WorldWideScience

Sample records for binary aperiodic chains

  1. Asymptotic period of an aperiodic Markov chain and the strong ratio limit property

    NARCIS (Netherlands)

    van Doorn, Erik A.

    We introduce the concept of asymptotic period for an irreducible and aperiodic discrete-time Markov chain on a countable state space. If the chain is transient its asymptotic period may be larger than one. We present some sufficient conditions and, in the more restricted setting of birth-death

  2. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  3. Superlattice configurations in linear chain hydrocarbon binary mixtures

    Indian Academy of Sciences (India)

    Unknown

    of n-C28H58 hydrocarbon, through an angle mθ, where m = 1, 2, 3 … and angle θ has an average value of. 3.3°. Supporting literature ... Keywords. Long-chain alkanes; binary mixtures; superlattices; discrete orientational changes. 1. Introduction ... tem and a model of superlattice configuration was proposed4, in terms of ...

  4. Renormalization group decimation technique for disordered binary harmonic chains

    International Nuclear Information System (INIS)

    Wiecko, C.; Roman, E.

    1983-10-01

    The density of states of disordered binary harmonic chains is calculated using the Renormalization Group Decimation technique on the displacements of the masses from their equilibrium positions. The results are compared with numerical simulation data and with those obtained with the current method of Goncalves da Silva and Koiller. The advantage of our procedure over other methods is discussed. (author)

  5. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean

    2015-01-01

    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  6. Aperiodic Volume Optics

    Science.gov (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  7. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang

    2017-09-01

    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  8. States recognition in random walk Markov chain via binary Entropy

    Directory of Open Access Journals (Sweden)

    Morteza Khodabin

    2013-03-01

    Full Text Available In this paper, a new method for specification of recurrence or transient of states in one and two dimensional simple random walk based on upper and lower bounds of {it r}-combinations from a set of m elements $(C^{m}_{r}$ via binary entropy is introduced.

  9. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  10. Simulation of aperiodic bipedal sprinting.

    Science.gov (United States)

    Celik, Huseyin; Piazza, Stephen J

    2013-08-01

    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  11. Special frequencies and Lifshitz singularities in binary random harmonic chains

    International Nuclear Information System (INIS)

    Nieuwenhuizen, T.M.; Luck, J.M.; Canisius, J.; van Hemmen, J.L.; Ventevogel, W.J.

    1986-01-01

    The authors consider a one-dimensional chain of coupled harmonic oscillators; the mass of each atom is a random variable taking only two values (M or 1). They investigate the integrated density of states H(omega 2 ) near special frequencies: a given frequency omega/sub s/ with rational wavelength becomes special if the mass ratio M exceeds a certain critical value M/sub c/. They show that H has essential singularities of the types H/sub sg/∼ exp(-C 1 absolute value of omega 2 -omega/sub s/ 2 /sup 1/2/) or exp(-C 2 absolute value of omega 2 -omega/sub s/ 2 -1 ), according to the value of M and the sign of (omega 2 -omega/sub s/ 2 ). The Lifshitz singularity at the band edge is analyzed in the same way. In each case, the constant C 1 or C 2 is evaluated explicitly and compared with a vast amount of numerical work. All these exponential singularities are modulated by periodic amplitudes. The properties of the eigenfunctions with frequencies close to the special values are also discussed, and are illustrated by numerical data

  12. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  13. Simulation methods for multiperiodic and aperiodic nanostructured dielectric waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    2017-01-01

    on Rudin–Shapiro, Fibonacci, and Thue–Morse binary sequences. The near-field and far-field properties are computed employing the finite-element method (FEM), the finite-difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). The results show that all three methods......, a comparison of experimental results and simulation results obtained with three different simulation methods is presented. We fabricated and characterized multiperiodic nanostructured dielectric waveguides with two and three compound periods as well as deterministic aperiodic nanostructured waveguides based...

  14. Characterization of Binary Organogels Based on Some Azobenzene Compounds and Alkyloxybenzoic Acids with Different Chain Lengths

    Directory of Open Access Journals (Sweden)

    Yongmei Hu

    2014-01-01

    Full Text Available In this work the gelation behaviors of binary organogels composed of azobenzene amino derivatives and alkyloxybenzoic acids with different lengths of alkyl chains in various organic solvents were investigated and characterized. The corresponding gelation behaviors in 20 solvents were characterized and shown as new binary organic systems. It showed that the lengths of substituent alkyl chains in compounds have played an important role in the gelation formation of gelator mixtures in present tested organic solvents. Longer methylene chains in molecular skeletons in these gelators seem more suitable for the gelation of present solvents. Morphological characterization showed that these gelator molecules have the tendency to self-assemble into various aggregates from lamella, wrinkle, and belt to dot with change of solvents and gelator mixtures. Spectral characterization demonstrated different H-bond formation and hydrophobic force existing in gels, depending on different substituent chains in molecular skeletons. Meanwhile, these organogels can self-assemble to form monomolecular or multilayer nanostructures owing to the different lengths of due to alkyl substituent chains. Possible assembly modes for present xerogels were proposed. The present investigation is perspective to provide new clues for the design of new nanomaterials and functional textile materials with special microstructures.

  15. Markov Chain Monte Carlo Methods

    Indian Academy of Sciences (India)

    Keywords. Markov chain; state space; stationary transition probability; stationary distribution; irreducibility; aperiodicity; stationarity; M-H algorithm; proposal distribution; acceptance probability; image processing; Gibbs sampler.

  16. Prediction of the Flash Point of Binary and Ternary Straight-Chain Alkane Mixtures

    Directory of Open Access Journals (Sweden)

    X. Li

    2014-01-01

    Full Text Available The flash point is an important physical property used to estimate the fire hazard of a flammable liquid. To avoid the occurrence of fire or explosion, many models are used to predict the flash point; however, these models are complex, and the calculation process is cumbersome. For pure flammable substances, the research for predicting the flash point is systematic and comprehensive. For multicomponent mixtures, especially a hydrocarbon mixture, the current research is insufficient to predict the flash point. In this study, a model was developed to predict the flash point of straight-chain alkane mixtures using a simple calculation process. The pressure, activity coefficient, and other associated physicochemical parameters are not required for the calculation in the proposed model. A series of flash points of binary and ternary mixtures of straight-chain alkanes were determined. The results of the model present consistent experimental results with an average absolute deviation for the binary mixtures of 0.7% or lower and an average absolute deviation for the ternary mixtures of 1.03% or lower.

  17. Dielectric studies on binary mixtures of Tri-n-butyl phosphate (TBP) and long-chain primary alcohols (modifiers)

    International Nuclear Information System (INIS)

    Dash, S.K.; Swain, B.B.

    1993-01-01

    Dielectric constant (ε) of Tri-n-butyl phosphate (TBP), in binary mixtures with five long-chain primary alcohols viz; 1-butanol, 1-pentanol, 1-hexanol, 1-heptanol and 1-octanol has been measured at ν = 455 kHz and at temperature 302 K. The data is used to evaluate mutual correlation factor g ab , excess molar polarization ΔP and excess free energy of mixing ΔF ab by using Winkelmann-Quitzsch eqn. for binary mixtures to assess the suitability of the alcohols as modifiers. The trend of variation of these parameters exhibit marked dependence on chain-length of the alcohols indicating 1-heptanol to be an efficient modifier. (author)

  18. Studying stellar binary systems with the Laser Interferometer Space Antenna using delayed rejection Markov chain Monte Carlo methods

    Energy Technology Data Exchange (ETDEWEB)

    Trias, Miquel [Departament de Fisica, Universitat de les Illes Balears, Cra. Valldemossa Km. 7.5, E-07122 Palma de Mallorca (Spain); Vecchio, Alberto; Veitch, John, E-mail: miquel.trias@uib.e, E-mail: av@star.sr.bham.ac.u, E-mail: jveitch@star.sr.bham.ac.u [School of Physics and Astronomy, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom)

    2009-10-21

    Bayesian analysis of Laser Interferometer Space Antenna (LISA) data sets based on Markov chain Monte Carlo methods has been shown to be a challenging problem, in part due to the complicated structure of the likelihood function consisting of several isolated local maxima that dramatically reduces the efficiency of the sampling techniques. Here we introduce a new fully Markovian algorithm, a delayed rejection Metropolis-Hastings Markov chain Monte Carlo method, to efficiently explore these kind of structures and we demonstrate its performance on selected LISA data sets containing a known number of stellar-mass binary signals embedded in Gaussian stationary noise.

  19. Surface properties of poly(styrene- co- n-butyl acrylate) binary copolymers: Effect of chain microstructure and composition

    Science.gov (United States)

    Bogdanova, Yu. G.; Kostina, J. V.; Dolzhikova, V. D.; Chernikova, E. V.; Plutalova, A. V.

    2015-12-01

    The regularities of changing of surface energy characteristics of poly(styrene- co- n-butyl acrylate) binary copolymers films at varying of chain microstructure, composition and thermodynamic quality of solvent, from which films are formed, with respect to comonomers, were detected. The concordance between the information about characteristics of films surfaces, obtained via contact angle measurements and ATR-FTIR spectroscopy was observed. The type of polymer chain microstructure, provided the best adhesion properties of copolymers with respect to polar phases was detected.

  20. Aperiodicity in one-way Markov cycles and repeat times of large earthquakes in faults

    OpenAIRE

    Tejedor, Alejandro; Gómez, Javier; Pacheco, Amalio F.

    2011-01-01

    A common use of Markov Chains is the simulation of the seismic cycle in a fault, i.e. as a renewal model for the repetition of its characteristic earthquakes. This representation is consistent with Reid's elastic rebound theory. Here it is proved that in {\\it any} one-way Markov cycle, the aperiodicity of the corresponding distribution of cycle lengths is always lower than one. This fact concurs with observations of large earthquakes in faults all over the world.

  1. The Meritfactor of Binary Seqences

    DEFF Research Database (Denmark)

    Høholdt, Tom

    1999-01-01

    Binary sequences with small aperiodic correlations play an important role in many applications ranging from radar to modulation and testing of systems. Golay(1977) introduced the merit factor as a measure of the goodness of the sequence and conjectured an upper bound for this. His conjecture...

  2. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.

    1997-01-01

    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  3. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

    2011-01-01

    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  4. Periodic and aperiodic synchronization in skilled action

    Directory of Open Access Journals (Sweden)

    Fred eCummins

    2011-12-01

    Full Text Available Synchronized action is considered as a manifestation of shared skill. Most synchronized behaviors in humans and other animals are based on periodic repetition. Aperiodic synchronization of complex action is found in the experimental task of synchronous speaking, in which naive subjects read a common text in lock step. The demonstration of synchronized behavior without a periodic basis is presented as a challenge for theoretical understanding. A unified treatment of periodic and aperiodic synchronization is suggested by replacing the sequential processing model of cognitivist approaches with the more local notion of a task-specific sensorimotor coordination. On this view, skilled action is the imposition of constraints on the co-variation of movement and sensory flux such that the boundary conditions that define the skill are met. This non-cognitivist approach originates in the work of John Dewey. It allows a unification of the treatment of sensorimotor synchronization in simple rhythmic behavior and in complex skilled behavior and it suggests that skill sharing is a uniquely human trait of considerable import.

  5. A Full-Chain Network Model with Sliplinks and Binary Constraint Release

    DEFF Research Database (Denmark)

    Neergaard, Jesper; Schieber, Jay D.

    2000-01-01

    A full-chain, mean-field, temporary network model is proposed. The model is inspired by the success of a recent reptation model, but contains no tubes. Instead, each chain uses a different (and smaller) set of dynamic variables: the position and age of each entanglement, and the number of Kuhn...... steps in chain strands between entanglements. The entanglements are assumed to move affinely, whereas the number of Kuhn steps varies stochastically from tension imbalances and Brownian forces. In the language of reptation, the model exhibits chain-length fluctuations, constraint release, chain...

  6. Robust Optimization of Aperiodic Photonic Structures

    Science.gov (United States)

    Nohadani, Omid; Meng Teo, Kwong; Bertsimas, Dimitris

    2007-03-01

    In engineering design, the physical properties of a system can often only be described by numerical simulation. Optimization of such systems is usually accomplished heuristically without taking into account that there are implementation errors that lead to very suboptimal, and often, infeasible solutions. We present a novel robust optimization method for electromagnetic scattering problems with large degrees of freedom, and report on results when this technique is applied to optimization of aperiodic dielectric structures. The spatial configuration of 50 dielectric scattering cylinders is optimized to match a desired target function such that the optimal arrangement is robust against placement and prototype errors. Our optimization method inherently improves the robustness of the optimized solution with respect to relevant errors and is suitable for real-world design of materials with novel electromagnetic functionalities.

  7. Surface plasmon field enhancements in deterministic aperiodic structures.

    Science.gov (United States)

    Shugayev, Roman

    2010-11-22

    In this paper we analyze optical properties and plasmonic field enhancements in large aperiodic nanostructures. We introduce extension of Generalized Ohm's Law approach to estimate electromagnetic properties of Fibonacci, Rudin-Shapiro, cluster-cluster aggregate and random deterministic clusters. Our results suggest that deterministic aperiodic structures produce field enhancements comparable to random morphologies while offering better understanding of field localizations and improved substrate design controllability. Generalized Ohm's law results for deterministic aperiodic structures are in good agreement with simulations obtained using discrete dipole method.

  8. Optimizing the surface density of polyethylene glycol chains by grafting from binary solvent mixtures

    Science.gov (United States)

    Arcot, Lokanathan; Ogaki, Ryosuke; Zhang, Shuai; Meyer, Rikke L.; Kingshott, Peter

    2015-06-01

    Polyethylene glycol (PEG) brushes are very effective at controlling non-specific deposition of biological material onto surfaces, which is of paramount importance to obtaining successful outcomes in biomaterials, tissue engineered scaffolds, biosensors, filtration membranes and drug delivery devices. We report on a simple 'grafting to' approach involving binary solvent mixtures that are chosen based on Hansen's solubility parameters to optimize the solubility of PEG thereby enabling control over the graft density. The PEG thiol-gold model system enabled a thorough characterization of PEG films formed, while studies on a PEG silane-silicon system examined the versatility to be applied to any substrate-head group system by choosing an appropriate solvent pair. The ability of PEG films to resist non-specific adsorption of proteins was quantitatively assessed by full serum exposure studies and the binary solvent strategy was found to produce PEG films with optimal graft density to efficiently resist protein adsorption.

  9. Aperiodic space-time modulation for pure frequency mixing

    Science.gov (United States)

    Taravati, Sajjad

    2018-03-01

    This paper experimentally demonstrates the effects of inharmonic photonic transition in tailored aperiodic space-time refractive index modulated media. Such effects introduce a pure frequency mixing based on the simultaneous and distinct shifts in the spatial and temporal frequencies. The medium is characterized with a periodic temporal modulation and a tailored aperiodic spatially modulated permittivity and permeability, yielding aperiodic, large and tunable photonic band gaps. Since the medium is time periodic, an infinite number of space-time mixing products are generated with a distance equal to the temporal frequency of the pump wave. However, thanks to the tailored spatial aperiodicity of the medium and associated photonic band gaps, transition to unwanted space-time mixing products is prohibited. Interesting features include tunability of the operation frequencies of the mixer via space-time modulation parameters, high isolation, linear response, and possibility of conversion gain due to the transfer of energy and momentum of the space-time modulation to the input wave. We derive the analytical solution for such mixer with aperiodic space-modulated permittivity and permeability and periodic time modulation, and then provide the synthesis procedure which takes into account the effects of space-time modulation inhomogeneity. Finally, to see the effect of the tailoring of space modulation, we compare the experimental results of the aperiodic space-time modulated pure mixer with those of the conventional periodic uniform space-time modulated medium.

  10. The phase behavior of a hard sphere chain model of a binary n-alkane mixture

    International Nuclear Information System (INIS)

    Malanoski, A. P.; Monson, P. A.

    2000-01-01

    Monte Carlo computer simulations have been used to study the solid and fluid phase properties as well as phase equilibrium in a flexible, united atom, hard sphere chain model of n-heptane/n-octane mixtures. We describe a methodology for calculating the chemical potentials for the components in the mixture based on a technique used previously for atomic mixtures. The mixture was found to conform accurately to ideal solution behavior in the fluid phase. However, much greater nonidealities were seen in the solid phase. Phase equilibrium calculations indicate a phase diagram with solid-fluid phase equilibrium and a eutectic point. The components are only miscible in the solid phase for dilute solutions of the shorter chains in the longer chains. (c) 2000 American Institute of Physics

  11. Applications the Lagrangian description in aperiodic flows

    Science.gov (United States)

    Mendoza, Carolina; Mancho, Ana Maria

    2012-11-01

    We use several recently developed Lagrangian tools for describing transport in general aperiodic flows. In our approach the first step is based in a Lagrangian descriptor (the so called function M). It measures the length of particle trajectories on the ocean surface over a given interval of time. We describe its output over satellite altimetry data on the Kuroshio current. The technique is combined with the direct computation of manifolds of Distinguished Hyperbolic trajectories and a very detailed description of transport is achieved across an eddy and a jet on the Kuroshio current,. A second velocity data set is examined with the M function tool. These are obtained from the HYCOM project on the Gulf of Mexico during the time of the oil-spill. We have identified underlying Lagrangian structures and dynamics. We acknowledge to the hospitality of the university of Delaware and the assistance of Bruce Lipphardt and Helga Huntley in accessing the model data sets. We acknowledge to the grants: UPM-AL12-PAC-09, Becas de Movilidad de Caja Madrid 2011, MTM2011-26696 and ILINK-0145.

  12. The effect of the alkyl chain length on physicochemical features of (ionic liquids + γ-butyrolactone) binary mixtures

    International Nuclear Information System (INIS)

    Papović, Snežana; Bešter-Rogač, Marija; Vraneš, Milan; Gadžurić, Slobodan

    2016-01-01

    Highlights: • Influence of alkyl substituent length on IL properties was studied. • Nature of interactions between studied [C n C 1 im][NTf 2 ] and GBL were discussed. • Angell strength parameter indicates [C n C 1 im][NTf 2 ] are fragile liquids. • ILs properties regularly change with increase of the alkyl chain length. • Absence of GBL self-association upon addition of IL is observed. - Abstract: Densities and viscosities were determined and analysed for γ-butyrolactone (GBL) binary mixtures with 1-alkyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ionic liquids (where alkyl = ethyl, hexyl, octyl) as a function of temperature at atmospheric pressure (p = 0.1 MPa) and over the whole composition range. Excess molar volumes have been calculated from the experimental densities and were fitted using Redlich–Kister’s polynomial equation. Other volumetric parameters have been also calculated in order to obtain information about interactions between GBL and imidazolium based ionic liquids with different alkyl chain length. From the viscosity measurements, the Angell strength parameter was calculated for pure ionic liquids indicating that all investigated electrolytes are “fragile” liquids.

  13. Self-Assembly and Soft Material Preparation of Binary Organogels via Aminobenzimidazole/Benzothiazole and Acids with Different Alkyl Substituent Chains

    Directory of Open Access Journals (Sweden)

    Tifeng Jiao

    2013-01-01

    Full Text Available The gelation behaviors of binary organogels composed of aminobenzimidazole/benzothiazole derivatives and benzoic acid with single-/multialkyl substituent chain in various organic solvents were designed and investigated. Their gelation behaviors in 20 solvents were tested as new binary organic gelators. This showed that the number and length of alkyl substituent chains and benzimidazole/benzothiazole segment have played a crucial role in the gelation behavior of all gelator mixtures in various organic solvents. More alkyl chains in molecular skeletons in present gelators are favorable for the gelation of organic solvents. The length of alkyl substituent chains has also played an important role in changing the gelation behaviors and assembly states. Morphological studies revealed that the gelator molecules self-assemble into different aggregates from wrinkle, lamella, belt, to fiber with change of solvents. Spectral studies indicated that there existed different H-bond formation and hydrophobic force, depending on benzimidazole/benzothiazole segment and alkyl substituent chains in molecular skeletons. The prepared nanostructured materials have wide perspectives and many potential applications in nanoscience and material fields due to their scientific values. The present work may also give new clues for designing new binary organogelators and soft materials.

  14. Perturbed-chain SAFT as a versatile tool for thermodynamic modeling of binary mixtures containing isoquinolinium ionic liquids.

    Science.gov (United States)

    Domańska, Urszula; Zawadzki, Maciej; Paduszyński, Kamil; Królikowski, Marek

    2012-07-19

    This contribution reports a recapitulation of our experimental and modeling study on thermodynamic behavior of binary systems containing N-alkylisoquinolinium ionic liquids (ILs) based on bis(trifluoromethylsulfonyl)imide anion, [CniQuin][NTf2] (n = 4,6,8). In particular, we report isothermal vapor-liquid equilibrium (VLE) phase diagrams and molar excess enthalpies of mixing (H(E)) for binary mixtures of [C8iQuin][NTf2] IL with various organic solutes including benzene, toluene, thiophene, pyridine, and butan-1-ol. The measured VLE data represented simple homozeotropic behavior with either negative or positive deviations from ideality, depending on polarity of the solute, temperature, and mole fraction of IL. In turn, the obtained data on H(E) were negative and positive for the mixtures containing aromatic hydrocarbons or thiophene and butan-1-ol, respectively, in the whole range of IL's concentration. All of the measured and some previously published data regarding phase behavior of [C8iQuin][NTf2] IL were analyzed and successfully described in terms of perturbed-chain statistical associating fluid theory (PC-SAFT). The methodology used in this work was described by us previously. In general, the proposed modeling results in VLE diagrams, which are in excellent agreement with experimental data. In the case of H(E), the results obtained are good as well but not so satisfactory such as those for VLE. Nevertheless, they seem to be very promising if one take into account the simplicity of the utilized molecular model against significant complexity of IL-based systems. Thus, we concluded that PC-SAFT equation of state can be viewed as a powerful and robust tool for modeling of systems involving ILs.

  15. Simulation Methods for Multiperiodic and Aperiodic Nanostructured Dielectric Waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    , L. Dal Negro, Optical gap formation and localization properties of optical modes in deterministic aperiodic photonic structures, Opt. Express 16, 18813, 2008 [2] E. Maciá, Exploiting aperiodic designs in nanophotonic devices, Rep Prog Phys 75, 036502, 2012 [3] C. Kluge, J. Adam, N. Barié, P. J....... Jakobs, M. Guttmann, M. Gerken, Multiperiodic nanostructures for photon control, Opt. Express 22, A1363-A1371, 2014 [4] L. T. Neustock, S. Jahns, J. Adam, M. Gerken, Optical waveguides with compound grating nanostructures for refractive index sensing, J. of Sensors, 6174527, 2016...

  16. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  17. Phase behavior of binary mixture systems of saturated-unsaturated mixed-acid triacylglycerols: effects of glycerol structures and chain-chain interactions.

    Science.gov (United States)

    Bayés-García, Laura; Calvet, Teresa; Cuevas-Diarte, Miquel Àngel; Ueno, Satoru; Sato, Kiyotaka

    2015-03-26

    We systematically examined the phase behavior of binary mixtures of mixed-acid triacylglycerols (TAGs) containing palmitic and oleic acid moieties 1,3-dioleoyl-2-palmitoyl-glycerol (OPO), 1,2-dipalmitoyl-3-oleoyl-rac-glycerol (PPO), and 1,2-dioleoyl-3-palmitoyl-rac-glycerol (OOP), which are widely present in natural fats and are employed in the food, pharmaceutical, and cosmetic industries. Differential scanning calorimetry and X-ray diffraction methods were applied to observe the mixing behavior of PPO/OPO, OOP/OPO, and PPO/OOP under metastable and stable conditions. The results led to three conclusions: (1) Eutectic behavior was observed in PPO/OPO. (2) Molecular compound (MC) crystals were formed in the mixtures of OOP/OPO and PPO/OOP. (3) However, the MC crystals occurred only under metastable conditions and tended to separate into component TAGs to form eutectic mixture systems after 17 months of incubation. These results were contrary to those of previous studies on 1,3-dipalmitoyl-2-oleoyl glycerol (POP)/OPO and POP/PPO in which the MC crystals were thermodynamically stable. We determined that specific molecular interactions may cause this different phase behavior (stability of POP/OPO and POP/PPO MC crystals and metastability of OOP/OPO and PPO/OOP MC crystals). All results confirm the significant effects of molecular structures of glycerol groups, interactions of fatty acid chains, and polymorphism of the component TAGs on the mixing behavior of mixed-acid TAGs.

  18. A method to identify aperiodic disturbances in the ionosphere

    Directory of Open Access Journals (Sweden)

    J.-S. Wang

    2014-05-01

    Full Text Available In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM, a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  19. Aperiodic Multiprocessor Scheduling for Real-Time Stream Processing Applications

    NARCIS (Netherlands)

    Wiggers, M.H.

    2009-01-01

    This thesis is concerned with the computation of buffer capacities that guarantee satisfaction of timing and resource constraints for task graphs with aperiodic task execution rates that are executed on run-time scheduled resources. Stream processing applications such as digital radio baseband

  20. Effect of temperature and chain length on the viscosity and surface tension of binary systems of N,N-dimethylformamide with 1-octanol, 1-nonanol and 1-decanol

    International Nuclear Information System (INIS)

    Mohammad, Abubaker A.; Alkhaldi, Khaled H.A.E.; AlTuwaim, Mohammad S.; Al-Jimaz, Adel S.

    2014-01-01

    Highlights: • Effect of temperature and chain length on η and σ of DMF + 1-alkanol binary systems. • Viscosity and surface tension were obtained. • Δη, Δσ and G ∗E were calculated using the experimental data. • H σ and S σ were determined using the surface tension data. • Semi-empirical relations were used to estimate the viscosity of liquid mixtures. - Abstract: Viscosity and surface tension of binary systems of N,N-dimethylformamide DMF with higher 1-alkanols (C 8 –C 10 ) were measured at atmospheric pressure and four different temperatures over the entire range of mole fraction. The experimental measurements were used to calculate the deviations in viscosity and surface tension. Furthermore, the excess Gibbs free energy of activation, surface enthalpy and surface entropy of the (DMF + 1-alkanols) binary mixtures were determined. In addition, the deviation and excess properties were fitted to the method of Redlich–Kister (R–K) polynomial. Viscosity data of the binary systems were correlated with three different expressions (Grunberg and Nissan, the three-body, and four-body McAllister). The effects of the chain length of the higher 1-alkanols and temperature were investigated

  1. Effect of temperature and composition on the surface tension and surface properties of binary mixtures containing DMSO and short chain alcohols

    International Nuclear Information System (INIS)

    Bagheri, Ahmad; Fazli, Mostafa; Bakhshaei, Malihe

    2016-01-01

    Highlights: • Surface tension of DMSO + alcohol (methanol, ethanol and isopropanol) at various temperatures was measured. • The surface tension data of binary mixtures were correlated with four equations. • Intermolecular interaction of DMSO with alcohol was discussed. • The surface mole fraction of alcohol increase with increasing the length of alcohol chain. - Abstract: Surface tension of binary mixtures of methanol, ethanol and isopropanol with DMSO (dimethyl sulfoxide) was measured over the whole range of composition at atmospheric pressure of 82.5 kPa within the temperatures between (298.15 and 328.15) K. The experimental measurements were used to calculate in surface tension deviations (Δσ). The sign of Δσ for all temperatures is negative (except of methanol/DMSO system) because of the factors of hydrogen bonding and dipole–dipole interactions in the DMSO-alcohol systems. Surface tension values of the binary systems were correlated with FLW, MS, RK and LWW models. The mean standard deviation obtained from the comparison of experimental and calculated surface tension values for binary systems with three models (FLW, MS and RK) at various temperatures is less than 0.83. Also, the results of the LWW model were used to account for the interaction energy between alcohols and DMSO in binary mixtures. The temperature dependence of σ (surface tension) at fixed composition of solutions was used to estimate surface enthalpy, H s , and surface entropy, S s . The results obtained show that the values of the thermodynamic parameters for alcohol/DMSO mixtures decrease with increasing alkyl chain length of alcohol. Finally, the results are discussed in terms of surface mole fraction and lyophobicity using the extended Langmuir (EL) isotherm.

  2. Orbits for 18 Visual Binaries and Two Double-line Spectroscopic Binaries Observed with HRCAM on the CTIO SOAR 4 m Telescope, Using a New Bayesian Orbit Code Based on Markov Chain Monte Carlo

    Science.gov (United States)

    Mendez, Rene A.; Claveria, Ruben M.; Orchard, Marcos E.; Silva, Jorge F.

    2017-11-01

    We present orbital elements and mass sums for 18 visual binary stars of spectral types B to K (five of which are new orbits) with periods ranging from 20 to more than 500 yr. For two double-line spectroscopic binaries with no previous orbits, the individual component masses, using combined astrometric and radial velocity data, have a formal uncertainty of ˜ 0.1 {M}⊙ . Adopting published photometry and trigonometric parallaxes, plus our own measurements, we place these objects on an H-R diagram and discuss their evolutionary status. These objects are part of a survey to characterize the binary population of stars in the Southern Hemisphere using the SOAR 4 m telescope+HRCAM at CTIO. Orbital elements are computed using a newly developed Markov chain Monte Carlo (MCMC) algorithm that delivers maximum-likelihood estimates of the parameters, as well as posterior probability density functions that allow us to evaluate the uncertainty of our derived parameters in a robust way. For spectroscopic binaries, using our approach, it is possible to derive a self-consistent parallax for the system from the combined astrometric and radial velocity data (“orbital parallax”), which compares well with the trigonometric parallaxes. We also present a mathematical formalism that allows a dimensionality reduction of the feature space from seven to three search parameters (or from 10 to seven dimensions—including parallax—in the case of spectroscopic binaries with astrometric data), which makes it possible to explore a smaller number of parameters in each case, improving the computational efficiency of our MCMC code. Based on observations obtained at the Southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inovação (MCTI) da República Federativa do Brasil, the U.S. National Optical Astronomy Observatory (NOAO), the University of North Carolina at Chapel Hill (UNC), and Michigan State University (MSU).

  3. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

    2015-01-01

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  4. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

    Science.gov (United States)

    Kumar, Pawan; Parmananda, P.

    2018-04-01

    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  5. Renormalization transformation of periodic and aperiodic lattices

    International Nuclear Information System (INIS)

    Macia, Enrique; Rodriguez-Oliveros, Rogelio

    2006-01-01

    In this work we introduce a similarity transformation acting on transfer matrices describing the propagation of elementary excitations through either periodic or Fibonacci lattices. The proposed transformation can act at two different scale lengths. At the atomic scale the transformation allows one to express the systems' global transfer matrix in terms of an equivalent on-site model one. Correlation effects among different hopping terms are described by a series of local phase factors in that case. When acting on larger scale lengths, corresponding to short segments of the original lattice, the similarity transformation can be properly regarded as describing an effective renormalization of the chain. The nature of the resulting renormalized lattice significantly depends on the kind of order (i.e., periodic or quasiperiodic) of the original lattice, expressing a delicate balance between chemical complexity and topological order as a consequence of the renormalization process

  6. Weak universality in inhomogeneous Ising quantum chains

    International Nuclear Information System (INIS)

    Karevski, Dragi

    2006-01-01

    The Ising quantum chain with arbitrary coupling distribution {λ i } leading to an anisotropic scaling is considered. The smallest gap of the chain is connected to the surface magnetization by the relation Λ 1 = m s ({λ i })m s ({λ -1 i }). For some aperiodic distribution {λ i }, a weak universality of the critical behaviour is found. (letter to the editor)

  7. Engineering aperiodic nanostructured surfaces for scattering-based optical devices

    Science.gov (United States)

    Lee, Yuk Kwan Sylvanus

    Novel optical devices such as biosensors, color displays and authentication devices can be obtained from the distinctive light scattering properties of resonant nanoparticles and nanostructured arrays. These arrays can be optimized through the choice of material, particle morphology and array geometry. In this thesis, by engineering the multi-frequency colorimetric responses of deterministic aperiodic nanostructured surfaces (DANS) with various spectral Fourier properties, I designed, fabricated and characterized scattering-based devices for optical biosensing and structural coloration applications. In particular, using analytical and numerical optimization, colorimetric biosensors are designed and fabricated with conventional electron beam lithography, and characterized using dark-field scattering imaging as well as image autocorrelation analysis of scattered intensity in the visible spectral range. These sensors, which consist of aperiodic surfaces ranging from quasi-periodic to pseudo-random structures with flat Fourier spectra, sustain highly complex structural resonances that enable a novel optical sensing approach beyond the traditional Bragg scattering. To this end, I have experimentally demonstrated that DANS with engineered structural colors are capable of detecting nanoscale protein monolayers with significantly enhanced sensitivity over periodic structures. In addition, different aperiodic arrays of gold (Au) nanoparticles are integrated with polydimethylsiloxane (PDMS) microfluidic structures by soft-lithographic micro-imprint techniques. Distinctive scattering spectral shifts and spatial modifications of structural color patterns in response to refractive index variations were simultaneously measured. The successful integration of DANS with microfluidics technology has introduced a novel opto-fluidic sensing platform for label-free and multiplexed lab-on-a-chip applications. Moreover, by studying the isotropic scattering properties of homogenized

  8. Investigation of Aperiodic Time Processes with Autocorrelation and Fourier Analysis

    Science.gov (United States)

    Exner, Marie Luise

    1958-01-01

    Autocorrelation and frequency analyses of a series of aperiodic time events, in particular, filtered noises and sibilant sounds, were made. The position and band width of the frequency ranges are best obtained from the frequency analysis, but the energies contained in the several bands are most easily obtained from the autocorrelation function. The mean number of zero crossings of the time function was determined from the curvature of the latter function in the vicinity of the zero crossing, and also with the aid of a decimal counter. The second method was found to be more exact.

  9. Critical phenomena in binary fluid mixtures : Classification of phase equilibria with the simplified-perturbed-hard-chain theory

    NARCIS (Netherlands)

    Van Pelt, A.

    1992-01-01

    I. INTRODUCTION AND THEORY This PhD research is mainly concerned with the global phase behaviour, that is calculated from the Simplified-Perturbed-Hard-Chain equation. This equation distinguishes itself from many other equations of state by a sound theoretical background. We enter the field of the

  10. Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

    Science.gov (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

    2017-11-07

    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  11. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    Energy Technology Data Exchange (ETDEWEB)

    Xie Yong E-mail: xie813@263.net; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

    2004-10-01

    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells.

  12. A Meta-Analysis of Aperiodic Noise Stress on Human Performance

    National Research Council Canada - National Science Library

    Saxton, B. M; Ross, J. M; Braczyk, A; Conway, G. E; Szalma, J. L; Hancock, P. A

    2006-01-01

    Aperiodic noise, also known as intermittent noise, is a pervasive and influential source of stress across military environments, and can be defined by the changes in its intensity over a given period of time...

  13. Bias driven coherent carrier dynamics in a two-dimensional aperiodic potential

    NARCIS (Netherlands)

    de Moura, F. A. B. F.; Viana, L. P.; Lyra, M. L.; Malyshev, Victor; Dominguez-Adame, F.

    2008-01-01

    We study the dynamics of an electron wave-packet in a two-dimensional square lattice with an aperiodic site potential in the presence of an external uniform electric field. The aperiodicity is described by epsilon(m) = V cos(pi alpha m(x)(nu x)) cos(pi alpha m(y)(nu y)) at lattice sites (m(x),m(y)),

  14. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

    2014-01-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

  15. ENERGY-DEPENDENT POWER SPECTRAL STATES AND ORIGIN OF APERIODIC VARIABILITY IN BLACK HOLE BINARIES

    International Nuclear Information System (INIS)

    Yu Wenfei; Zhang Wenda

    2013-01-01

    We found that the black hole candidate MAXI J1659–152 showed distinct power spectra, i.e., power-law noise (PLN) versus band-limited noise (BLN) plus quasi-periodic oscillations (QPOs) below and above about 2 keV, respectively, in observations with Swift and the Rossi X-ray Timing Explorer during the 2010 outburst, indicating a high energy cutoff of the PLN and a low energy cutoff of the BLN and QPOs around 2 keV. The emergence of the PLN and the fading of the BLN and QPOs initially took place below 2 keV when the source entered the hard intermediate state and settled in the soft state three weeks later. The evolution was accompanied by the emergence of the disk spectral component and decreases in the amplitudes of variability in the soft and hard X-ray bands. Our results indicate that the PLN is associated with an optically thick disk in both hard and intermediate states, and the power spectral state is independent of the X-ray energy spectral state in a broadband view. We suggest that in the hard or intermediate state, the BLN and QPOs emerge from the innermost hot flow subjected to Comptonization, while the PLN originates from the optically thick disk farther out. The energy cutoffs of the PLN and the BLN or QPOs then follow the temperature of the seed photons from the inner edge of the optically thick disk, while the high frequency cutoff of the PLN follows the orbital frequency of the inner edge of the optically thick disk as well.

  16. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1992-01-01

    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  17. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

    Science.gov (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

    2017-12-01

    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  18. Rate-distortion functions of non-stationary Markoff chains and their block-independent approximations

    OpenAIRE

    Agarwal, Mukul

    2018-01-01

    It is proved that the limit of the normalized rate-distortion functions of block independent approximations of an irreducible, aperiodic Markoff chain is independent of the initial distribution of the Markoff chain and thus, is also equal to the rate-distortion function of the Markoff chain.

  19. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue

    2011-01-01

    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  20. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure.

    Science.gov (United States)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

    2013-12-01

    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air-cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one.

  1. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

    2012-01-01

    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  2. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  3. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li

    2014-04-01

    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  4. Spatial and spectral detection of protein monolayers with deterministic aperiodic arrays of metal nanoparticles

    Science.gov (United States)

    Lee, Sylvanus Y.; Amsden, Jason J.; Boriskina, Svetlana V.; Gopinath, Ashwin; Mitropolous, Alexander; Kaplan, David L.; Omenetto, Fiorenzo G.; Negro, Luca Dal

    2010-01-01

    Light scattering phenomena in periodic systems have been investigated for decades in optics and photonics. Their classical description relies on Bragg scattering, which gives rise to constructive interference at specific wavelengths along well defined propagation directions, depending on illumination conditions, structural periodicity, and the refractive index of the surrounding medium. In this paper, by engineering multifrequency colorimetric responses in deterministic aperiodic arrays of nanoparticles, we demonstrate significantly enhanced sensitivity to the presence of a single protein monolayer. These structures, which can be readily fabricated by conventional Electron Beam Lithography, sustain highly complex structural resonances that enable a unique optical sensing approach beyond the traditional Bragg scattering with periodic structures. By combining conventional dark-field scattering micro-spectroscopy and simple image correlation analysis, we experimentally demonstrate that deterministic aperiodic surfaces with engineered structural color are capable of detecting, in the visible spectral range, protein layers with thickness of a few tens of Angstroms. PMID:20566892

  5. Interacting binaries

    CERN Document Server

    Shore, S N; van den Heuvel, EPJ

    1994-01-01

    This volume contains lecture notes presented at the 22nd Advanced Course of the Swiss Society for Astrophysics and Astronomy. The contributors deal with symbiotic stars, cataclysmic variables, massive binaries and X-ray binaries, in an attempt to provide a better understanding of stellar evolution.

  6. Homogenization procedures for the constitutive material modeling and analysis of aperiodic micro-structures

    Science.gov (United States)

    Aghalaya Manjunatha, Preetham

    Composite materials are the well-known substitutes for traditional metals in various industries because of their micro-structural character. Micro-structures provide a high strength-to-weight ratio, which makes them suitable for manufacturing large variety of applications ranging from simple toys to complicated space/aircraft structures. Since, these materials are widely used in high performance structures, their stress/thermal analysis issues are of major concern. Due to the high degree of material heterogeneity, it is extremely difficult to analyze such structures. Homogenization (rigorous averaging) is a process that overcomes the difficulty of modeling each micro-structure. It replaces an individual micro-structure by an equivalent material model representation (unit cell). Periodic micro-structures appear in regular intervals throughout the domain, in contrast aperiodic micro-structures follows an irregular pattern. Further, this method bridges the analysis gap between micro and macro domain of the structures. In this thesis, Homogenization procedure based on anti-periodic displacement fields for aperiodic micro-structures and aperiodic boundary conditions are considered to model the constitutive material matrix. This work could be easily implemented with the traditional finite element packages. In addition, it eventually increases the convergence accuracy and reduces the high computational expenses. Different problems are analyzed by the implementation of digital image processing schemes for the extraction of a unit cell around the Gauss quadrature points and the mesh-generation. In the future, this research defines a new path for the analysis of any random heterogeneous materials by its ease of implementation and the state-of-the-art micro-structure material modeling capabilities and digital image based micro-meshing.

  7. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos

    2015-05-01

    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  8. Rapidly tunable optical parametric oscillator based on aperiodic quasi-phase matching.

    Science.gov (United States)

    Descloux, Delphine; Dherbecourt, Jean-Baptiste; Melkonian, Jean-Michel; Raybaut, Myriam; Lai, Jui-Yu; Drag, Cyril; Godard, Antoine

    2016-05-16

    A new optical parametric oscillator (OPO) architecture with high tuning speed capability is demonstrated. This device exploits the versatility offered by aperiodic quasi-phase matching (QPM) to provide a broad parametric gain spectrum without changing the temperature, angle, or position of the nonlinear crystal. Rapid tuning is then straightforwardly achieved using a fast intracavity spectral filter. This concept is demonstrated here for a picosecond synchronously pumped OPO containing an aperiodically poled MgO-doped LiNbO3 crystal and a rapidly tunable spectral filter based on a diffraction grating. Tuning over 160 nm around 3.86 μm is achieved at fixed temperature and a fast tuning over 30 nm in 40 μs is demonstrated. Different configurations are tested and compared. The cavity length detuning is analyzed and discussed. This device is successfully used to detect N2O by absorption. This approach could be generalized to other spectral ranges (e.g., visible) and temporal regimes (e.g., continuous-wave or nanosecond).

  9. Aperiodic linear networked control considering variable channel delays: application to robots coordination.

    Science.gov (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

    2015-05-27

    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  10. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    Science.gov (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  11. Swinging multi-source industrial CT systems for aperiodic dynamic imaging.

    Science.gov (United States)

    Wu, Weiwen; Yu, Hengyong; Gong, Changcheng; Liu, Fenglin

    2017-10-02

    The goal of this paper is to develop a new architecture for industrial computed tomography (ICT) aiming at dynamically imaging an aperiodic changing object. We propose a data acquisition approach with multiple x-ray source/detector pairs targeting a continuously changeable object with corresponding timeframes. In this named swinging multi-source CT (SMCT) structure, each source and its associated detector swing forth and back within a certain angle for CT scanning. In the SMCT system design, we utilize a circular journal bearing based setup to replace the normal CT slip ring by weakening the scanning speed requirement. Inspired by the prior image constrained compressed sensing (PICCS) algorithm, we apply a modified PICCS algorithm for the SMCT (SM-PICCS). Our numerical simulation and realistic specimen experiment studies demonstrate the feasibility of the proposed approach.

  12. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.

    1992-09-01

    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  13. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  14. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

    2012-02-01

    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  15. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...... on the IEEE 14-bus and the Nordic32 test systems where results show that the method can efficiently determine the required active power redispatch to avoid an imminent instability....

  16. Velocity Fluctuations Driven by the Damped, Aperiodic Mode in the Intergalactic Medium

    Science.gov (United States)

    Kolberg, U.; Schlickeiser, R.; Yoon, P. H.

    2017-08-01

    On account of its finite temperature, the unmagnetized intergalactic medium (IGM) is subject to thermal fluctuations. Due to the fundamental coupling between particles and fields in a plasma, the field fluctuations generate current densities by means of the Lorentz force and thereby affect both the density and the velocity fluctuations of the particles. Recently, a new damped, aperiodic mode was discovered that dominates field fluctuations in the IGM. Apart from its impact on the transport properties of the IGM that determine the propagation of cosmic rays, previous research has shown that this mode provides turbulent magnetic seed fields of 6× {10}-18 {{G}} that are an essential ingredient in the generation of cosmic magnetic fields. The current investigation addresses the influence of the mode on the particle motion. In order to describe the corresponding state of the turbulence, both the spectrum and the integrated total value of the mode-driven proton velocity fluctuations are computed. It is found that the latter amounts to 1.16× {10}8{ T}47/2{n}-7-1/2 {cm} {{{s}}}-1 assuming a temperature of {T}e={T}p={10}4{T}4 {{K}} and a density of {n}e={n}p={10}-7{n}-7 {{cm}}-3. This value is two orders of magnitude larger than the thermal velocity. If the IGM neutrals adopt the same velocities as the protons by mutual charge exchange and elastic collisions (ambipolar diffusion), atomic lines propagating through the IGM are expected to display spectral broadening, enhanced by a factor of 90 beyond the thermal level in the case of hydrogen. This opens the window to a first direct observation of the damped aperiodic mode. Other observational techniques such as dispersion measure, rotation measure, and scintillation data are not applicable in this case because the mode is a transverse one, and, as such, it does not induce the required density fluctuations, as is shown here.

  17. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon

    2009-06-01

    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  18. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

    Science.gov (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

    2018-03-01

    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  19. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    Science.gov (United States)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  20. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

    2011-01-01

    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  1. Aperiodic and randomized dielectric mirrors: alternatives to metallic back reflectors for solar cells.

    Science.gov (United States)

    Lin, Albert; Zhong, Yan-Kai; Fu, Sze-Ming; Tseng, Chi Wei; Yan, Sheng Lun

    2014-05-05

    Dielectric mirrors have recently emerged for solar cells due to the advantages of lower cost, lower temperature processing, higher throughput, and zero plasmonic absorption as compared to conventional metallic counterparts. Nonetheless, in the past, efforts for incorporating dielectric mirrors into photovoltaics were not successful due to limited bandwidth and insufficient light scattering that prevented their wide usage. In this work, it is shown that the key for ultra-broadband dielectric mirrors is aperiodicity, or randomization. In addition, it has been proven that dielectric mirrors can be widely applicable to thin-film and thick wafer-based solar cells to provide for light trapping comparable to conventional metallic back reflectors at their respective optimal geometries. Finally, the near-field angular emission plot of Poynting vectors is conducted, and it further confirms the superior light-scattering property of dielectric mirrors, especially for diffuse medium reflectors, despite the absence of surface plasmon excitation. The preliminary experimental results also confirm the high feasibility of dielectric mirrors for photovoltaics.

  2. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

    Science.gov (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

    2001-04-01

    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  3. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

    Science.gov (United States)

    Koju, Vijay

    Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

  4. Time variability of X-ray binaries: observations with INTEGRAL. Modeling

    International Nuclear Information System (INIS)

    Cabanac, Clement

    2007-01-01

    The exact origin of the observed X and Gamma ray variability in X-ray binaries is still an open debate in high energy astrophysics. Among others, these objects are showing aperiodic and quasi-periodic luminosity variations on timescales as small as the millisecond. This erratic behavior must put constraints on the proposed emission processes occurring in the vicinity of the neutrons star or the stellar mass black-hole held by these objects. We propose here to study their behavior following 3 different ways: first we examine the evolution of a particular X-ray source discovered by INTEGRAL, IGR J19140+0951. Using timing and spectral data given by different instruments, we show that the source type is plausibly consistent with a High Mass X-ray Binary hosting a neutrons star. Subsequently, we propose a new method dedicated to the study of timing data coming from coded mask aperture instruments. Using it on INTEGRAL/ISGRI real data, we detect the presence of periodic and quasi-periodic features in some pulsars and micro-quasars at energies as high as a hundred keV. Finally, we suggest a model designed to describe the low frequency variability of X-ray binaries in their hardest state. This model is based on thermal comptonization of soft photons by a warm corona in which a pressure wave is propagating in cylindrical geometry. By computing both numerical simulations and analytical solution, we show that this model should be suitable to describe some of the typical features observed in X-ray binaries power spectra in their hard state and their evolution such as aperiodic noise and low frequency quasi-periodic oscillations. (author) [fr

  5. Statistics of clusters in binary linear lattices

    NARCIS (Netherlands)

    Felderhof, B.U.

    The statistics of clusters in binary linear lattices is studied on the assumption that the relative weight of an Al or Bm cluster is determined only by its size l or m, and is independent of the location of the cluster on the chain. The average cluster numbers and the variance of their fluctuations

  6. Solving a binary puzzle

    NARCIS (Netherlands)

    P.H. Utomo (Putranto); R.H. Makarim (Rusydi)

    2017-01-01

    textabstractA Binary puzzle is a Sudoku-like puzzle with values in each cell taken from the set (Formula presented.). Let (Formula presented.) be an even integer, a solved binary puzzle is an (Formula presented.) binary array that satisfies the following conditions: (1) no three consecutive ones and

  7. Eclipsing binaries in open clusters

    DEFF Research Database (Denmark)

    Southworth, John; Clausen, J.V.

    2006-01-01

    Stars: fundamental parameters - Stars : binaries : eclipsing - Stars: Binaries: spectroscopic - Open clusters and ass. : general Udgivelsesdato: 5 August......Stars: fundamental parameters - Stars : binaries : eclipsing - Stars: Binaries: spectroscopic - Open clusters and ass. : general Udgivelsesdato: 5 August...

  8. Programmable spectral design and the binary supergrating

    Science.gov (United States)

    Levner, Daniel

    Spectral operations such as wavelength selection, power level manipulation, and chromatic dispersion control are key to many processes in optical telecommunication, spectroscopy, and sensing. In their simplest forms, these functions can be performed using a number of successful devices such as the Fraunhofer ("diffraction") grating, Bragg grating, thin-film filter (TFF), and dispersion-compensating fiber (DCF). More complicated manipulations, however, often require either problematic cascades of many simple elements, the use of custom technologies that offer little adjustment, or the implementation of fully programmable devices, which allow for the desired spectral function to be synthesized ab initio. Here, I present the Binary Supergrating (BSG), a novel technology that permits the programmable and near-arbitrary control of optical amplitude and phase using a simple, robust and practical form. This guided-wave form consists of an aperiodic sequence of binary elements; the sequence, determined through the process of BSG synthesis, encodes an optical program that defines device functionality. The ability to derive optical programs that address broad spectral demands is central to the BSG's extensive capabilities. In consequence, I present a powerful approach to synthesis that exploits existing knowledge in the design of "analog" gratings. This approach is based on a two-step process, which first derives an analog diffractive structure using the best available methods and then transforms it into binary form. Accordingly, I discuss the notion of diffractive structure transformation and introduce the principle of key information. I identify such key information and illustrate its application in grating quantizers based on an atypical form of Delta-Sigma modulation. As a digital approach to spectral engineering, the BSG presents many of the same advantages offered by the digital approach to electronic signal processing (DSP) over its analog predecessors. As such, it

  9. Composite Binary Sequences with a Large Ensemble and Zero Correlation Zone

    Directory of Open Access Journals (Sweden)

    S. S. Yudachev

    2015-01-01

    Full Text Available The article considers a proposed class of derived signals such as composite binary sequences for application in advanced spread spectrum radio systems of various purposes, using signals based on spectrum spreading by direct sequence method. Considered composite sequences, having a representative set of lengths and unique correlation properties, compares favorably with the widely used at present large ensembles formed on a single algorithmic basis. To evaluate the properties of the composite sequences generated on the basis of two components - the Barker code and Kerdock sequences, expressions of periodic and aperiodic correlation functions are given.An algorithm for generating practical ensembles of composite sequences is presented. On the basis of the algorithm and its software implementation in C #, the samples of the sequence ensembles of various lengths were obtained and their periodic and aperiodic correlation functions and statistical characteristics were studied in detail. As an illustration, some of the most typical correlation functions are presented. The most remarkable characteristics allowing a ssessing the feasibility of using this type of sequences in the design of specific types of radio systems are considered.On the basis of the proposed program and the performed calculations the conclusions can be drawn about the possibility of using the sequences of these classes, with the aim of reducing intra-system disturbance in the projected spread spectrum CDMA.

  10. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

    Science.gov (United States)

    Kato, N.

    2017-12-01

    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  11. Interacting binary stars

    CERN Document Server

    Sahade, Jorge; Ter Haar, D

    1978-01-01

    Interacting Binary Stars deals with the development, ideas, and problems in the study of interacting binary stars. The book consolidates the information that is scattered over many publications and papers and gives an account of important discoveries with relevant historical background. Chapters are devoted to the presentation and discussion of the different facets of the field, such as historical account of the development in the field of study of binary stars; the Roche equipotential surfaces; methods and techniques in space astronomy; and enumeration of binary star systems that are studied

  12. Binary Masking & Speech Intelligibility

    DEFF Research Database (Denmark)

    Boldt, Jesper

    The purpose of this thesis is to examine how binary masking can be used to increase intelligibility in situations where hearing impaired listeners have difficulties understanding what is being said. The major part of the experiments carried out in this thesis can be categorized as either experime......The purpose of this thesis is to examine how binary masking can be used to increase intelligibility in situations where hearing impaired listeners have difficulties understanding what is being said. The major part of the experiments carried out in this thesis can be categorized as either...... experiments under ideal conditions or as experiments under more realistic conditions useful for real-life applications such as hearing aids. In the experiments under ideal conditions, the previously defined ideal binary mask is evaluated using hearing impaired listeners, and a novel binary mask -- the target...... binary mask -- is introduced. The target binary mask shows the same substantial increase in intelligibility as the ideal binary mask and is proposed as a new reference for binary masking. In the category of real-life applications, two new methods are proposed: a method for estimation of the ideal binary...

  13. On the thickness of accretion curtains on magnetized compact objects from analysis of their fast aperiodic time variability.

    Science.gov (United States)

    Semena, Andrey

    It is widely accepted that accretion onto magnetized compact objects is channelled to some areas close to magnetic poles of the star. Thickness of this channelled accretion flow intimately depends on details of penetration of highly conducting plasma of the flow to the compact object magnetosphere, i.e. on magnetic diffusivity etc. Until now our knowledge of these plasma properties is scarce. In our work we present our attempts to estimate the thickness of the plasma flow on top of the magnetosphere from observations of accreting intermediate polars (magnetized white dwarfs). We show that properties of aperiodic noise of accreting intermediate polars can be used to put constrains on cooling time of hot plasma, heated in the standing shock wave above the WD surface. Estimates of the cooling time and the mass accretion rate provide us a tool to measure the density of post-shock plasma and the cross-sectional area of the accretion funnel at the WD surface. We have studied aperiodic noise of emission of one of the brightest intermediate polar EX Hya with the help of data in optical and X-ray energy bands. We put an upper limit on the plasma cooling timescale tau <0.2-0.5 sec, on the fractional area of the accretion curtain footprint f < 1.6 × 10(-4) . We show that measurements of accretion column footprints, combined with results of the eclipse mapping, can be used to obtain an upper limit on the penetration depth of the accretion disc plasma at the boundary of the magnetosphere, Delta r / r ≈ 10(-3) If the magnetospheres of accreting neutron stars have similar plasma penetration depths at their boundaries, we predict that footprints of their accretion columns should be very small, with fractional areas < 10(-6) .

  14. Study and realisation of chaining operators

    International Nuclear Information System (INIS)

    Khan, Mohd Solaiman

    1970-01-01

    Within the frame of researches in the field of binary analysis performed in the nuclear instrumentation department of the Saclay Nuclear Centre, this research thesis belongs to the field of applications of binary analysis theories, and more particularly to the development and study of a chaining operator (chaining operators are used to develop complex automatic systems with a clear separation between information processing and program-based management of this processing). The author first recalls some notions of binary analysis: algebraic binary sets, products and their specific properties, and practical realisation of binary functions by means of logical circuits. He recalls methods for the general study of sequential systems; generalities, base functions, elementary reflex functions, graphical study of sequential systems, search for and removal of commutation variations. He discusses the present organisation of electronic computers: software, hardware, synchronous and asynchronous control. He presents chaining operators: generalities, computation of a chaining operator, static aspect of chaining operators. He reports and comments the practical realisation of chaining operators: components, measurements performed on elaborated chaining operators, simulation experimental set-up [fr

  15. Binary effectivity rules

    DEFF Research Database (Denmark)

    Keiding, Hans; Peleg, Bezalel

    2006-01-01

    effectivity rule is regular if it is the effectivity rule of some regular binary SCR. We characterize completely the family of regular binary effectivity rules. Quite surprisingly, intrinsically defined von Neumann-Morgenstern solutions play an important role in this characterization...

  16. Binary colloidal crystals

    NARCIS (Netherlands)

    Christova-Zdravkova, C.G.

    2005-01-01

    Binary crystals are crystals composed of two types of particles having different properties like size, mass density, charge etc. In this thesis several new approaches to make binary crystals of colloidal particles that differ in size, material and charge are reported We found a variety of crystal

  17. Analysis and prediction of aperiodic hydrodynamic oscillatory time series by feed-forward neural networks, fuzzy logic, and a local nonlinear predictor

    Energy Technology Data Exchange (ETDEWEB)

    Gentili, Pier Luigi, E-mail: pierluigi.gentili@unipg.it [Department of Chemistry, Biology and Biotechnology, University of Perugia, 06123 Perugia (Italy); Gotoda, Hiroshi [Department of Mechanical Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu-shi, Shiga 525-8577 (Japan); Dolnik, Milos; Epstein, Irving R. [Department of Chemistry, Brandeis University, Waltham, Massachusetts 02454-9110 (United States)

    2015-01-15

    Forecasting of aperiodic time series is a compelling challenge for science. In this work, we analyze aperiodic spectrophotometric data, proportional to the concentrations of two forms of a thermoreversible photochromic spiro-oxazine, that are generated when a cuvette containing a solution of the spiro-oxazine undergoes photoreaction and convection due to localized ultraviolet illumination. We construct the phase space for the system using Takens' theorem and we calculate the Lyapunov exponents and the correlation dimensions to ascertain the chaotic character of the time series. Finally, we predict the time series using three distinct methods: a feed-forward neural network, fuzzy logic, and a local nonlinear predictor. We compare the performances of these three methods.

  18. Analysis and prediction of aperiodic hydrodynamic oscillatory time series by feed-forward neural networks, fuzzy logic, and a local nonlinear predictor.

    Science.gov (United States)

    Gentili, Pier Luigi; Gotoda, Hiroshi; Dolnik, Milos; Epstein, Irving R

    2015-01-01

    Forecasting of aperiodic time series is a compelling challenge for science. In this work, we analyze aperiodic spectrophotometric data, proportional to the concentrations of two forms of a thermoreversible photochromic spiro-oxazine, that are generated when a cuvette containing a solution of the spiro-oxazine undergoes photoreaction and convection due to localized ultraviolet illumination. We construct the phase space for the system using Takens' theorem and we calculate the Lyapunov exponents and the correlation dimensions to ascertain the chaotic character of the time series. Finally, we predict the time series using three distinct methods: a feed-forward neural network, fuzzy logic, and a local nonlinear predictor. We compare the performances of these three methods.

  19. BINARY MINOR PLANETS

    Data.gov (United States)

    National Aeronautics and Space Administration — The data set lists orbital and physical properties for well-observed or suspected binary/multiple minor planets including the Pluto system, compiled from the...

  20. Close binary stars

    International Nuclear Information System (INIS)

    Larsson-Leander, G.

    1979-01-01

    Studies of close binary stars are being persued more vigorously than ever, with about 3000 research papers and notes pertaining to the field being published during the triennium 1976-1978. Many major advances and spectacular discoveries were made, mostly due to increased observational efficiency and precision, especially in the X-ray, radio, and ultraviolet domains. Progress reports are presented in the following areas: observational techniques, methods of analyzing light curves, observational data, physical data, structure and models of close binaries, statistical investigations, and origin and evolution of close binaries. Reports from the Coordinates Programs Committee, the Committee for Extra-Terrestrial Observations and the Working Group on RS CVn binaries are included. (Auth./C.F.)

  1. Binary and ternary systems

    International Nuclear Information System (INIS)

    Petrov, D.A.

    1986-01-01

    Conditions for thermodynamical equilibrium in binary and ternary systems are considered. Main types of binary and ternary system phase diagrams are sequently constructed on the basis of general regularities on the character of transition from one equilibria to others. New statements on equilibrium line direction in the diagram triple points and their isothermal cross sections are developed. New represenations on equilibria in case of monovariant curve minimum and maximum on three-phase equilibrium formation in ternary system are introduced

  2. Binary and Millisecond Pulsars

    OpenAIRE

    Lorimer, D. R.

    2005-01-01

    We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1800. There are now 83 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 140 pulsars in 26 of the Galactic globular clusters. Recent highlights include the discovery of the young relativistic b...

  3. Chain Posets

    OpenAIRE

    Johnson, Ian T.

    2018-01-01

    A chain poset, by definition, consists of chains of ordered elements in a poset. We study the chain posets associated to two posets: the Boolean algebra and the poset of isotropic flags. We prove that, in both cases, the chain posets satisfy the strong Sperner property and are rank-log concave.

  4. Astrophysics of white dwarf binaries

    NARCIS (Netherlands)

    Nelemans, G.A.

    2006-01-01

    White dwarf binaries are the most common compact binaries in the Universe and are especially important for low-frequency gravitational wave detectors such as LISA. There are a number of open questions about binary evolution and the Galactic population of white dwarf binaries that can be solved using

  5. Evolution of cataclysmic binaries

    International Nuclear Information System (INIS)

    Paczynski, B.

    1981-01-01

    Cataclysmic binaries with short orbital periods have low mass secondary components. Their nuclear time scale is too long to be of evolutionary significance. Angular momentum loss from the binary drives the mass transfer between the two components. As long as the characteristic time scale is compared with the Kelvin-Helmholtz time scale of the mass losing secondary the star remains close to the main sequence, and the binary period decreases with time. If angular momentum loss is due to gravitational radiation then the mass transfer time scale becomes comparable to the Kelvin-Helmoltz time scale when the secondary's mass decreases to 0.12 Msub(sun), and the binary period is reduced to 80 minutes. Later, the mass losing secondary departs from the main sequence and gradually becomes degenerate. Now the orbital period increases with time. The observed lower limit to the orbital periods of hydrogen rich cataclysmic binaries implies that gravitational radiation is the main driving force for the evolution of those systems. It is shown that binaries emerging from a common envelope phase of evolution are well detached. They have to lose additional angular momentum to become semidetached cataclysmic variables. (author)

  6. How Chain Intermixing Dictates the Polymorphism of PVDF in Poly(vinylidene fluoride/Polymethylmethacrylate Binary System during Recrystallization: A Comparative Study on Core–Shell Particles and Latex Blend

    Directory of Open Access Journals (Sweden)

    Yue Li

    2017-09-01

    Full Text Available In the past few decades, Poly(vinylidene fluoride/Polymethylmethacrylate (PVDF/PMMA binary blend has attracted substantial attention in the scientific community due to possible intriguing mechanical, optical and ferroelectric properties that are closely related to its multiple crystal structures/phases. However, the effect of PMMA phase on the polymorphism of PVDF, especially the relationship between miscibility and polymorphism, remains an open question and is not yet fully understood. In this work, three series of particle blends with varied levels of miscibility between PVDF and PMMA were prepared via seeded emulsion polymerization: PVDF–PMMA core–shell particle (PVDF@PMMA with high miscibility; PVDF/PMMA latex blend with modest miscibility; and PVDF@c–PMMA (crosslinked PMMA core–shell particle with negligible miscibility. The difference in miscibility, and the corresponding morphology and polymorphism were systematically studied to correlate the PMMA/PVDF miscibility with PVDF polymorphism. It is of interest to observe that the formation of polar β/γ phase during melt crystallization could be governed in two ways: dipole–dipole interaction and fast crystallization. For PVDF@PMMA and PVDF/PMMA systems, in which fast crystallization was unlikely triggered, higher content of β/γ phase, and intense suppression of crystallization temperature and capacity were observed in PVDF@PMMA, because high miscibility favored a higher intensity of overall dipole–dipole interaction and a longer interaction time. For PVDF@c–PMMA system, after a complete coverage of PVDF seeds by PMMA shells, nearly pure β/γ phase was obtained owing to the fast homogeneous nucleation. This is the first report that high miscibility between PVDF and PMMA could favor the formation of β/γ phase.

  7. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

    2012-01-01

    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  8. Binary Neutron Star Mergers

    Directory of Open Access Journals (Sweden)

    Joshua A. Faber

    2012-07-01

    Full Text Available We review the current status of studies of the coalescence of binary neutron star systems. We begin with a discussion of the formation channels of merging binaries and we discuss the most recent theoretical predictions for merger rates. Next, we turn to the quasi-equilibrium formalisms that are used to study binaries prior to the merger phase and to generate initial data for fully dynamical simulations. The quasi-equilibrium approximation has played a key role in developing our understanding of the physics of binary coalescence and, in particular, of the orbital instability processes that can drive binaries to merger at the end of their lifetimes. We then turn to the numerical techniques used in dynamical simulations, including relativistic formalisms, (magneto-hydrodynamics, gravitational-wave extraction techniques, and nuclear microphysics treatments. This is followed by a summary of the simulations performed across the field to date, including the most recent results from both fully relativistic and microphysically detailed simulations. Finally, we discuss the likely directions for the field as we transition from the first to the second generation of gravitational-wave interferometers and while supercomputers reach the petascale frontier.

  9. Skewed Binary Search Trees

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Moruz, Gabriel

    2006-01-01

    It is well-known that to minimize the number of comparisons a binary search tree should be perfectly balanced. Previous work has shown that a dominating factor over the running time for a search is the number of cache faults performed, and that an appropriate memory layout of a binary search tree...... can reduce the number of cache faults by several hundred percent. Motivated by the fact that during a search branching to the left or right at a node does not necessarily have the same cost, e.g. because of branch prediction schemes, we in this paper study the class of skewed binary search trees....... For all nodes in a skewed binary search tree the ratio between the size of the left subtree and the size of the tree is a fixed constant (a ratio of 1/2 gives perfect balanced trees). In this paper we present an experimental study of various memory layouts of static skewed binary search trees, where each...

  10. Modelling binary data

    CERN Document Server

    Collett, David

    2002-01-01

    INTRODUCTION Some Examples The Scope of this Book Use of Statistical Software STATISTICAL INFERENCE FOR BINARY DATA The Binomial Distribution Inference about the Success Probability Comparison of Two Proportions Comparison of Two or More Proportions MODELS FOR BINARY AND BINOMIAL DATA Statistical Modelling Linear Models Methods of Estimation Fitting Linear Models to Binomial Data Models for Binomial Response Data The Linear Logistic Model Fitting the Linear Logistic Model to Binomial Data Goodness of Fit of a Linear Logistic Model Comparing Linear Logistic Models Linear Trend in Proportions Comparing Stimulus-Response Relationships Non-Convergence and Overfitting Some other Goodness of Fit Statistics Strategy for Model Selection Predicting a Binary Response Probability BIOASSAY AND SOME OTHER APPLICATIONS The Tolerance Distribution Estimating an Effective Dose Relative Potency Natural Response Non-Linear Logistic Regression Models Applications of the Complementary Log-Log Model MODEL CHECKING Definition of Re...

  11. Evolution of dwarf binaries

    International Nuclear Information System (INIS)

    Tutukov, A.V.; Fedorova, A.V.; Yungel'son, L.R.

    1982-01-01

    The conditions of mass exchange in close binary systems with masses of components less or equal to one solar mass have been analysed for the case, when the system radiates gravitational waves. It has been shown that the mass exchange rate depends in a certain way on the mass ratio of components and on the mass of component that fills its inner critical lobe. The comparison of observed periods, masses of contact components, and mass exchange rates of observed cataclysmic binaries have led to the conclusion that the evolution of close binaries WZ Sge, OY Car, Z Cha, TT Ari, 2A 0311-227, and G 61-29 may be driven by the emission of gravitational waves [ru

  12. Evolution of dwarf binaries

    International Nuclear Information System (INIS)

    Tutukov, A.V.; Fedorova, A.V.; Yungel'son, L.R.

    1982-01-01

    The circumstances of mass exchange in close binary systems whose components have a mass < or approx. =1 M/sub sun/ are analyzed for the case where the system is losing orbital angular momentum by radiation of gravitational waves. The mass exchange rate will depend on the mass ratio of the components and on the mass of the component that is overfilling its critical Roche lobe. A comparison of the observed orbital periods, masses of the components losing material, and mass exchange rates against the theoretical values for cataclysmic binaries indicates that the evolution of the close binaries WZ Sge, OY Car, Z Cha, TT Ari, 2A 0311-227, and G61-29 may be driven by the emission of gravitational waves

  13. Binary and Millisecond Pulsars

    Directory of Open Access Journals (Sweden)

    Lorimer Duncan R.

    2008-11-01

    Full Text Available We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1800. There are now 83 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 140 pulsars in 26 of the Galactic globular clusters. Recent highlights include the discovery of the young relativistic binary system PSR J1906+0746, a rejuvination in globular cluster pulsar research including growing numbers of pulsars with masses in excess of 1.5M_⊙, a precise measurement of relativistic spin precession in the double pulsar system and a Galactic millisecond pulsar in an eccentric (e = 0.44 orbit around an unevolved companion.

  14. The Brightest Binaries

    Science.gov (United States)

    Vanbeveren, D., Van Rensbergen, W., De Loore, C.

    Massive stars are distributed all over the upper part of the Hertzsprung-Russell diagram according to their subsequent phases of stellar evolution from main sequence to supernova. Massive stars may either be single or they may be a component of a close binary. The observed single star/binary frequency is known only in a small part of the Galaxy. Whether this holds for the whole galaxy or for the whole cosmos is questionable and needs many more high quality observations. Massive star evolution depends critically on mass loss by stellar wind and this stellar wind mass loss may change dramatically when stars evolve from one phase to another. We start the book with a critical discussion of observations of the different types of massive stars, observations that are of fundamental importance in relation to stellar evolution, with special emphasis on mass loss by stellar wind. We update our knowledge of the physics that models the structure and evolution of massive single stars and we present new calculations. The conclusions resulting from a comparison between these calculations and observations are then used to study the evolution of massive binaries. This book provides our current knowledge of a great variety of massive binaries, and hence of a great variety of evolutionary phases. A large number of case studies illustrates the existence of these phases. Finally, we present the results of massive star population number synthesis, including the effect of binaries. The results indicate that neglecting them leads to a conclusion which may be far from reality. This book is written for researchers in massive star evolution. We hope that, after reading this book, university-level astrophysics students will become fascinated by the exciting world of the `Brightest Binaries'.

  15. Quaternary ammonium room-temperature ionic liquid including an oxygen atom in side chain/lithium salt binary electrolytes: ionic conductivity and 1H, 7Li, and 19F NMR studies on diffusion coefficients and local motions.

    Science.gov (United States)

    Hayamizu, Kikuko; Tsuzuki, Seiji; Seki, Shiro; Ohno, Yasutaka; Miyashiro, Hajime; Kobayashi, Yo

    2008-01-31

    A room-temperature ionic liquid (RTIL) of a quaternary ammonium cation having an ether chain, N,N-diethyl-N-methyl-N-(2-methoxyethyl)ammonium bis(trifluoromethylsulfonyl)amide (DEME-TFSA), is a candidate for use as an electrolyte of lithium secondary batteries. In this study, the electrochemical ionic conductivity, sigma, of the neat DEME-TFSA and DEME-TFSA-Li doped with five different concentrations of lithium salt (LiTFSA) was measured and correlated with NMR measurements of the diffusion coefficients D and the spin-lattice relaxation times T1 of the individual components DEME (1H), TFSA (19F), and lithium ion (7Li). The ion conduction of charged ions can be activated with less thermal energy than ion diffusion which contains a contribution from paired ions in DEME-TFSA. In the doped DEME-TFSA-Li samples, the sigma and D values decreased with increasing salt concentration, and within the same sample generally DLisalt concentration at low temperatures. Since plots of the temperature dependence of T1 of the 1H and 7Li resonances showed T1 minima, the correlation times tauc(H) and tauc(Li) were calculated for reorientational motions of DEME and the lithium jump, respectively. At the same temperature, tauc(Li) is longer than tauc(H), suggesting that the molecular motion of DEME occurs more rapidly than the lithium jump. Combining the DLi and tauc(Li), averaged distances for the lithium jump were estimated.

  16. Encounters of binaries

    International Nuclear Information System (INIS)

    Mikkola, S.

    1983-01-01

    Gravitational encounters of pairs of binaries have been studied numerically. Various cross-sections have been calculated for qualitative final results of the interaction and for energy transfer between the binding energy and the centre of mass kinetic energy. The distribution of the kinetic energies, resulting from the gravitational collision, were found to be virtually independent of the impact velocity in the case of collision of hard binaries. It was found that one out of five collisions, which are not simple fly-by's, leads to the formation of a stable three-body system. (author)

  17. Binary and Millisecond Pulsars

    Directory of Open Access Journals (Sweden)

    Duncan R. Lorimer

    1998-09-01

    Full Text Available Our knowledge of binary and millisecond pulsars has greatly increased in recent years. This is largely due to the success of large-area surveys which have brought the known population of such systems in the Galactic disk to around 50. As well as being interesting as a population of astronomical sources, many pulsars turn out to be superb celestial clocks. In this review we summarise the main properties of binary and millisecond pulsars and highlight some of their applications to relativistic astrophysics.

  18. Binary and Millisecond Pulsars

    Directory of Open Access Journals (Sweden)

    Lorimer Duncan R.

    2005-11-01

    Full Text Available We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1700. There are now 80 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 103 pulsars in 24 of the Galactic globular clusters. Recent highlights have been the discovery of the first ever double pulsar system and a recent flurry of discoveries in globular clusters, in particular Terzan 5.

  19. Interacting binary stars

    International Nuclear Information System (INIS)

    Pringle, J.E.; Wade, R.A.

    1985-01-01

    This book reviews the theoretical and observational knowledge of interacting binary stars. The topics discussed embrace the following features of these objects: their orbits, evolution, mass transfer, angular momentum losses, X-ray emission, eclipses, variability, and other related phenomena. (U.K.)

  20. Equational binary decision diagrams

    NARCIS (Netherlands)

    J.F. Groote (Jan Friso); J.C. van de Pol (Jaco)

    2000-01-01

    textabstractWe incorporate equations in binary decision diagrams (BDD). The resulting objects are called EQ-BDDs. A straightforward notion of ordered EQ-BDDs (EQ-OBDD) is defined, and it is proved that each EQ-BDD is logically equivalent to an EQ-OBDD. Moreover, on EQ-OBDDs satisfiability and

  1. N-Bit Binary Resistor

    Science.gov (United States)

    Tcheng, Ping

    1989-01-01

    Binary resistors in series tailored to precise value of resistance. Desired value of resistance obtained by cutting appropriate traces across resistors. Multibit, binary-based, adjustable resistor with high resolution used in many applications where precise resistance required.

  2. Kinetics of clusters in a binary linear system

    NARCIS (Netherlands)

    Hilhorst, H.J.

    We consider the stochastically time-dependent behaviour of a binary linear chain of N units at temperature T and in an external field H. The kinetics is described in terms of clusters (sequences) of specified numbers of units in the same state. A coarse-grained master equation for the cluster

  3. Preparation and Characterization of Binary Organogels via Some Azobenzene Amino Derivatives and Different Fatty Acids: Self-Assembly and Nanostructures

    OpenAIRE

    Haiying Guo; Tifeng Jiao; Xihai Shen; Qingrui Zhang; Adan Li; Faming Gao

    2014-01-01

    In present work the gelation behaviors of binary organogels composed of azobenzene amino derivatives and fatty acids with different alkyl chains in various organic solvents were designed and investigated. Their gelation behaviors in 20 solvents were tested as new binary organic gelators. It showed that the length of alkyl substituent chains and azobenzene segment have played a crucial role in the gelation behavior of all gelator mixtures in various organic solvents. Longer alkyl chains in mol...

  4. Black holes in binary stars

    NARCIS (Netherlands)

    Wijers, R.A.M.J.

    1996-01-01

    Introduction Distinguishing neutron stars and black holes Optical companions and dynamical masses X-ray signatures of the nature of a compact object Structure and evolution of black-hole binaries High-mass black-hole binaries Low-mass black-hole binaries Low-mass black holes Formation of black holes

  5. Classical diffusion, Anderson localization, and spectral statistics in billiard chains

    International Nuclear Information System (INIS)

    Dittrich, T.; Doron, E.; Smilansky, U.

    1993-03-01

    We study spectral properties of quasi one-dimensional extended systems that show deterministic diffusion on the classical level and Anderson localization in the quantal description. Using semiclassical arguments, we relate to universal aspects of the spectral fluctuations to features of the set of classical periodic orbits, expressed in terms of probability to perform periodic motion, that are likewise universal. This allows to derive an analytical expression for the spectral form factor which reflects the diffusive nature of the corresponding classical dynamics. It defines a novel spectral universality class which covers the transition between GOE statistics in the limit of a small ratio of the system size to the localization length, corresponding to the metallic regime of disordered systems, to Poissonian level fluctuations in the opposite limit. Our semiclassical predictions are illustrated and confirmed by a numerical investigation of aperiodic chains of chaotic billiards. (authors)

  6. Compressing Binary Decision Diagrams

    DEFF Research Database (Denmark)

    Hansen, Esben Rune; Satti, Srinivasa Rao; Tiedemann, Peter

    2008-01-01

    The paper introduces a new technique for compressing Binary Decision Diagrams in those cases where random access is not required. Using this technique, compression and decompression can be done in linear time in the size of the BDD and compression will in many cases reduce the size of the BDD to ......-2 bits per node. Empirical results for our compression technique are presented, including comparisons with previously introduced techniques, showing that the new technique dominate on all tested instances......The paper introduces a new technique for compressing Binary Decision Diagrams in those cases where random access is not required. Using this technique, compression and decompression can be done in linear time in the size of the BDD and compression will in many cases reduce the size of the BDD to 1...

  7. Compressing Binary Decision Diagrams

    DEFF Research Database (Denmark)

    Rune Hansen, Esben; Srinivasa Rao, S.; Tiedemann, Peter

    The paper introduces a new technique for compressing Binary Decision Diagrams in those cases where random access is not required. Using this technique, compression and decompression can be done in linear time in the size of the BDD and compression will in many cases reduce the size of the BDD to ......-2 bits per node. Empirical results for our compression technique are presented, including comparisons with previously introduced techniques, showing that the new technique dominate on all tested instances.......The paper introduces a new technique for compressing Binary Decision Diagrams in those cases where random access is not required. Using this technique, compression and decompression can be done in linear time in the size of the BDD and compression will in many cases reduce the size of the BDD to 1...

  8. Testing the relativistic Doppler boost hypothesis for supermassive black hole binary candidates

    Science.gov (United States)

    Charisi, Maria; Haiman, Zoltán; Schiminovich, David; D'Orazio, Daniel J.

    2018-02-01

    Supermassive black hole binaries (SMBHBs) should be common in galactic nuclei as a result of frequent galaxy mergers. Recently, a large sample of sub-parsec SMBHB candidates was identified as bright periodically variable quasars in optical surveys. If the observed periodicity corresponds to the redshifted binary orbital period, the inferred orbital velocities are relativistic (v/c ≈ 0.1). The optical and UV luminosities are expected to arise from gas bound to the individual BHs, and would be modulated by the relativistic Doppler effect. The optical and UV light curves should vary in tandem with relative amplitudes which depend on the respective spectral slopes. We constructed a control sample of 42 quasars with aperiodic variability, to test whether this Doppler colour signature can be distinguished from intrinsic chromatic variability. We found that the Doppler signature can arise by chance in ˜20% (˜37%) of quasars in the nUV (fUV) band. These probabilities reflect the limited quality of the control sample and represent upper limits on how frequently quasars mimic the Doppler brightness+colour variations. We performed separate tests on the periodic quasar candidates, and found that for the majority, the Doppler boost hypothesis requires an unusually steep UV spectrum or an unexpectedly large BH mass and orbital velocity. We conclude that at most ˜1/3rd of these periodic candidates can harbor Doppler-modulated SMBHBs.

  9. Parametric binary dissection

    Science.gov (United States)

    Bokhari, Shahid H.; Crockett, Thomas W.; Nicol, David M.

    1993-01-01

    Binary dissection is widely used to partition non-uniform domains over parallel computers. This algorithm does not consider the perimeter, surface area, or aspect ratio of the regions being generated and can yield decompositions that have poor communication to computation ratio. Parametric Binary Dissection (PBD) is a new algorithm in which each cut is chosen to minimize load + lambda x(shape). In a 2 (or 3) dimensional problem, load is the amount of computation to be performed in a subregion and shape could refer to the perimeter (respectively surface) of that subregion. Shape is a measure of communication overhead and the parameter permits us to trade off load imbalance against communication overhead. When A is zero, the algorithm reduces to plain binary dissection. This algorithm can be used to partition graphs embedded in 2 or 3-d. Load is the number of nodes in a subregion, shape the number of edges that leave that subregion, and lambda the ratio of time to communicate over an edge to the time to compute at a node. An algorithm is presented that finds the depth d parametric dissection of an embedded graph with n vertices and e edges in O(max(n log n, de)) time, which is an improvement over the O(dn log n) time of plain binary dissection. Parallel versions of this algorithm are also presented; the best of these requires O((n/p) log(sup 3)p) time on a p processor hypercube, assuming graphs of bounded degree. How PBD is applied to 3-d unstructured meshes and yields partitions that are better than those obtained by plain dissection is described. Its application to the color image quantization problem is also discussed, in which samples in a high-resolution color space are mapped onto a lower resolution space in a way that minimizes the color error.

  10. Binary Masking & Speech Intelligibility

    OpenAIRE

    Boldt, Jesper

    2010-01-01

    The purpose of this thesis is to examine how binary masking can be used to increase intelligibility in situations where hearing impaired listeners have difficulties understanding what is being said. The major part of the experiments carried out in this thesis can be categorized as either experiments under ideal conditions or as experiments under more realistic conditions useful for real-life applications such as hearing aids. In the experiments under ideal conditions, the previously defined i...

  11. Heavy Chain Diseases

    Science.gov (United States)

    ... heavy chain produced: Alpha Gamma Mu Alpha Heavy Chain Disease Alpha heavy chain disease (IgA heavy chain ... disease or lead to a remission. Gamma Heavy Chain Disease Gamma heavy chain disease (IgG heavy chain ...

  12. Solitary waves in dimer binary collision model

    Science.gov (United States)

    Ahsan, Zaid; Jayaprakash, K. R.

    2017-01-01

    Solitary wave propagation in nonlinear diatomic (dimer) chains is a very interesting topic of research in the study of nonlinear lattices. Such waves were recently found to be supported by the essentially nonlinear granular lattice and Toda lattice. An interesting aspect of this discovery is attributed to the realization of a spectrum of the mass ratio (the only system parameter governing the dynamics) that supports the propagation of such waves corresponding to the considered interaction potential. The objective of this exposition is to explore solitary wave propagation in the dimer binary collision (BC) model. Interestingly, the dimer BC model supports solitary wave propagation at a discrete spectrum of mass ratios similar to those observed in granular and Toda dimers. Further, we report a qualitative and one-to-one correspondence between the spectrum of the mass ratio corresponding to the dimer BC model and those corresponding to granular and Toda dimer chains.

  13. Functional continuity: did field-induced oriented aperiodic constraints at Life's origin aid its sequence-based evolution?

    Science.gov (United States)

    Mitra-Delmotte, G.; Mitra, A. N.

    2014-04-01

    A non-biological analog undergoing Darwinian-like evolution could have enhanced the probability of many crucial independent bottom-up emergent steps, engendered within its premises, and smoothen the inanimate-animate transition. Now, the higher-level environment-mutable DNA sequences influence the lower-level pattern of oriented templates (enzymes, lipid membranes, RNA) in the organized cell matrix and hence their associated substrate-dynamics; note how templates are akin to local fields, kinetically constraining reactant orientations. Since the lowerlevel is likely the more primitive of the two (rather than Cairns-Smith's "readily available" rigid clay crystal sequence-based replicators as a memory-like basis for slowly mutating predecessor-patterns enroute to complex RNA-based Darwinian evolution), a gradual thermodynamic-to-kinetic transition in an isotropic medium, is proposed as driven by some order-parameter --via "available" field-responsive dipolar colloid networks, as apart from bio-organics, mineral colloids also can display liquid crystal (LC) phases (see [1]). An access to solid-like orientational order in a fluid matrix suggests how aperiodic patterns can be influenced and sustained (a la homeostasis) via external inhomogeneous fields (e.g. magnetic rocks); this renders these cooperative networks with potential as confining host-media, whose environment-sensitivity can not only influence their sterically-coupled guest-substrates but also their network properties (the latter can enable 'functions' like spontaneous transport under non-equilibrium suggesting a natural basis for their selection by the environment). In turn LC systems could have been preceded by even simpler anisotropic fluid hosts, viz., external field-induced mineral magnetic nanoparticle (MNP) aggregates. Indeed, the capacity of an MNP to couple its magnetic and rotational d.o.f.s suggests how an environment-sensitive field-influenced network of interacting dipolar colloids close to

  14. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

    Science.gov (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

    2017-11-01

    A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

  15. Massive Black Hole Binary Evolution

    Directory of Open Access Journals (Sweden)

    Merritt David

    2005-11-01

    Full Text Available Coalescence of binary supermassive black holes (SBHs would constitute the strongest sources of gravitational waves to be observed by LISA. While the formation of binary SBHs during galaxy mergers is almost inevitable, coalescence requires that the separation between binary components first drop by a few orders of magnitude, due presumably to interaction of the binary with stars and gas in a galactic nucleus. This article reviews the observational evidence for binary SBHs and discusses how they would evolve. No completely convincing case of a bound, binary SBH has yet been found, although a handful of systems (e.g. interacting galaxies; remnants of galaxy mergers are now believed to contain two SBHs at projected separations of <~ 1kpc. N-body studies of binary evolution in gas-free galaxies have reached large enough particle numbers to reproduce the slow, “diffusive” refilling of the binary’s loss cone that is believed to characterize binary evolution in real galactic nuclei. While some of the results of these simulations - e.g. the binary hardening rate and eccentricity evolution - are strongly N-dependent, others - e.g. the “damage” inflicted by the binary on the nucleus - are not. Luminous early-type galaxies often exhibit depleted cores with masses of ~ 1-2 times the mass of their nuclear SBHs, consistent with the predictions of the binary model. Studies of the interaction of massive binaries with gas are still in their infancy, although much progress is expected in the near future. Binary coalescence has a large influence on the spins of SBHs, even for mass ratios as extreme as 10:1, and evidence of spin-flips may have been observed.

  16. Markov chains

    CERN Document Server

    Revuz, D

    1984-01-01

    This is the revised and augmented edition of a now classic book which is an introduction to sub-Markovian kernels on general measurable spaces and their associated homogeneous Markov chains. The first part, an expository text on the foundations of the subject, is intended for post-graduate students. A study of potential theory, the basic classification of chains according to their asymptotic behaviour and the celebrated Chacon-Ornstein theorem are examined in detail. The second part of the book is at a more advanced level and includes a treatment of random walks on general locally compact abelian groups. Further chapters develop renewal theory, an introduction to Martin boundary and the study of chains recurrent in the Harris sense. Finally, the last chapter deals with the construction of chains starting from a kernel satisfying some kind of maximum principle.

  17. Superlattice configurations in linear chain hydrocarbon binary mixtures

    Indian Academy of Sciences (India)

    Unknown

    number of samples. PBV thanks Prof. Ramana Rao,. EIT, Mainafe, Eritrea Ms Marta Asmara University/. Library, Eritea and Mr Asmamaw Molla Debub. University, Dilla, Ethiopia for cooperation. References. 1. Shashikanth P B and Prasad P B V 1999 Bull. Mater. Sci. 22 65. 2. Shashikanth P B and Prasad P B V 2001 Cryst.

  18. Superlattice configurations in linear chain hydrocarbon binary mixtures

    Indian Academy of Sciences (India)

    monoclinic, monoclinic-monoclinic) are realizable, because of discrete orientational changes in the alignment of molecules of -C28H58 hydrocarbon, through an angle , where = 1, 2, 3 … and angle has an average value of 3.3°.

  19. Magnetic binary nanofillers

    Energy Technology Data Exchange (ETDEWEB)

    Morales Mendoza, N. [INQUIMAE, CONICET-UBA, Ciudad Universitaria, Pab2, (C1428EHA) Bs As (Argentina); LPyMC, Dep. De Fisica, FCEN-UBA and IFIBA -CONICET, Ciudad Universitaria, Cap. Fed. (Argentina); Goyanes, S. [LPyMC, Dep. De Fisica, FCEN-UBA and IFIBA -CONICET, Ciudad Universitaria, Cap. Fed. (Argentina); Chiliotte, C.; Bekeris, V. [LBT, Dep. De Fisica, FCEN-UBA. Ciudad Universitaria, Pab1, C1428EGA CABA (Argentina); Rubiolo, G. [LPyMC, Dep. De Fisica, FCEN-UBA and IFIBA -CONICET, Ciudad Universitaria, Cap. Fed. (Argentina); Unidad de Actividad Materiales, CNEA, Av Gral. Paz 1499, San Martin (1650), Prov. de Bs As (Argentina); Candal, R., E-mail: candal@qi.fcen.uba.ar [INQUIMAE, CONICET-UBA, Ciudad Universitaria, Pab2, (C1428EHA) Bs As (Argentina); Escuela de Ciencia y Tecnologia, 3iA, Universidad de Gral. San Martin, San Martin, Prov. Bs As (Argentina)

    2012-08-15

    Magnetic binary nanofillers containing multiwall carbon nanotubes (MWCNT) and hercynite were synthesized by Chemical Vapor Deposition (CVD) on Fe/AlOOH prepared by the sol-gel method. The catalyst precursor was fired at 450 Degree-Sign C, ground and sifted through different meshes. Two powders were obtained with different particle sizes: sample A (50-75 {mu}m) and sample B (smaller than 50 {mu}m). These powders are composed of iron oxide particles widely dispersed in the non-crystalline matrix of aluminum oxide and they are not ferromagnetic. After reduction process the powders are composed of {alpha}-Fe nanoparticles inside hercynite matrix. These nanofillers are composed of hercynite containing {alpha}-Fe nanoparticles and MWCNT. The binary magnetic nanofillers were slightly ferromagnetic. The saturation magnetization of the nanofillers depended on the powder particle size. The nanofiller obtained from powder particles in the range 50-75 {mu}m showed a saturation magnetization 36% higher than the one formed from powder particles smaller than 50 {mu}m. The phenomenon is explained in terms of changes in the magnetic environment of the particles as consequence of the presence of MWCNT.

  20. CHAIN 2

    International Nuclear Information System (INIS)

    Bailey, D.

    1998-04-01

    The Second Processing Chain (CHAIN2) consists of a suite of ten programs which together provide a full local analysis of the bulk plasma physics within the JET Tokamak. In discussing these ten computational models this report is intended to fulfil two broad purposes. Firstly it is meant to be used as a reference source for any user of CHAIN2 data, and secondly it provides a basic User Manual sufficient to instruct anyone in running the CHAIN2 suite of codes. In the main report text each module is described in terms of its underlying physics and any associated assumptions or limitations, whilst deliberate emphasis is put on highlighting the physics and mathematics of the calculations required in deriving each individual datatype in the standard module PPF output. In fact each datatype of the CHAIN2 PPF output listed in Appendix D is cross referenced to the point in the main text where its evaluation is discussed. An effort is made not only to give the equation used to derive a particular data profile but also to explicitly define which external data sources are involved in the computational calculation

  1. Contact Binary Asteroids

    Science.gov (United States)

    Rieger, Samantha

    2015-05-01

    Recent observations have found that some contact binaries are oriented such that the secondary impacts with the primary at a high inclination. This research investigates the evolution of how such contact binaries came to exist. This process begins with an asteroid pair, where the secondary lies on the Laplace plane. The Laplace plane is a plane normal to the axis about which the pole of a satellites orbit precesses, causing a near constant inclination for such an orbit. For the study of the classical Laplace plane, the secondary asteroid is in circular orbit around an oblate primary with axial tilt. This system is also orbiting the Sun. Thus, there are two perturbations on the secondarys orbit: J2 and third body Sun perturbations. The Laplace surface is defined as the group of orbits that lie on the Laplace plane at varying distances from the primary. If the secondary is very close to the primary, the inclination of the Laplace plane will be near the equator of the asteroid, while further from the primary the inclination will be similar to the asteroid-Sun plane. The secondary will lie on the Laplace plane because near the asteroid the Laplace plane is stable to large deviations in motion, causing the asteroid to come to rest in this orbit. Assuming the secondary is asymmetrical in shape and the bodys rotation is synchronous with its orbit, the secondary will experience the BYORP effect. BYORP can cause secular motion such as the semi-major axis of the secondary expanding or contracting. Assuming the secondary expands due to BYORP, the secondary will eventually reach the unstable region of the Laplace plane. The unstable region exists if the primary has an obliquity of 68.875 degrees or greater. The unstable region exists at 0.9 Laplace radius to 1.25 Laplace radius, where the Laplace radius is defined as the distance from the central body where the inclination of the Laplace plane orbit is half the obliquity. In the unstable region, the eccentricity of the orbit

  2. Relativistic Binaries in Globular Clusters

    Directory of Open Access Journals (Sweden)

    Matthew J. Benacquista

    2013-03-01

    Full Text Available Galactic globular clusters are old, dense star systems typically containing 10^4 – 10^6 stars. As an old population of stars, globular clusters contain many collapsed and degenerate objects. As a dense population of stars, globular clusters are the scene of many interesting close dynamical interactions between stars. These dynamical interactions can alter the evolution of individual stars and can produce tight binary systems containing one or two compact objects. In this review, we discuss theoretical models of globular cluster evolution and binary evolution, techniques for simulating this evolution that leads to relativistic binaries, and current and possible future observational evidence for this population. Our discussion of globular cluster evolution will focus on the processes that boost the production of tight binary systems and the subsequent interaction of these binaries that can alter the properties of both bodies and can lead to exotic objects. Direct N-body integrations and Fokker–Planck simulations of the evolution of globular clusters that incorporate tidal interactions and lead to predictions of relativistic binary populations are also discussed. We discuss the current observational evidence for cataclysmic variables, millisecond pulsars, and low-mass X-ray binaries as well as possible future detection of relativistic binaries with gravitational radiation.

  3. Spectral properties of binary asteroids

    Science.gov (United States)

    Pajuelo, Myriam; Birlan, Mirel; Carry, Benoît; DeMeo, Francesca E.; Binzel, Richard P.; Berthier, Jérôme

    2018-04-01

    We present the first attempt to characterize the distribution of taxonomic class among the population of binary asteroids (15% of all small asteroids). For that, an analysis of 0.8-2.5{μ m} near-infrared spectra obtained with the SpeX instrument on the NASA/IRTF is presented. Taxonomic class and meteorite analog is determined for each target, increasing the sample of binary asteroids with known taxonomy by 21%. Most binary systems are bound in the S-, X-, and C- classes, followed by Q and V-types. The rate of binary systems in each taxonomic class agrees within uncertainty with the background population of small near-Earth objects and inner main belt asteroids, but for the C-types which are under-represented among binaries.

  4. Planets in Binary Star Systems

    CERN Document Server

    Haghighipour, Nader

    2010-01-01

    The discovery of extrasolar planets over the past decade has had major impacts on our understanding of the formation and dynamical evolution of planetary systems. There are features and characteristics unseen in our solar system and unexplainable by the current theories of planet formation and dynamics. Among these new surprises is the discovery of planets in binary and multiple-star systems. The discovery of such "binary-planetary" systems has confronted astrodynamicists with many new challenges, and has led them to re-examine the theories of planet formation and dynamics. Among these challenges are: How are planets formed in binary star systems? What would be the notion of habitability in such systems? Under what conditions can binary star systems have habitable planets? How will volatiles necessary for life appear on such planets? This volume seeks to gather the current research in the area of planets in binary and multistar systems and to familiarize readers with its associated theoretical and observation...

  5. BINARY ASTROMETRIC MICROLENSING WITH GAIA

    Energy Technology Data Exchange (ETDEWEB)

    Sajadian, Sedighe, E-mail: sajadian@ipm.ir [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5531, Tehran (Iran, Islamic Republic of); Department of Physics, Sharif University of Technology, P.O. Box 11155-9161, Tehran (Iran, Islamic Republic of)

    2015-04-15

    We investigate whether or not Gaia can specify the binary fractions of massive stellar populations in the Galactic disk through astrometric microlensing. Furthermore, we study whether or not some information about their mass distributions can be inferred via this method. In this regard, we simulate the binary astrometric microlensing events due to massive stellar populations according to the Gaia observing strategy by considering (i) stellar-mass black holes, (ii) neutron stars, (iii) white dwarfs, and (iv) main-sequence stars as microlenses. The Gaia efficiency for detecting the binary signatures in binary astrometric microlensing events is ∼10%–20%. By calculating the optical depth due to the mentioned stellar populations, the numbers of the binary astrometric microlensing events being observed with Gaia with detectable binary signatures, for the binary fraction of about 0.1, are estimated to be 6, 11, 77, and 1316, respectively. Consequently, Gaia can potentially specify the binary fractions of these massive stellar populations. However, the binary fraction of black holes measured with this method has a large uncertainty owing to a low number of the estimated events. Knowing the binary fractions in massive stellar populations helps with studying the gravitational waves. Moreover, we investigate the number of massive microlenses for which Gaia specifies masses through astrometric microlensing of single lenses toward the Galactic bulge. The resulting efficiencies of measuring the mass of mentioned populations are 9.8%, 2.9%, 1.2%, and 0.8%, respectively. The numbers of their astrometric microlensing events being observed in the Gaia era in which the lens mass can be inferred with the relative error less than 0.5 toward the Galactic bulge are estimated as 45, 34, 76, and 786, respectively. Hence, Gaia potentially gives us some information about the mass distribution of these massive stellar populations.

  6. Content identification: binary content fingerprinting versus binary content encoding

    Science.gov (United States)

    Ferdowsi, Sohrab; Voloshynovskiy, Svyatoslav; Kostadinov, Dimche

    2014-02-01

    In this work, we address the problem of content identification. We consider content identification as a special case of multiclass classification. The conventional approach towards identification is based on content fingerprinting where a short binary content description known as a fingerprint is extracted from the content. We propose an alternative solution based on elements of machine learning theory and digital communications. Similar to binary content fingerprinting, binary content representation is generated based on a set of trained binary classifiers. We consider several training/encoding strategies and demonstrate that the proposed system can achieve the upper theoretical performance limits of content identification. The experimental results were carried out both on a synthetic dataset with different parameters and the FAMOS dataset of microstructures from consumer packages.

  7. Optimally cloned binary coherent states

    Science.gov (United States)

    Müller, C. R.; Leuchs, G.; Marquardt, Ch.; Andersen, U. L.

    2017-10-01

    Binary coherent state alphabets can be represented in a two-dimensional Hilbert space. We capitalize this formal connection between the otherwise distinct domains of qubits and continuous variable states to map binary phase-shift keyed coherent states onto the Bloch sphere and to derive their quantum-optimal clones. We analyze the Wigner function and the cumulants of the clones, and we conclude that optimal cloning of binary coherent states requires a nonlinearity above second order. We propose several practical and near-optimal cloning schemes and compare their cloning fidelity to the optimal cloner.

  8. Binary typing of staphylococcus aureus

    NARCIS (Netherlands)

    W.B. van Leeuwen (Willem)

    2002-01-01

    textabstractThis thesis describes the development. application and validation of straindifferentiating DNA probes for the characterization of Staphylococcus aureus strains in a system. that yields a binary output. By comparing the differential hybridization of these DNA probes to staphylococcal

  9. Mesoscopic model for binary fluids

    Science.gov (United States)

    Echeverria, C.; Tucci, K.; Alvarez-Llamoza, O.; Orozco-Guillén, E. E.; Morales, M.; Cosenza, M. G.

    2017-10-01

    We propose a model for studying binary fluids based on the mesoscopic molecular simulation technique known as multiparticle collision, where the space and state variables are continuous, and time is discrete. We include a repulsion rule to simulate segregation processes that does not require calculation of the interaction forces between particles, so binary fluids can be described on a mesoscopic scale. The model is conceptually simple and computationally efficient; it maintains Galilean invariance and conserves the mass and energy in the system at the micro- and macro-scale, whereas momentum is conserved globally. For a wide range of temperatures and densities, the model yields results in good agreement with the known properties of binary fluids, such as the density profile, interface width, phase separation, and phase growth. We also apply the model to the study of binary fluids in crowded environments with consistent results.

  10. Testing theory of binary evolution with interacting binary stars

    Science.gov (United States)

    Ergma, E.; Sarna, M. J.

    2002-01-01

    Of particular interest to us is the study of mass loss and its influence on the evolution of a binary systems. For this we use theoretical evolutionary models, which include: mass accretion, mass loss, novae explosion, super--efficient wind, and mixing processes. To test our theoretical prediction we proposed to determine the 12C / 13C ratio via measurements of the 12CO and 13CO bands around 2.3 micron. The available observations (Exter at al. 2001, in preparation) show good agreement with the theoretical predictions (Sarna 1992), for Algol-type binaries. Our preliminary estimates of the isotopic ratios for pre-CV's and CV's (Catalan et al. 2000, Dhillon et al. 2001) agree with the theoretical predictions from the common--envelope binary evolution models by Sarna et al. (1995). For the SXT we proposed (Ergma & Sarna 2001) similar observational test, which has not been done yet.

  11. Biclustering sparse binary genomic data.

    Science.gov (United States)

    van Uitert, Miranda; Meuleman, Wouter; Wessels, Lodewyk

    2008-12-01

    Genomic datasets often consist of large, binary, sparse data matrices. In such a dataset, one is often interested in finding contiguous blocks that (mostly) contain ones. This is a biclustering problem, and while many algorithms have been proposed to deal with gene expression data, only two algorithms have been proposed that specifically deal with binary matrices. None of the gene expression biclustering algorithms can handle the large number of zeros in sparse binary matrices. The two proposed binary algorithms failed to produce meaningful results. In this article, we present a new algorithm that is able to extract biclusters from sparse, binary datasets. A powerful feature is that biclusters with different numbers of rows and columns can be detected, varying from many rows to few columns and few rows to many columns. It allows the user to guide the search towards biclusters of specific dimensions. When applying our algorithm to an input matrix derived from TRANSFAC, we find transcription factors with distinctly dissimilar binding motifs, but a clear set of common targets that are significantly enriched for GO categories.

  12. Pulse propagation in a chain of o-rings with and without precompression.

    Science.gov (United States)

    Pinto, Italo'Ivo Lima Dias; Rosas, Alexandre; Romero, Aldo H; Lindenberg, Katja

    2010-09-01

    We implement a binary collision approximation to study pulse propagation in a chain of o-rings. In particular, we arrive at analytic results from which the pulse velocity is obtained by simple quadrature. The predicted pulse velocity is compared to the velocity obtained from the far more resource-intensive numerical integration of the equations of motion. We study chains without precompression, chains precompressed by a constant force at the chain ends (constant precompression), and chains precompressed by gravity (variable precompression). The application of the binary collision approximation to precompressed chains provides an important generalization of a successful theory that had up to this point only been implemented to chains without precompression, that is, to chains in a sonic vacuum.

  13. Preparation and Characterization of Binary Organogels via Some Azobenzene Amino Derivatives and Different Fatty Acids: Self-Assembly and Nanostructures

    Directory of Open Access Journals (Sweden)

    Haiying Guo

    2014-01-01

    Full Text Available In present work the gelation behaviors of binary organogels composed of azobenzene amino derivatives and fatty acids with different alkyl chains in various organic solvents were designed and investigated. Their gelation behaviors in 20 solvents were tested as new binary organic gelators. It showed that the length of alkyl substituent chains and azobenzene segment have played a crucial role in the gelation behavior of all gelator mixtures in various organic solvents. Longer alkyl chains in molecular skeletons in present gelators are favorable for the gelation of organic solvents. Morphological studies revealed that the gelator molecules self-assemble into different aggregates from lamella, wrinkle, to belt with change of solvents. Spectral studies indicated that there existed different H-bond formation and hydrophobic force, depending on different substituent chains in molecular skeletons. The present work may also give new perspectives for designing new binary organogelators and soft materials.

  14. The Young Visual Binary Survey

    Science.gov (United States)

    Prato, Lisa; Avilez, Ian; Lindstrom, Kyle; Graham, Sean; Sullivan, Kendall; Biddle, Lauren; Skiff, Brian; Nofi, Larissa; Schaefer, Gail; Simon, Michal

    2018-01-01

    Differences in the stellar and circumstellar properties of the components of young binaries provide key information about star and disk formation and evolution processes. Because objects with separations of a few to a few hundred astronomical units share a common environment and composition, multiple systems allow us to control for some of the factors which play into star formation. We are completing analysis of a rich sample of about 100 pre-main sequence binaries and higher order multiples, primarily located in the Taurus and Ophiuchus star forming regions. This poster will highlight some of out recent, exciting results. All reduced spectra and the results of our analysis will be publicly available to the community at http://jumar.lowell.edu/BinaryStars/. Support for this research was provided in part by NSF award AST-1313399 and by NASA Keck KPDA funding.

  15. Humanitarian relief supply chain

    Indian Academy of Sciences (India)

    This paper models a humanitarian relief chain that includes a relief goods supply chain and an evacuation chain in case of a natural disaster. Optimum network flow is studied for both the chains by considering three conflicting objectives, namely demand satisfaction in relief chain, demand satisfaction in evacuation chain ...

  16. Protocols for quantum binary voting

    Science.gov (United States)

    Thapliyal, Kishore; Sharma, Rishi Dutt; Pathak, Anirban

    Two new protocols for quantum binary voting are proposed. One of the proposed protocols is designed using a standard scheme for controlled deterministic secure quantum communication (CDSQC), and the other one is designed using the idea of quantum cryptographic switch, which uses a technique known as permutation of particles. A few possible alternative approaches to accomplish the same task (quantum binary voting) have also been discussed. Security of the proposed protocols is analyzed. Further, the efficiencies of the proposed protocols are computed, and are compared with that of the existing protocols. The comparison has established that the proposed protocols are more efficient than the existing protocols.

  17. Matter in compact binary mergers

    Science.gov (United States)

    Read, Jocelyn; LIGO Scientific Collaboration, Virgo Scientific Collaboration

    2018-01-01

    Mergers of binary neutron stars or neutron-star/black-hole systems are promising targets for gravitational-wave detection. The dynamics of merging compact objects, and thus their gravitational-wave signatures, are primarily determined by the mass and spin of the components. However, the presence of matter can make an imprint on the final orbits and merger of a binary system. I will outline efforts to understand the impact of neutron-star matter on gravitational waves, using both theoretical and computational input, so that gravitational-wave observations can be used to measure the properties of source systems with neutron-star components.

  18. Mental Effort in Binary Categorization Aided by Binary Cues

    Science.gov (United States)

    Botzer, Assaf; Meyer, Joachim; Parmet, Yisrael

    2013-01-01

    Binary cueing systems assist in many tasks, often alerting people about potential hazards (such as alarms and alerts). We investigate whether cues, besides possibly improving decision accuracy, also affect the effort users invest in tasks and whether the required effort in tasks affects the responses to cues. We developed a novel experimental tool…

  19. A methodology for stochastic analysis of share prices as Markov chains with finite states.

    Science.gov (United States)

    Mettle, Felix Okoe; Quaye, Enoch Nii Boi; Laryea, Ravenhill Adjetey

    2014-01-01

    Price volatilities make stock investments risky, leaving investors in critical position when uncertain decision is made. To improve investor evaluation confidence on exchange markets, while not using time series methodology, we specify equity price change as a stochastic process assumed to possess Markov dependency with respective state transition probabilities matrices following the identified state pace (i.e. decrease, stable or increase). We established that identified states communicate, and that the chains are aperiodic and ergodic thus possessing limiting distributions. We developed a methodology for determining expected mean return time for stock price increases and also establish criteria for improving investment decision based on highest transition probabilities, lowest mean return time and highest limiting distributions. We further developed an R algorithm for running the methodology introduced. The established methodology is applied to selected equities from Ghana Stock Exchange weekly trading data.

  20. Chain reaction

    International Nuclear Information System (INIS)

    Balogh, Brian.

    1991-01-01

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  1. The Uses of Binary Thinking.

    Science.gov (United States)

    Elbow, Peter

    1993-01-01

    Argues that oppositional thinking, if handled in the right way, will serve as a way to avoid the very problems that Jonathan Culler and Paul de Mann are troubled by: "purity, order, and hierarchy." Asserts that binary thinking can serve to encourage difference--indeed, encourage nondominance, nontranscendence, instability, and disorder.…

  2. Biclustering Sparse Binary Genomic Data

    NARCIS (Netherlands)

    Van Uitert, M.; Meuleman, W.; Wessels, L.F.A.

    2008-01-01

    Genomic datasets often consist of large, binary, sparse data matrices. In such a dataset, one is often interested in finding contiguous blocks that (mostly) contain ones. This is a biclustering problem, and while many algorithms have been proposed to deal with gene expression data, only two

  3. Misclassification in binary choice models

    Czech Academy of Sciences Publication Activity Database

    Meyer, B. D.; Mittag, Nikolas

    2017-01-01

    Roč. 200, č. 2 (2017), s. 295-311 ISSN 0304-4076 R&D Projects: GA ČR(CZ) GJ16-07603Y Institutional support: Progres-Q24 Keywords : measurement error * binary choice models * program take-up Subject RIV: AH - Economics OBOR OECD: Economic Theory Impact factor: 1.633, year: 2016

  4. Misclassification in binary choice models

    Czech Academy of Sciences Publication Activity Database

    Meyer, B. D.; Mittag, Nikolas

    2017-01-01

    Roč. 200, č. 2 (2017), s. 295-311 ISSN 0304-4076 Institutional support: RVO:67985998 Keywords : measurement error * binary choice models * program take-up Subject RIV: AH - Economics OBOR OECD: Economic Theory Impact factor: 1.633, year: 2016

  5. Generating Constant Weight Binary Codes

    Science.gov (United States)

    Knight, D.G.

    2008-01-01

    The determination of bounds for A(n, d, w), the maximum possible number of binary vectors of length n, weight w, and pairwise Hamming distance no less than d, is a classic problem in coding theory. Such sets of vectors have many applications. A description is given of how the problem can be used in a first-year undergraduate computational…

  6. BHMcalc: Binary Habitability Mechanism Calculator

    Science.gov (United States)

    Zuluaga, Jorge I.; Mason, Paul; Cuartas-Restrepo, Pablo A.; Clark, Joni

    2018-02-01

    BHMcalc provides renditions of the instantaneous circumbinary habital zone (CHZ) and also calculates BHM properties of the system including those related to the rotational evolution of the stellar components and the combined XUV and SW fluxes as measured at different distances from the binary. Moreover, it provides numerical results that can be further manipulated and used to calculate other properties.

  7. Subluminous X-ray binaries

    NARCIS (Netherlands)

    Armas Padilla, M.

    2013-01-01

    The discovery of the first X-ray binary, Scorpius X-1, by Giacconi et al. (1962), marked the birth of X-ray astronomy. Following that discovery, many additional X-ray sources where found with the first generation of X-ray rockets and observatories (e.g., UHURU and Einstein). The short-timescale

  8. Interactions in Massive Colliding Wind Binaries

    Directory of Open Access Journals (Sweden)

    Michael F. Corcoran

    2012-03-01

    Full Text Available There are observational difficulties determining dynamical masses of binary star components in the upper HR diagram both due to the scarcity of massive binary systems and spectral and photometric contamination produced by the strong wind outflows in these systems. We discuss how variable X-ray emission in these systems produced by wind-wind collisions in massive binaries can be used to constrain the system parameters, with application to two important massive binaries, Eta Carinae and WR 140.

  9. Division Unit for Binary Integer Decimals

    DEFF Research Database (Denmark)

    Lang, Tomas; Nannarelli, Alberto

    2009-01-01

    In this work, we present a radix-10 division unit that is based on the digit-recurrence algorithm and implements binary encodings (binary integer decimal or BID) for significands. Recent decimal division designs are all based on the binary coded decimal (BCD) encoding. We adapt the radix-10 digit...

  10. MCMC exploration of supermassive black hole binary inspirals

    International Nuclear Information System (INIS)

    Cornish, Neil J; Porter, Edward K

    2006-01-01

    The Laser Interferometer Space Antenna will be able to detect the inspiral and merger of super massive black hole binaries (SMBHBs) anywhere in the universe. Standard matched filtering techniques can be used to detect and characterize these systems. Markov Chain Monte Carlo (MCMC) methods are ideally suited to this and other LISA data analysis problems as they are able to efficiently handle models with large dimensions. Here we compare the posterior parameter distributions derived by an MCMC algorithm with the distributions predicted by the Fisher information matrix. We find excellent agreement for the extrinsic parameters, while the Fisher matrix slightly overestimates errors in the intrinsic parameters

  11. Permutation Entropy for Random Binary Sequences

    Directory of Open Access Journals (Sweden)

    Lingfeng Liu

    2015-12-01

    Full Text Available In this paper, we generalize the permutation entropy (PE measure to binary sequences, which is based on Shannon’s entropy, and theoretically analyze this measure for random binary sequences. We deduce the theoretical value of PE for random binary sequences, which can be used to measure the randomness of binary sequences. We also reveal the relationship between this PE measure with other randomness measures, such as Shannon’s entropy and Lempel–Ziv complexity. The results show that PE is consistent with these two measures. Furthermore, we use PE as one of the randomness measures to evaluate the randomness of chaotic binary sequences.

  12. Gravity waves from relativistic binaries

    OpenAIRE

    Levin, Janna; O'Reilly, Rachel; Copeland, E. J.

    1999-01-01

    The stability of binary orbits can significantly shape the gravity wave signal which future Earth-based interferometers hope to detect. The inner most stable circular orbit has been of interest as it marks the transition from the late inspiral to final plunge. We consider purely relativistic orbits beyond the circular assumption. Homoclinic orbits are of particular importance to the question of stability as they lie on the boundary between dynamical stability and instability. We identify thes...

  13. Binary evolution and observational constraints

    International Nuclear Information System (INIS)

    Loore, C. de

    1984-01-01

    The evolution of close binaries is discussed in connection with problems concerning mass and angular momentum losses. Theoretical and observational evidence for outflow of matter, leaving the system during evolution is given: statistics on total masses and mass ratios, effects of the accretion of the mass gaining component, the presence of streams, disks, rings, circumstellar envelopes, period changes, abundance changes in the atmosphere. The effects of outflowing matter on the evolution is outlined, and estimates of the fraction of matter expelled by the loser, and leaving the system, are given. The various time scales involved with evolution and observation are compared. Examples of non conservative evolution are discussed. Problems related to contact phases, on mass and energy losses, in connection with entropy changes are briefly analysed. For advanced stages the disruption probabilities for supernova explosions are examined. A global picture is given for the evolution of massive close binaries, from ZAMS, through WR phases, X-ray phases, leading to runaway pulsars or to a binary pulsar and later to a millisecond pulsar. (Auth.)

  14. SPECIAL ISSUE DEVOTED TO THE 80TH BIRTHDAY OF S.A. AKHMANOV: Peculiarities of periodic and aperiodic energy-exchange regimes in the cascade quasi-synchronous parametric frequency conversion

    Science.gov (United States)

    Petnikova, V. M.; Shuvalov, Vladimir V.

    2009-07-01

    The domains of existence and peculiarities of exact analytic solutions of the problem of quasi-synchronous interaction of four plane collinear monochromatic waves — modes in a quadratically nonlinear medium during cascade frequency conversion are analysed. It is shown that the unusual types of multicomponent cnoidal and solitary soliton-like waves (of periodic and aperiodic energy-exchange regimes) are realised. Two of the four components of the latter are proportional to the real and imaginary parts of the well-known Lorentzian dependence, which is commonly used to describe the dispersion of contributions from resonance transitions to the complex permittivity in the case of homogeneous line broadening.

  15. Black holes and neutron stars: evolution of binary systems

    International Nuclear Information System (INIS)

    Kraft, R.P.

    1975-01-01

    Evidence for the existence of neutron stars and black holes in binary systems has been reviewed, and the following summarizes the current situation: (1) No statistically significant case has been made for the proposition that black holes and/or neutron stars contribute to the population of unseen companions of ordinary spectroscopic binaries; (2) Plausible evolutionary scenarios can be advanced that place compact X-ray sources into context as descendants of several common types of mass-exchange binaries. The collapse object may be a black hole, a neutron star, or a white dwarf, depending mostly on the mass of the original primary; (3) The rotating neutron star model for the pulsating X-ray sources Her X-1 and Cen X-3 is the simplest interpretation of these objects, but the idea that the pulsations result from the non-radial oscillations of a white dwarf cannot be altogether dismissed. The latter is particularly attractive in the case of Her X-1 because the total mass of the system is small; (4) The black hole picture for Cyg X-1 represents the simplest model that can presently be put forward to explain the observations. This does not insure its correctness, however. The picture depends on a long chain of inferences, some of which are by no means unassailable. (Auth.)

  16. Chains and identity

    NARCIS (Netherlands)

    Grijpink, J.H.A.M.

    2012-01-01

    This article is available in English and DutchGuidelines are presented to cope with identity problems in chains. A chain is a collaboration of a great number of autonomous organisations and professionals to tackle a dominant chain problem. In many chains identity fraud is an aspect of the dominant

  17. Silicone chain extender

    DEFF Research Database (Denmark)

    2015-01-01

    The present invention relates to a silicone chain extender, more particularly a chain extender for silicone polymers and copolymers, to a chain extended silicone polymer or copolymer and to a functionalized chain extended silicone polymer or copolymer, to a method for the preparation thereof...

  18. Logistic chain modelling

    NARCIS (Netherlands)

    Slats, P.A.; Bhola, B.; Evers, J.J.M.; Dijkhuizen, G.

    1995-01-01

    Logistic chain modelling is very important in improving the overall performance of the total logistic chain. Logistic models provide support for a large range of applications, such as analysing bottlenecks, improving customer service, configuring new logistic chains and adapting existing chains to

  19. Joint modelling rationale for chained equations

    Science.gov (United States)

    2014-01-01

    Background Chained equations imputation is widely used in medical research. It uses a set of conditional models, so is more flexible than joint modelling imputation for the imputation of different types of variables (e.g. binary, ordinal or unordered categorical). However, chained equations imputation does not correspond to drawing from a joint distribution when the conditional models are incompatible. Concurrently with our work, other authors have shown the equivalence of the two imputation methods in finite samples. Methods Taking a different approach, we prove, in finite samples, sufficient conditions for chained equations and joint modelling to yield imputations from the same predictive distribution. Further, we apply this proof in four specific cases and conduct a simulation study which explores the consequences when the conditional models are compatible but the conditions otherwise are not satisfied. Results We provide an additional “non-informative margins” condition which, together with compatibility, is sufficient. We show that the non-informative margins condition is not satisfied, despite compatible conditional models, in a situation as simple as two continuous variables and one binary variable. Our simulation study demonstrates that as a consequence of this violation order effects can occur; that is, systematic differences depending upon the ordering of the variables in the chained equations algorithm. However, the order effects appear to be small, especially when associations between variables are weak. Conclusions Since chained equations is typically used in medical research for datasets with different types of variables, researchers must be aware that order effects are likely to be ubiquitous, but our results suggest they may be small enough to be negligible. PMID:24559129

  20. Layered structure in compatible binary polymer brushes with high graft density: A computer simulation study.

    Science.gov (United States)

    Xue, Yao-Hong; Liu, Hong; Lu, Zhong-Yuan; Liang, Xue-Zhang

    2010-01-28

    We focus on highly grafted binary polymer brushes with compatible components in the cases of different chain lengths. Layered structures parallel to the surface that indicating "phase separation" are observed in a series of dissipative particle dynamics simulations. The stretch parameters indicate that the short chains are suppressed in the lower layer of the film, whereas the longer chains are much stretched in the region dominated by the short chains (lower layer) but possess relaxed conformations in the upper layer. By slightly changing the solvent selectivity to prefer the short chains, we find a reversion of the layered structure. Such a sensitive switch of film property implies its potential application as tuning the wettability and adhesion of the surface in industry.

  1. Crystallisation and chain conformation of long chain n-alkanes

    International Nuclear Information System (INIS)

    Gorce, J.

    2000-06-01

    the increase of the tilt angle as a function of the temperature was not detected due to a perfecting of the crystals. Indeed, due to successive heating and cooling to -173 deg. C, the concentration of non all-trans conformers was found to decrease within the crystals. Their numbers were found to be up to six times higher in n-C 198 H 398 crystallised in once folded form than when crystallised in extended form. The C-C stretching mode region of the spectra was used to identify the chain conformation and to estimate the length of the all-trans stem passing through the crystal layers at -173 deg. C. The transition between once folded and extended form crystals was indicated by the presence of additional bands in this region at 1089 cm -1 , 1078 cm -1 and 1064 cm -1 . Some of those bands may be related to the fold itself. At the same time, a strong decrease of the intensity of the infrared bands present in the wagging mode region was observed. Finally, the triple layered structure proposed on the basis of X-ray measurements obtained from the crystals of a binary mixture of long chain n-alkanes, namely n-C 162 H 326 and n-C 246 H 494 , was confirmed from the study of the C-C stretching mode region of the infrared spectra. (author)

  2. The structures of binary compounds

    CERN Document Server

    Hafner, J; Jensen, WB; Majewski, JA; Mathis, K; Villars, P; Vogl, P; de Boer, FR

    1990-01-01

    - Up-to-date compilation of the experimental data on the structures of binary compounds by Villars and colleagues. - Coloured structure maps which order the compounds into their respective structural domains and present for the first time the local co-ordination polyhedra for the 150 most frequently occurring structure types, pedagogically very helpful and useful in the search for new materials with a required crystal structure. - Crystal co-ordination formulas: a flexible notation for the interpretation of solid-state structures by chemist Bill Jensen. - Recent important advances in unders

  3. Young and Waltzing Binary Stars

    Science.gov (United States)

    2001-10-01

    ADONIS Observes Low-mass Eclipsing System in Orion Summary A series of very detailed images of a binary system of two young stars have been combined into a movie . In merely 3 days, the stars swing around each other. As seen from the earth, they pass in front of each other twice during a full revolution, producing eclipses during which their combined brightness diminishes . A careful analysis of the orbital motions has now made it possible to deduce the masses of the two dancing stars . Both turn out to be about as heavy as our Sun. But while the Sun is about 4500 million years old, these two stars are still in their infancy. They are located some 1500 light-years away in the Orion star-forming region and they probably formed just 10 million years ago . This is the first time such an accurate determination of the stellar masses could be achieved for a young binary system of low-mass stars . The new result provides an important piece of information for our current understanding of how young stars evolve. The observations were obtained by a team of astronomers from Italy and ESO [1] using the ADaptive Optics Near Infrared System (ADONIS) on the 3.6-m telescope at the ESO La Silla Observatory. PR Photo 29a/01 : The RXJ 0529.4+0041 system before primary eclipse PR Photo 29b/01 : The RXJ 0529.4+0041 system at mid-primary eclipse PR Photo 29c/01 : The RXJ 0529.4+0041 system after primary eclipse PR Photo 29d/01 : The RXJ 0529.4+0041 system before secondary eclipse PR Photo 29e/01 : The RXJ 0529.4+0041 system at mid-secondary eclipse PR Photo 29f/01 : The RXJ 0529.4+0041 system after secondary eclipse PR Video Clip 06/01 : Video of the RXJ 0529.4+0041 system Binary stars and stellar masses Since some time, astronomers have noted that most stars seem to form in binary or multiple systems. This is quite fortunate, as the study of binary stars is the only way in which it is possible to measure directly one of the most fundamental quantities of a star, its mass. The mass of a

  4. Pulsar magnetospheres in binary systems

    Science.gov (United States)

    Ershkovich, A. I.; Dolan, J. F.

    1985-01-01

    The criterion for stability of a tangential discontinuity interface in a magnetized, perfectly conducting inviscid plasma is investigated by deriving the dispersion equation including the effects of both gravitational and centrifugal acceleration. The results are applied to neutron star magnetospheres in X-ray binaries. The Kelvin-Helmholtz instability appears to be important in determining whether MHD waves of large amplitude generated by instability may intermix the plasma effectively, resulting in accretion onto the whole star as suggested by Arons and Lea and leading to no X-ray pulsar behavior.

  5. Tomographic reconstruction of binary fields

    International Nuclear Information System (INIS)

    Roux, Stéphane; Leclerc, Hugo; Hild, François

    2012-01-01

    A novel algorithm is proposed for reconstructing binary images from their projection along a set of different orientations. Based on a nonlinear transformation of the projection data, classical back-projection procedures can be used iteratively to converge to the sought image. A multiscale implementation allows for a faster convergence. The algorithm is tested on images up to 1 Mb definition, and an error free reconstruction is achieved with a very limited number of projection data, saving a factor of about 100 on the number of projections required for classical reconstruction algorithms.

  6. Microlensing Signature of Binary Black Holes

    Science.gov (United States)

    Schnittman, Jeremy; Sahu, Kailash; Littenberg, Tyson

    2012-01-01

    We calculate the light curves of galactic bulge stars magnified via microlensing by stellar-mass binary black holes along the line-of-sight. We show the sensitivity to measuring various lens parameters for a range of survey cadences and photometric precision. Using public data from the OGLE collaboration, we identify two candidates for massive binary systems, and discuss implications for theories of star formation and binary evolution.

  7. Survival of planets around shrinking stellar binaries

    Science.gov (United States)

    Muñoz, Diego J.; Lai, Dong

    2015-01-01

    The discovery of transiting circumbinary planets by the Kepler mission suggests that planets can form efficiently around binary stars. None of the stellar binaries currently known to host planets has a period shorter than 7 d, despite the large number of eclipsing binaries found in the Kepler target list with periods shorter than a few days. These compact binaries are believed to have evolved from wider orbits into their current configurations via the so-called Lidov–Kozai migration mechanism, in which gravitational perturbations from a distant tertiary companion induce large-amplitude eccentricity oscillations in the binary, followed by orbital decay and circularization due to tidal dissipation in the stars. Here we explore the orbital evolution of planets around binaries undergoing orbital decay by this mechanism. We show that planets may survive and become misaligned from their host binary, or may develop erratic behavior in eccentricity, resulting in their consumption by the stars or ejection from the system as the binary decays. Our results suggest that circumbinary planets around compact binaries could still exist, and we offer predictions as to what their orbital configurations should be like. PMID:26159412

  8. Speech perception of noise with binary gains

    DEFF Research Database (Denmark)

    Wang, DeLiang; Kjems, Ulrik; Pedersen, Michael Syskind

    2008-01-01

    For a given mixture of speech and noise, an ideal binary time-frequency mask is constructed by comparing speech energy and noise energy within local time-frequency units. It is observed that listeners achieve nearly perfect speech recognition from gated noise with binary gains prescribed...... by the ideal binary mask. Only 16 filter channels and a frame rate of 100 Hz are sufficient for high intelligibility. The results show that, despite a dramatic reduction of speech information, a pattern of binary gains provides an adequate basis for speech perception....

  9. Survival of planets around shrinking stellar binaries.

    Science.gov (United States)

    Muñoz, Diego J; Lai, Dong

    2015-07-28

    The discovery of transiting circumbinary planets by the Kepler mission suggests that planets can form efficiently around binary stars. None of the stellar binaries currently known to host planets has a period shorter than 7 d, despite the large number of eclipsing binaries found in the Kepler target list with periods shorter than a few days. These compact binaries are believed to have evolved from wider orbits into their current configurations via the so-called Lidov-Kozai migration mechanism, in which gravitational perturbations from a distant tertiary companion induce large-amplitude eccentricity oscillations in the binary, followed by orbital decay and circularization due to tidal dissipation in the stars. Here we explore the orbital evolution of planets around binaries undergoing orbital decay by this mechanism. We show that planets may survive and become misaligned from their host binary, or may develop erratic behavior in eccentricity, resulting in their consumption by the stars or ejection from the system as the binary decays. Our results suggest that circumbinary planets around compact binaries could still exist, and we offer predictions as to what their orbital configurations should be like.

  10. Sustainable Supply Chain Design

    DEFF Research Database (Denmark)

    Bals, Lydia; Tate, Wendy

    A significant conceptual and practical challenge is how to integrate triple bottom line (TBL; including economic, social and environmental) sustainability into global supply chains. Although this integration is necessary to slow down global resource depletion, understanding is limited of how...... to implement TBL goals across the supply chain. In supply chain design, the classic economic perspective still dominates, although the idea of the TBL is more widely disseminated. The purpose of this research is to add to the sustainable supply chain management literature (SSCM) research agenda...... by incorporating the physical chain, and the (information and financial) support chains into supply chain design. This manuscript tackles issues of what the chains are designed for and how they are designed structurally. Four sustainable businesses are used as illustrative case examples of innovative supply chain...

  11. Method of all-optical frequency encoded decimal to binary and binary coded decimal, binary to gray, and gray to binary data conversion using semiconductor optical amplifiers.

    Science.gov (United States)

    Garai, Sisir Kumar

    2011-07-20

    Conversion of optical data from decimal to binary format is very important in optical computing and optical signal processing. There are many binary code systems to represent decimal numbers, the most common being the binary coded decimal (BCD) and gray code system. There are a wide choice of BCD codes, one of which is a natural BCD having a weighted code of 8421, by means of which it is possible to represent a decimal number from 0 to 9 with a combination of 4 bit binary digits. The reflected binary code, also known as the Gray code, is a binary numeral system where two successive values differ in only 1 bit. The Gray code is very important in digital optical communication as it is used to prevent spurious output from optical switches as well as to facilitate error correction in digital communications in an optical domain. Here in this communication, the author proposes an all-optical frequency encoded method of ":decimal to binary, BCD," "binary to gray," and "gray to binary" data conversion using the high-speed switching actions of semiconductor optical amplifiers. To convert decimal numbers to a binary form, a frequency encoding technique is adopted to represent two binary bits, 0 and 1. The frequency encoding technique offers advantages over conventional encoding techniques in terms of less probability of bit errors and greater reliability. Here the author has exploited the polarization switch made of a semiconductor optical amplifier (SOA) and a property of nonlinear rotation of the state of polarization of the probe beam in SOA for frequency conversion to develop the method of frequency encoded data conversion. © 2011 Optical Society of America

  12. Predicting the Solubility of 1,1-Difluoroethane in Polystyrene Using the Perturbed Soft Chain Theory

    DEFF Research Database (Denmark)

    Pretel, Eduardo; Hong, Seong-Uk

    1998-01-01

    In this study, the solubility of 1,1-difluoroethane in polystyrene was correlated and predicted using the Perturbed Soft Chain Theory (PSCT) and compared with experimental data from the literature. For correlation, a binary interaction parameter was determined by using experimental solubility data....... For prediction, however, data at the infinitely dilute solvent concentration region obtained by Inverse Gas Chromatography (IGC) were only used in the determination of the binary interaction parameter. The results were comparable with the experimental data for both cases....

  13. Binary Relations as a Foundation of Mathematics

    NARCIS (Netherlands)

    Kuper, Jan; Barendsen, E.; Capretta, V.; Geuvers, H.; Niqui, M.

    2007-01-01

    We describe a theory for binary relations in the Zermelo-Fraenkel style. We choose for ZFCU, a variant of ZFC Set theory in which the Axiom of Foundation is replaced by an axiom allowing for non-wellfounded sets. The theory of binary relations is shown to be equi-consistent ZFCU by constructing a

  14. Novel quantum inspired binary neural network algorithm

    Indian Academy of Sciences (India)

    In this paper, a quantum based binary neural network algorithm is proposed, named as novel quantum binary neural network algorithm (NQ-BNN). It forms a neural network structure by deciding weights and separability parameter in quantum based manner. Quantum computing concept represents solution probabilistically ...

  15. The Evolution of Compact Binary Star Systems.

    Science.gov (United States)

    Postnov, Konstantin A; Yungelson, Lev R

    2014-01-01

    We review the formation and evolution of compact binary stars consisting of white dwarfs (WDs), neutron stars (NSs), and black holes (BHs). Mergings of compact-star binaries are expected to be the most important sources for forthcoming gravitational-wave (GW) astronomy. In the first part of the review, we discuss observational manifestations of close binaries with NS and/or BH components and their merger rate, crucial points in the formation and evolution of compact stars in binary systems, including the treatment of the natal kicks, which NSs and BHs acquire during the core collapse of massive stars and the common envelope phase of binary evolution, which are most relevant to the merging rates of NS-NS, NS-BH and BH-BH binaries. The second part of the review is devoted mainly to the formation and evolution of binary WDs and their observational manifestations, including their role as progenitors of cosmologically-important thermonuclear SN Ia. We also consider AM CVn-stars, which are thought to be the best verification binary GW sources for future low-frequency GW space interferometers.

  16. The Evolution of Compact Binary Star Systems

    Directory of Open Access Journals (Sweden)

    Yungelson, Lev R.

    2006-12-01

    Full Text Available We review the formation and evolution of compact binary stars consisting of white dwarfs (WDs, neutron stars (NSs, and black holes (BHs. Binary NSs and BHs are thought to be the primary astrophysical sources of gravitational waves (GWs within the frequency band of ground-based detectors, while compact binaries of WDs are important sources of GWs at lower frequencies to be covered by space interferometers (LISA. Major uncertainties in the current understanding of properties of NSs and BHs most relevant to the GW studies are discussed, including the treatment of the natal kicks which compact stellar remnants acquire during the core collapse of massive stars and the common envelope phase of binary evolution. We discuss the coalescence rates of binary NSs and BHs and prospects for their detections, the formation and evolution of binary WDs and their observational manifestations. Special attention is given to AM CVn-stars -- compact binaries in which the Roche lobe is filled by another WD or a low-mass partially degenerate helium-star, as these stars are thought to be the best LISA verification binary GW sources.

  17. Bondi-Hoyle-Lyttleton Accretion onto Binaries

    Science.gov (United States)

    Antoni, Andrea; MacLeod, Morgan; Ramírez-Ruiz, Enrico

    2018-01-01

    Binary stars are not rare. While only close binary stars will eventually interact with one another, even the widest binary systems interact with their gaseous surroundings. The rates of accretion and the gaseous drag forces arising in these interactions are the key to understanding how these systems evolve. This poster examines accretion flows around a binary system moving supersonically through a background gas. We perform three-dimensional hydrodynamic simulations of Bondi-Hoyle-Lyttleton accretion using the adaptive mesh refinement code FLASH. We simulate a range of values of semi-major axis of the orbit relative to the gravitational focusing impact parameter of the pair. On large scales, gas is gravitationally focused by the center-of-mass of the binary, leading to dynamical friction drag and to the accretion of mass and momentum. On smaller scales, the orbital motion imprints itself on the gas. Notably, the magnitude and direction of the forces acting on the binary inherit this orbital dependence. The long-term evolution of the binary is determined by the timescales for accretion, slow down of the center-of-mass, and decay of the orbit. We use our simulations to measure these timescales and to establish a hierarchy between them. In general, our simulations indicate that binaries moving through gaseous media will slow down before the orbit decays.

  18. The Evolution of Compact Binary Star Systems

    Directory of Open Access Journals (Sweden)

    Konstantin A. Postnov

    2014-05-01

    Full Text Available We review the formation and evolution of compact binary stars consisting of white dwarfs (WDs, neutron stars (NSs, and black holes (BHs. Mergings of compact-star binaries are expected to be the most important sources for forthcoming gravitational-wave (GW astronomy. In the first part of the review, we discuss observational manifestations of close binaries with NS and/or BH components and their merger rate, crucial points in the formation and evolution of compact stars in binary systems, including the treatment of the natal kicks, which NSs and BHs acquire during the core collapse of massive stars and the common envelope phase of binary evolution, which are most relevant to the merging rates of NS-NS, NS-BH and BH-BH binaries. The second part of the review is devoted mainly to the formation and evolution of binary WDs and their observational manifestations, including their role as progenitors of cosmologically-important thermonuclear SN Ia. We also consider AM CVn-stars, which are thought to be the best verification binary GW sources for future low-frequency GW space interferometers.

  19. Microlensing Binaries with Candidate Brown Dwarf Companions

    DEFF Research Database (Denmark)

    Shin, I.-G; Han, C.; Gould, A.

    2012-01-01

    Brown dwarfs are important objects because they may provide a missing link between stars and planets, two populations that have dramatically different formation histories. In this paper, we present the candidate binaries with brown dwarf companions that are found by analyzing binary microlensing...... with well-covered light curves increases with new-generation searches....

  20. Statistical properties of spectroscopic binary stars

    NARCIS (Netherlands)

    Hogeveen, S.J.

    1992-01-01

    As part of a study of the mass-ratio distribution of spectroscopic binary stars, the statistical properties of the systems in the Eighth Catalogue of the Orbital Elements of Spectroscopic Binary Stars, compiled by Batten et al. (1989), are investigated. Histograms are presented of the

  1. An Acidity Scale for Binary Oxides.

    Science.gov (United States)

    Smith, Derek W.

    1987-01-01

    Discusses the classification of binary oxides as acidic, basic, or amphoteric. Demonstrates how a numerical scale for acidity/basicity of binary oxides can be constructed using thermochemical data for oxoacid salts. Presents the calculations derived from the data that provide the numeric scale values. (TW)

  2. Binary trees equipped with semivaluations | Pajoohesh ...

    African Journals Online (AJOL)

    Our interest in this lattice stems from its application to binary decision trees. Binary decision trees form a crucial tool for algorithmic time analysis. The lattice properties of Tn are studied and we show that every Tn has a sublattice isomorphic to Tn-1 and prove that Tn is generated by Tn-1. Also we show that the distance from ...

  3. Eliciting Subjective Probabilities with Binary Lotteries

    DEFF Research Database (Denmark)

    Harrison, Glenn W.; Martínez-Correa, Jimmy; Swarthout, J. Todd

    objective probabilities. Drawing a sample from the same subject population, we find evidence that the binary lottery procedure induces linear utility in a subjective probability elicitation task using the Quadratic Scoring Rule. We also show that the binary lottery procedure can induce direct revelation...

  4. ChainConsumer

    Science.gov (United States)

    Hinton, Samuel R.

    2016-08-01

    ChainConsumer is a python package written to consume the output chains of Monte-Carlo processes and fitting algorithms, such as the results of MCMC. ChainConsumer's main function is to produce plots of the likelihood surface inferred from the supplied chain. In addition to showing the two-dimensional marginalised likelihood surfaces, marginalised parameter distributions are given, and maximum-likelihood statistics are used to present parameter constraints. In addition to this, parameter constraints can be output in the form of a LaTeX table. Finally, ChainConsumer also provides the functionality to plot the chains as a series of walks in parameter values, which provides an easy visual check on chain mixing and chain convergence.

  5. Markov Chain Monte Carlo

    Indian Academy of Sciences (India)

    . Keywords. Gibbs sampling, Markov Chain. Monte Carlo, Bayesian inference, stationary distribution, conver- gence, image restoration. Arnab Chakraborty. We describe the mathematics behind the Markov. Chain Monte Carlo method of ...

  6. Logistic chaotic maps for binary numbers generations

    International Nuclear Information System (INIS)

    Kanso, Ali; Smaoui, Nejib

    2009-01-01

    Two pseudorandom binary sequence generators, based on logistic chaotic maps intended for stream cipher applications, are proposed. The first is based on a single one-dimensional logistic map which exhibits random, noise-like properties at given certain parameter values, and the second is based on a combination of two logistic maps. The encryption step proposed in both algorithms consists of a simple bitwise XOR operation of the plaintext binary sequence with the keystream binary sequence to produce the ciphertext binary sequence. A threshold function is applied to convert the floating-point iterates into binary form. Experimental results show that the produced sequences possess high linear complexity and very good statistical properties. The systems are put forward for security evaluation by the cryptographic committees.

  7. Mass Transfer in Mira-Type Binaries

    Directory of Open Access Journals (Sweden)

    Mohamed S.

    2012-06-01

    Full Text Available Detached, symbiotic binaries are generally assumed to interact via Bondi-Hoyle-Littleton (BHL wind accretion. However, the accretion rates and outflow geometries that result from this mass-transfer mechanism cannot adequately explain the observations of the nearest and best studied symbiotic binary, Mira, or the formation of some post-AGB binaries, e.g. barium stars. We propose a new mass-transfer mode for Mira-type binaries, which we call ‘wind Roche-lobe overflow’ (WRLOF, and which we demonstrate with 3D hydrodynamic simulations. Importantly, we show that the circumstellar outflows which result from WRLOF tend to be highly aspherical and strongly focused towards the binary orbital plane. Furthermore, the subsequent mass-transfer rates are at least an order of magnitude greater than the analogous BHL values. We discuss the implications of these results for the shaping of bipolar (proto-planetary nebulae and other related systems.

  8. Detection Rates for Close Binaries via Microlensing

    Science.gov (United States)

    Gaudi, B. Scott; Gould, Andrew

    1997-06-01

    Microlensing is one of the most promising methods of reconstructing the stellar mass function down to masses even below the hydrogen-burning limit. The fundamental limit to this technique is the presence of unresolved binaries, which can, in principle, significantly alter the inferred mass function. Here we quantify the fraction of binaries that can be detected using microlensing, considering specifically the mass ratio and separation of the binary. We find that almost all binary systems with separations greater than b ~ 0.4 of their combined Einstein ring radius are detectable assuming a detection threshold of 3%. For two M dwarfs, this corresponds to a limiting separation of >~1 AU. Since very few observed M dwarfs have companions at separations corrupt the measurements of the mass function. We find that the detectability depends only weakly on the mass ratio. For those events for which individual masses can be determined, we find that binaries can be detected down to b ~ 0.2.

  9. Evolution of Supermassive Black-Hole Binaries

    Science.gov (United States)

    Milosavljevic, M.; Merritt, D.

    2000-10-01

    Binary supermassive black holes are expected to form in galactic nuclei following galaxy mergers. We report large-scale N-body simulations using the Aarseth/Spurzem parallel code NBODY6++ of the formation and evolution of such binaries. Initial conditions are drawn from a tree-code simulation of the merger of two spherical galaxies with ρ ~ r-2 density cusps (Cruz & Merritt, AAS Poster). Once the two black holes form a bound pair at the center of the merged galaxies, the evolution is continued using NBODY6++ at much higher resolution. Its exact force calculations generate faithful binary dynamics until the onset of gravity wave-dominated dissipation. We discuss the binary hardening rate, the amplitude of the binary's wandering, and the evolution of the structure of the galactic stellar nucleus.

  10. Phonons in fcc binary alloys

    International Nuclear Information System (INIS)

    Sharma, Amita; Rathore, R.P.S.

    1992-01-01

    Born-Mayer potential has been modified to account for the unpaired (three body) forces among the common nearest neighbours of the ordered binary fcc alloys i.e. Ni 3 Fe 7 , Ni 5 Fe 5 and Ni 75 Fe 25 . The three body potential is added to the two body form of Morse to formalize the total interaction potential. Measured inverse ionic compressibility, cohesive energy, lattice constant and one measured phonon frequency are used to evaluate the defining parameters of the potential. The potential seeks to bring about the binding among 140 and 132 atoms though pair wise (two body) and non-pair wise (three body) forces respectively. The phonon-dispersion relations obtained by solving the secular equation are compared with the experimental findings on the aforesaid alloys. (author). 19 refs., 3 figs

  11. The human discharge chain

    Science.gov (United States)

    Dudley, Scott C.; Heerema, Bret D.; Haaland, Ryan K.

    1997-06-01

    The common classroom demonstration of a human chain, charged by a Van de Graaff generator, and then discharged via the person at the end of the chain touching ground, is analyzed as a capacitor and resistor circuit model. The energy deposited in each person in the chain is determined. Further, the effect of increasing energy deposited in the person who touched ground, as the number of people in the chain is increased, is shown and quantified.

  12. The Global Value Chain

    DEFF Research Database (Denmark)

    Sørensen, Olav Jull

    The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool......The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool...

  13. On the Convergence of Biogeography-Based Optimization for Binary Problems

    Directory of Open Access Journals (Sweden)

    Haiping Ma

    2014-01-01

    Full Text Available Biogeography-based optimization (BBO is an evolutionary algorithm inspired by biogeography, which is the study of the migration of species between habitats. A finite Markov chain model of BBO for binary problems was derived in earlier work, and some significant theoretical results were obtained. This paper analyzes the convergence properties of BBO on binary problems based on the previously derived BBO Markov chain model. Analysis reveals that BBO with only migration and mutation never converges to the global optimum. However, BBO with elitism, which maintains the best candidate in the population from one generation to the next, converges to the global optimum. In spite of previously published differences between genetic algorithms (GAs and BBO, this paper shows that the convergence properties of BBO are similar to those of the canonical GA. In addition, the convergence rate estimate of BBO with elitism is obtained in this paper and is confirmed by simulations for some simple representative problems.

  14. Fluorescence resonance energy transfer in a binary organic nanoparticle system and its application.

    Science.gov (United States)

    Wu, Meng; Xu, Xinjun; Wang, Jinshan; Li, Lidong

    2015-04-22

    Fluorescent organic nanoparticles have a much better photostability than molecule-based probes. Here, we report a simple strategy to detect chemicals and biomolecules by a binary nanoparticle system based on fluorescence resonance energy transfer (FRET). Poly(9,9-di-n-octylfluorenyl-2,7-diyl) (PFO, energy donor) and poly [2-methoxy-5-(2-ethylhexyloxy)-1,4-phenylenevinylene] (MEH-PPV, energy acceptor) are utilized to prepare the binary nanoparticle system through a reprecipitation method. Since the FRET process is strongly distance-dependent, a change in the interparticle distance between the two kinds of nanoparticles after introduction of analytes will alter the FRET efficiency. The response of the binary nanoparticle system to cationic polyelectrolytes was investigated by monitoring the FRET efficiency from PFO to MEH-PPV nanoparticles and the fluorescence color of the nanoparticle solutions. Furthermore, the cationic polyelectrolyte pretreated binary nanoparticle system can be used to detect DNA by desorption of nanoparticles from the polyelectrolyte's chains and the detection concentration can go down to 10(-14) M. Thus, the binary nanoparticle system shows great promise for applications in chemical sensing or biosensing.

  15. Value Chain Engineering

    DEFF Research Database (Denmark)

    Wæhrens, Brian Vejrum; Slepniov, Dmitrij

    2015-01-01

    This workbook is recommended for the attention of students of and managers in Danish small and medium sized enterprises (SMEs). Danish SMEs are currently facing a number of key challenges related to their position in global value chains. This book provides an insight into value chain management...... that may help these SMEs to occupy and sustain a competitive position in the value chain. It addresses this objective by introducing and discussing: • The concept of global value chains and its founding principles • The buyer-supplier relationships • Various SMEs operations configurations • Ideas...... for positional change in the value chain • Practical case examples • Key take-aways and recommendations...

  16. Theory of phase equilibria and critical mixing points in binary lipid bilayers

    DEFF Research Database (Denmark)

    Risbo, Jens; Sperotto, Maria Maddalena; Mouritsen, Ole G.

    1995-01-01

    on a statistical mechanical model in which the interaction between lipid acyl chains of different length is formulated in terms of a hydrophobic mismatch. The model permits a series of binary phase diagrams to be determined in terms of a single ''universal'' interaction parameter. The part of the free energy...... for the enthalpy and the compositional fluctuations. It is shown, in accordance with experiments, that the nonideal mixing of lipid species due to mismatch in the hydrophobic lengths leads to a progressively nonideal mixing behavior as the chain-length difference is increased. Moreover, indications are found...

  17. BPASS predictions for binary black hole mergers

    Science.gov (United States)

    Eldridge, J. J.; Stanway, E. R.

    2016-11-01

    Using the Binary Population and Spectral Synthesis code, BPASS, we have calculated the rates, time-scales and mass distributions for binary black hole (BH) mergers as a function of metallicity. We consider these in the context of the recently reported first Laser Interferometer Gravitational-Wave Observatory (LIGO) event detection. We find that the event has a very low probability of arising from a stellar population with initial metallicity mass fraction above Z = 0.010 (Z ≳ 0.5 Z⊙). Binary BH merger events with the reported masses are most likely in populations below 0.008 (Z ≲ 0.4 Z⊙). Events of this kind can occur at all stellar population ages from 3 Myr up to the age of the Universe, but constitute only 0.1-0.4 per cent of binary BH mergers between metallicities of Z = 0.001 and 0.008. However at metallicity Z = 10-4, 26 per cent of binary BH mergers would be expected to have the reported masses. At this metallicity, the progenitor merger times can be close to ≈10 Gyr and rotationally mixed stars evolving through quasi-homogeneous evolution, due to mass transfer in a binary, dominate the rate. The masses inferred for the BHs in the binary progenitor of GW 150914 are amongst the most massive expected at anything but the lowest metallicities in our models. We discuss the implications of our analysis for the electromagnetic follow-up of future LIGO event detections.

  18. Topological and categorical properties of binary trees

    Directory of Open Access Journals (Sweden)

    H. Pajoohesh

    2008-04-01

    Full Text Available Binary trees are very useful tools in computer science for estimating the running time of so-called comparison based algorithms, algorithms in which every action is ultimately based on a prior comparison between two elements. For two given algorithms A and B where the decision tree of A is more balanced than that of B, it is known that the average and worst case times of A will be better than those of B, i.e., ₸A(n ≤₸B(n and TWA (n≤TWB (n. Thus the most balanced and the most imbalanced binary trees play a main role. Here we consider them as semilattices and characterize the most balanced and the most imbalanced binary trees by topological and categorical properties. Also we define the composition of binary trees as a commutative binary operation, *, such that for binary trees A and B, A * B is the binary tree obtained by attaching a copy of B to any leaf of A. We show that (T,* is a commutative po-monoid and investigate its properties.

  19. Instabilities in Interacting Binary Stars

    Science.gov (United States)

    Andronov, I. L.; Andrych, K. D.; Antoniuk, K. A.; Baklanov, A. V.; Beringer, P.; Breus, V. V.; Burwitz, V.; Chinarova, L. L.; Chochol, D.; Cook, L. M.; Cook, M.; Dubovský, P.; Godlowski, W.; Hegedüs, T.; Hoňková, K.; Hric, L.; Jeon, Y.-B.; Juryšek, J.; Kim, C.-H.; Kim, Y.; Kim, Y.-H.; Kolesnikov, S. V.; Kudashkina, L. S.; Kusakin, A. V.; Marsakova, V. I.; Mason, P. A.; Mašek, M.; Mishevskiy, N.; Nelson, R. H.; Oksanen, A.; Parimucha, S.; Park, J.-W.; Petrík, K.; Quiñones, C.; Reinsch, K.; Robertson, J. W.; Sergey, I. M.; Szpanko, M.; Tkachenko, M. G.; Tkachuk, L. G.; Traulsen, I.; Tremko, J.; Tsehmeystrenko, V. S.; Yoon, J.-N.; Zola, S.; Shakhovskoy, N. M.

    2017-07-01

    The types of instability in the interacting binary stars are briefly reviewed. The project “Inter-Longitude Astronomy” is a series of smaller projects on concrete stars or groups of stars. It has no special funds, and is supported from resources and grants of participating organizations, when informal working groups are created. This “ILA” project is in some kind similar and complementary to other projects like WET, CBA, UkrVO, VSOLJ, BRNO, MEDUZA, AstroStatistics, where many of us collaborate. Totally we studied 1900+ variable stars of different types, including newly discovered variables. The characteristic timescale is from seconds to decades and (extrapolating) even more. The monitoring of the first star of our sample AM Her was initiated by Prof. V.P. Tsesevich (1907-1983). Since more than 358 ADS papers were published. In this short review, we present some highlights of our photometric and photo-polarimetric monitoring and mathematical modeling of interacting binary stars of different types: classical (AM Her, QQ Vul, V808 Aur = CSS 081231:071126+440405, FL Cet), asynchronous (BY Cam, V1432 Aql), intermediate (V405 Aql, BG CMi, MU Cam, V1343 Her, FO Aqr, AO Psc, RXJ 2123, 2133, 0636, 0704) polars and magnetic dwarf novae (DO Dra) with 25 timescales corresponding to different physical mechanisms and their combinations (part “Polar”); negative and positive superhumpers in nova-like (TT Ari, MV Lyr, V603 Aql, V795 Her) and many dwarf novae stars (“Superhumper”); eclipsing “non-magnetic” cataclysmic variables(BH Lyn, DW UMa, EM Cyg; PX And); symbiotic systems (“Symbiosis”); super-soft sources (SSS, QR And); spotted (and not spotted) eclipsing variables with (and without) evidence for a current mass transfer (“Eclipser”) with a special emphasis on systems with a direct impact of the stream into the gainer star's atmosphere, which we propose to call “Impactor” (short from “Extreme Direct Impactor”), or V361 Lyr-type stars. Other

  20. Binary neutron star merger simulations

    Energy Technology Data Exchange (ETDEWEB)

    Bruegmann, Bernd [Jena Univ. (Germany)

    2016-11-01

    Our research focuses on the numerical tools necessary to solve Einstein's equations. In recent years we have been particularly interested in spacetimes consisting of two neutron stars in the final stages of their evolution. Because of the emission of gravitational radiation, the objects are driven together to merge; the emitted gravitational wave signal is visualized. This emitted gravitational radiation carries energy and momentum away from the system and contains information about the system. Late last year the Laser Interferometer Gravitational-wave Observatory (LIGO) began searches for these gravitational wave signals at a sensitivity at which detections are expected. Although such systems can radiate a significant amount of their total mass-energy in gravitational waves, the gravitational wave signals one expects to receive on Earth are not strong, since sources of gravitational waves are often many millions of light years away. Therefore one needs accurate templates for the radiation one expects from such systems in order to be able to extract them out of the detector's noise. Although analytical models exist for compact binary systems when the constituents are well separated, we need numerical simulation to investigate the last orbits before merger to obtain accurate templates and validate analytical approximations. Due to the strong nonlinearity of the equations and the large separation of length scales, these simulations are computationally demanding and need to be run on large supercomputers. When matter is present the computational cost as compared to pure black hole (vacuum) simulations increases even more due to the additional matter fields. But also more interesting astrophysical phenomena can happen. In fact, there is the possibility for a strong electromagnetic signal from the merger (e.g., a short gamma-ray burst or lower-energy electromagnetic signatures from the ejecta) and significant neutrino emission. Additionally, we can expect that

  1. Eliciting Subjective Probabilities with Binary Lotteries

    DEFF Research Database (Denmark)

    Harrison, Glenn W.; Martínez-Correa, Jimmy; Swarthout, J. Todd

    2014-01-01

    We evaluate a binary lottery procedure for inducing risk neutral behavior in a subjective belief elicitation task. Prior research has shown this procedure to robustly induce risk neutrality when subjects are given a single risk task defined over objective probabilities. Drawing a sample from...... the same subject population, we find evidence that the binary lottery procedure also induces linear utility in a subjective probability elicitation task using the Quadratic Scoring Rule. We also show that the binary lottery procedure can induce direct revelation of subjective probabilities in subjects...

  2. Stability studies of colloidal silica dispersions in binary solvent mixtures

    CERN Document Server

    Bean, K H

    1997-01-01

    A series of monodispersed colloidal silica dispersions, of varying radii, has been prepared. These particles are hydrophilic in nature due to the presence of surface silanol groups. Some of the particles have been rendered hydrophobic by terminally grafting n-alkyl (C sub 1 sub 8) chains to the surface. The stability of dispersions of these various particles has been studied in binary mixtures of liquids, namely (i) ethanol and cyclohexane, and (ii) benzene and n-heptane. The ethanol - cyclohexane systems have been studied using a variety of techniques. Adsorption excess isotherms have been established and electrophoretic mobility measurements have been made. The predicted stability of the dispersions from D.V.L.O. calculations is compared to the observed stability. The hydrophilic silica particles behave as predicted by the calculations, with the zeta potential decreasing and the van der Waals attraction increasing with increasing cyclohexane concentration. The hydrophobic particles behave differently than e...

  3. Spread-spectrum communication using binary spatiotemporal chaotic codes

    International Nuclear Information System (INIS)

    Wang Xingang; Zhan Meng; Gong Xiaofeng; Lai, C.H.; Lai, Y.-C.

    2005-01-01

    We propose a scheme to generate binary code for baseband spread-spectrum communication by using a chain of coupled chaotic maps. We compare the performances of this type of spatiotemporal chaotic code with those of a conventional code used frequently in digital communication, the Gold code, and demonstrate that our code is comparable or even superior to the Gold code in several key aspects: security, bit error rate, code generation speed, and the number of possible code sequences. As the field of communicating with chaos faces doubts in terms of performance comparison with conventional digital communication schemes, our work gives a clear message that communicating with chaos can be advantageous and it deserves further attention from the nonlinear science community

  4. Dixie Valley Bottoming Binary Unit

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, Dale [Terra-Gen Sierra Holdings, LLC, Reno, NV (United States)

    2014-12-21

    This binary plant is the first air cooled, high-output refrigeration based waste heat recovery cycle in the industry. Its working fluid is environmentally friendly and as such, the permits that would be required with a hydrocarbon based cycle are not necessary. The unit is largely modularized, meaning that the unit’s individual skids were assembled in another location and were shipped via truck to the plant site. The Air Cooled Condensers (ACC), equipment piping, and Balance of Plant (BOP) piping were constructed at site. This project further demonstrates the technical feasibility of using low temperature brine for geothermal power utilization. The development of the unit led to the realization of low temperature, high output, and environmentally friendly heat recovery systems through domestic research and engineering. The project generates additional renewable energy, resulting in cleaner air and reduced carbon dioxide emissions. Royalty and tax payments to governmental agencies will increase, resulting in reduced financial pressure on local entities. The major components of the unit were sourced from American companies, resulting in increased economic activity throughout the country.

  5. Supply Chain Management og Supply Chain costing

    DEFF Research Database (Denmark)

    Nielsen, Steen; Mortensen, Ole

    2002-01-01

    Formålet med denne artikel er at belyse de muligheder som ligger i at integrere virksomhedens økonomiske styring med begrebet Supply Chain Management (SCM). Dette søges belyst ved først at beskrive den teoretiske ramme, hvori SCM indgår. Herefter analyseres begrebet Supply Chain Costing (SCC) som...... Århus. Et resultat er, at via begrebet Supply Chain Costing skabes der mulighed for at måle logistikkædens aktiviteter i kr./øre. Anvendelsen af denne information har også strategisk betydning for at kunne vælge kunde og leverandør. Ved hjælp af integrationen skabes der også helt nye mulighed...

  6. Enhanced parametric processes in binary metamaterials

    OpenAIRE

    Gorkunov, Maxim V.; Shadrivov, Ilya V.; Kivshar, Yuri S.

    2005-01-01

    We suggest double-resonant (binary) metamaterials composed of two types of magnetic resonant elements, and demonstrate that in the nonlinear regime such metamaterials provide unique possibilities for phase-matched parametric interaction and enhanced second-harmonic generation.

  7. BINARY MINOR PLANETS V1.0

    Data.gov (United States)

    National Aeronautics and Space Administration — We present a data table giving basic physical and orbital parameters for known binary minor planets in the Solar System (and Pluto/Charon) based on published...

  8. BINARY MINOR PLANETS V6.0

    Data.gov (United States)

    National Aeronautics and Space Administration — The data set lists orbital and physical properties for well-observed or suspected binary/multiple minor planets including the Pluto system, as inspired by Richardson...

  9. BINARY MINOR PLANETS V4.0

    Data.gov (United States)

    National Aeronautics and Space Administration — The data set lists orbital and physical properties for well-observed or suspected binary/multiple minor planets including the Pluto system, as inspired by Richardson...

  10. BINARY MINOR PLANETS V5.0

    Data.gov (United States)

    National Aeronautics and Space Administration — The data set lists orbital and physical properties for well-observed or suspected binary/multiple minor planets including the Pluto system, as inspired by Richardson...

  11. BINARY MINOR PLANETS V8.0

    Data.gov (United States)

    National Aeronautics and Space Administration — The data set lists orbital and physical properties for well-observed or suspected binary/multiple minor planets including the Pluto system, compiled from the...

  12. BINARY MINOR PLANETS V9.0

    Data.gov (United States)

    National Aeronautics and Space Administration — The data set lists orbital and physical properties for well-observed or suspected binary/multiple minor planets including the Pluto system, compiled from the...

  13. BINARY MINOR PLANETS V7.0

    Data.gov (United States)

    National Aeronautics and Space Administration — The data set lists orbital and physical properties for well-observed or suspected binary/multiple minor planets including the Pluto system, compiled from the...

  14. BINARY MINOR PLANETS V2.0

    Data.gov (United States)

    National Aeronautics and Space Administration — We present data tables giving basic orbital and physical parameters for well-observed or suspected binary/multiple minor planets and the Pluto system, based on a...

  15. BINARY MINOR PLANETS V3.0

    Data.gov (United States)

    National Aeronautics and Space Administration — We present data tables giving basic orbital and physical parameters for well-observed or suspected binary/multiple minor planets and the Pluto system, based on a...

  16. A Type System for Certified Binaries

    National Research Council Canada - National Science Library

    Shao, Zhong; Trifonov, Valery; Saha, Bratin; Papaspyrou, Nikolaos

    2004-01-01

    ... (CPS and closure conversion) while preserving proofs represented in the type system. Our work provides a foundation for the process of automatically generating certified binaries in a type-theoretic framework.

  17. ON THE BINARY DIGITS OF ALGEBRAIC NUMBERS

    OpenAIRE

    KANEKO, HAJIME

    2010-01-01

    Borel conjectured that all algebraic irrational numbers are normal in base 2. However, very little is known about this problem. We improve the lower bounds for the number of digit changes in the binary expansions of algebraic irrational numbers.

  18. General simulation algorithm for autocorrelated binary processes

    Science.gov (United States)

    Serinaldi, Francesco; Lombardo, Federico

    2017-02-01

    The apparent ubiquity of binary random processes in physics and many other fields has attracted considerable attention from the modeling community. However, generation of binary sequences with prescribed autocorrelation is a challenging task owing to the discrete nature of the marginal distributions, which makes the application of classical spectral techniques problematic. We show that such methods can effectively be used if we focus on the parent continuous process of beta distributed transition probabilities rather than on the target binary process. This change of paradigm results in a simulation procedure effectively embedding a spectrum-based iterative amplitude-adjusted Fourier transform method devised for continuous processes. The proposed algorithm is fully general, requires minimal assumptions, and can easily simulate binary signals with power-law and exponentially decaying autocorrelation functions corresponding, for instance, to Hurst-Kolmogorov and Markov processes. An application to rainfall intermittency shows that the proposed algorithm can also simulate surrogate data preserving the empirical autocorrelation.

  19. Computer controlled evaluation of binary images

    NARCIS (Netherlands)

    Schouten, Th.E.; van den Broek, Egon

    2010-01-01

    The present invention relates to computer controlled image processing and, in particular, to computer controlled evaluation of two dimensional, 2D, and three dimensional, 3D, binary images including sequences of images using a distance map.

  20. On the Maximum Separation of Visual Binaries

    Indian Academy of Sciences (India)

    2016-01-27

    minimum) angular separation ρmax(ρmin), the corresponding apparent position angles (|ρmax , |ρmin) and the individual masses of visual binary systems. The algorithm uses Reed's formulae (1984) for the masses, and a ...

  1. Red-giant stars in eccentric binaries

    Directory of Open Access Journals (Sweden)

    Beck P. G.

    2015-01-01

    Full Text Available The unparalleled photometric data obtained by NASA’s Kepler Space Telescope has led to improved understanding of red-giant stars and binary stars. We discuss the characterization of known eccentric system, containing a solar-like oscillating red-giant primary component. We also report several new binary systems that are candidates for hosting an oscillating companion. A powerful approach to study binary stars is to combine asteroseimic techniques with light curve fitting. Seismology allows us to deduce the properties of red giants. In addition, by modeling the ellipsoidal modulations we can constrain the parameters of the binary system. An valuable independent source are ground-bases, high-resolution spectrographs.

  2. Observations of new Wolf-Rayet binaries

    International Nuclear Information System (INIS)

    Niemela, V.S.

    1982-01-01

    The author reports here preliminary results of spectrographic observations for three southern WR stars, whose binary nature had not been previously verified: HDE 320102, CD -45 0 4482, HD 62910. The observations were carried out at the Cerro Tololo Inter-American Observatory, Chile, mostly with the Cassegrain spectrograph with IT attached to the 1-m reflector. These spectrograms were secured on Kodak IIIaJ emulsion, and have a dispersion of 45 A/mm. The results suggest that HDE 320102 must be a double-lined 05-7 + WN3 spectroscopic binary, that CD -45 0 4482 appears to be a single-lined spectroscopic binary and that HD 62910 may be a binary. (Auth.)

  3. Editorial: Supply Chain Management

    Directory of Open Access Journals (Sweden)

    Dimitrios Aidonis

    2017-05-01

    Full Text Available This special issue has followed up the 3rd Olympus International Conference on Supply Chains held on Athens Metropolitan Expo, November 7 & 8 2015, Greece. The Conference was organized by the Department of Logistics Technological Educational Institute of Central Macedonia, in collaboration with the: a Laboratory of Quantitative Analysis, Logistics and Supply Chain Management of the Department of Mechanical Engineering, Aristotle University of Thessaloniki (AUTH, b Greek Association of Supply Chain Management (EEL of Northern Greece and the c Supply Chain & Logistics Journal. During the 2-Days Conference more than 60 research papers were presented covering the following thematic areas: (i Transportation, (ii Best Practices in Logistics, (iii Information and Communication Technologies in Supply Chain Management, (iv Food Logistics, (v New Trends in Business Logistics, and (vi Green Supply Chain Management. Three keynote invited speakers addressed interesting issues for the Operational Research, the Opportunities and Prospects of Greek Ports chaired Round Tables with other Greek and Foreign Scientists and Specialists.

  4. Supply chain components

    Directory of Open Access Journals (Sweden)

    Vieraşu, T.

    2011-01-01

    Full Text Available In this article I will go through three main logistics components, which are represented by: transportation, inventory and facilities, and the three secondary logistical components: information, production location, price and how they determine performance of any supply chain. I will discuss then how these components are used in the design, planning and operation of a supply chain. I will also talk about some obstacles a supply chain manager may encounter.

  5. Supply chain components

    OpenAIRE

    Vieraşu, T.; Bălăşescu, M.

    2011-01-01

    In this article I will go through three main logistics components, which are represented by: transportation, inventory and facilities, and the three secondary logistical components: information, production location, price and how they determine performance of any supply chain. I will discuss then how these components are used in the design, planning and operation of a supply chain. I will also talk about some obstacles a supply chain manager may encounter.

  6. Diffusion in ordered binary solid systems

    International Nuclear Information System (INIS)

    Stolwijk, N.A.

    1980-01-01

    This thesis contains contributions to the field of diffusion in ordered binary solid systems. An extensive experimental investigation of the self diffusion in CoGa is presented. The results of these diffusion measurements strongly suggest that a substantial part of the atomic migration is caused by a new type of defect. A quantitative description of the atomic displacements via this defect is given. Finally computer simulations are presented of diffusion and ordering in binary solid systems. (Auth.)

  7. Reflection effect in close binary systems

    International Nuclear Information System (INIS)

    Vanlandingham, F.G.

    1974-01-01

    The investigation studies the effects of the irradiation of the hotter component in a close binary system on the atmosphere of the secondary and on the observed flux distribution of the binary system. An existing model atmospheres computer program is modified to include the effects of non-zero incident radiation. Computations reveal that the irradiation can significantly raise the temperature in the upper layers of the atmosphere. (U.S.)

  8. Detecting Black Hole Binaries by Gaia

    OpenAIRE

    Yamaguchi, Masaki S.; Kawanaka, Norita; Bulik, Tomasz; Piran, Tsvi

    2017-01-01

    We study the prospect of the Gaia satellite to identify black hole binary systems by detecting the orbital motion of the companion stars. Taking into account the initial mass function, mass transfer, common envelope phase, interstellar absorption and identifiability of black holes, we estimate the number of black hole binaries detected by Gaia and their distributions with respect to the black hole mass for several models with different parameters. We find that $\\sim 300-6000$ black hole binar...

  9. Search for binary nuclei in planetary nebulae

    International Nuclear Information System (INIS)

    Jasniewicz, G.

    1987-01-01

    Two planetary nebulae with central stars of late spectral type were observed: LT 5 and Abell 35. The variation of the systemic velocity of the G-binary in HD 112313 gives strong support to the idea of a third body in the nucleus of LT 5. In addition, it is concluded that observed photometric variations of BD -22 deg 3467 (the central star of Abell 35) can best be explained by the binary nature of the star. 9 references

  10. Search for binary nuclei in planetary nebulae

    Science.gov (United States)

    Jasniewicz, G.

    Two planetary nebulae with central stars of late spectral type were observed: LT 5 and Abell 35. The variation of the systemic velocity of the G-binary in HD 112313 gives strong support to the idea of a third body in the nucleus of LT 5. In addition, it is concluded that observed photometric variations of BD -22 deg 3467 (the central star of Abell 35) can best be explained by the binary nature of the star.

  11. Isometries and binary images of linear block codes over ℤ4 + uℤ4 and ℤ8 + uℤ8

    Science.gov (United States)

    Sison, Virgilio; Remillion, Monica

    2017-10-01

    Let {{{F}}}2 be the binary field and ℤ2 r the residue class ring of integers modulo 2 r , where r is a positive integer. For the finite 16-element commutative local Frobenius non-chain ring ℤ4 + uℤ4, where u is nilpotent of index 2, two weight functions are considered, namely the Lee weight and the homogeneous weight. With the appropriate application of these weights, isometric maps from ℤ4 + uℤ4 to the binary spaces {{{F}}}24 and {{{F}}}28, respectively, are established via the composition of other weight-based isometries. The classical Hamming weight is used on the binary space. The resulting isometries are then applied to linear block codes over ℤ4+ uℤ4 whose images are binary codes of predicted length, which may or may not be linear. Certain lower and upper bounds on the minimum distances of the binary images are also derived in terms of the parameters of the ℤ4 + uℤ4 codes. Several new codes and their images are constructed as illustrative examples. An analogous procedure is performed successfully on the ring ℤ8 + uℤ8, where u 2 = 0, which is a commutative local Frobenius non-chain ring of order 64. It turns out that the method is possible in general for the class of rings ℤ2 r + uℤ2 r , where u 2 = 0, for any positive integer r, using the generalized Gray map from ℤ2 r to {{{F}}}2{2r-1}.

  12. New algorithms for binary wavefront optimization

    Science.gov (United States)

    Zhang, Xiaolong; Kner, Peter

    2015-03-01

    Binary amplitude modulation promises to allow rapid focusing through strongly scattering media with a large number of segments due to the faster update rates of digital micromirror devices (DMDs) compared to spatial light modulators (SLMs). While binary amplitude modulation has a lower theoretical enhancement than phase modulation, the faster update rate should more than compensate for the difference - a factor of π2 /2. Here we present two new algorithms, a genetic algorithm and a transmission matrix algorithm, for optimizing the focus with binary amplitude modulation that achieve enhancements close to the theoretical maximum. Genetic algorithms have been shown to work well in noisy environments and we show that the genetic algorithm performs better than a stepwise algorithm. Transmission matrix algorithms allow complete characterization and control of the medium but require phase control either at the input or output. Here we introduce a transmission matrix algorithm that works with only binary amplitude control and intensity measurements. We apply these algorithms to binary amplitude modulation using a Texas Instruments Digital Micromirror Device. Here we report an enhancement of 152 with 1536 segments (9.90%×N) using a genetic algorithm with binary amplitude modulation and an enhancement of 136 with 1536 segments (8.9%×N) using an intensity-only transmission matrix algorithm.

  13. Eclipsing Binary B-Star Mass Determinations

    Science.gov (United States)

    Townsend, Amanda; Eikenberry, Stephen S.

    2016-01-01

    B-stars in binary pairs provide a laboratory for key astrophysical measurements of massive stars, including key insights for the formation of compact objects (neutron stars and black holes). In their paper, Martayan et al (2004) find 23 Be binary star pairs in NGC2004 in the Large Magellanic Cloud, five of which are both eclipsing and spectroscopic binaries with archival data from VLT-Giraffe and photometric data from MACHO. By using the Wilson eclipsing binary code (e.g., Wilson, 1971), we can determine preliminary stellar masses of the binary components. We present the first results from this analysis. This study also serves as proof-of-concept for future observations with the Photonic Synthesis Telescope Array (Eikenberry et al., in prep) that we are currently building for low-cost, precision spectroscopic observations. With higher resolution and dedicated time for observations, we can follow-up observations of these Be stars as well as Be/X-ray binaries, for improved mass measurements of neutron stars and black holes and better constraints on their origin/formation.

  14. Texture classification by texton: statistical versus binary.

    Directory of Open Access Journals (Sweden)

    Zhenhua Guo

    Full Text Available Using statistical textons for texture classification has shown great success recently. The maximal response 8 (Statistical_MR8, image patch (Statistical_Joint and locally invariant fractal (Statistical_Fractal are typical statistical texton algorithms and state-of-the-art texture classification methods. However, there are two limitations when using these methods. First, it needs a training stage to build a texton library, thus the recognition accuracy will be highly depended on the training samples; second, during feature extraction, local feature is assigned to a texton by searching for the nearest texton in the whole library, which is time consuming when the library size is big and the dimension of feature is high. To address the above two issues, in this paper, three binary texton counterpart methods were proposed, Binary_MR8, Binary_Joint, and Binary_Fractal. These methods do not require any training step but encode local feature into binary representation directly. The experimental results on the CUReT, UIUC and KTH-TIPS databases show that binary texton could get sound results with fast feature extraction, especially when the image size is not big and the quality of image is not poor.

  15. Self-assembly of organocyanide dianions and metal–organic macrocycles into polymeric architectures including an unprecedented quadruple helical aperiodic structure\

    Czech Academy of Sciences Publication Activity Database

    Zhang, X.; Zhao, H.; Palatinus, Lukáš; Gagnon, K.J.; Bacsa, J.; Dunbar, K.R.

    2016-01-01

    Roč. 16, č. 4 (2016), s. 1805-1811 ISSN 1528-7483 Institutional support: RVO:68378271 Keywords : crystal engineering * self-assembled polymer * modulated structure * helical chain Subject RIV: CC - Organic Chemistry Impact factor: 4.055, year: 2016

  16. Imputation strategies for missing binary outcomes in cluster randomized trials

    Directory of Open Access Journals (Sweden)

    Akhtar-Danesh Noori

    2011-02-01

    Full Text Available Abstract Background Attrition, which leads to missing data, is a common problem in cluster randomized trials (CRTs, where groups of patients rather than individuals are randomized. Standard multiple imputation (MI strategies may not be appropriate to impute missing data from CRTs since they assume independent data. In this paper, under the assumption of missing completely at random and covariate dependent missing, we compared six MI strategies which account for the intra-cluster correlation for missing binary outcomes in CRTs with the standard imputation strategies and complete case analysis approach using a simulation study. Method We considered three within-cluster and three across-cluster MI strategies for missing binary outcomes in CRTs. The three within-cluster MI strategies are logistic regression method, propensity score method, and Markov chain Monte Carlo (MCMC method, which apply standard MI strategies within each cluster. The three across-cluster MI strategies are propensity score method, random-effects (RE logistic regression approach, and logistic regression with cluster as a fixed effect. Based on the community hypertension assessment trial (CHAT which has complete data, we designed a simulation study to investigate the performance of above MI strategies. Results The estimated treatment effect and its 95% confidence interval (CI from generalized estimating equations (GEE model based on the CHAT complete dataset are 1.14 (0.76 1.70. When 30% of binary outcome are missing completely at random, a simulation study shows that the estimated treatment effects and the corresponding 95% CIs from GEE model are 1.15 (0.76 1.75 if complete case analysis is used, 1.12 (0.72 1.73 if within-cluster MCMC method is used, 1.21 (0.80 1.81 if across-cluster RE logistic regression is used, and 1.16 (0.82 1.64 if standard logistic regression which does not account for clustering is used. Conclusion When the percentage of missing data is low or intra

  17. Renormalization group treatment for spin waves in the randomly disordered Heisenberg chain

    International Nuclear Information System (INIS)

    Chaves, C.M.; Koiller, B.

    1983-03-01

    Local densities of states in the randomly disordered binary quantum Heisenberg chain using a generalization of a recently developed approach based on renormalization group ideas are calculated. It envolves decimating alternate apins along the chain in such a way as to obtain recursion relations to describe the renormalized set of Green's function equations of motion. The densities of states are richly structured, indicating that the method takes into account compositional fluctuations of arbitrary range. (Author) [pt

  18. Global Value Chain Configuration

    DEFF Research Database (Denmark)

    Hernandez, Virginia; Pedersen, Torben

    2017-01-01

    This paper reviews the literature on global value chain configuration, providing an overview of this topic. Specifically, we review the literature focusing on the concept of the global value chain and its activities, the decisions involved in its configuration, such as location, the governance mo...

  19. Fields From Markov Chains

    DEFF Research Database (Denmark)

    Justesen, Jørn

    2005-01-01

    A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly.......A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly....

  20. Supply Chain Management

    DEFF Research Database (Denmark)

    Wieland, Andreas; Handfield, Robert B.

    Supply chain management has made great strides in becoming a discipline with a standalone body of theories. As part of this evolution, researchers have sought to embed and integrate observed supply chain management phenomena into theoretical statements. In our review, we explore where we have been...

  1. Exploring the Birth of Binary Stars

    Science.gov (United States)

    Kohler, Susanna

    2016-08-01

    More than half of all stars are thought to be in binary or multiple star systems. But how do these systems form? The misaligned spins of some binary protostars might provide a clue.Two Formation ModelsIts hard to tell how multiple-star systems form, since these systems are difficult to observe in their early stages. But based on numerical simulations, there are two proposed models for the formation of stellar binaries:Turbulent fragmentationTurbulence within a single core leads to multiple dense clumps. These clumps independently collapse to form stars that orbit each other.Disk fragmentationGravitational instabilities in a massive accretion disk cause the formation of a smaller, secondary disk within the first, resulting in two stars that orbit each other.Log column density for one of the authors simulated binary systems, just after the formation of two protostars. Diamonds indicate the protostar positions. [Adapted from Offner et al. 2016]Outflows as CluesHow can we differentiate between these formation mechanisms? Led by Stella Offner (University of Massachusetts), a team of scientists has suggested that the key isto examine the alignment of the stars protostellar outflows jets that are often emitted from the poles of young, newly forming stars.Naively, wed expect that disk fragmentation would produce binary stars with common angular momentum. As the stars spins would be aligned, they would therefore also launch protostellar jets that were aligned with each other. Turbulent fragmentation, on the other hand, would cause the stars to have independent angular momentum. This would lead to randomly oriented spins, so the protostellar jets would be misaligned.Snapshots from the authors simulations. Left panel of each pair: column density; green arrows giveprotostellar spin directions. Right panel: synthetic observations produced from the simulations; cyan arrows giveprotostellar outflow directions. [Offner et al. 2016]Simulations of FragmentationIn order to better

  2. Supply Chain Connectivity: Enhancing Participation in the Global Supply Chain

    OpenAIRE

    Patalinghug, Epictetus E.

    2015-01-01

    Supply chain connectivity is vital for the efficient flow of trade among APEC economies. This paper reviews the literature and supply chain management, describes the barriers to enhancing participation in global supply chain, analyzes the various measures of supply chain performance, and suggests steps for the Philippines to fully reap the benefits of the global value chain.

  3. Do stellar clusters form fewer binaries? Using moderate separation binaries to distinguish between nature and nurture

    Science.gov (United States)

    Reiter, Megan

    2017-08-01

    Fewer wide-separation binaries are found in dense stellar clusters than in looser stellar associations. It is therefore unclear whether feedback in clusters prevents the formation of multiple systems or dynamical interactions destroy them. Measuring the prevalence of close, bound binary systems provide a key test to distinguish between these possibilities. Systems with separations of 10-50 AU will survive interactions in the cluster environment, and therefore are more representative of the natal population of multiple systems. By fitting a double-star PSF, we will identify visual binaries in the Orion Nebula with separations as small as 0.03. At the distance of Orion, this corresponds to a physical separation of 12 AU, effectively closing the observational gap in the binary separation distribution left between known visual and spectroscopic binaries (>65 AU or PhD thesis.

  4. Inference on white dwarf binary systems using the first round Mock LISA Data Challenges data sets

    International Nuclear Information System (INIS)

    Stroeer, Alexander; Veitch, John; Roever, Christian; Bloomer, Ed; Clark, James; Christensen, Nelson; Hendry, Martin; Messenger, Chris; Meyer, Renate; Pitkin, Matthew; Toher, Jennifer; Umstaetter, Richard; Vecchio, Alberto; Woan, Graham

    2007-01-01

    We report on the analysis of selected single source data sets from the first round of the mock LISA data challenges (MLDC) for white dwarf binaries. We implemented an end-to-end pipeline consisting of a grid-based coherent pre-processing unit for signal detection and an automatic Markov Chain Monte Carlo (MCMC) post-processing unit for signal evaluation. We demonstrate that signal detection with our coherent approach is secure and accurate, and is increased in accuracy and supplemented with additional information on the signal parameters by our Markov Chain Monte Carlo approach. We also demonstrate that the Markov Chain Monte Carlo routine is additionally able to determine accurately the noise level in the frequency window of interest

  5. Satisfiability modulo theory and binary puzzle

    Science.gov (United States)

    Utomo, Putranto

    2017-06-01

    The binary puzzle is a sudoku-like puzzle with values in each cell taken from the set {0, 1}. We look at the mathematical theory behind it. A solved binary puzzle is an n × n binary array where n is even that satisfies the following conditions: (1) No three consecutive ones and no three consecutive zeros in each row and each column, (2) Every row and column is balanced, that is the number of ones and zeros must be equal in each row and in each column, (3) Every two rows and every two columns must be distinct. The binary puzzle had been proven to be an NP-complete problem [5]. Research concerning the satisfiability of formulas with respect to some background theory is called satisfiability modulo theory (SMT). An SMT solver is an extension of a satisfiability (SAT) solver. The notion of SMT can be used for solving various problem in mathematics and industries such as formula verification and operation research [1, 7]. In this paper we apply SMT to solve binary puzzles. In addition, we do an experiment in solving different sizes and different number of blanks. We also made comparison with two other approaches, namely by a SAT solver and exhaustive search.

  6. Star formation history: Modeling of visual binaries

    Science.gov (United States)

    Gebrehiwot, Y. M.; Tessema, S. B.; Malkov, O. Yu.; Kovaleva, D. A.; Sytov, A. Yu.; Tutukov, A. V.

    2018-05-01

    Most stars form in binary or multiple systems. Their evolution is defined by masses of components, orbital separation and eccentricity. In order to understand star formation and evolutionary processes, it is vital to find distributions of physical parameters of binaries. We have carried out Monte Carlo simulations in which we simulate different pairing scenarios: random pairing, primary-constrained pairing, split-core pairing, and total and primary pairing in order to get distributions of binaries over physical parameters at birth. Next, for comparison with observations, we account for stellar evolution and selection effects. Brightness, radius, temperature, and other parameters of components are assigned or calculated according to approximate relations for stars in different evolutionary stages (main-sequence stars, red giants, white dwarfs, relativistic objects). Evolutionary stage is defined as a function of system age and component masses. We compare our results with the observed IMF, binarity rate, and binary mass-ratio distributions for field visual binaries to find initial distributions and pairing scenarios that produce observed distributions.

  7. Stacking Analysis of Binary Systems with HAWC

    Science.gov (United States)

    Brisbois, Chad; HAWC Collaboration

    2017-01-01

    Detecting binary systems at TeV energies is an important problem because only a handful of such systems are currently known. The nature of such systems is typically thought to be composed of a compact object and a massive star. The TeV emission from these systems does not obviously correspond to emission in GeV or X-ray, where many binary systems have previously been found. This study focuses on a stacking method to detect TeV emission from LS 5039, a known TeV binary, to test its efficacy in HAWC data. Stacking is a widely employed method for increasing signal to noise ratio in optical astronomy, but has never been attempted previously with HAWC. HAWC is an ideal instrument to search for TeV binaries, because of its wide field of view and high uptime. Applying this method to the entire sky may allow HAWC to detect binary sources of very short or very long periods not sensitive to current analyses. NSF, DOE, Los Alamos, Michigan Tech, CONACyt, UNAM, BUAP.

  8. Finding binaries from phase modulation of pulsating stars with Kepler: V. Orbital parameters, with eccentricity and mass-ratio distributions of 341 new binaries

    Science.gov (United States)

    Murphy, Simon J.; Moe, Maxwell; Kurtz, Donald W.; Bedding, Timothy R.; Shibahashi, Hiromoto; Boffin, Henri M. J.

    2018-03-01

    The orbital parameters of binaries at intermediate periods (102-103 d) are difficult to measure with conventional methods and are very incomplete. We have undertaken a new survey, applying our pulsation timing method to Kepler light curves of 2224 main-sequence A/F stars and found 341 non-eclipsing binaries. We calculate the orbital parameters for 317 PB1 systems (single-pulsator binaries) and 24 PB2s (double-pulsators), tripling the number of intermediate-mass binaries with full orbital solutions. The method reaches down to small mass ratios q ≈ 0.02 and yields a highly homogeneous sample. We parametrize the mass-ratio distribution using both inversion and Markov-Chain Monte Carlo forward-modelling techniques, and find it to be skewed towards low-mass companions, peaking at q ≈ 0.2. While solar-type primaries exhibit a brown dwarf desert across short and intermediate periods, we find a small but statistically significant (2.6σ) population of extreme-mass-ratio companions (q 0.1, we measure the binary fraction of current A/F primaries to be 15.4 per cent ± 1.4 per cent, though we find that a large fraction of the companions (21 per cent ± 6 per cent) are white dwarfs in post-mass-transfer systems with primaries that are now blue stragglers, some of which are the progenitors of Type Ia supernovae, barium stars, symbiotics, and related phenomena. Excluding these white dwarfs, we determine the binary fraction of original A/F primaries to be 13.9 per cent ± 2.1 per cent over the same parameter space. Combining our measurements with those in the literature, we find the binary fraction across these periods is a constant 5 per cent for primaries M1 < 0.8 M⊙, but then increases linearly with log M1, demonstrating that natal discs around more massive protostars M1 ≳ 1 M⊙ become increasingly more prone to fragmentation. Finally, we find the eccentricity distribution of the main-sequence pairs to be much less eccentric than the thermal distribution.

  9. Predicting the Solubility of 1,1-Difluoroethane in Polystyrene Using the Perturbed Soft Chain Theory

    DEFF Research Database (Denmark)

    Pretel, Eduardo; Hong, Seong-Uk

    1998-01-01

    In this study, the solubility of 1,1-difluoroethane in polystyrene was correlated and predicted using the Perturbed Soft Chain Theory (PSCT) and compared with experimental data from the literature. For correlation, a binary interaction parameter was determined by using experimental solubility data...

  10. Understanding the supply chain

    Directory of Open Access Journals (Sweden)

    Aćimović Slobodan

    2006-01-01

    Full Text Available Supply chain management represents new business philosophy and includes strategically positioned and much wider scope of activity in comparison with its "older brother" - management of logistics. Philosophy of the concept of supply chain is directed to more coordination of key business functions of every link in distribution chain in the process of organization of the flow of both goods and information, while logistic managing instruments are focused on internal optimum of flows of goods and information within one company. Applying the concept of integrated supply chain among several companies makes the importance of operative logistics activity even greater on the level of one company, thus advancing processes of optimum and coordination within and between different companies and confirms the importance of logistics performances for the company’s profitability. Besides the fact that the borders between companies are being deleted, this concept of supply chain in one distribution channel influences increasing of importance of functional, i.e. traditional business managing approaches but instead it points out the importance of process managing approaches. Although the author is aware that "there is nothing harder, more dangerous and with uncertain success, but to find a way for introducing some novelties (Machiavelli, it would be even his additional stimulation for trying to bring closer the concept and goals of supply chain implementation that are identified in key, relevant, modern, theoretical and consulting approaches in order to achieve better understanding of the subject and faster implementation of the concept of supply chain management by domestic companies.

  11. EVOLUTION OF THE BINARY FRACTION IN DENSE STELLAR SYSTEMS

    International Nuclear Information System (INIS)

    Fregeau, John M.; Ivanova, Natalia; Rasio, Frederic A.

    2009-01-01

    Using our recently improved Monte Carlo evolution code, we study the evolution of the binary fraction in globular clusters. In agreement with previous N-body simulations, we find generally that the hard binary fraction in the core tends to increase with time over a range of initial cluster central densities for initial binary fractions ∼<90%. The dominant processes driving the evolution of the core binary fraction are mass segregation of binaries into the cluster core and preferential destruction of binaries there. On a global scale, these effects and the preferential tidal stripping of single stars tend to roughly balance, leading to overall cluster binary fractions that are roughly constant with time. Our findings suggest that the current hard binary fraction near the half-mass radius is a good indicator of the hard primordial binary fraction. However, the relationship between the true binary fraction and the fraction of main-sequence stars in binaries (which is typically what observers measure) is nonlinear and rather complicated. We also consider the importance of soft binaries, which not only modify the evolution of the binary fraction, but can also drastically change the evolution of the cluster as a whole. Finally, we briefly describe the recent addition of single and binary stellar evolution to our cluster evolution code.

  12. Project Decision Chain

    DEFF Research Database (Denmark)

    Rolstadås, Asbjørn; Pinto, Jeffrey K.; Falster, Peter

    2015-01-01

    To add value to project performance and help obtain project success, a new framework for decision making in projects is defined. It introduces the project decision chain inspired by the supply chain thinking in the manufacturing sector and uses three types of decisions: authorization, selection......, and plan decision. A primitive decision element is defined where all the three decision types can be accommodated. Each task in the primitive element can in itself contain subtasks that in turn will comprise new primitive elements. The primitive elements are nested together in a project decision chain....

  13. Global Value Chain Configuration

    DEFF Research Database (Denmark)

    Hernandez, Virginia; Pedersen, Torben

    2017-01-01

    This paper reviews the literature on global value chain configuration, providing an overview of this topic. Specifically, we review the literature focusing on the concept of the global value chain and its activities, the decisions involved in its configuration, such as location, the governance...... modes chosen and the different ways of coordinating them. We also examine the outcomes of a global value chain configuration in terms of performance and upgrading. Our aim is to review the state of the art of these issues, identify research gaps and suggest new lines for future research that would...

  14. Plastic value chains

    DEFF Research Database (Denmark)

    Baxter, John; Wahlstrom, Margareta; Zu Castell-Rüdenhausen, Malin

    2014-01-01

    Optimizing plastic value chains is regarded as an important measure in order to increase recycling of plastics in an efficient way. This can also lead to improved awareness of the hazardous substances contained in plastic waste, and how to avoid that these substances are recycled. As an example......, plastics from WEEE is chosen as a Nordic case study. The project aims to propose a number of improvements for this value chain together with representatives from Nordic stakeholders. Based on the experiences made, a guide for other plastic value chains shall be developed....

  15. TIDAL NOVAE IN COMPACT BINARY WHITE DWARFS

    International Nuclear Information System (INIS)

    Fuller, Jim; Lai Dong

    2012-01-01

    Compact binary white dwarfs (WDs) undergoing orbital decay due to gravitational radiation can experience significant tidal heating prior to merger. In these WDs, the dominant tidal effect involves the excitation of outgoing gravity waves in the inner stellar envelope and the dissipation of these waves in the outer envelope. As the binary orbit decays, the WDs are synchronized from outside in (with the envelope synchronized first, followed by the core). We examine the deposition of tidal heat in the envelope of a carbon-oxygen WD and study how such tidal heating affects the structure and evolution of the WD. We show that significant tidal heating can occur in the star's degenerate hydrogen layer. This layer heats up faster than it cools, triggering runaway nuclear fusion. Such 'tidal novae' may occur in all WD binaries containing a CO WD, at orbital periods between 5 minutes and 20 minutes, and precede the final merger by 10 5 -10 6 years.

  16. Compact binary hashing for music retrieval

    Science.gov (United States)

    Seo, Jin S.

    2014-03-01

    With the huge volume of music clips available for protection, browsing, and indexing, there is an increased attention to retrieve the information contents of the music archives. Music-similarity computation is an essential building block for browsing, retrieval, and indexing of digital music archives. In practice, as the number of songs available for searching and indexing is increased, so the storage cost in retrieval systems is becoming a serious problem. This paper deals with the storage problem by extending the supervector concept with the binary hashing. We utilize the similarity-preserving binary embedding in generating a hash code from the supervector of each music clip. Especially we compare the performance of the various binary hashing methods for music retrieval tasks on the widely-used genre dataset and the in-house singer dataset. Through the evaluation, we find an effective way of generating hash codes for music similarity estimation which improves the retrieval performance.

  17. Hybrid Black-Hole Binary Initial Data

    Science.gov (United States)

    Mundim, Bruno C.; Kelly, Bernard J.; Nakano, Hiroyuki; Zlochower, Yosef; Campanelli, Manuela

    2010-01-01

    "Traditional black-hole binary puncture initial data is conformally flat. This unphysical assumption is coupled with a lack of radiation signature from the binary's past life. As a result, waveforms extracted from evolutions of this data display an abrupt jump. In Kelly et al. [Class. Quantum Grav. 27:114005 (2010)], a new binary black-hole initial data with radiation contents derived in the post-Newtonian (PN) calculations was adapted to puncture evolutions in numerical relativity. This data satisfies the constraint equations to the 2.5PN order, and contains a transverse-traceless "wavy" metric contribution, violating the standard assumption of conformal flatness. Although the evolution contained less spurious radiation, there were undesired features; the unphysical horizon mass loss and the large initial orbital eccentricity. Introducing a hybrid approach to the initial data evaluation, we significantly reduce these undesired features."

  18. The dynamical evolution of binaries in clusters

    International Nuclear Information System (INIS)

    Heggie, D.C.

    1975-01-01

    Using information on the rates at which binaries suffer encounters in a stellar system (Heggie, 1974), the effects of such processes on the evolution of the system itself are studied. First considering systems with no binaries initially, it is shown that low-energy pairs attain a quasi-equilibrium distribution comparatively quickly. Their effect on the evolution of the cluster is negligible compared with that of two-body relaxation. In small systems energetic pairs may form sufficiently quickly to exercise a substantial effect on its development and on the escape rate, but in large systems their appearance is delayed until the evolution of the core is well advanced. In that case they appear to be responsible for arresting the collapse of the core at some stage. Binaries of low energy, even if present initially in large numbers, are likely to have at most only a temporary effect on the evolution of the system. High-energy pairs are not so easily destroyed, and so, if present initially, their effect is persistent. It competes with two-body relaxation especially when the fraction of such pairs and the total number-density are high, as in the core, where, in addition, binaries tend to congregate by mass segregation. When encounters with binaries become important, being mostly 'super-elastic' they enhance escape and lead to ejection of mass from the core into the halo, thus accelerating the rate at which mass is lost by tidal forces. It is difficult to decide observationally whether globular clusters possess sufficiently large numbers of binaries for these effects to be important. (Auth.)

  19. Shared Value Chain Design

    DEFF Research Database (Denmark)

    Bals, Lydia; Tate, Wendy L.

    In Sustainable Supply Chain Management (SSCM) research still the classic economic perspective is the dominating perspective, although the triple bottom line (including economic, social and ecological) is well accepted. The theoretical foundation for the paper is Stakeholder Theory. Case studies...

  20. Moldova - Value Chain Training

    Data.gov (United States)

    Millennium Challenge Corporation — The evaluation of the GHS value chain training subactivity wwas designed to measure the extent, if any, to which the training activities improved the productivity...

  1. Editorial: Supply Chain Management

    Directory of Open Access Journals (Sweden)

    Aidonis, D.

    2012-01-01

    Full Text Available This special issue has followed up the 2nd Olympus International Conference on Supply Chains held on October 5-6, 2012, in Katerini, Greece. The Conference was organized by the Department of Logistics of Alexander Technological Educational Institution (ATEI of Thessaloniki, in collaboration with the Laboratory of Quantitative Analysis, Logistics and Supply Chain Management of the Department of Mechanical Engineering, Aristotle University of Thessaloniki (AUTH. During the 2-Days Conference more than 50 research papers were presented covering the following thematic areas: (i Business Logistics, (ii Transportation, Telematics and Distribution Networks, (iii Green Logistics, (iv Information and Communication Technologies in Supply Chain Management, and (v Services and Quality. Three keynote invited speakers addressed interesting issues for the Humanitarian Logistics, Green Supply Chains of the Agrifood Sector and the Opportunities and Prospects of Greek Ports chaired Round Tables with other Greek and Foreign Scientists and Specialists.

  2. Characterizing Oregon's supply chains.

    Science.gov (United States)

    2013-03-01

    In many regions throughout the world, freight models are used to aid infrastructure investment and : policy decisions. Since freight is such an integral part of efficient supply chains, more realistic : transportation models can be of greater assista...

  3. Writing on polymer chains.

    Science.gov (United States)

    Lutz, Jean-François

    2013-11-19

    Synthetic polymer materials are currently limited by their inability to store information in their chains, unlike some well-characterized biopolymers. Nucleic acids store and transmit genetic information, and amino acids encode the complex tridimensional structures and functions within proteins. To confer similar properties on synthetic materials, researchers must develop"writing" mechanisms, facile chemical pathways that allow control over the primary structure of synthetic polymer chains. The most obvious way to control the primary structure is to connect monomer units one-by-one in a given order using iterative chemistry. Although such synthesis strategies are commonly used to produce peptides and nucleic acids, they produce limited yields and are much slower than natural polymerization mechanisms. An alternative strategy would be to use multiblock copolymers with blocks that have specified sequences. In this case, however, the basic storage element is not a single molecular unit, but a longer block composed of several repeating units. However, the synthesis of multiblock copolymers is long and tedious. Therefore, researchers will need to develop other strategies for writing information onto polymer chains. In this Account, I describe our recent progress in the development of sequence controlled polymerization methods. Although our research focuses on different strategies, we have emphasized sequence-regulation in chain-growth polymerization processes. Chain-growth polymerizations, particularly radical polymerization, are very convenient methods for synthesizing polymers. However, in most cases, such approaches do not lead to controlled monomer sequences. During the last five years, we have shown that controlled/living chain-growth polymerization mechanisms offer interesting advantages for sequence regulation. In such mechanisms, the chains form gradually over time, and therefore the primary structure can be tuned by using time-controlled monomer additions. For

  4. Sputtering yield calculation for binary target

    International Nuclear Information System (INIS)

    Jimenez-Rodriguez, J.J.; Rodriguez-Vidal, M.; Valles-Abarca, J.A.

    1979-01-01

    The generalization for binary targets, of the ideas proposed by Sigmund for monoatomic targets, leads to a set of coupled intergrodifferential equations for the sputtering functions. After moment decomposition, the final formulae are obtained by the standard method based on the Laplace Transform, where the inverse transform is made with the aid of asymptotic expansions in the limit of very high projectile energy as compared to the surface binding energy. The possible loss of stoichiometry for binary targets is analyzed. Comparison of computed values of sputtering yield for normal incidence, with experimental results shows good agreement. (author)

  5. Binary Sparse Phase Retrieval via Simulated Annealing

    Directory of Open Access Journals (Sweden)

    Wei Peng

    2016-01-01

    Full Text Available This paper presents the Simulated Annealing Sparse PhAse Recovery (SASPAR algorithm for reconstructing sparse binary signals from their phaseless magnitudes of the Fourier transform. The greedy strategy version is also proposed for a comparison, which is a parameter-free algorithm. Sufficient numeric simulations indicate that our method is quite effective and suggest the binary model is robust. The SASPAR algorithm seems competitive to the existing methods for its efficiency and high recovery rate even with fewer Fourier measurements.

  6. A simple model for binary star evolution

    International Nuclear Information System (INIS)

    Whyte, C.A.; Eggleton, P.P.

    1985-01-01

    A simple model for calculating the evolution of binary stars is presented. Detailed stellar evolution calculations of stars undergoing mass and energy transfer at various rates are reported and used to identify the dominant physical processes which determine the type of evolution. These detailed calculations are used to calibrate the simple model and a comparison of calculations using the detailed stellar evolution equations and the simple model is made. Results of the evolution of a few binary systems are reported and compared with previously published calculations using normal stellar evolution programs. (author)

  7. Testing the Binary Black Hole Nature of a Compact Binary Coalescence.

    Science.gov (United States)

    Krishnendu, N V; Arun, K G; Mishra, Chandra Kant

    2017-09-01

    We propose a novel method to test the binary black hole nature of compact binaries detectable by gravitational wave (GW) interferometers and, hence, constrain the parameter space of other exotic compact objects. The spirit of the test lies in the "no-hair" conjecture for black holes where all properties of a Kerr black hole are characterized by its mass and spin. The method relies on observationally measuring the quadrupole moments of the compact binary constituents induced due to their spins. If the compact object is a Kerr black hole (BH), its quadrupole moment is expressible solely in terms of its mass and spin. Otherwise, the quadrupole moment can depend on additional parameters (such as the equation of state of the object). The higher order spin effects in phase and amplitude of a gravitational waveform, which explicitly contains the spin-induced quadrupole moments of compact objects, hence, uniquely encode the nature of the compact binary. Thus, we argue that an independent measurement of the spin-induced quadrupole moment of the compact binaries from GW observations can provide a unique way to distinguish binary BH systems from binaries consisting of exotic compact objects.

  8. The fate of close encounters between binary stars and binary supermassive black holes

    Science.gov (United States)

    Wang, Yi-Han; Leigh, Nathan; Yuan, Ye-Fei; Perna, Rosalba

    2018-04-01

    The evolution of main-sequence binaries that reside in the Galactic Centre can be heavily influenced by the central supermassive black hole (SMBH). Due to these perturbative effects, the stellar binaries in dense environments are likely to experience mergers, collisions, or ejections through secular and/or non-secular interactions. More direct interactions with the central SMBH are thought to produce hypervelocity stars (HVSs) and tidal disruption events (TDEs). In this paper, we use N-body simulations to study the dynamics of stellar binaries orbiting a central SMBH primary with an outer SMBH secondary orbiting this inner triple. The effects of the secondary SMBH on the event rates of HVSs, TDEs, and stellar mergers are investigated, as a function of the SMBH-SMBH binary mass ratio. Our numerical experiments reveal that, relative to the isolated SMBH case, the TDE and HVS rates are enhanced for, respectively, the smallest and largest mass ratio SMBH-SMBH binaries. This suggests that the observed event rates of TDEs and HVSs have the potential to serve as a diagnostic of the mass ratio of a central SMBH-SMBH binary. The presence of a secondary SMBH also allows for the creation of hypervelocity binaries. Observations of these systems could thus constrain the presence of a secondary SMBH in the Galactic Centre.

  9. Innovation Across the Supply Chain

    DEFF Research Database (Denmark)

    Druehl, Cheryl; Carrillo, Janice; Hsuan, Juliana

    Innovation is an integral part of every firm’s ongoing operations. Beyond product innovation, supply chain innovations offer a unique source of competitive advantage. We synthesize recent research on innovation in the supply chain, specifically, innovative supply chain processes...

  10. BINARIES MIGRATING IN A GASEOUS DISK: WHERE ARE THE GALACTIC CENTER BINARIES?

    International Nuclear Information System (INIS)

    Baruteau, C.; Lin, D. N. C.; Cuadra, J.

    2011-01-01

    The massive stars in the Galactic center inner arcsecond share analogous properties with the so-called Hot Jupiters. Most of these young stars have highly eccentric orbits and were probably not formed in situ. It has been proposed that these stars acquired their current orbits from the tidal disruption of compact massive binaries scattered toward the proximity of the central supermassive black hole. Assuming a binary star formed in a thin gaseous disk beyond 0.1 pc from the central object, we investigate the relevance of disk-satellite interactions to harden the binding energy of the binary, and to drive its inward migration. A massive, equal-mass binary star is found to become more tightly wound as it migrates inward toward the central black hole. The migration timescale is very similar to that of a single-star satellite of the same mass. The binary's hardening is caused by the formation of spiral tails lagging the stars inside the binary's Hill radius. We show that the hardening timescale is mostly determined by the mass of gas inside the binary's Hill radius and that it is much shorter than the migration timescale. We discuss some implications of the binary's hardening process. When the more massive (primary) components of close binaries eject most their mass through supernova explosion, their secondary stars may attain a range of eccentricities and inclinations. Such processes may provide an alternative unified scenario for the origin of the kinematic properties of the central cluster and S-stars in the Galactic center as well as the high-velocity stars in the Galactic halo.

  11. Neutron-Star-Black-Hole Binaries Produced by Binary-Driven Hypernovae.

    Science.gov (United States)

    Fryer, Chris L; Oliveira, F G; Rueda, J A; Ruffini, R

    2015-12-04

    Binary-driven hypernovae (BdHNe) within the induced gravitational collapse paradigm have been introduced to explain energetic (E_{iso}≳10^{52}  erg), long gamma-ray bursts (GRBs) associated with type Ic supernovae (SNe). The progenitor is a tight binary composed of a carbon-oxygen (CO) core and a neutron-star (NS) companion, a subclass of the newly proposed "ultrastripped" binaries. The CO-NS short-period orbit causes the NS to accrete appreciable matter from the SN ejecta when the CO core collapses, ultimately causing it to collapse to a black hole (BH) and producing a GRB. These tight binaries evolve through the SN explosion very differently than compact binaries studied in population synthesis calculations. First, the hypercritical accretion onto the NS companion alters both the mass and the momentum of the binary. Second, because the explosion time scale is on par with the orbital period, the mass ejection cannot be assumed to be instantaneous. This dramatically affects the post-SN fate of the binary. Finally, the bow shock created as the accreting NS plows through the SN ejecta transfers angular momentum, braking the orbit. These systems remain bound even if a large fraction of the binary mass is lost in the explosion (well above the canonical 50% limit), and even large kicks are unlikely to unbind the system. Indeed, BdHNe produce a new family of NS-BH binaries unaccounted for in current population synthesis analyses and, although they may be rare, the fact that nearly 100% remain bound implies that they may play an important role in the compact merger rate, important for gravitational waves that, in turn, can produce a new class of ultrashort GRBs.

  12. A Novel Simulation Method for Binary Discrete Exponential Families, with Application to Social Networks.

    Science.gov (United States)

    Butts, Carter T

    Stochastic models for finite binary vectors are widely used in sociology, with examples ranging from social influence models on dichotomous behaviors or attitudes to models for random graphs. Exact sampling for such models is difficult in the presence of dependence, leading to the use of Markov chain Monte Carlo (MCMC) as an approximation technique. While often effective, MCMC methods have variable execution time, and the quality of the resulting draws can be difficult to assess. Here, we present a novel alternative method for approximate sampling from binary discrete exponential families having fixed execution time and well-defined quality guarantees. We demonstrate the use of this sampling procedure in the context of random graph generation, with an application to the simulation of a large-scale social network using both geographical covariates and dyadic dependence mechanisms.

  13. The Tarantula Massive Binary Monitoring. I. Observational campaign and OB-type spectroscopic binaries

    Science.gov (United States)

    Almeida, L. A.; Sana, H.; Taylor, W.; Barbá, R.; Bonanos, A. Z.; Crowther, P.; Damineli, A.; de Koter, A.; de Mink, S. E.; Evans, C. J.; Gieles, M.; Grin, N. J.; Hénault-Brunet, V.; Langer, N.; Lennon, D.; Lockwood, S.; Maíz Apellániz, J.; Moffat, A. F. J.; Neijssel, C.; Norman, C.; Ramírez-Agudelo, O. H.; Richardson, N. D.; Schootemeijer, A.; Shenar, T.; Soszyński, I.; Tramper, F.; Vink, J. S.

    2017-02-01

    Context. Massive binaries play a crucial role in the Universe. Knowing the distributions of their orbital parameters is important for a wide range of topics from stellar feedback to binary evolution channels and from the distribution of supernova types to gravitational wave progenitors, yet no direct measurements exist outside the Milky Way. Aims: The Tarantula Massive Binary Monitoring project was designed to help fill this gap by obtaining multi-epoch radial velocity (RV) monitoring of 102 massive binaries in the 30 Doradus region. Methods: In this paper we analyze 32 FLAMES/GIRAFFE observations of 93 O- and 7 B-type binaries. We performed a Fourier analysis and obtained orbital solutions for 82 systems: 51 single-lined (SB1) and 31 double-lined (SB2) spectroscopic binaries. Results: Overall, the binary fraction and orbital properties across the 30 Doradus region are found to be similar to existing Galactic samples. This indicates that within these domains environmental effects are of second order in shaping the properties of massive binary systems. A small difference is found in the distribution of orbital periods, which is slightly flatter (in log space) in 30 Doradus than in the Galaxy, although this may be compatible within error estimates and differences in the fitting methodology. Also, orbital periods in 30 Doradus can be as short as 1.1 d, somewhat shorter than seen in Galactic samples. Equal mass binaries (q> 0.95) in 30 Doradus are all found outside NGC 2070, the central association that surrounds R136a, the very young and massive cluster at 30 Doradus's core. Most of the differences, albeit small, are compatible with expectations from binary evolution. One outstanding exception, however, is the fact that earlier spectral types (O2-O7) tend to have shorter orbital periods than later spectral types (O9.2-O9.7). Conclusions: Our results point to a relative universality of the incidence rate of massive binaries and their orbital properties in the

  14. A coinductive calculus of binary trees

    NARCIS (Netherlands)

    A.M. Silva (Alexandra); J.J.M.M. Rutten (Jan)

    2007-01-01

    htmlabstractWe study the set T_A of infinite binary trees with nodes labelled in a semiring A from a coalgebraic perspective. We present coinductive definition and proof principles based on the fact that T_A carries a final coalgebra structure. By viewing trees as formal power series, we develop a

  15. ANGULAR-MOMENTUM IN BINARY SPIRAL GALAXIES

    NARCIS (Netherlands)

    OOSTERLOO, T

    In order to investigate the relative orientations of spiral galaxies in pairs, the distribution of the angle between the spin-vectors for a new sample of 40 binary spiral galaxies is determined. From this distribution it is found, contrary to an earlier result obtained by Helou (1984), that there is

  16. Short-timescale variability in cataclysmic binaries

    International Nuclear Information System (INIS)

    Cordova, F.A.; Mason, K.O.

    1982-01-01

    Rapid variability, including flickering and pulsations, has been detected in cataclysmic binaries at optical and x-ray frequencies. In the case of the novalike variable TT Arietis, simultaneous observations reveal that the x-ray and optical flickering activity is strongly correlated, while short period pulsations are observed that occur at the same frequencies in both wavelength bands

  17. Binary palmprint representation for feature template protection

    NARCIS (Netherlands)

    Mu, Meiru; Ruan, Qiuqi; Shao, X.; Spreeuwers, Lieuwe Jan; Veldhuis, Raymond N.J.

    2012-01-01

    The major challenge of biometric template protection comes from the intraclass variations of biometric data. The helper data scheme aims to solve this problem by employing the Error Correction Codes (ECC). However, many reported biometric binary features from the same user reach bit error rate (BER)

  18. Binary translation using peephole translation rules

    Science.gov (United States)

    Bansal, Sorav; Aiken, Alex

    2010-05-04

    An efficient binary translator uses peephole translation rules to directly translate executable code from one instruction set to another. In a preferred embodiment, the translation rules are generated using superoptimization techniques that enable the translator to automatically learn translation rules for translating code from the source to target instruction set architecture.

  19. Receptive fields selection for binary feature description.

    Science.gov (United States)

    Fan, Bin; Kong, Qingqun; Trzcinski, Tomasz; Wang, Zhiheng; Pan, Chunhong; Fua, Pascal

    2014-06-01

    Feature description for local image patch is widely used in computer vision. While the conventional way to design local descriptor is based on expert experience and knowledge, learning-based methods for designing local descriptor become more and more popular because of their good performance and data-driven property. This paper proposes a novel data-driven method for designing binary feature descriptor, which we call receptive fields descriptor (RFD). Technically, RFD is constructed by thresholding responses of a set of receptive fields, which are selected from a large number of candidates according to their distinctiveness and correlations in a greedy way. Using two different kinds of receptive fields (namely rectangular pooling area and Gaussian pooling area) for selection, we obtain two binary descriptors RFDR and RFDG .accordingly. Image matching experiments on the well-known patch data set and Oxford data set demonstrate that RFD significantly outperforms the state-of-the-art binary descriptors, and is comparable with the best float-valued descriptors at a fraction of processing time. Finally, experiments on object recognition tasks confirm that both RFDR and RFDG successfully bridge the performance gap between binary descriptors and their floating-point competitors.

  20. Flip-flopping binary black holes.

    Science.gov (United States)

    Lousto, Carlos O; Healy, James

    2015-04-10

    We study binary spinning black holes to display the long term individual spin dynamics. We perform a full numerical simulation starting at an initial proper separation of d≈25M between equal mass holes and evolve them down to merger for nearly 48 orbits, 3 precession cycles, and half of a flip-flop cycle. The simulation lasts for t=20 000M and displays a total change in the orientation of the spin of one of the black holes from an initial alignment with the orbital angular momentum to a complete antialignment after half of a flip-flop cycle. We compare this evolution with an integration of the 3.5 post-Newtonian equations of motion and spin evolution to show that this process continuously flip flops the spin during the lifetime of the binary until merger. We also provide lower order analytic expressions for the maximum flip-flop angle and frequency. We discuss the effects this dynamics may have on spin growth in accreting binaries and on the observational consequences for galactic and supermassive binary black holes.

  1. Predicting Social Trust with Binary Logistic Regression

    Science.gov (United States)

    Adwere-Boamah, Joseph; Hufstedler, Shirley

    2015-01-01

    This study used binary logistic regression to predict social trust with five demographic variables from a national sample of adult individuals who participated in The General Social Survey (GSS) in 2012. The five predictor variables were respondents' highest degree earned, race, sex, general happiness and the importance of personally assisting…

  2. Compiler-Agnostic Function Detection in Binaries

    NARCIS (Netherlands)

    Andriesse, D.A.; Slowinska, J.M.; Bos, H.J.

    2017-01-01

    We propose Nucleus, a novel function detection algorithm for binaries. In contrast to prior work, Nucleus is compiler-agnostic, and does not require any learning phase or signature information. Instead of scanning for signatures, Nucleus detects functions at the Control Flow Graph-level, making it

  3. Non-binary or genderqueer genders.

    Science.gov (United States)

    Richards, Christina; Bouman, Walter Pierre; Seal, Leighton; Barker, Meg John; Nieder, Timo O; T'Sjoen, Guy

    2016-01-01

    Some people have a gender which is neither male nor female and may identify as both male and female at one time, as different genders at different times, as no gender at all, or dispute the very idea of only two genders. The umbrella terms for such genders are 'genderqueer' or 'non-binary' genders. Such gender identities outside of the binary of female and male are increasingly being recognized in legal, medical and psychological systems and diagnostic classifications in line with the emerging presence and advocacy of these groups of people. Population-based studies show a small percentage--but a sizable proportion in terms of raw numbers--of people who identify as non-binary. While such genders have been extant historically and globally, they remain marginalized, and as such--while not being disorders or pathological in themselves--people with such genders remain at risk of victimization and of minority or marginalization stress as a result of discrimination. This paper therefore reviews the limited literature on this field and considers ways in which (mental) health professionals may assist the people with genderqueer and non-binary gender identities and/or expressions they may see in their practice. Treatment options and associated risks are discussed.

  4. Planar quark diagrams and binary spin processes

    International Nuclear Information System (INIS)

    Grigoryan, A.A.; Ivanov, N.Ya.

    1986-01-01

    Contributions of planar diagrams to the binary scattering processes are analyzed. The analysis is based on the predictions of quark-gluon picture of strong interactions for the coupling of reggeons with quarks as well as on the SU(6)-classification of hadrons. The dependence of contributions of nonplanar corrections on spins and quark composition of interacting particles is discussed

  5. Binary nucleation of water and sodium chloride

    Czech Academy of Sciences Publication Activity Database

    Němec, Tomáš; Maršík, František; Palmer, A.

    2006-01-01

    Roč. 124, č. 4 (2006), 0445091-0445096 ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA101/05/2536 Institutional research plan: CEZ:AV0Z20760514 Keywords : binary nucleation * sodium chloride * water Subject RIV: BJ - Thermodynamics Impact factor: 3.166, year: 2006

  6. The average size of ordered binary subgraphs

    NARCIS (Netherlands)

    van Leeuwen, J.; Hartel, Pieter H.

    To analyse the demands made on the garbage collector in a graph reduction system, the change in size of an average graph is studied when an arbitrary edge is removed. In ordered binary trees the average number of deleted nodes as a result of cutting a single edge is equal to the average size of a

  7. Void formation in irradiated binary nickel alloys

    International Nuclear Information System (INIS)

    Shaikh, M.A.; Ahmed, M.; Akhter, J.I.

    1994-01-01

    In this work a computer program has been used to compute void radius, void density and swelling parameter for nickel and binary nickel-carbon alloys irradiated with nickel ions of 100 keV. The aim is to compare the computed results with experimental results already reported

  8. The Benchmark Eclipsing Binary V530 Ori

    DEFF Research Database (Denmark)

    Torres, Guillermo; Lacy, Claud H. Sandberg; Pavlovski, Kresimir

    2015-01-01

    We report accurate measurements of the physical properties (mass, radius, temperature) of components of the G+M eclipsing binary V530 On. The M-type secondary shows a larger radius and a cooler temperature than predicted by standard stellar evolution models, as has been found for many other low...

  9. Chain conformation-dependent thermal conductivity of amorphous polymer blends: the impact of inter- and intra-chain interactions.

    Science.gov (United States)

    Wei, Xingfei; Zhang, Teng; Luo, Tengfei

    2016-11-30

    Polymers with high thermal conductivities are of great interest for both scientific research and industrial applications. In this study, model amorphous polymer blends are studied using molecular dynamics simulations. We have examined the effects of inter- and intra-chain interactions on the molecular-level conformations of the blends, which in turn impact their thermal conductivity. It is found that the thermal conductivity of polymer blends is strongly related to the molecular conformation, especially the spatial extent of the molecular chains indicated by their radius of gyration. Tuning the intra-chain van der Waals (vdW) interaction leads to different molecular structures of the minor component in the binary blend, but the thermal conductivity is not changed. However, increasing the inter-chain vdW interactions between the major and the minor components will increase the thermal conductivity of the blend, which is due to the conformation change in the major component that leads to enhanced thermal transport along the chain backbone through the intra-chain bonding interactions. The fundamental structure-property relationship from this study may provide useful guidance for designing and synthesizing polymer blends with desirable thermal conductivity.

  10. Terrestrial Planet Formation Around Individual Stars Within Binary Star Systems

    OpenAIRE

    Quintana, Elisa V.; Adams, Fred C.; Lissauer, Jack J.; Chambers, John E.

    2007-01-01

    We calculate herein the late stages of terrestrial planet accumulation around a solar type star that has a binary companion with semimajor axis larger than the terrestrial planet region. We perform more than one hundred simulations to survey binary parameter space and to account for sensitive dependence on initial conditions in these dynamical systems. As expected, sufficiently wide binaries leave the planet formation process largely unaffected. As a rough approximation, binary stars with per...

  11. Orbital synchronization capture of two binaries emitting gravitational waves

    Science.gov (United States)

    Seto, Naoki

    2018-03-01

    We study the possibility of orbital synchronization capture for a hierarchical quadrupole stellar system composed by two binaries emitting gravitational waves. Based on a simple model including the mass transfer for white dwarf binaries, we find that the capture might be realized for inter-binary distances less than their gravitational wavelength. We also discuss related intriguing phenomena such as a parasitic relation between the coupled white dwarf binaries and significant reductions of gravitational and electromagnetic radiations.

  12. Influence of non-binary effects on intranuclear cascade method

    International Nuclear Information System (INIS)

    Gomes, E.H.C.

    1985-01-01

    The importance of non binary process effects in the intranuclear cascade method is analysed. It is shown that, in the higher density steps, the non binary collisions lead to baryon density distribution and rapidity differents from the one obtained using the usual intranuclear cascade method (limited to purely binary collisions). The validity of the applications of binary intranuclear cascade method to the simulation of the thermal equilibrium, nuclear transparency and particle production, is discussed. (M.C.K.) [pt

  13. Gravitational waves from spinning eccentric binaries

    Science.gov (United States)

    Csizmadia, Péter; Debreczeni, Gergely; Rácz, István; Vasúth, Mátyás

    2012-12-01

    This paper is to introduce a new software called CBwaves which provides a fast and accurate computational tool to determine the gravitational waveforms yielded by generic spinning binaries of neutron stars and/or black holes on eccentric orbits. This is done within the post-Newtonian (PN) framework by integrating the equations of motion and the spin precession equations, while the radiation field is determined by a simultaneous evaluation of the analytic waveforms. In applying CBwaves various physically interesting scenarios have been investigated. In particular, we have studied the appropriateness of the adiabatic approximation, and justified that the energy balance relation is indeed insensitive to the specific form of the applied radiation reaction term. By studying eccentric binary systems, it is demonstrated that circular template banks are very ineffective in identifying binaries even if they possess tiny residual orbital eccentricity, thus confirming a similar result obtained by Brown and Zimmerman (2010 Phys. Rev. D 81 024007). In addition, by investigating the validity of the energy balance relation we show that, contrary to the general expectations, the PN approximation should not be applied once the PN parameter gets beyond the critical value ˜0.08 - 0.1. Finally, by studying the early phase of the gravitational waves emitted by strongly eccentric binary systems—which could be formed e.g. in various many-body interactions in the galactic halo—we have found that they possess very specific characteristics which may be used to identify these type of binary systems. This paper is dedicated to the memory of our colleague and friend Péter Csizmadia a young physicist, computer expert and one of the best Hungarian mountaineers who disappeared in China’s Sichuan near the Ren Zhong Feng peak of the Himalayas on 23 Oct. 2009. We started to develop CBwaves jointly with Péter a couple of months before he left for China.

  14. Probabilistic seismic history matching using binary images

    Science.gov (United States)

    Davolio, Alessandra; Schiozer, Denis Jose

    2018-02-01

    Currently, the goal of history-matching procedures is not only to provide a model matching any observed data but also to generate multiple matched models to properly handle uncertainties. One such approach is a probabilistic history-matching methodology based on the discrete Latin Hypercube sampling algorithm, proposed in previous works, which was particularly efficient for matching well data (production rates and pressure). 4D seismic (4DS) data have been increasingly included into history-matching procedures. A key issue in seismic history matching (SHM) is to transfer data into a common domain: impedance, amplitude or pressure, and saturation. In any case, seismic inversions and/or modeling are required, which can be time consuming. An alternative to avoid these procedures is using binary images in SHM as they allow the shape, rather than the physical values, of observed anomalies to be matched. This work presents the incorporation of binary images in SHM within the aforementioned probabilistic history matching. The application was performed with real data from a segment of the Norne benchmark case that presents strong 4D anomalies, including softening signals due to pressure build up. The binary images are used to match the pressurized zones observed in time-lapse data. Three history matchings were conducted using: only well data, well and 4DS data, and only 4DS. The methodology is very flexible and successfully utilized the addition of binary images for seismic objective functions. Results proved the good convergence of the method in few iterations for all three cases. The matched models of the first two cases provided the best results, with similar well matching quality. The second case provided models presenting pore pressure changes according to the expected dynamic behavior (pressurized zones) observed on 4DS data. The use of binary images in SHM is relatively new with few examples in the literature. This work enriches this discussion by presenting a new

  15. Characterizing chain-compact and chain-finite topological semilattices

    OpenAIRE

    Banakh, Taras; Bardyla, Serhii

    2017-01-01

    In the paper we present various characterizations of chain-compact and chain-finite topological semilattices. A topological semilattice $X$ is called chain-compact (resp. chain-finite) if each closed chain in $X$ is compact (finite). In particular, we prove that a (Hausdorff) $T_1$-topological semilattice $X$ is chain-finite (chain-compact) if and only if for any closed subsemilattice $Z\\subset X$ and any continuous homomorphism $h:X\\to Y$ to a (Hausdorff) $T_1$-topological semilattice $Y$ th...

  16. Rapid method for interconversion of binary and decimal numbers

    Science.gov (United States)

    Lim, R. S.

    1970-01-01

    Decoding tree consisting of 40-bit semiconductor read-only memories interconverts binary and decimal numbers 50 to 100 times faster than current methods. Decimal-to-binary conversion algorithm is based on a divided-by-2 iterative equation, binary-to-decimal conversion algorithm utilizes multiplied-by-2 iterative equation.

  17. Binary interaction dominates the evolution of massive stars

    NARCIS (Netherlands)

    Sana, H.; de Mink, S.E.; de Koter, A.; Langer, N.; Evans, C.J.; Gieles, M.; Gosset, E.; Izzard, R.G.; Le Bouquin, J.-B.; Schneider, F.R.N.

    2012-01-01

    The presence of a nearby companion alters the evolution of massive stars in binary systems, leading to phenomena such as stellar mergers, x-ray binaries, and gamma-ray bursts. Unambiguous constraints on the fraction of massive stars affected by binary interaction were lacking. We simultaneously

  18. Microlensing Binaries Discovered through High-magnification Channel

    DEFF Research Database (Denmark)

    Shin, I.-G.; Choi, J.-Y.; Park, S.-Y.

    2012-01-01

    Microlensing can provide a useful tool to probe binary distributions down to low-mass limits of binary companions. In this paper, we analyze the light curves of eight binary-lensing events detected through the channel of high-magnification events during the seasons from 2007 to 2010. The perturba...

  19. Compact stars and the evolution of binary systems

    NARCIS (Netherlands)

    van den Heuvel, E.P.J.

    2011-01-01

    The Chandrasekhar limit is of key importance for the evolution of white dwarfs in binary systems and for the formation of neutron stars and black holes in binaries. Mass transfer can drive a white dwarf in a binary over the Chandrasekhar limit, which may lead to a Type Ia supernova (in case of a CO

  20. Chain Mixing and Chain Recurrent Iterated Function Systems

    OpenAIRE

    Nia, Mehdi Fatehi

    2016-01-01

    This paper considers the egodicity properties in iterated function systems. First, we will introduce chain mixing and chain transitive iterated function systems then some results and examples are presented to compare with these notions in discrete dynamical systems. As our main result, using adding machine maps and topological conjugacy we show that chain mixing, chain transitive and chain recurrence properties in iterated function systems are equivalent.

  1. A decoding method of an n length binary BCH code through (n + 1n length binary cyclic code

    Directory of Open Access Journals (Sweden)

    TARIQ SHAH

    2013-09-01

    Full Text Available For a given binary BCH code Cn of length n = 2 s - 1 generated by a polynomial of degree r there is no binary BCH code of length (n + 1n generated by a generalized polynomial of degree 2r. However, it does exist a binary cyclic code C (n+1n of length (n + 1n such that the binary BCH code Cn is embedded in C (n+1n . Accordingly a high code rate is attained through a binary cyclic code C (n+1n for a binary BCH code Cn . Furthermore, an algorithm proposed facilitates in a decoding of a binary BCH code Cn through the decoding of a binary cyclic code C (n+1n , while the codes Cn and C (n+1n have the same minimum hamming distance.

  2. Supply chain quality management

    Directory of Open Access Journals (Sweden)

    Hannan Amoozad Mahdiraji

    2012-10-01

    Full Text Available In recent years, there are several methods introduced for the improvement of operational performances. Total quality management and supply chain management are two methods recommended for this purpose. These two approaches have been studied in most researches separately, while they have objectives in common, and this makes them a strategic means, which can be used, simultaneously. Total quality management and supply chain management play significant roles to increase the organizational competitiveness power. Moreover, they have only one purpose that is customer satisfaction, and they are different only on their approaches to reach their objectives. In this research, we aim to study both approaches of quality management and supply chain, their positive increasing effects that may be generated after their integration. For this purpose, the concept and definitions of each approach is studied, independently, their similarities and differences are recognized, and finally, the advantages of their integration are introduced.

  3. Supply-Chain Optimization Template

    Science.gov (United States)

    Quiett, William F.; Sealing, Scott L.

    2009-01-01

    The Supply-Chain Optimization Template (SCOT) is an instructional guide for identifying, evaluating, and optimizing (including re-engineering) aerospace- oriented supply chains. The SCOT was derived from the Supply Chain Council s Supply-Chain Operations Reference (SCC SCOR) Model, which is more generic and more oriented toward achieving a competitive advantage in business.

  4. Essentials of supply chain management

    CERN Document Server

    Hugos, Michael H

    2011-01-01

    The latest thinking, strategies, developments, and technologies to stay current in supply chain management Presenting the core concepts and techniques of supply chain management in a clear, concise and easily readable style, the Third Edition of Essentials of Supply Chain Management outlines the most crucial tenets and concepts of supply chain management.

  5. Shared Value Chain Design

    DEFF Research Database (Denmark)

    Bals, Lydia; Tate, Wendy L.

    In Sustainable Supply Chain Management (SSCM) research still the classic economic perspective is the dominating perspective, although the triple bottom line (including economic, social and ecological) is well accepted. The theoretical foundation for the paper is Stakeholder Theory. Case studies...... of social businesses funded by the Germany-based company Yunus Social Business (YSB; http://www.yunussb.com) are presented, extracting the basic model types and how they involve and affect the stakeholders. These models reveal innovative approaches to enable positive economic, social and ecological impacts...... in local communities, fundamentally changing supply chains....

  6. METRODOS: Meteorological preprocessor chain

    DEFF Research Database (Denmark)

    Astrup, P.; Mikkelsen, T.; Deme, S.

    2001-01-01

    The METRODOS meteorological preprocessor chain combines measured tower data and coarse grid numerical weather prediction (NWP) data with local scale flow models and similarity scaling to give high resolution approximations of the meteorological situation. Based on available wind velocity...... - heat flux related measurement, e.g. a temperature gradient, are used to give local values of friction velocity and Monin-Obukhov length plus an estimate of the mixing height. The METRODOS meteorological preprocessor chain is an integral part of the RODOS - Real Time On Line Decision Support - program...

  7. Nuclear safety chains

    International Nuclear Information System (INIS)

    Robbins, M.C.; Eames, G.F.; Mayell, J.R.

    1981-01-01

    An original scheme has been developed for expressing the complex interrelationships associated with the engineered safeguards provided for a nuclear power station. This management tool, based upon network diagrams called Nuclear Safety Chains, looks at the function required of a particular item of safety plant, defines all of the vital supplies and support features necessary for successful operation, and expresses them in visual form, to facilitate analysis and optimisation for operations and maintenance staff. The safety chains are confined to manual schemes at present, although they are designed to be compatible with modern computer techniques. Their usefulness with any routine maintenance planning application on high technology plant is already being appreciated. (author)

  8. VISCOSITY OF BINARY NON-ELECTROLYTE LIQUID MIXTURES: PREDICTION AND CORRELATION

    Directory of Open Access Journals (Sweden)

    Mirjana Lj. Kijevčanin

    2008-11-01

    Full Text Available The viscosity of 31 binary liquid mixtures containing diverse groups of organic compounds, determined at atmospheric pressure: alcohols, alkanes (cyclo and aliphatic, esters, aromatics, ketones etc., were calculated using two different approaches, correlative (with Teja-Rice and McAllister models and predictive by group contribution models (UNIFAC-VISCO, ASOG-VISCO and Grunberg-Nissan. The obtained results were analysed in terms of the applied approach and model, the structure of the investigated mixtures, the nature of components of the mixtures and the influence of alkyl chain length of the alcohol molecule.

  9. Integrated supply chain risk management

    Directory of Open Access Journals (Sweden)

    Riaan Bredell

    2007-11-01

    Full Text Available Integrated supply chain risk management (ISCRM has become indispensable to the theory and practice of supply chain management. The economic and political realities of the modern world require not only a different approach to supply chain management, but also bold steps to secure supply chain performance and sustainable wealth creation. Integrated supply chain risk management provides supply chain organisations with a level of insight into their supply chains yet to be achieved. If correctly applied, this process may optimise management decision-making and assist in the protection and enhancement of shareholder value.

  10. Exploration Supply Chain Simulation

    Science.gov (United States)

    2008-01-01

    The Exploration Supply Chain Simulation project was chartered by the NASA Exploration Systems Mission Directorate to develop a software tool, with proper data, to quantitatively analyze supply chains for future program planning. This tool is a discrete-event simulation that uses the basic supply chain concepts of planning, sourcing, making, delivering, and returning. This supply chain perspective is combined with other discrete or continuous simulation factors. Discrete resource events (such as launch or delivery reviews) are represented as organizational functional units. Continuous resources (such as civil service or contractor program functions) are defined as enabling functional units. Concepts of fixed and variable costs are included in the model to allow the discrete events to interact with cost calculations. The definition file is intrinsic to the model, but a blank start can be initiated at any time. The current definition file is an Orion Ares I crew launch vehicle. Parameters stretch from Kennedy Space Center across and into other program entities (Michaud Assembly Facility, Aliant Techsystems, Stennis Space Center, Johnson Space Center, etc.) though these will only gain detail as the file continues to evolve. The Orion Ares I file definition in the tool continues to evolve, and analysis from this tool is expected in 2008. This is the first application of such business-driven modeling to a NASA/government-- aerospace contractor endeavor.

  11. Improved chain control operations.

    Science.gov (United States)

    2010-01-01

    In California, field maintenance personnel use turntable signs to advise motorists of chain control conditions on rural : highways and freeways. To do this an operator has to park, exit the vehicle, turn the sign on the shoulder and then : walk acros...

  12. Polymerase chain reaction system

    Science.gov (United States)

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  13. Chain on a cone

    Directory of Open Access Journals (Sweden)

    Zubelevich Oleg

    2017-11-01

    Full Text Available We consider a loop of a chain thrown like a lasso on a fixed right circular cone. The system is in the standard homogeneous gravity field. The axis of the cone is vertical. It is shown that under certain vertex angles chain’s loop has an oblique equilibrium.

  14. Markov Chain Monte Carlo

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 7; Issue 3. Markov Chain Monte Carlo - Examples. Arnab Chakraborty. General Article Volume 7 Issue 3 March 2002 pp 25-34. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/007/03/0025-0034. Keywords.

  15. Supply Chain Costing

    DEFF Research Database (Denmark)

    Asmussen, Jesper Normann; Kristensen, Jesper; Wæhrens, Brian Vejrum

    Based Costing (ABC) på et forsyningskædeniveau – heri benævnt Supply Chain Costing (SCC). Udoverdefordelederfindesved ABCtilføjerSCCogså et økonomisk grundlag til det strategiske rationale, der ofte ligger bag opbygningen af virksomhedens forsyningskæde, og kan dermed medvirke til konkret...

  16. Innovation in Supply Chains

    DEFF Research Database (Denmark)

    Maier, Maximilian; Korbel, Jakob; Brem, Alexander

    2015-01-01

    . Moreover, along with the fourth industrial revolution – industry 4.0 – new technologies such as cyber physical systems are fast gaining popularity. Hence, based on the analysis of relevant literature, we further develop the supply chain committee model, developed by Kaluza et al. (2003) to demonstrate how...

  17. Economy, market and chain

    NARCIS (Netherlands)

    Sukkel, W.; Hommes, M.

    2009-01-01

    In their pursuit of growth and professionalisation, the Dutch organic sector focuses primarily on market development. But how do you stimulate the market for organic foods? This is the subject of many research projects concerning market, consumer preferences and the supply chain. These projects

  18. Supply Chain Management

    Science.gov (United States)

    Bauer, Jürgen

    Die Produktionslogistik hat im Rahmen der Materialbeschaffung und der Belieferung von externen Kunden vielfältige Beziehungen zu Lieferanten und Kunden. Im Ansatz des Supply Chain Managements (Lieferkettenmanagement), kurz auch als SCM bezeichnet, versucht man, sowohl Lieferanten als auch Kunden in die gesamte Logistikplanung zu integrieren. SCM umfasst dabei vor allem folgende Aufgaben: Bedarfs- und Bestandsplanung der Materialien entlang der Lieferkette

  19. Supply chain reliability modelling

    Directory of Open Access Journals (Sweden)

    Eugen Zaitsev

    2012-03-01

    Full Text Available Background: Today it is virtually impossible to operate alone on the international level in the logistics business. This promotes the establishment and development of new integrated business entities - logistic operators. However, such cooperation within a supply chain creates also many problems related to the supply chain reliability as well as the optimization of the supplies planning. The aim of this paper was to develop and formulate the mathematical model and algorithms to find the optimum plan of supplies by using economic criterion and the model for the probability evaluating of non-failure operation of supply chain. Methods: The mathematical model and algorithms to find the optimum plan of supplies were developed and formulated by using economic criterion and the model for the probability evaluating of non-failure operation of supply chain. Results and conclusions: The problem of ensuring failure-free performance of goods supply channel analyzed in the paper is characteristic of distributed network systems that make active use of business process outsourcing technologies. The complex planning problem occurring in such systems that requires taking into account the consumer's requirements for failure-free performance in terms of supply volumes and correctness can be reduced to a relatively simple linear programming problem through logical analysis of the structures. The sequence of the operations, which should be taken into account during the process of the supply planning with the supplier's functional reliability, was presented.

  20. Development Value Chains meet Business Supply Chains : The concept of Global Value Chains unraveled

    NARCIS (Netherlands)

    S. Drost (Sarah); J.C.A.C. van Wijk (Jeroen); S.R. Vellema (Sietze)

    2011-01-01

    textabstractValue chain promotion is considered a key element of private sector development strategies and pro-poor growth. However, (value) chain concepts are rather complex and unclear. This paper unravels the concept of global value chains and studies the diversity of key value chain-related

  1. Standard handbook of chains chains for power transmission and material handling

    CERN Document Server

    2005-01-01

    A BRIEF HISTORY OF THE DEVELOPMENT OF CHAINEarly DevelopmentsCog ChainCast Detachable ChainCast Pintle ChainPrecision Roller ChainEngineering Steel ChainSilent ChainFlat-Top ChainTerminologyA CHAIN OVERVIEW: USES AND ADVANTAGESGeneralTypes of ChainScope of Chains CoveredStyles and Forms of ChainsStraight and Offset Link ChainsChains With and Without RollersUses of ChainStandard Chains and Their UsesThe Advantages of Chains in ApplicationsAdvantages of Roller Chains in DrivesAdvantages of Silent Chain Drives

  2. Confusing Binaries: The Role of Stellar Binaries in Biasing Disk Properties in the Galactic Center

    Science.gov (United States)

    Naoz, Smadar; Ghez, Andrea M.; Hees, Aurelien; Do, Tuan; Witzel, Gunther; Lu, Jessica R.

    2018-02-01

    The population of young stars near the supermassive black hole (SMBH) in the Galactic Center (GC) has presented an unexpected challenge to theories of star formation. Kinematic measurements of these stars have revealed a stellar disk structure (with an apparent 20% disk membership) that has provided important clues regarding the origin of these mysterious young stars. However, many of the apparent disk properties are difficult to explain, including the low disk membership fraction and the high eccentricities given the youth of this population. Thus far, all efforts to derive the properties of this disk have made the simplifying assumption that stars at the GC are single stars. Nevertheless, stellar binaries are prevalent in our Galaxy, and recent investigations suggested that they may also be abundant in the Galactic Center. Here, we show that binaries in the disk can largely alter the apparent orbital properties of the disk. The motion of binary members around each other adds a velocity component, which can be comparable to the magnitude of the velocity around the SMBH in the GC. Thus, neglecting the contribution of binaries can significantly vary the inferred stars’ orbital properties. While the disk orientation is unaffected, the apparent disk’s 2D width will be increased to about 11.°2, similar to the observed width. For a population of stars orbiting the SMBH with zero eccentricity, unaccounted for binaries will create a wide apparent eccentricity distribution with an average of 0.23. This is consistent with the observed average eccentricity of the stars’ in the disk. We suggest that this high eccentricity value, which poses a theoretical challenge, may be an artifact of binary stars. Finally, our results suggest that the actual disk membership might be significantly higher than the one inferred by observations that ignore the contribution of binaries, alleviating another theoretical challenge.

  3. Performance analysis and binary working fluid selection of combined flash-binary geothermal cycle

    International Nuclear Information System (INIS)

    Zeyghami, Mehdi

    2015-01-01

    Performance of the combined flash-binary geothermal power cycle for geofluid temperatures between 150 and 250 °C is studied. A thermodynamic model is developed, and the suitable binary working fluids for different geofluid temperatures are identified from a list of thirty working fluid candidates, consisting environmental friendly refrigerants and hydrocarbons. The overall system exergy destruction and Vapor Expansion Ratio across the binary cycle turbine are selected as key performance indicators. The results show that for low-temperature heat sources using refrigerants as binary working fluids result in higher overall cycle efficiency and for medium and high-temperature resources, hydrocarbons are more suitable. For combined flash-binary cycle, secondary working fluids; R-152a, Butane and Cis-butane show the best performances at geofluid temperatures 150, 200 and 250 °C respectively. The overall second law efficiency is calculated as high as 0.48, 0.55 and 0.58 for geofluid temperatures equal 150, 200 and 250 °C respectively. The flash separator pressure found to has important effects on cycle operation and performance. Separator pressure dictates the work production share of steam and binary parts of the system. And there is an optimal separator pressure at which overall exergy destruction of the cycle achieves its minimum value. - Highlights: • Performance of the combined flash-binary geothermal cycle is investigated. • Thirty different fluids are screened to find the most suitable ORC working fluid. • Optimum cycle operation conditions presented for geofluids between 150 °C and 250 °C. • Refrigerants are more suitable for the ORC at geothermal sources temperature ≤200 °C. • Hydrocarbons are more suitable for the ORC at geothermal sources temperature >200 °C

  4. Complex Binary Number System Algorithms and Circuits

    CERN Document Server

    Jamil, Tariq

    2013-01-01

    This book is a compilation of the entire research work on the topic of Complex Binary Number System (CBNS) carried out by the author as the principal investigator and members of his research groups at various universities during the years 1992-2012. Pursuant to these efforts spanning several years, the realization of CBNS as a viable alternative to represent complex numbers in an 'all-in-one' binary number format has become possible and efforts are underway to build computer hardware based on this unique number system. It is hoped that this work will be of interest to anyone involved in computer arithmetic and digital logic design and kindle renewed enthusiasm among the engineers working in the areas of digital signal and image processing for developing newer and efficient algorithms and techniques incorporating CBNS.

  5. Studies of Long Period Eclipsing Binaries

    Science.gov (United States)

    Ratajczak, M.; Hełminiak, K. G.; Konacki, M.

    2015-07-01

    The survey of long period eclipsing binaries from the All Sky Automated Survey (ASAS) catalog aims at searching for and characterizing subgiants and red giants in double-lined detached binary systems. Absolute physical and orbital parameters are presented based on radial velocities from high-quality optical spectra obtained with the following telescope/instrument combinations: 8.2 m Subaru/HDS, ESO 3.6 m/HARPS, 1.9 m Radcliffe/GIRAFFE, CTIO 1.5 m/CHIRON, and 1.2 m Euler/CORALIE. Photometric data from ASAS, SuperWASP, and the Solaris Project were also used. We discuss the derived uncertainties for the individual masses and radii of the components (better than 3% for several systems), as well as results from the spectral analysis performed for components of systems whose spectra we disentangled.

  6. Kilonova Counterparts of Binary Neutron Star Mergers

    Science.gov (United States)

    Metzger, Brian

    2018-01-01

    The merger of a binary neutron star is accompanied by the ejection of neutron-rich matter into space at velocities up to several tenths that of light, which synthesizes rare heavy isotopes through the rapid neutron capture process (r-process). The radioactive decay of these nuclei was predicted by Metzger et al. (2010) to power an optical transient roughly 1000 times more luminous than a classical nova (a "kilonova"), which is among the most promising electromagnetic counterparts to accompany gravitational wave signal from the merger. I will describe how the luminosities, color, and spectra of the kilonova emission inform the properties of the merging binary (neutron star masses/radii and inclination angle) and the long sought origin of the heaviest elements in the Universe. Results will be discussed in the context of recent discoveries by Advanced LIGO/Virgo.

  7. On the dynamics of binary galaxies

    International Nuclear Information System (INIS)

    Verner, D.A.; Chernin, A.D.

    1987-01-01

    The dynamics of close noncontact binary galaxies is investigated. It is demonsrated that the tidal interaction is ineffective for circularization of galaxy orbits. Nonsphericity of galaxies develops a torque in a binary system. For a pair of elliptical galaxies this torque leads to swinging of the galaxies with respect to the orbital plane (which can be observed as a rotation about the minor axis) and to the excitation of internal degrees of freedom. Besides, this pendulum effect may be effective for elliptical galaxies in clusters due to the presence of the torque produced by a cluster as a whole. In the case of spiral galaxies the torque leads to the precession of their rotational axes. However this effect seems to be too weak to be observable

  8. Induced Ellipticity for Inspiraling Binary Systems

    Science.gov (United States)

    Randall, Lisa; Xianyu, Zhong-Zhi

    2018-01-01

    Although gravitational waves tend to erase eccentricity of an inspiraling binary system, ellipticity can be generated in the presence of surrounding matter. We present a semianalytical method for understanding the eccentricity distribution of binary black holes (BHs) in the presence of a supermassive BH in a galactic center. Given a matter distribution, we show how to determine the resultant eccentricity analytically in the presence of both tidal forces and evaporation up to one cutoff and one matter-distribution-independent function, paving the way for understanding the environment of detected inspiraling BHs. We furthermore generalize Kozai–Lidov dynamics to situations where perturbation theory breaks down for short time intervals, allowing more general angular momentum exchange, such that eccentricity is generated even when all bodies orbit in the same plane.

  9. Binary fingerprints at fluctuation-enhanced sensing.

    Science.gov (United States)

    Chang, Hung-Chih; Kish, Laszlo B; King, Maria D; Kwan, Chiman

    2010-01-01

    We have developed a simple way to generate binary patterns based on spectral slopes in different frequency ranges at fluctuation-enhanced sensing. Such patterns can be considered as binary "fingerprints" of odors. The method has experimentally been demonstrated with a commercial semiconducting metal oxide (Taguchi) sensor exposed to bacterial odors (Escherichia coli and Anthrax-surrogate Bacillus subtilis) and processing their stochastic signals. With a single Taguchi sensor, the situations of empty chamber, tryptic soy agar (TSA) medium, or TSA with bacteria could be distinguished with 100% reproducibility. The bacterium numbers were in the range of 2.5 × 10(4)-10(6). To illustrate the relevance for ultra-low power consumption, we show that this new type of signal processing and pattern recognition task can be implemented by a simple analog circuitry and a few logic gates with total power consumption in the microWatts range.

  10. X-Ray Background from Early Binaries

    Science.gov (United States)

    Kohler, Susanna

    2016-11-01

    What impact did X-rays from the first binary star systems have on the universe around them? A new study suggests this radiation may have played an important role during the reionization of our universe.Ionizing the UniverseDuring the period of reionization, the universe reverted from being neutral (as it was during recombination, the previous period)to once again being ionized plasma a state it has remained in since then. This transition, which occurred between 150 million and one billion years after the Big Bang (redshift of 6 z 20), was caused by the formation of the first objects energetic enough to reionize the universes neutral hydrogen.ROSAT image of the soft X-ray background throughout the universe. The different colors represent different energy bands: 0.25 keV (red), 0.75 keV (green), 1.5 keV (blue). [NASA/ROSAT Project]Understanding this time period in particular, determining what sources caused the reionization, and what the properties were of the gas strewn throughout the universe during this time is necessary for us to be able to correctly interpret cosmological observations.Conveniently, the universe has provided us with an interesting clue: the large-scale, diffuse X-ray background we observe all around us. What produced these X-rays, and what impact did this radiation have on the intergalactic medium long ago?The First BinariesA team of scientists led by Hao Xu (UC San Diego) has suggested that the very first generation of stars might be an important contributor to these X-rays.This hypothetical first generation, Population III stars, are thought to have formed before and during reionization from large clouds of gas containing virtually no metals. Studies suggest that a large fraction of Pop III stars formed in binaries and when those stars ended their lives as black holes, ensuing accretion from their companions could produceX-ray radiation.The evolution with redshift of the mean X-ray background intensities. Each curve represents a different

  11. Eclipsing binary stars modeling and analysis

    CERN Document Server

    Kallrath, Josef

    1999-01-01

    This book focuses on the formulation of mathematical models for the light curves of eclipsing binary stars, and on the algorithms for generating such models Since information gained from binary systems provides much of what we know of the masses, luminosities, and radii of stars, such models are acquiring increasing importance in studies of stellar structure and evolution As in other areas of science, the computer revolution has given many astronomers tools that previously only specialists could use; anyone with access to a set of data can now expect to be able to model it This book will provide astronomers, both amateur and professional, with a guide for - specifying an astrophysical model for a set of observations - selecting an algorithm to determine the parameters of the model - estimating the errors of the parameters It is written for readers with knowledge of basic calculus and linear algebra; appendices cover mathematical details on such matters as optimization, coordinate systems, and specific models ...

  12. Binary interaction dominates the evolution of massive stars.

    Science.gov (United States)

    Sana, H; de Mink, S E; de Koter, A; Langer, N; Evans, C J; Gieles, M; Gosset, E; Izzard, R G; Le Bouquin, J-B; Schneider, F R N

    2012-07-27

    The presence of a nearby companion alters the evolution of massive stars in binary systems, leading to phenomena such as stellar mergers, x-ray binaries, and gamma-ray bursts. Unambiguous constraints on the fraction of massive stars affected by binary interaction were lacking. We simultaneously measured all relevant binary characteristics in a sample of Galactic massive O stars and quantified the frequency and nature of binary interactions. More than 70% of all massive stars will exchange mass with a companion, leading to a binary merger in one-third of the cases. These numbers greatly exceed previous estimates and imply that binary interaction dominates the evolution of massive stars, with implications for populations of massive stars and their supernovae.

  13. Detectability of Gravitational Waves from High-Redshift Binaries.

    Science.gov (United States)

    Rosado, Pablo A; Lasky, Paul D; Thrane, Eric; Zhu, Xingjiang; Mandel, Ilya; Sesana, Alberto

    2016-03-11

    Recent nondetection of gravitational-wave backgrounds from pulsar timing arrays casts further uncertainty on the evolution of supermassive black hole binaries. We study the capabilities of current gravitational-wave observatories to detect individual binaries and demonstrate that, contrary to conventional wisdom, some are, in principle, detectable throughout the Universe. In particular, a binary with rest-frame mass ≳10^{10}M_{⊙} can be detected by current timing arrays at arbitrarily high redshifts. The same claim will apply for less massive binaries with more sensitive future arrays. As a consequence, future searches for nanohertz gravitational waves could be expanded to target evolving high-redshift binaries. We calculate the maximum distance at which binaries can be observed with pulsar timing arrays and other detectors, properly accounting for redshift and using realistic binary waveforms.

  14. THE ELM SURVEY. V. MERGING MASSIVE WHITE DWARF BINARIES

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Warren R.; Kenyon, Scott J. [Smithsonian Astrophysical Observatory, 60 Garden St, Cambridge, MA 02138 (United States); Kilic, Mukremin; Gianninas, A. [Homer L. Dodge Department of Physics and Astronomy, University of Oklahoma, 440 W. Brooks St., Norman, OK, 73019 (United States); Allende Prieto, Carlos, E-mail: wbrown@cfa.harvard.edu, E-mail: skenyon@cfa.harvard.edu, E-mail: kilic@ou.edu, E-mail: alexg@nhn.ou.edu, E-mail: callende@iac.es [Instituto de Astrofisica de Canarias, E-38205, La Laguna, Tenerife (Spain)

    2013-05-20

    We present the discovery of 17 low-mass white dwarfs (WDs) in short-period (P {<=} 1 day) binaries. Our sample includes four objects with remarkable log g {approx_equal} 5 surface gravities and orbital solutions that require them to be double degenerate binaries. All of the lowest surface gravity WDs have metal lines in their spectra implying long gravitational settling times or ongoing accretion. Notably, six of the WDs in our sample have binary merger times <10 Gyr. Four have {approx}>0.9 M{sub Sun} companions. If the companions are massive WDs, these four binaries will evolve into stable mass transfer AM CVn systems and possibly explode as underluminous supernovae. If the companions are neutron stars, then these may be millisecond pulsar binaries. These discoveries increase the number of detached, double degenerate binaries in the ELM Survey to 54; 31 of these binaries will merge within a Hubble time.

  15. THE ELM SURVEY. V. MERGING MASSIVE WHITE DWARF BINARIES

    International Nuclear Information System (INIS)

    Brown, Warren R.; Kenyon, Scott J.; Kilic, Mukremin; Gianninas, A.; Allende Prieto, Carlos

    2013-01-01

    We present the discovery of 17 low-mass white dwarfs (WDs) in short-period (P ≤ 1 day) binaries. Our sample includes four objects with remarkable log g ≅ 5 surface gravities and orbital solutions that require them to be double degenerate binaries. All of the lowest surface gravity WDs have metal lines in their spectra implying long gravitational settling times or ongoing accretion. Notably, six of the WDs in our sample have binary merger times 0.9 M ☉ companions. If the companions are massive WDs, these four binaries will evolve into stable mass transfer AM CVn systems and possibly explode as underluminous supernovae. If the companions are neutron stars, then these may be millisecond pulsar binaries. These discoveries increase the number of detached, double degenerate binaries in the ELM Survey to 54; 31 of these binaries will merge within a Hubble time.

  16. Dynamic logistic regression and dynamic model averaging for binary classification.

    Science.gov (United States)

    McCormick, Tyler H; Raftery, Adrian E; Madigan, David; Burd, Randall S

    2012-03-01

    We propose an online binary classification procedure for cases when there is uncertainty about the model to use and parameters within a model change over time. We account for model uncertainty through dynamic model averaging, a dynamic extension of Bayesian model averaging in which posterior model probabilities may also change with time. We apply a state-space model to the parameters of each model and we allow the data-generating model to change over time according to a Markov chain. Calibrating a "forgetting" factor accommodates different levels of change in the data-generating mechanism. We propose an algorithm that adjusts the level of forgetting in an online fashion using the posterior predictive distribution, and so accommodates various levels of change at different times. We apply our method to data from children with appendicitis who receive either a traditional (open) appendectomy or a laparoscopic procedure. Factors associated with which children receive a particular type of procedure changed substantially over the 7 years of data collection, a feature that is not captured using standard regression modeling. Because our procedure can be implemented completely online, future data collection for similar studies would require storing sensitive patient information only temporarily, reducing the risk of a breach of confidentiality. © 2011, The International Biometric Society.

  17. White dwarfs in Be star binary systems

    Science.gov (United States)

    Apparao, K. M. V.

    1991-01-01

    An evaluation is made of possible reasons for the persistent inability to identify white dwarf stars in the Be binary systems. It is noted that many Be stars exhibiting large optical enhancements may be Be + WD and Be + He systems, and that observations of pulsations in the H-alpha emission, as well as observation of time delays between enhancements of optical line and continuum, can identify such systems.

  18. Search for forced oscillations in binaries

    Czech Academy of Sciences Publication Activity Database

    Janík, J.; Harmanec, Petr; Lehmann, H.; Yang, S.; Božić, H.; Ak, H.; Hadrava, Petr; Eenens, P.; Ruždjak, D.; Sudar, D.; Hubený, I.; Linnell, A. P.

    2003-01-01

    Roč. 408, č. 2 (2003), s. 611-619 ISSN 0004-6361 R&D Projects: GA ČR GA205/96/0162; GA ČR GA205/02/0445; GA AV ČR IAA3003805; GA AV ČR KSK2043105 Institutional research plan: CEZ:AV0Z1003909 Keywords : binaries stars * close stars * spectroscopis Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.843, year: 2003

  19. Binary choice models with endogenous regressors

    OpenAIRE

    Christopher Baum; Yingying Dong; Arthur Lewbel; Tao Yang

    2012-01-01

    Dong and Lewbel have developed the theory of simple estimators for binary choice models with endogenous or mismeasured regressors, depending on a `special regressor' as defined by Lewbel (J. Econometrics, 2000). `Control function' methods such as Stata's ivprobit are generally only valid when endogenous regressors are consistent. The estimators proposed here can be used with limited, censored, continuous or discrete endogenous regressors, and have significant advantages over alternatives such...

  20. Digitizing Villanova University's Eclipsing Binary Card Catalogue

    Science.gov (United States)

    Guzman, Giannina; Dalton, Briana; Conroy, Kyle; Prsa, Andrej

    2018-01-01

    Villanova University’s Department of Astrophysics and Planetary Science has years of hand-written archival data on Eclipsing Binaries at its disposal. This card catalog began at Princeton in the 1930’s with notable contributions from scientists such as Henry Norris Russel. During World War II, the archive was moved to the University of Pennsylvania, which was one of the world centers for Eclipsing Binary research, consequently, the contributions to the catalog during this time were immense. It was then moved to University of Florida at Gainesville before being accepted by Villanova in the 1990’s. The catalog has been kept in storage since then. The objective of this project is to digitize this archive and create a fully functional online catalog that contains the information available on the cards, along with the scan of the actual cards. Our group has built a database using a python-powered infrastructure to contain the collected data. The team also built a prototype web-based searchable interface as a front-end to the catalog. Following the data-entry process, information like the Right Ascension and Declination will be run against SIMBAD and any differences between values will be noted as part of the catalog. Information published online from the card catalog and even discrepancies in information for a star, could be a catalyst for new studies on these Eclipsing Binaries. Once completed, the database-driven interface will be made available to astronomers worldwide. The group will also acquire, from the database, a list of referenced articles that have yet to be found online in order to further pursue their digitization. This list will be comprised of references in the cards that were neither found on ADS nor online during the data-entry process. Pursuing the integration of these references to online queries such as ADS will be an ongoing process that will contribute and further facilitate studies on Eclipsing Binaries.

  1. Phase analysis of amplitude binary mask structures

    Science.gov (United States)

    Puthankovilakam, Krishnaparvathy; Scharf, Toralf; Herzig, Hans Peter; Vogler, Uwe; Bramati, Arianna; Voelkel, Reinhard

    2016-03-01

    Shaping of light behind masks using different techniques is the milestone of the printing industry. The aerial image distribution or the intensity distribution at the printing distances defines the resolution of the structure after printing. Contrast and phase are the two parameters that play a major role in shaping of light to get the desired intensity pattern. Here, in contrast to many other contributions that focus on intensity, we discuss the phase evolution for different structures. The amplitude or intensity characteristics of the structures in a binary mask at different proximity gaps have been analyzed extensively for many industrial applications. But the phase evolution from the binary mask having OPC structures is not considered so far. The mask we consider here is the normal amplitude binary mask but having high resolution Optical Proximity Correction (OPC) structures for corners. The corner structures represent a two dimensional problem which is difficult to handle with simple rules of phase masks design and therefore of particular interest. The evolution of light from small amplitude structures might lead to high contrast by creating sharp phase changes or phase singularities which are points of zero intensity. We show the phase modulation at different proximity gaps and can visualize the shaping of light according to the phase changes. The analysis is done with an instrument called High Resolution Interference Microscopy (HRIM), a Mach-Zehnder interferometer that gives access to three-dimensional phase and amplitude images. The current paper emphasizes on the phase measurement of different optical proximity correction structures, and especially on corners of a binary mask.

  2. Composition profile determination in isomorphous binary alloys

    International Nuclear Information System (INIS)

    An, C.Y.; Bandeira, I.N.

    1983-07-01

    The inhomogeneity along the growth axis of the pseudo-binary alloys is due to the segregation of the solute which will be mixed in the melt due to convective and diffusive flows. A process for determination of the exact composition profile by measurements of the crystal density, for alloys of the type A sub(1-x) B sub(x), is shown. (Author) [pt

  3. Robust Speech Recognition from Binary Masks

    Science.gov (United States)

    2010-01-01

    invariance to translation and size of the input pattern. Since the binary patterns of IBM are, in a way, similar to handwritten digits, we used a CNN...classification for each pattern. This also adds to the translational invariance of the CNN. To be consistent, we use the same strategy while testing IBMs...the cases, the noisy speech was enhanced using the MMSE algorithm, which is a widely used speech enhancement algorithm (Ephraim and Malah, 1985), as

  4. Inducing Risk Neutral Preferences with Binary Lotteries

    DEFF Research Database (Denmark)

    Harrison, Glenn W.; Martínez-Correa, Jimmy; Swarthout, J. Todd

    2013-01-01

    We evaluate the binary lottery procedure for inducing risk neutral behavior. We strip the experimental implementation down to bare bones, taking care to avoid any potentially confounding assumptions about behavior having to be made. In particular, our evaluation does not rely on the assumed valid...... toward risk neutrality. This striking result generalizes to the case in which subjects make several lottery choices and one is selected for payment....

  5. Binary DNA Nanostructures for Data Encryption

    OpenAIRE

    Halvorsen, Ken; Wong, Wesley P.

    2012-01-01

    We present a simple and secure system for encrypting and decrypting information using DNA self-assembly. Binary data is encoded in the geometry of DNA nanostructures with two distinct conformations. Removing or leaving out a single component reduces these structures to an encrypted solution of ssDNA, whereas adding back this missing "decryption key" causes the spontaneous formation of the message through self-assembly, enabling rapid read out via gel electrophoresis. Applications include auth...

  6. Binary DNA nanostructures for data encryption.

    Science.gov (United States)

    Halvorsen, Ken; Wong, Wesley P

    2012-01-01

    We present a simple and secure system for encrypting and decrypting information using DNA self-assembly. Binary data is encoded in the geometry of DNA nanostructures with two distinct conformations. Removing or leaving out a single component reduces these structures to an encrypted solution of ssDNA, whereas adding back this missing "decryption key" causes the spontaneous formation of the message through self-assembly, enabling rapid read out via gel electrophoresis. Applications include authentication, secure messaging, and barcoding.

  7. EXACT LOGISTIC MODELS FOR NESTED BINARY DATA

    OpenAIRE

    TROXLER, STEVEN; LALONDE, TRENT; WILSON, JEFFREY R.

    2011-01-01

    The use of logistic models for independent binary data has relied first on asymptotic theory and later on exact distributions for small samples. However, the use of logistic models for dependent analysis based on exact analysis is not as common. Moreover attention is usually given to one-stage clustering. In this paper we extend the exact techniques to address hypothesis testing (estimation is not addressed) for data with second-stage and probably higher levels of clustering. The methods are ...

  8. Relativistic apsidal motion in eccentric eclipsing binaries

    Czech Academy of Sciences Publication Activity Database

    Wolf, M.; Claret, L.; Kotková, Lenka; Kučáková, Hana; Kocián, R.; Brát, L.; Svoboda, P.; Šmelcer, L.

    2010-01-01

    Roč. 509, January (2010), A18/1-A18/14 ISSN 0004-6361 Grant - others:GA ČR(CZ) GA205/04/2063; GA ČR(CZ) GA205/06/0217 Institutional research plan: CEZ:AV0Z10030501 Keywords : binaries eclipsing Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.410, year: 2010

  9. Orbital Decay in Binaries with Evolved Stars

    Science.gov (United States)

    Sun, Meng; Arras, Phil; Weinberg, Nevin N.; Troup, Nicholas; Majewski, Steven R.

    2018-01-01

    Two mechanisms are often invoked to explain tidal friction in binary systems. The ``dynamical tide” is the resonant excitation of internal gravity waves by the tide, and their subsequent damping by nonlinear fluid processes or thermal diffusion. The ``equilibrium tide” refers to non-resonant excitation of fluid motion in the star’s convection zone, with damping by interaction with the turbulent eddies. There have been numerous studies of these processes in main sequence stars, but less so on the subgiant and red giant branches. Motivated by the newly discovered close binary systems in the Apache Point Observatory Galactic Evolution Experiment (APOGEE-1), we have performed calculations of both the dynamical and equilibrium tide processes for stars over a range of mass as the star’s cease core hydrogen burning and evolve to shell burning. Even for stars which had a radiative core on the main sequence, the dynamical tide may have very large amplitude in the newly radiative core in post-main sequence, giving rise to wave breaking. The resulting large dynamical tide dissipation rate is compared to the equilibrium tide, and the range of secondary masses and orbital periods over which rapid orbital decay may occur will be discussed, as well as applications to close APOGEE binaries.

  10. Spinodal decomposition of chemically reactive binary mixtures

    Science.gov (United States)

    Lamorgese, A.; Mauri, R.

    2016-08-01

    We simulate the influence of a reversible isomerization reaction on the phase segregation process occurring after spinodal decomposition of a deeply quenched regular binary mixture, restricting attention to systems wherein material transport occurs solely by diffusion. Our theoretical approach follows a diffuse-interface model of partially miscible binary mixtures wherein the coupling between reaction and diffusion is addressed within the frame of nonequilibrium thermodynamics, leading to a linear dependence of the reaction rate on the chemical affinity. Ultimately, the rate for an elementary reaction depends on the local part of the chemical potential difference since reaction is an inherently local phenomenon. Based on two-dimensional simulation results, we express the competition between segregation and reaction as a function of the Damköhler number. For a phase-separating mixture with components having different physical properties, a skewed phase diagram leads, at large times, to a system converging to a single-phase equilibrium state, corresponding to the absolute minimum of the Gibbs free energy. This conclusion continues to hold for the critical phase separation of an ideally perfectly symmetric binary mixture, where the choice of final equilibrium state at large times depends on the initial mean concentration being slightly larger or less than the critical concentration.

  11. Circumstellar disks around binary stars in Taurus

    International Nuclear Information System (INIS)

    Akeson, R. L.; Jensen, E. L. N.

    2014-01-01

    We have conducted a survey of 17 wide (>100 AU) young binary systems in Taurus with the Atacama Large Millimeter Array (ALMA) at two wavelengths. The observations were designed to measure the masses of circumstellar disks in these systems as an aid to understanding the role of multiplicity in star and planet formation. The ALMA observations had sufficient resolution to localize emission within the binary system. Disk emission was detected around all primaries and 10 secondaries, with disk masses as low as 10 –4 M ☉ . We compare the properties of our sample to the population of known disks in Taurus and find that the disks from this binary sample match the scaling between stellar mass and millimeter flux of F mm ∝M ∗ 1.5--2.0 to within the scatter found in previous studies. We also compare the properties of the primaries to those of the secondaries and find that the secondary/primary stellar and disk mass ratios are not correlated; in three systems, the circumsecondary disk is more massive than the circumprimary disk, counter to some theoretical predictions.

  12. Circumstellar disks around binary stars in Taurus

    Energy Technology Data Exchange (ETDEWEB)

    Akeson, R. L. [NASA Exoplanet Science Institute, IPAC/Caltech, Pasadena, CA 91125 (United States); Jensen, E. L. N. [Swarthmore College, Department of Physics and Astronomy, Swarthmore, PA 19081 (United States)

    2014-03-20

    We have conducted a survey of 17 wide (>100 AU) young binary systems in Taurus with the Atacama Large Millimeter Array (ALMA) at two wavelengths. The observations were designed to measure the masses of circumstellar disks in these systems as an aid to understanding the role of multiplicity in star and planet formation. The ALMA observations had sufficient resolution to localize emission within the binary system. Disk emission was detected around all primaries and 10 secondaries, with disk masses as low as 10{sup –4} M {sub ☉}. We compare the properties of our sample to the population of known disks in Taurus and find that the disks from this binary sample match the scaling between stellar mass and millimeter flux of F{sub mm}∝M{sub ∗}{sup 1.5--2.0} to within the scatter found in previous studies. We also compare the properties of the primaries to those of the secondaries and find that the secondary/primary stellar and disk mass ratios are not correlated; in three systems, the circumsecondary disk is more massive than the circumprimary disk, counter to some theoretical predictions.

  13. ORBITAL EVOLUTION OF COMPACT WHITE DWARF BINARIES

    Energy Technology Data Exchange (ETDEWEB)

    Kaplan, David L. [Physics Department, University of Wisconsin-Milwaukee, Milwaukee, WI 53211 (United States); Bildsten, Lars [Kavli Institute for Theoretical Physics and Department of Physics, Kohn Hall, University of California, Santa Barbara, CA 93106 (United States); Steinfadt, Justin D. R., E-mail: kaplan@uwm.edu, E-mail: bildsten@kitp.ucsb.edu, E-mail: jdrsteinfadt@gmail.com [Department of Physics, Broida Hall, University of California, Santa Barbara, CA 93106 (United States)

    2012-10-10

    The newfound prevalence of extremely low mass (ELM, M{sub He} < 0.2 M{sub Sun }) helium white dwarfs (WDs) in tight binaries with more massive WDs has raised our interest in understanding the nature of their mass transfer. Possessing small (M{sub env} {approx} 10{sup -3} M{sub Sun }) but thick hydrogen envelopes, these objects have larger radii than cold WDs and so initiate mass transfer of H-rich material at orbital periods of 6-10 minutes. Building on the original work of D'Antona et al., we confirm the 10{sup 6} yr period of continued inspiral with mass transfer of H-rich matter and highlight the fact that the inspiraling direct-impact double WD binary HM Cancri likely has an ELM WD donor. The ELM WDs have less of a radius expansion under mass loss, thus enabling a larger range of donor masses that can stably transfer matter and become a He mass transferring AM CVn binary. Even once in the long-lived AM CVn mass transferring stage, these He WDs have larger radii due to their higher entropy from the prolonged H-burning stage.

  14. Constraining the Statistics of Population III Binaries

    Science.gov (United States)

    Stacy, Athena; Bromm, Volker

    2012-01-01

    We perform a cosmological simulation in order to model the growth and evolution of Population III (Pop III) stellar systems in a range of host minihalo environments. A Pop III multiple system forms in each of the ten minihaloes, and the overall mass function is top-heavy compared to the currently observed initial mass function in the Milky Way. Using a sink particle to represent each growing protostar, we examine the binary characteristics of the multiple systems, resolving orbits on scales as small as 20 AU. We find a binary fraction of approx. 36, with semi-major axes as large as 3000 AU. The distribution of orbital periods is slightly peaked at approx. < 900 yr, while the distribution of mass ratios is relatively flat. Of all sink particles formed within the ten minihaloes, approx. 50 are lost to mergers with larger sinks, and 50 of the remaining sinks are ejected from their star-forming disks. The large binary fraction may have important implications for Pop III evolution and nucleosynthesis, as well as the final fate of the first stars.

  15. Observations of binary stars by speckle interferometry

    International Nuclear Information System (INIS)

    Morgan, B.L.; Beckmann, G.K.; Scaddan, R.J.

    1980-01-01

    This is the second paper in a series describing observations of binary stars using the technique of speckle interferometry. Observations were made using the 2.5-m Isaac Newton Telescope and the 1-m telescope of the Royal Greenwich Observatory and the 1.9-m telescope of the South African Astronomical Observatory. The classical Rayleigh diffraction limits are 0.050 arcsec for the 2.5-m telescope, 0.065 arcsec for the 1.9-m telescope and 0.125 arcsec for the 1-m telescope, at a wavelength of 500 nm. The results of 29 measurements of 26 objects are presented. The objects include long period spectroscopic binaries from the 6th Catalogue of Batten, close visual binary systems from the 3rd Catalogue of Finsen and Worley and variable stars. Nine of the objects have not been previously resolved by speckle interferometry. New members are detected in the systems β Cep, p Vel and iota UMa. (author)

  16. On the binary expansions of algebraic numbers

    Energy Technology Data Exchange (ETDEWEB)

    Bailey, David H.; Borwein, Jonathan M.; Crandall, Richard E.; Pomerance, Carl

    2003-07-01

    Employing concepts from additive number theory, together with results on binary evaluations and partial series, we establish bounds on the density of 1's in the binary expansions of real algebraic numbers. A central result is that if a real y has algebraic degree D > 1, then the number {number_sign}(|y|, N) of 1-bits in the expansion of |y| through bit position N satisfies {number_sign}(|y|, N) > CN{sup 1/D} for a positive number C (depending on y) and sufficiently large N. This in itself establishes the transcendency of a class of reals {summation}{sub n{ge}0} 1/2{sup f(n)} where the integer-valued function f grows sufficiently fast; say, faster than any fixed power of n. By these methods we re-establish the transcendency of the Kempner--Mahler number {summation}{sub n{ge}0}1/2{sup 2{sup n}}, yet we can also handle numbers with a substantially denser occurrence of 1's. Though the number z = {summation}{sub n{ge}0}1/2{sup n{sup 2}} has too high a 1's density for application of our central result, we are able to invoke some rather intricate number-theoretical analysis and extended computations to reveal aspects of the binary structure of z{sup 2}.

  17. Accreting Binary Populations in the Earlier Universe

    Science.gov (United States)

    Hornschemeier, Ann

    2010-01-01

    It is now understood that X-ray binaries dominate the hard X-ray emission from normal star-forming galaxies. Thanks to the deepest (2-4 Ms) Chandra surveys, such galaxies are now being studied in X-rays out to z approximates 4. Interesting X-ray stacking results (based on 30+ galaxies per redshift bin) suggest that the mean rest-frame 2-10 keV luminosity from z=3-4 Lyman break galaxies (LBGs), is comparable to the most powerful starburst galaxies in the local Universe. This result possibly indicates a similar production mechanism for accreting binaries over large cosmological timescales. To understand and constrain better the production of X-ray binaries in high-redshift LBGs, we have utilized XMM-Newton observations of a small sample of z approximates 0.1 GALEX-selected Ultraviolet-Luminous Galaxies (UVLGs); local analogs to high-redshift LBGs. Our observations enable us to study the X-ray emission from LBG-like galaxies on an individual basis, thus allowing us to constrain object-to-object variances in this population. We supplement these results with X-ray stacking constraints using the new 3.2 Ms Chandra Deep Field-South (completed spring 2010) and LBG candidates selected from HST, Swift UVOT, and ground-based data. These measurements provide new X-ray constraints that sample well the entire z=0-4 baseline

  18. Asteroseismic modelling of the Binary HD 176465

    Directory of Open Access Journals (Sweden)

    Nsamba B.

    2017-01-01

    Full Text Available The detection and analysis of oscillations in binary star systems is critical in understanding stellar structure and evolution. This is partly because such systems have the same initial chemical composition and age. Solar-like oscillations have been detected by Kepler in both components of the asteroseismic binary HD 176465. We present an independent modelling of each star in this binary system. Stellar models generated using MESA (Modules for Experiments in Stellar Astrophysics were fitted to both the observed individual frequencies and complementary spectroscopic parameters. The individual theoretical oscillation frequencies for the corresponding stellar models were obtained using GYRE as the pulsation code. A Bayesian approach was applied to find the probability distribution functions of the stellar parameters using AIMS (Asteroseismic Inference on a Massive Scale as the optimisation code. The ages of HD 176465 A and HD 176465 B were found to be 2.81 ± 0.48 Gyr and 2.52 ± 0.80 Gyr, respectively. These results are in agreement when compared to previous studies carried out using other asteroseismic modelling techniques and gyrochronology.

  19. Infalling clouds on to supermassive black hole binaries - II. Binary evolution and the final parsec problem

    Science.gov (United States)

    Goicovic, Felipe G.; Sesana, Alberto; Cuadra, Jorge; Stasyszyn, Federico

    2017-11-01

    The formation of massive black hole binaries (MBHBs) is an unavoidable outcome of galaxy evolution via successive mergers. However, the mechanism that drives their orbital evolution from parsec separations down to the gravitational wave dominated regime is poorly understood, and their final fate is still unclear. If such binaries are embedded in gas-rich and turbulent environments, as observed in remnants of galaxy mergers, the interaction with gas clumps (such as molecular clouds) may efficiently drive their orbital evolution. Using numerical simulations, we test this hypothesis by studying the dynamical evolution of an equal mass, circular MBHB accreting infalling molecular clouds. We investigate different orbital configurations, modelling a total of 13 systems to explore different possible impact parameters and relative inclinations of the cloud-binary encounter. We focus our study on the prompt, transient phase during the first few orbits when the dynamical evolution of the binary is fastest, finding that this evolution is dominated by the exchange of angular momentum through gas capture by the individual black holes and accretion. Building on these results, we construct a simple model for evolving an MBHB interacting with a sequence of clouds, which are randomly drawn from reasonable populations with different levels of anisotropy in their angular momenta distributions. We show that the binary efficiently evolves down to the gravitational wave emission regime within a few hundred million years, overcoming the 'final parsec' problem regardless of the stellar distribution.

  20. The design of supply chains

    DEFF Research Database (Denmark)

    Bøge Sørensen, Lars

    2004-01-01

    Keywords Supply Chain Management, Supply Chain Design, Literature studyAbstract Argues stability is a design objective for supply chain design alongside cost, leadtime and responsiveness. Performs an extensive literature study on supply chain design,identifies methods, theories and objectives...... in the existing literature. Describes the conceptexternal specificity and how it's used to design supply chains. Using the concept upstream,archetypes of risk minimal and maximal design are identified. Downstream the conceptdescribes two viable scenarios, one minimizing the impact, the other minimizing...... theprobability of (intended) departure of a supply chain partner. Finally, principles for supplychain design are described and managerial outlined....

  1. Decision-Making for Supply Chain Integration Supply Chain Integration

    CERN Document Server

    Lettice, Fiona; Durowoju, Olatunde

    2012-01-01

    Effective supply chain integration, and the tight co-ordination it creates, is an essential pre-requisite for successful supply chain management.  Decision-Making for Supply Chain Integration is a practical reference on recent research in the area of supply chain integration focusing on distributed decision-making problems. Recent applications of various decision-making tools for integrating supply chains are covered including chapters focusing on: •Supplier selection, pricing strategy and inventory decisions in multi-level supply chains, •RFID-enabled distributed decision-making, •Operational risk issues and time-critical decision-making for sensitive logistics nodes, Modelling end to end processes to improve supply chain integration, and •Integrated systems to improve service delivery and optimize resource use. Decision-Making for Supply Chain Integration provides an insight into the tools and methodologies of this field with support from real-life case studies demonstrating successful application ...

  2. The formation of eccentric compact binary inspirals and the role of gravitational wave emission in binary-single stellar encounters

    International Nuclear Information System (INIS)

    Samsing, Johan; MacLeod, Morgan; Ramirez-Ruiz, Enrico

    2014-01-01

    The inspiral and merger of eccentric binaries leads to gravitational waveforms distinct from those generated by circularly merging binaries. Dynamical environments can assemble binaries with high eccentricity and peak frequencies within the LIGO band. In this paper, we study binary-single stellar scatterings occurring in dense stellar systems as a source of eccentrically inspiraling binaries. Many interactions between compact binaries and single objects are characterized by chaotic resonances in which the binary-single system undergoes many exchanges before reaching a final state. During these chaotic resonances, a pair of objects has a non-negligible probability of experiencing a very close passage. Significant orbital energy and angular momentum are carried away from the system by gravitational wave (GW) radiation in these close passages, and in some cases this implies an inspiral time shorter than the orbital period of the bound third body. We derive the cross section for such dynamical inspiral outcomes through analytical arguments and through numerical scattering experiments including GW losses. We show that the cross section for dynamical inspirals grows with increasing target binary semi-major axis a and that for equal-mass binaries it scales as a 2/7 . Thus, we expect wide target binaries to predominantly contribute to the production of these relativistic outcomes. We estimate that eccentric inspirals account for approximately 1% of dynamically assembled non-eccentric merging binaries. While these events are rare, we show that binary-single scatterings are a more effective formation channel than single-single captures for the production of eccentrically inspiraling binaries, even given modest binary fractions.

  3. Sympathetic chain Schwannoma

    International Nuclear Information System (INIS)

    Al-Mashat, Faisal M.

    2009-01-01

    Schwannomas are rare, benign, slowly growing tumors arising from Schwann cells that line nerve sheaths. Schwannomas arising from the cervical sympathetic chain are extremely rare. Here, we report a case of a 70-year-old man who presented with only an asymptomatic neck mass. Physical examination revealed a left sided Horner syndrome and a neck mass with transmitted pulsation and anterior displacement of the carotid artery. Computed tomography (CT) showed a well-defined non-enhancing mass with vascular displacement. The nerve of origin of this encapsulated tumor was the sympathetic chain. The tumor was excised completely intact. The pathologic diagnosis was Schwannoma (Antoni type A and Antoni type B). The patient has been well and free of tumor recurrence for 14 months with persistence of asymptomatic left sided Horner syndrome. The clinical, radiological and pathological evaluations, therapy and postoperative complications of this tumor are discussed. (author)

  4. METRODOS: Meteorological preprocessor chain

    DEFF Research Database (Denmark)

    Astrup, P.; Mikkelsen, T.; Deme, S.

    2001-01-01

    The METRODOS meteorological preprocessor chain combines measured tower data and coarse grid numerical weather prediction (NWP) data with local scale flow models and similarity scaling to give high resolution approximations of the meteorological situation. Based on available wind velocity...... - heat flux related measurement, e.g. a temperature gradient, are used to give local values of friction velocity and Monin-Obukhov length plus an estimate of the mixing height. The METRODOS meteorological preprocessor chain is an integral part of the RODOS - Real Time On Line Decision Support - program...... and direction measurements/NWP predictions, the LINCOM or the MCF flow model determines the wind field on a 1/2 to 1 km grid over the area of interest, taking the influence of orography and mixed roughness into consideration. For each grid point the obtained wind and the most appropriate - normally the nearest...

  5. Extended linear chain compounds

    CERN Document Server

    Linear chain substances span a large cross section of contemporary chemistry ranging from covalent polymers, to organic charge transfer com­ plexes to nonstoichiometric transition metal coordination complexes. Their commonality, which coalesced intense interest in the theoretical and exper­ imental solid state physics/chemistry communities, was based on the obser­ vation that these inorganic and organic polymeric substrates exhibit striking metal-like electrical and optical properties. Exploitation and extension of these systems has led to the systematic study of both the chemistry and physics of highly and poorly conducting linear chain substances. To gain a salient understanding of these complex materials rich in anomalous aniso­ tropic electrical, optical, magnetic, and mechanical properties, the conver­ gence of diverse skills and talents was required. The constructive blending of traditionally segregated disciplines such as synthetic and physical organic, inorganic, and polymer chemistry, crystallog...

  6. The IASI detection chain

    Science.gov (United States)

    Nicol, Patrick; Fleury, Joel; Le Naour, Claire; Bernard, Frédéric

    2017-11-01

    IASI (Infrared Atmospheric Sounding Interferometer) is an infrared atmospheric sounder. It will provide meteorologist and scientific community with atmospheric spectra. The instrument is composed of a Fourier transform spectrometer and an associated infrared imager. The presentation will describe the spectrometer detection chain architecture, composed by three different detectors cooled in a passive cryo-cooler (so called CBS : Cold Box Subsystem) and associated analog electronics up to digital conversion. It will mainly focus on design choices with regards to environment constraints, implemented technologies, and associated performances. CNES is leading the IASI program in collaboration with EUMETSAT. The instrument Prime is ALCATEL SPACE responsible, notably, of the detection chain architecture. SAGEM SA provides the detector package (so called CAU : Cold Acquisition Unit).

  7. Towards Intelligent Supply Chains

    DEFF Research Database (Denmark)

    Siurdyban, Artur; Møller, Charles

    2012-01-01

    applied to the context of organizational processes can increase the success rate of business operations. The framework is created using a set of theoretical based constructs grounded in a discussion across several streams of research including psychology, pedagogy, artificial intelligence, learning...... of deploying inapt operations leading to deterioration of profits. To address this problem, we propose a unified business process design framework based on the paradigm of intelligence. Intelligence allows humans and human-designed systems cope with environmental volatility, and we argue that its principles......, business process management and supply chain management. It outlines a number of system tasks combined in four integrated management perspectives: build, execute, grow and innovate, put forward as business process design propositions for Intelligent Supply Chains....

  8. Degradation behavior of polymer blend of isotactic polypropylenes with and without unsaturated chain end group

    Science.gov (United States)

    Nakatani, Hisayuki; Kurniawan, Dodik; Taniike, Toshiaki; Terano, Minoru

    2008-04-01

    In this work, the relationship between the unsaturated chain end group content and the thermal oxidative degradation rate was systematically studied with binary polymer blends of isotactic polypropylene (iPP) with and without the unsaturated chain end group. The iPPs with and without the unsaturated chain end group were synthesized by a metallocene catalyst in the absence of hydrogen and by a Ziegler catalyst in the presence of one, respectively. The thermal oxidative degradation rate of the binary iPP blends was estimated from the molecular weight and the apparent activation energy (ΔE), which were obtained through size exclusion chromatography (SEC) and thermogravimetric analysis (TGA) measurements, respectively. These values exhibited a negative correlation against the mole content of the unsaturated chain end group. The thermal oxidative degradation rate apparently depends on the content of the unsaturated chain end group. This tendency suggests that the unsaturated chain end acts as a radical initiator of the iPP degradation reaction.

  9. Degradation behavior of polymer blend of isotactic polypropylenes with and without unsaturated chain end group

    International Nuclear Information System (INIS)

    Nakatani, Hisayuki; Kurniawan, Dodik; Taniike, Toshiaki; Terano, Minoru

    2008-01-01

    In this work, the relationship between the unsaturated chain end group content and the thermal oxidative degradation rate was systematically studied with binary polymer blends of isotactic polypropylene (iPP) with and without the unsaturated chain end group. The iPPs with and without the unsaturated chain end group were synthesized by a metallocene catalyst in the absence of hydrogen and by a Ziegler catalyst in the presence of one, respectively. The thermal oxidative degradation rate of the binary iPP blends was estimated from the molecular weight and the apparent activation energy (ΔE), which were obtained through size exclusion chromatography (SEC) and thermogravimetric analysis (TGA) measurements, respectively. These values exhibited a negative correlation against the mole content of the unsaturated chain end group. The thermal oxidative degradation rate apparently depends on the content of the unsaturated chain end group. This tendency suggests that the unsaturated chain end acts as a radical initiator of the iPP degradation reaction.

  10. Degradation behavior of polymer blend of isotactic polypropylenes with and without unsaturated chain end group

    Directory of Open Access Journals (Sweden)

    Hisayuki Nakatani et al

    2008-01-01

    Full Text Available In this work, the relationship between the unsaturated chain end group content and the thermal oxidative degradation rate was systematically studied with binary polymer blends of isotactic polypropylene (iPP with and without the unsaturated chain end group. The iPPs with and without the unsaturated chain end group were synthesized by a metallocene catalyst in the absence of hydrogen and by a Ziegler catalyst in the presence of one, respectively. The thermal oxidative degradation rate of the binary iPP blends was estimated from the molecular weight and the apparent activation energy (ΔE, which were obtained through size exclusion chromatography (SEC and thermogravimetric analysis (TGA measurements, respectively. These values exhibited a negative correlation against the mole content of the unsaturated chain end group. The thermal oxidative degradation rate apparently depends on the content of the unsaturated chain end group. This tendency suggests that the unsaturated chain end acts as a radical initiator of the iPP degradation reaction.

  11. Supply Chain Interoperability Measurement

    Science.gov (United States)

    2015-06-19

    International Journal of Production Economics 85 (2): 199-215. Dumond, E. J. 1994. Making best use of... International Journal of Production Economics 87 (3) (2/18): 333-47. Gunasekaran, A., H. J. Williams, and R. E. McGaughey. 2005. Performance measurement...supply chain quality management and its relevance to academic and industrial practice. International Journal of Production Economics 96 : 315-37.

  12. Supply chain finance

    Directory of Open Access Journals (Sweden)

    Kasavica Petar

    2014-01-01

    Full Text Available The concept of supply chain finance is a response to global illiquidity, intensified through the global economic crisis and globalization of commercial and financial flows. The growing illiquidity undermines credit ratings of economic entities, thereby reducing the potential for achieving the projected goals (profitability and portfolio quality. In order to overcome this, banks have introduced certain products flexible to the requirements of specific transactions. The concerned products redirect the focus from a client's credit rating and risk to the credit rating and risk of a business partner (buyer, resulting in benefits for all transaction participants ('win-win-win'. Moreover, the activities are targeted at transaction analysis, i.e. the isolation and protection of the cash flow as the source of financial instrument's repayment. On the other hand, there has been an increasing number of transactions based on the risk of the commercial bank of the client's business partner, or on the risk of collateral (inventory. The focus is actually placed on the financing of adequate supply chain stages, given that counterparty relationship management has been proven to be crucial for efficient management of one's own business. The tensions existing in the relations between partners (increasingly long payment deadlines are in the basis of the supply chain finance concept. Decisions made by banks are based on the entire supply chain (wide information basis, thereby shifting the focus from the product (as was the case before the crisis to the client's needs. Thus, decisions become increasingly comprehensive, quicker, and more precise, and portfolios less risky. Through the individual portfolio of banks, the market of national economies also becomes safer and more liquid. These are rather profitable transactions, because, due to the risk transfer, financing is enabled to companies to whom classic crediting in most cases is not available.

  13. All-optical conversion scheme: Binary to quaternary and quaternary to binary number

    Science.gov (United States)

    Chattopadhyay, Tanay; Roy, Jitendra Nath

    2009-04-01

    To achieve the inherent parallelism in optics a suitable number system and efficient encoding/decoding scheme for handling the data are very much essential. Binary number is accepted as the best representing number system in almost all types of existing electronic computers. But, binary number (0 and 1) is insufficient in respect to the demand of the coming generation. Multi-valued logic (with radix >2) can be viewed as an alternative approach to solve many problems in transmission, storage and processing of large amount of information in digital signal processing. Here, in this paper all-optical scheme for the conversion of binary to quaternary number and vice versa have been proposed and described. Simulation has also been done. In this all-optical scheme the numbers are represented by different discrete polarized state of light.

  14. Approximate quantum Markov chains

    CERN Document Server

    Sutter, David

    2018-01-01

    This book is an introduction to quantum Markov chains and explains how this concept is connected to the question of how well a lost quantum mechanical system can be recovered from a correlated subsystem. To achieve this goal, we strengthen the data-processing inequality such that it reveals a statement about the reconstruction of lost information. The main difficulty in order to understand the behavior of quantum Markov chains arises from the fact that quantum mechanical operators do not commute in general. As a result we start by explaining two techniques of how to deal with non-commuting matrices: the spectral pinching method and complex interpolation theory. Once the reader is familiar with these techniques a novel inequality is presented that extends the celebrated Golden-Thompson inequality to arbitrarily many matrices. This inequality is the key ingredient in understanding approximate quantum Markov chains and it answers a question from matrix analysis that was open since 1973, i.e., if Lieb's triple ma...

  15. Port supply chain integration : analyzing biofuel supply chains

    NARCIS (Netherlands)

    Stevens, Leonie C. E.; Vis, Iris F. A.

    2016-01-01

    This paper focuses on port supply chain integration to strengthen operational and business performance. We provide a structured and comprehensive method to enable port supply chain integration and demonstrate its applicability to the biofuel supply chain. We define the value proposition, role,

  16. Differential Evolution Markov Chain with snooker updater and fewer chains

    NARCIS (Netherlands)

    Braak, ter C.J.F.; Vrugt, J.A.

    2008-01-01

    Differential Evolution Markov Chain (DE-MC) is an adaptive MCMC algorithm, in which multiple chains are run in parallel. Standard DE-MC requires at least N=2d chains to be run in parallel, where d is the dimensionality of the posterior. This paper extends DE-MC with a snooker updater and shows by

  17. Searching Ultra-compact Pulsar Binaries with Abnormal Timing Behavior

    Science.gov (United States)

    Gong, B. P.; Li, Y. P.; Yuan, J. P.; Tian, J.; Zhang, Y. Y.; Li, D.; Jiang, B.; Li, X. D.; Wang, H. G.; Zou, Y. C.; Shao, L. J.

    2018-03-01

    Ultra-compact pulsar binaries are both ideal sources of gravitational radiation for gravitational wave detectors and laboratories for fundamental physics. However, the shortest orbital period of all radio pulsar binaries is currently 1.6 hr. The absence of pulsar binaries with a shorter orbital period is most likely due to technique limit. This paper points out that a tidal effect occurring on pulsar binaries with a short orbital period can perturb the orbital elements and result in a significant change in orbital modulation, which dramatically reduces the sensitivity of the acceleration searching that is widely used. Here a new search is proposed. The abnormal timing residual exhibited in a single pulse observation is simulated by a tidal effect occurring on an ultra-compact binary. The reproduction of the main features represented by the sharp peaks displayed in the abnormal timing behavior suggests that pulsars like PSR B0919+06 could be a candidate for an ultra-compact binary of an orbital period of ∼10 minutes and a companion star of a white dwarf star. The binary nature of such a candidate is further tested by (1) comparing the predicted long-term binary effect with decades of timing noise observed and (2) observing the optical counterpart of the expected companion star. Test (1) likely supports our model, while more observations are needed in test (2). Some interesting ultra-compact binaries could be found in the near future by applying such a new approach to other binary candidates.

  18. Inclination evolution of protoplanetary discs around eccentric binaries

    Science.gov (United States)

    Zanazzi, J. J.; Lai, Dong

    2018-01-01

    It is usually thought that viscous torque works to align a circumbinary disc with the binary's orbital plane. However, recent numerical simulations suggest that the disc may evolve to a configuration perpendicular to the binary orbit ('polar alignment) if the binary is eccentric and the initial disc-binary inclination is sufficiently large. We carry out a theoretical study on the long-term evolution of inclined discs around eccentric binaries, calculating the disc warp profile and dissipative torque acting on the disc. For discs with aspect ratio H/r larger than the viscosity parameter α, bending wave propagation effectively makes the disc precess as a quasi-rigid body, while viscosity acts on the disc warp and twist to drive secular evolution of the disc-binary inclination. We derive a simple analytic criterion (in terms of the binary eccentricity and initial disc orientation) for the disc to evolve towards polar alignment with the eccentric binary. When the disc has a non-negligible angular momentum compared to the binary, the final 'polar alignment' inclination angle is reduced from 90°. For typical protoplanetary disc parameters, the time-scale of the inclination evolution is shorter than the disc lifetime, suggesting that highly inclined discs and planets may exist orbiting eccentric binaries.

  19. Theory and Experiment of Binary Diffusion Coefficient of n-Alkanes in Dilute Gases.

    Science.gov (United States)

    Liu, Changran; McGivern, W Sean; Manion, Jeffrey A; Wang, Hai

    2016-10-10

    Binary diffusion coefficients were measured for n-pentane, n-hexane, and n-octane in helium and of n-pentane in nitrogen over the temperature range of 300 to 600 K, using reversed-flow gas chromatography. A generalized, analytical theory is proposed for the binary diffusion coefficients of long-chain molecules in simple diluent gases, taking advantage of a recently developed gas-kinetic theory of the transport properties of nanoslender bodies in dilute free-molecular flows. The theory addresses the long-standing question about the applicability of the Chapman-Enskog theory in describing the transport properties of nonspherical molecular structures, or equivalently, the use of isotropic potentials of interaction for a roughly cylindrical molecular structure such as large normal alkanes. An approximate potential energy function is proposed for the intermolecular interaction of long-chain n-alkane with typical bath gases. Using this potential and the analytical theory for nanoslender bodies, we show that the diffusion coefficients of n-alkanes in typical bath gases can be treated by the resulting analytical model accurately, especially for compounds larger than n-butane.

  20. Supply Chain Dynamics in Asia

    OpenAIRE

    Ruth Banomyong

    2009-01-01

    Supply chain management in Asia is a relatively novel topic but a key challenge for all Asian based manufacturers and traders when trying to integrate into the "global market". The purpose of the paper is to describe key supply chain issues faced in Asia. These issues are related to supply chain security that forces Asian firms to comply with numerous requirements as well as the importance of a properly managed supply chain in enhancing firms' competitiveness. The critical role played by Asia...

  1. Environmentally conscious supply chain design

    OpenAIRE

    Altmann, Michael

    2015-01-01

    Sustainability has become a critical topic in all areas of supply chain management. As discussed earlier, drivers for this development can be identified as both internal and external phenomena. Since customers are one of the key stakeholders in supply chain management, special attention is paid to the impact of costumers´ behavior on sustainable supply chain design decisions. In this context, two main research questions were analyzed: 1.What is the appropriate way to design a supply chain...

  2. Academic Education Chain Operation Model

    OpenAIRE

    Ruskov, Petko; Ruskov, Andrey

    2007-01-01

    This paper presents an approach for modelling the educational processes as a value added chain. It is an attempt to use a business approach to interpret and compile existing business and educational processes towards reference models and suggest an Academic Education Chain Operation Model. The model can be used to develop an Academic Chain Operation Reference Model.

  3. Process Algebra and Markov Chains

    NARCIS (Netherlands)

    Brinksma, Hendrik; Hermanns, H.; Brinksma, Hendrik; Hermanns, H.; Katoen, Joost P.

    This paper surveys and relates the basic concepts of process algebra and the modelling of continuous time Markov chains. It provides basic introductions to both fields, where we also study the Markov chains from an algebraic perspective, viz. that of Markov chain algebra. We then proceed to study

  4. A chain of FPU cells

    NARCIS (Netherlands)

    Verhulst, F.

    2015-01-01

    In contrast to the classical Fermi-Pasta-Ulam (FPU) chain, the inhomogeneous FPU chain shows nearly all the principal resonances. Using this fact, we can construct a periodic FPU chain of low dimension, for instance a FPU cell of four degrees-of-freedom, that can be used as a building block for a

  5. Designing structural supply chain flexibility

    NARCIS (Netherlands)

    Mulinski, Ksawery Jan

    2012-01-01

    In a continuously changing business environment the role of supply chain flexibility is constantly increasing. A flexible supply chain can ensure survival in quickly changing market conditions as well as enable sustainable growth. This thesis explores the topic of supply chain flexibility with focus

  6. On chains of centered valuations

    Directory of Open Access Journals (Sweden)

    Rachid Chibloun

    2003-01-01

    Full Text Available We study chains of centered valuations of a domain A and chains of centered valuations of A [X1,…,Xn] corresponding to valuations of A. Finally, we make some applications to chains of valuations centered on the same ideal of A [X1,…,Xn] and extending the same valuation of A.

  7. Risk Management in Logystics Chains

    OpenAIRE

    Butrin, Andrey; Vikulov, Vladimir

    2013-01-01

    Article is devoted to risk management of supply chain. The authors considered indicators of supply chain risks, including risks caused by supplier. Authors formed a method of optimizing the level of supply chain risk in the integration with suppliers and customers.

  8. Eclipsing binaries observed with the WIRE satellite I. Discovery and photometric analysis of the new bright A0 IV eclipsing binary psi centauri

    DEFF Research Database (Denmark)

    Bruntt, Hans; Southworth, J.; Penny, A. J.

    2006-01-01

    Stars: fundamental parameters, binaries: close, eclipsing, techniques: photometric Udgivelsesdato: Sep.......Stars: fundamental parameters, binaries: close, eclipsing, techniques: photometric Udgivelsesdato: Sep....

  9. The Fate of Neutron Star Binary Mergers

    Energy Technology Data Exchange (ETDEWEB)

    Piro, Anthony L. [The Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Giacomazzo, Bruno [Physics Department, University of Trento, via Sommarive 14, I-38123 Trento (Italy); Perna, Rosalba, E-mail: piro@carnegiescience.edu [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States)

    2017-08-01

    Following merger, a neutron star (NS) binary can produce roughly one of three different outcomes: (1) a stable NS, (2) a black hole (BH), or (3) a supramassive, rotationally supported NS, which then collapses to a BH following angular momentum losses. Which of these fates occur and in what proportion has important implications for the electromagnetic transient associated with the mergers and the expected gravitational wave (GW) signatures, which in turn depend on the high density equation of state (EOS). Here we combine relativistic calculations of NS masses using realistic EOSs with Monte Carlo population synthesis based on the mass distribution of NS binaries in our Galaxy to predict the distribution of fates expected. For many EOSs, a significant fraction of the remnants are NSs or supramassive NSs. This lends support to scenarios in which a quickly spinning, highly magnetized NS may be powering an electromagnetic transient. This also indicates that it will be important for future GW observatories to focus on high frequencies to study the post-merger GW emission. Even in cases where individual GW events are too low in signal to noise to study the post merger signature in detail, the statistics of how many mergers produce NSs versus BHs can be compared with our work to constrain the EOS. To match short gamma-ray-burst (SGRB) X-ray afterglow statistics, we find that the stiffest EOSs are ruled out. Furthermore, many popular EOSs require a significant fraction of ∼60%–70% of SGRBs to be from NS–BH mergers rather than just binary NSs.

  10. Binary Classification Method of Social Network Users

    Directory of Open Access Journals (Sweden)

    I. A. Poryadin

    2017-01-01

    Full Text Available The subject of research is a binary classification method of social network users based on the data analysis they have placed. Relevance of the task to gain information about a person by examining the content of his/her pages in social networks is exemplified. The most common approach to its solution is a visual browsing. The order of the regional authority in our country illustrates that its using in school education is needed. The article shows restrictions on the visual browsing of pupil’s pages in social networks as a tool for the teacher and the school psychologist and justifies that a process of social network users’ data analysis should be automated. Explores publications, which describe such data acquisition, processing, and analysis methods and considers their advantages and disadvantages. The article also gives arguments to support a proposal to study the classification method of social network users. One such method is credit scoring, which is used in banks and credit institutions to assess the solvency of clients. Based on the high efficiency of the method there is a proposal for significant expansion of its using in other areas of society. The possibility to use logistic regression as the mathematical apparatus of the proposed method of binary classification has been justified. Such an approach enables taking into account the different types of data extracted from social networks. Among them: the personal user data, information about hobbies, friends, graphic and text information, behaviour characteristics. The article describes a number of existing methods of data transformation that can be applied to solve the problem. An experiment of binary gender-based classification of social network users is described. A logistic model obtained for this example includes multiple logical variables obtained by transforming the user surnames. This experiment confirms the feasibility of the proposed method. Further work is to define a system

  11. Studies of Gas Disks in Binary Systems

    Science.gov (United States)

    de Val-Borro, Miguel

    There are over 300 exoplanets detected through radial velocity surveys and photometric studies showing a tremendous variety of masses, compositions and orbital parameters. Understanding the way these planets formed and evolved within the circumstellar disks they were initially embedded in is a crucial issue. In the first part of this thesis we study the physical interaction between a gaseous protoplanetary disk and an embedded planet using numerical simulations. In order to trust the results from simulations it is important to compare different methods. However, the standard test problems for hydrodynamic codes differ considerably from the case of a protoplanetary disk interacting with an embedded planet. We have carried out a code comparison in which the problem of a massive planet in a protoplanetary disk was studied with various numerical schemes. We compare the surface density, potential vorticity and azimuthally averaged density profiles at several times. There is overall good agreement between our codes for Neptune and Jupiter-sized planets. We performed simulations for each planet in an inviscid disk and including physical viscosity. The surface density profiles agree within about 5% for the grid-based schemes while the particle codes have less resolution in the low density regions and weaker spiral wakes. In Paper II, we study hydrodynamical instabilities in disks with planets. Vortices are generated close to the gap in our numerical models in agreement with the linear modal analysis. The vortices exert strong perturbations on the planet as they move along the gap and can change its migration rate. In addition, disk viscosity can be modified by the presence of vortices. The last part of this thesis studies the mass transfer in symbiotic binaries and close T Tauri binary systems. Our simulations of gravitationally focused wind accretion in binary systems show the formation of stream flows and enhanced accretion rates onto the compact component.

  12. Formation and Evolution of Binary Asteroids

    Science.gov (United States)

    Walsh, K. J.; Jacobson, S. A.

    Satellites of asteroids have been discovered in nearly every known small-body population, and a remarkable aspect of the known satellites is the diversity of their properties. They tell a story of vast differences in formation and evolution mechanisms that act as a function of size, distance from the Sun, and the properties of their nebular environment at the beginning of solar system history and their dynamical environment over the next 4.5 G.y. The mere existence of these systems provides a laboratory to study numerous types of physical processes acting on asteroids, and their dynamics provide a valuable probe of their physical properties otherwise possible only with spacecraft. Advances in understanding the formation and evolution of binary systems have been assisted by (1) the growing catalog of known systems, increasing from 33 to ~250 between the Merline et al. (2002) chapter in Asteroids III and now; (2) the detailed study and long-term monitoring of individual systems such as 1999 KW4 and 1996 FG3, (3) the discovery of new binary system morphologies and triple systems, (4) and the discovery of unbound systems that appear to be end-states of binary dynamical evolutionary paths. Specifically for small bodies (diameter smaller than 10 km), these observations and discoveries have motivated theoretical work finding that thermal forces can efficiently drive the rotational disruption of small asteroids. Long-term monitoring has allowed studies to constrain the system's dynamical evolution by the combination of tides, thermal forces, and rigid-body physics. The outliers and split pairs have pushed the theoretical work to explore a wide range of evolutionary end-states.

  13. Electronic band structures of binary skutterudites

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Banaras [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan); Aliabad, H.A. Rahnamaye [Department of Physics, Hakim Sabzevari University, Sabzevar (Iran, Islamic Republic of); Saifullah [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan); Jalali-Asadabadi, S. [Department of Physics, Faculty of Science, University of Isfahan (UI), 81744 Isfahan (Iran, Islamic Republic of); Khan, Imad [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan); Ahmad, Iftikhar, E-mail: ahma5532@gmail.com [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan)

    2015-10-25

    The electronic properties of complex binary skutterudites, MX{sub 3} (M = Co, Rh, Ir; X = P, As, Sb) are explored, using various density functional theory (DFT) based theoretical approaches including Green's Function (GW) as well as regular and non-regular Tran Blaha modified Becke Jhonson (TB-mBJ) methods. The wide range of calculated bandgap values for each compound of this skutterudites family confirm that they are theoretically as challenging as their experimental studies. The computationally expensive GW method, which is generally assume to be efficient in the reproduction of the experimental bandgaps, is also not very successful in the calculation of bandgaps. In this article, the issue of the theoretical bandgaps of these compounds is resolved by reproducing the accurate experimental bandgaps, using the recently developed non-regular TB-mBJ approach, based on DFT. The effectiveness of this technique is due to the fact that a large volume of the binary skutterudite crystal is empty and hence quite large proportion of electrons lie outside of the atomic spheres, where unlike LDA and GGA which are poor in the treatment of these electrons, this technique properly treats these electrons and hence reproduces the clear electronic picture of these compounds. - Highlights: • Theoretical and experimental electronic band structures of binary skutterudites are reviewed. • The literature reveals that none of the existing theoretical results are consistent with the experiments. • GW, regular and non-regular TB-mBJ methods are used to reproduce the correct results. • The GW and regular TB-mBJ results are better than the available results in literature. • However, non-regular TB-mBJ reproduces the correct experimental band structures.

  14. Electronic band structures of binary skutterudites

    International Nuclear Information System (INIS)

    Khan, Banaras; Aliabad, H.A. Rahnamaye; Saifullah; Jalali-Asadabadi, S.; Khan, Imad; Ahmad, Iftikhar

    2015-01-01

    The electronic properties of complex binary skutterudites, MX 3 (M = Co, Rh, Ir; X = P, As, Sb) are explored, using various density functional theory (DFT) based theoretical approaches including Green's Function (GW) as well as regular and non-regular Tran Blaha modified Becke Jhonson (TB-mBJ) methods. The wide range of calculated bandgap values for each compound of this skutterudites family confirm that they are theoretically as challenging as their experimental studies. The computationally expensive GW method, which is generally assume to be efficient in the reproduction of the experimental bandgaps, is also not very successful in the calculation of bandgaps. In this article, the issue of the theoretical bandgaps of these compounds is resolved by reproducing the accurate experimental bandgaps, using the recently developed non-regular TB-mBJ approach, based on DFT. The effectiveness of this technique is due to the fact that a large volume of the binary skutterudite crystal is empty and hence quite large proportion of electrons lie outside of the atomic spheres, where unlike LDA and GGA which are poor in the treatment of these electrons, this technique properly treats these electrons and hence reproduces the clear electronic picture of these compounds. - Highlights: • Theoretical and experimental electronic band structures of binary skutterudites are reviewed. • The literature reveals that none of the existing theoretical results are consistent with the experiments. • GW, regular and non-regular TB-mBJ methods are used to reproduce the correct results. • The GW and regular TB-mBJ results are better than the available results in literature. • However, non-regular TB-mBJ reproduces the correct experimental band structures

  15. Magic structures of binary metallic clusters

    Science.gov (United States)

    Ferrando, Riccardo

    2005-03-01

    The structure of binary metallic clusters is investigated by a variety of computational tools, ranging from genetic and basin-hopping global optimization algorithms, to molecular dynamics, and to density-functional calculations. Three different binary systems are investigated: Ag-Cu, Ag-Ni, and Ag-Pd. A new family of magic cluster structures is found. These clusters have the common feature of presenting a perfect core-shell chemical arrangement (with an outer Ag shell of monoatomic thickness) and of being polyicosahedra, that is being made of interpenetrating icosahedra of 13 atoms. Core-shell polyicosahedra are of special stability, which originates from the interplay of different factors. First of all, polyicosahedra are very compact structures, so that they maximize the number of nearest-neighbor bonds for a given size. However, in single-element clusters, these bonds are not optimal, since inner bonds are strongly compressed and surface bonds are expanded. This is the contrary of what is required from the bond order -bond length correlation in metals, which favors contracted surface bonds. In binary clusters, the situation is different. Substituting the inner atoms of a single-element polyicosahedron with different atoms of smaller size, the bonds can relax close to their optimal distance. This leads naturally to the appearance of core-shell polyicosahedra. In Ag-Cu, Ag-Ni and Ag-Pd the formation of these structures is reinforced by the tendency of Ag atoms to surface segregation. A similar mechanism of structural relaxation, originating from the interplay of cluster geometry and bond order - bond length correlation, is also the cause of the destabilization of icosahedral structures in pure Pt and Au clusters . In these clusters, the compressed inner atoms of the icosahedra can relax because of the formation of rosette structures at vertices in the outer layer.

  16. Evaporation of binary mixtures in microgravity

    Science.gov (United States)

    Girgis, Morris; Matta, Nabil; Kolli, Kiran; Brown, Leon; Chubb, Kevin

    1995-01-01

    The motivation of this research is to obtain a better understanding of phase-change heat transfer within single and binary liquid meniscii, both in 1-g and 0-g environments. During phase 1 and part of phase 2, in a glass test cell with an inclined heated plate, 1-6 experiments on pentane with additions of decane up to 3% were conducted to determine the optimum concentration that will exhibit the maximum heat transfer and stability. During phase 2 emphasis was given to explore fundamental research issues and to ultimately develop a reliable capillary pumped loop (CPL) device for low gravity. In related experimental work, it was found that thermocapillary stresses near the contract line could result in a degraded wettability which ultimately could explain the observed failure of CPL devices in zero-gravity environment. Therefore, the current experimental effort investigates the effect of adding binary constituents in improving the thermocapillary characteristics near the contact line within the loop configuration. Achievements during second phase include: (1) Further enhancement of Central State University's Microgravity Laboratory by adding or improving upon capabilities of photography, video imaging, fluid visualization, and general experimental testing capabilities; (2) Experimental results for the inclined plate cell; (3) Modeling effort with a detailed scaling analysis; (4) Additional testing with a tube loop configuration to extend experimental work by Dickens, et al.; (5) Fabrication of a capillary loop to be tested using binary fluid (pentane/decane). The device that has been recently completed will be set up horizontally so that the effect of gravity on the performance is negligible. Testing will cover a wide range of parameters such as decane/pentane concentration, heat input value, heat input location (below or above meniscus), and loop temperature.

  17. Disordered multihyperuniformity derived from binary plasmas

    Science.gov (United States)

    Lomba, Enrique; Weis, Jean-Jacques; Torquato, Salvatore

    2018-01-01

    Disordered multihyperuniform many-particle systems are exotic amorphous states that allow exquisite color sensing capabilities due to their anomalous suppression of density fluctuations for distinct subsets of particles, as recently evidenced in photoreceptor mosaics in avian retina. Motivated by this biological finding, we present a statistical-mechanical model that rigorously achieves disordered multihyperuniform many-body systems by tuning interactions in binary mixtures of nonadditive hard-disk plasmas. We demonstrate that multihyperuniformity competes with phase separation and stabilizes a clustered phase. Our work provides a systematic means to generate disordered multihyperuniform solids, and hence lays the groundwork to explore their potentially unique photonic, phononic, electronic, and transport properties.

  18. Diffusive flux of energy in binary mixtures

    International Nuclear Information System (INIS)

    Sampaio, R.S.

    1976-04-01

    The diffusive flux of energy j tilde is studied through the reduced diffusive flux of energy K tilde, which obeys equations of the form: sim(delta K tilde/delta grad rho sub(α))= sim(delta K tilde/delta grad theta)=0. By a representation theorem, herein proved, is obtained a general representation for K tilde which is simplified, for the case of binary mixtures, using the principle of objectivity. Some consequences of this representation are discussed such as the symmetry of the partial stresses T 1 tilde and T 2 tilde and the difference between the normal stresses [pt

  19. Dynamic Binary Modification Tools, Techniques and Applications

    CERN Document Server

    Hazelwood, Kim

    2011-01-01

    Dynamic binary modification tools form a software layer between a running application and the underlying operating system, providing the powerful opportunity to inspect and potentially modify every user-level guest application instruction that executes. Toolkits built upon this technology have enabled computer architects to build powerful simulators and emulators for design-space exploration, compiler writers to analyze and debug the code generated by their compilers, software developers to fully explore the features, bottlenecks, and performance of their software, and even end-users to extend

  20. in Binary Liquid Mixtures of Ethyl benzoate

    Directory of Open Access Journals (Sweden)

    Shaik Babu

    2012-01-01

    Full Text Available Ultrasonic velocity is measured at 2MHz frequency in the binary mixtures of Ethyl Benzoate with 1-Propanol, 1-Butanol, 1-Pentanol and theoretical values of ultrasonic velocity have been evaluated at 303K using Nomoto's relation, Impedance relation, Ideal mixture relation, Junjie's method and free length theory. Theoretical values are compared with the experimental values and the validity of the theories is checked by applying the chi-square test for goodness of fit and by calculating the average percentage error (APE. A good agreement has been found between experimental and Nomoto’s ultrasonic velocity.

  1. A unified kinetic approach to binary nucleation

    Energy Technology Data Exchange (ETDEWEB)

    Kevrekidis, P.G. [Department of Physics, Rutgers University, 136 Frelinghuysen Road]|[E.O.H.S.I., Rutgers University]|[UMDNJ, 170 Frelinghuysen Road, Piscataway, New Jersey 08854-8019 (United States); Lazaridis, M. [Norwegian Institute for Air Research (NILU), Instittutvein 18, P. O. Box 100, N-2007 Kjeller (Norway); Drossinos, Y. [European Commission, Joint Research Centre, I-21020 Ispra (Vatican City State, Holy See) (Italy); Georgopoulos, P.G. [E.O.H.S.I., Rutgers University]|[UMDNJ, 170 Frelinghuysen Road, Piscataway, New Jersey 08854 (United States)

    1999-11-01

    Two different methods to calculate the steady-state nucleation rate in heteromolecular systems proposed by Stauffer (1976) and Langer (1969) are analyzed. Their mathematical equivalence is explicitly demonstrated, thereby obtaining a generic expression for the rate of binary nucleation. Its numerical evaluation does not entail rotation of the coordinate system at the saddle point, but it only requires data in the natural coordinate system of number fluctuations, namely molecular impingement rates, the droplet free energy and its second order derivatives at the saddle point, and the total density of condensible vapors. {copyright} {ital 1999 American Institute of Physics.}

  2. Binary breeder reactor with annular core

    International Nuclear Information System (INIS)

    Nascimento, J.A. do; Ishiguro, Y.

    1988-01-01

    Characteristics of a 1200 MWe binary breeder reactor with annular core fueled with metallic 233 U- 238 U-Zr, Pu- 238 U-Zr and Th in the blankets have been analyzed. The Doppler effect is small as expected in a metal fueled fast reactor. The sodium void reactivity is, in general, smaller than in homogeneous fast reactors fueled with metallic fuel and with 1 m core height. The worths of available control is high and there is a large shutdown margin throughout the operational cycle. There are flexibility in blankets fueling in the two cycles, uranium and thorium, with doubling times of about 20 years. (author) [pt

  3. Burnup characteristics of binary breeder reactors

    International Nuclear Information System (INIS)

    Dias, A.F.; Nascimento, J.A. do; Ishiguro, Y.

    1983-01-01

    Burnup calculations of a binary breeder reactor have been done for two cases of fueling. In one case the U 233 /TH fueled inner core and the Pu/U-fueled outer core have the same number of fuel assemblies. In the other case two outermost rings in the inner core are Pu/U-fueled. The second case is considered for an initial phase of thorim cycle introduction when the supply of U 233 could be limited. Results show an efficient breeding on the thorium cycle in both cases. (Author) [pt

  4. Pycnonuclear reaction rates for binary ionic mixtures

    Science.gov (United States)

    Ichimaru, S.; Ogata, S.; Van Horn, H. M.

    1992-01-01

    Through a combination of compositional scaling arguments and examinations of Monte Carlo simulation results for the interparticle separations in binary-ionic mixture (BIM) solids, we have derived parameterized expressions for the BIM pycnonuclear rates as generalizations of those in one-component solids obtained previously by Salpeter and Van Horn and by Ogata et al. We have thereby discovered a catalyzing effect of the heavier elements, which enhances the rates of reactions among the lighter elements when the charge ratio exceeds a critical value of approximately 2.3.

  5. HD 161306: a radiatively interacting Be binary?

    Czech Academy of Sciences Publication Activity Database

    Koubský, Pavel; Kotková, Lenka; Kraus, Michaela; Yang, S.; Šlechta, Miroslav; Harmanec, P.; Wolf, M.; Votruba, Viktor; Kubát, Jiří; Kubátová, Brankica; Niemczura, E.; Škoda, Petr

    2014-01-01

    Roč. 567, July (2014), A57/1-A57/4 ISSN 0004-6361 R&D Projects: GA ČR(CZ) GA14-21373S; GA MŠk LG14026 Grant - others:ESA(XE) ESA-PECS project no. 98058; GA ČR(CZ) GAP209/10/0715 Program:GA Institutional support: RVO:67985815 Keywords : binaries: spectroscopic * stars: emission -line * Be: stars Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.378, year: 2014

  6. The Boundary Layer in compact binaries

    OpenAIRE

    Hertfelder, Marius; Kley, Wilhelm; Suleimanov, Valery; Werner, Klaus

    2013-01-01

    Disk accretion onto stars leads to the formation of a Boundary Layer (BL) near the stellar surface where the disk makes contact with the star. Albeit a large fraction of the total luminosity of the system originates from this tiny layer connecting the accretion disk and the accreting object, its structure has not been fully understood yet. It is the aim of this work, to obtain more insight into the Boundary Layer around the white dwarf in compact binary systems. There are still many uncertain...

  7. Binary DNA nanostructures for data encryption.

    Directory of Open Access Journals (Sweden)

    Ken Halvorsen

    Full Text Available We present a simple and secure system for encrypting and decrypting information using DNA self-assembly. Binary data is encoded in the geometry of DNA nanostructures with two distinct conformations. Removing or leaving out a single component reduces these structures to an encrypted solution of ssDNA, whereas adding back this missing "decryption key" causes the spontaneous formation of the message through self-assembly, enabling rapid read out via gel electrophoresis. Applications include authentication, secure messaging, and barcoding.

  8. NONLINEAR TIDES IN CLOSE BINARY SYSTEMS

    International Nuclear Information System (INIS)

    Weinberg, Nevin N.; Arras, Phil; Quataert, Eliot; Burkart, Josh

    2012-01-01

    We study the excitation and damping of tides in close binary systems, accounting for the leading-order nonlinear corrections to linear tidal theory. These nonlinear corrections include two distinct physical effects: three-mode nonlinear interactions, i.e., the redistribution of energy among stellar modes of oscillation, and nonlinear excitation of stellar normal modes by the time-varying gravitational potential of the companion. This paper, the first in a series, presents the formalism for studying nonlinear tides and studies the nonlinear stability of the linear tidal flow. Although the formalism we present is applicable to binaries containing stars, planets, and/or compact objects, we focus on non-rotating solar-type stars with stellar or planetary companions. Our primary results include the following: (1) The linear tidal solution almost universally used in studies of binary evolution is unstable over much of the parameter space in which it is employed. More specifically, resonantly excited internal gravity waves in solar-type stars are nonlinearly unstable to parametric resonance for companion masses M' ∼> 10-100 M ⊕ at orbital periods P ≈ 1-10 days. The nearly static 'equilibrium' tidal distortion is, however, stable to parametric resonance except for solar binaries with P ∼ 3 [P/10 days] for a solar-type star) and drives them as a single coherent unit with growth rates that are a factor of ≈N faster than the standard three-wave parametric instability. These are local instabilities viewed through the lens of global analysis; the coherent global growth rate follows local rates in the regions where the shear is strongest. In solar-type stars, the dynamical tide is unstable to this collective version of the parametric instability for even sub-Jupiter companion masses with P ∼< a month. (4) Independent of the parametric instability, the dynamical and equilibrium tides excite a wide range of stellar p-modes and g-modes by nonlinear inhomogeneous forcing

  9. X-ray binaries, part 1

    International Nuclear Information System (INIS)

    Hammerschlag-Hensberge, G.C.M.J.

    1977-01-01

    Optical observations of X-ray binaries and their interpretation are described. A number of early-type stars which are identified as companions of X-ray sources are photometrically and spectroscopically observed. The spectra were obtained with the coude spectrograph attached to the 1.5 m telescope of the European Southern Observatory, La Silla, Chile. Registrations of the spectra were made with the Faul-Coradi microphotometer of the Observatory at Utrecht. To study radial velocity variations, the positions of the spectral lines were measured with the Grant comparator of the University of Groningen

  10. Electrostatic collection efficiency in binary fluidized beds

    Energy Technology Data Exchange (ETDEWEB)

    Romero, A.; Guardiola, J.; Rincon, J. (Univ. of Alcala de Henares, Madrid (Spain))

    1992-01-01

    Fluidized beds of binary mixtures have been used to clean air streams containing dust particles in the size range 4.4 to 14 {mu}m. All beds were composed of glass beads and plastic granules mixed at different proportions. The effect on the electrostatic collection efficiency of a number of variables, including type of collecting mixture, bed height, and gas velocity, was examined. To calculate the single collection efficiency from experimental results, an early model proposed by Clift et al. was used. The electrostatic collection efficiency was determined by subtracting the other individual mechanism efficiencies from the single particle collection efficiency.

  11. Gas filtration in binary fluidized beds

    Energy Technology Data Exchange (ETDEWEB)

    Rincon, J. (Univ. de Castilla-La Mancha, Ciudad Real (Spain)); Guardiola, J.; Romero, A. (Univ. de Alcala de Henares, Madrid (Spain))

    1992-12-01

    A systematic experimental study of aerosol filtration in a binary fluidized bed of dielectric material is carried out. Measurements of the collection efficiency when such parameters as gas velocity, bed height, collecting mixture, and column diameter are varied over a wide range have been made. Experimental evidence is given to show that charges generated naturally by triboelectrification of the bed dielectric particles can considerably increase the efficiency of such beds. Furthermore, it is demonstrated that a proper choice of the fluidized mixture can significantly improve the performance of such filters.

  12. On Binary-State Phyllosilicate Automata

    Science.gov (United States)

    Adamatzky, Andrew

    Phyllosilicate is a sheet of silicate tetrahedra bound by basal oxygens. A phyllosilicate automaton is a regular network of finite state machines, which mimics the structure of phyllosilicate. A node of a binary state phyllosilicate automaton takes states 0 and 1. A node updates its state in discrete time depending on a sum of states of its three (silicon nodes) or six (oxygen nodes) closest neighbors. We phenomenologically select the main types of patterns generated by phyllosilicate automata based on their shape: convex and concave hulls, almost circularly growing patterns, octagonal patterns, and those with dendritic growth; and, the patterns' interior: disordered, solid, labyrinthine. We also present the rules exhibiting traveling localizations.

  13. Binary Stars and Globular Cluster Dynamics

    Science.gov (United States)

    Fregeau, John M.

    2008-05-01

    In this brief proceedings article I summarize the review talk I gave at the IAU 246 meeting in Capri, Italy, glossing over the well-known results from the literature, but paying particular attention to new, previously unpublished material. This new material includes a careful comparison of the apparently contradictory results of two independent methods used to simulate the evolution of binary populations in dense stellar systems (the direct N-body method of Hurley, Aarseth, & Shara (2007) and the approximate Monte Carlo method of Ivanova et al. (2005)), that shows that the two methods may not actually yield contradictory results, and suggests future work to more directly compare the two methods.

  14. Physical Structure of Four Symbiotic Binaries

    Science.gov (United States)

    Kenyon, Scott J. (Principal Investigator)

    1997-01-01

    Disk accretion powers many astronomical objects, including pre-main sequence stars, interacting binary systems, and active galactic nuclei. Unfortunately, models developed to explain the behavior of disks and their surroundings - boundary layers, jets, and winds - lack much predictive power, because the physical mechanism driving disk evolution - the viscosity - is not understood. Observations of many types of accreting systems are needed to constrain the basic physics of disks and provide input for improved models. Symbiotic stars are an attractive laboratory for studying physical phenomena associated with disk accretion. These long period binaries (P(sub orb) approx. 2-3 yr) contain an evolved red giant star, a hot companion, and an ionized nebula. The secondary star usually is a white dwarf accreting material from the wind of its red giant companion. A good example of this type of symbiotic is BF Cygni: our analysis shows that disk accretion powers the nuclear burning shell of the hot white dwarf and also manages to eject material perpendicular to the orbital plane (Mikolajewska, Kenyon, and Mikolajewski 1989). The hot components in other symbiotic binaries appear powered by tidal overflow from a very evolved red giant companion. We recently completed a study of CI Cygni and demonstrated that the accreting secondary is a solar-type main sequence star, rather than a white dwarf (Kenyon et aL 1991). This project continued our study of symbiotic binary systems. Our general plan was to combine archival ultraviolet and optical spectrophotometry with high quality optical radial velocity observations to determine the variation of line and continuum sources as functions of orbital phase. We were very successful in generating orbital solutions and phasing UV+optical spectra for five systems: AG Dra, V443 Her, RW Hya, AG Peg, and AX Per. Summaries of our main results for these systems appear below. A second goal of our project was to consider general models for the

  15. Binary Modulation Formats in Optical Access Networks

    Directory of Open Access Journals (Sweden)

    Vladimir Tejkal

    2010-01-01

    Full Text Available In this paper the binary modulation formats and their application in passive optical networks have been discussed. Passive optical networks are characterized by dividing the optical signal between several end users by using passive splitters, which added a significant attenuation to the network. The performance of the selected modulation formats, depending on the transmitter power in order to verify that there is no signal distortion, has been examined in our simulations. A minimal error rate of the system for each modulation format has been also examined. Finding a suitable modulation, which would allow extension of the distance and splitting ration in current passive optical networks, has been the main aim.

  16. Astronomical Plate Archives and Binary Blazars Studies

    Czech Academy of Sciences Publication Activity Database

    Hudec, René

    2011-01-01

    Roč. 32, 1-2 (2011), s. 91-95 ISSN 0250-6335. [Conference on Multiwavelength Variability of Blazars. Guangzhou, 22,09,2010-24,09,2010] R&D Projects: GA ČR GA205/08/1207 Grant - others:GA ČR(CZ) GA102/09/0997; MŠMT(CZ) ME09027 Institutional research plan: CEZ:AV0Z10030501 Keywords : astronomical plates * plate archives archives * binary blazars Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 0.400, year: 2011

  17. Generating quality tetrahedral meshes from binary volumes

    DEFF Research Database (Denmark)

    Hansen, Mads Fogtmann; Bærentzen, Jakob Andreas; Larsen, Rasmus

    2010-01-01

    use these measures to generate high quality meshes from signed distance maps. This paper also describes an approach for computing (smooth) signed distance maps from binary volumes as volumetric data in many cases originate from segmentation of objects from imaging techniques such as CT, MRI, etc...... generation algorithm on four examples (torus, Stanford dragon, brain mask, and pig back) and report the dihedral angle, aspect ratio and radius-edge ratio. Even though, the algorithm incorporates none of the mentioned quality measures in the compression stage it receives a good score for all these measures...

  18. Binary magnetic structures in HoEr

    DEFF Research Database (Denmark)

    Howard, B.K.; Bohr, J.

    1991-01-01

    The magnetic structure of a single crystal of the rare earth random alloy Ho50% Er50% has been investigated by elastic neutron diffraction measurements in the temperature range 120-10 K. Three distinct magnetic phases are identified below the Neel temperature of 104 K. The high-temperature phase...... observed between 104 K and 47.5 K is a binary magnetic structure where the holmium and erbium moments belong to different modulated c-axis spirals. The intermediate-temperature phase between 47.5 K and 35 K is a simple basal plane spiral. Below 35 K, the measurements suggest a ferrimagnetic structure...

  19. WIYN Open Cluster Study: Tidal Interactions in Solar type Binaries

    OpenAIRE

    Meibom, S.; Mathieu, R. D.

    2003-01-01

    We present an ongoing study on tidal interactions in late-type close binary stars. New results on tidal circularization are combined with existing data to test and constrain theoretical predictions of tidal circularization in the pre-main-sequence (PMS) phase and throughout the main-sequence phase of stellar evolution. Current data suggest that tidal circularization during the PMS phase sets the tidal cutoff period for binary populations younger than ~1 Gyr. Binary populations older than ~1 G...

  20. Optimal static and dynamic recycling of defective binary devices

    Science.gov (United States)

    Challet, Damien; Pérez Castillo, Isaac

    2004-11-01

    The binary defect combination problem consists in finding a fully working subset from a given ensemble of imperfect binary components. We determine the typical properties of the model using methods of statistical mechanics, in particular the region in the parameter space where there is almost surely at least one fully working subset. Dynamic recycling of a flux of imperfect binary components leads to zero wastage.

  1. CNN-aware Binary Map for General Semantic Segmentation

    OpenAIRE

    Ravanbakhsh, Mahdyar; Mousavi, Hossein; Nabi, Moin; Rastegari, Mohammad; Regazzoni, Carlo

    2016-01-01

    In this paper we introduce a novel method for general semantic segmentation that can benefit from general semantics of Convolutional Neural Network (CNN). Our segmentation proposes visually and semantically coherent image segments. We use binary encoding of CNN features to overcome the difficulty of the clustering on the high-dimensional CNN feature space. These binary codes are very robust against noise and non-semantic changes in the image. These binary encoding can be embedded into the CNN...

  2. Detection of Contact Binaries Using Sparse High Phase Angle Lightcurves

    OpenAIRE

    Lacerda, Pedro

    2007-01-01

    We show that candidate contact binary asteroids can be efficiently identified from sparsely sampled photometry taken at phase angles >60deg. At high phase angle, close/contact binary systems produce distinctive lightcurves that spend most of the time at maximum or minimum (typically >1mag apart) brightness with relatively fast transitions between the two. This means that a few (~5) sparse observations will suffice to measure the large range of variation and identify candidate contact binary s...

  3. Radiology's value chain.

    Science.gov (United States)

    Enzmann, Dieter R

    2012-04-01

    A diagnostic radiology value chain is constructed to define its main components, all of which are vulnerable to change, because digitization has caused disaggregation of the chain. Some components afford opportunities to improve productivity, some add value, while some face outsourcing to lower labor cost and to information technology substitutes, raising commoditization risks. Digital image information, because it can be competitive at smaller economies of scale, allows faster, differential rates of technological innovation of components, initiating a centralization-to-decentralization technology trend. Digitization, having triggered disaggregation of radiology's professional service model, may soon usher in an information business model. This means moving from a mind-set of "reading images" to an orientation of creating and organizing information for greater accuracy, faster speed, and lower cost in medical decision making. Information businesses view value chain investments differently than do small professional services. In the former model, producing a better business product will extend image interpretation beyond a radiologist's personal fund of knowledge to encompass expanding external imaging databases. A follow-on expansion with integration of image and molecular information into a report will offer new value in medical decision making. Improved interpretation plus new integration will enrich and diversify radiology's key service products, the report and consultation. A more robust, information-rich report derived from a "systems" and "computational" radiology approach will be facilitated by a transition from a professional service to an information business. Under health care reform, radiology will transition its emphasis from volume to greater value. Radiology's future brightens with the adoption of a philosophy of offering information rather than "reads" for decision making. Staunchly defending the status quo via turf wars is unlikely to constitute a

  4. Detox fashion supply chain

    CERN Document Server

    2017-01-01

    This first volume on detox fashion discusses various interesting topics including a Toxic-Free Supply Chain for Textiles and Clothing; Environmental Issues in Textiles; Global Regulations, Restrictions & Research; Making the Change: Consumer Adoption of Sustainable Fashion; and Strategies for Detoxing Your Wardrobe. It provides an overview of the chemical-related issues confronting the fashion sector, summarizes global regulations, and discusses how to make the change by changing consumers’ attitude towards adopting sustainable fashion, as well as the best strategies for detoxing our wardrobes.

  5. 6d string chains

    Science.gov (United States)

    Gadde, Abhijit; Haghighat, Babak; Kim, Joonho; Kim, Seok; Lockhart, Guglielmo; Vafa, Cumrun

    2018-02-01

    We consider bound states of strings which arise in 6d (1,0) SCFTs that are realized in F-theory in terms of linear chains of spheres with negative self-intersections 1,2, and 4. These include the strings associated to N small E 8 instantons, as well as the ones associated to M5 branes probing A and D type singularities in M-theory or D5 branes probing ADE singularities in Type IIB string theory. We find that these bound states of strings admit (0,4) supersymmetric quiver descriptions and show how one can compute their elliptic genera.

  6. Musical Markov Chains

    Science.gov (United States)

    Volchenkov, Dima; Dawin, Jean René

    A system for using dice to compose music randomly is known as the musical dice game. The discrete time MIDI models of 804 pieces of classical music written by 29 composers have been encoded into the transition matrices and studied by Markov chains. Contrary to human languages, entropy dominates over redundancy, in the musical dice games based on the compositions of classical music. The maximum complexity is achieved on the blocks consisting of just a few notes (8 notes, for the musical dice games generated over Bach's compositions). First passage times to notes can be used to resolve tonality and feature a composer.

  7. Microfluidic polymerase chain reaction

    Science.gov (United States)

    Maltezos, George; Gomez, Alvaro; Zhong, Jiang; Gomez, Frank A.; Scherer, Axel

    2008-12-01

    We implement microfluidic technology to miniaturize a thermal cycling system for amplifying DNA fragments. By using a microfluidic thermal heat exchanger to cool a Peltier junction, we have demonstrated rapid heating and cooling of small volumes of solution. We use a miniature K-type thermocouple to provide a means for in situ sensing of the temperature inside the microrefrigeration system. By combining the thermocouple, two power supplies controlled by a relay system, and computer automation, we reproduce the function of a commercial polymerase chain reaction thermal cycler and demonstrate amplification of a DNA sample of about 1000 base pairs.

  8. Environmental Retail Supply Chains

    DEFF Research Database (Denmark)

    Kotzab, Herbert; Munch, Hilde; de Faultrier, Birgitte

    2011-01-01

    been undertaken through an investigative approach applying a web-scan framework which included the analysis of web sites and publicly published documents such as annual reports and corporate social responsibility reports. Findings – The authors identified 34 environmental sustainability initiatives...... which were grouped into eight categories; they refer to “fundamental environmental attitude”, “use of energy”, “use of input material”, “product”, “packaging”, “transport”, “consumption” and “waste”. The level of environmental supply chain management can be characterised as very operational and very...

  9. Search for forced oscillations in binaries. 4. The eclipsing binary V436 Per revisited

    Czech Academy of Sciences Publication Activity Database

    Janík, J.; Harmanec, Petr; Lehmann, H.; Yang, S.; Božić, H.; Ak, H.; Hadrava, Petr; Eenens, P.; Ruždjak, D.; Sudar, D.; Hubený, I.; Linnell, A. P.

    2003-01-01

    Roč. 408, č. 2 (2003), s. 611-619 ISSN 0004-6361 R&D Projects: GA ČR GA205/96/0162; GA AV ČR KSK2043105 Institutional research plan: CEZ:AV0Z1003909 Keywords : binaries stars * eclipsing * spectroscopic Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.843, year: 2003

  10. The design of supply chains

    DEFF Research Database (Denmark)

    Bøge Sørensen, Lars

    2004-01-01

    in the existing literature. Describes the conceptexternal specificity and how it's used to design supply chains. Using the concept upstream,archetypes of risk minimal and maximal design are identified. Downstream the conceptdescribes two viable scenarios, one minimizing the impact, the other minimizing......Keywords Supply Chain Management, Supply Chain Design, Literature studyAbstract Argues stability is a design objective for supply chain design alongside cost, leadtime and responsiveness. Performs an extensive literature study on supply chain design,identifies methods, theories and objectives...

  11. Small angle neutron scattering study on short and long chain phosphatidylcholine mixture in trehalose solution

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroshi [Department of Physics, Gunma University, Maebashi, Gunma (Japan)

    2001-03-01

    Trehalose protects cells and proteins against various stresses due to low temperatures or dryness. In order to clarify the molecular mechanism of cryoprotective function of trehalose, we have studied the interaction between trehalose and phosphatidylcholine (PC) which is a main lipid component of cell membranes. In this study, the structural change of a binary PC mixture by the presence of trehalose was investigated by means of small angle neutron scattering. The PC binary mixture studied contains dihexanoyl-PC (diC{sub 6}PC) and dihexadecy-PC (DHPC). The former has short hydrocarbon chains and the latter has long hydrocarbon chains. The scattering profiles from the DHPC/diC{sub 6}PC mixture were changed, depending on trehalose concentrations. This change can be interpreted as suggesting that the presence of trehalose reduces the interfacial area between water and PCs. (author)

  12. Absolute Dimensions of Contact Binary Stars in Baade Window

    Directory of Open Access Journals (Sweden)

    Young Woon Kang

    1999-12-01

    Full Text Available The light curves of the representative 6 contact binary stars observed by OGLE Project of searching for dark matter in our Galaxy have been analyzed by the method of the Wilson and Devinney Differential Correction to find photometric solutions. The orbital inclinations of these binaries are in the range of 52 deg - 69 deg which is lower than that of the solar neighborhood binaries. The Roche lobe filling factor of these binaries are distributed in large range of 0.12 - 0.90. Since absence of spectroscopic observations for these binaries we have found masses of the 6 binary systems based on the intersection between Kepler locus and locus derived from Vandenberg isochrones in the mass - luminosity plane. Then absolute dimensions and distances have been found by combining the masses and the photometric solutions. The distances of the 6 binary systems are distributed in the range of 1 kpc - 6 kpc. This distance range is the limiting range where the contact binaries which have period shorter than a day are visible. Most contact binaries discovered in the Baade window do not belong to the Galactic bulge.

  13. Inferences about binary stellar populations using gravitational wave observations

    Science.gov (United States)

    Wysocki, Daniel; Gerosa, Davide; O'Shaughnessy, Richard; Belczynski, Krzysztof; Gladysz, Wojciech; Berti, Emanuele; Kesden, Michael; Holz, Daniel

    2018-01-01

    With the dawn of gravitational wave astronomy, enabled by the LIGO and Virgo interferometers, we now have a new window into the Universe. In the short time these detectors have been in use, multiple confirmed detections of gravitational waves from compact binary coalescences have been made. Stellar binary systems are one of the likely progenitors of the observed compact binary sources. If this is indeed the case, then we can use measured properties of these binary systems to learn about their progenitors. We will discuss the Bayesian framework in which we make these inferences, and results which include mass and spin distributions.

  14. Modern geothermal power: Binary cycle geothermal power plants

    Science.gov (United States)

    Tomarov, G. V.; Shipkov, A. A.

    2017-04-01

    In the second part of the review of modern geothermal power plant technologies and equipment, a role, a usage scale, and features of application of binary cycle plants in the geothermal economy are considered. Data on the use of low-boiling fluids, their impact on thermal parameters and performance of geothermal binary power units are presented. A retrospective of the use of various low-boiling fluids in industrial binary power units in the world since 1965 is shown. It is noted that the current generating capacity of binary power units running on hydrocarbons is equal to approximately 82.7% of the total installed capacity of all the binary power units in the world. At the same time over the past 5 years, the total installed capacity of geothermal binary power units in 25 countries increased by more than 50%, reaching nearly 1800 MW (hereinafter electric power is indicated), by 2015. A vast majority of the existing binary power plants recovers heat of geothermal fluid in the range of 100-200°C. Binary cycle power plants have an average unit capacity of 6.3 MW, 30.4 MW at single-flash power plants, 37.4 MW at double-flash plants, and 45.4 MW at power plants working on superheated steam. The largest binary cycle geothermal power plants (GeoPP) with an installed capacity of over 60 MW are in operation in the United States and the Philippines. In most cases, binary plants are involved in the production process together with a steam cycle. Requirements to the fluid ensuring safety, reliability, and efficiency of binary power plants using heat of geothermal fluid are determined, and differences and features of their technological processes are shown. Application of binary cycle plants in the technological process of combined GeoPPs makes it possible to recover geothermal fluid more efficiently. Features and advantages of binary cycle plants using multiple fluids, including a Kalina Cycle, are analyzed. Technical characteristics of binary cycle plants produced by various

  15. An Economic Evaluation of Binary Cycle Geothermal Electricity Production

    National Research Council Canada - National Science Library

    Fitzgerald, Crissie

    2003-01-01

    .... Variables such as well flow rate, geothermal gradient and electricity prices were varied to study their influence on the economic payback period for binary cycle geothermal electricity production...

  16. Improving geothermal power plants with a binary cycle

    Science.gov (United States)

    Tomarov, G. V.; Shipkov, A. A.; Sorokina, E. V.

    2015-12-01

    The recent development of binary geothermal technology is analyzed. General trends in the introduction of low-temperature geothermal sources are summarized. The use of single-phase low-temperature geothermal fluids in binary power plants proves possible and expedient. The benefits of power plants with a binary cycle in comparison with traditional systems are shown. The selection of the working fluid is considered, and the influence of the fluid's physicochemical properties on the design of the binary power plant is discussed. The design of binary power plants is based on the chemical composition and energy potential of the geothermal fluids and on the landscape and climatic conditions at the intended location. Experience in developing a prototype 2.5 MW Russian binary power unit at Pauzhetka geothermal power plant (Kamchatka) is outlined. Most binary systems are designed individually for a specific location. Means of improving the technology and equipment at binary geothermal power plants are identified. One option is the development of modular systems based on several binary systems that employ the heat from the working fluid at different temperatures.

  17. Viscosity and surface tension of binary systems of N,N-dimethylformamide with alkan-1-ols at different temperatures

    International Nuclear Information System (INIS)

    Mohammad, Abubaker A.; Alkhaldi, Khaled H.A.E.; AlTuwaim, Mohammad S.; Al-Jimaz, Adel S.

    2013-01-01

    Highlights: ► Physical properties of binary mixtures of DMF+1-pentanol, 1-hexanol, or 1-heptanol. ► Viscosity and surface tension were measured. ►Δη, Δσ σ and G ∗E were calculated using the experimental data. ► H σ and S σ were determined using the surface tension data. ► Semi-empirical relations were used to estimate the viscosity of liquid mixtures. - Abstract: Viscosity η and surface tension σ were measured for binary mixtures of N,N-dimethylformamide DMF with pentan-1-ol, hexan-1-ol, and heptan-1-ol at T = (298.15, 303.15, 308.15, and 313.15) K and atmospheric pressure over the entire mole fraction range. Deviations in viscosity Δη and surface tension Δσ were calculated using experimental results. Moreover, the values of the excess Gibbs free energy of activation G ∗E , surface enthalpy H σ and surface entropy S σ of these mixtures were determined. Viscosity measurements of the binary systems were correlated with Grunberg and Nissan, the three-body and four-body McAllister expressions. Viscosity deviation, surface tension deviation and excess Gibbs energy of activation functions were fitted to the method of Redlich–Kister (R–K) polynomial to estimate the coefficients and standard deviations. The effects of chain length of alkan-1-ols and temperature on the thermodynamic properties of binary systems were studied.

  18. Self-lacing atom chains

    International Nuclear Information System (INIS)

    Zandvliet, Harold J W; Van Houselt, Arie; Poelsema, Bene

    2009-01-01

    The structural and electronic properties of self-lacing atomic chains on Pt modified Ge(001) surfaces have been studied using low-temperature scanning tunnelling microscopy and spectroscopy. The self-lacing chains have a cross section of only one atom, are perfectly straight, thousands of atoms long and virtually defect free. The atomic chains are composed of dimers that have their bonds aligned in a direction parallel to the chain direction. At low temperatures the atomic chains undergo a Peierls transition: the periodicity of the chains doubles from a 2 x to a 4 x periodicity and an energy gap opens up. Furthermore, at low temperatures (T<80 K) novel quasi-one-dimensional electronic states are found. These quasi-one-dimensional electronic states originate from an electronic state of the underlying terrace that is confined between the atomic chains.

  19. TIDAL INTERACTIONS IN MERGING WHITE DWARF BINARIES

    International Nuclear Information System (INIS)

    Piro, Anthony L.

    2011-01-01

    The recently discovered system J0651 is the tightest known detached white dwarf (WD) binary. Since it has not yet initiated Roche-lobe overflow, it provides a relatively clean environment for testing our understanding of tidal interactions. I investigate the tidal heating of each WD, parameterized in terms of its tidal Q parameter. Assuming that the heating can be radiated efficiently, the current luminosities are consistent with Q 1 ∼ 7 x 10 10 and Q 2 ∼ 2 x 10 7 , for the He and C/O WDs, respectively. Conversely, if the observed luminosities are merely from the cooling of the WDs, these estimated values of Q represent the upper limits. A large Q 1 for the He WD means its spin velocity will be slower than that expected if it was tidally locked, which, since the binary is eclipsing, may be measurable via the Rossiter-McLaughlin effect. After one year, gravitational wave emission shifts the time of eclipses by 5.5 s, but tidal interactions cause the orbit to shrink more rapidly, changing the time by up to an additional 0.3 s after a year. Future eclipse timing measurements may therefore infer the degree of tidal locking.

  20. Structure Defect Property Relationships in Binary Intermetallics

    Science.gov (United States)

    Medasani, Bharat; Ding, Hong; Chen, Wei; Persson, Kristin; Canning, Andrew; Haranczyk, Maciej; Asta, Mark

    2015-03-01

    Ordered intermetallics are light weight materials with technologically useful high temperature properties such as creep resistance. Knowledge of constitutional and thermal defects is required to understand these properties. Vacancies and antisites are the dominant defects in the intermetallics and their concentrations and formation enthalpies could be computed by using first principles density functional theory and thermodynamic formalisms such as dilute solution method. Previously many properties of the intermetallics such as melting temperatures and formation enthalpies were statistically analyzed for large number of intermetallics using structure maps and data mining approaches. We undertook a similar exercise to establish the dependence of the defect properties in binary intermetallics on the underlying structural and chemical composition. For more than 200 binary intermetallics comprising of AB, AB2 and AB3 structures, we computed the concentrations and formation enthalpies of vacancies and antisites in a small range of stoichiometries deviating from ideal stoichiometry. The calculated defect properties were datamined to gain predictive capabilities of defect properties as well as to classify the intermetallics for their suitability in high-T applications. Supported by the US DOE under Contract No. DEAC02-05CH11231 under the Materials Project Center grant (Award No. EDCBEE).

  1. GRAVITATIONAL MEMORY IN BINARY BLACK HOLE MERGERS

    International Nuclear Information System (INIS)

    Pollney, Denis; Reisswig, Christian

    2011-01-01

    In addition to the dominant oscillatory gravitational wave signals produced during binary inspirals, a non-oscillatory component arises from the nonlinear 'memory' effect, sourced by the emitted gravitational radiation. The memory grows significantly during the late-inspiral and merger, modifying the signal by an almost step-function profile, and making it difficult to model by approximate methods. We use numerical evolutions of binary black holes (BHs) to evaluate the nonlinear memory during late-inspiral, merger, and ringdown. We identify two main components of the signal: the monotonically growing portion corresponding to the memory, and an oscillatory part which sets in roughly at the time of merger and is due to the BH ringdown. Counterintuitively, the ringdown is most prominent for models with the lowest total spin. Thus, the case of maximally spinning BHs anti-aligned to the orbital angular momentum exhibits the highest signal-to-noise ratio (S/N) for interferometric detectors. The largest memory offset, however, occurs for highly spinning BHs, with an estimated value of h tot 20 ≅ 0.24 in the maximally spinning case. These results are central to determining the detectability of nonlinear memory through pulsar timing array measurements.

  2. Binary Polymer Brushes of Strongly Immiscible Polymers.

    Science.gov (United States)

    Chu, Elza; Babar, Tashnia; Bruist, Michael F; Sidorenko, Alexander

    2015-06-17

    The phenomenon of microphase separation is an example of self-assembly in soft matter and has been observed in block copolymers (BCPs) and similar materials (i.e., supramolecular assemblies (SMAs) and homo/block copolymer blends (HBCs)). In this study, we use microphase separation to construct responsive polymer brushes that collapse to generate periodic surfaces. This is achieved by a chemical reaction between the minor block (10%, poly(4-vinylpyridine)) of the block copolymer and a substrate. The major block of polystyrene (PS) forms mosaic-like arrays of grafted patches that are 10-20 nm in size. Depending on the nature of the assembly (SMA, HBC, or neat BCP) and annealing method (exposure to vapors of different solvents or heating above the glass transition temperature), a range of "mosaic" brushes with different parameters can be obtained. Successive grafting of a secondary polymer (polyacrylamide, PAAm) results in the fabrication of binary polymer brushes (BPBs). Upon being exposed to specific selective solvents, BPBs may adopt different conformations. The surface tension and adhesion of the binary brush are governed by the polymer occupying the top stratum. The "mosaic" brush approach allows for a combination of strongly immiscible polymers in one brush. This facilitates substantial contrast in the surface properties upon switching, previously only possible for substrates composed of predetermined nanostructures. We also demonstrate a possible application of such PS/PAAm brushes in a tunable bioadhesion-bioadhesive (PS on top) or nonbioadhesive (PAAm on top) surface as revealed by Escherichia coli bacterial seeding.

  3. Multilevel Cross-Dependent Binary Longitudinal Data

    KAUST Repository

    Serban, Nicoleta

    2013-10-16

    We provide insights into new methodology for the analysis of multilevel binary data observed longitudinally, when the repeated longitudinal measurements are correlated. The proposed model is logistic functional regression conditioned on three latent processes describing the within- and between-variability, and describing the cross-dependence of the repeated longitudinal measurements. We estimate the model components without employing mixed-effects modeling but assuming an approximation to the logistic link function. The primary objectives of this article are to highlight the challenges in the estimation of the model components, to compare two approximations to the logistic regression function, linear and exponential, and to discuss their advantages and limitations. The linear approximation is computationally efficient whereas the exponential approximation applies for rare events functional data. Our methods are inspired by and applied to a scientific experiment on spectral backscatter from long range infrared light detection and ranging (LIDAR) data. The models are general and relevant to many new binary functional data sets, with or without dependence between repeated functional measurements.

  4. ACOUSTIC EFFECTS ON BINARY AEROELASTICITY MODEL

    Directory of Open Access Journals (Sweden)

    Kok Hwa Yu

    2011-10-01

    Full Text Available Acoustics is the science concerned with the study of sound. The effects of sound on structures attract overwhelm interests and numerous studies were carried out in this particular area. Many of the preliminary investigations show that acoustic pressure produces significant influences on structures such as thin plate, membrane and also high-impedance medium like water (and other similar fluids. Thus, it is useful to investigate the structure response with the presence of acoustics on aircraft, especially on aircraft wings, tails and control surfaces which are vulnerable to flutter phenomena. The present paper describes the modeling of structural-acoustic interactions to simulate the external acoustic effect on binary flutter model. Here, the binary flutter model which illustrated as a rectangular wing is constructed using strip theory with simplified unsteady aerodynamics involving flap and pitch degree of freedom terms. The external acoustic excitation, on the other hand, is modeled using four-node quadrilateral isoparametric element via finite element approach. Both equations then carefully coupled and solved using eigenvalue solution. The mentioned approach is implemented in MATLAB and the outcome of the simulated result are later described, analyzed and illustrated in this paper.

  5. Binary rf pulse compression experiment at SLAC

    International Nuclear Information System (INIS)

    Lavine, T.L.; Spalek, G.; Farkas, Z.D.; Menegat, A.; Miller, R.H.; Nantista, C.; Wilson, P.B.

    1990-06-01

    Using rf pulse compression it will be possible to boost the 50- to 100-MW output expected from high-power microwave tubes operating in the 10- to 20-GHz frequency range, to the 300- to 1000-MW level required by the next generation of high-gradient linacs for linear for linear colliders. A high-power X-band three-stage binary rf pulse compressor has been implemented and operated at the Stanford Linear Accelerator Center (SLAC). In each of three successive stages, the rf pulse-length is compressed by half, and the peak power is approximately doubled. The experimental results presented here have been obtained at low-power (1-kW) and high-power (15-MW) input levels in initial testing with a TWT and a klystron. Rf pulses initially 770 nsec long have been compressed to 60 nsec. Peak power gains of 1.8 per stage, and 5.5 for three stages, have been measured. This corresponds to a peak power compression efficiency of about 90% per stage, or about 70% for three stages, consistent with the individual component losses. The principle of operation of a binary pulse compressor (BPC) is described in detail elsewhere. We recently have implemented and operated at SLAC a high-power (high-vacuum) three-stage X-band BPC. First results from the high-power three-stage BPC experiment are reported here

  6. High-quality binary interactome mapping.

    Science.gov (United States)

    Dreze, Matija; Monachello, Dario; Lurin, Claire; Cusick, Michael E; Hill, David E; Vidal, Marc; Braun, Pascal

    2010-01-01

    Physical interactions mediated by proteins are critical for most cellular functions and altogether form a complex macromolecular "interactome" network. Systematic mapping of protein-protein, protein-DNA, protein-RNA, and protein-metabolite interactions at the scale of the whole proteome can advance understanding of interactome networks with applications ranging from single protein functional characterization to discoveries on local and global systems properties. Since the early efforts at mapping protein-protein interactome networks a decade ago, the field has progressed rapidly giving rise to a growing number of interactome maps produced using high-throughput implementations of either binary protein-protein interaction assays or co-complex protein association methods. Although high-throughput methods are often thought to necessarily produce lower quality information than low-throughput experiments, we have recently demonstrated that proteome-scale interactome datasets can be produced with equal or superior quality than that observed in literature-curated datasets derived from large numbers of small-scale experiments. In addition to performing all experimental steps thoroughly and including all necessary controls and quality standards, careful verification of all interacting pairs and validation tests using independent, orthogonal assays are crucial to ensure the release of interactome maps of the highest possible quality. This chapter describes a high-quality, high-throughput binary protein-protein interactome mapping pipeline that includes these features. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. Binary droplet collision at high Weber number.

    Science.gov (United States)

    Pan, Kuo-Long; Chou, Ping-Chung; Tseng, Yu-Jen

    2009-09-01

    By using the techniques developed for generating high-speed droplets, we have systematically investigated binary droplet collision when the Weber number (We) was increased from the range usually tested in previous studies on the order of 10 to a much larger value of about 5100 for water (a droplet at 23 m/s with a diameter of 0.7 mm). Various liquids were also used to explore the effects of viscosity and surface tension. Specifically, beyond the well-known regimes at moderate We's, which exhibited coalescence, separation, and separation followed by satellite droplets, we found different behaviors showing a fingering lamella, separation after fingering, breakup of outer fingers, and prompt splattering into multiple secondary droplets as We was increased. The critical Weber numbers that mark the boundaries between these impact regimes are identified. The specific impact behaviors, such as fingering and prompt splattering or splashing, share essential similarity with those also observed in droplet-surface impacts, whereas substantial variations in the transition boundaries may result from the disparity of the boundary conditions at impacts. To compare the outcomes of both types of collisions, a simple model based on energy conservation was carried out to predict the maximum diameter of an expanding liquid disk for a binary droplet collision. The results oppose the dominance of viscous drag, as proposed by previous studies, as the main deceleration force to effect a Rayleigh-Taylor instability and ensuing periphery fingers, which may further lead to the formations of satellite droplets.

  8. Pattern formation in phase separating binary mixtures.

    Science.gov (United States)

    Sam, Ebie M; Hayase, Yumino; Auernhammer, Günter K; Vollmer, Doris

    2011-08-07

    We experimentally investigate the interplay of thermodynamics with hydrodynamics during phase separation of (quasi-) binary mixtures. Well defined patterns emerge while slowly crossing the cloud point curve. Depending on the material parameters of the experimental system, two distinct scenarios are observed. In quasi-binary mixtures of methanol-hexane patterns appear before macroscopic phase separation sets in. In course of time the patterns turn faint while the overall turbidity of the sample increases until the mixtures become completely turbid. We attribute this pattern formation to a latent heat induced instability resembling a Rayleigh-Bénard instability. This is confirmed by calorimetric data and an estimate of its Rayleigh number. Mixtures of C(4)E(1)-water doped with decane phase separate under heating. After passing the cloud point curve these mixtures first become homogenously turbid. While clearing up, pattern formation is observed. We attribute this type of pattern formation to an interfacial tension induced Bénard-Marangoni instability. The occurrence of the two scenarios is supported by the relevant dimensionless numbers. This journal is © the Owner Societies 2011

  9. Theoretical Bounds of Direct Binary Search Halftoning.

    Science.gov (United States)

    Liao, Jan-Ray

    2015-11-01

    Direct binary search (DBS) produces the images of the best quality among half-toning algorithms. The reason is that it minimizes the total squared perceived error instead of using heuristic approaches. The search for the optimal solution involves two operations: (1) toggle and (2) swap. Both operations try to find the binary states for each pixel to minimize the total squared perceived error. This error energy minimization leads to a conjecture that the absolute value of the filtered error after DBS converges is bounded by half of the peak value of the autocorrelation filter. However, a proof of the bound's existence has not yet been found. In this paper, we present a proof that shows the bound existed as conjectured under the condition that at least one swap occurs after toggle converges. The theoretical analysis also indicates that a swap with a pixel further away from the center of the autocorrelation filter results in a tighter bound. Therefore, we propose a new DBS algorithm which considers toggle and swap separately, and the swap operations are considered in the order from the edge to the center of the filter. Experimental results show that the new algorithm is more efficient than the previous algorithm and can produce half-toned images of the same quality as the previous algorithm.

  10. Inverse halftoning using binary permutation filters.

    Science.gov (United States)

    Kim, Y T; Arce, G R; Grabowski, N

    1995-01-01

    The problem of reconstructing a continuous-tone image given its ordered dithered halftone or its error-diffused halftone image is considered. We develop a modular class of nonlinear filters that can reconstruct the continuous-tone information preserving image details and edges that provide important visual cues. The proposed nonlinear reconstruction algorithms, denoted as binary permutation filters, are based on the space and rank orderings of the halftone samples provided by the multiset permutation of the "on" pixels in a halftone observation window. For a given window size, we obtain a wide range of filters by varying the amount of space-rank ordering information utilized in the estimate. For image reconstructions from ordered dithered halftones, we develop periodically space-varying filters that can account for the periodical nature of the underlying screening process. A class of suboptimal but simpler space-invariant reconstruction filters are also proposed and tested. Constrained LMS type algorithms are employed for the design of reconstruction filters that minimize the reconstruction mean squared error. We present simulations showing that binary permutation filters are modular, robust to image source characteristics, and that they produce high visual quality image reconstruction.

  11. Modeling and analysis of advanced binary cycles

    Energy Technology Data Exchange (ETDEWEB)

    Gawlik, K.

    1997-12-31

    A computer model (Cycle Analysis Simulation Tool, CAST) and a methodology have been developed to perform value analysis for small, low- to moderate-temperature binary geothermal power plants. The value analysis method allows for incremental changes in the levelized electricity cost (LEC) to be determined between a baseline plant and a modified plant. Thermodynamic cycle analyses and component sizing are carried out in the model followed by economic analysis which provides LEC results. The emphasis of the present work is on evaluating the effect of mixed working fluids instead of pure fluids on the LEC of a geothermal binary plant that uses a simple Organic Rankine Cycle. Four resources were studied spanning the range of 265{degrees}F to 375{degrees}F. A variety of isobutane and propane based mixtures, in addition to pure fluids, were used as working fluids. This study shows that the use of propane mixtures at a 265{degrees}F resource can reduce the LEC by 24% when compared to a base case value that utilizes commercial isobutane as its working fluid. The cost savings drop to 6% for a 375{degrees}F resource, where an isobutane mixture is favored. Supercritical cycles were found to have the lowest cost at all resources.

  12. FG-MOS neuron for binary CNN

    Science.gov (United States)

    Flak, Jacek; Laiho, Mika; Halonen, Kari

    2005-06-01

    This paper presents a neuron implementation based on floating-gate MOSFET (FG-MOS) structure. The computation is performed by charge distribution at the input of FG-MOS inverter determining the cell state. There is no current-flow through the interconnections after processing is completed, thus a significant reduction in DC power consumption can be achieved. Such neuron can be used to build a capacitively coupled cellular neural/nonlinear network (CNN) for processing black and white (B/W) images. Although the coupling coefficients are basically implemented with capacitances, this approach provides them with 1-bit programmability. Also the neuron's threshold level can be digitally programmed to four different values. The templates operating on the B/W images can be modified to have only binary-valued {0,1} terms or can be split into such (sequentially run) simple subtasks. Therefore, the presented neuron structure is able to perform the evaluation of almost all B/W templates proposed so far. Exploration of FG-MOS structures can help to understand the implementation problems of capacitively coupled CNNs. Such a situation appears, e.g., in nanoelectronic CNNs composed of single-electron tunneling (SET) transistors, which also deal with B/W images only. Moreover, the binary programmability approach utilized here should help to develop an effective programming scheme for future SET or CMOS-SET hybrid CNN implementations. Along with the neuron structure, its operation description and simulation results of the 8 x 8 network are presented.

  13. Backyard Telescopes Watch an Expanding Binary

    Science.gov (United States)

    Kohler, Susanna

    2018-01-01

    What can you do with a team of people armed with backyard telescopes and a decade of patience? Test how binary star systems evolve under Einsteins general theory of relativity!Unusual VariablesCataclysmic variables irregularly brightening binary stars consisting of an accreting white dwarf and a donor star are a favorite target among amateur astronomers: theyre detectable even with small telescopes, and theres a lot we can learn about stellar astrophysics by observing them, if were patient.Diagram of a cataclysmic variable. In an AM CVn, the donor is most likely a white dwarf as well, or a low-mass helium star. [Philip D. Hall]Among the large family of cataclysmic variables is one unusual type: the extremely short-period AM Canum Venaticorum (AM CVn) stars. These rare variables (only 40 are known) are unique in having spectra dominated by helium, suggesting that they contain little or no hydrogen. Because of this, scientists have speculated that the donor stars in these systems are either white dwarfs themselves or very low-mass helium stars.Why study AM CVn stars? Because their unusual configuration allows us to predict the behavior of their orbital evolution. According to the general theory of relativity, the two components of an AM CVn will spiral closer and closer as the system loses angular momentum to gravitational-wave emission. Eventually they will get so close that the low-mass companion star overflows its Roche lobe, beginning mass transfer to the white dwarf. At this point, the orbital evolution will reverse and the binary orbit will expand, increasing its period.CBA member Enrique de Miguel, lead author on the study, with his backyard telescope in Huelva, Spain. [Enrique de Miguel]Backyard Astronomy Hard at WorkMeasuring the evolution of an AM CVns orbital period is the best way to confirm this model, but this is no simple task! To observe this evolution, we first need a system with a period that can be very precisely measured best achieved with an

  14. LIGO Finds Lightest Black-Hole Binary

    Science.gov (United States)

    Kohler, Susanna

    2017-11-01

    Wednesdayevening the Laser Interferometer Gravitational-wave Observatory (LIGO) collaboration quietly mentioned that theyd found gravitational waves from yet another black-hole binary back in June. This casual announcement reveals what is so far the lightest pair of black holes weve watched merge opening the door for comparisons to the black holes weve detected by electromagnetic means.A Routine DetectionThe chirp signal of GW170608 detected by LIGO Hanford and LIGO Livingston. [LIGO collaboration 2017]After the fanfare of the previous four black-hole-binary merger announcements over the past year and a half as well as the announcement of the one neutron-star binary merger in August GW170608 marks our entry into the era in which gravitational-wave detections are officially routine.GW170608, a gravitational-wave signal from the merger of two black holes roughly a billion light-years away, was detected in June of this year. This detection occurred after wed already found gravitational waves from several black-hole binaries with the two LIGO detectors in the U.S., but before the Virgo interferometer came online in Europe and increased the joint ability of the detectors to localize sources.Mass estimates for the two components of GW170608 using different models. [LIGO collaboration 2017]Overall, GW170608 is fairly unremarkable: it was detected by both LIGO Hanford and LIGO Livingston some 7 ms apart, and the signal looks not unlike those of the previous LIGO detections. But because were still in the early days of gravitational-wave astronomy, every discovery is still remarkable in some way! GW170608 stands out as being the lightest pair of black holes weve yet to see merge, with component masses before the merger estimated at 12 and 7 times the mass of the Sun.Why Size MattersWith the exception of GW151226, the gravitational-wave signal discovered on Boxing Day last year, all of the black holes that have been discovered by LIGO/Virgo have been quite large: the masses

  15. Creative industries value chain: The value chain logic in supply chain relationships

    OpenAIRE

    Emilia Madudová

    2017-01-01

    The purpose of this paper is to provide a deeper look into value chain logic in supply chain relationships in a creative industries value chains. In recent years, value has been recognized as a key factor in better understanding of consumer behavior and gaining a competitive advantage. In a value chain, added value should be defined at every step of the chain. There should be defined activity which adds value as well as the activity that subtracts any value. The total value can be then calcul...

  16. Binary to Octal and Octal to Binary Code Converter Using Mach-Zehnder Interferometer for High Speed Communication

    Science.gov (United States)

    Pal, Amrindra; Kumar, Santosh; Sharma, Sandeep

    2017-05-01

    Binary to octal and octal to binary code converter is a device that allows placing digital information from many inputs to many outputs. Any application of combinational logic circuit can be implemented by using external gates. In this paper, binary to octal and octal to binary code converter is proposed using electro-optic effect inside lithium-niobate based Mach-Zehnder interferometers (MZIs). The MZI structures have powerful capability to switching an optical input signal to a desired output port. The paper constitutes a mathematical description of the proposed device and thereafter simulation using MATLAB. The study is verified using beam propagation method (BPM).

  17. Perceptual biases for rhythm: The Mismatch Negativity latency indexes the privileged status of binary vs non-binary interval ratios.

    Science.gov (United States)

    Pablos Martin, X; Deltenre, P; Hoonhorst, I; Markessis, E; Rossion, B; Colin, C

    2007-12-01

    Rhythm perception appears to be non-linear as human subjects are better at discriminating, categorizing and reproducing rhythms containing binary vs non-binary (e.a. 1:2 vs 1:3) as well as metrical vs non-metrical (e.a. 1:2 vs 1:2.5) interval ratios. This study examined the representation of binary and non-binary interval ratios within the sensory memory, thus yielding a truly sensory, pre-motor, attention-independent neural representation of rhythmical intervals. Five interval ratios, one binary, flanked by four non-binary ones, were compared on the basis of the MMN they evoked when contrasted against a common standard interval. For all five intervals, the larger the contrast was, the larger the MMN amplitude was. The binary interval evoked a significantly much shorter (by at least 23 ms) MMN latency than the other intervals, whereas no latency difference was observed between the four non-binary intervals. These results show that the privileged perceptual status of binary rhythmical intervals is already present in the sensory representations found in echoic memory at an early, automatic, pre-perceptual and pre-motor level. MMN latency can be used to study rhythm perception at a truly sensory level, without any contribution from the motor system.

  18. MARVELS Radial Velocity Solutions to Seven Kepler Eclipsing Binaries

    Science.gov (United States)

    Heslar, Michael Francis; Thomas, Neil B.; Ge, Jian; Ma, Bo; Herczeg, Alec; Reyes, Alan; SDSS-III MARVELS Team

    2016-01-01

    Eclipsing binaries serve momentous purposes to improve the basis of understanding aspects of stellar astrophysics, such as the accurate calculation of the physical parameters of stars and the enigmatic mass-radius relationship of M and K dwarfs. We report the investigation results of 7 eclipsing binary candidates, initially identified by the Kepler mission, overlapped with the radial velocity observations from the SDSS-III Multi-Object APO Radial-Velocity Exoplanet Large-Area Survey (MARVELS). The RV extractions and spectroscopic solutions of these eclipsing binaries were generated by the University of Florida's 1D data pipeline with a median RV precision of ~60-100 m/s, which was utilized for the DR12 data release. We performed the cross-reference fitting of the MARVELS RV data and the Kepler photometric fluxes obtained from the Kepler Eclipsing Binary Catalog (V2) and modelled the 7 eclipsing binaries in the BinaryMaker3 and PHOEBE programs. This analysis accurately determined the absolute physical and orbital parameters of each binary. Most of the companion stars were determined to have masses of K and M dwarf stars (0.3-0.8 M⊙), and allowed for an investigation into the mass-radius relationship of M and K dwarfs. Among the cases are KIC 9163796, a 122.2 day period "heartbeat star", a recently-discovered class of eccentric binaries known for tidal distortions and pulsations, with a high eccentricity (e~0.75) and KIC 11244501, a 0.29 day period, contact binary with a double-lined spectrum and mass ratio (q~0.45). We also report on the possible reclassification of 2 Kepler eclipsing binary candidates as background eclipsing binaries based on the analysis of the flux measurements, flux ratios of the spectroscopic and photometric solutions, the differences in the FOVs, the image processing of Kepler, and RV and spectral analysis of MARVELS.

  19. Polyneutron Chain Reactions

    International Nuclear Information System (INIS)

    John C. Fisher

    2000-01-01

    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of ∼60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N≥12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between 16 O and A Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound 16 O A Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the 16 O and A Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of A Nt is prevented by the buildup of Coulomb energy associated with transforming A Nt into A H in close proximity to 16 O. Thus, it is possible that 16 O A Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the A Nt component can tunnel to an adjacent nucleus, and if the adjacent nucleus is 18 O, a

  20. Stability studies of colloidal silica dispersions in binary solvent mixtures

    International Nuclear Information System (INIS)

    Bean, Keith Howard

    1997-01-01

    A series of monodispersed colloidal silica dispersions, of varying radii, has been prepared. These particles are hydrophilic in nature due to the presence of surface silanol groups. Some of the particles have been rendered hydrophobic by terminally grafting n-alkyl (C 18 ) chains to the surface. The stability of dispersions of these various particles has been studied in binary mixtures of liquids, namely (i) ethanol and cyclohexane, and (ii) benzene and n-heptane. The ethanol - cyclohexane systems have been studied using a variety of techniques. Adsorption excess isotherms have been established and electrophoretic mobility measurements have been made. The predicted stability of the dispersions from D.V.L.O. calculations is compared to the observed stability. The hydrophilic silica particles behave as predicted by the calculations, with the zeta potential decreasing and the van der Waals attraction increasing with increasing cyclohexane concentration. The hydrophobic particles behave differently than expected, and the stability as a function of solvent mixture composition does not show a uniform trend. The effect of varying the coverage of C 18 chains on the surface and the effect of trace water in the systems has also been investigated. Organophilic silica dispersions in benzene - n-heptane solvent mixtures show weak aggregation and phase separation into a diffuse 'gas-like' phase and a more concentrated 'liquid-like' phase, analogous to molecular condensation processes. Calculations of the van der Waals potential as a function of solvent mixture composition show good agreement with the observed stability. Determination of the number of particles in each phase at equilibrium allows the energy of flocculation to be determined using a simple thermodynamic relationship. Finally, the addition of an AB block copolymer to organophilic silica particles in benzene n-heptane solvent mixtures has been shown to have a marked effect on the dispersion stability. This stability

  1. One long chain among shorter chains : the Flory approach revisited

    OpenAIRE

    Raphaël , E.; Fredrickson , G.; Pincus , P.

    1992-01-01

    We consider the mean square end-to-end distance of a long chain immersed in a monodisperse, concentrated solution of shorter, chemically identical chains. In contrast with the earlier work of Flory, no simplifying assumption on the wave vector dependence of the effective potential between segments is made. In order to obtain a closed form expression for the dimension of the long chain, we first derive a general expression for the mean square end-to-end distance of a flexible chain with arbitr...

  2. The glassy wormlike chain

    International Nuclear Information System (INIS)

    Kroy, Klaus; Glaser, Jens

    2007-01-01

    We introduce a new model for the dynamics of a wormlike chain (WLC) in an environment that gives rise to a rough free energy landscape, which we name the glassy WLC. It is obtained from the common WLC by an exponential stretching of the relaxation spectrum of its long-wavelength eigenmodes, controlled by a single parameter E. Predictions for pertinent observables such as the dynamic structure factor and the microrheological susceptibility exhibit the characteristics of soft glassy rheology and compare favourably with experimental data for reconstituted cytoskeletal networks and live cells. We speculate about the possible microscopic origin of the stretching, implications for the nonlinear rheology, and the potential physiological significance of our results

  3. Supply chain reaction

    International Nuclear Information System (INIS)

    Snieckus, Darius

    2000-01-01

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  4. NNSA TRITIUM SUPPLY CHAIN

    Energy Technology Data Exchange (ETDEWEB)

    Wyrick, Steven [Savannah River National Laboratory, Aiken, SC, USA; Cordaro, Joseph [Savannah River National Laboratory, Aiken, SC, USA; Founds, Nanette [National Nuclear Security Administration, Albuquerque, NM, USA; Chambellan, Curtis [National Nuclear Security Administration, Albuquerque, NM, USA

    2013-08-21

    Savannah River Site plays a critical role in the Tritium Production Supply Chain for the National Nuclear Security Administration (NNSA). The entire process includes: • Production of Tritium Producing Burnable Absorber Rods (TPBARs) at the Westinghouse WesDyne Nuclear Fuels Plant in Columbia, South Carolina • Production of unobligated Low Enriched Uranium (LEU) at the United States Enrichment Corporation (USEC) in Portsmouth, Ohio • Irradiation of TPBARs with the LEU at the Tennessee Valley Authority (TVA) Watts Bar Reactor • Extraction of tritium from the irradiated TPBARs at the Tritium Extraction Facility (TEF) at Savannah River Site • Processing the tritium at the Savannah River Site, which includes removal of nonhydrogen species and separation of the hydrogen isotopes of protium, deuterium and tritium.

  5. Impact of Consumer Preferences on Food Chain Choice: An empirical study of consumers in Bratislava

    Directory of Open Access Journals (Sweden)

    Pavol Kita

    2017-01-01

    Full Text Available The objective of this paper is to highlight the use of multiple criteria evaluation methods as a tool for the rating and selection of retail chains from the customers and suppliers perspective. We provide an assessment on the attractiveness of active retail chains on the Slovak market through multiple criteria methods used for the analysis of customer preferences. An analysis was conducted on a sample of consumers in Bratislava involving 11 389 respondents interviewed. The multi-attribute decision-making methods PROMETHEE II and V were used to assess the variants. In the first part of analysis the collected data uncover customers’ preferences in the selection of retail chains. Findings suggest a ranking of evaluated retail chains and thus of customer preferences. Based on the obtained evaluation, in the second part of analysis, a set of retail chains was chosen under constraints concerning the effectiveness of advertising, market share of sales and the maximum number of chosen retail chains and a binary linear programming model was formulated as an outcome. Proposed procedure aims to assist the decision maker in selecting which retail chain to choose for distribution of supplier’s products, and thus maximize benefits, which will result from consumer preferences and service satisfaction level in retail chain.

  6. Light chain amyloidosis

    Directory of Open Access Journals (Sweden)

    Paolo Milani

    2018-03-01

    Full Text Available Light chain (AL amyloidosis is caused by a usually small plasma-cell clone that is able to produce the amyloidogenic lights chains. They are able to misfold and aggregate, deposit in tissues in the form of amyloid fibrils and lead to irreversible organ dysfunction and eventually death if treatment is late or ineffective. Cardiac damage is the most important prognostic determinant. The risk of dialysis is predicted by the severity of renal involvement, defined by the baseline proteinuria and glomerular filtration rate, and by response to therapy. The specific treatment is chemotherapy targeting the underlying plasma-cell clone. This needs be risk adapted, according to the severity of cardiac and/or multi-organ involvement. Autologous stem cell transplant (preceded by induction and/or followed by consolidation with bortezomib-based regimens can be considered for low-risk patients (~20%. Bortezomib combined with alkylators is used in the majority of intermediate-risk patients, and with possible dose escalation in high-risk subjects. Novel, powerful anti-plasma cell agents were investigated in the relapsed/refractory setting, and are being moved to upfront therapy in clinical trials. In addition, the use of novel approaches based on antibodies targeting the amyloid deposits or small molecules interfering with the amyloidogenic process gave promising results in preliminary studies. Some of them are under evaluation in controlled trials. These molecules will probably add powerful complements to standard chemotherapy. The understanding of the specific molecular mechanisms of cardiac damage and the characteristics of the amyloidogenic clone are unveiling novel potential treatment approaches, moving towards a cure for this dreadful disease.

  7. Binary classification posed as a quadratically constrained quadratic ...

    Indian Academy of Sciences (India)

    DEEPAK KUMAR

    Binary classification is one of the active research areas in machine learning [4, 5]. There are several ways to train a binary classifier. The features and the class labels of the training data set can be stored and retrieved during classifica- tion using the nearest neighbor approach [6]. A hyperplane is learnt for classification by ...

  8. A Comparative Study of the Compaction Properties of Binary and ...

    African Journals Online (AJOL)

    Purpose: To comparatively evaluate the tableting properties of binary mixtures and bilayer tablets containing plastic deformation and brittle fracture excipients. Methods: Binary mixture and bilayer tablets of microcrystalline cellulose (MCC), ethyl cellulose, anhydrous lactose and dextrate were prepared by direct compression ...

  9. Neutron Stars in X-ray Binaries and their Environments

    Indian Academy of Sciences (India)

    The X-ray pulsars among the binary neutron stars provide excellent handle to make accurate measurement of the orbital parameters and thus also evolution of the binray orbits that take place over time scale of a fraction of a million years to tens of millions of years. The orbital period evolution of X-ray binaries have shown ...

  10. Phase separation in binary hard-core mixtures

    NARCIS (Netherlands)

    Dijkstra, Marjolein; Frenkel, D.; Hansen, J.-P.

    1994-01-01

    We report the observation of a purely entropic demixing transition in a three-dimensional binary hard-core mixture by computer simulations. This transition is observed in a lattice model of a binary hard-core mixture of parallel cubes provided that the size asymmetry of the large and small particles

  11. Research note : Miscibility behaviour of binary mixtures of benzyl ...

    African Journals Online (AJOL)

    Miscibility of binary mixtures of benzyl benzoate and liquid paraffin as functions of temperature and composition has been determined using phase separation method. The binary mixtures demonstrated a critical (upper) solution temperature of 35 °C at 101325 Nm-2 with a mixing gap. A tie-line drawn at 28 °C across the ...

  12. Progenitor models of Wolf-Rayet+O binary systems

    NARCIS (Netherlands)

    Petrovic, J.; Langer, N.

    2007-01-01

    Since close WR+O binaries are the result of a strong interaction of both stars in massive close binary systems, they can be used to constrain the highly uncertain mass and angular momentum budget during the major mass- transfer phase. We explore the progenitor evolution of the three best suited WR+O

  13. Grammar-Based Specification and Parsing of Binary File Formats

    Directory of Open Access Journals (Sweden)

    William Underwood

    2012-03-01

    Full Text Available The capability to validate and view or play binary file formats, as well as to convert binary file formats to standard or current file formats, is critically important to the preservation of digital data and records. This paper describes the extension of context-free grammars from strings to binary files. Binary files are arrays of data types, such as long and short integers, floating-point numbers and pointers, as well as characters. The concept of an attribute grammar is extended to these context-free array grammars. This attribute grammar has been used to define a number of chunk-based and directory-based binary file formats. A parser generator has been used with some of these grammars to generate syntax checkers (recognizers for validating binary file formats. Among the potential benefits of an attribute grammar-based approach to specification and parsing of binary file formats is that attribute grammars not only support format validation, but support generation of error messages during validation of format, validation of semantic constraints, attribute value extraction (characterization, generation of viewers or players for file formats, and conversion to current or standard file formats. The significance of these results is that with these extensions to core computer science concepts, traditional parser/compiler technologies can potentially be used as a part of a general, cost effective curation strategy for binary file formats.

  14. Formation of Thorne–Żytkow objects in close binaries

    Indian Academy of Sciences (India)

    Bumareyamu Hutilukejiang

    2018-03-06

    Zytkow, may form as a result of unstable mass transfer in a massive X-ray binary after a neutron star (NS) is engulfed in the envelope of its companion star. Using a rapid binary evolution program and the Monte Carlo method, ...

  15. Resonant Tidal Forcing in Close Binaries: Implications for CVs

    Science.gov (United States)

    Ford, K. E. Saavik; McKernan, Barry; Schwab, Elliana

    2018-01-01

    Resonant tidal forcing occurs when the tidal forcing frequency of a binary matches a quadrupolar oscillation mode of one of the binary members and energy is transferred from the orbit of the binary to the mode. Tidal locking permits ongoing resonant driving of modes even as binary orbital parameters change. At small binary separations during tidal lock, a significant fraction of binary orbital energy can be deposited quickly into a resonant mode and the binary decays faster than via the emission of gravitational radiation alone. Here we discuss some of the implications of resonant tidal forcing for the class of binaries known as Cataclysmic Variable (CV) stars. We show that resonant tidal forcing of the donor’s Roche lobe could explain the observed 2‑3hr period gap in CVs, assuming modest orbital eccentricities are allowed (eb ∼ 0.03), and can be complementary or an alternative to, existing models. Sudden collapse of the companion orbit, yielding a Type Ia supernova is disfavoured, since Hydrogen is not observed in Type Ia supernova spectra. Therefore, resonance must generally be truncated, probably via mass loss from the Roche lobe or orbital perturbation, ultimately producing a short period CV containing an ’overheated’ white dwarf.

  16. Lamellar-in-lamellar structure of binary linear multiblock copolymers

    NARCIS (Netherlands)

    Klymko, T.; Subbotin, A.; ten Brinke, G.

    2008-01-01

    A theoretical description of the lamellar-in-lamellar self-assembly of binary A-b-(B-b-A)(m)-b-B-b-A multiblock copolymers in the strong segregation limit is presented. The essential difference between this binary multiblock system and the previously considered C-b-(B-b-A)(m)-b-B-b-C ternary

  17. Binary sequence detector uses minimum number of decision elements

    Science.gov (United States)

    Perlman, M.

    1966-01-01

    Detector of an n bit binary sequence code within a serial binary data system assigns states to memory elements of a code sequence detector by employing the same order of states for the sequence detector as that of the sequence generator when the linear recursion relationship employed by the sequence generator is given.

  18. White dwarf-red dwarf binaries in the Galaxy

    NARCIS (Netherlands)

    Besselaar, E.J.M. van den

    2007-01-01

    This PhD thesis shows several studies on white dwarf - red dwarf binaries. White dwarfs are the end products of most stars and red dwarfs are normal hydrogen burning low-mass stars. White dwarf - red dwarf binaries are both blue (white dwarf) and red (red dwarf). Together with the fact that they are

  19. Binary GCD like Algorithms for Some Complex Quadratic Rings

    DEFF Research Database (Denmark)

    Agarwal, Saurabh; Frandsen, Gudmund Skovbjerg

    2004-01-01

    binary gcd like algorithms for the ring of integers in and , one now has binary gcd like algorithms for all complex quadratic Euclidean domains. The running time of our algorithms is O(n 2) in each ring. While there exists an O(n 2) algorithm for computing the gcd in quadratic number rings by Erich...

  20. Observer bias in randomised clinical trials with binary outcomes

    DEFF Research Database (Denmark)

    Hróbjartsson, Asbjørn; Thomsen, Ann Sofia Skou; Emanuelsson, Frida

    2012-01-01

    To evaluate the impact of non-blinded outcome assessment on estimated treatment effects in randomised clinical trials with binary outcomes.......To evaluate the impact of non-blinded outcome assessment on estimated treatment effects in randomised clinical trials with binary outcomes....