binary systems and maximum white dwarf mass in ultra-compact X-ray binaries

Directory of Open Access Journals (Sweden)

Arbutina Bojan

2011-01-01

Full Text Available AM CVn-type stars and ultra-compact X-ray binaries are extremely interesting semi-detached close binary systems in which the Roche lobe filling component is a white dwarf transferring mass to another white dwarf, neutron star or a black hole. Earlier theoretical considerations show that there is a maximum mass ratio of AM CVn-type binary systems (qmax ≈ 2/3 below which the mass transfer is stable. In this paper we derive slightly different value for qmax and more interestingly, by applying the same procedure, we find the maximum expected white dwarf mass in ultra-compact X-ray binaries.

SDSS J1254+0846: A BINARY QUASAR CAUGHT IN THE ACT OF MERGING

International Nuclear Information System (INIS)

Green, Paul J.; Cox, Thomas J.; Aldcroft, Thomas L.; Myers, Adam D.; Barkhouse, Wayne A.; Mulchaey, John S.; Bennert, Vardha N.

2010-01-01

We present the first luminous, spatially resolved binary quasar that clearly inhabits an ongoing galaxy merger. SDSS J125455.09+084653.9 and SDSS J125454.87+084652.1 (SDSS J1254+0846 hereafter) are two luminous z = 0.44 radio-quiet quasars, with a radial velocity difference of just 215 km s -1 , separated on the sky by 21 kpc in a disturbed host galaxy merger showing obvious tidal tails. The pair was targeted as part of a complete sample of binary quasar candidates with small transverse separations drawn from SDSS DR6 photometry. We present follow-up optical imaging which shows broad, symmetrical tidal arm features spanning some 75 kpc at the quasars' redshift. Previously, the triggering of two quasars during a merger had only been hypothesized but our observations provide strong evidence of such an event. SDSS J1254+0846, as a face-on, pre-coalescence merger hosting two luminous quasars separated by a few dozen kpc, provides a unique opportunity to probe quasar activity in an ongoing gas-rich merger. Numerical modeling suggests that the system consists of two massive disk galaxies prograde to their mutual orbit, caught during the first passage of an active merger. This demonstrates rapid black hole growth during the early stages of a merger between galaxies with pre-existing bulges. Neither of the two luminous nuclei show significant intrinsic absorption by gas or dust in our optical or X-ray observations, illustrating that not all merging quasars will be in an obscured, ultraluminous phase. We find that the Eddington ratio for the fainter component B is rather normal, while for the A component L/L Edd is quite (>3σ) high compared to quasars of similar luminosity and redshift, possibly evidence for strong merger-triggered accretion. More such mergers should be identifiable at higher redshifts using binary quasars as tracers.

Non-binary or genderqueer genders.

Science.gov (United States)

Richards, Christina; Bouman, Walter Pierre; Seal, Leighton; Barker, Meg John; Nieder, Timo O; T'Sjoen, Guy

2016-01-01

Some people have a gender which is neither male nor female and may identify as both male and female at one time, as different genders at different times, as no gender at all, or dispute the very idea of only two genders. The umbrella terms for such genders are 'genderqueer' or 'non-binary' genders. Such gender identities outside of the binary of female and male are increasingly being recognized in legal, medical and psychological systems and diagnostic classifications in line with the emerging presence and advocacy of these groups of people. Population-based studies show a small percentage--but a sizable proportion in terms of raw numbers--of people who identify as non-binary. While such genders have been extant historically and globally, they remain marginalized, and as such--while not being disorders or pathological in themselves--people with such genders remain at risk of victimization and of minority or marginalization stress as a result of discrimination. This paper therefore reviews the limited literature on this field and considers ways in which (mental) health professionals may assist the people with genderqueer and non-binary gender identities and/or expressions they may see in their practice. Treatment options and associated risks are discussed.

The Young Visual Binary Survey

Science.gov (United States)

Prato, Lisa; Avilez, Ian; Lindstrom, Kyle; Graham, Sean; Sullivan, Kendall; Biddle, Lauren; Skiff, Brian; Nofi, Larissa; Schaefer, Gail; Simon, Michal

2018-01-01

Differences in the stellar and circumstellar properties of the components of young binaries provide key information about star and disk formation and evolution processes. Because objects with separations of a few to a few hundred astronomical units share a common environment and composition, multiple systems allow us to control for some of the factors which play into star formation. We are completing analysis of a rich sample of about 100 pre-main sequence binaries and higher order multiples, primarily located in the Taurus and Ophiuchus star forming regions. This poster will highlight some of out recent, exciting results. All reduced spectra and the results of our analysis will be publicly available to the community at http://jumar.lowell.edu/BinaryStars/. Support for this research was provided in part by NSF award AST-1313399 and by NASA Keck KPDA funding.

A Survey of Binary Similarity and Distance Measures

Directory of Open Access Journals (Sweden)

Seung-Seok Choi

2010-02-01

Full Text Available The binary feature vector is one of the most common representations of patterns and measuring similarity and distance measures play a critical role in many problems such as clustering, classification, etc. Ever since Jaccard proposed a similarity measure to classify ecological species in 1901, numerous binary similarity and distance measures have been proposed in various fields. Applying appropriate measures results in more accurate data analysis. Notwithstanding, few comprehensive surveys on binary measures have been conducted. Hence we collected 76 binary similarity and distance measures used over the last century and reveal their correlations through the hierarchical clustering technique.

The binary white dwarf LHS 3236

Energy Technology Data Exchange (ETDEWEB)

Harris, Hugh C.; Dahn, Conard C.; Canzian, Blaise; Guetter, Harry H.; Levine, Stephen E.; Luginbuhl, Christian B.; Monet, Alice K. B.; Stone, Ronald C.; Subasavage, John P.; Tilleman, Trudy; Walker, Richard L. [US Naval Observatory, 10391 West Naval Observatory Road, Flagstaff, AZ 86001-8521 (United States); Dupuy, Trent J.; Liu, Michael C. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Hartkopf, William I. [US Naval Observatory, 3450 Massachusetts Avenue, N.W., Washington, DC 20392-5420 (United States); Ireland, Michael J. [Department of Physics and Astronomy, Macquarie University, New South Wales, NSW 2109 (Australia); Leggett, S. K., E-mail: hch@nofs.navy.mil [Gemini Observatory, 670 N. Aohoku Place, Hilo, HI 96720 (United States)

2013-12-10

The white dwarf LHS 3236 (WD1639+153) is shown to be a double-degenerate binary, with each component having a high mass. Astrometry at the U.S. Naval Observatory gives a parallax and distance of 30.86 ± 0.25 pc and a tangential velocity of 98 km s{sup –1}, and reveals binary orbital motion. The orbital parameters are determined from astrometry of the photocenter over more than three orbits of the 4.0 yr period. High-resolution imaging at the Keck Observatory resolves the pair with a separation of 31 and 124 mas at two epochs. Optical and near-IR photometry give a set of possible binary components. Consistency of all data indicates that the binary is a pair of DA stars with temperatures near 8000 and 7400 K and with masses of 0.93 and 0.91 M {sub ☉}; also possible is a DA primary and a helium DC secondary with temperatures near 8800 and 6000 K and with masses of 0.98 and 0.69 M {sub ☉}. In either case, the cooling ages of the stars are ∼3 Gyr and the total ages are <4 Gyr. The combined mass of the binary (1.66-1.84 M {sub ☉}) is well above the Chandrasekhar limit; however, the timescale for coalescence is long.

Resolved, expanding jets in the Galactic black hole candidate XTE J1908+094

Science.gov (United States)

Rushton, A. P.; Miller-Jones, J. C. A.; Curran, P. A.; Sivakoff, G. R.; Rupen, M. P.; Paragi, Z.; Spencer, R. E.; Yang, J.; Altamirano, D.; Belloni, T.; Fender, R. P.; Krimm, H. A.; Maitra, D.; Migliari, S.; Russell, D. M.; Russell, T. D.; Soria, R.; Tudose, V.

2017-07-01

Black hole X-ray binaries undergo occasional outbursts caused by changing inner accretion flows. Here we report high angular resolution radio observations of the 2013 outburst of the black hole candidate X-ray binary system XTE J1908+094, using data from the Very Long Baseline Array and European VLBI Network. We show that following a hard-to-soft state transition, we detect moving jet knots that appear asymmetric in morphology and brightness, and expand to become laterally resolved as they move away from the core, along an axis aligned approximately -11° east of north. We initially see only the southern component, whose evolution gives rise to a 15-mJy radio flare and generates the observed radio polarization. This fades and becomes resolved out after 4 days, after which a second component appears to the north, moving in the opposite direction. From the timing of the appearance of the knots relative to the X-ray state transition, a 90° swing of the inferred magnetic field orientation, the asymmetric appearance of the knots, their complex and evolving morphology, and their low speeds, we interpret the knots as working surfaces where the jets impact the surrounding medium. This would imply a substantially denser environment surrounding XTE J1908+094 than has been inferred to exist around the microquasar sources GRS 1915+105 and GRO J1655-40.

The evolutionary adaptation of the C282Y mutation to culture and climate during the European Neolithic

OpenAIRE

Heath, Kathleen M.; Axton, Jacob H.; McCullough, John M.; Harris, Nathan

2016-01-01

ABSTRACT Objectives The C282Y allele is the major cause of hemochromatosis as a result of excessive iron absorption. The mutation arose in continental Europe no earlier than 6,000 years ago, coinciding with the arrival of the Neolithic agricultural revolution. Here we hypothesize that this new Neolithic diet, which originated in the sunny warm and dry climates of the Middle East, was carried by migrating farmers into the chilly and damp environments of Europe where iron is a critical micronut...

Binary and Millisecond Pulsars

Directory of Open Access Journals (Sweden)

Lorimer Duncan R.

2005-11-01

Full Text Available We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1700. There are now 80 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 103 pulsars in 24 of the Galactic globular clusters. Recent highlights have been the discovery of the first ever double pulsar system and a recent flurry of discoveries in globular clusters, in particular Terzan 5.

Eclipsing binary stars with a δ Scuti component

Science.gov (United States)

Kahraman Aliçavuş, F.; Soydugan, E.; Smalley, B.; Kubát, J.

2017-09-01

Eclipsing binaries with a δ Sct component are powerful tools to derive the fundamental parameters and probe the internal structure of stars. In this study, spectral analysis of six primary δ Sct components in eclipsing binaries has been performed. Values of Teff, v sin I, and metallicity for the stars have been derived from medium-resolution spectroscopy. Additionally, a revised list of δ Sct stars in eclipsing binaries is presented. In this list, we have only given the δ Sct stars in eclipsing binaries to show the effects of the secondary components and tidal-locking on the pulsations of primary δ Sct components. The stellar pulsation, atmospheric and fundamental parameters (e.g. mass, radius) of 92 δ Sct stars in eclipsing binaries have been gathered. Comparison of the properties of single and eclipsing binary member δ Sct stars has been made. We find that single δ Sct stars pulsate in longer periods and with higher amplitudes than the primary δ Sct components in eclipsing binaries. The v sin I of δ Sct components is found to be significantly lower than that of single δ Sct stars. Relationships between the pulsation periods, amplitudes and stellar parameters in our list have been examined. Significant correlations between the pulsation periods and the orbital periods, Teff, log g, radius, mass ratio, v sin I and the filling factor have been found.

Tidal Disruption of Inclined or Eccentric Binaries by Massive Black Holes

Science.gov (United States)

Brown, Harriet; Kobayashi, Shiho; Rossi, Elena M.; Sari, Re'em

2018-04-01

Binary stars that are on close orbits around massive black holes (MBH) such as Sgr A* in the centre of the Milky Way are liable to undergo tidal disruption and eject a hypervelocity star. We study the interaction between such a MBH and circular binaries for general binary orientations and penetration depths (i.e. binaries penetrate into the tidal radius around the BH). We show that for very deep penetrators, almost all binaries are disrupted when the binary rotation axis is roughly oriented toward the BH or it is in the opposite direction. The surviving chance becomes significant when the angle between the binary rotation axis and the BH direction is between 0.15π and 0.85π. The surviving chance is as high as ˜20% when the binary rotation axis is perpendicular to the BH direction. However, for shallow penetrators, the highest disruption chance is found in such a perpendicular case, especially in the prograde case. This is because the dynamics of shallow penetrators is more sensitive to the relative orientation of the binary and orbital angular momenta. We provide numerical fits to the disruption probability and energy gain at the the BH encounter as a function of the penetration depth. The latter can be simply rescaled in terms of binary masses, their initial separation and the binary-to-BH mass ratio to evaluate the ejection velocity of a binary members in various systems. We also investigate the disruption of coplanar, eccentric binaries by a MBH. It is shown that for highly eccentric binaries retrograde orbits have a significantly increased disruption probability and ejection velocities compared to the circular binaries.

Evolution of binaries with compact objects in globular clusters

OpenAIRE

Ivanova, Natalia

2017-01-01

Dynamical interactions that take place between objects in dense stellar systems lead to frequent formation of exotic stellar objects, unusual binaries, and systems of higher multiplicity. They are most important for the formation of binaries with neutron stars and black holes, which are usually observationally revealed in mass-transferring binaries. Here we review the current understanding of compact object's retention, of the metallicity dependence on the formation of low-mass X-ray binaries...

Non-Binary Protograph-Based LDPC Codes: Analysis,Enumerators and Designs

OpenAIRE

Sun, Yizeng

2013-01-01

Non-binary LDPC codes can outperform binary LDPC codes using sum-product algorithm with higher computation complexity. Non-binary LDPC codes based on protographs have the advantage of simple hardware architecture. In the first part of this thesis, we will use EXIT chart analysis to compute the thresholds of different protographs over GF(q). Based on threshold computation, some non-binary protograph-based LDPC codes are designed and their frame error rates are compared with binary LDPC codes. ...

A novel binary T-vector with the GFP reporter gene for promoter characterization.

Directory of Open Access Journals (Sweden)

Shu-Ye Jiang

Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

Gamma Prime Stability in Haynes 282: Theoretical and Experimental Considerations

Science.gov (United States)

Hawk, Jeffrey A.; Cheng, Tian-Le; Sears, John S.; Jablonski, Paul D.; Wen, You-Hai

2015-11-01

The life cycle requirements for advanced Ni alloys are very demanding and can be on the order of several hundreds of thousands of hours. Results are presented on a wrought Ni-based superalloy designed within the nominal chemistry range of Haynes 282 with a fixed amount of γ' strengthening phase, and either low Al or Ti (within the alloy specification) to give different ratios of Ti/Al, and thus, different γ' misfit with the γ matrix. The effect that these changes have on the γ' misfit and its relevance to long-term microstructural stability is being explored both experimentally as well as with computational modeling with results through almost 10,000 h. The basics of the modeling approach are presented as are the procedures for evaluating the γ' volume fractions from transmission electron microscopy (TEM) micrographs and correcting these volume fractions for truncation error due to TEM foil thickness. Results on each alloy formulation are compared and discussed with respect to possible γ' coarsening due to the different Ti/Al ratio and what this might mean for the long-term stability of the alloy.

Citizen Candidates Under Uncertainty

OpenAIRE

Eguia, Jon X.

2005-01-01

In this paper we make two contributions to the growing literature on "citizen-candidate" models of representative democracy. First, we add uncertainty about the total vote count. We show that in a society with a large electorate, where the outcome of the election is uncertain and where winning candidates receive a large reward from holding office, there will be a two-candidate equilibrium and no equilibria with a single candidate. Second, we introduce a new concept of equilibrium, which we te...

Reconciliation with non-binary species trees.

Science.gov (United States)

Vernot, Benjamin; Stolzer, Maureen; Goldman, Aiton; Durand, Dannie

2008-10-01

Reconciliation extracts information from the topological incongruence between gene and species trees to infer duplications and losses in the history of a gene family. The inferred duplication-loss histories provide valuable information for a broad range of biological applications, including ortholog identification, estimating gene duplication times, and rooting and correcting gene trees. While reconciliation for binary trees is a tractable and well studied problem, there are no algorithms for reconciliation with non-binary species trees. Yet a striking proportion of species trees are non-binary. For example, 64% of branch points in the NCBI taxonomy have three or more children. When applied to non-binary species trees, current algorithms overestimate the number of duplications because they cannot distinguish between duplication and incomplete lineage sorting. We present the first algorithms for reconciling binary gene trees with non-binary species trees under a duplication-loss parsimony model. Our algorithms utilize an efficient mapping from gene to species trees to infer the minimum number of duplications in O(|V(G) | x (k(S) + h(S))) time, where |V(G)| is the number of nodes in the gene tree, h(S) is the height of the species tree and k(S) is the size of its largest polytomy. We present a dynamic programming algorithm which also minimizes the total number of losses. Although this algorithm is exponential in the size of the largest polytomy, it performs well in practice for polytomies with outdegree of 12 or less. We also present a heuristic which estimates the minimal number of losses in polynomial time. In empirical tests, this algorithm finds an optimal loss history 99% of the time. Our algorithms have been implemented in NOTUNG, a robust, production quality, tree-fitting program, which provides a graphical user interface for exploratory analysis and also supports automated, high-throughput analysis of large data sets.

THE DOUBLE-DEGENERATE NUCLEUS OF THE PLANETARY NEBULA TS 01: A CLOSE BINARY EVOLUTION SHOWCASE

International Nuclear Information System (INIS)

Tovmassian, Gagik; Richer, Michael G.; Yungelson, Lev; Rauch, Thomas; Suleimanov, Valery; Napiwotzki, Ralf; Stasinska, Grazyna; Tomsick, John; Wilms, Joern; Morisset, Christophe; Pena, Miriam

2010-01-01

We present a detailed investigation of SBS 1150+599A, a close binary star hosted by the planetary nebula PN G135.9+55.9 (TS 01). The nebula, located in the Galactic halo, is the most oxygen-poor known to date and is the only one known to harbor a double degenerate core. We present XMM-Newton observations of this object, which allowed the detection of the previously invisible component of the binary core, whose existence was inferred so far only from radial velocity (RV) and photometric variations. The parameters of the binary system were deduced from a wealth of information via three independent routes using the spectral energy distribution (from the infrared to X-rays), the light and RV curves, and a detailed model atmosphere fitting of the stellar absorption features of the optical/UV component. We find that the cool component must have a mass of 0.54 ± 0.2 M sun , an average effective temperature, T eff , of 58,000 ± 3000 K, a mean radius of 0.43 ± 0.3 R sun , a gravity, log g = 5.0 ± 0.3, and that it nearly fills its Roche lobe. Its surface elemental abundances are found to be: 12 + log He/H = 10.95 ± 0.04 dex, 12 + log C/H = 7.20 ± 0.3 dex, 12 + log N/H eff = 160-180 kK, a luminosity of about ∼10 4 L sun and a radius slightly larger than that of a white dwarf. It is probably bloated and heated as a result of intense accretion and nuclear burning on its surface in the past. The total mass of the binary system is very close to the Chandrasekhar limit. This makes TS 01 one of the best Type Ia supernova progenitor candidates. We propose two possible scenarios for the evolution of the system up to its present stage.

Influence of non-binary effects on intranuclear cascade method

International Nuclear Information System (INIS)

Gomes, E.H.C.

1985-01-01

The importance of non binary process effects in the intranuclear cascade method is analysed. It is shown that, in the higher density steps, the non binary collisions lead to baryon density distribution and rapidity differents from the one obtained using the usual intranuclear cascade method (limited to purely binary collisions). The validity of the applications of binary intranuclear cascade method to the simulation of the thermal equilibrium, nuclear transparency and particle production, is discussed. (M.C.K.) [pt

THE CLOSE BINARY FRACTION OF DWARF M STARS

International Nuclear Information System (INIS)

Clark, Benjamin M.; Blake, Cullen H.; Knapp, Gillian R.

2012-01-01

We describe a search for close spectroscopic dwarf M star binaries using data from the Sloan Digital Sky Survey to address the question of the rate of occurrence of multiplicity in M dwarfs. We use a template-fitting technique to measure radial velocities from 145,888 individual spectra obtained for a magnitude-limited sample of 39,543 M dwarfs. Typically, the three or four spectra observed for each star are separated in time by less than four hours, but for ∼17% of the stars, the individual observations span more than two days. In these cases we are sensitive to large-amplitude radial velocity variations on timescales comparable to the separation between the observations. We use a control sample of objects having observations taken within a four-hour period to make an empirical estimate of the underlying radial velocity error distribution and simulate our detection efficiency for a wide range of binary star systems. We find the frequency of binaries among the dwarf M stars with a < 0.4 AU to be 3%-4%. Comparison with other samples of binary stars demonstrates that the close binary fraction, like the total binary fraction, is an increasing function of primary mass.

THE CLOSE BINARY FRACTION OF DWARF M STARS

Energy Technology Data Exchange (ETDEWEB)

Clark, Benjamin M. [Penn Manor High School, 100 East Cottage Avenue, Millersville, PA 17551 (United States); Blake, Cullen H.; Knapp, Gillian R. [Princeton University, Department of Astrophysical Sciences, Peyton Hall, Ivy Lane, Princeton, NJ 08544 (United States)

2012-01-10

We describe a search for close spectroscopic dwarf M star binaries using data from the Sloan Digital Sky Survey to address the question of the rate of occurrence of multiplicity in M dwarfs. We use a template-fitting technique to measure radial velocities from 145,888 individual spectra obtained for a magnitude-limited sample of 39,543 M dwarfs. Typically, the three or four spectra observed for each star are separated in time by less than four hours, but for {approx}17% of the stars, the individual observations span more than two days. In these cases we are sensitive to large-amplitude radial velocity variations on timescales comparable to the separation between the observations. We use a control sample of objects having observations taken within a four-hour period to make an empirical estimate of the underlying radial velocity error distribution and simulate our detection efficiency for a wide range of binary star systems. We find the frequency of binaries among the dwarf M stars with a < 0.4 AU to be 3%-4%. Comparison with other samples of binary stars demonstrates that the close binary fraction, like the total binary fraction, is an increasing function of primary mass.

Binary Cockroach Swarm Optimization for Combinatorial Optimization Problem

Directory of Open Access Journals (Sweden)

Ibidun Christiana Obagbuwa

2016-09-01

Full Text Available The Cockroach Swarm Optimization (CSO algorithm is inspired by cockroach social behavior. It is a simple and efficient meta-heuristic algorithm and has been applied to solve global optimization problems successfully. The original CSO algorithm and its variants operate mainly in continuous search space and cannot solve binary-coded optimization problems directly. Many optimization problems have their decision variables in binary. Binary Cockroach Swarm Optimization (BCSO is proposed in this paper to tackle such problems and was evaluated on the popular Traveling Salesman Problem (TSP, which is considered to be an NP-hard Combinatorial Optimization Problem (COP. A transfer function was employed to map a continuous search space CSO to binary search space. The performance of the proposed algorithm was tested firstly on benchmark functions through simulation studies and compared with the performance of existing binary particle swarm optimization and continuous space versions of CSO. The proposed BCSO was adapted to TSP and applied to a set of benchmark instances of symmetric TSP from the TSP library. The results of the proposed Binary Cockroach Swarm Optimization (BCSO algorithm on TSP were compared to other meta-heuristic algorithms.

Binary-space-partitioned images for resolving image-based visibility.

Science.gov (United States)

Fu, Chi-Wing; Wong, Tien-Tsin; Tong, Wai-Shun; Tang, Chi-Keung; Hanson, Andrew J

2004-01-01

We propose a novel 2D representation for 3D visibility sorting, the Binary-Space-Partitioned Image (BSPI), to accelerate real-time image-based rendering. BSPI is an efficient 2D realization of a 3D BSP tree, which is commonly used in computer graphics for time-critical visibility sorting. Since the overall structure of a BSP tree is encoded in a BSPI, traversing a BSPI is comparable to traversing the corresponding BSP tree. BSPI performs visibility sorting efficiently and accurately in the 2D image space by warping the reference image triangle-by-triangle instead of pixel-by-pixel. Multiple BSPIs can be combined to solve "disocclusion," when an occluded portion of the scene becomes visible at a novel viewpoint. Our method is highly automatic, including a tensor voting preprocessing step that generates candidate image partition lines for BSPIs, filters the noisy input data by rejecting outliers, and interpolates missing information. Our system has been applied to a variety of real data, including stereo, motion, and range images.

A binary mixture operated heat pump

International Nuclear Information System (INIS)

Hihara, E.; Saito, T.

1991-01-01

This paper evaluates the performance of possible binary mixtures as working fluids in high- temperature heat pump applications. The binary mixtures, which are potential alternatives of fully halogenated hydrocarbons, include HCFC142b/HCFC22, HFC152a/HCFC22, HFC134a/HCFC22. The performance of the mixtures is estimated by a thermodynamic model and a practical model in which the heat transfer is considered in heat exchangers. One of the advantages of binary mixtures is a higher coefficient of performance, which is caused by the small temperature difference between the heat-sink/-source fluid and the refrigerant. The mixture HCFC142b/HCFC22 is promising from the stand point of thermodynamic performance

Wide- and contact-binary formation in substructured young stellar clusters

Science.gov (United States)

Dorval, J.; Boily, C. M.; Moraux, E.; Roos, O.

2017-02-01

We explore with collisional gravitational N-body models the evolution of binary stars in initially fragmented and globally subvirial clusters of stars. Binaries are inserted in the (initially) clumpy configurations so as to match the observed distributions of the field-binary-stars' semimajor axes a and binary fraction versus primary mass. The dissolution rate of wide binaries is very high at the start of the simulations, and is much reduced once the clumps are eroded by the global infall. The transition between the two regimes is sharper as the number of stars N is increased, from N = 1.5 k up to 80 k. The fraction of dissolved binary stars increases only mildly with N, from ≈15 per cent to ≈25 per cent for the same range in N. We repeated the calculation for two initial system mean number densities of 6 per pc3 (low) and 400 per pc3 (high). We found that the longer free-fall time of the low-density runs allows for prolonged binary-binary interactions inside clumps and the formation of very tight (a ≈ 0.01 au) binaries by exchange collisions. This is an indication that the statistics of such compact binaries bear a direct link to their environment at birth. We also explore the formation of wide (a ≳ 5 × 104 au) binaries and find a low (≈0.01 per cent) fraction mildly bound to the central star cluster. The high-precision astrometric mission Gaia could identify them as outflowing shells or streams.

An Efficient Binary Differential Evolution with Parameter Adaptation

Directory of Open Access Journals (Sweden)

Dongli Jia

2013-04-01

Full Text Available Differential Evolution (DE has been applied to many scientific and engineering problems for its simplicity and efficiency. However, the standard DE cannot be used in a binary search space directly. This paper proposes an adaptive binary Differential Evolution algorithm, or ABDE, that has a similar framework as the standard DE but with an improved binary mutation strategy in which the best individual participates. To further enhance the search ability, the parameters of the ABDE are slightly disturbed in an adaptive manner. Experiments have been carried out by comparing ABDE with two binary DE variants, normDE and BDE, and the most used binary search technique, GA, on a set of 13 selected benchmark functions and the classical 0-1 knapsack problem. Results show that the ABDE performs better than, or at least comparable to, the other algorithms in terms of search ability, convergence speed, and solution accuracy.

Beyond binaries : a way forward for comparativeeducation

Directory of Open Access Journals (Sweden)

Marianne Larsen

2012-09-01

Full Text Available Binary discourses shape and produce the stories we construct about the field of comparative education. In the first part of this article, I review a set of binary discourses that have characterized social science research since the Enlightenment, including: quantitative-qualitative, nomotheticidiographic, inductive-deductive, and practice-theory. We can think of each of these binaries at opposite ends of a set of spectrums. In the second section of the paper, I show some of the ways in which these binaries have influenced the ways that we write and talk about research within the field of comparative education. I refer to the notion of binary discourses and the productive capacity of these discourses to shape our field. I then outline some critiques of these binaries to demonstrate the inherent limitations of binary discourses, and why we need to move beyond binaries in our research, and in the histories about our field. Finally, I present some tentative conclusions on ways to get ourselves out of the trap of binary thinking.Los discursos binarios moldean y producen los argumentos que construimos sobre la disciplina de la Educación Comparada. En la primera parte de este artículo, analizo un conjunto de discursos binarios que han caracterizado la investigación en Ciencias Sociales desde la Ilustración, incluyendo la cuantitativa-cualitativa, nomotética-idiográfica, inductivadeductiva, y la práctica-teoría. Podemos pensar sobre cada uno de estos discursos binarios como argumentos en los polos de un conjunto de posibilidades. En la segunda sección del artículo, revelo algunos modos en los que estos discursos binarios han influenciado las formas a través de las cuales escribimos y analizamos la investigación en el ámbito de la Educación Comparada. Analizo la noción de discursos binarios y la capacidad productiva de estos discursos de impactar nuestra ciencia. Seguidamente expongo algunas críticas de estos discursos binarios con el

Grammar-Based Specification and Parsing of Binary File Formats

Directory of Open Access Journals (Sweden)

William Underwood

2012-03-01

Full Text Available The capability to validate and view or play binary file formats, as well as to convert binary file formats to standard or current file formats, is critically important to the preservation of digital data and records. This paper describes the extension of context-free grammars from strings to binary files. Binary files are arrays of data types, such as long and short integers, floating-point numbers and pointers, as well as characters. The concept of an attribute grammar is extended to these context-free array grammars. This attribute grammar has been used to define a number of chunk-based and directory-based binary file formats. A parser generator has been used with some of these grammars to generate syntax checkers (recognizers for validating binary file formats. Among the potential benefits of an attribute grammar-based approach to specification and parsing of binary file formats is that attribute grammars not only support format validation, but support generation of error messages during validation of format, validation of semantic constraints, attribute value extraction (characterization, generation of viewers or players for file formats, and conversion to current or standard file formats. The significance of these results is that with these extensions to core computer science concepts, traditional parser/compiler technologies can potentially be used as a part of a general, cost effective curation strategy for binary file formats.

Comments on the evolution and origin of cataclysmic binaries

International Nuclear Information System (INIS)

Whyte, C.A.; Eggleton, P.P.

1980-01-01

Aspects of the observational data on cataclysmic binaries are discussed and possible correlations between type of behaviour and binary period are noted. A gap between 2 and 3 hr in binary periods is judged to be real. A simple numerical procedure for evolving Roche-lobe-filling stars is described, and applied to white dwarf-red dwarf binaries for various mass loss and angular momentum loss mechanisms, and initial conditions. The results, in which the short-time-scale behaviour of the systems is ignored, are classified into four modes of evolution: normal, nuclear evolution dominated, angular momentum loss dominated and hydrodynamical. The clustering below 2 hr is interpreted in terms of evolution following the hydrodynamical mode, and it is suggested that both stars in such systems are of low mass. This may be the commonest type of cataclysmic binary. A possible explanation for the apparent clustering of classical novae to periods of 3 to 5 hr is given, and evolutionary schemes for cataclysmic binaries outlined. It is suggested that the short-period systems (approximately < 2 hr) arise mainly from late case B mass transfer in the original binary and the longer period systems mainly from case C. (author)

Non-binary or genderqueer genders

OpenAIRE

Richards, Christina; Bouman, Walter Pierre; Seal, Leighton; Barker, Meg John; Nieder, Timo O; T'Sjoen, Guy

2016-01-01

Some people have a gender which is neither male nor female and may identify as both male and female at one time, as different genders at different times, as no gender at all, or dispute the very idea of only two genders. The umbrella terms for such genders are genderqueer' or non-binary' genders. Such gender identities outside of the binary of female and male are increasingly being recognized in legal, medical and psychological systems and diagnostic classifications in line with the emerging ...

Efficient removal of arsenic from water using a granular adsorbent: Fe-Mn binary oxide impregnated chitosan bead.

Science.gov (United States)

Qi, Jianying; Zhang, Gaosheng; Li, Haining

2015-10-01

A novel sorbent of Fe-Mn binary oxide impregnated chitosan bead (FMCB) was fabricated through impregnating Fe-Mn binary oxide into chitosan matrix. The FMCB is sphere-like with a diameter of 1.6-1.8 mm, which is effective for both As(V) and As(III) sorption. The maximal sorption capacities are 39.1 and 54.2 mg/g, respectively, outperforming most of reported granular sorbents. The arsenic was mainly removed by adsorbing onto the Fe-Mn oxide component. The coexisting SO4(2-), HCO3(-) and SiO3(2-) have no great influence on arsenic sorption, whereas, the HPO4(2-) shows negative effects. The arsenic-loaded FMCB could be effectively regenerated using NaOH solution and repeatedly used. In column tests, about 1500 and 3200 bed volumes of simulated groundwater containing 233 μg/L As(V) and As(III) were respectively treated before breakthrough. These results demonstrate the superiority of the FMCB in removing As(V) and As(III), indicating that it is a promising candidate for arsenic removal from real drinking water. Copyright © 2015 Elsevier Ltd. All rights reserved.

Statistical Analysis of a Comprehensive List of Visual Binaries

Directory of Open Access Journals (Sweden)

Kovaleva D.

2015-12-01

Full Text Available Visual binary stars are the most abundant class of observed binaries. The most comprehensive list of data on visual binaries compiled recently by cross-matching the largest catalogues of visual binaries allowed a statistical investigation of observational parameters of these systems. The dataset was cleaned by correcting uncertainties and misclassifications, and supplemented with available parallax data. The refined dataset is free from technical biases and contains 3676 presumably physical visual pairs of luminosity class V with known angular separations, magnitudes of the components, spectral types, and parallaxes. We also compiled a restricted sample of 998 pairs free from observational biases due to the probability of binary discovery. Certain distributions of observational and physical parameters of stars of our dataset are discussed.

Low-latency analysis pipeline for compact binary coalescences in the advanced gravitational wave detector era

International Nuclear Information System (INIS)

Adams, T; Buskulic, D; Germain, V; Marion, F; Mours, B; Guidi, G M; Montani, M; Piergiovanni, F; Wang, G

2016-01-01

The multi-band template analysis (MBTA) pipeline is a low-latency coincident analysis pipeline for the detection of gravitational waves (GWs) from compact binary coalescences. MBTA runs with a low computational cost, and can identify candidate GW events online with a sub-minute latency. The low computational running cost of MBTA also makes it useful for data quality studies. Events detected by MBTA online can be used to alert astronomical partners for electromagnetic follow-up. We outline the current status of MBTA and give details of recent pipeline upgrades and validation tests that were performed in preparation for the first advanced detector observing period. The MBTA pipeline is ready for the outset of the advanced detector era and the exciting prospects it will bring. (paper)

Main Memory Implementations for Binary Grouping

OpenAIRE

May, Norman; Moerkotte, Guido

2005-01-01

An increasing number of applications depend on efficient storage and analysis features for XML data. Hence, query optimization and efficient evaluation techniques for the emerging XQuery standard become more and more important. Many XQuery queries require nested expressions. Unnesting them often introduces binary grouping. We introduce several algorithms implementing binary grouping and analyze their time and space complexity. Experiments demonstrate their performance.

Distinguishing Between Formation Channels for Binary Black Holes with LISA

Science.gov (United States)

Breivik, Katelyn; Rodriguez, Carl L.; Larson, Shane L.; Kalogera, Vassiliki; Rasio, Frederic A.

2017-01-01

The recent detections of GW150914 and GW151226 imply an abundance of stellar-mass binary-black-hole mergers in the local universe. While ground-based gravitational-wave detectors are limited to observing the final moments before a binary merges, space-based detectors, such as the Laser Interferometer Space Antenna (LISA), can observe binaries at lower orbital frequencies where such systems may still encode information about their formation histories. In particular, the orbital eccentricity and mass of binary black holes in the LISA frequency band can be used together to discriminate between binaries formed in isolation in galactic fields and those formed in dense stellar environments such as globular clusters. In this letter, we explore the orbital eccentricity and mass of binary-black-hole populations as they evolve through the LISA frequency band. Overall we find that there are two distinct populations discernible by LISA. We show that up to ~90% of binaries formed either dynamically or in isolation have eccentricities measurable by LISA. Finally, we note how measured eccentricities of low-mass binary black holes evolved in isolation could provide detailed constraints on the physics of black-hole natal kicks and common-envelope evolution.

Optical three-step binary-logic-gate-based MSD arithmetic

Science.gov (United States)

Fyath, R. S.; Alsaffar, A. A. W.; Alam, M. S.

2003-11-01

A three-step modified signed-digit (MSD) adder is proposed which can be optically implmented using binary logic gates. The proposed scheme depends on encoding each MSD digits into a pair of binary digits using a two-state and multi-position based encoding scheme. The design algorithm depends on constructing the addition truth table of binary-coded MSD numbers and then using Karnaugh map to achieve output minimization. The functions associated with the optical binary logic gates are achieved by simply programming the decoding masks of an optical shadow-casting logic system.

Dynamic Inertia Weight Binary Bat Algorithm with Neighborhood Search

Directory of Open Access Journals (Sweden)

Xingwang Huang

2017-01-01

Full Text Available Binary bat algorithm (BBA is a binary version of the bat algorithm (BA. It has been proven that BBA is competitive compared to other binary heuristic algorithms. Since the update processes of velocity in the algorithm are consistent with BA, in some cases, this algorithm also faces the premature convergence problem. This paper proposes an improved binary bat algorithm (IBBA to solve this problem. To evaluate the performance of IBBA, standard benchmark functions and zero-one knapsack problems have been employed. The numeric results obtained by benchmark functions experiment prove that the proposed approach greatly outperforms the original BBA and binary particle swarm optimization (BPSO. Compared with several other heuristic algorithms on zero-one knapsack problems, it also verifies that the proposed algorithm is more able to avoid local minima.

Asymmetric supernova explosions and the origin of binary pulsars

International Nuclear Information System (INIS)

Sutantyo, W.

1978-01-01

The author investigates the effect of asymmetric supernova explosions on the orbital parameters of binary systems with a compact component. Such explosions are related to the origin of binary pulsars. The degree of asymmetry of the explosion is represented by the kick velocity gained by the exploding star due to the asymmetric mass ejection. The required kick velocity to produce the observed parameters of the binary pulsar PSR 1913 + 16 should be larger than approximately 80 km s -1 if the mass of the exploding star is larger than approximately 4 solar masses. The mean survival probability of the binary system ( ) is examined for various degrees of asymmetry in the explosion. The rare occurrence of a binary pulsar does not neccessarily imply that such a probability is low since not all pulsars have originated in a binary system. Assuming the birth rate of pulsars by Taylor and Manchester (1977), it is derived that would be as high as 0.25. Such values of can be obtained if the mass of the exploding stars is, in general, not large (< approximately 10 solar masses). (Auth.)

General simulation algorithm for autocorrelated binary processes.

Science.gov (United States)

Serinaldi, Francesco; Lombardo, Federico

2017-02-01

The apparent ubiquity of binary random processes in physics and many other fields has attracted considerable attention from the modeling community. However, generation of binary sequences with prescribed autocorrelation is a challenging task owing to the discrete nature of the marginal distributions, which makes the application of classical spectral techniques problematic. We show that such methods can effectively be used if we focus on the parent continuous process of beta distributed transition probabilities rather than on the target binary process. This change of paradigm results in a simulation procedure effectively embedding a spectrum-based iterative amplitude-adjusted Fourier transform method devised for continuous processes. The proposed algorithm is fully general, requires minimal assumptions, and can easily simulate binary signals with power-law and exponentially decaying autocorrelation functions corresponding, for instance, to Hurst-Kolmogorov and Markov processes. An application to rainfall intermittency shows that the proposed algorithm can also simulate surrogate data preserving the empirical autocorrelation.

Mass loss from interacting close binary systems

Science.gov (United States)

Plavec, M. J.

1981-01-01

The three well-defined classes of evolved binary systems that show evidence of present and/or past mass loss are the cataclysmic variables, the Algols, and Wolf-Rayet stars. It is thought that the transformation of supergiant binary systems into the very short-period cataclysmic variables must have been a complex process. The new evidence that has recently been obtained from the far ultraviolet spectra that a certain subclass of the Algols (the Serpentids) are undergoing fairly rapid evolution is discussed. It is thought probable that the remarkable mass outflow observed in them is connected with a strong wind powered by accretion. The origin of the circumbinary clouds or flat disks that probably surround many strongly interacting binaries is not clear. Attention is also given to binary systems with hot white dwarf or subdwarf components, such as the symbiotic objects and the BQ stars; it is noted that in them both components may be prone to an enhanced stellar wind.

General simulation algorithm for autocorrelated binary processes

Science.gov (United States)

Serinaldi, Francesco; Lombardo, Federico

2017-02-01

The apparent ubiquity of binary random processes in physics and many other fields has attracted considerable attention from the modeling community. However, generation of binary sequences with prescribed autocorrelation is a challenging task owing to the discrete nature of the marginal distributions, which makes the application of classical spectral techniques problematic. We show that such methods can effectively be used if we focus on the parent continuous process of beta distributed transition probabilities rather than on the target binary process. This change of paradigm results in a simulation procedure effectively embedding a spectrum-based iterative amplitude-adjusted Fourier transform method devised for continuous processes. The proposed algorithm is fully general, requires minimal assumptions, and can easily simulate binary signals with power-law and exponentially decaying autocorrelation functions corresponding, for instance, to Hurst-Kolmogorov and Markov processes. An application to rainfall intermittency shows that the proposed algorithm can also simulate surrogate data preserving the empirical autocorrelation.

The Discovery of the Most Accelerated Binary Pulsar

OpenAIRE

Cameron, A. D.; Champion, D. J.; Kramer, M.; Bailes, M.; Barr, E. D.; Bassa, C. G.; Bhandari, S.; Bhat, N. D. R.; Burgay, M.; Burke-Spolaor, S.; Eatough, R. P.; Flynn, C. M. L.; Freire, P. C. C.; Jameson, A.; Johnston, S.

2018-01-01

Pulsars in relativistic binary systems have emerged as fantastic natural laboratories for testing theories of gravity, the most prominent example being the double pulsar, PSR J0737$-$3039. The HTRU-South Low Latitude pulsar survey represents one of the most sensitive blind pulsar surveys taken of the southern Galactic plane to date, and its primary aim has been the discovery of new relativistic binary pulsars. Here we present our binary pulsar searching strategy and report on the survey's fla...

Shrinking of Binaries in a WIMPY Background at the Galactic Center

Science.gov (United States)

Hills, J. G.

2001-12-01

The nature of the dark matter in the Galactic Halo is still not clear. Constraints can be placed on it; e.g., it cannot be in baryons less massive than about 1022 grams (Hills, 1986, Astron. J. 92, 595). It may be in elementary weakly interacting massive particles, WIMPS. Apart from providing most of the mass of the Galaxy, the only known significant dynamical effect of WIMPS is to cause a gradual shrinking of tightly bound binaries (Hills 1983, Astron. J. 88, 1269) as they interact with the background soup of WIMPS. This effect may be observable in binaries close to the Galactic Center if a significant fraction of the mass density near the central black hole is from WIMPS. The requisite binaries would have to have orbital velocities greater than the local velocity dispersion of the WIMPS relative to the binary. The velocity dispersion increases near the black hole. The binary cannot be too close to the black hole or its tidal field will breakup the binary. If the local WIMP density is 107 g/cm3, the fractional rate of reduction in the binary orbital period is about 5 x 10-10/yr for a binary having a semimajor axis equal to 3 solar radii in a soup of WIMPS having a velocity dispersion of 200 km/s relative to the binary. This gradual erosion of the binary period may be detectable, particularly, if one of the binary components is a pulsar.

New inclination changing eclipsing binaries in the Magellanic Clouds

Science.gov (United States)

Juryšek, J.; Zasche, P.; Wolf, M.; Vraštil, J.; Vokrouhlický, D.; Skarka, M.; Liška, J.; Janík, J.; Zejda, M.; Kurfürst, P.; Paunzen, E.

2018-01-01

Context. Multiple stellar systems are unique laboratories for astrophysics. Analysis of their orbital dynamics, if well characterized from their observations, may reveal invaluable information about the physical properties of the participating stars. Unfortunately, there are only a few known and well described multiple systems, this is even more so for systems located outside the Milky Way galaxy. A particularly interesting situation occurs when the inner binary in a compact triple system is eclipsing. This is because the stellar interaction, typically resulting in precession of orbital planes, may be observable as a variation of depth of the eclipses on a long timescale. Aims: We aim to present a novel method to determine compact triples using publicly available photometric data from large surveys. Here we apply it to eclipsing binaries (EBs) in Magellanic Clouds from OGLE III database. Our tool consists of identifying the cases where the orbital plane of EB evolves in accord with expectations from the interaction with a third star. Methods: We analyzed light curves (LCs) of 26121 LMC and 6138 SMC EBs with the goal to identify those for which the orbital inclination varies in time. Archival LCs of the selected systems, when complemented by our own observations with Danish 1.54-m telescope, were thoroughly analyzed using the PHOEBE program. This provided physical parameters of components of each system. Time dependence of the EB's inclination was described using the theory of orbital-plane precession. By observing the parameter-dependence of the precession rate, we were able to constrain the third companion mass and its orbital period around EB. Results: We identified 58 candidates of new compact triples in Magellanic Clouds. This is the largest published sample of such systems so far. Eight of them were analyzed thoroughly and physical parameters of inner binary were determined together with an estimation of basic characteristics of the third star. Prior to our

PROSPECTS FOR DETECTING ASTEROSEISMIC BINARIES IN KEPLER DATA

Energy Technology Data Exchange (ETDEWEB)

Miglio, A.; Chaplin, W. J.; Elsworth, Y.; Handberg, R. [School of Physics and Astronomy, University of Birmingham, Edgbaston, Birmingham, B15 2TT (United Kingdom); Farmer, R.; Kolb, U. [Department of Physical Sciences, The Open University, Walton Hall, Milton Keynes MK7 6AA (United Kingdom); Girardi, L. [INAF-Osservatorio Astronomico di Padova, Vicolo dell' Osservatorio 5, I-35122 Padova (Italy); Appourchaux, T. [Institut d' Astrophysique Spatiale, UMR8617, Université Paris XI, Bâtiment 121, F-91405 Orsay Cedex (France)

2014-03-20

Asteroseismology may in principle be used to detect unresolved stellar binary systems comprised of solar-type stars and/or red giants. This novel method relies on the detection of the presence of two solar-like oscillation spectra in the frequency spectrum of a single light curve. Here, we make predictions of the numbers of systems that may be detectable in data already collected by the NASA Kepler Mission. Our predictions, which are based upon TRILEGAL and BiSEPS simulations of the Kepler field of view, indicate that as many as 200 or more ''asteroseismic binaries'' may be detectable in this manner. Most of these binaries should be comprised of two He-core-burning red giants. Owing largely to the limited numbers of targets with the requisite short-cadence Kepler data, we expect only a small number of detected binaries containing solar-type stars. The predicted yield of detections is sensitive to the assumed initial mass ratio distribution (IMRD) of the binary components and therefore represents a sensitive calibration of the much debated IMRD near mass ratio unity.

Evolution in close binary systems

International Nuclear Information System (INIS)

Yungel'son, L.R.; Masevich, A.G.

1983-01-01

Duality is the property most typical of stars. If one investigates how prevalent double stars are, making due allowance for selection effects, one finds that as many as 90 percent of all stars are paired. Contrary to tradition it is single stars that are out of the ordinary, and as will be shown presently even some of these may have been formed by coalescence of the members of binary systems. This review deals with the evolution of close binaries, defined as double-star systems whose evolution entails exchange of material between the two components

The gravitational-wave memory from eccentric binaries

International Nuclear Information System (INIS)

Favata, Marc

2011-01-01

The nonlinear gravitational-wave memory causes a time-varying but nonoscillatory correction to the gravitational-wave polarizations. It arises from gravitational-waves that are sourced by gravitational-waves. Previous considerations of the nonlinear memory effect have focused on quasicircular binaries. Here I consider the nonlinear memory from Newtonian orbits with arbitrary eccentricity. Expressions for the waveform polarizations and spin-weighted spherical-harmonic modes are derived for elliptic, hyperbolic, parabolic, and radial orbits. In the hyperbolic, parabolic, and radial cases the nonlinear memory provides a 2.5 post-Newtonian (PN) correction to the leading-order waveforms. This is in contrast to the elliptical and quasicircular cases, where the nonlinear memory corrects the waveform at leading (0PN) order. This difference in PN order arises from the fact that the memory builds up over a short ''scattering'' time scale in the hyperbolic case, as opposed to a much longer radiation-reaction time scale in the elliptical case. The nonlinear memory corrections presented here complete our knowledge of the leading-order (Peters-Mathews) waveforms for elliptical orbits. These calculations are also relevant for binaries with quasicircular orbits in the present epoch which had, in the past, large eccentricities. Because the nonlinear memory depends sensitively on the past evolution of a binary, I discuss the effect of this early-time eccentricity on the value of the late-time memory in nearly circularized binaries. I also discuss the observability of large ''memory jumps'' in a binary's past that could arise from its formation in a capture process. Lastly, I provide estimates of the signal-to-noise ratio of the linear and nonlinear memories from hyperbolic and parabolic binaries.

Proposed experiment to test fundamentally binary theories

Science.gov (United States)

Kleinmann, Matthias; Vértesi, Tamás; Cabello, Adán

2017-09-01

Fundamentally binary theories are nonsignaling theories in which measurements of many outcomes are constructed by selecting from binary measurements. They constitute a sensible alternative to quantum theory and have never been directly falsified by any experiment. Here we show that fundamentally binary theories are experimentally testable with current technology. For that, we identify a feasible Bell-type experiment on pairs of entangled qutrits. In addition, we prove that, for any n , quantum n -ary correlations are not fundamentally (n -1 ) -ary. For that, we introduce a family of inequalities that hold for fundamentally (n -1 ) -ary theories but are violated by quantum n -ary correlations.

Coalescence of Black Hole-Neutron Star Binaries

Directory of Open Access Journals (Sweden)

Masaru Shibata

2011-08-01

Full Text Available We review the current status of general relativistic studies for the coalescence of black hole-neutron star (BH-NS binaries. First, procedures for a solution of BH-NS binaries in quasi-equilibrium circular orbits and the numerical results, such as quasi-equilibrium sequence and mass-shedding limit, of the high-precision computation, are summarized. Then, the current status of numerical-relativity simulations for the merger of BH-NS binaries is described. We summarize our understanding for the merger and/or tidal disruption processes, the criterion for tidal disruption, the properties of the remnant formed after the tidal disruption, gravitational waveform, and gravitational-wave spectrum.

Dielectric properties of binary solutions a data handbook

CERN Document Server

Akhadov, Y Y

1980-01-01

Dielectric Properties of Binary Solutions focuses on the investigation of the dielectric properties of solutions, as well as the molecular interactions and mechanisms of molecular processes that occur in liquids. The book first discusses the fundamental formulas describing the dielectric properties of liquids and dielectric data for binary systems of non-aqueous solutions. Topics include permittivity and dielectric dispersion parameters of non-aqueous solutions of organic and inorganic compounds. The text also tackles dielectric data for binary systems of aqueous solutions, including permittiv

A likely candidate of type Ia supernova progenitors: the X-ray pulsating companion of the hot subdwarf HD 49798

International Nuclear Information System (INIS)

Wang Bo; Han Zhanwen

2010-01-01

HD 49798 is a hydrogen depleted subdwarf O6 star and has an X-ray pulsating companion (RX J0648.0-4418). The X-ray pulsating companion is a massive white dwarf. Employing Eggleton's stellar evolution code with the optically thick wind assumption, we find that the hot subdwarf HD 49798 and its X-ray pulsating companion could produce a type Ia supernova (SN Ia) in future evolution. This implies that the binary system is a likely candidate of an SN Ia progenitor. We also discuss the possibilities of some other WD + He star systems (e.g. V445 Pup and KPD 1930+2752) for producing SNe Ia. (research papers)

RELATIONSHIP BETWEEN FLASH POINTS OF SOME BINARY ...

African Journals Online (AJOL)

B. S. Chandravanshi

Miscellaneous binary blends containing solvent neutral-150 (SN-150), ... viscosity, the flash point test has always been a standard part of a lubricant's specification. ... between structure and flash points of organic compounds [5-12] and fuels [13, 14]. ... in binary mixtures, the gaps between flash points would be high enough.

Searching for galactic white-dwarf binaries in mock LISA data using an F-statistic template bank

International Nuclear Information System (INIS)

Whelan, John T; Prix, Reinhard; Khurana, Deepak

2010-01-01

We describe an F-statistic search for continuous gravitational waves from galactic white-dwarf binaries in simulated LISA data. Our search method employs a hierarchical template-grid-based exploration of the parameter space. In the first stage, candidate sources are identified in searches using different simulated laser signal combinations (known as TDI variables). Since each source generates a primary maximum near its true 'Doppler parameters' (intrinsic frequency and sky position) as well as numerous secondary maxima of the F-statistic in Doppler parameter space, a search for multiple sources needs to distinguish between true signals and secondary maxima associated with other 'louder' signals. Our method does this by applying a coincidence test to reject candidates which are not found at nearby parameter space positions in searches using each of the three TDI variables. For signals surviving the coincidence test, we perform a fully coherent search over a refined parameter grid to provide an accurate parameter estimation for the final candidates. Suitably tuned, the pipeline is able to extract 1989 true signals with only 5 false alarms. The use of the rigid adiabatic approximation allows recovery of signal parameters with errors comparable to statistical expectations, although there is still some systematic excess with respect to statistical errors expected from Gaussian noise. An experimental iterative pipeline with seven rounds of signal subtraction and reanalysis of the residuals allows us to increase the number of signals recovered to a total of 3419 with 29 false alarms.

Searching for galactic white-dwarf binaries in mock LISA data using an F-statistic template bank

Energy Technology Data Exchange (ETDEWEB)

Whelan, John T [Center for Computational Relativity and Gravitation, School of Mathematical Sciences, Rochester Institute of Technology, 85 Lomb Memorial Drive, Rochester, NY 14623 (United States); Prix, Reinhard [Max-Planck-Institut fuer Gravitationsphysik (Albert-Einstein-Institut), D-30167 Hannover (Germany); Khurana, Deepak, E-mail: john.whelan@astro.rit.ed, E-mail: reinhard.prix@aei.mpg.d [Indian Institute of Technology, Kharagpur, West Bengal 721302 (India)

2010-03-07

We describe an F-statistic search for continuous gravitational waves from galactic white-dwarf binaries in simulated LISA data. Our search method employs a hierarchical template-grid-based exploration of the parameter space. In the first stage, candidate sources are identified in searches using different simulated laser signal combinations (known as TDI variables). Since each source generates a primary maximum near its true 'Doppler parameters' (intrinsic frequency and sky position) as well as numerous secondary maxima of the F-statistic in Doppler parameter space, a search for multiple sources needs to distinguish between true signals and secondary maxima associated with other 'louder' signals. Our method does this by applying a coincidence test to reject candidates which are not found at nearby parameter space positions in searches using each of the three TDI variables. For signals surviving the coincidence test, we perform a fully coherent search over a refined parameter grid to provide an accurate parameter estimation for the final candidates. Suitably tuned, the pipeline is able to extract 1989 true signals with only 5 false alarms. The use of the rigid adiabatic approximation allows recovery of signal parameters with errors comparable to statistical expectations, although there is still some systematic excess with respect to statistical errors expected from Gaussian noise. An experimental iterative pipeline with seven rounds of signal subtraction and reanalysis of the residuals allows us to increase the number of signals recovered to a total of 3419 with 29 false alarms.

Short-term variability of binary and non-binary Trans-Neptunian Objects

Science.gov (United States)

Thirouin, Audrey; Noll, K. S.; Campo Bagatin, A.; Ortiz Moreno, J. L.; Morales, N.

2013-10-01

Since 1992, more than 1400 Trans-Neptunian Objects (TNOs) have been discovered. Our approach to understand such objects is to study their rotations by monitoring their brightness variations. By studying the rotational properties of the TNOs a wealth of information can be obtained on their physics. So, the study of the spins and shapes of TNOs is a powerful method of gaining information on the formation and evolution of our Solar System. We have observed most of the brightest TNOs and centaurs, and compiled one of the largest lightcurves samples. The main purpose was to increase the number of objects whose short-term variability has been studied and present a homogeneous dataset trying to avoid observational biases. A dataset composed of 54 TNOs/Centaurs is reported and analyzed. Amplitudes and rotational periods have been derived for 45 of them with different degrees of reliability. For 9 objects, only an estimation of the amplitude is reported. Because most of the TNOs/Centaurs have low amplitude lightcurves, it is difficult to distinguish between single- and double-peaked lightcurves. Based on our results and the literature, following Binzel et al. (1989) study about asteroids rotational frequency distribution, we studied the TNOs spin rate distributions. We performed several Maxwellian fits to various histograms obtained considering that the lightcurves are single- or double-peaked. We tested lightcurve amplitude limits to distinguish if the lightcurve is albedo- or shape-dominated. Such a consideration introduces important changes in the distribution. We derived that an amplitude limit of 0.15mag gave a good fit to Maxwellian distribution. So, it seems that 0.15mag is a good measure of the typical variability caused by albedo. We studied the short-term variability of binary TNOs thanks to unresolved lightcurves. Based on our results and those from the literature, we come up with a sample of 32 systems with a rotational period and/or lightcurve amplitude value

Binary Black Hole Mergers from Globular Clusters: Implications for Advanced LIGO.

Science.gov (United States)

Rodriguez, Carl L; Morscher, Meagan; Pattabiraman, Bharath; Chatterjee, Sourav; Haster, Carl-Johan; Rasio, Frederic A

2015-07-31

The predicted rate of binary black hole mergers from galactic fields can vary over several orders of magnitude and is extremely sensitive to the assumptions of stellar evolution. But in dense stellar environments such as globular clusters, binary black holes form by well-understood gravitational interactions. In this Letter, we study the formation of black hole binaries in an extensive collection of realistic globular cluster models. By comparing these models to observed Milky Way and extragalactic globular clusters, we find that the mergers of dynamically formed binaries could be detected at a rate of ∼100 per year, potentially dominating the binary black hole merger rate. We also find that a majority of cluster-formed binaries are more massive than their field-formed counterparts, suggesting that Advanced LIGO could identify certain binaries as originating from dense stellar environments.

Kepler Eclipsing Binary Stars. I. Catalog and Principal Characterization of 1879 Eclipsing Binaries in the First Data Release

Science.gov (United States)

Prša, Andrej; Batalha, Natalie; Slawson, Robert W.; Doyle, Laurance R.; Welsh, William F.; Orosz, Jerome A.; Seager, Sara; Rucker, Michael; Mjaseth, Kimberly; Engle, Scott G.; Conroy, Kyle; Jenkins, Jon; Caldwell, Douglas; Koch, David; Borucki, William

2011-03-01

The Kepler space mission is devoted to finding Earth-size planets orbiting other stars in their habitable zones. Its large, 105 deg2 field of view features over 156,000 stars that are observed continuously to detect and characterize planet transits. Yet, this high-precision instrument holds great promise for other types of objects as well. Here we present a comprehensive catalog of eclipsing binary stars observed by Kepler in the first 44 days of operation, the data being publicly available through MAST as of 2010 June 15. The catalog contains 1879 unique objects. For each object, we provide its Kepler ID (KID), ephemeris (BJD0, P 0), morphology type, physical parameters (T eff, log g, E(B - V)), the estimate of third light contamination (crowding), and principal parameters (T 2/T 1, q, fillout factor, and sin i for overcontacts, and T 2/T 1, (R 1 + R 2)/a, esin ω, ecos ω, and sin i for detached binaries). We present statistics based on the determined periods and measure the average occurrence rate of eclipsing binaries to be ~1.2% across the Kepler field. We further discuss the distribution of binaries as a function of galactic latitude and thoroughly explain the application of artificial intelligence to obtain principal parameters in a matter of seconds for the whole sample. The catalog was envisioned to serve as a bridge between the now public Kepler data and the scientific community interested in eclipsing binary stars.

KEPLER ECLIPSING BINARY STARS. I. CATALOG AND PRINCIPAL CHARACTERIZATION OF 1879 ECLIPSING BINARIES IN THE FIRST DATA RELEASE

International Nuclear Information System (INIS)

Prsa, Andrej; Engle, Scott G.; Conroy, Kyle; Batalha, Natalie; Rucker, Michael; Mjaseth, Kimberly; Slawson, Robert W.; Doyle, Laurance R.; Welsh, William F.; Orosz, Jerome A.; Seager, Sara; Jenkins, Jon; Caldwell, Douglas; Koch, David; Borucki, William

2011-01-01

The Kepler space mission is devoted to finding Earth-size planets orbiting other stars in their habitable zones. Its large, 105 deg 2 field of view features over 156,000 stars that are observed continuously to detect and characterize planet transits. Yet, this high-precision instrument holds great promise for other types of objects as well. Here we present a comprehensive catalog of eclipsing binary stars observed by Kepler in the first 44 days of operation, the data being publicly available through MAST as of 2010 June 15. The catalog contains 1879 unique objects. For each object, we provide its Kepler ID (KID), ephemeris (BJD 0 , P 0 ), morphology type, physical parameters (T eff , log g, E(B - V)), the estimate of third light contamination (crowding), and principal parameters (T 2 /T 1 , q, fillout factor, and sin i for overcontacts, and T 2 /T 1 , (R 1 + R 2 )/a, esin ω, ecos ω, and sin i for detached binaries). We present statistics based on the determined periods and measure the average occurrence rate of eclipsing binaries to be ∼1.2% across the Kepler field. We further discuss the distribution of binaries as a function of galactic latitude and thoroughly explain the application of artificial intelligence to obtain principal parameters in a matter of seconds for the whole sample. The catalog was envisioned to serve as a bridge between the now public Kepler data and the scientific community interested in eclipsing binary stars.

DISCOVERY AND CHARACTERIZATION OF WIDE BINARY SYSTEMS WITH A VERY LOW MASS COMPONENT

Energy Technology Data Exchange (ETDEWEB)

Baron, Frédérique; Lafrenière, David; Artigau, Étienne; Doyon, René; Gagné, Jonathan; Robert, Jasmin; Nadeau, Daniel [Département de Physique, Université de Montréal, C.P. 6128 Succ. Centre-ville, Montréal, Qc H3C 3J7 (Canada); Davison, Cassy L. [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30303 (United States); Malo, Lison [Canada-France-Hawaii Telescope, 65–1238 Mamalahoa Hwy, Kamuela, HI 96743 (United States); Reylé, Céline, E-mail: baron@astro.umontreal.ca [Institut Utinam, CNRS UMR6213, Université de Franche-Comté, OSU THETA Franche-Comté-Bourgogne, Observatoire de Besançon, BP 1615, F-25010 Besançon Cedex (France)

2015-03-20

We report the discovery of 14 low-mass binary systems containing mid-M to mid-L dwarf companions with separations larger than 250 AU. We also report the independent discovery of nine other systems with similar characteristics that were recently discovered in other studies. We have identified these systems by searching for common proper motion sources in the vicinity of known high proper motion stars, based on a cross-correlation of wide area near-infrared surveys (2MASS, SDSS, and SIMP). An astrometric follow-up, for common proper motion confirmation, was made with SIMON and/or CPAPIR at the Observatoire du Mont Mégantic 1.6 m and CTIO 1.5 m telescopes for all the candidates identified. A spectroscopic follow-up was also made with GMOS or GNIRS at Gemini to determine the spectral types of 11 of our newly identified companions and 10 of our primaries. Statistical arguments are provided to show that all of the systems we report here are very likely to be physical binaries. One of the new systems reported features a brown dwarf companion: LSPM J1259+1001 (M5) has an L4.5 (2M1259+1001) companion at ∼340 AU. This brown dwarf was previously unknown. Seven other systems have a companion of spectral type L0–L1 at a separation in the 250–7500 AU range. Our sample includes 14 systems with a mass ratio below 0.3.

DISCOVERY AND CHARACTERIZATION OF WIDE BINARY SYSTEMS WITH A VERY LOW MASS COMPONENT

International Nuclear Information System (INIS)

Baron, Frédérique; Lafrenière, David; Artigau, Étienne; Doyon, René; Gagné, Jonathan; Robert, Jasmin; Nadeau, Daniel; Davison, Cassy L.; Malo, Lison; Reylé, Céline

2015-01-01

We report the discovery of 14 low-mass binary systems containing mid-M to mid-L dwarf companions with separations larger than 250 AU. We also report the independent discovery of nine other systems with similar characteristics that were recently discovered in other studies. We have identified these systems by searching for common proper motion sources in the vicinity of known high proper motion stars, based on a cross-correlation of wide area near-infrared surveys (2MASS, SDSS, and SIMP). An astrometric follow-up, for common proper motion confirmation, was made with SIMON and/or CPAPIR at the Observatoire du Mont Mégantic 1.6 m and CTIO 1.5 m telescopes for all the candidates identified. A spectroscopic follow-up was also made with GMOS or GNIRS at Gemini to determine the spectral types of 11 of our newly identified companions and 10 of our primaries. Statistical arguments are provided to show that all of the systems we report here are very likely to be physical binaries. One of the new systems reported features a brown dwarf companion: LSPM J1259+1001 (M5) has an L4.5 (2M1259+1001) companion at ∼340 AU. This brown dwarf was previously unknown. Seven other systems have a companion of spectral type L0–L1 at a separation in the 250–7500 AU range. Our sample includes 14 systems with a mass ratio below 0.3

Variations of the candidate SEZ6L2 gene on Chromosome 16p11.2 in patients with autism spectrum disorders and in human populations.

Directory of Open Access Journals (Sweden)

Marina Konyukh

Full Text Available BACKGROUND: Autism spectrum disorders (ASD are a group of severe childhood neurodevelopmental disorders with still unknown etiology. One of the most frequently reported associations is the presence of recurrent de novo or inherited microdeletions and microduplications on chromosome 16p11.2. The analysis of rare variations of 8 candidate genes among the 27 genes located in this region suggested SEZ6L2 as a compelling candidate. METHODOLOGY/PRINCIPAL FINDINGS: We further explored the role of SEZ6L2 variations by screening its coding part in a group of 452 individuals, including 170 patients with ASD and 282 individuals from different ethnic backgrounds of the Human Genome Diversity Panel (HGDP, complementing the previously reported screening. We detected 7 previously unidentified non-synonymous variations of SEZ6L2 in ASD patients. We also identified 6 non-synonymous variations present only in HGDP. When we merged our results with the previously published, no enrichment of non-synonymous variation in SEZ6L2 was observed in the ASD group compared with controls. CONCLUSIONS/SIGNIFICANCE: Our results provide an extensive ascertainment of the genetic variability of SEZ6L2 in human populations and do not support a major role for SEZ6L2 sequence variations in the susceptibility to ASD.

Substitution rates in the X- and Y-linked genes of the plants, Silene latifolia and S. dioica.

Science.gov (United States)

Filatov, Dmitry A; Charlesworth, Deborah

2002-06-01

Theory predicts that selection should be less effective in the nonrecombining genes of Y-chromosomes, relative to the situation for genes on the other chromosomes, and this should lead to the accumulation of deleterious nonsynonymous substitutions. In addition, synonymous substitution rates may differ between X- and Y-linked genes because of the male-driven evolution effect and also because of actual differences in per-replication mutation rates between the sex chromosomes. Here, we report the first study of synonymous and nonsynonymous substitution rates on plant sex chromosomes. We sequenced two pairs of sex-linked genes, SlX1-SlY1 and SlX4-SlY4, from dioecious Silene latifolia and S. dioica, and their non-sex-linked homologues from nondioecious S. vulgaris and Lychnis flos-jovis, respectively. The rate of nonsynonymous substitutions in the SlY4 gene is significantly higher than that in the SlX4 gene. Silent substitution rates are also significantly higher in both Y-linked genes, compared with their X-linked homologues. The higher nonsynonymous substitution rate in the SlY4 gene is therefore likely to be caused by a mutation rate difference between the sex chromosomes. The difference in silent substitution rates between the SlX4 and SlY4 genes is too great to be explained solely by a higher per-generation mutation rate in males than females. It is thus probably caused by a difference in per-replication mutation rates between the sex chromosomes. This suggests that the local mutation rate can change in a relatively short evolutionary time.

Hot subdwarf stars in close-up view. I. Rotational properties of subdwarf B stars in close binary systems and nature of their unseen companions

Science.gov (United States)

Geier, S.; Heber, U.; Podsiadlowski, Ph.; Edelmann, H.; Napiwotzki, R.; Kupfer, T.; Müller, S.

2010-09-01

mass companions appears to be consistent with expectations, whereas a lack of high inclinations becomes obvious for the massive systems. We show that the formation of such systems can be explained with common envelope evolution and present an appropriate formation channel including two phases of unstable mass transfer and one supernova explosion. The sample also contains a candidate post-RGB star, which rotates fast despite its long orbital period. The post-RGB stars are expected to spin-up caused by their ongoing contraction. The age of the sdB is another important factor. If the EHB star is too young, the synchronisation process might not be finished yet. Estimating the ages of the target stars from their positions on the EHB band, we found PG 2345+318, which is known not to be synchronised, to lie near the zero-age extreme horizontal branch as are the massive candidates PG 1232-136, PG 1432+159 and PG 1101+249. These star may possibly be too young to have reached synchronisation. The derived large fraction of putative massive sdB binary systems in low inclination orbits is inconsistent with theoretical predictions. Even if we dismiss three candidates because they may be too young and assume that the other sdB primaries are of low mass, PG 1743+477 and, in particular, HE 0532-4503 remain as candidates whose companions may have masses close to or above the Chandrasekhar limit. X-ray observations and accurate photometry are suggested to clarify their nature. As high inclination systems must also exist, an appropriate survey has already been launched to find such binaries. Based on observations at the Paranal Observatory of the European Southern Observatory for programmes number 165.H-0588(A), 167.D-0407(A), 068.D-0483(A), 069.D-0534(A), 070.D-0334(A), 071.D-0380(A), 071.D-0383(A) and 382.D-0841(A). Based on observations at the La Silla Observatory of the European Southern Observatory for programmes number 073.D-0495(A), 074.B-0455(A) and 077.D-0515(A). Some of the data

Binary evolution and observational constraints

International Nuclear Information System (INIS)

Loore, C. de

1984-01-01

The evolution of close binaries is discussed in connection with problems concerning mass and angular momentum losses. Theoretical and observational evidence for outflow of matter, leaving the system during evolution is given: statistics on total masses and mass ratios, effects of the accretion of the mass gaining component, the presence of streams, disks, rings, circumstellar envelopes, period changes, abundance changes in the atmosphere. The effects of outflowing matter on the evolution is outlined, and estimates of the fraction of matter expelled by the loser, and leaving the system, are given. The various time scales involved with evolution and observation are compared. Examples of non conservative evolution are discussed. Problems related to contact phases, on mass and energy losses, in connection with entropy changes are briefly analysed. For advanced stages the disruption probabilities for supernova explosions are examined. A global picture is given for the evolution of massive close binaries, from ZAMS, through WR phases, X-ray phases, leading to runaway pulsars or to a binary pulsar and later to a millisecond pulsar. (Auth.)

X rays from radio binaries

International Nuclear Information System (INIS)

Apparao, K.M.V.

1977-01-01

Reference is made to the radio binary systems CC Cas, AR Lac, β Per (Algol), β Lyr, b Per and Cyg X-1. It is stated that a thermal interpretation of the radiation from Algol requires a much larger x-ray flux than the observed value of 3.8 x 10 -11 erg/cm 2 /sec/keV in the 2 to 6 keV energy range. Observations of some non-thermal flares, together with the small size of the radio source in Algol, indicate that the radio emission is non-thermal in nature. The radio emission is interpreted as synchrotron radiation and it is suggested that the observed x-ray emission is due to inverse Compton scattering of the light of the primary star by the radio electrons. The x-ray emission from other radio binaries is also calculated using this model. The energy for the radio electrons can arise from annihilation of magnetic lines connecting the binary stars, twisted by the rotation of the stars. (U.K.)

Binary Relations as a Foundation of Mathematics

NARCIS (Netherlands)

Kuper, Jan; Barendsen, E.; Capretta, V.; Geuvers, H.; Niqui, M.

2007-01-01

We describe a theory for binary relations in the Zermelo-Fraenkel style. We choose for ZFCU, a variant of ZFC Set theory in which the Axiom of Foundation is replaced by an axiom allowing for non-wellfounded sets. The theory of binary relations is shown to be equi-consistent ZFCU by constructing a

Eclipsing binaries observed with the WIRE satellite I. Discovery and photometric analysis of the new bright A0 IV eclipsing binary psi centauri

DEFF Research Database (Denmark)

Bruntt, Hans; Southworth, J.; Penny, A. J.

2006-01-01

Stars: fundamental parameters, binaries: close, eclipsing, techniques: photometric Udgivelsesdato: Sep.......Stars: fundamental parameters, binaries: close, eclipsing, techniques: photometric Udgivelsesdato: Sep....

Hybrid Black-Hole Binary Initial Data

Science.gov (United States)

Mundim, Bruno C.; Kelly, Bernard J.; Nakano, Hiroyuki; Zlochower, Yosef; Campanelli, Manuela

2010-01-01

"Traditional black-hole binary puncture initial data is conformally flat. This unphysical assumption is coupled with a lack of radiation signature from the binary's past life. As a result, waveforms extracted from evolutions of this data display an abrupt jump. In Kelly et al. [Class. Quantum Grav. 27:114005 (2010)], a new binary black-hole initial data with radiation contents derived in the post-Newtonian (PN) calculations was adapted to puncture evolutions in numerical relativity. This data satisfies the constraint equations to the 2.5PN order, and contains a transverse-traceless "wavy" metric contribution, violating the standard assumption of conformal flatness. Although the evolution contained less spurious radiation, there were undesired features; the unphysical horizon mass loss and the large initial orbital eccentricity. Introducing a hybrid approach to the initial data evaluation, we significantly reduce these undesired features."

ADDITIONAL MASSIVE BINARIES IN THE CYGNUS OB2 ASSOCIATION

International Nuclear Information System (INIS)

Kiminki, Daniel C.; Kobulnicky, Henry A.; Ewing, Ian; Lundquist, Michael; Alexander, Michael; Vargas-Alvarez, Carlos; Choi, Heather; Bagley Kiminki, Megan M.; Henderson, C. B.

2012-01-01

We report the discovery and orbital solutions for two new OB binaries in the Cygnus OB2 Association, MT311 (B2V + B3V) and MT605 (B0.5V + B2.5:V). We also identify the system MT429 as a probable triple system consisting of a tight eclipsing 2.97 day B3V+B6V pair and a B0V at a projected separation of 138 AU. We further provide the first spectroscopic orbital solutions to the eclipsing, double-lined, O-star binary MT696 (O9.5V + B1:V), the double-lined, early B binary MT720 (B0-1V + B1-2V), and the double-lined, O-star binary MT771 (O7V + O9V). These systems exhibit orbital periods between 1.5 days and 12.3 days, with the majority having P <6 days. The two new binary discoveries and six spectroscopic solutions bring the total number of known massive binaries in the central region of the Cygnus OB2 Association to 20, with all but two having full orbital solutions.

ADDITIONAL MASSIVE BINARIES IN THE CYGNUS OB2 ASSOCIATION

Energy Technology Data Exchange (ETDEWEB)

Kiminki, Daniel C.; Kobulnicky, Henry A.; Ewing, Ian; Lundquist, Michael; Alexander, Michael; Vargas-Alvarez, Carlos; Choi, Heather [Department of Physics and Astronomy, University of Wyoming, Laramie, WY 82070 (United States); Bagley Kiminki, Megan M. [Department of Astronomy, University of Arizona, Tucson, AZ 85721 (United States); Henderson, C. B. [Department of Astronomy, Ohio State University, Columbus, OH 43210 (United States)

2012-03-01

We report the discovery and orbital solutions for two new OB binaries in the Cygnus OB2 Association, MT311 (B2V + B3V) and MT605 (B0.5V + B2.5:V). We also identify the system MT429 as a probable triple system consisting of a tight eclipsing 2.97 day B3V+B6V pair and a B0V at a projected separation of 138 AU. We further provide the first spectroscopic orbital solutions to the eclipsing, double-lined, O-star binary MT696 (O9.5V + B1:V), the double-lined, early B binary MT720 (B0-1V + B1-2V), and the double-lined, O-star binary MT771 (O7V + O9V). These systems exhibit orbital periods between 1.5 days and 12.3 days, with the majority having P <6 days. The two new binary discoveries and six spectroscopic solutions bring the total number of known massive binaries in the central region of the Cygnus OB2 Association to 20, with all but two having full orbital solutions.

Re-evaluation of activities of magnesium and zinc components in the magnesium-zinc binary system from very low to high temperature

Energy Technology Data Exchange (ETDEWEB)

Morishita, Masao; Yamamoto, Hiroaki [Univ. of Hyogo, Dept. of Materials Science and Chemistry, Himeji (Japan); Shikada, Shinichi [Misubishi Varbide Kobe Tools Ltd., Akashi (Japan); Kusumoto, Minoru [Sony Semiconductor Kyushu Corporation, Isahaya (Japan); Matsumoto, Yasutomo [Santoku Corporation, Kobe (Japan)

2011-02-15

The activities of zinc, a{sub Zn}, and magnesium, a{sub Mg}, from very low to high temperatures in the Mg-Zn binary system were evaluated for the first time from the relationship between the Gibbs energies of formation, {delta}{sub f}G{sub T}{sup o}, of Mg{sub 48}Zn{sub 52}, Mg{sub 2}Zn{sub 3}, MgZn{sub 2} and Mg{sub 2}Zn11 and their phase equilibria. The {delta}{sub f}G{sub T}{sup o} values adopted were determined in our previous calorimetric studies. It was found that the a{sub Zn} and a{sub Mg} values in the compounds steeply changed from the minimum to maximum as a function of the composition in a narrow solubility range. Such a change was more emphasized toward low temperatures (3 K). Since one of the dominant factors for the composition change in a narrow solubility range in Mg{sub 48}Zn{sub 52} and Mg{sub 2}Zn{sub 3} is the formation of vacancies at the Zn site, the relative partial molar Gibbs energies of the vacancy formation, {delta} anti G{sub Zn}{sup Zn} {sup vacancy}, were estimated from the obtained a{sub Zn} values. At 298 K, the {delta} anti G{sub Zn}{sup Zn} {sup vacancy} values of Mg{sub 48}Zn{sub 52} and Mg{sub 2}Zn{sub 3} were 73.5 and 344.3 kJ mol{sup -1}, consistent with about the same order of the enthalpy of the vacancy formation in Ni{sub 3}Al (= 173.7 kJ mol{sup -1}) as determined by positron annihilation spectroscopy. When the symmetric atomic configuration at the stoichiometric composition was violated by the formation of vacancies, the change in relative partial molar value of lattice defects was found to be large. (orig.)

Improvement of supercritical CO2 Brayton cycle using binary gas mixture

International Nuclear Information System (INIS)

Jeong, Woo Seok

2011-02-01

A Sodium-cooled Fast Reactor (SFR) is one of the strongest candidates for the next generation nuclear reactor. However, the conventional design of a SFR concept with an indirect Rankine cycle is inevitably subjected to a sodium-water reaction. To prevent hazardous situation caused by sodium-water reaction, the SFR with Brayton cycle using Supercritical Carbon dioxide (S-CO 2 cycle) as a working fluid can be an alternative approach. The S-CO 2 Brayton cycle is more sensitive to the critical point of working fluids than other Brayton cycles. This is because compressor work significantly decreases at slightly above the critical point due to high density near the boundary between the supercritical state and the subcritical state. For this reason, the minimum temperature and pressure of cycle are just above the CO 2 critical point. The critical point acts as a limitation of the lowest operating condition of the cycle. In general, lowering the rejection temperature of a thermodynamic cycle increases the efficiency and thus, changing the critical point of CO 2 can result in an improvement of the total cycle efficiency with the same cycle layout. Modifying the critical point of the working fluid can be done by adding other gases to CO 2 . The direction and range of the CO 2 critical point variation depends on the mixed component and its amount. In particular, chemical reactivity of the gas mixture itself and the gas mixture with sodium at high temperatures are of interest. To modify the critical point of the working fluid, several gases were chosen as candidates by which chemical stability with sodium within the interested range of cycle operating condition was assured: CO 2 was mixed with N 2 , O 2 , He, Ar and Xe. To evaluate the effect of shifting the critical point and changes in the properties of the S-CO 2 Brayton cycle, a supercritical Brayton cycle analysis code connected with the REFPROP program from the NIST was developed. The developed code is for evaluating

Physics of Relativistic Objects in Compact Binaries: From Birth to Coalescence

CERN Document Server

Colpi, Monica; Gorini, Vittorio; Moschella, Ugo; Possenti, Andrea

2009-01-01

This book provides a comprehensive, authoritative and timely review of the astrophysical approach to the investigation of gravity theories. Particular attention is paid to strong-field tests of general relativity and alternative theories of gravity, performed using collapsed objects (neutron stars, black holes and white dwarfs) in relativistic binaries as laboratories. The book starts with an introduction which gives the background linking experimental gravity in cosmic laboratories to astrophysics and fundamental physics. Subsequent chapters cover observational and theoretical aspects of the following topics: from binaries as test-beds of gravity theories to binary pulsars as cosmic laboratories; from binary star evolution to the formation of relativistic binaries; from short gamma-ray bursts to low mass X-ray binaries; from stellar-mass black hole binaries to coalescing super-massive black holes in galaxy mergers. The book will be useful to researchers, PhD and graduate students in Astrophysics, Cosmology, ...

Optical studies of massive X-ray binaries

International Nuclear Information System (INIS)

Zuiderwijk, E.J.

1979-01-01

Photometric and spectroscopic studies of several optical counterparts of massive X-ray binaries are presented. Subjects of study were the binary systems:HD77581/4U0900-40 (Vela X-1), HD153919/4U1700-37, Wray 977/4U1223-62 and Sk160/4U0115-74 (=SMC X-1). (Auth.)

Binary pairs of supermassive black holes - Formation in merging galaxies

Energy Technology Data Exchange (ETDEWEB)

Valtaoja, L.; Valtonen, M.J.; Byrd, G.G. (Turku Univ. (Finland); Alabama Univ., Tuscaloosa (USA))

1989-08-01

A process in which supermassive binary blackholes are formed in nuclei of supergiant galaxies due to galaxy mergers is examined. There is growing evidence that mergers of galaxies are common and that supermassive black holes in center of galaxies are also common. Consequently, it is expected that binary black holes should arise in connection with galaxy mergers. The merger process in a galaxy modeled after M87 is considered. The capture probability of a companion is derived as a function of its mass. Assuming a correlation between the galaxy mass and the blackholes mass, the expected mass ratio in binary black holes is calculated. The binary black holes formed in this process are long lived, surviving longer than the Hubble time unless they are perturbed by black holes from successive mergers. The properties of these binaries agree with Gaskell's (1988) observational work on quasars and its interpretation in terms of binary black holes. 39 refs.

GRAVITATIONAL WAVES FROM MASSIVE MAGNETARS FORMED IN BINARY NEUTRON STAR MERGERS