WorldWideScience

Sample records for binary aperiodic chains

  1. A Bayesian model for binary Markov chains

    Directory of Open Access Journals (Sweden)

    Belkheir Essebbar

    2004-02-01

    Full Text Available This note is concerned with Bayesian estimation of the transition probabilities of a binary Markov chain observed from heterogeneous individuals. The model is founded on the Jeffreys' prior which allows for transition probabilities to be correlated. The Bayesian estimator is approximated by means of Monte Carlo Markov chain (MCMC techniques. The performance of the Bayesian estimates is illustrated by analyzing a small simulated data set.

  2. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  3. Renormalization group decimation technique for disordered binary harmonic chains

    International Nuclear Information System (INIS)

    Wiecko, C.; Roman, E.

    1983-10-01

    The density of states of disordered binary harmonic chains is calculated using the Renormalization Group Decimation technique on the displacements of the masses from their equilibrium positions. The results are compared with numerical simulation data and with those obtained with the current method of Goncalves da Silva and Koiller. The advantage of our procedure over other methods is discussed. (author)

  4. Superlattice configurations in linear chain hydrocarbon binary mixtures

    Indian Academy of Sciences (India)

    Unknown

    Long-chain alkanes; binary mixtures; superlattices; discrete orientational changes. 1. Introduction ... tem and a model of superlattice configuration was proposed4, in terms of .... C18 system,4 the angle with value = 3⋅3° was seen to play an ...

  5. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean

    2015-01-01

    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  6. Aperiodic Volume Optics

    Science.gov (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  7. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang

    2017-09-01

    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  8. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  9. Distribution of short block copolymer chains in Binary Blends of Block Copolymers Having Hydrogen Bonding

    Science.gov (United States)

    Kwak, Jongheon; Han, Sunghyun; Kim, Jin Kon

    2014-03-01

    A binary mixture of two block copolymers whose blocks are capable of forming the hydrogen bonding allows one to obtain various microdomains that could not be expected for neat block copolymer. For instance, the binary blend of symmetric polystyrene-block-poly(2-vinylpyridine) copolymer (PS-b-P2VP) and polystyrene-block-polyhydroxystyrene copolymer (PS-b-PHS) blends where the hydrogen bonding occurred between P2VP and PHS showed hexagonally packed (HEX) cylindrical and body centered cubic (BCC) spherical microdomains. To know the exact location of short block copolymer chains at the interface, we synthesized deuterated polystyrene-block-polyhydroxystyrene copolymer (dPS-b-PHS) and prepared a binary mixture with PS-b-P2VP. We investigate, via small angle X-ray scattering (SAXS) and neutron reflectivity (NR), the exact location of shorter dPS block chain near the interface of the microdomains.

  10. Simulation of aperiodic bipedal sprinting.

    Science.gov (United States)

    Celik, Huseyin; Piazza, Stephen J

    2013-08-01

    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  11. Memory functions and correlations in additive binary Markov chains

    International Nuclear Information System (INIS)

    Melnyk, S S; Usatenko, O V; Yampol'skii, V A; Apostolov, S S; Maiselis, Z A

    2006-01-01

    A theory of additive Markov chains with a long-range memory, proposed earlier in Usatenko et al (2003 Phys. Rev. E 68 061107), is developed and used to describe statistical properties of long-range correlated systems. The convenient characteristics of such systems, memory functions and their relation to the correlation properties of the systems are examined. Various methods for finding the memory function via the correlation function are proposed. The inverse problem (calculation of the correlation function by means of the prescribed memory function) is also solved. This is demonstrated for the analytically solvable model of the system with a step-wise memory function

  12. Memory functions and correlations in additive binary Markov chains

    Energy Technology Data Exchange (ETDEWEB)

    Melnyk, S S [A Ya Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Usatenko, O V [A Ya Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Yampol' skii, V A [A Ya Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Apostolov, S S [V N Karazin Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine); Maiselis, Z A [V N Karazin Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine)

    2006-11-17

    A theory of additive Markov chains with a long-range memory, proposed earlier in Usatenko et al (2003 Phys. Rev. E 68 061107), is developed and used to describe statistical properties of long-range correlated systems. The convenient characteristics of such systems, memory functions and their relation to the correlation properties of the systems are examined. Various methods for finding the memory function via the correlation function are proposed. The inverse problem (calculation of the correlation function by means of the prescribed memory function) is also solved. This is demonstrated for the analytically solvable model of the system with a step-wise memory function.

  13. Special frequencies and Lifshitz singularities in binary random harmonic chains

    International Nuclear Information System (INIS)

    Nieuwenhuizen, T.M.; Luck, J.M.; Canisius, J.; van Hemmen, J.L.; Ventevogel, W.J.

    1986-01-01

    The authors consider a one-dimensional chain of coupled harmonic oscillators; the mass of each atom is a random variable taking only two values (M or 1). They investigate the integrated density of states H(omega 2 ) near special frequencies: a given frequency omega/sub s/ with rational wavelength becomes special if the mass ratio M exceeds a certain critical value M/sub c/. They show that H has essential singularities of the types H/sub sg/∼ exp(-C 1 absolute value of omega 2 -omega/sub s/ 2 /sup 1/2/) or exp(-C 2 absolute value of omega 2 -omega/sub s/ 2 -1 ), according to the value of M and the sign of (omega 2 -omega/sub s/ 2 ). The Lifshitz singularity at the band edge is analyzed in the same way. In each case, the constant C 1 or C 2 is evaluated explicitly and compared with a vast amount of numerical work. All these exponential singularities are modulated by periodic amplitudes. The properties of the eigenfunctions with frequencies close to the special values are also discussed, and are illustrated by numerical data

  14. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  15. Modeling long correlation times using additive binary Markov chains: Applications to wind generation time series.

    Science.gov (United States)

    Weber, Juliane; Zachow, Christopher; Witthaut, Dirk

    2018-03-01

    Wind power generation exhibits a strong temporal variability, which is crucial for system integration in highly renewable power systems. Different methods exist to simulate wind power generation but they often cannot represent the crucial temporal fluctuations properly. We apply the concept of additive binary Markov chains to model a wind generation time series consisting of two states: periods of high and low wind generation. The only input parameter for this model is the empirical autocorrelation function. The two-state model is readily extended to stochastically reproduce the actual generation per period. To evaluate the additive binary Markov chain method, we introduce a coarse model of the electric power system to derive backup and storage needs. We find that the temporal correlations of wind power generation, the backup need as a function of the storage capacity, and the resting time distribution of high and low wind events for different shares of wind generation can be reconstructed.

  16. Modeling long correlation times using additive binary Markov chains: Applications to wind generation time series

    Science.gov (United States)

    Weber, Juliane; Zachow, Christopher; Witthaut, Dirk

    2018-03-01

    Wind power generation exhibits a strong temporal variability, which is crucial for system integration in highly renewable power systems. Different methods exist to simulate wind power generation but they often cannot represent the crucial temporal fluctuations properly. We apply the concept of additive binary Markov chains to model a wind generation time series consisting of two states: periods of high and low wind generation. The only input parameter for this model is the empirical autocorrelation function. The two-state model is readily extended to stochastically reproduce the actual generation per period. To evaluate the additive binary Markov chain method, we introduce a coarse model of the electric power system to derive backup and storage needs. We find that the temporal correlations of wind power generation, the backup need as a function of the storage capacity, and the resting time distribution of high and low wind events for different shares of wind generation can be reconstructed.

  17. Characterization of Binary Organogels Based on Some Azobenzene Compounds and Alkyloxybenzoic Acids with Different Chain Lengths

    Directory of Open Access Journals (Sweden)

    Yongmei Hu

    2014-01-01

    Full Text Available In this work the gelation behaviors of binary organogels composed of azobenzene amino derivatives and alkyloxybenzoic acids with different lengths of alkyl chains in various organic solvents were investigated and characterized. The corresponding gelation behaviors in 20 solvents were characterized and shown as new binary organic systems. It showed that the lengths of substituent alkyl chains in compounds have played an important role in the gelation formation of gelator mixtures in present tested organic solvents. Longer methylene chains in molecular skeletons in these gelators seem more suitable for the gelation of present solvents. Morphological characterization showed that these gelator molecules have the tendency to self-assemble into various aggregates from lamella, wrinkle, and belt to dot with change of solvents and gelator mixtures. Spectral characterization demonstrated different H-bond formation and hydrophobic force existing in gels, depending on different substituent chains in molecular skeletons. Meanwhile, these organogels can self-assemble to form monomolecular or multilayer nanostructures owing to the different lengths of due to alkyl substituent chains. Possible assembly modes for present xerogels were proposed. The present investigation is perspective to provide new clues for the design of new nanomaterials and functional textile materials with special microstructures.

  18. Markov Chain Monte Carlo Methods

    Indian Academy of Sciences (India)

    Keywords. Markov chain; state space; stationary transition probability; stationary distribution; irreducibility; aperiodicity; stationarity; M-H algorithm; proposal distribution; acceptance probability; image processing; Gibbs sampler.

  19. Prediction of the Flash Point of Binary and Ternary Straight-Chain Alkane Mixtures

    Directory of Open Access Journals (Sweden)

    X. Li

    2014-01-01

    Full Text Available The flash point is an important physical property used to estimate the fire hazard of a flammable liquid. To avoid the occurrence of fire or explosion, many models are used to predict the flash point; however, these models are complex, and the calculation process is cumbersome. For pure flammable substances, the research for predicting the flash point is systematic and comprehensive. For multicomponent mixtures, especially a hydrocarbon mixture, the current research is insufficient to predict the flash point. In this study, a model was developed to predict the flash point of straight-chain alkane mixtures using a simple calculation process. The pressure, activity coefficient, and other associated physicochemical parameters are not required for the calculation in the proposed model. A series of flash points of binary and ternary mixtures of straight-chain alkanes were determined. The results of the model present consistent experimental results with an average absolute deviation for the binary mixtures of 0.7% or lower and an average absolute deviation for the ternary mixtures of 1.03% or lower.

  20. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  1. Dielectric studies on binary mixtures of Tri-n-butyl phosphate (TBP) and long-chain primary alcohols (modifiers)

    International Nuclear Information System (INIS)

    Dash, S.K.; Swain, B.B.

    1993-01-01

    Dielectric constant (ε) of Tri-n-butyl phosphate (TBP), in binary mixtures with five long-chain primary alcohols viz; 1-butanol, 1-pentanol, 1-hexanol, 1-heptanol and 1-octanol has been measured at ν = 455 kHz and at temperature 302 K. The data is used to evaluate mutual correlation factor g ab , excess molar polarization ΔP and excess free energy of mixing ΔF ab by using Winkelmann-Quitzsch eqn. for binary mixtures to assess the suitability of the alcohols as modifiers. The trend of variation of these parameters exhibit marked dependence on chain-length of the alcohols indicating 1-heptanol to be an efficient modifier. (author)

  2. Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Povinelli, Michelle L

    2011-09-12

    We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.

  3. Studying stellar binary systems with the Laser Interferometer Space Antenna using delayed rejection Markov chain Monte Carlo methods

    International Nuclear Information System (INIS)

    Trias, Miquel; Vecchio, Alberto; Veitch, John

    2009-01-01

    Bayesian analysis of Laser Interferometer Space Antenna (LISA) data sets based on Markov chain Monte Carlo methods has been shown to be a challenging problem, in part due to the complicated structure of the likelihood function consisting of several isolated local maxima that dramatically reduces the efficiency of the sampling techniques. Here we introduce a new fully Markovian algorithm, a delayed rejection Metropolis-Hastings Markov chain Monte Carlo method, to efficiently explore these kind of structures and we demonstrate its performance on selected LISA data sets containing a known number of stellar-mass binary signals embedded in Gaussian stationary noise.

  4. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.

    1997-01-01

    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  5. Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams

    Science.gov (United States)

    Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović

    2017-08-01

    We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.

  6. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

    2011-01-01

    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  7. The phase behavior of a hard sphere chain model of a binary n-alkane mixture

    International Nuclear Information System (INIS)

    Malanoski, A. P.; Monson, P. A.

    2000-01-01

    Monte Carlo computer simulations have been used to study the solid and fluid phase properties as well as phase equilibrium in a flexible, united atom, hard sphere chain model of n-heptane/n-octane mixtures. We describe a methodology for calculating the chemical potentials for the components in the mixture based on a technique used previously for atomic mixtures. The mixture was found to conform accurately to ideal solution behavior in the fluid phase. However, much greater nonidealities were seen in the solid phase. Phase equilibrium calculations indicate a phase diagram with solid-fluid phase equilibrium and a eutectic point. The components are only miscible in the solid phase for dilute solutions of the shorter chains in the longer chains. (c) 2000 American Institute of Physics

  8. The effect of the alkyl chain length on physicochemical features of (ionic liquids + γ-butyrolactone) binary mixtures

    International Nuclear Information System (INIS)

    Papović, Snežana; Bešter-Rogač, Marija; Vraneš, Milan; Gadžurić, Slobodan

    2016-01-01

    Highlights: • Influence of alkyl substituent length on IL properties was studied. • Nature of interactions between studied [C_nC_1im][NTf_2] and GBL were discussed. • Angell strength parameter indicates [C_nC_1im][NTf_2] are fragile liquids. • ILs properties regularly change with increase of the alkyl chain length. • Absence of GBL self-association upon addition of IL is observed. - Abstract: Densities and viscosities were determined and analysed for γ-butyrolactone (GBL) binary mixtures with 1-alkyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ionic liquids (where alkyl = ethyl, hexyl, octyl) as a function of temperature at atmospheric pressure (p = 0.1 MPa) and over the whole composition range. Excess molar volumes have been calculated from the experimental densities and were fitted using Redlich–Kister’s polynomial equation. Other volumetric parameters have been also calculated in order to obtain information about interactions between GBL and imidazolium based ionic liquids with different alkyl chain length. From the viscosity measurements, the Angell strength parameter was calculated for pure ionic liquids indicating that all investigated electrolytes are “fragile” liquids.

  9. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  10. Stochastic resonance in a bistable system subject to multi-time-delayed feedback and aperiodic signal

    International Nuclear Information System (INIS)

    Li Jianlong; Zeng Lingzao

    2010-01-01

    We discuss in detail the effects of the multi-time-delayed feedback driven by an aperiodic signal on the output of a stochastic resonance (SR) system. The effective potential function and dynamical probability density function (PDF) are derived. To measure the performance of the SR system in the presence of a binary random signal, the bit error rate (BER) defined by the dynamical PDF is employed, as is commonly used in digital communications. We find that the delay time, strength of the feedback, and number of time-delayed terms can change the effective potential function and the effective amplitude of the signal, and then affect the BER of the SR system. The numerical simulations strongly support the theoretical results. The goal of this investigation is to explore the effects of the multi-time-delayed feedback on SR and give a guidance to nonlinear systems in the application of information processing.

  11. Markov Chain Monte Carlo

    Indian Academy of Sciences (India)

    be obtained as a limiting value of a sample path of a suitable ... makes a mathematical model of chance and deals with the problem by .... Is the Markov chain aperiodic? It is! Here is how you can see it. Suppose that after you do the cut, you hold the top half in your right hand, and the bottom half in your left. Then there.

  12. Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing

    DEFF Research Database (Denmark)

    Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina

    2016-01-01

    Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...

  13. A method to identify aperiodic disturbances in the ionosphere

    Science.gov (United States)

    Wang, J.-S.; Chen, Z.; Huang, C.-M.

    2014-05-01

    In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  14. Topological aperiodicity for product systems over semigroups of Ore type

    DEFF Research Database (Denmark)

    Kwasniewski, Bartosz; Szymanski, Wojciech

    2016-01-01

    aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...

  15. Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L

    2012-01-02

    We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.

  16. Effect of temperature and chain length on the viscosity and surface tension of binary systems of N,N-dimethylformamide with 1-octanol, 1-nonanol and 1-decanol

    International Nuclear Information System (INIS)

    Mohammad, Abubaker A.; Alkhaldi, Khaled H.A.E.; AlTuwaim, Mohammad S.; Al-Jimaz, Adel S.

    2014-01-01

    Highlights: • Effect of temperature and chain length on η and σ of DMF + 1-alkanol binary systems. • Viscosity and surface tension were obtained. • Δη, Δσ and G ∗E were calculated using the experimental data. • H σ and S σ were determined using the surface tension data. • Semi-empirical relations were used to estimate the viscosity of liquid mixtures. - Abstract: Viscosity and surface tension of binary systems of N,N-dimethylformamide DMF with higher 1-alkanols (C 8 –C 10 ) were measured at atmospheric pressure and four different temperatures over the entire range of mole fraction. The experimental measurements were used to calculate the deviations in viscosity and surface tension. Furthermore, the excess Gibbs free energy of activation, surface enthalpy and surface entropy of the (DMF + 1-alkanols) binary mixtures were determined. In addition, the deviation and excess properties were fitted to the method of Redlich–Kister (R–K) polynomial. Viscosity data of the binary systems were correlated with three different expressions (Grunberg and Nissan, the three-body, and four-body McAllister). The effects of the chain length of the higher 1-alkanols and temperature were investigated

  17. Effect of temperature and composition on the surface tension and surface properties of binary mixtures containing DMSO and short chain alcohols

    International Nuclear Information System (INIS)

    Bagheri, Ahmad; Fazli, Mostafa; Bakhshaei, Malihe

    2016-01-01

    Highlights: • Surface tension of DMSO + alcohol (methanol, ethanol and isopropanol) at various temperatures was measured. • The surface tension data of binary mixtures were correlated with four equations. • Intermolecular interaction of DMSO with alcohol was discussed. • The surface mole fraction of alcohol increase with increasing the length of alcohol chain. - Abstract: Surface tension of binary mixtures of methanol, ethanol and isopropanol with DMSO (dimethyl sulfoxide) was measured over the whole range of composition at atmospheric pressure of 82.5 kPa within the temperatures between (298.15 and 328.15) K. The experimental measurements were used to calculate in surface tension deviations (Δσ). The sign of Δσ for all temperatures is negative (except of methanol/DMSO system) because of the factors of hydrogen bonding and dipole–dipole interactions in the DMSO-alcohol systems. Surface tension values of the binary systems were correlated with FLW, MS, RK and LWW models. The mean standard deviation obtained from the comparison of experimental and calculated surface tension values for binary systems with three models (FLW, MS and RK) at various temperatures is less than 0.83. Also, the results of the LWW model were used to account for the interaction energy between alcohols and DMSO in binary mixtures. The temperature dependence of σ (surface tension) at fixed composition of solutions was used to estimate surface enthalpy, H s , and surface entropy, S s . The results obtained show that the values of the thermodynamic parameters for alcohol/DMSO mixtures decrease with increasing alkyl chain length of alcohol. Finally, the results are discussed in terms of surface mole fraction and lyophobicity using the extended Langmuir (EL) isotherm.

  18. Orbits for 18 Visual Binaries and Two Double-line Spectroscopic Binaries Observed with HRCAM on the CTIO SOAR 4 m Telescope, Using a New Bayesian Orbit Code Based on Markov Chain Monte Carlo

    Science.gov (United States)

    Mendez, Rene A.; Claveria, Ruben M.; Orchard, Marcos E.; Silva, Jorge F.

    2017-11-01

    We present orbital elements and mass sums for 18 visual binary stars of spectral types B to K (five of which are new orbits) with periods ranging from 20 to more than 500 yr. For two double-line spectroscopic binaries with no previous orbits, the individual component masses, using combined astrometric and radial velocity data, have a formal uncertainty of ˜ 0.1 {M}⊙ . Adopting published photometry and trigonometric parallaxes, plus our own measurements, we place these objects on an H-R diagram and discuss their evolutionary status. These objects are part of a survey to characterize the binary population of stars in the Southern Hemisphere using the SOAR 4 m telescope+HRCAM at CTIO. Orbital elements are computed using a newly developed Markov chain Monte Carlo (MCMC) algorithm that delivers maximum-likelihood estimates of the parameters, as well as posterior probability density functions that allow us to evaluate the uncertainty of our derived parameters in a robust way. For spectroscopic binaries, using our approach, it is possible to derive a self-consistent parallax for the system from the combined astrometric and radial velocity data (“orbital parallax”), which compares well with the trigonometric parallaxes. We also present a mathematical formalism that allows a dimensionality reduction of the feature space from seven to three search parameters (or from 10 to seven dimensions—including parallax—in the case of spectroscopic binaries with astrometric data), which makes it possible to explore a smaller number of parameters in each case, improving the computational efficiency of our MCMC code. Based on observations obtained at the Southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inovação (MCTI) da República Federativa do Brasil, the U.S. National Optical Astronomy Observatory (NOAO), the University of North Carolina at Chapel Hill (UNC), and Michigan State University (MSU).

  19. Excess molar enthalpies of binary mixtures containing 2-decanone or dipentyl ether with long-chain n-alkanes at T = 298.15 K

    International Nuclear Information System (INIS)

    Liao, Wei-Chen; Lin, Ho-mu; Lee, Ming-Jer

    2011-01-01

    Research highlights: → An isothermal titration calorimeter was used for enthalpy data measurment. → The investigated systems are 2-decanone or dipentyl ether with long-chain n-alkanes. → The excess enthalpies are all positive over entire composition range. → The Patel-Teja equation of state with two parameters gives the best representation. - Abstract: Excess molar enthalpies (H E ) of binary mixtures of 2-decanone or dipentyl ether with n-alkanes, including n-dodecane, n-tetradecane, and n-hexadecane, were measured with an isothermal titration calorimeter (ITC) at T = 298.15 K under atmospheric pressure. All the measured H E values are positive over the entire range of composition, indicating that all these mixing processes are endothermic. The H E values varying with composition are found to be nearly symmetric for each binary system. It was also shown that the H E values follow the order of n-hexadecane > n-tetradecane > n-dodecane at a given composition in either the 2-decanone or dipentyl ether binary systems. An empirical Redlich-Kister equation correlated quantitatively these new H E data. The Peng-Robinson and the Patel-Teja equations of state, and the NRTL model were also applied to fit the H E results. Among these tested correlative models, the Patel-Teja equation of state with two adjustable binary interaction parameters generally yielded the best representation.

  20. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    Energy Technology Data Exchange (ETDEWEB)

    Findeisen, Krzysztof; Hillenbrand, Lynne [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Cody, Ann Marie, E-mail: krzys@astro.caltech.edu [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States)

    2015-01-10

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs.

  1. Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell

    Science.gov (United States)

    Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.

    2016-08-01

    In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.

  2. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

    2015-01-01

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  3. Renormalization transformation of periodic and aperiodic lattices

    International Nuclear Information System (INIS)

    Macia, Enrique; Rodriguez-Oliveros, Rogelio

    2006-01-01

    In this work we introduce a similarity transformation acting on transfer matrices describing the propagation of elementary excitations through either periodic or Fibonacci lattices. The proposed transformation can act at two different scale lengths. At the atomic scale the transformation allows one to express the systems' global transfer matrix in terms of an equivalent on-site model one. Correlation effects among different hopping terms are described by a series of local phase factors in that case. When acting on larger scale lengths, corresponding to short segments of the original lattice, the similarity transformation can be properly regarded as describing an effective renormalization of the chain. The nature of the resulting renormalized lattice significantly depends on the kind of order (i.e., periodic or quasiperiodic) of the original lattice, expressing a delicate balance between chemical complexity and topological order as a consequence of the renormalization process

  4. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

    Science.gov (United States)

    Kumar, Pawan; Parmananda, P.

    2018-04-01

    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  5. Shape control in wafer-based aperiodic 3D nanostructures

    International Nuclear Information System (INIS)

    Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen

    2014-01-01

    Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)

  6. Weak universality in inhomogeneous Ising quantum chains

    International Nuclear Information System (INIS)

    Karevski, Dragi

    2006-01-01

    The Ising quantum chain with arbitrary coupling distribution {λ i } leading to an anisotropic scaling is considered. The smallest gap of the chain is connected to the surface magnetization by the relation Λ 1 = m s ({λ i })m s ({λ -1 i }). For some aperiodic distribution {λ i }, a weak universality of the critical behaviour is found. (letter to the editor)

  7. Non-commutative Chern numbers for generic aperiodic discrete systems

    Science.gov (United States)

    Bourne, Chris; Prodan, Emil

    2018-06-01

    The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.

  8. Critical phenomena in binary fluid mixtures : Classification of phase equilibria with the simplified-perturbed-hard-chain theory

    NARCIS (Netherlands)

    Van Pelt, A.

    1992-01-01

    I. INTRODUCTION AND THEORY This PhD research is mainly concerned with the global phase behaviour, that is calculated from the Simplified-Perturbed-Hard-Chain equation. This equation distinguishes itself from many other equations of state by a sound theoretical background. We enter the field of the

  9. Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

    Science.gov (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

    2017-11-07

    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  10. Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices

    Directory of Open Access Journals (Sweden)

    Enrique Maciá

    2015-05-01

    Full Text Available Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.

  11. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    International Nuclear Information System (INIS)

    Xie Yong; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

    2004-01-01

    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells

  12. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

    2014-01-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

  13. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    Energy Technology Data Exchange (ETDEWEB)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H. [Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); White, Russel J., E-mail: parksj@chara.gsu.edu [Georgia State University, Department of Physics and Astronomy, 25 Park Place, Room 605, Atlanta, GA 30303 (United States)

    2014-03-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K{sub s} -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK{sub s} -band amplitudes from 0.044 to 2.31 mag and Δ(J – K{sub s} ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K{sub s} time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief

  14. ENERGY-DEPENDENT POWER SPECTRAL STATES AND ORIGIN OF APERIODIC VARIABILITY IN BLACK HOLE BINARIES

    International Nuclear Information System (INIS)

    Yu Wenfei; Zhang Wenda

    2013-01-01

    We found that the black hole candidate MAXI J1659–152 showed distinct power spectra, i.e., power-law noise (PLN) versus band-limited noise (BLN) plus quasi-periodic oscillations (QPOs) below and above about 2 keV, respectively, in observations with Swift and the Rossi X-ray Timing Explorer during the 2010 outburst, indicating a high energy cutoff of the PLN and a low energy cutoff of the BLN and QPOs around 2 keV. The emergence of the PLN and the fading of the BLN and QPOs initially took place below 2 keV when the source entered the hard intermediate state and settled in the soft state three weeks later. The evolution was accompanied by the emergence of the disk spectral component and decreases in the amplitudes of variability in the soft and hard X-ray bands. Our results indicate that the PLN is associated with an optically thick disk in both hard and intermediate states, and the power spectral state is independent of the X-ray energy spectral state in a broadband view. We suggest that in the hard or intermediate state, the BLN and QPOs emerge from the innermost hot flow subjected to Comptonization, while the PLN originates from the optically thick disk farther out. The energy cutoffs of the PLN and the BLN or QPOs then follow the temperature of the seed photons from the inner edge of the optically thick disk, while the high frequency cutoff of the PLN follows the orbital frequency of the inner edge of the optically thick disk as well.

  15. Some remarks about the thermodynamics of discrete finite Markov chains

    Energy Technology Data Exchange (ETDEWEB)

    Siboni, S. [Trento Univ. (Italy). Facolta` di Ingegneria, Dip. di Ingegneria dei Materiali

    1998-08-01

    The Author propose a simple way to define a Hamiltonian for aperiodic Markov chains and to apply these chains in a thermodynamical context. The basic thermodynamic functions are correspondingly calculated. A quite intriguing and nontrivial application to stochastic automata is also pointed out.

  16. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1992-01-01

    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  17. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

    Science.gov (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

    2017-12-01

    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  18. Rate-distortion functions of non-stationary Markoff chains and their block-independent approximations

    OpenAIRE

    Agarwal, Mukul

    2018-01-01

    It is proved that the limit of the normalized rate-distortion functions of block independent approximations of an irreducible, aperiodic Markoff chain is independent of the initial distribution of the Markoff chain and thus, is also equal to the rate-distortion function of the Markoff chain.

  19. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue

    2011-01-01

    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  20. Outer synchronization of complex networks with internal delay and coupling delay via aperiodically intermittent pinning control

    Science.gov (United States)

    Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu

    This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.

  1. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure

    International Nuclear Information System (INIS)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

    2013-01-01

    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)

  2. Simulation methods for multiperiodic and aperiodic nanostructured dielectric waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    2017-01-01

    on Rudin–Shapiro, Fibonacci, and Thue–Morse binary sequences. The near-field and far-field properties are computed employing the finite-element method (FEM), the finite-difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). The results show that all three methods...

  3. Simulation Methods for Multiperiodic and Aperiodic Nanostructured Dielectric Waveguides

    DEFF Research Database (Denmark)

    Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina

    on Rudin-Shapiro, Fibonacci, and Thue-Morse binary sequences. The near-field and far-field properties are calculated employing the finite-element method (FEM), the finite- difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). References [1] S. V. Boriskina, A. Gopinath...

  4. An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.

  5. Interacting binaries

    International Nuclear Information System (INIS)

    Eggleton, P.P.; Pringle, J.E.

    1985-01-01

    This volume contains 15 review articles in the field of binary stars. The subjects reviewed span considerably, from the shortest period of interacting binaries to the longest, symbiotic stars. Also included are articles on Algols, X-ray binaries and Wolf-Rayet stars (single and binary). Contents: Preface. List of Participants. Activity of Contact Binary Systems. Wolf-Rayet Stars and Binarity. Symbiotic Stars. Massive X-ray Binaries. Stars that go Hump in the Night: The SU UMa Stars. Interacting Binaries - Summing Up

  6. Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators

    DEFF Research Database (Denmark)

    Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde

    2014-01-01

    and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...

  7. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2014-01-01

    in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...

  8. Influences of Fundamental Frequency, Formant Frequencies, Aperiodicity, and Spectrum Level on the Perception of Voice Gender

    Science.gov (United States)

    Skuk, Verena G.; Schweinberger, Stefan R.

    2014-01-01

    Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…

  9. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

    2012-01-01

    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  10. Near-to far-field transformation in the aperiodic Fourier modal method

    NARCIS (Netherlands)

    Rook, R.; Pisarenco, M.; Setija, I.D.

    2013-01-01

    This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by

  11. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  12. Probing and exploiting the chaotic dynamics of a hydrodynamic photochemical oscillator to implement all the basic binary logic functions

    Energy Technology Data Exchange (ETDEWEB)

    Hayashi, Kenta [Department of Mechanical Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu-shi, Shiga 525-8577 (Japan); Department of Chemistry, Biology, and Biotechnology, University of Perugia, 06123 Perugia (Italy); Gotoda, Hiroshi [Department of Mechanical Engineering, Tokyo University of Science, 6-3-1 Niijuku, Katsushika-ku, Tokyo 125-8585 (Japan); Gentili, Pier Luigi, E-mail: pierluigi.gentili@unipg.it [Department of Chemistry, Biology, and Biotechnology, University of Perugia, 06123 Perugia (Italy)

    2016-05-15

    The convective motions within a solution of a photochromic spiro-oxazine being irradiated by UV only on the bottom part of its volume, give rise to aperiodic spectrophotometric dynamics. In this paper, we study three nonlinear properties of the aperiodic time series: permutation entropy, short-term predictability and long-term unpredictability, and degree distribution of the visibility graph networks. After ascertaining the extracted chaotic features, we show how the aperiodic time series can be exploited to implement all the fundamental two-inputs binary logic functions (AND, OR, NAND, NOR, XOR, and XNOR) and some basic arithmetic operations (half-adder, full-adder, half-subtractor). This is possible due to the wide range of states a nonlinear system accesses in the course of its evolution. Therefore, the solution of the convective photochemical oscillator results in hardware for chaos-computing alternative to conventional complementary metal-oxide semiconductor-based integrated circuits.

  13. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2013-01-01

    This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...

  14. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li

    2014-04-01

    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  15. Interacting binaries

    CERN Document Server

    Shore, S N; van den Heuvel, EPJ

    1994-01-01

    This volume contains lecture notes presented at the 22nd Advanced Course of the Swiss Society for Astrophysics and Astronomy. The contributors deal with symbiotic stars, cataclysmic variables, massive binaries and X-ray binaries, in an attempt to provide a better understanding of stellar evolution.

  16. Trojan Binaries

    Science.gov (United States)

    Noll, K. S.

    2017-12-01

    The Jupiter Trojans, in the context of giant planet migration models, can be thought of as an extension of the small body populations found beyond Neptune in the Kuiper Belt. Binaries are a distinctive feature of small body populations in the Kuiper Belt with an especially high fraction apparent among the brightest Cold Classicals. The binary fraction, relative sizes, and separations in the dynamically excited populations (Scattered, Resonant) reflects processes that may have eroded a more abundant initial population. This trend continues in the Centaurs and Trojans where few binaries have been found. We review new evidence including a third resolved Trojan binary and lightcurve studies to understand how the Trojans are related to the small body populations that originated in the outer protoplanetary disk.

  17. Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates

    Science.gov (United States)

    Yu, Yisheng

    This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.

  18. Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances

    Science.gov (United States)

    Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong

    2017-11-01

    Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.

  19. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

    Science.gov (United States)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

    2016-02-01

    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  20. Optimized emission in nanorod arrays through quasi-aperiodic inverse design.

    Science.gov (United States)

    Anderson, P Duke; Povinelli, Michelle L

    2015-06-01

    We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.

  1. Combinations of response-reinforcer relations in periodic and aperiodic schedules.

    Science.gov (United States)

    Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E

    2013-03-01

    Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.

  2. Investigation of aperiodic W/C multi-layer mirror for X-ray optics

    International Nuclear Information System (INIS)

    Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan

    2011-01-01

    Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.

  3. Aperiodic linear networked control considering variable channel delays: application to robots coordination.

    Science.gov (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

    2015-05-27

    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  4. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos

    2015-05-01

    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  5. Binary effectivity rules

    DEFF Research Database (Denmark)

    Keiding, Hans; Peleg, Bezalel

    2006-01-01

    is binary if it is rationalized by an acyclic binary relation. The foregoing result motivates our definition of a binary effectivity rule as the effectivity rule of some binary SCR. A binary SCR is regular if it satisfies unanimity, monotonicity, and independence of infeasible alternatives. A binary...

  6. Application of the three-dimensional aperiodic Fourier modal method using arc elements in curvilinear coordinates.

    Science.gov (United States)

    Bucci, Davide; Martin, Bruno; Morand, Alain

    2012-03-01

    This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.

  7. Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene

    Science.gov (United States)

    Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel

    2016-01-01

    We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.

  8. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...

  9. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    Science.gov (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  10. Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number

    Science.gov (United States)

    Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.

    2017-09-01

    Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.

  11. Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers

    Science.gov (United States)

    Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.

    2018-02-01

    Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.

  12. Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.

    Science.gov (United States)

    Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S

    2016-01-15

    Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.

  13. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.

    1992-09-01

    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  14. The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns

    Science.gov (United States)

    Duarte, Fabiola; Lemus, Luis

    2017-01-01

    The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406

  15. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

    2012-02-01

    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  16. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  17. Dual-wavelength green laser with a 4.5 THz frequency difference based on self-frequency- doubling in Nd3+ -doped aperiodically poled lithium niobate.

    Science.gov (United States)

    Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J

    2008-05-01

    We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.

  18. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon

    2009-06-01

    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  19. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    Science.gov (United States)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  20. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

    2011-01-01

    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  1. Synchronization of coupled stochastic complex-valued dynamical networks with time-varying delays via aperiodically intermittent adaptive control

    Science.gov (United States)

    Wang, Pengfei; Jin, Wei; Su, Huan

    2018-04-01

    This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.

  2. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

    Science.gov (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

    2001-04-01

    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  3. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

    Science.gov (United States)

    Koju, Vijay

    Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

  4. A novel scenario of aperiodical impacts appearance in the turbine draft tube

    Science.gov (United States)

    Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.

    2016-11-01

    The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.

  5. A binary plasmid system for shuffling combinatorial antibody libraries.

    OpenAIRE

    Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A

    1992-01-01

    We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind a...

  6. Theoretical and experimental study of bent fully aperiodic large-pitch fibers for enhancing the high-order modes delocalization

    Science.gov (United States)

    du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe

    2018-02-01

    The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.

  7. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

    Science.gov (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

    2018-03-01

    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  8. Time variability of X-ray binaries: observations with INTEGRAL. Modeling

    International Nuclear Information System (INIS)

    Cabanac, Clement

    2007-01-01

    The exact origin of the observed X and Gamma ray variability in X-ray binaries is still an open debate in high energy astrophysics. Among others, these objects are showing aperiodic and quasi-periodic luminosity variations on timescales as small as the millisecond. This erratic behavior must put constraints on the proposed emission processes occurring in the vicinity of the neutrons star or the stellar mass black-hole held by these objects. We propose here to study their behavior following 3 different ways: first we examine the evolution of a particular X-ray source discovered by INTEGRAL, IGR J19140+0951. Using timing and spectral data given by different instruments, we show that the source type is plausibly consistent with a High Mass X-ray Binary hosting a neutrons star. Subsequently, we propose a new method dedicated to the study of timing data coming from coded mask aperture instruments. Using it on INTEGRAL/ISGRI real data, we detect the presence of periodic and quasi-periodic features in some pulsars and micro-quasars at energies as high as a hundred keV. Finally, we suggest a model designed to describe the low frequency variability of X-ray binaries in their hardest state. This model is based on thermal comptonization of soft photons by a warm corona in which a pressure wave is propagating in cylindrical geometry. By computing both numerical simulations and analytical solution, we show that this model should be suitable to describe some of the typical features observed in X-ray binaries power spectra in their hard state and their evolution such as aperiodic noise and low frequency quasi-periodic oscillations. (author) [fr

  9. Achieving sub-50 nm controlled diameter of aperiodic Si nanowire arrays by ultrasonic catalyst removal for photonic applications

    Science.gov (United States)

    Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit

    2018-05-01

    We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.

  10. Solving a binary puzzle

    NARCIS (Netherlands)

    Utomo, P.H.; Makarim, R.H.

    2017-01-01

    A Binary puzzle is a Sudoku-like puzzle with values in each cell taken from the set {0,1} {0,1}. Let n≥4 be an even integer, a solved binary puzzle is an n×n binary array that satisfies the following conditions: (1) no three consecutive ones and no three consecutive zeros in each row and each

  11. Eclipsing binaries in open clusters

    DEFF Research Database (Denmark)

    Southworth, John; Clausen, J.V.

    2006-01-01

    Stars: fundamental parameters - Stars : binaries : eclipsing - Stars: Binaries: spectroscopic - Open clusters and ass. : general Udgivelsesdato: 5 August......Stars: fundamental parameters - Stars : binaries : eclipsing - Stars: Binaries: spectroscopic - Open clusters and ass. : general Udgivelsesdato: 5 August...

  12. Markov chains with exponentially small transition probabilities: First exit problem from a general domain. II. The general case

    International Nuclear Information System (INIS)

    Olivieri, E.; Scoppola, E.

    1996-01-01

    In this paper we consider aperiodic ergodic Markov chains with transition probabilities exponentially small in a large parameter β. We extend to the general, not necessarily reversible case the analysis, started in part I of this work, of the first exit problem from a general domain Q containing many stable equilibria (attracting equilibrium points for the β = ∞ dynamics). In particular we describe the tube of typical trajectories during the first excursion outside Q

  13. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

    Science.gov (United States)

    Kato, N.

    2017-12-01

    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  14. Composite Binary Sequences with a Large Ensemble and Zero Correlation Zone

    Directory of Open Access Journals (Sweden)

    S. S. Yudachev

    2015-01-01

    Full Text Available The article considers a proposed class of derived signals such as composite binary sequences for application in advanced spread spectrum radio systems of various purposes, using signals based on spectrum spreading by direct sequence method. Considered composite sequences, having a representative set of lengths and unique correlation properties, compares favorably with the widely used at present large ensembles formed on a single algorithmic basis. To evaluate the properties of the composite sequences generated on the basis of two components - the Barker code and Kerdock sequences, expressions of periodic and aperiodic correlation functions are given.An algorithm for generating practical ensembles of composite sequences is presented. On the basis of the algorithm and its software implementation in C #, the samples of the sequence ensembles of various lengths were obtained and their periodic and aperiodic correlation functions and statistical characteristics were studied in detail. As an illustration, some of the most typical correlation functions are presented. The most remarkable characteristics allowing a ssessing the feasibility of using this type of sequences in the design of specific types of radio systems are considered.On the basis of the proposed program and the performed calculations the conclusions can be drawn about the possibility of using the sequences of these classes, with the aim of reducing intra-system disturbance in the projected spread spectrum CDMA.

  15. Study and realisation of chaining operators

    International Nuclear Information System (INIS)

    Khan, Mohd Solaiman

    1970-01-01

    Within the frame of researches in the field of binary analysis performed in the nuclear instrumentation department of the Saclay Nuclear Centre, this research thesis belongs to the field of applications of binary analysis theories, and more particularly to the development and study of a chaining operator (chaining operators are used to develop complex automatic systems with a clear separation between information processing and program-based management of this processing). The author first recalls some notions of binary analysis: algebraic binary sets, products and their specific properties, and practical realisation of binary functions by means of logical circuits. He recalls methods for the general study of sequential systems; generalities, base functions, elementary reflex functions, graphical study of sequential systems, search for and removal of commutation variations. He discusses the present organisation of electronic computers: software, hardware, synchronous and asynchronous control. He presents chaining operators: generalities, computation of a chaining operator, static aspect of chaining operators. He reports and comments the practical realisation of chaining operators: components, measurements performed on elaborated chaining operators, simulation experimental set-up [fr

  16. Binary Masking & Speech Intelligibility

    DEFF Research Database (Denmark)

    Boldt, Jesper

    The purpose of this thesis is to examine how binary masking can be used to increase intelligibility in situations where hearing impaired listeners have difficulties understanding what is being said. The major part of the experiments carried out in this thesis can be categorized as either experime......The purpose of this thesis is to examine how binary masking can be used to increase intelligibility in situations where hearing impaired listeners have difficulties understanding what is being said. The major part of the experiments carried out in this thesis can be categorized as either...... experiments under ideal conditions or as experiments under more realistic conditions useful for real-life applications such as hearing aids. In the experiments under ideal conditions, the previously defined ideal binary mask is evaluated using hearing impaired listeners, and a novel binary mask -- the target...... binary mask -- is introduced. The target binary mask shows the same substantial increase in intelligibility as the ideal binary mask and is proposed as a new reference for binary masking. In the category of real-life applications, two new methods are proposed: a method for estimation of the ideal binary...

  17. Interacting binary stars

    CERN Document Server

    Sahade, Jorge; Ter Haar, D

    1978-01-01

    Interacting Binary Stars deals with the development, ideas, and problems in the study of interacting binary stars. The book consolidates the information that is scattered over many publications and papers and gives an account of important discoveries with relevant historical background. Chapters are devoted to the presentation and discussion of the different facets of the field, such as historical account of the development in the field of study of binary stars; the Roche equipotential surfaces; methods and techniques in space astronomy; and enumeration of binary star systems that are studied

  18. Mining frequent binary expressions

    NARCIS (Netherlands)

    Calders, T.; Paredaens, J.; Kambayashi, Y.; Mohania, M.K.; Tjoa, A.M.

    2000-01-01

    In data mining, searching for frequent patterns is a common basic operation. It forms the basis of many interesting decision support processes. In this paper we present a new type of patterns, binary expressions. Based on the properties of a specified binary test, such as reflexivity, transitivity

  19. A binary plasmid system for shuffling combinatorial antibody libraries.

    Science.gov (United States)

    Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A

    1992-11-01

    We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind antigen varied from 43% to 100% and depended strongly on the heavy-chain sequence. Such productive crosses resulted in a set of Fab fragments of similar apparent binding constants, which seemed to differ mainly in the amount of active Fab fragment produced in the bacterial cell. The dominance of the heavy chain in the antibody-antigen interaction was further explored in a set of directed crosses, in which heavy and light chains derived from antigen-specific clones were crossed with nonrelated heavy and light chains. In these crosses, an Fab fragment retained antigen binding only if it contained a heavy chain from an antigen-specific clone. In no case did the light chain confer detectable affinity when paired with indifferent heavy chains. The surprising promiscuity of heavy chains has ramifications for the evaluation of the diversity of combinatorial libraries made against protein antigens and should allow the combination of one such promiscuous heavy chain with an engineered light chain to form an Fab fragment carrying synthetic cofactors to assist in antibody catalysis.

  20. Close binary stars

    International Nuclear Information System (INIS)

    Larsson-Leander, G.

    1979-01-01

    Studies of close binary stars are being persued more vigorously than ever, with about 3000 research papers and notes pertaining to the field being published during the triennium 1976-1978. Many major advances and spectacular discoveries were made, mostly due to increased observational efficiency and precision, especially in the X-ray, radio, and ultraviolet domains. Progress reports are presented in the following areas: observational techniques, methods of analyzing light curves, observational data, physical data, structure and models of close binaries, statistical investigations, and origin and evolution of close binaries. Reports from the Coordinates Programs Committee, the Committee for Extra-Terrestrial Observations and the Working Group on RS CVn binaries are included. (Auth./C.F.)

  1. Binary and ternary systems

    International Nuclear Information System (INIS)

    Petrov, D.A.

    1986-01-01

    Conditions for thermodynamical equilibrium in binary and ternary systems are considered. Main types of binary and ternary system phase diagrams are sequently constructed on the basis of general regularities on the character of transition from one equilibria to others. New statements on equilibrium line direction in the diagram triple points and their isothermal cross sections are developed. New represenations on equilibria in case of monovariant curve minimum and maximum on three-phase equilibrium formation in ternary system are introduced

  2. Planet formation in Binaries

    OpenAIRE

    Thebault, Ph.; Haghighipour, N.

    2014-01-01

    Spurred by the discovery of numerous exoplanets in multiple systems, binaries have become in recent years one of the main topics in planet formation research. Numerous studies have investigated to what extent the presence of a stellar companion can affect the planet formation process. Such studies have implications that can reach beyond the sole context of binaries, as they allow to test certain aspects of the planet formation scenario by submitting them to extreme environments. We review her...

  3. Evidence for deterministic chaos in aperiodic oscillations of acute lymphoblastic leukemia cells in long-term culture

    Science.gov (United States)

    Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.

    Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.

  4. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

    2012-01-01

    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  5. Loschmidt echo of a two-level qubit coupled to nonuniform anisotropic XY chains in a transverse field

    International Nuclear Information System (INIS)

    Zhong Ming; Tong Peiqing

    2011-01-01

    The Loschmidt echo (LE) of a central two-level qubit coupled to nonuniform anisotropic XY chains in a transverse field is studied. A general formula for LE is derived, which we use to discuss the influence of the criticality of the environment on LE. It is found that for the periodic XY chain the behaviors of LE in the vicinity of the critical points are similar to those of the uniform case. It is different for the disordered transverse Ising chains. For the aperiodic chains, if the surrounding systems are bounded chains, the behaviors of LE are similar to those of the uniform case, while if the surrounding systems are unbounded chains, they are similar to those of the disordered case.

  6. How Chain Intermixing Dictates the Polymorphism of PVDF in Poly(vinylidene fluoride/Polymethylmethacrylate Binary System during Recrystallization: A Comparative Study on Core–Shell Particles and Latex Blend

    Directory of Open Access Journals (Sweden)

    Yue Li

    2017-09-01

    Full Text Available In the past few decades, Poly(vinylidene fluoride/Polymethylmethacrylate (PVDF/PMMA binary blend has attracted substantial attention in the scientific community due to possible intriguing mechanical, optical and ferroelectric properties that are closely related to its multiple crystal structures/phases. However, the effect of PMMA phase on the polymorphism of PVDF, especially the relationship between miscibility and polymorphism, remains an open question and is not yet fully understood. In this work, three series of particle blends with varied levels of miscibility between PVDF and PMMA were prepared via seeded emulsion polymerization: PVDF–PMMA core–shell particle (PVDF@PMMA with high miscibility; PVDF/PMMA latex blend with modest miscibility; and PVDF@c–PMMA (crosslinked PMMA core–shell particle with negligible miscibility. The difference in miscibility, and the corresponding morphology and polymorphism were systematically studied to correlate the PMMA/PVDF miscibility with PVDF polymorphism. It is of interest to observe that the formation of polar β/γ phase during melt crystallization could be governed in two ways: dipole–dipole interaction and fast crystallization. For PVDF@PMMA and PVDF/PMMA systems, in which fast crystallization was unlikely triggered, higher content of β/γ phase, and intense suppression of crystallization temperature and capacity were observed in PVDF@PMMA, because high miscibility favored a higher intensity of overall dipole–dipole interaction and a longer interaction time. For PVDF@c–PMMA system, after a complete coverage of PVDF seeds by PMMA shells, nearly pure β/γ phase was obtained owing to the fast homogeneous nucleation. This is the first report that high miscibility between PVDF and PMMA could favor the formation of β/γ phase.

  7. Falling chains

    OpenAIRE

    Wong, Chun Wa; Yasui, Kosuke

    2005-01-01

    The one-dimensional fall of a folded chain with one end suspended from a rigid support and a chain falling from a resting heap on a table is studied. Because their Lagrangians contain no explicit time dependence, the falling chains are conservative systems. Their equations of motion are shown to contain a term that enforces energy conservation when masses are transferred between subchains. We show that Cayley's 1857 energy nonconserving solution for a chain falling from a resting heap is inco...

  8. Skewed Binary Search Trees

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Moruz, Gabriel

    2006-01-01

    It is well-known that to minimize the number of comparisons a binary search tree should be perfectly balanced. Previous work has shown that a dominating factor over the running time for a search is the number of cache faults performed, and that an appropriate memory layout of a binary search tree...... can reduce the number of cache faults by several hundred percent. Motivated by the fact that during a search branching to the left or right at a node does not necessarily have the same cost, e.g. because of branch prediction schemes, we in this paper study the class of skewed binary search trees....... For all nodes in a skewed binary search tree the ratio between the size of the left subtree and the size of the tree is a fixed constant (a ratio of 1/2 gives perfect balanced trees). In this paper we present an experimental study of various memory layouts of static skewed binary search trees, where each...

  9. Modelling binary data

    CERN Document Server

    Collett, David

    2002-01-01

    INTRODUCTION Some Examples The Scope of this Book Use of Statistical Software STATISTICAL INFERENCE FOR BINARY DATA The Binomial Distribution Inference about the Success Probability Comparison of Two Proportions Comparison of Two or More Proportions MODELS FOR BINARY AND BINOMIAL DATA Statistical Modelling Linear Models Methods of Estimation Fitting Linear Models to Binomial Data Models for Binomial Response Data The Linear Logistic Model Fitting the Linear Logistic Model to Binomial Data Goodness of Fit of a Linear Logistic Model Comparing Linear Logistic Models Linear Trend in Proportions Comparing Stimulus-Response Relationships Non-Convergence and Overfitting Some other Goodness of Fit Statistics Strategy for Model Selection Predicting a Binary Response Probability BIOASSAY AND SOME OTHER APPLICATIONS The Tolerance Distribution Estimating an Effective Dose Relative Potency Natural Response Non-Linear Logistic Regression Models Applications of the Complementary Log-Log Model MODEL CHECKING Definition of Re...

  10. Evolution of dwarf binaries

    International Nuclear Information System (INIS)

    Tutukov, A.V.; Fedorova, A.V.; Yungel'son, L.R.

    1982-01-01

    The conditions of mass exchange in close binary systems with masses of components less or equal to one solar mass have been analysed for the case, when the system radiates gravitational waves. It has been shown that the mass exchange rate depends in a certain way on the mass ratio of components and on the mass of component that fills its inner critical lobe. The comparison of observed periods, masses of contact components, and mass exchange rates of observed cataclysmic binaries have led to the conclusion that the evolution of close binaries WZ Sge, OY Car, Z Cha, TT Ari, 2A 0311-227, and G 61-29 may be driven by the emission of gravitational waves [ru

  11. Binary catalogue of exoplanets

    Science.gov (United States)

    Schwarz, Richard; Bazso, Akos; Zechner, Renate; Funk, Barbara

    2016-02-01

    Since 1995 there is a database which list most of the known exoplanets (The Extrasolar Planets Encyclopaedia at http://exoplanet.eu/). With the growing number of detected exoplanets in binary and multiple star systems it became more important to mark and to separate them into a new database, which is not available in the Extrasolar Planets Encyclopaedia. Therefore we established an online database (which can be found at: http://www.univie.ac.at/adg/schwarz/multiple.html) for all known exoplanets in binary star systems and in addition for multiple star systems, which will be updated regularly and linked to the Extrasolar Planets Encyclopaedia. The binary catalogue of exoplanets is available online as data file and can be used for statistical purposes. Our database is divided into two parts: the data of the stars and the planets, given in a separate list. We describe also the different parameters of the exoplanetary systems and present some applications.

  12. Binary and Millisecond Pulsars.

    Science.gov (United States)

    Lorimer, Duncan R

    2008-01-01

    We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1800. There are now 83 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 140 pulsars in 26 of the Galactic globular clusters. Recent highlights include the discovery of the young relativistic binary system PSR J1906+0746, a rejuvination in globular cluster pulsar research including growing numbers of pulsars with masses in excess of 1.5 M ⊙ , a precise measurement of relativistic spin precession in the double pulsar system and a Galactic millisecond pulsar in an eccentric ( e = 0.44) orbit around an unevolved companion. Supplementary material is available for this article at 10.12942/lrr-2008-8.

  13. Binary and Millisecond Pulsars

    Directory of Open Access Journals (Sweden)

    Lorimer Duncan R.

    2008-11-01

    Full Text Available We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1800. There are now 83 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 140 pulsars in 26 of the Galactic globular clusters. Recent highlights include the discovery of the young relativistic binary system PSR J1906+0746, a rejuvination in globular cluster pulsar research including growing numbers of pulsars with masses in excess of 1.5M_⊙, a precise measurement of relativistic spin precession in the double pulsar system and a Galactic millisecond pulsar in an eccentric (e = 0.44 orbit around an unevolved companion.

  14. Experimental investigation of the transverse modal instabilities onset in high power fully-aperiodic-large-pitch fiber lasers

    Science.gov (United States)

    Malleville, Marie-Alicia; Benoît, Aurélien; Dauliat, Romain; Leconte, Baptiste; Darwich, Dia; du Jeu, Rémi; Jamier, Raphaël.; Schwuchow, Anka; Schuster, Kay; Roy, Philippe

    2018-02-01

    Over the last decade, significant work has been carried out in order to increase the energy/peak power provided by fiber lasers. Indeed, new microstructured fibers with large (or very large) mode area cores (LMA) such as Distributed Mode Filtering (DMF) fibers and Large-Pitch Fibers (LPF) have been developed to address this concern. These technologies have allowed diffraction-limited emission with core diameters higher than 80 μm, and have state-of-the-art performances in terms of pulse energy or peak power while keeping an excellent spatial beam quality. Although these fibers were designed to reach high power levels while maintaining a single transverse mode propagation, power scaling becomes quickly limited by the onset of transverse modal instabilities (TMI). This effect suddenly arises when a certain average power threshold is exceeded, drastically degrading the emitted beam quality. In this work, we investigate the influence of the core dimensions and the refractive index mismatch between the active core and the background cladding material, on the TMI power threshold in rod-type Fully-Aperiodic-LPF. This fiber structure was specifically designed to enhance the higher-order modes (HOMs) delocalization out of the gain region and thus push further the onset of modal instabilities. Using a 400W pump diode at 976 nm, the power scaling, as well as the spatial beam quality and its temporal behavior were investigated in laser configuration, which theoretically provides a lower TMI power threshold than the amplifier one due to the lack of selective excitation of the fundamental mode.

  15. Dissipative binary collisions

    International Nuclear Information System (INIS)

    Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.

    1998-01-01

    The binary character of the heavy ion collisions at intermediate energies in the exit channel has been observed under 30 MeV/n in medium and heavy systems. Measurements in light systems at energies approaching ∼ 100 MeV/nucleon as well as in very heavy systems have allowed to extend considerably the investigations of this binary process. Thus, the study of the Pb + Au system showed that the complete charge events indicated two distinct sources: the quasi-projectile and the quasi-target. The characteristics of these two sources are rather well reproduced by a trajectory computation which takes into account the Coulomb and nuclear forces and the friction appearing from the projectile-target interaction. The Wilczynski diagram is used to probe the correlation between the kinetic energy quenching and the deflecting angle. In case of the system Pb + Au at 29 MeV/nucleon the diagram indicate dissipative binary collisions typical for low energies. This binary aspect was also detected in the systems Xe + Ag at 44 MeV/nucleon, 36 Ar + 27 Al and 64 Zn + nat Ti. Thus, it was possible to reconstruct the quasi-projectile and to study its mass and excitation energy evolution as a function of the impact parameter. The dissipative binary collisions represent for the systems and energies under considerations the main contribution to the cross section. This does not implies that there are not other processes; particularly, the more or less complete fusion is also observed but with a low cross section which decreases with the increase of bombardment energy. More exclusive measurements with the INDRA detector on quasi-symmetric systems as Ar + KCl and Xe + Sn seem to confirm the importance of the binary collisions. The two source reconstruction of the Xe + Sn data at 50 MeV/nucleon reproduces the same behaviour as that observed in the system Pb + Au at 29 MeV/nucleon

  16. Binary and Millisecond Pulsars

    Directory of Open Access Journals (Sweden)

    Lorimer Duncan R.

    2005-11-01

    Full Text Available We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1700. There are now 80 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 103 pulsars in 24 of the Galactic globular clusters. Recent highlights have been the discovery of the first ever double pulsar system and a recent flurry of discoveries in globular clusters, in particular Terzan 5.

  17. Equational binary decision diagrams

    NARCIS (Netherlands)

    J.F. Groote (Jan Friso); J.C. van de Pol (Jaco)

    2000-01-01

    textabstractWe incorporate equations in binary decision diagrams (BDD). The resulting objects are called EQ-BDDs. A straightforward notion of ordered EQ-BDDs (EQ-OBDD) is defined, and it is proved that each EQ-BDD is logically equivalent to an EQ-OBDD. Moreover, on EQ-OBDDs satisfiability and

  18. Binary tense and modality

    NARCIS (Netherlands)

    Broekhuis, H.; Verkuyl, H.J

    2014-01-01

    The present paper adopts as its point of departure the claim by Te Winkel (1866) and Verkuyl (2008) that mental temporal representations are built on the basis of three binary oppositions: Present/Past, Synchronous/Posterior and Imperfect/Perfect. Te Winkel took the second opposition in terms of the

  19. N-Bit Binary Resistor

    Science.gov (United States)

    Tcheng, Ping

    1989-01-01

    Binary resistors in series tailored to precise value of resistance. Desired value of resistance obtained by cutting appropriate traces across resistors. Multibit, binary-based, adjustable resistor with high resolution used in many applications where precise resistance required.

  20. The True Ultracool Binary Fraction Using Spectral Binaries

    Science.gov (United States)

    Bardalez Gagliuffi, Daniella; Burgasser, Adam J.; Schmidt, Sarah J.; Gagné, Jonathan; Faherty, Jacqueline K.; Cruz, Kelle; Gelino, Chris

    2018-01-01

    Brown dwarfs bridge the gap between stars and giant planets. While the essential mechanisms governing their formation are not well constrained, binary statistics are a direct outcome of the formation process, and thus provide a means to test formation theories. Observational constraints on the brown dwarf binary fraction place it at 10 ‑ 20%, dominated by imaging studies (85% of systems) with the most common separation at 4 AU. This coincides with the resolution limit of state-of-the-art imaging techniques, suggesting that the binary fraction is underestimated. We have developed a separation-independent method to identify and characterize tightly-separated (dwarfs as spectral binaries by identifying traces of methane in the spectra of late-M and early-L dwarfs. Imaging follow-up of 17 spectral binaries yielded 3 (18%) resolved systems, corroborating the observed binary fraction, but 5 (29%) known binaries were missed, reinforcing the hypothesis that the short-separation systems are undercounted. In order to find the true binary fraction of brown dwarfs, we have compiled a volume-limited, spectroscopic sample of M7-L5 dwarfs and searched for T dwarf companions. In the 25 pc volume, 4 candidates were found, three of which are already confirmed, leading to a spectral binary fraction of 0.95 ± 0.50%, albeit for a specific combination of spectral types. To extract the true binary fraction and determine the biases of the spectral binary method, we have produced a binary population simulation based on different assumptions of the mass function, age distribution, evolutionary models and mass ratio distribution. Applying the correction fraction resulting from this method to the observed spectral binary fraction yields a true binary fraction of 27 ± 4%, which is roughly within 1σ of the binary fraction obtained from high resolution imaging studies, radial velocity and astrometric monitoring. This method can be extended to identify giant planet companions to young brown

  1. Black holes in binary stars

    NARCIS (Netherlands)

    Wijers, R.A.M.J.

    1996-01-01

    Introduction Distinguishing neutron stars and black holes Optical companions and dynamical masses X-ray signatures of the nature of a compact object Structure and evolution of black-hole binaries High-mass black-hole binaries Low-mass black-hole binaries Low-mass black holes Formation of black holes

  2. Learning to assign binary weights to binary descriptor

    Science.gov (United States)

    Huang, Zhoudi; Wei, Zhenzhong; Zhang, Guangjun

    2016-10-01

    Constructing robust binary local feature descriptors are receiving increasing interest due to their binary nature, which can enable fast processing while requiring significantly less memory than their floating-point competitors. To bridge the performance gap between the binary and floating-point descriptors without increasing the computational cost of computing and matching, optimal binary weights are learning to assign to binary descriptor for considering each bit might contribute differently to the distinctiveness and robustness. Technically, a large-scale regularized optimization method is applied to learn float weights for each bit of the binary descriptor. Furthermore, binary approximation for the float weights is performed by utilizing an efficient alternatively greedy strategy, which can significantly improve the discriminative power while preserve fast matching advantage. Extensive experimental results on two challenging datasets (Brown dataset and Oxford dataset) demonstrate the effectiveness and efficiency of the proposed method.

  3. Classical diffusion, Anderson localization, and spectral statistics in billiard chains

    International Nuclear Information System (INIS)

    Dittrich, T.; Doron, E.; Smilansky, U.

    1993-03-01

    We study spectral properties of quasi one-dimensional extended systems that show deterministic diffusion on the classical level and Anderson localization in the quantal description. Using semiclassical arguments, we relate to universal aspects of the spectral fluctuations to features of the set of classical periodic orbits, expressed in terms of probability to perform periodic motion, that are likewise universal. This allows to derive an analytical expression for the spectral form factor which reflects the diffusive nature of the corresponding classical dynamics. It defines a novel spectral universality class which covers the transition between GOE statistics in the limit of a small ratio of the system size to the localization length, corresponding to the metallic regime of disordered systems, to Poissonian level fluctuations in the opposite limit. Our semiclassical predictions are illustrated and confirmed by a numerical investigation of aperiodic chains of chaotic billiards. (authors)

  4. Testing the relativistic Doppler boost hypothesis for supermassive black hole binary candidates

    Science.gov (United States)

    Charisi, Maria; Haiman, Zoltán; Schiminovich, David; D'Orazio, Daniel J.

    2018-06-01

    Supermassive black hole binaries (SMBHBs) should be common in galactic nuclei as a result of frequent galaxy mergers. Recently, a large sample of sub-parsec SMBHB candidates was identified as bright periodically variable quasars in optical surveys. If the observed periodicity corresponds to the redshifted binary orbital period, the inferred orbital velocities are relativistic (v/c ≈ 0.1). The optical and ultraviolet (UV) luminosities are expected to arise from gas bound to the individual BHs, and would be modulated by the relativistic Doppler effect. The optical and UV light curves should vary in tandem with relative amplitudes which depend on the respective spectral slopes. We constructed a control sample of 42 quasars with aperiodic variability, to test whether this Doppler colour signature can be distinguished from intrinsic chromatic variability. We found that the Doppler signature can arise by chance in ˜20 per cent (˜37 per cent) of quasars in the nUV (fUV) band. These probabilities reflect the limited quality of the control sample and represent upper limits on how frequently quasars mimic the Doppler brightness+colour variations. We performed separate tests on the periodic quasar candidates, and found that for the majority, the Doppler boost hypothesis requires an unusually steep UV spectrum or an unexpectedly large BH mass and orbital velocity. We conclude that at most approximately one-third of these periodic candidates can harbor Doppler-modulated SMBHBs.

  5. Processing Of Binary Images

    Science.gov (United States)

    Hou, H. S.

    1985-07-01

    An overview of the recent progress in the area of digital processing of binary images in the context of document processing is presented here. The topics covered include input scan, adaptive thresholding, halftoning, scaling and resolution conversion, data compression, character recognition, electronic mail, digital typography, and output scan. Emphasis has been placed on illustrating the basic principles rather than descriptions of a particular system. Recent technology advances and research in this field are also mentioned.

  6. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

    Science.gov (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

    2017-11-01

    A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

  7. Massive Black Hole Binary Evolution

    Directory of Open Access Journals (Sweden)

    Merritt David

    2005-11-01

    Full Text Available Coalescence of binary supermassive black holes (SBHs would constitute the strongest sources of gravitational waves to be observed by LISA. While the formation of binary SBHs during galaxy mergers is almost inevitable, coalescence requires that the separation between binary components first drop by a few orders of magnitude, due presumably to interaction of the binary with stars and gas in a galactic nucleus. This article reviews the observational evidence for binary SBHs and discusses how they would evolve. No completely convincing case of a bound, binary SBH has yet been found, although a handful of systems (e.g. interacting galaxies; remnants of galaxy mergers are now believed to contain two SBHs at projected separations of <~ 1kpc. N-body studies of binary evolution in gas-free galaxies have reached large enough particle numbers to reproduce the slow, “diffusive” refilling of the binary’s loss cone that is believed to characterize binary evolution in real galactic nuclei. While some of the results of these simulations - e.g. the binary hardening rate and eccentricity evolution - are strongly N-dependent, others - e.g. the “damage” inflicted by the binary on the nucleus - are not. Luminous early-type galaxies often exhibit depleted cores with masses of ~ 1-2 times the mass of their nuclear SBHs, consistent with the predictions of the binary model. Studies of the interaction of massive binaries with gas are still in their infancy, although much progress is expected in the near future. Binary coalescence has a large influence on the spins of SBHs, even for mass ratios as extreme as 10:1, and evidence of spin-flips may have been observed.

  8. Many-Body Potentials For Binary Immiscible liquid Metal Alloys

    International Nuclear Information System (INIS)

    Karaguelle, H.

    2004-01-01

    The modified analytic embedded atom method (MAEAM) type many- body potentials have been constructed for three binary liquid immiscible alloy systems: Al-Pb, Ag-Ni, Ag- Cu. The MAEAM potential functions are fitted to both solid and liquid state properties for only liquid pure metals which consist the immiscible alloy. In order to test the reliability of the constructed MAEAM effective potentials, partial structure factors and pair distribution functions of these binary liquid metal alloys have been calculated using the thermodynamically self-consistent variational modified hypernetted chain (VMHNC) theory of liquids. A good agreement with the available experimental data for structure has

  9. Binary optics: Trends and limitations

    Science.gov (United States)

    Farn, Michael W.; Veldkamp, Wilfrid B.

    1993-01-01

    We describe the current state of binary optics, addressing both the technology and the industry (i.e., marketplace). With respect to the technology, the two dominant aspects are optical design methods and fabrication capabilities, with the optical design problem being limited by human innovation in the search for new applications and the fabrication issue being limited by the availability of resources required to improve fabrication capabilities. With respect to the industry, the current marketplace does not favor binary optics as a separate product line and so we expect that companies whose primary purpose is the production of binary optics will not represent the bulk of binary optics production. Rather, binary optics' more natural role is as an enabling technology - a technology which will directly result in a competitive advantage in a company's other business areas - and so we expect that the majority of binary optics will be produced for internal use.

  10. Particle acceleration in binaries

    Directory of Open Access Journals (Sweden)

    Sinitsyna V.G.

    2017-01-01

    Full Text Available Cygnus X-3 massive binary system is one of the powerful sources of radio and X-ray emission consisting of an accreting compact object, probably a black hole, with a Wolf-Rayet star companion. Based on the detections of ultra high energy gamma-rays by Kiel and Havera Park, Cygnus X-3 has been proposed to be one of the most powerful sources of charged cosmic ray particles in the Galaxy. The results of long-term observations of the Cyg X-3 binary at energies 800 GeV–85 TeV detected by SHALON in 1995 are presented with images, integral spectra and spectral energy distribution. The identification of source with Cygnus X-3 detected by SHALON was secured by the detection of its 4.8 hour orbital period in TeV gamma-rays. During the whole observation period of Cyg X-3 with SHALON significant flux increases were detected at energies above 0.8 TeV. These TeV flux increases are correlated with flaring activity at a lower energy range of X-ray and/or at observations of Fermi LAT as well as with radio emission from the relativistic jets of Cygnus X-3. The variability of very high-energy gamma-radiation and correlation of radiation activity in the wide energy range can provide essential information on particle mechanism production up to very high energies. Whereas, modulation of very high energy emission connected to the orbital motion of the binary system, provides an understanding of the emission processes, nature and location of particle acceleration.

  11. Superlattice configurations in linear chain hydrocarbon binary mixtures

    Indian Academy of Sciences (India)

    monoclinic, monoclinic-monoclinic) are realizable, because of discrete orientational changes in the alignment of molecules of -C28H58 hydrocarbon, through an angle , where = 1, 2, 3 … and angle has an average value of 3.3°.

  12. Magnetic binary nanofillers

    International Nuclear Information System (INIS)

    Morales Mendoza, N.; Goyanes, S.; Chiliotte, C.; Bekeris, V.; Rubiolo, G.; Candal, R.

    2012-01-01

    Magnetic binary nanofillers containing multiwall carbon nanotubes (MWCNT) and hercynite were synthesized by Chemical Vapor Deposition (CVD) on Fe/AlOOH prepared by the sol-gel method. The catalyst precursor was fired at 450 °C, ground and sifted through different meshes. Two powders were obtained with different particle sizes: sample A (50-75 μm) and sample B (smaller than 50 μm). These powders are composed of iron oxide particles widely dispersed in the non-crystalline matrix of aluminum oxide and they are not ferromagnetic. After reduction process the powders are composed of α-Fe nanoparticles inside hercynite matrix. These nanofillers are composed of hercynite containing α-Fe nanoparticles and MWCNT. The binary magnetic nanofillers were slightly ferromagnetic. The saturation magnetization of the nanofillers depended on the powder particle size. The nanofiller obtained from powder particles in the range 50-75 μm showed a saturation magnetization 36% higher than the one formed from powder particles smaller than 50 μm. The phenomenon is explained in terms of changes in the magnetic environment of the particles as consequence of the presence of MWCNT.

  13. Magnetic binary nanofillers

    Energy Technology Data Exchange (ETDEWEB)

    Morales Mendoza, N. [INQUIMAE, CONICET-UBA, Ciudad Universitaria, Pab2, (C1428EHA) Bs As (Argentina); LPyMC, Dep. De Fisica, FCEN-UBA and IFIBA -CONICET, Ciudad Universitaria, Cap. Fed. (Argentina); Goyanes, S. [LPyMC, Dep. De Fisica, FCEN-UBA and IFIBA -CONICET, Ciudad Universitaria, Cap. Fed. (Argentina); Chiliotte, C.; Bekeris, V. [LBT, Dep. De Fisica, FCEN-UBA. Ciudad Universitaria, Pab1, C1428EGA CABA (Argentina); Rubiolo, G. [LPyMC, Dep. De Fisica, FCEN-UBA and IFIBA -CONICET, Ciudad Universitaria, Cap. Fed. (Argentina); Unidad de Actividad Materiales, CNEA, Av Gral. Paz 1499, San Martin (1650), Prov. de Bs As (Argentina); Candal, R., E-mail: candal@qi.fcen.uba.ar [INQUIMAE, CONICET-UBA, Ciudad Universitaria, Pab2, (C1428EHA) Bs As (Argentina); Escuela de Ciencia y Tecnologia, 3iA, Universidad de Gral. San Martin, San Martin, Prov. Bs As (Argentina)

    2012-08-15

    Magnetic binary nanofillers containing multiwall carbon nanotubes (MWCNT) and hercynite were synthesized by Chemical Vapor Deposition (CVD) on Fe/AlOOH prepared by the sol-gel method. The catalyst precursor was fired at 450 Degree-Sign C, ground and sifted through different meshes. Two powders were obtained with different particle sizes: sample A (50-75 {mu}m) and sample B (smaller than 50 {mu}m). These powders are composed of iron oxide particles widely dispersed in the non-crystalline matrix of aluminum oxide and they are not ferromagnetic. After reduction process the powders are composed of {alpha}-Fe nanoparticles inside hercynite matrix. These nanofillers are composed of hercynite containing {alpha}-Fe nanoparticles and MWCNT. The binary magnetic nanofillers were slightly ferromagnetic. The saturation magnetization of the nanofillers depended on the powder particle size. The nanofiller obtained from powder particles in the range 50-75 {mu}m showed a saturation magnetization 36% higher than the one formed from powder particles smaller than 50 {mu}m. The phenomenon is explained in terms of changes in the magnetic environment of the particles as consequence of the presence of MWCNT.

  14. CHAIN 2

    International Nuclear Information System (INIS)

    Bailey, D.

    1998-04-01

    The Second Processing Chain (CHAIN2) consists of a suite of ten programs which together provide a full local analysis of the bulk plasma physics within the JET Tokamak. In discussing these ten computational models this report is intended to fulfil two broad purposes. Firstly it is meant to be used as a reference source for any user of CHAIN2 data, and secondly it provides a basic User Manual sufficient to instruct anyone in running the CHAIN2 suite of codes. In the main report text each module is described in terms of its underlying physics and any associated assumptions or limitations, whilst deliberate emphasis is put on highlighting the physics and mathematics of the calculations required in deriving each individual datatype in the standard module PPF output. In fact each datatype of the CHAIN2 PPF output listed in Appendix D is cross referenced to the point in the main text where its evaluation is discussed. An effort is made not only to give the equation used to derive a particular data profile but also to explicitly define which external data sources are involved in the computational calculation

  15. Relativistic Binaries in Globular Clusters

    Directory of Open Access Journals (Sweden)

    Matthew J. Benacquista

    2013-03-01

    Full Text Available Galactic globular clusters are old, dense star systems typically containing 10^4 – 10^6 stars. As an old population of stars, globular clusters contain many collapsed and degenerate objects. As a dense population of stars, globular clusters are the scene of many interesting close dynamical interactions between stars. These dynamical interactions can alter the evolution of individual stars and can produce tight binary systems containing one or two compact objects. In this review, we discuss theoretical models of globular cluster evolution and binary evolution, techniques for simulating this evolution that leads to relativistic binaries, and current and possible future observational evidence for this population. Our discussion of globular cluster evolution will focus on the processes that boost the production of tight binary systems and the subsequent interaction of these binaries that can alter the properties of both bodies and can lead to exotic objects. Direct N-body integrations and Fokker–Planck simulations of the evolution of globular clusters that incorporate tidal interactions and lead to predictions of relativistic binary populations are also discussed. We discuss the current observational evidence for cataclysmic variables, millisecond pulsars, and low-mass X-ray binaries as well as possible future detection of relativistic binaries with gravitational radiation.

  16. Spectral properties of binary asteroids

    Science.gov (United States)

    Pajuelo, Myriam; Birlan, Mirel; Carry, Benoît; DeMeo, Francesca E.; Binzel, Richard P.; Berthier, Jérôme

    2018-04-01

    We present the first attempt to characterize the distribution of taxonomic class among the population of binary asteroids (15% of all small asteroids). For that, an analysis of 0.8-2.5{μ m} near-infrared spectra obtained with the SpeX instrument on the NASA/IRTF is presented. Taxonomic class and meteorite analog is determined for each target, increasing the sample of binary asteroids with known taxonomy by 21%. Most binary systems are bound in the S-, X-, and C- classes, followed by Q and V-types. The rate of binary systems in each taxonomic class agrees within uncertainty with the background population of small near-Earth objects and inner main belt asteroids, but for the C-types which are under-represented among binaries.

  17. Planets in Binary Star Systems

    CERN Document Server

    Haghighipour, Nader

    2010-01-01

    The discovery of extrasolar planets over the past decade has had major impacts on our understanding of the formation and dynamical evolution of planetary systems. There are features and characteristics unseen in our solar system and unexplainable by the current theories of planet formation and dynamics. Among these new surprises is the discovery of planets in binary and multiple-star systems. The discovery of such "binary-planetary" systems has confronted astrodynamicists with many new challenges, and has led them to re-examine the theories of planet formation and dynamics. Among these challenges are: How are planets formed in binary star systems? What would be the notion of habitability in such systems? Under what conditions can binary star systems have habitable planets? How will volatiles necessary for life appear on such planets? This volume seeks to gather the current research in the area of planets in binary and multistar systems and to familiarize readers with its associated theoretical and observation...

  18. RS CVn binary systems

    International Nuclear Information System (INIS)

    Linsky, J.L.

    1984-01-01

    The author attempts to place in context the vast amount of data obtained in the last few years as a result of X-ray, ultraviolet, optical, and microwave observations of RS CVn and similar spectroscopic binary systems. He concentrates on the RS CVn systems and their long-period analogs, and restricts the scope by attempting to answer on the basis of the recent data and theory following questions: (1) Are the original defining characteristics still valid and still adequate? (2) What is the evidence for discrete active regions? (3) Have we derived any meaningful physical properties for the atmospheres of RS CVn systems? (4) What are the flare observations telling us about magnetic fields in the RS CVn systems? (5) Is there evidence for systematic trends in RS CVn systems with spectral type?

  19. Direct current hopping conductance along DNA chain

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Li Ming-Jun

    2007-01-01

    This paper proposes a model of direct current(DC) electron hopping transport in DNA,in which DNA is considered as a binary one-dimensional disordered system.To quantitatively study the DC conductivity in DNA,it numerically calculates the DC conductivity of DNA chains with difierent parameter values.The result shows that the DC conductivity of DNA chain increases with the increase of temperature.And the conductivity of DNA chain is depended on the probability P.which represents the degree of compositional disorder in a DNA sequence to some extent.For P<0.5,the conductivity of DNA chain decreases with the increase of P,while for P≥0.5,the conductivity increases with the increase of p.The DC conductivity in DNA chain also varies with the change of the electric field,it presents non-Ohm's law conductivity characteristics.

  20. Heavy Chain Diseases

    Science.gov (United States)

    ... of heavy chain produced: Alpha Gamma Mu Alpha Heavy Chain Disease Alpha heavy chain disease (IgA heavy ... the disease or lead to a remission. Gamma Heavy Chain Disease Gamma heavy chain disease (IgG heavy ...

  1. Formation of the wide asynchronous binary asteroid population

    International Nuclear Information System (INIS)

    Jacobson, Seth A.; Scheeres, Daniel J.; McMahon, Jay

    2014-01-01

    We propose and analyze a new mechanism for the formation of the wide asynchronous binary population. These binary asteroids have wide semimajor axes relative to most near-Earth and main belt asteroid systems. Confirmed members have rapidly rotating primaries and satellites that are not tidally locked. Previously suggested formation mechanisms from impact ejecta, from planetary flybys, and directly from rotational fission events cannot satisfy all of the observations. The newly hypothesized mechanism works as follows: (1) these systems are formed from rotational fission, (2) their satellites are tidally locked, (3) their orbits are expanded by the binary Yarkovsky-O'Keefe-Radzievskii-Paddack (BYORP) effect, (4) their satellites desynchronize as a result of the adiabatic invariance between the libration of the secondary and the mutual orbit, and (5) the secondary avoids resynchronization because of the YORP effect. This seemingly complex chain of events is a natural pathway for binaries with satellites that have particular shapes, which define the BYORP effect torque that acts on the system. After detailing the theory, we analyze each of the wide asynchronous binary members and candidates to assess their most likely formation mechanism. Finally, we suggest possible future observations to check and constrain our hypothesis.

  2. Optimally cloned binary coherent states

    Science.gov (United States)

    Müller, C. R.; Leuchs, G.; Marquardt, Ch.; Andersen, U. L.

    2017-10-01

    Binary coherent state alphabets can be represented in a two-dimensional Hilbert space. We capitalize this formal connection between the otherwise distinct domains of qubits and continuous variable states to map binary phase-shift keyed coherent states onto the Bloch sphere and to derive their quantum-optimal clones. We analyze the Wigner function and the cumulants of the clones, and we conclude that optimal cloning of binary coherent states requires a nonlinearity above second order. We propose several practical and near-optimal cloning schemes and compare their cloning fidelity to the optimal cloner.

  3. TOWARD COMPLETE STATISTICS OF MASSIVE BINARY STARS: PENULTIMATE RESULTS FROM THE CYGNUS OB2 RADIAL VELOCITY SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Kobulnicky, Henry A.; Lundquist, Michael J.; Burke, Jamison; Chapman, James; Keller, Erica; Lester, Kathryn; Rolen, Emily K.; Topel, Eric; Bhattacharjee, Anirban; Smullen, Rachel A.; Álvarez, Carlos A. Vargas; Runnoe, Jessie C.; Dale, Daniel A.; Brotherton, Michael M. [Department of Physics and Astronomy, University of Wyoming, Laramie, WY 82070 (United States); Kiminki, Daniel C., E-mail: chipk@uwyo.edu, E-mail: jburke2@swarthmore.edu, E-mail: jc6380@mcla.edu, E-mail: kelle22e@mtholyoke.edu, E-mail: kvl214@lehigh.edu, E-mail: emily.k.rolen@vanderbilt.edu, E-mail: topel@stolaf.edu [Department of Astronomy, University of Arizona, Tucson, AZ 85721 (United States)

    2014-08-01

    We analyze orbital solutions for 48 massive multiple-star systems in the Cygnus OB2 association, 23 of which are newly presented here, to find that the observed distribution of orbital periods is approximately uniform in log P for P < 45 days, but it is not scale-free. Inflections in the cumulative distribution near 6 days, 14 days, and 45 days suggest key physical scales of ≅0.2, ≅0.4, and ≅1 A.U. where yet-to-be-identified phenomena create distinct features. No single power law provides a statistically compelling prescription, but if features are ignored, a power law with exponent β ≅ –0.22 provides a crude approximation over P = 1.4-2000 days, as does a piece-wise linear function with a break near 45 days. The cumulative period distribution flattens at P > 45 days, even after correction for completeness, indicating either a lower binary fraction or a shift toward low-mass companions. A high degree of similarity (91% likelihood) between the Cyg OB2 period distribution and that of other surveys suggests that the binary properties at P ≲ 25 days are determined by local physics of disk/clump fragmentation and are relatively insensitive to environmental and evolutionary factors. Fully 30% of the unbiased parent sample is a binary with period P < 45 days. Completeness corrections imply a binary fraction near 55% for P < 5000 days. The observed distribution of mass ratios 0.2 < q < 1 is consistent with uniform, while the observed distribution of eccentricities 0.1 < e < 0.6 is consistent with uniform plus an excess of e ≅ 0 systems. We identify six stars, all supergiants, that exhibit aperiodic velocity variations of ∼30 km s{sup –1} attributed to atmospheric fluctuations.

  4. Separation in 5 Msun Binaries

    Science.gov (United States)

    Evans, Nancy R.; Bond, H. E.; Schaefer, G.; Mason, B. D.; Karovska, M.; Tingle, E.

    2013-01-01

    Cepheids (5 Msun stars) provide an excellent sample for determining the binary properties of fairly massive stars. International Ultraviolet Explorer (IUE) observations of Cepheids brighter than 8th magnitude resulted in a list of ALL companions more massive than 2.0 Msun uniformly sensitive to all separations. Hubble Space Telescope Wide Field Camera 3 (WFC3) has resolved three of these binaries (Eta Aql, S Nor, and V659 Cen). Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations for a sample of 18 Cepheids, and also a distribution of mass ratios. The distribution of orbital periods shows that the 5 Msun binaries prefer shorter periods than 1 Msun stars, reflecting differences in star formation processes.

  5. Mesoscopic model for binary fluids

    Science.gov (United States)

    Echeverria, C.; Tucci, K.; Alvarez-Llamoza, O.; Orozco-Guillén, E. E.; Morales, M.; Cosenza, M. G.

    2017-10-01

    We propose a model for studying binary fluids based on the mesoscopic molecular simulation technique known as multiparticle collision, where the space and state variables are continuous, and time is discrete. We include a repulsion rule to simulate segregation processes that does not require calculation of the interaction forces between particles, so binary fluids can be described on a mesoscopic scale. The model is conceptually simple and computationally efficient; it maintains Galilean invariance and conserves the mass and energy in the system at the micro- and macro-scale, whereas momentum is conserved globally. For a wide range of temperatures and densities, the model yields results in good agreement with the known properties of binary fluids, such as the density profile, interface width, phase separation, and phase growth. We also apply the model to the study of binary fluids in crowded environments with consistent results.

  6. Some properties of spectral binary stars

    International Nuclear Information System (INIS)

    Krajcheva, Z.T.; Popova, E.I.; Tutukov, A.V.; Yungel'son, L.R.; AN SSSR, Moscow. Astronomicheskij Sovet)

    1978-01-01

    Statistical investigations of spectra binary stars are carried out. Binary systems consisting of main sequence stars are considered. For 826 binary stars masses of components, ratios of component masses, semiaxes of orbits and orbital angular momenta are calculated. The distributions of these parameters and their correlations are analyzed. The dependences of statistical properties of spectral binary stars on their origin and evolution are discussed

  7. Binary Systems and the Initial Mass Function

    Science.gov (United States)

    Malkov, O. Yu.

    2017-07-01

    In the present paper we discuss advantages and disadvantages of binary stars, which are important for star formation history determination. We show that to make definite conclusions of the initial mass function shape, it is necessary to study binary population well enough to correct the luminosity function for unresolved binaries; to construct the mass-luminosity relation based on wide binaries data, and to separate observational mass functions of primaries, of secondaries, and of unresolved binaries.

  8. The search for massive black hole binaries with LISA

    International Nuclear Information System (INIS)

    Cornish, Neil J; Porter, Edward K

    2007-01-01

    In this work we focus on the search and detection of massive black hole binary (MBHB) systems, including systems at high redshift. As well as expanding on previous works where we used a variant of Markov chain Monte Carlo (MCMC), called Metropolis-Hastings Monte Carlo, with simulated annealing, we introduce a new search method based on frequency annealing which leads to a more rapid and robust detection. We compare the two search methods on systems where we do and do not see the merger of the black holes. In the non-merger case, we also examine the posterior distribution exploration using a 7D MCMC algorithm. We demonstrate that this method is effective in dealing with the high correlations between parameters, has a higher acceptance rate than previously proposed methods and produces posterior distribution functions that are close to the prediction from the Fisher information matrix. Finally, after carrying out searches where there is only one binary in the data stream, we examine the case where two black hole binaries are present in the same data stream. We demonstrate that our search algorithm can accurately recover both binaries, and more importantly showing that we can safely extract the MBHB sources without contaminating the rest of the data stream

  9. Hidden slow pulsars in binaries

    Science.gov (United States)

    Tavani, Marco; Brookshaw, Leigh

    1993-01-01

    The recent discovery of the binary containing the slow pulsar PSR 1718-19 orbiting around a low-mass companion star adds new light on the characteristics of binary pulsars. The properties of the radio eclipses of PSR 1718-19 are the most striking observational characteristics of this system. The surface of the companion star produces a mass outflow which leaves only a small 'window' in orbital phase for the detection of PSR 1718-19 around 400 MHz. At this observing frequency, PSR 1718-19 is clearly observable only for about 1 hr out of the total 6.2 hr orbital period. The aim of this Letter is twofold: (1) to model the hydrodynamical behavior of the eclipsing material from the companion star of PSR 1718-19 and (2) to argue that a population of binary slow pulsars might have escaped detection in pulsar surveys carried out at 400 MHz. The possible existence of a population of partially or totally hidden slow pulsars in binaries will have a strong impact on current theories of binary evolution of neutron stars.

  10. The Young Visual Binary Survey

    Science.gov (United States)

    Prato, Lisa; Avilez, Ian; Lindstrom, Kyle; Graham, Sean; Sullivan, Kendall; Biddle, Lauren; Skiff, Brian; Nofi, Larissa; Schaefer, Gail; Simon, Michal

    2018-01-01

    Differences in the stellar and circumstellar properties of the components of young binaries provide key information about star and disk formation and evolution processes. Because objects with separations of a few to a few hundred astronomical units share a common environment and composition, multiple systems allow us to control for some of the factors which play into star formation. We are completing analysis of a rich sample of about 100 pre-main sequence binaries and higher order multiples, primarily located in the Taurus and Ophiuchus star forming regions. This poster will highlight some of out recent, exciting results. All reduced spectra and the results of our analysis will be publicly available to the community at http://jumar.lowell.edu/BinaryStars/. Support for this research was provided in part by NSF award AST-1313399 and by NASA Keck KPDA funding.

  11. A methodology for stochastic analysis of share prices as Markov chains with finite states.

    Science.gov (United States)

    Mettle, Felix Okoe; Quaye, Enoch Nii Boi; Laryea, Ravenhill Adjetey

    2014-01-01

    Price volatilities make stock investments risky, leaving investors in critical position when uncertain decision is made. To improve investor evaluation confidence on exchange markets, while not using time series methodology, we specify equity price change as a stochastic process assumed to possess Markov dependency with respective state transition probabilities matrices following the identified state pace (i.e. decrease, stable or increase). We established that identified states communicate, and that the chains are aperiodic and ergodic thus possessing limiting distributions. We developed a methodology for determining expected mean return time for stock price increases and also establish criteria for improving investment decision based on highest transition probabilities, lowest mean return time and highest limiting distributions. We further developed an R algorithm for running the methodology introduced. The established methodology is applied to selected equities from Ghana Stock Exchange weekly trading data.

  12. Chain reaction

    International Nuclear Information System (INIS)

    Balogh, Brian.

    1991-01-01

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  13. Evolution in close binary systems

    International Nuclear Information System (INIS)

    Yungel'son, L.R.; Masevich, A.G.

    1983-01-01

    Duality is the property most typical of stars. If one investigates how prevalent double stars are, making due allowance for selection effects, one finds that as many as 90 percent of all stars are paired. Contrary to tradition it is single stars that are out of the ordinary, and as will be shown presently even some of these may have been formed by coalescence of the members of binary systems. This review deals with the evolution of close binaries, defined as double-star systems whose evolution entails exchange of material between the two components

  14. Characterization of binary string statistics for syntactic landmine detection

    Science.gov (United States)

    Nasif, Ahmed O.; Mark, Brian L.; Hintz, Kenneth J.

    2011-06-01

    Syntactic landmine detection has been proposed to detect and classify non-metallic landmines using ground penetrating radar (GPR). In this approach, the GPR return is processed to extract characteristic binary strings for landmine and clutter discrimination. In our previous work, we discussed the preprocessing methodology by which the amplitude information of the GPR A-scan signal can be effectively converted into binary strings, which identify the impedance discontinuities in the signal. In this work, we study the statistical properties of the binary string space. In particular, we develop a Markov chain model to characterize the observed bit sequence of the binary strings. The state is defined as the number of consecutive zeros between two ones in the binarized A-scans. Since the strings are highly sparse (the number of zeros is much greater than the number of ones), defining the state this way leads to fewer number of states compared to the case where each bit is defined as a state. The number of total states is further reduced by quantizing the number of consecutive zeros. In order to identify the correct order of the Markov model, the mean square difference (MSD) between the transition matrices of mine strings and non-mine strings is calculated up to order four using training data. The results show that order one or two maximizes this MSD. The specification of the transition probabilities of the chain can be used to compute the likelihood of any given string. Such a model can be used to identify characteristic landmine strings during the training phase. These developments on modeling and characterizing the string statistics can potentially be part of a real-time landmine detection algorithm that identifies landmine and clutter in an adaptive fashion.

  15. The Binary Ties that Bind

    Science.gov (United States)

    Rose, Mike

    2008-01-01

    As any reader of "About Campus" knows, binary oppositions contribute to the definitions of institutional types--the trade school versus the liberal arts college, for example. They help define disciplines and subdisciplines and the status differentials among them: consider the difference in intellectual cachet as one moves from linguistics to…

  16. Optimally cloned binary coherent states

    DEFF Research Database (Denmark)

    Mueller, C. R.; Leuchs, G.; Marquardt, Ch

    2017-01-01

    their quantum-optimal clones. We analyze the Wigner function and the cumulants of the clones, and we conclude that optimal cloning of binary coherent states requires a nonlinearity above second order. We propose several practical and near-optimal cloning schemes and compare their cloning fidelity to the optimal...

  17. Subluminous X-ray binaries

    NARCIS (Netherlands)

    Armas Padilla, M.

    2013-01-01

    The discovery of the first X-ray binary, Scorpius X-1, by Giacconi et al. (1962), marked the birth of X-ray astronomy. Following that discovery, many additional X-ray sources where found with the first generation of X-ray rockets and observatories (e.g., UHURU and Einstein). The short-timescale

  18. Misclassification in binary choice models

    Czech Academy of Sciences Publication Activity Database

    Meyer, B. D.; Mittag, Nikolas

    2017-01-01

    Roč. 200, č. 2 (2017), s. 295-311 ISSN 0304-4076 R&D Projects: GA ČR(CZ) GJ16-07603Y Institutional support: Progres-Q24 Keywords : measurement error * binary choice models * program take-up Subject RIV: AH - Economics OBOR OECD: Economic Theory Impact factor: 1.633, year: 2016

  19. Misclassification in binary choice models

    Czech Academy of Sciences Publication Activity Database

    Meyer, B. D.; Mittag, Nikolas

    2017-01-01

    Roč. 200, č. 2 (2017), s. 295-311 ISSN 0304-4076 Institutional support: RVO:67985998 Keywords : measurement error * binary choice models * program take-up Subject RIV: AH - Economics OBOR OECD: Economic Theory Impact factor: 1.633, year: 2016

  20. Binary logic is rich enough

    International Nuclear Information System (INIS)

    Zapatrin, R.R.

    1992-01-01

    Given a finite ortholattice L, the *-semigroup is explicitly built whose annihilator ortholattice is isomorphic to L. Thus, it is shown that any finite quantum logic is the additive part of a binary logic. Some areas of possible applications are outlined. 7 refs

  1. A New Algorithm of Shape Boundaries Based on Chain Coding

    Directory of Open Access Journals (Sweden)

    Zhao Xin

    2017-01-01

    Full Text Available A new method to obtain connected component in binary images is presented. The method uses DFA automaton to obtain chain code and label the component boundary. It is theoretically proved that the algorithm improves the image encoding efficiency closer to the lowest time consumption.

  2. Astronomy of binary and multiple stars

    International Nuclear Information System (INIS)

    Tokovinin, A.A.

    1984-01-01

    Various types of binary stars and methods for their observation are described in a popular form. Some models of formation and evolution of binary and multiple star systems are presented. It is concluded that formation of binary and multiple stars is a regular stage in the process of star production

  3. Coevolution of Binaries and Circumbinary Gaseous Disks

    Science.gov (United States)

    Fleming, David; Quinn, Thomas R.

    2018-04-01

    The recent discoveries of circumbinary planets by Kepler raise questions for contemporary planet formation models. Understanding how these planets form requires characterizing their formation environment, the circumbinary protoplanetary disk, and how the disk and binary interact. The central binary excites resonances in the surrounding protoplanetary disk that drive evolution in both the binary orbital elements and in the disk. To probe how these interactions impact both binary eccentricity and disk structure evolution, we ran N-body smooth particle hydrodynamics (SPH) simulations of gaseous protoplanetary disks surrounding binaries based on Kepler 38 for 10^4 binary orbital periods for several initial binary eccentricities. We find that nearly circular binaries weakly couple to the disk via a parametric instability and excite disk eccentricity growth. Eccentric binaries strongly couple to the disk causing eccentricity growth for both the disk and binary. Disks around sufficiently eccentric binaries strongly couple to the disk and develop an m = 1 spiral wave launched from the 1:3 eccentric outer Lindblad resonance (EOLR). This wave corresponds to an alignment of gas particle longitude of periastrons. We find that in all simulations, the binary semi-major axis decays due to dissipation from the viscous disk.

  4. Formation and evolution of compact binaries

    NARCIS (Netherlands)

    Sluijs, Marcel Vincent van der

    2006-01-01

    In this thesis we investigate the formation and evolution of compact binaries. Chapters 2 through 4 deal with the formation of luminous, ultra-compact X-ray binaries in globular clusters. We show that the proposed scenario of magnetic capture produces too few ultra-compact X-ray binaries to explain

  5. MCMC exploration of supermassive black hole binary inspirals

    International Nuclear Information System (INIS)

    Cornish, Neil J; Porter, Edward K

    2006-01-01

    The Laser Interferometer Space Antenna will be able to detect the inspiral and merger of super massive black hole binaries (SMBHBs) anywhere in the universe. Standard matched filtering techniques can be used to detect and characterize these systems. Markov Chain Monte Carlo (MCMC) methods are ideally suited to this and other LISA data analysis problems as they are able to efficiently handle models with large dimensions. Here we compare the posterior parameter distributions derived by an MCMC algorithm with the distributions predicted by the Fisher information matrix. We find excellent agreement for the extrinsic parameters, while the Fisher matrix slightly overestimates errors in the intrinsic parameters

  6. Binary Linear-Time Erasure Decoding for Non-Binary LDPC codes

    OpenAIRE

    Savin, Valentin

    2009-01-01

    In this paper, we first introduce the extended binary representation of non-binary codes, which corresponds to a covering graph of the bipartite graph associated with the non-binary code. Then we show that non-binary codewords correspond to binary codewords of the extended representation that further satisfy some simplex-constraint: that is, bits lying over the same symbol-node of the non-binary graph must form a codeword of a simplex code. Applied to the binary erasure channel, this descript...

  7. Understanding Effect of Constraint Release Environment on End-to-End Vector Relaxation of Linear Polymer Chains

    KAUST Repository

    Shivokhin, Maksim E.; Read, Daniel J.; Kouloumasis, Dimitris; Kocen, Rok; Zhuge, Flanco; Bailly, Christian; Hadjichristidis, Nikolaos; Likhtman, Alexei E.

    2017-01-01

    of a linear probe chain. For this purpose we first validate the ability of the model to consistently predict both the viscoelastic and dielectric response of monodisperse and binary mixtures of type A polymers, based on published experimental data. We

  8. Detecting Malicious Code by Binary File Checking

    Directory of Open Access Journals (Sweden)

    Marius POPA

    2014-01-01

    Full Text Available The object, library and executable code is stored in binary files. Functionality of a binary file is altered when its content or program source code is changed, causing undesired effects. A direct content change is possible when the intruder knows the structural information of the binary file. The paper describes the structural properties of the binary object files, how the content can be controlled by a possible intruder and what the ways to identify malicious code in such kind of files. Because the object files are inputs in linking processes, early detection of the malicious content is crucial to avoid infection of the binary executable files.

  9. Permutation Entropy for Random Binary Sequences

    Directory of Open Access Journals (Sweden)

    Lingfeng Liu

    2015-12-01

    Full Text Available In this paper, we generalize the permutation entropy (PE measure to binary sequences, which is based on Shannon’s entropy, and theoretically analyze this measure for random binary sequences. We deduce the theoretical value of PE for random binary sequences, which can be used to measure the randomness of binary sequences. We also reveal the relationship between this PE measure with other randomness measures, such as Shannon’s entropy and Lempel–Ziv complexity. The results show that PE is consistent with these two measures. Furthermore, we use PE as one of the randomness measures to evaluate the randomness of chaotic binary sequences.

  10. CHAINS-PC, Decay Chain Atomic Densities

    International Nuclear Information System (INIS)

    1994-01-01

    1 - Description of program or function: CHAINS computes the atom density of members of a single radioactive decay chain. The linearity of the Bateman equations allows tracing of interconnecting chains by manually accumulating results from separate calculations of single chains. Re-entrant loops can be treated as extensions of a single chain. Losses from the chain are also tallied. 2 - Method of solution: The Bateman equations are solved analytically using double-precision arithmetic. Poles are avoided by small alterations of the loss terms. Multigroup fluxes, cross sections, and self-shielding factors entered as input are used to compute the effective specific reaction rates. The atom densities are computed at any specified times. 3 - Restrictions on the complexity of the problem: Maxima of 100 energy groups, 100 time values, 50 members in a chain

  11. A ROSAT Survey of Contact Binary Stars

    Science.gov (United States)

    Geske, M. T.; Gettel, S. J.; McKay, T. A.

    2006-01-01

    Contact binary stars are common variable stars that are all believed to emit relatively large fluxes of X-rays. In this work we combine a large new sample of contact binary stars derived from the ROTSE-I telescope with X-ray data from the ROSAT All Sky Survey (RASS) to estimate the X-ray volume emissivity of contact binary stars in the Galaxy. We obtained X-ray fluxes for 140 contact binaries from the RASS, as well as two additional stars observed by the XMM-Newton observatory. From these data we confirm the emission of X-rays from all contact binary systems, with typical luminosities of approximately 1.0×1030 ergs s-1. Combining calculated luminosities with an estimated contact binary space density, we find that contact binaries do not have strong enough X-ray emission to account for a significant portion of the Galactic X-ray background.

  12. Binary evolution and observational constraints

    International Nuclear Information System (INIS)

    Loore, C. de

    1984-01-01

    The evolution of close binaries is discussed in connection with problems concerning mass and angular momentum losses. Theoretical and observational evidence for outflow of matter, leaving the system during evolution is given: statistics on total masses and mass ratios, effects of the accretion of the mass gaining component, the presence of streams, disks, rings, circumstellar envelopes, period changes, abundance changes in the atmosphere. The effects of outflowing matter on the evolution is outlined, and estimates of the fraction of matter expelled by the loser, and leaving the system, are given. The various time scales involved with evolution and observation are compared. Examples of non conservative evolution are discussed. Problems related to contact phases, on mass and energy losses, in connection with entropy changes are briefly analysed. For advanced stages the disruption probabilities for supernova explosions are examined. A global picture is given for the evolution of massive close binaries, from ZAMS, through WR phases, X-ray phases, leading to runaway pulsars or to a binary pulsar and later to a millisecond pulsar. (Auth.)

  13. X rays from radio binaries

    International Nuclear Information System (INIS)

    Apparao, K.M.V.

    1977-01-01

    Reference is made to the radio binary systems CC Cas, AR Lac, β Per (Algol), β Lyr, b Per and Cyg X-1. It is stated that a thermal interpretation of the radiation from Algol requires a much larger x-ray flux than the observed value of 3.8 x 10 -11 erg/cm 2 /sec/keV in the 2 to 6 keV energy range. Observations of some non-thermal flares, together with the small size of the radio source in Algol, indicate that the radio emission is non-thermal in nature. The radio emission is interpreted as synchrotron radiation and it is suggested that the observed x-ray emission is due to inverse Compton scattering of the light of the primary star by the radio electrons. The x-ray emission from other radio binaries is also calculated using this model. The energy for the radio electrons can arise from annihilation of magnetic lines connecting the binary stars, twisted by the rotation of the stars. (U.K.)

  14. Black holes and neutron stars: evolution of binary systems

    International Nuclear Information System (INIS)

    Kraft, R.P.

    1975-01-01

    Evidence for the existence of neutron stars and black holes in binary systems has been reviewed, and the following summarizes the current situation: (1) No statistically significant case has been made for the proposition that black holes and/or neutron stars contribute to the population of unseen companions of ordinary spectroscopic binaries; (2) Plausible evolutionary scenarios can be advanced that place compact X-ray sources into context as descendants of several common types of mass-exchange binaries. The collapse object may be a black hole, a neutron star, or a white dwarf, depending mostly on the mass of the original primary; (3) The rotating neutron star model for the pulsating X-ray sources Her X-1 and Cen X-3 is the simplest interpretation of these objects, but the idea that the pulsations result from the non-radial oscillations of a white dwarf cannot be altogether dismissed. The latter is particularly attractive in the case of Her X-1 because the total mass of the system is small; (4) The black hole picture for Cyg X-1 represents the simplest model that can presently be put forward to explain the observations. This does not insure its correctness, however. The picture depends on a long chain of inferences, some of which are by no means unassailable. (Auth.)

  15. Logistic chain modelling

    NARCIS (Netherlands)

    Slats, P.A.; Bhola, B.; Evers, J.J.M.; Dijkhuizen, G.

    1995-01-01

    Logistic chain modelling is very important in improving the overall performance of the total logistic chain. Logistic models provide support for a large range of applications, such as analysing bottlenecks, improving customer service, configuring new logistic chains and adapting existing chains to

  16. GALAXY ROTATION AND RAPID SUPERMASSIVE BINARY COALESCENCE

    Energy Technology Data Exchange (ETDEWEB)

    Holley-Bockelmann, Kelly [Vanderbilt University, Nashville, TN (United States); Khan, Fazeel Mahmood, E-mail: k.holley@vanderbilt.edu [Institute of Space Technology (IST), Islamabad (Pakistan)

    2015-09-10

    Galaxy mergers usher the supermassive black hole (SMBH) in each galaxy to the center of the potential, where they form an SMBH binary. The binary orbit shrinks by ejecting stars via three-body scattering, but ample work has shown that in spherical galaxy models, the binary separation stalls after ejecting all the stars in its loss cone—this is the well-known final parsec problem. However, it has been shown that SMBH binaries in non-spherical galactic nuclei harden at a nearly constant rate until reaching the gravitational wave regime. Here we use a suite of direct N-body simulations to follow SMBH binary evolution in both corotating and counterrotating flattened galaxy models. For N > 500 K, we find that the evolution of the SMBH binary is convergent and is independent of the particle number. Rotation in general increases the hardening rate of SMBH binaries even more effectively than galaxy geometry alone. SMBH binary hardening rates are similar for co- and counterrotating galaxies. In the corotating case, the center of mass of the SMBH binary settles into an orbit that is in corotation resonance with the background rotating model, and the coalescence time is roughly a few 100 Myr faster than a non-rotating flattened model. We find that counterrotation drives SMBHs to coalesce on a nearly radial orbit promptly after forming a hard binary. We discuss the implications for gravitational wave astronomy, hypervelocity star production, and the effect on the structure of the host galaxy.

  17. GALAXY ROTATION AND RAPID SUPERMASSIVE BINARY COALESCENCE

    International Nuclear Information System (INIS)

    Holley-Bockelmann, Kelly; Khan, Fazeel Mahmood

    2015-01-01

    Galaxy mergers usher the supermassive black hole (SMBH) in each galaxy to the center of the potential, where they form an SMBH binary. The binary orbit shrinks by ejecting stars via three-body scattering, but ample work has shown that in spherical galaxy models, the binary separation stalls after ejecting all the stars in its loss cone—this is the well-known final parsec problem. However, it has been shown that SMBH binaries in non-spherical galactic nuclei harden at a nearly constant rate until reaching the gravitational wave regime. Here we use a suite of direct N-body simulations to follow SMBH binary evolution in both corotating and counterrotating flattened galaxy models. For N > 500 K, we find that the evolution of the SMBH binary is convergent and is independent of the particle number. Rotation in general increases the hardening rate of SMBH binaries even more effectively than galaxy geometry alone. SMBH binary hardening rates are similar for co- and counterrotating galaxies. In the corotating case, the center of mass of the SMBH binary settles into an orbit that is in corotation resonance with the background rotating model, and the coalescence time is roughly a few 100 Myr faster than a non-rotating flattened model. We find that counterrotation drives SMBHs to coalesce on a nearly radial orbit promptly after forming a hard binary. We discuss the implications for gravitational wave astronomy, hypervelocity star production, and the effect on the structure of the host galaxy

  18. Crystallisation and chain conformation of long chain n-alkanes

    International Nuclear Information System (INIS)

    Gorce, J.

    2000-06-01

    the increase of the tilt angle as a function of the temperature was not detected due to a perfecting of the crystals. Indeed, due to successive heating and cooling to -173 deg. C, the concentration of non all-trans conformers was found to decrease within the crystals. Their numbers were found to be up to six times higher in n-C 198 H 398 crystallised in once folded form than when crystallised in extended form. The C-C stretching mode region of the spectra was used to identify the chain conformation and to estimate the length of the all-trans stem passing through the crystal layers at -173 deg. C. The transition between once folded and extended form crystals was indicated by the presence of additional bands in this region at 1089 cm -1 , 1078 cm -1 and 1064 cm -1 . Some of those bands may be related to the fold itself. At the same time, a strong decrease of the intensity of the infrared bands present in the wagging mode region was observed. Finally, the triple layered structure proposed on the basis of X-ray measurements obtained from the crystals of a binary mixture of long chain n-alkanes, namely n-C 162 H 326 and n-C 246 H 494 , was confirmed from the study of the C-C stretching mode region of the infrared spectra. (author)

  19. Volumetric properties under pressure for the binary system ethanol plus toluene

    DEFF Research Database (Denmark)

    Zeberg-Mikkelsen, Claus Kjær; Lugo, Luis; García, Josefa

    2005-01-01

    . The VLE behavior of this binary system within the considered temperature range is represented satisfactory by the perturbed-chain statistical association fluid theory (PC-SAFT) equation of state with a single interaction parameter, although no cross association between ethanol and toluene is taken...... into account. The densities of this binary system (pure compounds and mixtures) are satisfactory predicted by PC-SAFT with an overall AAD of 0.8%, but the behavior of the excess molar volume is not described correctly....

  20. Corrections for frequency domain transformations of Winfrith binary cross correlator responses

    International Nuclear Information System (INIS)

    Cummins, J.D.

    1968-04-01

    This report considers the corrections for frequency domain transformations of Winfrith binary cross correlator responses; (i) for the finite bandwidth of the equivalent input signal; (2) for the finite time required for the actuator to move between the two positions appropriate to the two levels of the periodic binary chain code input and (3) for the averaging of experimental determinations of the system frequency response and calculations of the standard deviations of the modulus and phase of the frequency responses determined from the cross correlator responses. (author)

  1. Activity coefficients of solutes in binary solvents

    International Nuclear Information System (INIS)

    Gokcen, N.A.

    1982-01-01

    The activity coefficients in dilute ternary systems are discussed in detail by using the Margules equations. Analyses of some relevant data at high temperatures show that the sparingly dissolved solutes in binary solvents follow complex behavior even when the binary solvents are very nearly ideal. It is shown that the activity data on the solute or the binary system cannot permit computation of the remaining activities except for the regular solutions. It is also shown that a fourth-order equation is usually adequate in expressing the activity coefficient of a solute in binary solvents at high temperatures. When the activity data for a binary solvent are difficult to obtain in a certain range of composition, the activity data for a sparingly dissolved solute can be used to supplement determination of the binary activities

  2. Pulsar magnetospheres in binary systems

    Science.gov (United States)

    Ershkovich, A. I.; Dolan, J. F.

    1985-01-01

    The criterion for stability of a tangential discontinuity interface in a magnetized, perfectly conducting inviscid plasma is investigated by deriving the dispersion equation including the effects of both gravitational and centrifugal acceleration. The results are applied to neutron star magnetospheres in X-ray binaries. The Kelvin-Helmholtz instability appears to be important in determining whether MHD waves of large amplitude generated by instability may intermix the plasma effectively, resulting in accretion onto the whole star as suggested by Arons and Lea and leading to no X-ray pulsar behavior.

  3. The structures of binary compounds

    CERN Document Server

    Hafner, J; Jensen, WB; Majewski, JA; Mathis, K; Villars, P; Vogl, P; de Boer, FR

    1990-01-01

    - Up-to-date compilation of the experimental data on the structures of binary compounds by Villars and colleagues. - Coloured structure maps which order the compounds into their respective structural domains and present for the first time the local co-ordination polyhedra for the 150 most frequently occurring structure types, pedagogically very helpful and useful in the search for new materials with a required crystal structure. - Crystal co-ordination formulas: a flexible notation for the interpretation of solid-state structures by chemist Bill Jensen. - Recent important advances in unders

  4. Tomographic reconstruction of binary fields

    International Nuclear Information System (INIS)

    Roux, Stéphane; Leclerc, Hugo; Hild, François

    2012-01-01

    A novel algorithm is proposed for reconstructing binary images from their projection along a set of different orientations. Based on a nonlinear transformation of the projection data, classical back-projection procedures can be used iteratively to converge to the sought image. A multiscale implementation allows for a faster convergence. The algorithm is tested on images up to 1 Mb definition, and an error free reconstruction is achieved with a very limited number of projection data, saving a factor of about 100 on the number of projections required for classical reconstruction algorithms.

  5. Young and Waltzing Binary Stars

    Science.gov (United States)

    2001-10-01

    ADONIS Observes Low-mass Eclipsing System in Orion Summary A series of very detailed images of a binary system of two young stars have been combined into a movie . In merely 3 days, the stars swing around each other. As seen from the earth, they pass in front of each other twice during a full revolution, producing eclipses during which their combined brightness diminishes . A careful analysis of the orbital motions has now made it possible to deduce the masses of the two dancing stars . Both turn out to be about as heavy as our Sun. But while the Sun is about 4500 million years old, these two stars are still in their infancy. They are located some 1500 light-years away in the Orion star-forming region and they probably formed just 10 million years ago . This is the first time such an accurate determination of the stellar masses could be achieved for a young binary system of low-mass stars . The new result provides an important piece of information for our current understanding of how young stars evolve. The observations were obtained by a team of astronomers from Italy and ESO [1] using the ADaptive Optics Near Infrared System (ADONIS) on the 3.6-m telescope at the ESO La Silla Observatory. PR Photo 29a/01 : The RXJ 0529.4+0041 system before primary eclipse PR Photo 29b/01 : The RXJ 0529.4+0041 system at mid-primary eclipse PR Photo 29c/01 : The RXJ 0529.4+0041 system after primary eclipse PR Photo 29d/01 : The RXJ 0529.4+0041 system before secondary eclipse PR Photo 29e/01 : The RXJ 0529.4+0041 system at mid-secondary eclipse PR Photo 29f/01 : The RXJ 0529.4+0041 system after secondary eclipse PR Video Clip 06/01 : Video of the RXJ 0529.4+0041 system Binary stars and stellar masses Since some time, astronomers have noted that most stars seem to form in binary or multiple systems. This is quite fortunate, as the study of binary stars is the only way in which it is possible to measure directly one of the most fundamental quantities of a star, its mass. The mass of a

  6. Sustainable Supply Chain Design

    DEFF Research Database (Denmark)

    Bals, Lydia; Tate, Wendy

    A significant conceptual and practical challenge is how to integrate triple bottom line (TBL; including economic, social and environmental) sustainability into global supply chains. Although this integration is necessary to slow down global resource depletion, understanding is limited of how...... to implement TBL goals across the supply chain. In supply chain design, the classic economic perspective still dominates, although the idea of the TBL is more widely disseminated. The purpose of this research is to add to the sustainable supply chain management literature (SSCM) research agenda...... by incorporating the physical chain, and the (information and financial) support chains into supply chain design. This manuscript tackles issues of what the chains are designed for and how they are designed structurally. Four sustainable businesses are used as illustrative case examples of innovative supply chain...

  7. Microlensing Signature of Binary Black Holes

    Science.gov (United States)

    Schnittman, Jeremy; Sahu, Kailash; Littenberg, Tyson

    2012-01-01

    We calculate the light curves of galactic bulge stars magnified via microlensing by stellar-mass binary black holes along the line-of-sight. We show the sensitivity to measuring various lens parameters for a range of survey cadences and photometric precision. Using public data from the OGLE collaboration, we identify two candidates for massive binary systems, and discuss implications for theories of star formation and binary evolution.

  8. Survival of planets around shrinking stellar binaries.

    Science.gov (United States)

    Muñoz, Diego J; Lai, Dong

    2015-07-28

    The discovery of transiting circumbinary planets by the Kepler mission suggests that planets can form efficiently around binary stars. None of the stellar binaries currently known to host planets has a period shorter than 7 d, despite the large number of eclipsing binaries found in the Kepler target list with periods shorter than a few days. These compact binaries are believed to have evolved from wider orbits into their current configurations via the so-called Lidov-Kozai migration mechanism, in which gravitational perturbations from a distant tertiary companion induce large-amplitude eccentricity oscillations in the binary, followed by orbital decay and circularization due to tidal dissipation in the stars. Here we explore the orbital evolution of planets around binaries undergoing orbital decay by this mechanism. We show that planets may survive and become misaligned from their host binary, or may develop erratic behavior in eccentricity, resulting in their consumption by the stars or ejection from the system as the binary decays. Our results suggest that circumbinary planets around compact binaries could still exist, and we offer predictions as to what their orbital configurations should be like.

  9. Contact Binaries on Their Way Towards Merging

    Science.gov (United States)

    Gazeas, K.

    2015-07-01

    Contact binaries are the most frequently observed type of eclipsing star system. They are small, cool, low-mass binaries belonging to a relatively old stellar population. They follow certain empirical relationships that closely connect a number of physical parameters with each other, largely because of constraints coming from the Roche geometry. As a result, contact binaries provide an excellent test of stellar evolution, specifically for stellar merger scenarios. Observing campaigns by many authors have led to the cataloging of thousands of contact binaries and enabled statistical studies of many of their properties. A large number of contact binaries have been found to exhibit extraordinary behavior, requiring follow-up observations to study their peculiarities in detail. For example, a doubly-eclipsing quadruple system consisting of a contact binary and a detached binary is a highly constrained system offering an excellent laboratory to test evolutionary theories for binaries. A new observing project was initiated at the University of Athens in 2012 in order to investigate the possible lower limit for the orbital period of binary systems before coalescence, prior to merging.

  10. Enzymatic hydrolysis of short-chain lecithin/long-chain phospholipid unilamellar vesicles: sensitivity of phospholipases to matrix phase state.

    Science.gov (United States)

    Gabriel, N E; Agman, N V; Roberts, M F

    1987-11-17

    Short-chain lecithin/long-chain phospholipid unilamellar vesicles (SLUVs), unlike pure long-chain lecithin vesicles, are excellent substrates for water-soluble phospholipases. Hemolysis assays show that greater than 99.5% of the short-chain lecithin is partitioned in the bilayer. In these binary component vesicles, the short-chain species is the preferred substrate, while the long-chain phospholipid can be treated as an inhibitor (phospholipase C) or poor substrate (phospholipase A2). For phospholipase C Bacillus cereus, apparent Km and Vmax values show that bilayer-solubilized diheptanoylphosphatidylcholine (diheptanoyl-PC) is nearly as good a substrate as pure micellar diheptanoyl-PC, although the extent of short-chain lecithin hydrolysis depends on the phase state of the long-chain lipid. For phospholipase A2 Naja naja naja, both Km and Vmax values show a greater range: in a gel-state matrix, diheptanoyl-PC is hydrolyzed with micellelike kinetic parameters; in a liquid-crystalline matrix, the short-chain lecithin becomes comparable to the long-chain component. Both enzymes also show an anomalous increase in specific activity toward diheptanoyl-PC around the phase transition temperature of the long-chain phospholipid. Since the short-chain lecithin does not exhibit a phase transition, this must reflect fluctuations in head-group area or vertical motions of the short-chain lecithin caused by surrounding long-chain lecithin molecules. These results are discussed in terms of a specific model for SLUV hydrolysis and a general explanation for the "interfacial activation" observed with water-soluble phospholipases.

  11. Fabricating binary optics: An overview of binary optics process technology

    Science.gov (United States)

    Stern, Margaret B.

    1993-01-01

    A review of binary optics processing technology is presented. Pattern replication techniques have been optimized to generate high-quality efficient microoptics in visible and infrared materials. High resolution optical photolithography and precision alignment is used to fabricate maximally efficient fused silica diffractive microlenses at lambda = 633 nm. The degradation in optical efficiency of four-phase-level fused silica microlenses resulting from an intentional 0.35 micron translational error has been systematically measured as a function of lens speed (F/2 - F/60). Novel processes necessary for high sag refractive IR microoptics arrays, including deep anisotropic Si-etching, planarization of deep topography and multilayer resist techniques, are described. Initial results are presented for monolithic integration of photonic and microoptic systems.

  12. The Global Value Chain

    DEFF Research Database (Denmark)

    Sørensen, Olav Jull

    The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool......The conference paper aims to develop the global value chain concept by including corporate internal value adding activities and competition to the basic framework in order to turn the global value chain into a strategic management tool...

  13. Radial Velocities of 41 Kepler Eclipsing Binaries

    Science.gov (United States)

    Matson, Rachel A.; Gies, Douglas R.; Guo, Zhao; Williams, Stephen J.

    2017-12-01

    Eclipsing binaries are vital for directly determining stellar parameters without reliance on models or scaling relations. Spectroscopically derived parameters of detached and semi-detached binaries allow us to determine component masses that can inform theories of stellar and binary evolution. Here we present moderate resolution ground-based spectra of stars in close binary systems with and without (detected) tertiary companions observed by NASA’s Kepler mission and analyzed for eclipse timing variations. We obtain radial velocities and spectroscopic orbits for five single-lined and 35 double-lined systems, and confirm one false positive eclipsing binary. For the double-lined spectroscopic binaries, we also determine individual component masses and examine the mass ratio {M}2/{M}1 distribution, which is dominated by binaries with like-mass pairs and semi-detached classical Algol systems that have undergone mass transfer. Finally, we constrain the mass of the tertiary component for five double-lined binaries with previously detected companions.

  14. BHDD: Primordial black hole binaries code

    Science.gov (United States)

    Kavanagh, Bradley J.; Gaggero, Daniele; Bertone, Gianfranco

    2018-06-01

    BHDD (BlackHolesDarkDress) simulates primordial black hole (PBH) binaries that are clothed in dark matter (DM) halos. The software uses N-body simulations and analytical estimates to follow the evolution of PBH binaries formed in the early Universe.

  15. Main Memory Implementations for Binary Grouping

    OpenAIRE

    May, Norman; Moerkotte, Guido

    2005-01-01

    An increasing number of applications depend on efficient storage and analysis features for XML data. Hence, query optimization and efficient evaluation techniques for the emerging XQuery standard become more and more important. Many XQuery queries require nested expressions. Unnesting them often introduces binary grouping. We introduce several algorithms implementing binary grouping and analyze their time and space complexity. Experiments demonstrate their performance.

  16. Eliciting Subjective Probabilities with Binary Lotteries

    DEFF Research Database (Denmark)

    Harrison, Glenn W.; Martínez-Correa, Jimmy; Swarthout, J. Todd

    objective probabilities. Drawing a sample from the same subject population, we find evidence that the binary lottery procedure induces linear utility in a subjective probability elicitation task using the Quadratic Scoring Rule. We also show that the binary lottery procedure can induce direct revelation...

  17. Bondi-Hoyle-Lyttleton Accretion onto Binaries

    Science.gov (United States)

    Antoni, Andrea; MacLeod, Morgan; Ramírez-Ruiz, Enrico

    2018-01-01

    Binary stars are not rare. While only close binary stars will eventually interact with one another, even the widest binary systems interact with their gaseous surroundings. The rates of accretion and the gaseous drag forces arising in these interactions are the key to understanding how these systems evolve. This poster examines accretion flows around a binary system moving supersonically through a background gas. We perform three-dimensional hydrodynamic simulations of Bondi-Hoyle-Lyttleton accretion using the adaptive mesh refinement code FLASH. We simulate a range of values of semi-major axis of the orbit relative to the gravitational focusing impact parameter of the pair. On large scales, gas is gravitationally focused by the center-of-mass of the binary, leading to dynamical friction drag and to the accretion of mass and momentum. On smaller scales, the orbital motion imprints itself on the gas. Notably, the magnitude and direction of the forces acting on the binary inherit this orbital dependence. The long-term evolution of the binary is determined by the timescales for accretion, slow down of the center-of-mass, and decay of the orbit. We use our simulations to measure these timescales and to establish a hierarchy between them. In general, our simulations indicate that binaries moving through gaseous media will slow down before the orbit decays.

  18. Binary Relations as a Foundation of Mathematics

    NARCIS (Netherlands)

    Kuper, Jan; Barendsen, E.; Capretta, V.; Geuvers, H.; Niqui, M.

    2007-01-01

    We describe a theory for binary relations in the Zermelo-Fraenkel style. We choose for ZFCU, a variant of ZFC Set theory in which the Axiom of Foundation is replaced by an axiom allowing for non-wellfounded sets. The theory of binary relations is shown to be equi-consistent ZFCU by constructing a

  19. RELATIONSHIP BETWEEN FLASH POINTS OF SOME BINARY ...

    African Journals Online (AJOL)

    B. S. Chandravanshi

    Miscellaneous binary blends containing solvent neutral-150 (SN-150), ... viscosity, the flash point test has always been a standard part of a lubricant's specification. ... between structure and flash points of organic compounds [5-12] and fuels [13, 14]. ... in binary mixtures, the gaps between flash points would be high enough.

  20. The origin of the RS CVn binaries

    International Nuclear Information System (INIS)

    Biermann, P.

    1976-01-01

    Six possible origins for the RS CVn binaries are considered based on the following possibilities. RS CVn binaries might now be either pre-main-sequence or post-main-sequence. A pre-main-sequence binary might not always have been a binary but might have resulted from fission of a rapidly rotating single pre-main-sequence star. The main-sequence counterparts might be either single stars or binaries. To decide which of the six origins is possible, the following observed data for the RS CVn binaries are considered: total mass, total angular momentum, lack of observed connection with regions of star formation, large space density, kinematical age, and the visual companion of WW Dra. In addition lifetimes and space densities of single stars and other types of binaries are considered. The only origin possible is that the RS CVn binaries are in a thermal phase following fission of a main-sequence single star. In this explanation the single star had a rapidly rotating core which became unstable due to the core contraction which made it begin to evolve off the main sequence. The present Be stars might be examples of such parent single stars. (Auth.)

  1. An application of nonlinear supratransmission to the propagation of binary signals in weakly damped, mechanical systems of coupled oscillators

    International Nuclear Information System (INIS)

    Macias-Diaz, J.E.; Puri, A.

    2007-01-01

    In the present Letter, we simulate the propagation of binary signals in semi-infinite, mechanical chains of coupled oscillators harmonically driven at the end, by making use of the recently discovered process of nonlinear supratransmission. Our numerical results-which are based on a brand-new computational technique with energy-invariant properties-show an efficient and reliable transmission of information

  2. On the Convergence of Biogeography-Based Optimization for Binary Problems

    Directory of Open Access Journals (Sweden)

    Haiping Ma

    2014-01-01

    Full Text Available Biogeography-based optimization (BBO is an evolutionary algorithm inspired by biogeography, which is the study of the migration of species between habitats. A finite Markov chain model of BBO for binary problems was derived in earlier work, and some significant theoretical results were obtained. This paper analyzes the convergence properties of BBO on binary problems based on the previously derived BBO Markov chain model. Analysis reveals that BBO with only migration and mutation never converges to the global optimum. However, BBO with elitism, which maintains the best candidate in the population from one generation to the next, converges to the global optimum. In spite of previously published differences between genetic algorithms (GAs and BBO, this paper shows that the convergence properties of BBO are similar to those of the canonical GA. In addition, the convergence rate estimate of BBO with elitism is obtained in this paper and is confirmed by simulations for some simple representative problems.

  3. Evolution of massive close binaries and formation of neutron stars and black holes

    International Nuclear Information System (INIS)

    Massevitch, A.G.; Tutukov, A.V.; Yungelson, L.R.

    1976-01-01

    Main results of computations of evolution for massive close binaries (10 M(Sun)+9.4 M(Sun), 16 M(Sun)+15 M(Sun), 32 M(Sun)+30 M(Sun), 64 M(Sun)+60 M(Sun)) up to oxygen exhaustion in the core are described. Mass exchange starting in core hydrogen, shell hydrogen and core helium burning stages was studied. Computations were performed assuming both the Ledoux and Schwarzschild stability criteria for semiconvection. The influence of UFI-neutrino emission on evolution of close binaries was investigated. The results obtained allow to outline the following evolutionary chain: two detached Main-Sequence stars - mass exchange - Wolf-Rayet star or blue supergiant plus main sequence star - explosion of the initially more massive star appearing as a supernova event - collapsed or neutron star plus Main-Sequence star, that may be observed as a 'runaway star' - mass exchange leading to X-rays emission - collapsed or neutron star plus WR-star or blue supergiant - second explosion of supernova that preferentially disrupts the system and gives birth to two single high spatial velocity pulsars. Numerical estimates concerning the number and properties of WR-stars, pulsars and X-ray sources are presented. The results are in favour of the existence of UFI-neutrino and of the Ledoux criterion for describing semiconvection. Properties of several well-known X-ray sources and the binary pulsar are discussed on base of evolutionary chain of close binaries. (Auth.)

  4. Mass Transfer in Mira-Type Binaries

    Directory of Open Access Journals (Sweden)

    Mohamed S.

    2012-06-01

    Full Text Available Detached, symbiotic binaries are generally assumed to interact via Bondi-Hoyle-Littleton (BHL wind accretion. However, the accretion rates and outflow geometries that result from this mass-transfer mechanism cannot adequately explain the observations of the nearest and best studied symbiotic binary, Mira, or the formation of some post-AGB binaries, e.g. barium stars. We propose a new mass-transfer mode for Mira-type binaries, which we call ‘wind Roche-lobe overflow’ (WRLOF, and which we demonstrate with 3D hydrodynamic simulations. Importantly, we show that the circumstellar outflows which result from WRLOF tend to be highly aspherical and strongly focused towards the binary orbital plane. Furthermore, the subsequent mass-transfer rates are at least an order of magnitude greater than the analogous BHL values. We discuss the implications of these results for the shaping of bipolar (proto-planetary nebulae and other related systems.

  5. Logistic chaotic maps for binary numbers generations

    International Nuclear Information System (INIS)

    Kanso, Ali; Smaoui, Nejib

    2009-01-01

    Two pseudorandom binary sequence generators, based on logistic chaotic maps intended for stream cipher applications, are proposed. The first is based on a single one-dimensional logistic map which exhibits random, noise-like properties at given certain parameter values, and the second is based on a combination of two logistic maps. The encryption step proposed in both algorithms consists of a simple bitwise XOR operation of the plaintext binary sequence with the keystream binary sequence to produce the ciphertext binary sequence. A threshold function is applied to convert the floating-point iterates into binary form. Experimental results show that the produced sequences possess high linear complexity and very good statistical properties. The systems are put forward for security evaluation by the cryptographic committees.

  6. Phonons in fcc binary alloys

    International Nuclear Information System (INIS)

    Sharma, Amita; Rathore, R.P.S.

    1992-01-01

    Born-Mayer potential has been modified to account for the unpaired (three body) forces among the common nearest neighbours of the ordered binary fcc alloys i.e. Ni 3 Fe 7 , Ni 5 Fe 5 and Ni 75 Fe 25 . The three body potential is added to the two body form of Morse to formalize the total interaction potential. Measured inverse ionic compressibility, cohesive energy, lattice constant and one measured phonon frequency are used to evaluate the defining parameters of the potential. The potential seeks to bring about the binding among 140 and 132 atoms though pair wise (two body) and non-pair wise (three body) forces respectively. The phonon-dispersion relations obtained by solving the secular equation are compared with the experimental findings on the aforesaid alloys. (author). 19 refs., 3 figs

  7. Chain transitivity in hyperspaces

    International Nuclear Information System (INIS)

    Fernández, Leobardo; Good, Chris; Puljiz, Mate; Ramírez, Ártico

    2015-01-01

    Given a non-empty compact metric space X and a continuous function f: X → X, we study the dynamics of the induced maps on the hyperspace of non-empty compact subsets of X and on various other invariant subspaces thereof, in particular symmetric products. We show how some important dynamical properties transfer across induced systems. These amongst others include, chain transitivity, chain (weakly) mixing, chain recurrence, exactness by chains. From our main theorem we derive an ε-chain version of Furstenberg’s celebrated 2 implies n Theorem. We also show the implications our results have for dynamics on continua.

  8. Decisive Markov Chains

    OpenAIRE

    Abdulla, Parosh Aziz; Henda, Noomene Ben; Mayr, Richard

    2007-01-01

    We consider qualitative and quantitative verification problems for infinite-state Markov chains. We call a Markov chain decisive w.r.t. a given set of target states F if it almost certainly eventually reaches either F or a state from which F can no longer be reached. While all finite Markov chains are trivially decisive (for every set F), this also holds for many classes of infinite Markov chains. Infinite Markov chains which contain a finite attractor are decisive w.r.t. every set F. In part...

  9. Gushing metal chain

    Science.gov (United States)

    Belyaev, Alexander; Sukhanov, Alexander; Tsvetkov, Alexander

    2016-03-01

    This article addresses the problem in which a chain falls from a glass from some height. This phenomenon demonstrates a paradoxical rise of the chain over the glass. To explain this effect, an initial hypothesis and an appropriate theory are proposed for calculating the steady fall parameters of the chain. For this purpose, the modified Cayley's problem of falling chain given its rise due to the centrifugal force of upward inertia is solved. Results show that the lift caused by an increase in linear density at the part of chain where it is being bent (the upper part) is due to the convergence of the chain balls to one another. The experiments confirm the obtained estimates of the lifting chain.

  10. Excess Molar Volume of Binary Mixtures of Methylheptenone+Alkanols at 298.15 K

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Excess molar volume(VE) data on binary liquid mixtures of methylheptenone (MHO) with methanol, ethanol, n-propanol or n-butanol have been determined from the density measurements at 298.15 K and atmospheric pressure. The values of VE in all the systems over the entire composition range are quantified by the Redlich-Kister equation. The effects of the chain length of alkanols on VE are discussed.

  11. EXPERIMENTAL RESEARCHES OF ELECTRO-THERMAL RESISTIBILITY OF SEND-OFFS AND CABLES TO ACTION RATIONED ON THE INTERNATIONAL STANDARD OF IEC 62305-1-2010 OF APERIODIC IMPULSE OF CURRENT OF ARTIFICIAL LIGHTNING

    Directory of Open Access Journals (Sweden)

    M.I. Baranov

    2016-03-01

    Full Text Available Purpose. Experimental researches of electro-thermal resistibility of cable-explorer products, applied in the power electric circuits of objects of electric-power industry, to action on its copper and aluminum parts bearings a current rationed on the International Standard of IEC 62305-1-2010 aperiodic impulse 10/350 μs of current of artificial lightning. Methodology. Electrophysics bases of technique of high tensions and high pulsed currents (HPC, and also scientific and technical bases of planning of devices of high-voltage impulsive technique and measuring HPC in them. Results. Experimental a way the quantitative levels of maximal values maximum of possible and critical closenesses of aperiodic impulse 10/350 μs of current of artificial lightning with rationed on the international standard of IEC 62305-1-2010 peak-temporal parameters and admittances on them in copper (aluminum parts bearings a current of send-offs and cables with a polyethylene (PET and polyvinylchloride (PVCH isolation. Originality. First in world practice on the unique powerful high-voltage generator of HPC of artificial lightning experimental researches of resistibility to lightning of pre-production models of send-offs (cables are conducted with copper (aluminum tendons, PET and PVCH by an isolation, in-use in power electric circuits of electric-power industry objects. Practical value. The use in practice of protecting from lightning of the got results will allow substantially to promote functional and fire-prevention safety of engineering communications of objects of industrial electroenergy in the conditions of action on them of short shots of linear lightning.

  12. PERIODIC SIGNALS IN BINARY MICROLENSING EVENTS

    International Nuclear Information System (INIS)

    Guo, Xinyi; Stefano, Rosanne Di; Esin, Ann; Taylor, Jeffrey

    2015-01-01

    Gravitational microlensing events are powerful tools for the study of stellar populations. In particular, they can be used to discover and study a variety of binary systems. A large number of binary lenses have already been found through microlensing surveys and a few of these systems show strong evidence of orbital motion on the timescale of the lensing event. We expect that more binary lenses of this kind will be detected in the future. For binaries whose orbital period is comparable to the event duration, the orbital motion can cause the lensing signal to deviate drastically from that of a static binary lens. The most striking property of such light curves is the presence of quasi-periodic features, which are produced as the source traverses the same regions in the rotating lens plane. These repeating features contain information about the orbital period of the lens. If this period can be extracted, then much can be learned about the lensing system even without performing time-consuming, detailed light-curve modeling. However, the relative transverse motion between the source and the lens significantly complicates the problem of period extraction. To resolve this difficulty, we present a modification of the standard Lomb–Scargle periodogram analysis. We test our method for four representative binary lens systems and demonstrate its efficiency in correctly extracting binary orbital periods

  13. Topological and categorical properties of binary trees

    Directory of Open Access Journals (Sweden)

    H. Pajoohesh

    2008-04-01

    Full Text Available Binary trees are very useful tools in computer science for estimating the running time of so-called comparison based algorithms, algorithms in which every action is ultimately based on a prior comparison between two elements. For two given algorithms A and B where the decision tree of A is more balanced than that of B, it is known that the average and worst case times of A will be better than those of B, i.e., ₸A(n ≤₸B(n and TWA (n≤TWB (n. Thus the most balanced and the most imbalanced binary trees play a main role. Here we consider them as semilattices and characterize the most balanced and the most imbalanced binary trees by topological and categorical properties. Also we define the composition of binary trees as a commutative binary operation, *, such that for binary trees A and B, A * B is the binary tree obtained by attaching a copy of B to any leaf of A. We show that (T,* is a commutative po-monoid and investigate its properties.

  14. Theoretical studies of binaries in astrophysics

    Science.gov (United States)

    Dischler, Johann Sebastian

    This thesis introduces and summarizes four papers dealing with computer simulations of astrophysical processes involving binaries. The first part gives the rational and theoretical background to these papers. In paper I and II a statistical approach to studying eclipsing binaries is described. By using population synthesis models for binaries the probabilities for eclipses are calculated for different luminosity classes of binaries. These are compared with Hipparcos data and they agree well if one uses a standard input distribution for the orbit sizes. If one uses a random pairing model, where both companions are independently picked from an IMF, one finds too feclipsing binaries by an order of magnitude. In paper III we investigate a possible scenario for the origin of the stars observed close to the centre of our galaxy, called S stars. We propose that a cluster falls radially cowards the central black hole. The binaries within the cluster can then, if they have small impact parameters, be broken up by the black hole's tidal held and one of the components of the binary will be captured by the black hole. Paper IV investigates how the onset of mass transfer in eccentric binaries depends on the eccentricity. To do this we have developed a new two-phase SPH scheme where very light particles are at tire outer edge of our simulated star. This enables us to get a much better resolution of the very small mass that is transferred in close binaries. Our simulations show that the minimum required distance between the stars to have mass transfer decreases with the eccentricity.

  15. Spread-spectrum communication using binary spatiotemporal chaotic codes

    International Nuclear Information System (INIS)

    Wang Xingang; Zhan Meng; Gong Xiaofeng; Lai, C.H.; Lai, Y.-C.

    2005-01-01

    We propose a scheme to generate binary code for baseband spread-spectrum communication by using a chain of coupled chaotic maps. We compare the performances of this type of spatiotemporal chaotic code with those of a conventional code used frequently in digital communication, the Gold code, and demonstrate that our code is comparable or even superior to the Gold code in several key aspects: security, bit error rate, code generation speed, and the number of possible code sequences. As the field of communicating with chaos faces doubts in terms of performance comparison with conventional digital communication schemes, our work gives a clear message that communicating with chaos can be advantageous and it deserves further attention from the nonlinear science community

  16. Binary neutron star merger simulations

    Energy Technology Data Exchange (ETDEWEB)

    Bruegmann, Bernd [Jena Univ. (Germany)

    2016-11-01

    Our research focuses on the numerical tools necessary to solve Einstein's equations. In recent years we have been particularly interested in spacetimes consisting of two neutron stars in the final stages of their evolution. Because of the emission of gravitational radiation, the objects are driven together to merge; the emitted gravitational wave signal is visualized. This emitted gravitational radiation carries energy and momentum away from the system and contains information about the system. Late last year the Laser Interferometer Gravitational-wave Observatory (LIGO) began searches for these gravitational wave signals at a sensitivity at which detections are expected. Although such systems can radiate a significant amount of their total mass-energy in gravitational waves, the gravitational wave signals one expects to receive on Earth are not strong, since sources of gravitational waves are often many millions of light years away. Therefore one needs accurate templates for the radiation one expects from such systems in order to be able to extract them out of the detector's noise. Although analytical models exist for compact binary systems when the constituents are well separated, we need numerical simulation to investigate the last orbits before merger to obtain accurate templates and validate analytical approximations. Due to the strong nonlinearity of the equations and the large separation of length scales, these simulations are computationally demanding and need to be run on large supercomputers. When matter is present the computational cost as compared to pure black hole (vacuum) simulations increases even more due to the additional matter fields. But also more interesting astrophysical phenomena can happen. In fact, there is the possibility for a strong electromagnetic signal from the merger (e.g., a short gamma-ray burst or lower-energy electromagnetic signatures from the ejecta) and significant neutrino emission. Additionally, we can expect that

  17. Instabilities in Interacting Binary Stars

    Science.gov (United States)

    Andronov, I. L.; Andrych, K. D.; Antoniuk, K. A.; Baklanov, A. V.; Beringer, P.; Breus, V. V.; Burwitz, V.; Chinarova, L. L.; Chochol, D.; Cook, L. M.; Cook, M.; Dubovský, P.; Godlowski, W.; Hegedüs, T.; Hoňková, K.; Hric, L.; Jeon, Y.-B.; Juryšek, J.; Kim, C.-H.; Kim, Y.; Kim, Y.-H.; Kolesnikov, S. V.; Kudashkina, L. S.; Kusakin, A. V.; Marsakova, V. I.; Mason, P. A.; Mašek, M.; Mishevskiy, N.; Nelson, R. H.; Oksanen, A.; Parimucha, S.; Park, J.-W.; Petrík, K.; Quiñones, C.; Reinsch, K.; Robertson, J. W.; Sergey, I. M.; Szpanko, M.; Tkachenko, M. G.; Tkachuk, L. G.; Traulsen, I.; Tremko, J.; Tsehmeystrenko, V. S.; Yoon, J.-N.; Zola, S.; Shakhovskoy, N. M.

    2017-07-01

    The types of instability in the interacting binary stars are briefly reviewed. The project “Inter-Longitude Astronomy” is a series of smaller projects on concrete stars or groups of stars. It has no special funds, and is supported from resources and grants of participating organizations, when informal working groups are created. This “ILA” project is in some kind similar and complementary to other projects like WET, CBA, UkrVO, VSOLJ, BRNO, MEDUZA, AstroStatistics, where many of us collaborate. Totally we studied 1900+ variable stars of different types, including newly discovered variables. The characteristic timescale is from seconds to decades and (extrapolating) even more. The monitoring of the first star of our sample AM Her was initiated by Prof. V.P. Tsesevich (1907-1983). Since more than 358 ADS papers were published. In this short review, we present some highlights of our photometric and photo-polarimetric monitoring and mathematical modeling of interacting binary stars of different types: classical (AM Her, QQ Vul, V808 Aur = CSS 081231:071126+440405, FL Cet), asynchronous (BY Cam, V1432 Aql), intermediate (V405 Aql, BG CMi, MU Cam, V1343 Her, FO Aqr, AO Psc, RXJ 2123, 2133, 0636, 0704) polars and magnetic dwarf novae (DO Dra) with 25 timescales corresponding to different physical mechanisms and their combinations (part “Polar”); negative and positive superhumpers in nova-like (TT Ari, MV Lyr, V603 Aql, V795 Her) and many dwarf novae stars (“Superhumper”); eclipsing “non-magnetic” cataclysmic variables(BH Lyn, DW UMa, EM Cyg; PX And); symbiotic systems (“Symbiosis”); super-soft sources (SSS, QR And); spotted (and not spotted) eclipsing variables with (and without) evidence for a current mass transfer (“Eclipser”) with a special emphasis on systems with a direct impact of the stream into the gainer star's atmosphere, which we propose to call “Impactor” (short from “Extreme Direct Impactor”), or V361 Lyr-type stars. Other

  18. Variance in binary stellar population synthesis

    Science.gov (United States)

    Breivik, Katelyn; Larson, Shane L.

    2016-03-01

    In the years preceding LISA, Milky Way compact binary population simulations can be used to inform the science capabilities of the mission. Galactic population simulation efforts generally focus on high fidelity models that require extensive computational power to produce a single simulated population for each model. Each simulated population represents an incomplete sample of the functions governing compact binary evolution, thus introducing variance from one simulation to another. We present a rapid Monte Carlo population simulation technique that can simulate thousands of populations in less than a week, thus allowing a full exploration of the variance associated with a binary stellar evolution model.

  19. Proposed experiment to test fundamentally binary theories

    Science.gov (United States)

    Kleinmann, Matthias; Vértesi, Tamás; Cabello, Adán

    2017-09-01

    Fundamentally binary theories are nonsignaling theories in which measurements of many outcomes are constructed by selecting from binary measurements. They constitute a sensible alternative to quantum theory and have never been directly falsified by any experiment. Here we show that fundamentally binary theories are experimentally testable with current technology. For that, we identify a feasible Bell-type experiment on pairs of entangled qutrits. In addition, we prove that, for any n , quantum n -ary correlations are not fundamentally (n -1 ) -ary. For that, we introduce a family of inequalities that hold for fundamentally (n -1 ) -ary theories but are violated by quantum n -ary correlations.

  20. Galactic binaries with eLISA

    OpenAIRE

    Nelemans, G.

    2013-01-01

    I review what eLISA will see from Galactic binaries -- double stars with orbital periods less than a few hours and white dwarf (or neutron star/black hole) components. I discuss the currently known binaries that are guaranteed (or verification) sources and explain why the expected total number of eLISA Galactic binaries is several thousand, even though there are large uncertainties in our knowledge of this population, in particular that of the interacting AM CVn systems. I very briefly sketch...

  1. Editorial: Supply Chain Management

    Directory of Open Access Journals (Sweden)

    Dimitrios Aidonis

    2017-05-01

    Full Text Available This special issue has followed up the 3rd Olympus International Conference on Supply Chains held on Athens Metropolitan Expo, November 7 & 8 2015, Greece. The Conference was organized by the Department of Logistics Technological Educational Institute of Central Macedonia, in collaboration with the: a Laboratory of Quantitative Analysis, Logistics and Supply Chain Management of the Department of Mechanical Engineering, Aristotle University of Thessaloniki (AUTH, b Greek Association of Supply Chain Management (EEL of Northern Greece and the c Supply Chain & Logistics Journal. During the 2-Days Conference more than 60 research papers were presented covering the following thematic areas: (i Transportation, (ii Best Practices in Logistics, (iii Information and Communication Technologies in Supply Chain Management, (iv Food Logistics, (v New Trends in Business Logistics, and (vi Green Supply Chain Management. Three keynote invited speakers addressed interesting issues for the Operational Research, the Opportunities and Prospects of Greek Ports chaired Round Tables with other Greek and Foreign Scientists and Specialists.

  2. Supply Chain Management og Supply Chain costing

    DEFF Research Database (Denmark)

    Nielsen, Steen; Mortensen, Ole

    2002-01-01

    Formålet med denne artikel er at belyse de muligheder som ligger i at integrere virksomhedens økonomiske styring med begrebet Supply Chain Management (SCM). Dette søges belyst ved først at beskrive den teoretiske ramme, hvori SCM indgår. Herefter analyseres begrebet Supply Chain Costing (SCC) som...... Århus. Et resultat er, at via begrebet Supply Chain Costing skabes der mulighed for at måle logistikkædens aktiviteter i kr./øre. Anvendelsen af denne information har også strategisk betydning for at kunne vælge kunde og leverandør. Ved hjælp af integrationen skabes der også helt nye mulighed...

  3. Supply chain components

    OpenAIRE

    Vieraşu, T.; Bălăşescu, M.

    2011-01-01

    In this article I will go through three main logistics components, which are represented by: transportation, inventory and facilities, and the three secondary logistical components: information, production location, price and how they determine performance of any supply chain. I will discuss then how these components are used in the design, planning and operation of a supply chain. I will also talk about some obstacles a supply chain manager may encounter.

  4. Supply chain components

    Directory of Open Access Journals (Sweden)

    Vieraşu, T.

    2011-01-01

    Full Text Available In this article I will go through three main logistics components, which are represented by: transportation, inventory and facilities, and the three secondary logistical components: information, production location, price and how they determine performance of any supply chain. I will discuss then how these components are used in the design, planning and operation of a supply chain. I will also talk about some obstacles a supply chain manager may encounter.

  5. Markov Tail Chains

    OpenAIRE

    janssen, Anja; Segers, Johan

    2013-01-01

    The extremes of a univariate Markov chain with regularly varying stationary marginal distribution and asymptotically linear behavior are known to exhibit a multiplicative random walk structure called the tail chain. In this paper we extend this fact to Markov chains with multivariate regularly varying marginal distributions in Rd. We analyze both the forward and the backward tail process and show that they mutually determine each other through a kind of adjoint relation. In ...

  6. Economy, market and chain

    OpenAIRE

    Sukkel, W.; Hommes, M.

    2009-01-01

    In their pursuit of growth and professionalisation, the Dutch organic sector focuses primarily on market development. But how do you stimulate the market for organic foods? This is the subject of many research projects concerning market, consumer preferences and the supply chain. These projects focus specifically at consumer purchasing behaviour, product development, supply chain formation and minimising cost price. As a rule, this research takes place in close cooperation with chain actors

  7. Supply chain planning classification

    Science.gov (United States)

    Hvolby, Hans-Henrik; Trienekens, Jacques; Bonde, Hans

    2001-10-01

    Industry experience a need to shift in focus from internal production planning towards planning in the supply network. In this respect customer oriented thinking becomes almost a common good amongst companies in the supply network. An increase in the use of information technology is needed to enable companies to better tune their production planning with customers and suppliers. Information technology opportunities and supply chain planning systems facilitate companies to monitor and control their supplier network. In spite if these developments, most links in today's supply chains make individual plans, because the real demand information is not available throughout the chain. The current systems and processes of the supply chains are not designed to meet the requirements now placed upon them. For long term relationships with suppliers and customers, an integrated decision-making process is needed in order to obtain a satisfactory result for all parties. Especially when customized production and short lead-time is in focus. An effective value chain makes inventory available and visible among the value chain members, minimizes response time and optimizes total inventory value held throughout the chain. In this paper a supply chain planning classification grid is presented based current manufacturing classifications and supply chain planning initiatives.

  8. Dixie Valley Bottoming Binary Unit

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, Dale [Terra-Gen Sierra Holdings, LLC, Reno, NV (United States)

    2014-12-21

    This binary plant is the first air cooled, high-output refrigeration based waste heat recovery cycle in the industry. Its working fluid is environmentally friendly and as such, the permits that would be required with a hydrocarbon based cycle are not necessary. The unit is largely modularized, meaning that the unit’s individual skids were assembled in another location and were shipped via truck to the plant site. The Air Cooled Condensers (ACC), equipment piping, and Balance of Plant (BOP) piping were constructed at site. This project further demonstrates the technical feasibility of using low temperature brine for geothermal power utilization. The development of the unit led to the realization of low temperature, high output, and environmentally friendly heat recovery systems through domestic research and engineering. The project generates additional renewable energy, resulting in cleaner air and reduced carbon dioxide emissions. Royalty and tax payments to governmental agencies will increase, resulting in reduced financial pressure on local entities. The major components of the unit were sourced from American companies, resulting in increased economic activity throughout the country.

  9. The symbiotics as binary stars

    International Nuclear Information System (INIS)

    Plavec, M.J.

    1982-01-01

    The author envisages at least three models that can give a symbiotic object: He has called them, respectively, the PN symbiotic, the Algol symbiotic, and the novalike symbiotic. Their properties are briefly discussed. The most promising model is one of a binary system in the second stage of mass transfer, actually at the beginning of it: The cool component is a red giant ascending the asymptotic branch, expanding but not yet filling its critical lobe. The hot star is a subdwarf located in the same region of the Hertzsprung-Russell diagram as the central stars of planetary nebulae. It may be closely related to them, or it may be a helium star, actually a remnant of an Algol primary which underwent the first stage of mass transfer. In these cases, accretion on this star may not play a significant role (PN symbiotic). Perhaps more often, the subdwarf is a ''rejuvenated'' degenerate dwarf whose nuclear burning shells were ignited and are maintained by accretion of material coming from the red giant in the form of a stellar wind. Eruptions are often inevitable: this is the novalike symbiotic. A third alternative is a system in the first stage of mass transfer, where the photons needed for ionization of the nebula come from an accretion disk surrounding a main sequence star: an Algol symbiotic. In spite of considerable observational effort, the symbiotics are known so poorly that it is hard to decide between the models, or even decide if all three can actually exist. (Auth.)

  10. Pulsars in binary systems: probing binary stellar evolution and general relativity.

    Science.gov (United States)

    Stairs, Ingrid H

    2004-04-23

    Radio pulsars in binary orbits often have short millisecond spin periods as a result of mass transfer from their companion stars. They therefore act as very precise, stable, moving clocks that allow us to investigate a large set of otherwise inaccessible astrophysical problems. The orbital parameters derived from high-precision binary pulsar timing provide constraints on binary evolution, characteristics of the binary pulsar population, and the masses of neutron stars with different mass-transfer histories. These binary systems also test gravitational theories, setting strong limits on deviations from general relativity. Surveys for new pulsars yield new binary systems that increase our understanding of all these fields and may open up whole new areas of physics, as most spectacularly evidenced by the recent discovery of an extremely relativistic double-pulsar system.

  11. CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. II. P-TYPE BINARIES

    International Nuclear Information System (INIS)

    Haghighipour, Nader; Kaltenegger, Lisa

    2013-01-01

    We have developed a comprehensive methodology for calculating the circumbinary habitable zone (HZ) in planet-hosting P-type binary star systems. We present a general formalism for determining the contribution of each star of the binary to the total flux received at the top of the atmosphere of an Earth-like planet and use the Sun's HZ to calculate the inner and outer boundaries of the HZ around a binary star system. We apply our calculations to the Kepler's currently known circumbinary planetary systems and show the combined stellar flux that determines the boundaries of their HZs. We also show that the HZ in P-type systems is dynamic and, depending on the luminosity of the binary stars, their spectral types, and the binary eccentricity, its boundaries vary as the stars of the binary undergo their orbital motion. We present the details of our calculations and discuss the implications of the results

  12. CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. II. P-TYPE BINARIES

    Energy Technology Data Exchange (ETDEWEB)

    Haghighipour, Nader [Institute for Astronomy and NASA Astrobiology Institute, University of Hawaii-Manoa, Honolulu, HI 96822 (United States); Kaltenegger, Lisa [MPIA, Koenigstuhl 17, Heidelberg, D-69117 (Germany)

    2013-11-10

    We have developed a comprehensive methodology for calculating the circumbinary habitable zone (HZ) in planet-hosting P-type binary star systems. We present a general formalism for determining the contribution of each star of the binary to the total flux received at the top of the atmosphere of an Earth-like planet and use the Sun's HZ to calculate the inner and outer boundaries of the HZ around a binary star system. We apply our calculations to the Kepler's currently known circumbinary planetary systems and show the combined stellar flux that determines the boundaries of their HZs. We also show that the HZ in P-type systems is dynamic and, depending on the luminosity of the binary stars, their spectral types, and the binary eccentricity, its boundaries vary as the stars of the binary undergo their orbital motion. We present the details of our calculations and discuss the implications of the results.

  13. General simulation algorithm for autocorrelated binary processes.

    Science.gov (United States)

    Serinaldi, Francesco; Lombardo, Federico

    2017-02-01

    The apparent ubiquity of binary random processes in physics and many other fields has attracted considerable attention from the modeling community. However, generation of binary sequences with prescribed autocorrelation is a challenging task owing to the discrete nature of the marginal distributions, which makes the application of classical spectral techniques problematic. We show that such methods can effectively be used if we focus on the parent continuous process of beta distributed transition probabilities rather than on the target binary process. This change of paradigm results in a simulation procedure effectively embedding a spectrum-based iterative amplitude-adjusted Fourier transform method devised for continuous processes. The proposed algorithm is fully general, requires minimal assumptions, and can easily simulate binary signals with power-law and exponentially decaying autocorrelation functions corresponding, for instance, to Hurst-Kolmogorov and Markov processes. An application to rainfall intermittency shows that the proposed algorithm can also simulate surrogate data preserving the empirical autocorrelation.

  14. General simulation algorithm for autocorrelated binary processes

    Science.gov (United States)

    Serinaldi, Francesco; Lombardo, Federico

    2017-02-01

    The apparent ubiquity of binary random processes in physics and many other fields has attracted considerable attention from the modeling community. However, generation of binary sequences with prescribed autocorrelation is a challenging task owing to the discrete nature of the marginal distributions, which makes the application of classical spectral techniques problematic. We show that such methods can effectively be used if we focus on the parent continuous process of beta distributed transition probabilities rather than on the target binary process. This change of paradigm results in a simulation procedure effectively embedding a spectrum-based iterative amplitude-adjusted Fourier transform method devised for continuous processes. The proposed algorithm is fully general, requires minimal assumptions, and can easily simulate binary signals with power-law and exponentially decaying autocorrelation functions corresponding, for instance, to Hurst-Kolmogorov and Markov processes. An application to rainfall intermittency shows that the proposed algorithm can also simulate surrogate data preserving the empirical autocorrelation.

  15. Observations of new Wolf-Rayet binaries

    International Nuclear Information System (INIS)

    Niemela, V.S.

    1982-01-01

    The author reports here preliminary results of spectrographic observations for three southern WR stars, whose binary nature had not been previously verified: HDE 320102, CD -45 0 4482, HD 62910. The observations were carried out at the Cerro Tololo Inter-American Observatory, Chile, mostly with the Cassegrain spectrograph with IT attached to the 1-m reflector. These spectrograms were secured on Kodak IIIaJ emulsion, and have a dispersion of 45 A/mm. The results suggest that HDE 320102 must be a double-lined 05-7 + WN3 spectroscopic binary, that CD -45 0 4482 appears to be a single-lined spectroscopic binary and that HD 62910 may be a binary. (Auth.)

  16. Isometries and binary images of linear block codes over ℤ4 + uℤ4 and ℤ8 + uℤ8

    Science.gov (United States)

    Sison, Virgilio; Remillion, Monica

    2017-10-01

    Let {{{F}}}2 be the binary field and ℤ2 r the residue class ring of integers modulo 2 r , where r is a positive integer. For the finite 16-element commutative local Frobenius non-chain ring ℤ4 + uℤ4, where u is nilpotent of index 2, two weight functions are considered, namely the Lee weight and the homogeneous weight. With the appropriate application of these weights, isometric maps from ℤ4 + uℤ4 to the binary spaces {{{F}}}24 and {{{F}}}28, respectively, are established via the composition of other weight-based isometries. The classical Hamming weight is used on the binary space. The resulting isometries are then applied to linear block codes over ℤ4+ uℤ4 whose images are binary codes of predicted length, which may or may not be linear. Certain lower and upper bounds on the minimum distances of the binary images are also derived in terms of the parameters of the ℤ4 + uℤ4 codes. Several new codes and their images are constructed as illustrative examples. An analogous procedure is performed successfully on the ring ℤ8 + uℤ8, where u 2 = 0, which is a commutative local Frobenius non-chain ring of order 64. It turns out that the method is possible in general for the class of rings ℤ2 r + uℤ2 r , where u 2 = 0, for any positive integer r, using the generalized Gray map from ℤ2 r to {{{F}}}2{2r-1}.

  17. Diffusion in ordered binary solid systems

    International Nuclear Information System (INIS)

    Stolwijk, N.A.

    1980-01-01

    This thesis contains contributions to the field of diffusion in ordered binary solid systems. An extensive experimental investigation of the self diffusion in CoGa is presented. The results of these diffusion measurements strongly suggest that a substantial part of the atomic migration is caused by a new type of defect. A quantitative description of the atomic displacements via this defect is given. Finally computer simulations are presented of diffusion and ordering in binary solid systems. (Auth.)

  18. An Introduction to Binary Decision Diagrams

    DEFF Research Database (Denmark)

    Andersen, Henrik Reif

    1996-01-01

    This note is a short introduction to Binary Decision Diagrams (BDDs). It provides some background knowledge and describes the core algorithms. It is used in the course "C4340 Advanced Algorithms" at the Technical University of Denmark, autumn 1996.......This note is a short introduction to Binary Decision Diagrams (BDDs). It provides some background knowledge and describes the core algorithms. It is used in the course "C4340 Advanced Algorithms" at the Technical University of Denmark, autumn 1996....

  19. Asteroseismic effects in close binary stars

    Science.gov (United States)

    Springer, Ofer M.; Shaviv, Nir J.

    2013-09-01

    Turbulent processes in the convective envelopes of the Sun and stars have been shown to be a source of internal acoustic excitations. In single stars, acoustic waves having frequencies below a certain cut-off frequency propagate nearly adiabatically and are effectively trapped below the photosphere where they are internally reflected. This reflection essentially occurs where the local wavelength becomes comparable to the pressure scale height. In close binary stars, the sound speed is a constant on equipotentials, while the pressure scale height, which depends on the local effective gravity, varies on equipotentials and may be much greater near the inner Lagrangian point (L1). As a result, waves reaching the vicinity of L1 may propagate unimpeded into low-density regions, where they tend to dissipate quickly due to non-linear and radiative effects. We study the three-dimensional propagation and enhanced damping of such waves inside a set of close binary stellar models using a WKB approximation of the acoustic field. We find that these waves can have much higher damping rates in close binaries, compared to their non-binary counterparts. We also find that the relative distribution of acoustic energy density at the visible surface of close binaries develops a ring-like feature at specific acoustic frequencies and binary separations.

  20. Texture classification by texton: statistical versus binary.

    Directory of Open Access Journals (Sweden)

    Zhenhua Guo

    Full Text Available Using statistical textons for texture classification has shown great success recently. The maximal response 8 (Statistical_MR8, image patch (Statistical_Joint and locally invariant fractal (Statistical_Fractal are typical statistical texton algorithms and state-of-the-art texture classification methods. However, there are two limitations when using these methods. First, it needs a training stage to build a texton library, thus the recognition accuracy will be highly depended on the training samples; second, during feature extraction, local feature is assigned to a texton by searching for the nearest texton in the whole library, which is time consuming when the library size is big and the dimension of feature is high. To address the above two issues, in this paper, three binary texton counterpart methods were proposed, Binary_MR8, Binary_Joint, and Binary_Fractal. These methods do not require any training step but encode local feature into binary representation directly. The experimental results on the CUReT, UIUC and KTH-TIPS databases show that binary texton could get sound results with fast feature extraction, especially when the image size is not big and the quality of image is not poor.

  1. Renormalization group treatment for spin waves in the randomly disordered Heisenberg chain

    International Nuclear Information System (INIS)

    Chaves, C.M.; Koiller, B.

    1983-03-01

    Local densities of states in the randomly disordered binary quantum Heisenberg chain using a generalization of a recently developed approach based on renormalization group ideas are calculated. It envolves decimating alternate apins along the chain in such a way as to obtain recursion relations to describe the renormalized set of Green's function equations of motion. The densities of states are richly structured, indicating that the method takes into account compositional fluctuations of arbitrary range. (Author) [pt

  2. Ordering Strategy Analysis of Prefabricated Component Manufacturer in Construction Supply Chain

    OpenAIRE

    Yang, Hongxiong; Chung, Jacky K. H.; Chen, Yuhong; Pan, Yifan; Mei, Zhiling; Sun, Xiongle

    2018-01-01

    Firstly, the characteristics and present situations of the prefabricated construction supply chain are analyzed; inventory cost models for construction material of every phase order, one-off order, and fractionated order are built based on traditional EOQ model and construction supply chain theory. Next, the order decision is represented in binary numbers 0 and 1, in which 0 stands for “no order” and 1 for “order.” The analysis uses the genetic algorithm, sets the objective function, and unde...

  3. Supply Chain Management

    DEFF Research Database (Denmark)

    Wieland, Andreas; Handfield, Robert B.

    Supply chain management has made great strides in becoming a discipline with a standalone body of theories. As part of this evolution, researchers have sought to embed and integrate observed supply chain management phenomena into theoretical statements. In our review, we explore where we have been...

  4. Critical Chain Exercises

    Science.gov (United States)

    Doyle, John Kevin

    2010-01-01

    Critical Chains project management focuses on holding buffers at the project level vs. task level, and managing buffers as a project resource. A number of studies have shown that Critical Chain project management can significantly improve organizational schedule fidelity (i.e., improve the proportion of projects delivered on time) and reduce…

  5. Value Chain Engineering

    DEFF Research Database (Denmark)

    Wæhrens, Brian Vejrum; Slepniov, Dmitrij

    2015-01-01

    This workbook is recommended for the attention of students of and managers in Danish small and medium sized enterprises (SMEs). Danish SMEs are currently facing a number of key challenges related to their position in global value chains. This book provides an insight into value chain management t...

  6. Fields From Markov Chains

    DEFF Research Database (Denmark)

    Justesen, Jørn

    2005-01-01

    A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly.......A simple construction of two-dimensional (2-D) fields is presented. Rows and columns are outcomes of the same Markov chain. The entropy can be calculated explicitly....

  7. Origin of very-short orbital-period binary systems

    International Nuclear Information System (INIS)

    Miyaji, S.

    1983-01-01

    Recent observations of four close binaries have established that there is a group of very-short orbital-period (VSOP) binaries whose orbital periods are less than 60 minutes. The VSOP binaries consist of both X-ray close binaries and cataclysmic variables. Their orbital periods are too short to have a main-sequence companion. However, four binaries, none of which belongs to any globular cluster, are too abundant to be explained by the capturing mechanism of a white dwarf. Therefore it seemed to be worthwhile to present an evolutionary scenario from an original binary system which can be applied for all VSOP binaries. (Auth.)

  8. Gas dynamics of semidetached binaries

    International Nuclear Information System (INIS)

    Lubow, S.H.; Shu, F.H.

    1975-01-01

    We analyze the gas dynamics of semidetached binary systems within the context of the Rohce model. With the adoption of the assumptions that the contact component rotates synchronously and that the flow occurs isothermally with the thermal speed being a small fraction epsilon of the relative orbital speed, Ωd, of the two stars, we show that the steady flow can be formulated in terms of a problem with multiple length scales. Using this concept, we demonstrate the following by semianalytical methods. (1) The escape of material from the surface of the contact component is accomplished by a highly nonisotropic stellar wind which reaches sonic velocities in a neighborhood of the inner Lagrangian point, L1, of size epsilon in comparison with the orbit separation d. (2) This wind throttles into a narrow stram of material which makes a prescribed angle with respect to the line joining the stellar centers ranging from 19 0 5 to 28 0 4 for the full range of possible stellar mass ratios. (3) The width of the stream scales epsilond while its density scales with epsilon -2 M-dot/Ωd 3 , where M-dot is the mass transfer rate. (4) The stream width remains nearly constant over the part of the stream which is nearly straight, and narrows somewhat as the stream curves toward the detached component. (5) If the detached component is smaller than a certain specified size, the stream results in the formation of a disk of material of prescribed size orbiting the detached component in a direct sense. A subsidi []ry issue examined briefly in this paper is the flow mechanism responsible for moving material to the equator of the contact component, and from there to the L1 region where it is lost by the directed stellar wind. Comparisons of our work are made with previous theoretical studies, and some applications are indicated

  9. Integrated supply chain risk management

    OpenAIRE

    Riaan Bredell; Jackie Walters

    2007-01-01

    Integrated supply chain risk management (ISCRM) has become indispensable to the theory and practice of supply chain management. The economic and political realities of the modern world require not only a different approach to supply chain management, but also bold steps to secure supply chain performance and sustainable wealth creation. Integrated supply chain risk management provides supply chain organisations with a level of insight into their supply chains yet to be achieved. If correctly ...

  10. Supply Chain Connectivity: Enhancing Participation in the Global Supply Chain

    OpenAIRE

    Patalinghug, Epictetus E.

    2015-01-01

    Supply chain connectivity is vital for the efficient flow of trade among APEC economies. This paper reviews the literature and supply chain management, describes the barriers to enhancing participation in global supply chain, analyzes the various measures of supply chain performance, and suggests steps for the Philippines to fully reap the benefits of the global value chain.

  11. Excess Volumes and Excess Isentropic Compressibilities of Binary Liquid Mixtures of Trichloroethylene with Esters at 303.15 K

    Science.gov (United States)

    Ramanaiah, S.; Rao, C. Narasimha; Nagaraja, P.; Venkateswarlu, P.

    2015-11-01

    Exces volumes, VE, and excess isentropic compressibilities, κSE, have been reported as a function of composition for binary liquid mixtures of trichloroethylene with ethyl acetate, n-propyl acetate, and n-butyl acetate at 303.15 K. Isentropic compressibilities are calculated using measured sound speeds and density data for pure components and for binary mixtures. Excess volumes and excess isentropic compressibilities are found to be negative for the three systems studied over the entire composition range at 303.15 K, whereas these values become more negative with an increase of carbon chain length. The results are discussed in terms of intermolecular interactions between unlike molecules.

  12. Binaries and triples among asteroid pairs

    Science.gov (United States)

    Pravec, Petr; Scheirich, Peter; Kušnirák, Peter; Hornoch, Kamil; Galád, Adrián

    2015-08-01

    Despite major achievements obtained during the past two decades, our knowledge of the population and properties of small binary and multiple asteroid systems is still far from advanced. There is a numerous indirect evidence for that most small asteroid systems were formed by rotational fission of cohesionless parent asteroids that were spun up to the critical frequency presumably by YORP, but details of the process are lacking. Furthermore, as we proceed with observations of more and more binary and paired asteroids, we reveal new facts that substantially refine and sometimes change our understanding of the asteroid systems. One significant new finding we have recently obtained is that primaries of many asteroid pairs are actually binary or triple systems. The first such case found is (3749) Balam (Vokrouhlický, ApJL 706, L37, 2009). We have found 9 more binary systems among asteroid pairs within our ongoing NEOSource photometric project since October 2012. They are (6369) 1983 UC, (8306) Shoko, (9783) Tensho-kan, (10123) Fideoja, (21436) Chaoyichi, (43008) 1999 UD31, (44620) 1999 RS43, (46829) 1998 OS14 and (80218) 1999 VO123. We will review their characteristics. These paired binaries as we call them are mostly similar to binaries in the general ("background") population (of unpaired asteroids), but there are a few trends. The paired binaries tend to have larger secondaries with D_2/D_1 = 0.3 to 0.5 and they also tend to be wider systems with 8 of the 10 having orbital periods between 30 and 81 hours, than average among binaries in the general population. There may be also a larger fraction of triples; (3749) Balam is a confirmed triple, having a larger close and a smaller distant satellite, and (8306) Shoko and (10123) Fideoja are suspect triples as they show additional rotational lightcurve components with periods of 61 and 38.8 h that differ from the orbital period of 36.2 and 56.5 h, respectively. The unbound secondaries tend to be of the same size or

  13. Close-binary central stars of planetary nebulae

    International Nuclear Information System (INIS)

    Bond, H.E.; Grauer, A.D.

    1987-01-01

    Recent observations of PN central stars identified as binary systems are reviewed. The theoretical significance of binary central stars is discussed, and the characteristics of UU Sge, V 477 Lyr, MT Ser, LSS 2018, VW Pyx, and the central star of HFG 1 are briefly summarized. All of these binaries are shown to have periods less than 1 day, and it is estimated that about 10 percent of all binary central stars are close binaries. 27 references

  14. Understanding the supply chain

    Directory of Open Access Journals (Sweden)

    Aćimović Slobodan

    2006-01-01

    Full Text Available Supply chain management represents new business philosophy and includes strategically positioned and much wider scope of activity in comparison with its "older brother" - management of logistics. Philosophy of the concept of supply chain is directed to more coordination of key business functions of every link in distribution chain in the process of organization of the flow of both goods and information, while logistic managing instruments are focused on internal optimum of flows of goods and information within one company. Applying the concept of integrated supply chain among several companies makes the importance of operative logistics activity even greater on the level of one company, thus advancing processes of optimum and coordination within and between different companies and confirms the importance of logistics performances for the company’s profitability. Besides the fact that the borders between companies are being deleted, this concept of supply chain in one distribution channel influences increasing of importance of functional, i.e. traditional business managing approaches but instead it points out the importance of process managing approaches. Although the author is aware that "there is nothing harder, more dangerous and with uncertain success, but to find a way for introducing some novelties (Machiavelli, it would be even his additional stimulation for trying to bring closer the concept and goals of supply chain implementation that are identified in key, relevant, modern, theoretical and consulting approaches in order to achieve better understanding of the subject and faster implementation of the concept of supply chain management by domestic companies.

  15. Joint simulation of regional areas burned in Canadian forest fires: A Markov Chain Monte Carlo approach

    Science.gov (United States)

    Steen Magnussen

    2009-01-01

    Areas burned annually in 29 Canadian forest fire regions show a patchy and irregular correlation structure that significantly influences the distribution of annual totals for Canada and for groups of regions. A binary Monte Carlo Markov Chain (MCMC) is constructed for the purpose of joint simulation of regional areas burned in forest fires. For each year the MCMC...

  16. Predicting the Solubility of 1,1-Difluoroethane in Polystyrene Using the Perturbed Soft Chain Theory

    DEFF Research Database (Denmark)

    Pretel, Eduardo; Hong, Seong-Uk

    1998-01-01

    In this study, the solubility of 1,1-difluoroethane in polystyrene was correlated and predicted using the Perturbed Soft Chain Theory (PSCT) and compared with experimental data from the literature. For correlation, a binary interaction parameter was determined by using experimental solubility data...

  17. Entropy of finite random binary sequences with weak long-range correlations.

    Science.gov (United States)

    Melnik, S S; Usatenko, O V

    2014-11-01

    We study the N-step binary stationary ergodic Markov chain and analyze its differential entropy. Supposing that the correlations are weak we express the conditional probability function of the chain through the pair correlation function and represent the entropy as a functional of the pair correlator. Since the model uses the two-point correlators instead of the block probability, it makes it possible to calculate the entropy of strings at much longer distances than using standard methods. A fluctuation contribution to the entropy due to finiteness of random chains is examined. This contribution can be of the same order as its regular part even at the relatively short lengths of subsequences. A self-similar structure of entropy with respect to the decimation transformations is revealed for some specific forms of the pair correlation function. Application of the theory to the DNA sequence of the R3 chromosome of Drosophila melanogaster is presented.

  18. Inference on white dwarf binary systems using the first round Mock LISA Data Challenges data sets

    International Nuclear Information System (INIS)

    Stroeer, Alexander; Veitch, John; Roever, Christian; Bloomer, Ed; Clark, James; Christensen, Nelson; Hendry, Martin; Messenger, Chris; Meyer, Renate; Pitkin, Matthew; Toher, Jennifer; Umstaetter, Richard; Vecchio, Alberto; Woan, Graham

    2007-01-01

    We report on the analysis of selected single source data sets from the first round of the mock LISA data challenges (MLDC) for white dwarf binaries. We implemented an end-to-end pipeline consisting of a grid-based coherent pre-processing unit for signal detection and an automatic Markov Chain Monte Carlo (MCMC) post-processing unit for signal evaluation. We demonstrate that signal detection with our coherent approach is secure and accurate, and is increased in accuracy and supplemented with additional information on the signal parameters by our Markov Chain Monte Carlo approach. We also demonstrate that the Markov Chain Monte Carlo routine is additionally able to determine accurately the noise level in the frequency window of interest

  19. Plastic value chains

    DEFF Research Database (Denmark)

    Baxter, John; Wahlstrom, Margareta; Zu Castell-Rüdenhausen, Malin

    2014-01-01

    Optimizing plastic value chains is regarded as an important measure in order to increase recycling of plastics in an efficient way. This can also lead to improved awareness of the hazardous substances contained in plastic waste, and how to avoid that these substances are recycled. As an example......, plastics from WEEE is chosen as a Nordic case study. The project aims to propose a number of improvements for this value chain together with representatives from Nordic stakeholders. Based on the experiences made, a guide for other plastic value chains shall be developed....

  20. Project Decision Chain

    DEFF Research Database (Denmark)

    Rolstadås, Asbjørn; Pinto, Jeffrey K.; Falster, Peter

    2015-01-01

    To add value to project performance and help obtain project success, a new framework for decision making in projects is defined. It introduces the project decision chain inspired by the supply chain thinking in the manufacturing sector and uses three types of decisions: authorization, selection......, and plan decision. A primitive decision element is defined where all the three decision types can be accommodated. Each task in the primitive element can in itself contain subtasks that in turn will comprise new primitive elements. The primitive elements are nested together in a project decision chain....

  1. Do stellar clusters form fewer binaries? Using moderate separation binaries to distinguish between nature and nurture

    Science.gov (United States)

    Reiter, Megan

    2017-08-01

    Fewer wide-separation binaries are found in dense stellar clusters than in looser stellar associations. It is therefore unclear whether feedback in clusters prevents the formation of multiple systems or dynamical interactions destroy them. Measuring the prevalence of close, bound binary systems provide a key test to distinguish between these possibilities. Systems with separations of 10-50 AU will survive interactions in the cluster environment, and therefore are more representative of the natal population of multiple systems. By fitting a double-star PSF, we will identify visual binaries in the Orion Nebula with separations as small as 0.03. At the distance of Orion, this corresponds to a physical separation of 12 AU, effectively closing the observational gap in the binary separation distribution left between known visual and spectroscopic binaries (>65 AU or PhD thesis.

  2. Serial binary interval ratios improve rhythm reproduction.

    Science.gov (United States)

    Wu, Xiang; Westanmo, Anders; Zhou, Liang; Pan, Junhao

    2013-01-01

    Musical rhythm perception is a natural human ability that involves complex cognitive processes. Rhythm refers to the organization of events in time, and musical rhythms have an underlying hierarchical metrical structure. The metrical structure induces the feeling of a beat and the extent to which a rhythm induces the feeling of a beat is referred to as its metrical strength. Binary ratios are the most frequent interval ratio in musical rhythms. Rhythms with hierarchical binary ratios are better discriminated and reproduced than rhythms with hierarchical non-binary ratios. However, it remains unclear whether a superiority of serial binary over non-binary ratios in rhythm perception and reproduction exists. In addition, how different types of serial ratios influence the metrical strength of rhythms remains to be elucidated. The present study investigated serial binary vs. non-binary ratios in a reproduction task. Rhythms formed with exclusively binary (1:2:4:8), non-binary integer (1:3:5:6), and non-integer (1:2.3:5.3:6.4) ratios were examined within a constant meter. The results showed that the 1:2:4:8 rhythm type was more accurately reproduced than the 1:3:5:6 and 1:2.3:5.3:6.4 rhythm types, and the 1:2.3:5.3:6.4 rhythm type was more accurately reproduced than the 1:3:5:6 rhythm type. Further analyses showed that reproduction performance was better predicted by the distribution pattern of event occurrences within an inter-beat interval, than by the coincidence of events with beats, or the magnitude and complexity of interval ratios. Whereas rhythm theories and empirical data emphasize the role of the coincidence of events with beats in determining metrical strength and predicting rhythm performance, the present results suggest that rhythm processing may be better understood when the distribution pattern of event occurrences is taken into account. These results provide new insights into the mechanisms underlining musical rhythm perception.

  3. Serial binary interval ratios improve rhythm reproduction

    Directory of Open Access Journals (Sweden)

    Xiang eWu

    2013-08-01

    Full Text Available Musical rhythm perception is a natural human ability that involves complex cognitive processes. Rhythm refers to the organization of events in time, and musical rhythms have an underlying hierarchical metrical structure. The metrical structure induces the feeling of a beat and the extent to which a rhythm induces the feeling of a beat is referred to as its metrical strength. Binary ratios are the most frequent interval ratio in musical rhythms. Rhythms with hierarchical binary ratios are better discriminated and reproduced than rhythms with hierarchical non-binary ratios. However, it remains unclear whether a superiority of serial binary over non-binary ratios in rhythm perception and reproduction exists. In addition, how different types of serial ratios influence the metrical strength of rhythms remains to be elucidated. The present study investigated serial binary vs. non-binary ratios in a reproduction task. Rhythms formed with exclusively binary (1:2:4:8, non-binary integer (1:3:5:6, and non-integer (1:2.3:5.3:6.4 ratios were examined within a constant meter. The results showed that the 1:2:4:8 rhythm type was more accurately reproduced than the 1:3:5:6 and 1:2.3:5.3:6.4 rhythm types, and the 1:2.3:5.3:6.4 rhythm type was more accurately reproduced than the 1:3:5:6 rhythm type. Further analyses showed that reproduction performance was better predicted by the distribution pattern of event occurrences within an inter-beat interval, than by the coincidence of events with beats, or the magnitude and complexity of interval ratios. Whereas rhythm theories and empirical data emphasize the role of the coincidence of events with beats in determining metrical strength and predicting rhythm performance, the present results suggest that rhythm processing may be better understood when the distribution pattern of event occurrences is taken into account. These results provide new insights into the mechanisms underlining musical rhythm perception.

  4. Beyond binaries : a way forward for comparativeeducation

    Directory of Open Access Journals (Sweden)

    Marianne Larsen

    2012-09-01

    Full Text Available Binary discourses shape and produce the stories we construct about the field of comparative education. In the first part of this article, I review a set of binary discourses that have characterized social science research since the Enlightenment, including: quantitative-qualitative, nomotheticidiographic, inductive-deductive, and practice-theory. We can think of each of these binaries at opposite ends of a set of spectrums. In the second section of the paper, I show some of the ways in which these binaries have influenced the ways that we write and talk about research within the field of comparative education. I refer to the notion of binary discourses and the productive capacity of these discourses to shape our field. I then outline some critiques of these binaries to demonstrate the inherent limitations of binary discourses, and why we need to move beyond binaries in our research, and in the histories about our field. Finally, I present some tentative conclusions on ways to get ourselves out of the trap of binary thinking.Los discursos binarios moldean y producen los argumentos que construimos sobre la disciplina de la Educación Comparada. En la primera parte de este artículo, analizo un conjunto de discursos binarios que han caracterizado la investigación en Ciencias Sociales desde la Ilustración, incluyendo la cuantitativa-cualitativa, nomotética-idiográfica, inductivadeductiva, y la práctica-teoría. Podemos pensar sobre cada uno de estos discursos binarios como argumentos en los polos de un conjunto de posibilidades. En la segunda sección del artículo, revelo algunos modos en los que estos discursos binarios han influenciado las formas a través de las cuales escribimos y analizamos la investigación en el ámbito de la Educación Comparada. Analizo la noción de discursos binarios y la capacidad productiva de estos discursos de impactar nuestra ciencia. Seguidamente expongo algunas críticas de estos discursos binarios con el

  5. The binary white dwarf LHS 3236

    Energy Technology Data Exchange (ETDEWEB)

    Harris, Hugh C.; Dahn, Conard C.; Canzian, Blaise; Guetter, Harry H.; Levine, Stephen E.; Luginbuhl, Christian B.; Monet, Alice K. B.; Stone, Ronald C.; Subasavage, John P.; Tilleman, Trudy; Walker, Richard L. [US Naval Observatory, 10391 West Naval Observatory Road, Flagstaff, AZ 86001-8521 (United States); Dupuy, Trent J.; Liu, Michael C. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Hartkopf, William I. [US Naval Observatory, 3450 Massachusetts Avenue, N.W., Washington, DC 20392-5420 (United States); Ireland, Michael J. [Department of Physics and Astronomy, Macquarie University, New South Wales, NSW 2109 (Australia); Leggett, S. K., E-mail: hch@nofs.navy.mil [Gemini Observatory, 670 N. Aohoku Place, Hilo, HI 96720 (United States)

    2013-12-10

    The white dwarf LHS 3236 (WD1639+153) is shown to be a double-degenerate binary, with each component having a high mass. Astrometry at the U.S. Naval Observatory gives a parallax and distance of 30.86 ± 0.25 pc and a tangential velocity of 98 km s{sup –1}, and reveals binary orbital motion. The orbital parameters are determined from astrometry of the photocenter over more than three orbits of the 4.0 yr period. High-resolution imaging at the Keck Observatory resolves the pair with a separation of 31 and 124 mas at two epochs. Optical and near-IR photometry give a set of possible binary components. Consistency of all data indicates that the binary is a pair of DA stars with temperatures near 8000 and 7400 K and with masses of 0.93 and 0.91 M {sub ☉}; also possible is a DA primary and a helium DC secondary with temperatures near 8800 and 6000 K and with masses of 0.98 and 0.69 M {sub ☉}. In either case, the cooling ages of the stars are ∼3 Gyr and the total ages are <4 Gyr. The combined mass of the binary (1.66-1.84 M {sub ☉}) is well above the Chandrasekhar limit; however, the timescale for coalescence is long.

  6. Investigating Dark Energy with Black Hole Binaries

    International Nuclear Information System (INIS)

    Mersini-Houghton, Laura; Kelleher, Adam

    2009-01-01

    The accelerated expansion of the universe is ascribed to the existence of dark energy. Black holes accrete dark energy. The accretion induces a mass change proportional to the energy density and pressure of the background dark energy fluid. The time scale during which the mass of black holes changes considerably is long relative to the age of the universe, thus beyond detection possibilities. We propose to take advantage of the modified black hole masses for exploring the equation of state w[z] of dark energy, by investigating the evolution of supermassive black hole binaries on a dark energy background. Deriving the signatures of dark energy accretion on the evolution of binaries, we find that dark energy imprints on the emitted gravitational radiation and on the changes in the orbital radius of the binary can be within detection limits for certain supermassive black hole binaries. This talk describes how binaries can provide a useful tool in obtaining complementary information on the nature of dark energy.

  7. Star formation history: Modeling of visual binaries

    Science.gov (United States)

    Gebrehiwot, Y. M.; Tessema, S. B.; Malkov, O. Yu.; Kovaleva, D. A.; Sytov, A. Yu.; Tutukov, A. V.

    2018-05-01

    Most stars form in binary or multiple systems. Their evolution is defined by masses of components, orbital separation and eccentricity. In order to understand star formation and evolutionary processes, it is vital to find distributions of physical parameters of binaries. We have carried out Monte Carlo simulations in which we simulate different pairing scenarios: random pairing, primary-constrained pairing, split-core pairing, and total and primary pairing in order to get distributions of binaries over physical parameters at birth. Next, for comparison with observations, we account for stellar evolution and selection effects. Brightness, radius, temperature, and other parameters of components are assigned or calculated according to approximate relations for stars in different evolutionary stages (main-sequence stars, red giants, white dwarfs, relativistic objects). Evolutionary stage is defined as a function of system age and component masses. We compare our results with the observed IMF, binarity rate, and binary mass-ratio distributions for field visual binaries to find initial distributions and pairing scenarios that produce observed distributions.

  8. Editorial: Supply Chain Management

    Directory of Open Access Journals (Sweden)

    Aidonis, D.

    2012-01-01

    Full Text Available This special issue has followed up the 2nd Olympus International Conference on Supply Chains held on October 5-6, 2012, in Katerini, Greece. The Conference was organized by the Department of Logistics of Alexander Technological Educational Institution (ATEI of Thessaloniki, in collaboration with the Laboratory of Quantitative Analysis, Logistics and Supply Chain Management of the Department of Mechanical Engineering, Aristotle University of Thessaloniki (AUTH. During the 2-Days Conference more than 50 research papers were presented covering the following thematic areas: (i Business Logistics, (ii Transportation, Telematics and Distribution Networks, (iii Green Logistics, (iv Information and Communication Technologies in Supply Chain Management, and (v Services and Quality. Three keynote invited speakers addressed interesting issues for the Humanitarian Logistics, Green Supply Chains of the Agrifood Sector and the Opportunities and Prospects of Greek Ports chaired Round Tables with other Greek and Foreign Scientists and Specialists.

  9. Characterizing Oregon's supply chains.

    Science.gov (United States)

    2013-03-01

    In many regions throughout the world, freight models are used to aid infrastructure investment and : policy decisions. Since freight is such an integral part of efficient supply chains, more realistic : transportation models can be of greater assista...

  10. Moldova - Value Chain Training

    Data.gov (United States)

    Millennium Challenge Corporation — The evaluation of the GHS value chain training subactivity wwas designed to measure the extent, if any, to which the training activities improved the productivity...

  11. Innovation Across the Supply Chain

    DEFF Research Database (Denmark)

    Druehl, Cheryl; Carrillo, Janice; Hsuan, Juliana

    Innovation is an integral part of every firm’s ongoing operations. Beyond product innovation, supply chain innovations offer a unique source of competitive advantage. We synthesize recent research on innovation in the supply chain, specifically, innovative supply chain processes...

  12. EVOLUTION OF THE BINARY FRACTION IN DENSE STELLAR SYSTEMS

    International Nuclear Information System (INIS)

    Fregeau, John M.; Ivanova, Natalia; Rasio, Frederic A.

    2009-01-01

    Using our recently improved Monte Carlo evolution code, we study the evolution of the binary fraction in globular clusters. In agreement with previous N-body simulations, we find generally that the hard binary fraction in the core tends to increase with time over a range of initial cluster central densities for initial binary fractions ∼<90%. The dominant processes driving the evolution of the core binary fraction are mass segregation of binaries into the cluster core and preferential destruction of binaries there. On a global scale, these effects and the preferential tidal stripping of single stars tend to roughly balance, leading to overall cluster binary fractions that are roughly constant with time. Our findings suggest that the current hard binary fraction near the half-mass radius is a good indicator of the hard primordial binary fraction. However, the relationship between the true binary fraction and the fraction of main-sequence stars in binaries (which is typically what observers measure) is nonlinear and rather complicated. We also consider the importance of soft binaries, which not only modify the evolution of the binary fraction, but can also drastically change the evolution of the cluster as a whole. Finally, we briefly describe the recent addition of single and binary stellar evolution to our cluster evolution code.

  13. Supply chain risk management

    OpenAIRE

    Christian Hollstein; Frank Himpel

    2013-01-01

    Background: Supply chain risk management increasingly gains prominence in many international industries. In order to strengthen supply chain structures, processes, and networks, adequate potentials for risk management need to be built (focus on effective logistics) and to be utilized (focus on efficient logistics). Natural-based disasters, such as the case of Fukushima, illustrate how crucial risk management is. Method: By aligning a theoretical-conceptual framework with empirical-induct...

  14. MASTERING SUPPLY CHAIN RISKS

    Directory of Open Access Journals (Sweden)

    Borut Jereb

    2012-11-01

    Full Text Available Risks in supply chains represent one of the major business issues today. Since every organizationstrives for success and uninterrupted operations, efficient supply chain risk management is crucial.During supply chain risk research at the Faculty of Logistics in Maribor (Slovenia some keyissues in the field were identified, the major being the lack of instruments which can make riskmanagement in an organization easier and more efficient. Consequently, a model which captures anddescribes risks in an organization and its supply chain was developed. It is in accordance with thegeneral risk management and supply chain security standards, the ISO 31000 and ISO 28000families. It also incorporates recent finding from the risk management field, especially from theviewpoint of segmenting of the public.The model described in this paper focuses on the risks itself by defining them by different keydimensions, so that risk management is simplified and can be undertaken in every supply chain andorganizations within them. Based on our mode and consequent practical research in actualorganizations, a freely accessible risk catalog has been assembled and published online from the risksthat have been identified so far. This catalog can serve as a checklist and a starting point in supplychain risk management in organizations. It also incorporates experts from the field into a community,in order to assemble an ever growing list of possible risks and to provide insight into the model andits value in practice.

  15. Hybrid Black-Hole Binary Initial Data

    Science.gov (United States)

    Mundim, Bruno C.; Kelly, Bernard J.; Nakano, Hiroyuki; Zlochower, Yosef; Campanelli, Manuela

    2010-01-01

    "Traditional black-hole binary puncture initial data is conformally flat. This unphysical assumption is coupled with a lack of radiation signature from the binary's past life. As a result, waveforms extracted from evolutions of this data display an abrupt jump. In Kelly et al. [Class. Quantum Grav. 27:114005 (2010)], a new binary black-hole initial data with radiation contents derived in the post-Newtonian (PN) calculations was adapted to puncture evolutions in numerical relativity. This data satisfies the constraint equations to the 2.5PN order, and contains a transverse-traceless "wavy" metric contribution, violating the standard assumption of conformal flatness. Although the evolution contained less spurious radiation, there were undesired features; the unphysical horizon mass loss and the large initial orbital eccentricity. Introducing a hybrid approach to the initial data evaluation, we significantly reduce these undesired features."

  16. Optimized reversible binary-coded decimal adders

    DEFF Research Database (Denmark)

    Thomsen, Michael Kirkedal; Glück, Robert

    2008-01-01

    Abstract Babu and Chowdhury [H.M.H. Babu, A.R. Chowdhury, Design of a compact reversible binary coded decimal adder circuit, Journal of Systems Architecture 52 (5) (2006) 272-282] recently proposed, in this journal, a reversible adder for binary-coded decimals. This paper corrects and optimizes...... their design. The optimized 1-decimal BCD full-adder, a 13 × 13 reversible logic circuit, is faster, and has lower circuit cost and less garbage bits. It can be used to build a fast reversible m-decimal BCD full-adder that has a delay of only m + 17 low-power reversible CMOS gates. For a 32-decimal (128-bit....... Keywords: Reversible logic circuit; Full-adder; Half-adder; Parallel adder; Binary-coded decimal; Application of reversible logic synthesis...

  17. A binary mixture operated heat pump

    International Nuclear Information System (INIS)

    Hihara, E.; Saito, T.

    1991-01-01

    This paper evaluates the performance of possible binary mixtures as working fluids in high- temperature heat pump applications. The binary mixtures, which are potential alternatives of fully halogenated hydrocarbons, include HCFC142b/HCFC22, HFC152a/HCFC22, HFC134a/HCFC22. The performance of the mixtures is estimated by a thermodynamic model and a practical model in which the heat transfer is considered in heat exchangers. One of the advantages of binary mixtures is a higher coefficient of performance, which is caused by the small temperature difference between the heat-sink/-source fluid and the refrigerant. The mixture HCFC142b/HCFC22 is promising from the stand point of thermodynamic performance

  18. TIDAL NOVAE IN COMPACT BINARY WHITE DWARFS

    International Nuclear Information System (INIS)

    Fuller, Jim; Lai Dong

    2012-01-01

    Compact binary white dwarfs (WDs) undergoing orbital decay due to gravitational radiation can experience significant tidal heating prior to merger. In these WDs, the dominant tidal effect involves the excitation of outgoing gravity waves in the inner stellar envelope and the dissipation of these waves in the outer envelope. As the binary orbit decays, the WDs are synchronized from outside in (with the envelope synchronized first, followed by the core). We examine the deposition of tidal heat in the envelope of a carbon-oxygen WD and study how such tidal heating affects the structure and evolution of the WD. We show that significant tidal heating can occur in the star's degenerate hydrogen layer. This layer heats up faster than it cools, triggering runaway nuclear fusion. Such 'tidal novae' may occur in all WD binaries containing a CO WD, at orbital periods between 5 minutes and 20 minutes, and precede the final merger by 10 5 -10 6 years.

  19. Compact binary hashing for music retrieval

    Science.gov (United States)

    Seo, Jin S.

    2014-03-01

    With the huge volume of music clips available for protection, browsing, and indexing, there is an increased attention to retrieve the information contents of the music archives. Music-similarity computation is an essential building block for browsing, retrieval, and indexing of digital music archives. In practice, as the number of songs available for searching and indexing is increased, so the storage cost in retrieval systems is becoming a serious problem. This paper deals with the storage problem by extending the supervector concept with the binary hashing. We utilize the similarity-preserving binary embedding in generating a hash code from the supervector of each music clip. Especially we compare the performance of the various binary hashing methods for music retrieval tasks on the widely-used genre dataset and the in-house singer dataset. Through the evaluation, we find an effective way of generating hash codes for music similarity estimation which improves the retrieval performance.

  20. Reconciliation with non-binary species trees.

    Science.gov (United States)

    Vernot, Benjamin; Stolzer, Maureen; Goldman, Aiton; Durand, Dannie

    2008-10-01

    Reconciliation extracts information from the topological incongruence between gene and species trees to infer duplications and losses in the history of a gene family. The inferred duplication-loss histories provide valuable information for a broad range of biological applications, including ortholog identification, estimating gene duplication times, and rooting and correcting gene trees. While reconciliation for binary trees is a tractable and well studied problem, there are no algorithms for reconciliation with non-binary species trees. Yet a striking proportion of species trees are non-binary. For example, 64% of branch points in the NCBI taxonomy have three or more children. When applied to non-binary species trees, current algorithms overestimate the number of duplications because they cannot distinguish between duplication and incomplete lineage sorting. We present the first algorithms for reconciling binary gene trees with non-binary species trees under a duplication-loss parsimony model. Our algorithms utilize an efficient mapping from gene to species trees to infer the minimum number of duplications in O(|V(G) | x (k(S) + h(S))) time, where |V(G)| is the number of nodes in the gene tree, h(S) is the height of the species tree and k(S) is the size of its largest polytomy. We present a dynamic programming algorithm which also minimizes the total number of losses. Although this algorithm is exponential in the size of the largest polytomy, it performs well in practice for polytomies with outdegree of 12 or less. We also present a heuristic which estimates the minimal number of losses in polynomial time. In empirical tests, this algorithm finds an optimal loss history 99% of the time. Our algorithms have been implemented in NOTUNG, a robust, production quality, tree-fitting program, which provides a graphical user interface for exploratory analysis and also supports automated, high-throughput analysis of large data sets.

  1. Microlensing Binaries Discovered through High-magnification Channel

    DEFF Research Database (Denmark)

    Shin, I.-G.; Choi, J.-Y.; Park, S.-Y.

    2012-01-01

    Microlensing can provide a useful tool to probe binary distributions down to low-mass limits of binary companions. In this paper, we analyze the light curves of eight binary-lensing events detected through the channel of high-magnification events during the seasons from 2007 to 2010. The perturba......Microlensing can provide a useful tool to probe binary distributions down to low-mass limits of binary companions. In this paper, we analyze the light curves of eight binary-lensing events detected through the channel of high-magnification events during the seasons from 2007 to 2010...

  2. Inducing Risk Neutral Preferences with Binary Lotteries

    DEFF Research Database (Denmark)

    Harrison, Glenn W.; Martínez-Correa, Jimmy; Swarthout, J. Todd

    2013-01-01

    validity of any strategic equilibrium behavior, or even the customary independence axiom. We show that subjects sampled from our population are generally risk averse when lotteries are defined over monetary outcomes, and that the binary lottery procedure does indeed induce a statistically significant shift......We evaluate the binary lottery procedure for inducing risk neutral behavior. We strip the experimental implementation down to bare bones, taking care to avoid any potentially confounding assumptions about behavior having to be made. In particular, our evaluation does not rely on the assumed...... toward risk neutrality. This striking result generalizes to the case in which subjects make several lottery choices and one is selected for payment....

  3. A simple model for binary star evolution

    International Nuclear Information System (INIS)

    Whyte, C.A.; Eggleton, P.P.

    1985-01-01

    A simple model for calculating the evolution of binary stars is presented. Detailed stellar evolution calculations of stars undergoing mass and energy transfer at various rates are reported and used to identify the dominant physical processes which determine the type of evolution. These detailed calculations are used to calibrate the simple model and a comparison of calculations using the detailed stellar evolution equations and the simple model is made. Results of the evolution of a few binary systems are reported and compared with previously published calculations using normal stellar evolution programs. (author)

  4. Non-binary or genderqueer genders

    OpenAIRE

    Richards, Christina; Bouman, Walter Pierre; Seal, Leighton; Barker, Meg John; Nieder, Timo O; T'Sjoen, Guy

    2016-01-01

    Some people have a gender which is neither male nor female and may identify as both male and female at one time, as different genders at different times, as no gender at all, or dispute the very idea of only two genders. The umbrella terms for such genders are genderqueer' or non-binary' genders. Such gender identities outside of the binary of female and male are increasingly being recognized in legal, medical and psychological systems and diagnostic classifications in line with the emerging ...

  5. Applications Of Binary Image Analysis Techniques

    Science.gov (United States)

    Tropf, H.; Enderle, E.; Kammerer, H. P.

    1983-10-01

    After discussing the conditions where binary image analysis techniques can be used, three new applications of the fast binary image analysis system S.A.M. (Sensorsystem for Automation and Measurement) are reported: (1) The human view direction is measured at TV frame rate while the subject's head is free movable. (2) Industrial parts hanging on a moving conveyor are classified prior to spray painting by robot. (3) In automotive wheel assembly, the eccentricity of the wheel is minimized by turning the tyre relative to the rim in order to balance the eccentricity of the components.

  6. Sputtering yield calculation for binary target

    International Nuclear Information System (INIS)

    Jimenez-Rodriguez, J.J.; Rodriguez-Vidal, M.; Valles-Abarca, J.A.

    1979-01-01

    The generalization for binary targets, of the ideas proposed by Sigmund for monoatomic targets, leads to a set of coupled intergrodifferential equations for the sputtering functions. After moment decomposition, the final formulae are obtained by the standard method based on the Laplace Transform, where the inverse transform is made with the aid of asymptotic expansions in the limit of very high projectile energy as compared to the surface binding energy. The possible loss of stoichiometry for binary targets is analyzed. Comparison of computed values of sputtering yield for normal incidence, with experimental results shows good agreement. (author)

  7. Binary Sparse Phase Retrieval via Simulated Annealing

    Directory of Open Access Journals (Sweden)

    Wei Peng

    2016-01-01

    Full Text Available This paper presents the Simulated Annealing Sparse PhAse Recovery (SASPAR algorithm for reconstructing sparse binary signals from their phaseless magnitudes of the Fourier transform. The greedy strategy version is also proposed for a comparison, which is a parameter-free algorithm. Sufficient numeric simulations indicate that our method is quite effective and suggest the binary model is robust. The SASPAR algorithm seems competitive to the existing methods for its efficiency and high recovery rate even with fewer Fourier measurements.

  8. Testing the Binary Black Hole Nature of a Compact Binary Coalescence.

    Science.gov (United States)

    Krishnendu, N V; Arun, K G; Mishra, Chandra Kant

    2017-09-01

    We propose a novel method to test the binary black hole nature of compact binaries detectable by gravitational wave (GW) interferometers and, hence, constrain the parameter space of other exotic compact objects. The spirit of the test lies in the "no-hair" conjecture for black holes where all properties of a Kerr black hole are characterized by its mass and spin. The method relies on observationally measuring the quadrupole moments of the compact binary constituents induced due to their spins. If the compact object is a Kerr black hole (BH), its quadrupole moment is expressible solely in terms of its mass and spin. Otherwise, the quadrupole moment can depend on additional parameters (such as the equation of state of the object). The higher order spin effects in phase and amplitude of a gravitational waveform, which explicitly contains the spin-induced quadrupole moments of compact objects, hence, uniquely encode the nature of the compact binary. Thus, we argue that an independent measurement of the spin-induced quadrupole moment of the compact binaries from GW observations can provide a unique way to distinguish binary BH systems from binaries consisting of exotic compact objects.

  9. The fate of close encounters between binary stars and binary supermassive black holes

    Science.gov (United States)

    Wang, Yi-Han; Leigh, Nathan; Yuan, Ye-Fei; Perna, Rosalba

    2018-04-01

    The evolution of main-sequence binaries that reside in the Galactic Centre can be heavily influenced by the central supermassive black hole (SMBH). Due to these perturbative effects, the stellar binaries in dense environments are likely to experience mergers, collisions, or ejections through secular and/or non-secular interactions. More direct interactions with the central SMBH are thought to produce hypervelocity stars (HVSs) and tidal disruption events (TDEs). In this paper, we use N-body simulations to study the dynamics of stellar binaries orbiting a central SMBH primary with an outer SMBH secondary orbiting this inner triple. The effects of the secondary SMBH on the event rates of HVSs, TDEs, and stellar mergers are investigated, as a function of the SMBH-SMBH binary mass ratio. Our numerical experiments reveal that, relative to the isolated SMBH case, the TDE and HVS rates are enhanced for, respectively, the smallest and largest mass ratio SMBH-SMBH binaries. This suggests that the observed event rates of TDEs and HVSs have the potential to serve as a diagnostic of the mass ratio of a central SMBH-SMBH binary. The presence of a secondary SMBH also allows for the creation of hypervelocity binaries. Observations of these systems could thus constrain the presence of a secondary SMBH in the Galactic Centre.

  10. CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. I. S-TYPE BINARIES

    Energy Technology Data Exchange (ETDEWEB)

    Kaltenegger, Lisa [MPIA, Koenigstuhl 17, D-69117 Heidelberg (Germany); Haghighipour, Nader, E-mail: kaltenegger@mpia.de [Institute for Astronomy and NASA Astrobiology Institute, University of Hawaii-Manoa, Honolulu, HI 96822 (United States)

    2013-11-10

    We have developed a comprehensive methodology for calculating the boundaries of the habitable zone (HZ) of planet-hosting S-type binary star systems. Our approach is general and takes into account the contribution of both stars to the location and extent of the binary HZ with different stellar spectral types. We have studied how the binary eccentricity and stellar energy distribution affect the extent of the HZ. Results indicate that in binaries where the combination of mass-ratio and orbital eccentricity allows planet formation around a star of the system to proceed successfully, the effect of a less luminous secondary on the location of the primary's HZ is generally negligible. However, when the secondary is more luminous, it can influence the extent of the HZ. We present the details of the derivations of our methodology and discuss its application to the binary HZ around the primary and secondary main-sequence stars of an FF, MM, and FM binary, as well as two known planet-hosting binaries α Cen AB and HD 196886.

  11. CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. I. S-TYPE BINARIES

    International Nuclear Information System (INIS)

    Kaltenegger, Lisa; Haghighipour, Nader

    2013-01-01

    We have developed a comprehensive methodology for calculating the boundaries of the habitable zone (HZ) of planet-hosting S-type binary star systems. Our approach is general and takes into account the contribution of both stars to the location and extent of the binary HZ with different stellar spectral types. We have studied how the binary eccentricity and stellar energy distribution affect the extent of the HZ. Results indicate that in binaries where the combination of mass-ratio and orbital eccentricity allows planet formation around a star of the system to proceed successfully, the effect of a less luminous secondary on the location of the primary's HZ is generally negligible. However, when the secondary is more luminous, it can influence the extent of the HZ. We present the details of the derivations of our methodology and discuss its application to the binary HZ around the primary and secondary main-sequence stars of an FF, MM, and FM binary, as well as two known planet-hosting binaries α Cen AB and HD 196886

  12. Searching for massive black hole binaries in the first Mock LISA Data Challenge

    International Nuclear Information System (INIS)

    Cornish, Neil J; Porter, Edward K

    2007-01-01

    The Mock LISA Data Challenge is a worldwide effort to solve the LISA data analysis problem. We present here our results for the massive black hole binary (BBH) section of round 1. Our results cover challenge 1.2.1, where the coalescence of the binary is seen, and challenge 1.2.2, where the coalescence occurs after the simulated observational period. The data stream is composed of Gaussian instrumental noise plus an unknown BBH waveform. Our search algorithm is based on a variant of the Markov chain Monte Carlo method that uses Metropolis-Hastings sampling and thermostated frequency annealing. We present results from the training data sets where we know the parameter values a priori and the blind data sets where we were informed of the parameter values after the challenge had finished. We demonstrate that our algorithm is able to rapidly locate the sources, accurately recover the source parameters and provide error estimates for the recovered parameters

  13. BROWN DWARF BINARIES FROM DISINTEGRATING TRIPLE SYSTEMS

    International Nuclear Information System (INIS)

    Reipurth, Bo; Mikkola, Seppo

    2015-01-01

    Binaries in which both components are brown dwarfs (BDs) are being discovered at an increasing rate, and their properties may hold clues to their origin. We have carried out 200,000 N-body simulations of three identical stellar embryos with masses drawn from a Chabrier IMF and embedded in a molecular core. The bodies are initially non-hierarchical and undergo chaotic motions within the cloud core, while accreting using Bondi–Hoyle accretion. The coupling of dynamics and accretion often leads to one or two dominant bodies controlling the center of the cloud core, while banishing the other(s) to the lower-density outskirts, leading to stunted growth. Eventually each system transforms either to a bound hierarchical configuration or breaks apart into separate single and binary components. The orbital motion is followed for 100 Myr. In order to illustrate 200,000 end-states of such dynamical evolution with accretion, we introduce the “triple diagnostic diagram,” which plots two dimensionless numbers against each other, representing the binary mass ratio and the mass ratio of the third body to the total system mass. Numerous freefloating BD binaries are formed in these simulations, and statistical properties are derived. The separation distribution function is in good correspondence with observations, showing a steep rise at close separations, peaking around 13 AU and declining more gently, reaching zero at separations greater than 200 AU. Unresolved BD triple systems may appear as wider BD binaries. Mass ratios are strongly peaked toward unity, as observed, but this is partially due to the initial assumptions. Eccentricities gradually increase toward higher values, due to the lack of viscous interactions in the simulations, which would both shrink the orbits and decrease their eccentricities. Most newborn triple systems are unstable and while there are 9209 ejected BD binaries at 1 Myr, corresponding to about 4% of the 200,000 simulations, this number has grown to

  14. BROWN DWARF BINARIES FROM DISINTEGRATING TRIPLE SYSTEMS

    Energy Technology Data Exchange (ETDEWEB)

    Reipurth, Bo [Institute for Astronomy and NASA Astrobiology Institute University of Hawaii, 640 N. Aohoku Place, Hilo, HI 96720 (United States); Mikkola, Seppo, E-mail: reipurth@ifa.hawaii.edu, E-mail: Seppo.Mikkola@utu.fi [Tuorla Observatory, University of Turku, Väisäläntie 20, Piikkiö (Finland)

    2015-04-15

    Binaries in which both components are brown dwarfs (BDs) are being discovered at an increasing rate, and their properties may hold clues to their origin. We have carried out 200,000 N-body simulations of three identical stellar embryos with masses drawn from a Chabrier IMF and embedded in a molecular core. The bodies are initially non-hierarchical and undergo chaotic motions within the cloud core, while accreting using Bondi–Hoyle accretion. The coupling of dynamics and accretion often leads to one or two dominant bodies controlling the center of the cloud core, while banishing the other(s) to the lower-density outskirts, leading to stunted growth. Eventually each system transforms either to a bound hierarchical configuration or breaks apart into separate single and binary components. The orbital motion is followed for 100 Myr. In order to illustrate 200,000 end-states of such dynamical evolution with accretion, we introduce the “triple diagnostic diagram,” which plots two dimensionless numbers against each other, representing the binary mass ratio and the mass ratio of the third body to the total system mass. Numerous freefloating BD binaries are formed in these simulations, and statistical properties are derived. The separation distribution function is in good correspondence with observations, showing a steep rise at close separations, peaking around 13 AU and declining more gently, reaching zero at separations greater than 200 AU. Unresolved BD triple systems may appear as wider BD binaries. Mass ratios are strongly peaked toward unity, as observed, but this is partially due to the initial assumptions. Eccentricities gradually increase toward higher values, due to the lack of viscous interactions in the simulations, which would both shrink the orbits and decrease their eccentricities. Most newborn triple systems are unstable and while there are 9209 ejected BD binaries at 1 Myr, corresponding to about 4% of the 200,000 simulations, this number has grown to

  15. Phasic Triplet Markov Chains.

    Science.gov (United States)

    El Yazid Boudaren, Mohamed; Monfrini, Emmanuel; Pieczynski, Wojciech; Aïssani, Amar

    2014-11-01

    Hidden Markov chains have been shown to be inadequate for data modeling under some complex conditions. In this work, we address the problem of statistical modeling of phenomena involving two heterogeneous system states. Such phenomena may arise in biology or communications, among other fields. Namely, we consider that a sequence of meaningful words is to be searched within a whole observation that also contains arbitrary one-by-one symbols. Moreover, a word may be interrupted at some site to be carried on later. Applying plain hidden Markov chains to such data, while ignoring their specificity, yields unsatisfactory results. The Phasic triplet Markov chain, proposed in this paper, overcomes this difficulty by means of an auxiliary underlying process in accordance with the triplet Markov chains theory. Related Bayesian restoration techniques and parameters estimation procedures according to the new model are then described. Finally, to assess the performance of the proposed model against the conventional hidden Markov chain model, experiments are conducted on synthetic and real data.

  16. Nodal-chain metals.

    Science.gov (United States)

    Bzdušek, Tomáš; Wu, QuanSheng; Rüegg, Andreas; Sigrist, Manfred; Soluyanov, Alexey A

    2016-10-06

    The band theory of solids is arguably the most successful theory of condensed-matter physics, providing a description of the electronic energy levels in various materials. Electronic wavefunctions obtained from the band theory enable a topological characterization of metals for which the electronic spectrum may host robust, topologically protected, fermionic quasiparticles. Many of these quasiparticles are analogues of the elementary particles of the Standard Model, but others do not have a counterpart in relativistic high-energy theories. A complete list of possible quasiparticles in solids is lacking, even in the non-interacting case. Here we describe the possible existence of a hitherto unrecognized type of fermionic excitation in metals. This excitation forms a nodal chain-a chain of connected loops in momentum space-along which conduction and valence bands touch. We prove that the nodal chain is topologically distinct from previously reported excitations. We discuss the symmetry requirements for the appearance of this excitation and predict that it is realized in an existing material, iridium tetrafluoride (IrF 4 ), as well as in other compounds of this class of materials. Using IrF 4 as an example, we provide a discussion of the topological surface states associated with the nodal chain. We argue that the presence of the nodal-chain fermions will result in anomalous magnetotransport properties, distinct from those of materials exhibiting previously known excitations.

  17. Ultracompact X-ray binary stars

    NARCIS (Netherlands)

    Haaften, L.M. van

    2013-01-01

    Ultracompact X-ray binary stars usually consist of a neutron star and a white dwarf, two stars bound together by their strong gravity and orbiting each other very rapidly, completing one orbit in less than one hour. Neutron stars are extremely compact remnants of the collapsed cores of massive stars

  18. Jet precession in binary black holes

    Science.gov (United States)

    Abraham, Zulema

    2018-06-01

    Supermassive binary black holes are thought to lie at the centres of merging galaxies. The blazar OJ 287 is the poster child of such systems, showing strong and periodic variability across the electromagnetic spectrum. A new study questions the physical origin of this variability.

  19. Mesoscopic electrohydrodynamic simulations of binary colloidal suspensions

    NARCIS (Netherlands)

    Rivas, Nicolas; Frijters, Stefan; Pagonabarraga, Ignacio; Harting, Jens

    2018-01-01

    A model is presented for the solution of electrokinetic phenomena of colloidal suspensions in fluid mixtures. We solve the discrete Boltzmann equation with a Bhatnagar-Gross-Krook collision operator using the lattice Boltzmann method to simulate binary fluid flows. Solvent-solvent and solvent-solute

  20. Smoothed analysis of binary search trees

    NARCIS (Netherlands)

    Manthey, Bodo; Reischuk, Rüdiger

    2007-01-01

    Binary search trees are one of the most fundamental data structures. While the height of such a tree may be linear in the worst case, the average height with respect to the uniform distribution is only logarithmic. The exact value is one of the best studied problems in average-case complexity. We

  1. A coinductive calculus of binary trees

    NARCIS (Netherlands)

    A.M. Silva (Alexandra); J.J.M.M. Rutten (Jan)

    2007-01-01

    htmlabstractWe study the set T_A of infinite binary trees with nodes labelled in a semiring A from a coalgebraic perspective. We present coinductive definition and proof principles based on the fact that T_A carries a final coalgebra structure. By viewing trees as formal power series, we develop a

  2. Binary palmprint representation for feature template protection

    NARCIS (Netherlands)

    Mu, Meiru; Ruan, Qiuqi; Shao, X.; Spreeuwers, Lieuwe Jan; Veldhuis, Raymond N.J.

    2012-01-01

    The major challenge of biometric template protection comes from the intraclass variations of biometric data. The helper data scheme aims to solve this problem by employing the Error Correction Codes (ECC). However, many reported biometric binary features from the same user reach bit error rate (BER)

  3. The average size of ordered binary subgraphs

    NARCIS (Netherlands)

    van Leeuwen, J.; Hartel, Pieter H.

    To analyse the demands made on the garbage collector in a graph reduction system, the change in size of an average graph is studied when an arbitrary edge is removed. In ordered binary trees the average number of deleted nodes as a result of cutting a single edge is equal to the average size of a

  4. Short-timescale variability in cataclysmic binaries

    International Nuclear Information System (INIS)

    Cordova, F.A.; Mason, K.O.

    1982-01-01

    Rapid variability, including flickering and pulsations, has been detected in cataclysmic binaries at optical and x-ray frequencies. In the case of the novalike variable TT Arietis, simultaneous observations reveal that the x-ray and optical flickering activity is strongly correlated, while short period pulsations are observed that occur at the same frequencies in both wavelength bands

  5. Non-binary or genderqueer genders.

    Science.gov (United States)

    Richards, Christina; Bouman, Walter Pierre; Seal, Leighton; Barker, Meg John; Nieder, Timo O; T'Sjoen, Guy

    2016-01-01

    Some people have a gender which is neither male nor female and may identify as both male and female at one time, as different genders at different times, as no gender at all, or dispute the very idea of only two genders. The umbrella terms for such genders are 'genderqueer' or 'non-binary' genders. Such gender identities outside of the binary of female and male are increasingly being recognized in legal, medical and psychological systems and diagnostic classifications in line with the emerging presence and advocacy of these groups of people. Population-based studies show a small percentage--but a sizable proportion in terms of raw numbers--of people who identify as non-binary. While such genders have been extant historically and globally, they remain marginalized, and as such--while not being disorders or pathological in themselves--people with such genders remain at risk of victimization and of minority or marginalization stress as a result of discrimination. This paper therefore reviews the limited literature on this field and considers ways in which (mental) health professionals may assist the people with genderqueer and non-binary gender identities and/or expressions they may see in their practice. Treatment options and associated risks are discussed.

  6. Some thoughts on interacting binary systems

    International Nuclear Information System (INIS)

    Ulrich, R.K.

    1980-01-01

    The author presents some thoughts on the theory and observation of interacting binary systems. The complex physical processes possible in these systems make our present understanding inconclusive. New types of observation (X-ray, EUV, radio) present new challenges to the theoretician. The author discusses those problems which seem to hold the most promise for future progress. (Auth.)

  7. Mass loss from interacting close binary systems

    Science.gov (United States)

    Plavec, M. J.

    1981-01-01

    The three well-defined classes of evolved binary systems that show evidence of present and/or past mass loss are the cataclysmic variables, the Algols, and Wolf-Rayet stars. It is thought that the transformation of supergiant binary systems into the very short-period cataclysmic variables must have been a complex process. The new evidence that has recently been obtained from the far ultraviolet spectra that a certain subclass of the Algols (the Serpentids) are undergoing fairly rapid evolution is discussed. It is thought probable that the remarkable mass outflow observed in them is connected with a strong wind powered by accretion. The origin of the circumbinary clouds or flat disks that probably surround many strongly interacting binaries is not clear. Attention is also given to binary systems with hot white dwarf or subdwarf components, such as the symbiotic objects and the BQ stars; it is noted that in them both components may be prone to an enhanced stellar wind.

  8. Stretchable Binary Fresnel Lens for Focus Tuning

    NARCIS (Netherlands)

    Li, X.; Wei, L.; Poelma, R.H.; Vollebregt, S.; Wei, J.; Urbach, Paul; Sarro, P.M.; Zhang, G.Q.

    2016-01-01

    This paper presents a tuneable binary amplitude Fresnel lens produced by wafer-level microfabrication. The Fresnel lens is fabricated by encapsulating lithographically defined vertically aligned carbon nanotube (CNT) bundles inside a polydimethyl-siloxane (PDMS) layer. The composite lens material

  9. Flip-flopping binary black holes.

    Science.gov (United States)

    Lousto, Carlos O; Healy, James

    2015-04-10

    We study binary spinning black holes to display the long term individual spin dynamics. We perform a full numerical simulation starting at an initial proper separation of d≈25M between equal mass holes and evolve them down to merger for nearly 48 orbits, 3 precession cycles, and half of a flip-flop cycle. The simulation lasts for t=20 000M and displays a total change in the orientation of the spin of one of the black holes from an initial alignment with the orbital angular momentum to a complete antialignment after half of a flip-flop cycle. We compare this evolution with an integration of the 3.5 post-Newtonian equations of motion and spin evolution to show that this process continuously flip flops the spin during the lifetime of the binary until merger. We also provide lower order analytic expressions for the maximum flip-flop angle and frequency. We discuss the effects this dynamics may have on spin growth in accreting binaries and on the observational consequences for galactic and supermassive binary black holes.

  10. Compiler-Agnostic Function Detection in Binaries

    NARCIS (Netherlands)

    Andriesse, D.A.; Slowinska, J.M.; Bos, H.J.

    2017-01-01

    We propose Nucleus, a novel function detection algorithm for binaries. In contrast to prior work, Nucleus is compiler-agnostic, and does not require any learning phase or signature information. Instead of scanning for signatures, Nucleus detects functions at the Control Flow Graph-level, making it

  11. Photometric survey of asynchronous binary asteroids

    Czech Academy of Sciences Publication Activity Database

    Pravec, Petr; Scheirich, Peter; Kušnirák, Peter; Kotková, Lenka; Mottola, S.; Hahn, G.; Brown, P.; Esquerdo, G.; Kaiser, K.; Krzeminski, Z.; Pray, D. P.; Warner, B. D.; Harris, A. W.; Nolan, M. C.; Howell, E. S.; Benner, L. A. M.; Margot, J. L.; Galád, Adrián; Holliday, W.; Hicks, M. D.; Krugly, Yu. N.; Tholen, D.; Whiteley, R.; Marchis, F.; DeGraff, D. R.; Grauer, A.; Larson, S. M.; Velichko, F. P.; Cooney, W.R.; Stephens, R.; Zhu, J.; Kirsch, K.; Dyvig, R.; Snyder, L.; Reddy, V.; Moore, S.; Gajdoš, Š.; Világi, J.; Masi, G.; Higgins, D.; Funkhouser, G. M.; Knight, B.; Slivan, S. M.; Behrend, R.; Grenon, M.; Burki, G.; Roy, R.; Demeautis, C.; Matter, D.; Waelchli, N.; Revaz, Y.; Klotz, A.; Rieugné, M.; Thieri, P.; Cotrez, V.; Brunetto, L.; Kober, G.

    2006-01-01

    Roč. 181, č. 1 (2006), s. 63-93 ISSN 0019-1035 R&D Projects: GA ČR GA205/05/0604; GA AV ČR IAA3003204 Institutional research plan: CEZ:AV0Z10030501 Keywords : asteroids * binary * photometry Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.151, year: 2006

  12. Planar quark diagrams and binary spin processes

    International Nuclear Information System (INIS)

    Grigoryan, A.A.; Ivanov, N.Ya.

    1986-01-01

    Contributions of planar diagrams to the binary scattering processes are analyzed. The analysis is based on the predictions of quark-gluon picture of strong interactions for the coupling of reggeons with quarks as well as on the SU(6)-classification of hadrons. The dependence of contributions of nonplanar corrections on spins and quark composition of interacting particles is discussed

  13. Binary translation using peephole translation rules

    Science.gov (United States)

    Bansal, Sorav; Aiken, Alex

    2010-05-04

    An efficient binary translator uses peephole translation rules to directly translate executable code from one instruction set to another. In a preferred embodiment, the translation rules are generated using superoptimization techniques that enable the translator to automatically learn translation rules for translating code from the source to target instruction set architecture.

  14. Predicting Social Trust with Binary Logistic Regression

    Science.gov (United States)

    Adwere-Boamah, Joseph; Hufstedler, Shirley

    2015-01-01

    This study used binary logistic regression to predict social trust with five demographic variables from a national sample of adult individuals who participated in The General Social Survey (GSS) in 2012. The five predictor variables were respondents' highest degree earned, race, sex, general happiness and the importance of personally assisting…

  15. Face Alignment via Regressing Local Binary Features.

    Science.gov (United States)

    Ren, Shaoqing; Cao, Xudong; Wei, Yichen; Sun, Jian

    2016-03-01

    This paper presents a highly efficient and accurate regression approach for face alignment. Our approach has two novel components: 1) a set of local binary features and 2) a locality principle for learning those features. The locality principle guides us to learn a set of highly discriminative local binary features for each facial landmark independently. The obtained local binary features are used to jointly learn a linear regression for the final output. This approach achieves the state-of-the-art results when tested on the most challenging benchmarks to date. Furthermore, because extracting and regressing local binary features are computationally very cheap, our system is much faster than previous methods. It achieves over 3000 frames per second (FPS) on a desktop or 300 FPS on a mobile phone for locating a few dozens of landmarks. We also study a key issue that is important but has received little attention in the previous research, which is the face detector used to initialize alignment. We investigate several face detectors and perform quantitative evaluation on how they affect alignment accuracy. We find that an alignment friendly detector can further greatly boost the accuracy of our alignment method, reducing the error up to 16% relatively. To facilitate practical usage of face detection/alignment methods, we also propose a convenient metric to measure how good a detector is for alignment initialization.

  16. Structure Map for Embedded Binary Alloy Nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, C.W.; Shin, S.J.; Liao, C.Y.; Guzman, J.; Stone, P.R.; Watanabe, M.; Ager III, J.W.; Haller, E.E.; Chrzan, D.C.

    2008-09-20

    The equilibrium structure of embedded nanocrystals formed from strongly segregating binary-alloys is considered within a simple thermodynamic model. The model identifies two dimensionlessinterface energies that dictate the structure, and allows prediction of the stable structure for anychoice of these parameters. The resulting structure map includes three distinct nanocrystal mor-phologies: core/shell, lobe/lobe, and completely separated spheres.

  17. ANGULAR-MOMENTUM IN BINARY SPIRAL GALAXIES

    NARCIS (Netherlands)

    OOSTERLOO, T

    In order to investigate the relative orientations of spiral galaxies in pairs, the distribution of the angle between the spin-vectors for a new sample of 40 binary spiral galaxies is determined. From this distribution it is found, contrary to an earlier result obtained by Helou (1984), that there is

  18. Gravitational waves from binary black holes

    Indian Academy of Sciences (India)

    Raman Research Institute, C.V. Raman Avenue, Sadashivanagar, Bangalore ... In the 1916 paper exploring the physical implications of GR, Einstein .... Thus, for a neutron star binary in the Virgo cluster (D = 18 Mpc; 5.6×1020 km) the strain.

  19. The Binary Pulsar: Gravity Waves Exist.

    Science.gov (United States)

    Will, Clifford

    1987-01-01

    Reviews the history of pulsars generally and the 1974 discovery of the binary pulsar by Joe Taylor and Russell Hulse specifically. Details the data collection and analysis used by Taylor and Hulse. Uses this discussion as support for Albert Einstein's theory of gravitational waves. (CW)

  20. Receptive fields selection for binary feature description.

    Science.gov (United States)

    Fan, Bin; Kong, Qingqun; Trzcinski, Tomasz; Wang, Zhiheng; Pan, Chunhong; Fua, Pascal

    2014-06-01

    Feature description for local image patch is widely used in computer vision. While the conventional way to design local descriptor is based on expert experience and knowledge, learning-based methods for designing local descriptor become more and more popular because of their good performance and data-driven property. This paper proposes a novel data-driven method for designing binary feature descriptor, which we call receptive fields descriptor (RFD). Technically, RFD is constructed by thresholding responses of a set of receptive fields, which are selected from a large number of candidates according to their distinctiveness and correlations in a greedy way. Using two different kinds of receptive fields (namely rectangular pooling area and Gaussian pooling area) for selection, we obtain two binary descriptors RFDR and RFDG .accordingly. Image matching experiments on the well-known patch data set and Oxford data set demonstrate that RFD significantly outperforms the state-of-the-art binary descriptors, and is comparable with the best float-valued descriptors at a fraction of processing time. Finally, experiments on object recognition tasks confirm that both RFDR and RFDG successfully bridge the performance gap between binary descriptors and their floating-point competitors.

  1. Binary nucleation of water and sodium chloride

    Czech Academy of Sciences Publication Activity Database

    Němec, Tomáš; Maršík, František; Palmer, A.

    2006-01-01

    Roč. 124, č. 4 (2006), 0445091-0445096 ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA101/05/2536 Institutional research plan: CEZ:AV0Z20760514 Keywords : binary nucleation * sodium chloride * water Subject RIV: BJ - Thermodynamics Impact factor: 3.166, year: 2006

  2. The Benchmark Eclipsing Binary V530 Ori

    DEFF Research Database (Denmark)

    Torres, Guillermo; Lacy, Claud H. Sandberg; Pavlovski, Kresimir

    2015-01-01

    We report accurate measurements of the physical properties (mass, radius, temperature) of components of the G+M eclipsing binary V530 On. The M-type secondary shows a larger radius and a cooler temperature than predicted by standard stellar evolution models, as has been found for many other low...

  3. Void formation in irradiated binary nickel alloys

    International Nuclear Information System (INIS)

    Shaikh, M.A.; Ahmed, M.; Akhter, J.I.

    1994-01-01

    In this work a computer program has been used to compute void radius, void density and swelling parameter for nickel and binary nickel-carbon alloys irradiated with nickel ions of 100 keV. The aim is to compare the computed results with experimental results already reported

  4. Supply chain quality management

    Directory of Open Access Journals (Sweden)

    Hannan Amoozad Mahdiraji

    2012-10-01

    Full Text Available In recent years, there are several methods introduced for the improvement of operational performances. Total quality management and supply chain management are two methods recommended for this purpose. These two approaches have been studied in most researches separately, while they have objectives in common, and this makes them a strategic means, which can be used, simultaneously. Total quality management and supply chain management play significant roles to increase the organizational competitiveness power. Moreover, they have only one purpose that is customer satisfaction, and they are different only on their approaches to reach their objectives. In this research, we aim to study both approaches of quality management and supply chain, their positive increasing effects that may be generated after their integration. For this purpose, the concept and definitions of each approach is studied, independently, their similarities and differences are recognized, and finally, the advantages of their integration are introduced.

  5. Chain inflation revisited

    International Nuclear Information System (INIS)

    Chialva, Diego; Danielsson, Ulf H

    2008-01-01

    This paper represents an in-depth treatment of the chain inflation scenario. We fully determine the evolution of the universe in the model, the conditions necessary in order to have a successful inflationary period, and the matching with the observational results regarding the cosmological perturbations. We study in great detail, and in general, the dynamics of the background, as well as the mechanism of generation of the perturbations. We also find an explicit formula for the spectrum of adiabatic perturbations. Our results prove that chain inflation is a viable model for solving the horizon, entropy and flatness problems of standard cosmology and for generating the right amount of adiabatic cosmological perturbations. The results are radically different from those found in previous works on the subject. Finally, we argue that there is a natural way to embed chain inflation into flux compactified string theory. We discuss the details of the implementation and how to fit observations

  6. Supply-Chain Optimization Template

    Science.gov (United States)

    Quiett, William F.; Sealing, Scott L.

    2009-01-01

    The Supply-Chain Optimization Template (SCOT) is an instructional guide for identifying, evaluating, and optimizing (including re-engineering) aerospace- oriented supply chains. The SCOT was derived from the Supply Chain Council s Supply-Chain Operations Reference (SCC SCOR) Model, which is more generic and more oriented toward achieving a competitive advantage in business.

  7. Essentials of supply chain management

    CERN Document Server

    Hugos, Michael H

    2011-01-01

    The latest thinking, strategies, developments, and technologies to stay current in supply chain management Presenting the core concepts and techniques of supply chain management in a clear, concise and easily readable style, the Third Edition of Essentials of Supply Chain Management outlines the most crucial tenets and concepts of supply chain management.

  8. Integrated supply chain risk management

    Directory of Open Access Journals (Sweden)

    Riaan Bredell

    2007-11-01

    Full Text Available Integrated supply chain risk management (ISCRM has become indispensable to the theory and practice of supply chain management. The economic and political realities of the modern world require not only a different approach to supply chain management, but also bold steps to secure supply chain performance and sustainable wealth creation. Integrated supply chain risk management provides supply chain organisations with a level of insight into their supply chains yet to be achieved. If correctly applied, this process may optimise management decision-making and assist in the protection and enhancement of shareholder value.

  9. Solitons in Granular Chains

    International Nuclear Information System (INIS)

    Manciu, M.; Sen, S.; Hurd, A.J.

    1999-01-01

    The authors consider a chain of elastic (Hertzian) grains that repel upon contact according to the potential V = adelta u , u > 2, where delta is the overlap between the grains. They present numerical and analytical results to show that an impulse initiated at an end of a chain of Hertzian grains in contact eventually propagates as a soliton for all n > 2 and that no solitons are possible for n le 2. Unlike continuous, they find that colliding solitons in discrete media initiative multiple weak solitons at the point of crossing

  10. Nuclear safety chains

    International Nuclear Information System (INIS)

    Robbins, M.C.; Eames, G.F.; Mayell, J.R.

    1981-01-01

    An original scheme has been developed for expressing the complex interrelationships associated with the engineered safeguards provided for a nuclear power station. This management tool, based upon network diagrams called Nuclear Safety Chains, looks at the function required of a particular item of safety plant, defines all of the vital supplies and support features necessary for successful operation, and expresses them in visual form, to facilitate analysis and optimisation for operations and maintenance staff. The safety chains are confined to manual schemes at present, although they are designed to be compatible with modern computer techniques. Their usefulness with any routine maintenance planning application on high technology plant is already being appreciated. (author)

  11. Markov set-chains

    CERN Document Server

    Hartfiel, Darald J

    1998-01-01

    In this study extending classical Markov chain theory to handle fluctuating transition matrices, the author develops a theory of Markov set-chains and provides numerous examples showing how that theory can be applied. Chapters are concluded with a discussion of related research. Readers who can benefit from this monograph are those interested in, or involved with, systems whose data is imprecise or that fluctuate with time. A background equivalent to a course in linear algebra and one in probability theory should be sufficient.

  12. Evolution of binaries with compact objects in globular clusters

    OpenAIRE

    Ivanova, Natalia

    2017-01-01

    Dynamical interactions that take place between objects in dense stellar systems lead to frequent formation of exotic stellar objects, unusual binaries, and systems of higher multiplicity. They are most important for the formation of binaries with neutron stars and black holes, which are usually observationally revealed in mass-transferring binaries. Here we review the current understanding of compact object's retention, of the metallicity dependence on the formation of low-mass X-ray binaries...

  13. Influence of non-binary effects on intranuclear cascade method

    International Nuclear Information System (INIS)

    Gomes, E.H.C.

    1985-01-01

    The importance of non binary process effects in the intranuclear cascade method is analysed. It is shown that, in the higher density steps, the non binary collisions lead to baryon density distribution and rapidity differents from the one obtained using the usual intranuclear cascade method (limited to purely binary collisions). The validity of the applications of binary intranuclear cascade method to the simulation of the thermal equilibrium, nuclear transparency and particle production, is discussed. (M.C.K.) [pt

  14. Gravitational waves from spinning eccentric binaries

    Science.gov (United States)

    Csizmadia, Péter; Debreczeni, Gergely; Rácz, István; Vasúth, Mátyás

    2012-12-01

    This paper is to introduce a new software called CBwaves which provides a fast and accurate computational tool to determine the gravitational waveforms yielded by generic spinning binaries of neutron stars and/or black holes on eccentric orbits. This is done within the post-Newtonian (PN) framework by integrating the equations of motion and the spin precession equations, while the radiation field is determined by a simultaneous evaluation of the analytic waveforms. In applying CBwaves various physically interesting scenarios have been investigated. In particular, we have studied the appropriateness of the adiabatic approximation, and justified that the energy balance relation is indeed insensitive to the specific form of the applied radiation reaction term. By studying eccentric binary systems, it is demonstrated that circular template banks are very ineffective in identifying binaries even if they possess tiny residual orbital eccentricity, thus confirming a similar result obtained by Brown and Zimmerman (2010 Phys. Rev. D 81 024007). In addition, by investigating the validity of the energy balance relation we show that, contrary to the general expectations, the PN approximation should not be applied once the PN parameter gets beyond the critical value ˜0.08 - 0.1. Finally, by studying the early phase of the gravitational waves emitted by strongly eccentric binary systems—which could be formed e.g. in various many-body interactions in the galactic halo—we have found that they possess very specific characteristics which may be used to identify these type of binary systems. This paper is dedicated to the memory of our colleague and friend Péter Csizmadia a young physicist, computer expert and one of the best Hungarian mountaineers who disappeared in China’s Sichuan near the Ren Zhong Feng peak of the Himalayas on 23 Oct. 2009. We started to develop CBwaves jointly with Péter a couple of months before he left for China.

  15. Probabilistic seismic history matching using binary images

    Science.gov (United States)

    Davolio, Alessandra; Schiozer, Denis Jose

    2018-02-01

    Currently, the goal of history-matching procedures is not only to provide a model matching any observed data but also to generate multiple matched models to properly handle uncertainties. One such approach is a probabilistic history-matching methodology based on the discrete Latin Hypercube sampling algorithm, proposed in previous works, which was particularly efficient for matching well data (production rates and pressure). 4D seismic (4DS) data have been increasingly included into history-matching procedures. A key issue in seismic history matching (SHM) is to transfer data into a common domain: impedance, amplitude or pressure, and saturation. In any case, seismic inversions and/or modeling are required, which can be time consuming. An alternative to avoid these procedures is using binary images in SHM as they allow the shape, rather than the physical values, of observed anomalies to be matched. This work presents the incorporation of binary images in SHM within the aforementioned probabilistic history matching. The application was performed with real data from a segment of the Norne benchmark case that presents strong 4D anomalies, including softening signals due to pressure build up. The binary images are used to match the pressurized zones observed in time-lapse data. Three history matchings were conducted using: only well data, well and 4DS data, and only 4DS. The methodology is very flexible and successfully utilized the addition of binary images for seismic objective functions. Results proved the good convergence of the method in few iterations for all three cases. The matched models of the first two cases provided the best results, with similar well matching quality. The second case provided models presenting pore pressure changes according to the expected dynamic behavior (pressurized zones) observed on 4DS data. The use of binary images in SHM is relatively new with few examples in the literature. This work enriches this discussion by presenting a new

  16. Full Ionisation In Binary-Binary Encounters With Small Positive Energies

    Science.gov (United States)

    Sweatman, W. L.

    2006-08-01

    Interactions between binary stars and single stars and binary stars and other binary stars play a key role in the dynamics of a dense stellar system. Energy can be transferred between the internal dynamics of a binary and the larger scale dynamics of the interacting objects. Binaries can be destroyed and created by the interaction. In a binary-binary encounter, full ionisation occurs when both of the binary stars are destroyed in the interaction to create four single stars. This is only possible when the total energy of the system is positive. For very small energies the probability of this occurring is very low and it tends towards zero as the total energy tends towards zero. Here the case is considered for which all the stars have equal masses. An asymptotic power law is predicted relating the probability of full ionisation with the total energy when this latter quantity is small. The exponent, which is approximately 2.31, is compared with the results from numerical scattering experiments. The theoretical approach taken is similar to one used previously in the three-body problem. It makes use of the fact that the most dramatic changes in scale and energies of a few-body system occur when its components pass near to a central configuration. The position, and number, of these configurations is not known for the general four-body problem, however, with equal masses there are known to be exactly five different cases. Separate consideration and comparison of the properties of orbits close to each of these five central configurations enables the prediction of the form of the cross-section for full ionisation for the case of small positive total energy. This is the relation between total energy and the probability of total ionisation described above.

  17. Planetary Formation and Dynamics in Binary Systems

    Science.gov (United States)

    Xie, J. W.

    2013-01-01

    As of today, over 500 exoplanets have been detected since the first exoplanet was discovered around a solar-like star in 1995. The planets in binaries could be common as stars are usually born in binary or multiple star systems. Although current observations show that the planet host rate in multiple star systems is around 17%, this fraction should be considered as a lower limit because of noticeable selection effects against binaries in planet searches. Most of the current known planet-bearing binary systems are S-types, meaning the companion star acts as a distant satellite, typically orbiting the inner star-planet system over 100 AU away. Nevertheless, there are four systems with a smaller separation of 20 AU, including the Gamma Cephei, GJ 86, HD 41004, and HD 196885. In addition to the planets in circumprimary (S-type) orbits discussed above, planets in circumbinary (P-type) orbits have been found in only two systems. In this thesis, we mainly study the planet formation in the S-type binary systems. In chapter 1, we first summarize current observational facts of exoplanets both in single-star and binary systems, then review the theoretical models of planet formation, with special attention to the application in binary systems. Perturbative effects from stellar companions render the planet formation process in binary systems even more complex than that in single-star systems. The perturbations from a binary companion can excite planetesimal orbits, and increase their mutual impact velocities to the values that might exceed their escape velocity or even the critical velocity for the onset of eroding collisions. The intermediate stage of the formation process---from planetesimals to planetary embryos---is thus the most problematic. In the following chapters, we investigate whether and how the planet formation goes through such a problematic stage. In chapter 2, we study the effects of gas dissipation on the planetesimals' mutual accretion. We find that in a

  18. The design of supply chains

    OpenAIRE

    Bøge Sørensen, Lars

    2004-01-01

    Keywords Supply Chain Management, Supply Chain Design, Literature study Abstract Argues stability is a design objective for supply chain design alongside cost, lead time and responsiveness. Performs an extensive literature study on supply chain design, identifies methods, theories and objectives in the existing literature. Describes the concept external specificity and how it’s used to design supply chains. Using the concept upstream, archetypes of risk minimal and maximal desi...

  19. Compact stars and the evolution of binary systems

    NARCIS (Netherlands)

    van den Heuvel, E.P.J.

    2011-01-01

    The Chandrasekhar limit is of key importance for the evolution of white dwarfs in binary systems and for the formation of neutron stars and black holes in binaries. Mass transfer can drive a white dwarf in a binary over the Chandrasekhar limit, which may lead to a Type Ia supernova (in case of a CO

  20. VISCOSITY OF BINARY NON-ELECTROLYTE LIQUID MIXTURES: PREDICTION AND CORRELATION

    Directory of Open Access Journals (Sweden)

    Mirjana Lj. Kijevčanin

    2008-11-01

    Full Text Available The viscosity of 31 binary liquid mixtures containing diverse groups of organic compounds, determined at atmospheric pressure: alcohols, alkanes (cyclo and aliphatic, esters, aromatics, ketones etc., were calculated using two different approaches, correlative (with Teja-Rice and McAllister models and predictive by group contribution models (UNIFAC-VISCO, ASOG-VISCO and Grunberg-Nissan. The obtained results were analysed in terms of the applied approach and model, the structure of the investigated mixtures, the nature of components of the mixtures and the influence of alkyl chain length of the alcohol molecule.

  1. Standard handbook of chains chains for power transmission and material handling

    CERN Document Server

    2005-01-01

    A BRIEF HISTORY OF THE DEVELOPMENT OF CHAINEarly DevelopmentsCog ChainCast Detachable ChainCast Pintle ChainPrecision Roller ChainEngineering Steel ChainSilent ChainFlat-Top ChainTerminologyA CHAIN OVERVIEW: USES AND ADVANTAGESGeneralTypes of ChainScope of Chains CoveredStyles and Forms of ChainsStraight and Offset Link ChainsChains With and Without RollersUses of ChainStandard Chains and Their UsesThe Advantages of Chains in ApplicationsAdvantages of Roller Chains in DrivesAdvantages of Silent Chain Drives

  2. Development Value Chains meet Business Supply Chains : The concept of Global Value Chains unraveled

    NARCIS (Netherlands)

    S. Drost (Sarah); J.C.A.C. van Wijk (Jeroen); S.R. Vellema (Sietze)

    2011-01-01

    textabstractValue chain promotion is considered a key element of private sector development strategies and pro-poor growth. However, (value) chain concepts are rather complex and unclear. This paper unravels the concept of global value chains and studies the diversity of key value chain-related

  3. Innovation in Supply Chains

    DEFF Research Database (Denmark)

    Maier, Maximilian; Korbel, Jakob; Brem, Alexander

    2015-01-01

    . Moreover, along with the fourth industrial revolution – industry 4.0 – new technologies such as cyber physical systems are fast gaining popularity. Hence, based on the analysis of relevant literature, we further develop the supply chain committee model, developed by Kaluza et al. (2003) to demonstrate how...

  4. Serum Free Light Chains

    Science.gov (United States)

    ... lab's website in order to provide you with background information about the test(s) you had performed. You will need to return ... the free light chains have a much shorter half-life (3-5 hours) than ... cell disorders, the test is also used for assessing response and minimal ...

  5. Galileo Chain Thermometer

    Science.gov (United States)

    Ucke, C.; Schlichting, H. J.

    2017-01-01

    This relatively rare thermometer has a rather unusual display: lower temperatures are located at the top of the scale, higher ones at the bottom. A sphere on a chain floats in a suitable liquid, sinking at high temperatures when the density of the liquid decreases and rising in the increased density at low temperatures. With reasonable effort and…

  6. Supply Chain Costing

    DEFF Research Database (Denmark)

    Asmussen, Jesper Normann; Kristensen, Jesper; Wæhrens, Brian Vejrum

    Based Costing (ABC) på et forsyningskædeniveau – heri benævnt Supply Chain Costing (SCC). Udoverdefordelederfindesved ABCtilføjerSCCogså et økonomisk grundlag til det strategiske rationale, der ofte ligger bag opbygningen af virksomhedens forsyningskæde, og kan dermed medvirke til konkret...

  7. Global Value Chain Configuration

    DEFF Research Database (Denmark)

    Hernandez, Virginia; Pedersen, Torben

    2017-01-01

    modes chosen and the different ways of coordinating them. We also examine the outcomes of a global value chain configuration in terms of performance and upgrading. Our aim is to review the state of the art of these issues, identify research gaps and suggest new lines for future research that would...

  8. Exploration Supply Chain Simulation

    Science.gov (United States)

    2008-01-01

    The Exploration Supply Chain Simulation project was chartered by the NASA Exploration Systems Mission Directorate to develop a software tool, with proper data, to quantitatively analyze supply chains for future program planning. This tool is a discrete-event simulation that uses the basic supply chain concepts of planning, sourcing, making, delivering, and returning. This supply chain perspective is combined with other discrete or continuous simulation factors. Discrete resource events (such as launch or delivery reviews) are represented as organizational functional units. Continuous resources (such as civil service or contractor program functions) are defined as enabling functional units. Concepts of fixed and variable costs are included in the model to allow the discrete events to interact with cost calculations. The definition file is intrinsic to the model, but a blank start can be initiated at any time. The current definition file is an Orion Ares I crew launch vehicle. Parameters stretch from Kennedy Space Center across and into other program entities (Michaud Assembly Facility, Aliant Techsystems, Stennis Space Center, Johnson Space Center, etc.) though these will only gain detail as the file continues to evolve. The Orion Ares I file definition in the tool continues to evolve, and analysis from this tool is expected in 2008. This is the first application of such business-driven modeling to a NASA/government-- aerospace contractor endeavor.

  9. Perturbed Markov chains

    OpenAIRE

    Solan, Eilon; Vieille, Nicolas

    2015-01-01

    We study irreducible time-homogenous Markov chains with finite state space in discrete time. We obtain results on the sensitivity of the stationary distribution and other statistical quantities with respect to perturbations of the transition matrix. We define a new closeness relation between transition matrices, and use graph-theoretic techniques, in contrast with the matrix analysis techniques previously used.

  10. Economy, market and chain

    NARCIS (Netherlands)

    Sukkel, W.; Hommes, M.

    2009-01-01

    In their pursuit of growth and professionalisation, the Dutch organic sector focuses primarily on market development. But how do you stimulate the market for organic foods? This is the subject of many research projects concerning market, consumer preferences and the supply chain. These projects

  11. Heavy chain only antibodies

    DEFF Research Database (Denmark)

    Moghimi, Seyed Moein; Rahbarizadeh, Fatemeh; Ahmadvand, Davoud

    2013-01-01

    Unlike conventional antibodies, heavy chain only antibodies derived from camel contain a single variable domain (VHH) and two constant domains (CH2 and CH3). Cloned and isolated VHHs possess unique properties that enable them to excel conventional therapeutic antibodies and their smaller antigen...

  12. Markov Chain Monte Carlo

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 7; Issue 3. Markov Chain Monte Carlo - Examples. Arnab Chakraborty. General Article Volume 7 Issue 3 March 2002 pp 25-34. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/007/03/0025-0034. Keywords.

  13. Supply chain reliability modelling

    Directory of Open Access Journals (Sweden)

    Eugen Zaitsev

    2012-03-01

    Full Text Available Background: Today it is virtually impossible to operate alone on the international level in the logistics business. This promotes the establishment and development of new integrated business entities - logistic operators. However, such cooperation within a supply chain creates also many problems related to the supply chain reliability as well as the optimization of the supplies planning. The aim of this paper was to develop and formulate the mathematical model and algorithms to find the optimum plan of supplies by using economic criterion and the model for the probability evaluating of non-failure operation of supply chain. Methods: The mathematical model and algorithms to find the optimum plan of supplies were developed and formulated by using economic criterion and the model for the probability evaluating of non-failure operation of supply chain. Results and conclusions: The problem of ensuring failure-free performance of goods supply channel analyzed in the paper is characteristic of distributed network systems that make active use of business process outsourcing technologies. The complex planning problem occurring in such systems that requires taking into account the consumer's requirements for failure-free performance in terms of supply volumes and correctness can be reduced to a relatively simple linear programming problem through logical analysis of the structures. The sequence of the operations, which should be taken into account during the process of the supply planning with the supplier's functional reliability, was presented.

  14. METRODOS: Meteorological preprocessor chain

    DEFF Research Database (Denmark)

    Astrup, P.; Mikkelsen, T.; Deme, S.

    2001-01-01

    The METRODOS meteorological preprocessor chain combines measured tower data and coarse grid numerical weather prediction (NWP) data with local scale flow models and similarity scaling to give high resolution approximations of the meteorological situation. Based on available wind velocity and dire...

  15. Transportation and concentration inequalities for bifurcating Markov chains

    DEFF Research Database (Denmark)

    Penda, S. Valère Bitseki; Escobar-Bach, Mikael; Guillin, Arnaud

    2017-01-01

    We investigate the transportation inequality for bifurcating Markov chains which are a class of processes indexed by a regular binary tree. Fitting well models like cell growth when each individual gives birth to exactly two offsprings, we use transportation inequalities to provide useful...... concentration inequalities.We also study deviation inequalities for the empirical means under relaxed assumptions on the Wasserstein contraction for the Markov kernels. Applications to bifurcating nonlinear autoregressive processes are considered for point-wise estimates of the non-linear autoregressive...

  16. Performance Analysis of Binary Search Algorithm in RFID

    Directory of Open Access Journals (Sweden)

    Xiangmei SONG

    2014-12-01

    Full Text Available Binary search algorithm (BS is a kind of important anti-collision algorithm in the Radio Frequency Identification (RFID, is also one of the key technologies which determine whether the information in the tag is identified by the reader-writer fast and reliably. The performance of BS directly affects the quality of service in Internet of Things. This paper adopts an automated formal technology: probabilistic model checking to analyze the performance of BS algorithm formally. Firstly, according to the working principle of BS algorithm, its dynamic behavior is abstracted into a Discrete Time Markov Chains which can describe deterministic, discrete time and the probability selection. And then on the model we calculate the probability of the data sent successfully and the expected time of tags completing the data transmission. Compared to the another typical anti-collision protocol S-ALOHA in RFID, experimental results show that with an increase in the number of tags the BS algorithm has a less space and time consumption, the average number of conflicts increases slower than the S-ALOHA protocol standard, BS algorithm needs fewer expected time to complete the data transmission, and the average speed of the data transmission in BS is as 1.6 times as the S-ALOHA protocol.

  17. Performance analysis and binary working fluid selection of combined flash-binary geothermal cycle

    International Nuclear Information System (INIS)

    Zeyghami, Mehdi

    2015-01-01

    Performance of the combined flash-binary geothermal power cycle for geofluid temperatures between 150 and 250 °C is studied. A thermodynamic model is developed, and the suitable binary working fluids for different geofluid temperatures are identified from a list of thirty working fluid candidates, consisting environmental friendly refrigerants and hydrocarbons. The overall system exergy destruction and Vapor Expansion Ratio across the binary cycle turbine are selected as key performance indicators. The results show that for low-temperature heat sources using refrigerants as binary working fluids result in higher overall cycle efficiency and for medium and high-temperature resources, hydrocarbons are more suitable. For combined flash-binary cycle, secondary working fluids; R-152a, Butane and Cis-butane show the best performances at geofluid temperatures 150, 200 and 250 °C respectively. The overall second law efficiency is calculated as high as 0.48, 0.55 and 0.58 for geofluid temperatures equal 150, 200 and 250 °C respectively. The flash separator pressure found to has important effects on cycle operation and performance. Separator pressure dictates the work production share of steam and binary parts of the system. And there is an optimal separator pressure at which overall exergy destruction of the cycle achieves its minimum value. - Highlights: • Performance of the combined flash-binary geothermal cycle is investigated. • Thirty different fluids are screened to find the most suitable ORC working fluid. • Optimum cycle operation conditions presented for geofluids between 150 °C and 250 °C. • Refrigerants are more suitable for the ORC at geothermal sources temperature ≤200 °C. • Hydrocarbons are more suitable for the ORC at geothermal sources temperature >200 °C

  18. WHITE-LIGHT FLARES ON CLOSE BINARIES OBSERVED WITH KEPLER

    International Nuclear Information System (INIS)

    Gao, Qing; Xin, Yu; Liu, Ji-Feng; Zhang, Xiao-Bin; Gao, Shuang

    2016-01-01

    Based on Kepler data, we present the results of a search for white light flares on 1049 close binaries. We identify 234 flare binaries, of which 6818 flares are detected. We compare the flare-binary fraction in different binary morphologies (“detachedness”). The result shows that the fractions in over-contact and ellipsoidal binaries are approximately 10%–20% lower than those in detached and semi-detached systems. We calculate the binary flare activity level (AL) of all the flare binaries, and discuss its variations along the orbital period ( P orb ) and rotation period ( P rot , calculated for only detached binaries). We find that the AL increases with decreasing P orb or P rot , up to the critical values at P orb ∼ 3 days or P rot ∼ 1.5 days, and thereafter the AL starts decreasing no matter how fast the stars rotate. We examine the flaring rate as a function of orbital phase in two eclipsing binaries on which a large number of flares are detected. It appears that there is no correlation between flaring rate and orbital phase in these two binaries. In contrast, when we examine the function with 203 flares on 20 non-eclipse ellipsoidal binaries, bimodal distribution of amplitude-weighted flare numbers shows up at orbital phases 0.25 and 0.75. Such variation could be larger than what is expected from the cross section modification.

  19. Effects of Chain Length and Degree of Unsaturation of Fatty Acids on Structure and in Vitro Digestibility of Starch-Protein-Fatty Acid Complexes.

    Science.gov (United States)

    Zheng, Mengge; Chao, Chen; Yu, Jinglin; Copeland, Les; Wang, Shuo; Wang, Shujun

    2018-02-28

    The effects of chain length and degree of unsaturation of fatty acids (FAs) on structure and in vitro digestibility of starch-protein-FA complexes were investigated in model systems. Studies with the rapid visco analyzer (RVA) showed that the formation of ternary complex resulted in higher viscosities than those of binary complex during the cooling and holding stages. The results of differential scanning calorimetry (DSC), Raman, and X-ray diffraction (XRD) showed that the structural differences for ternary complexes were much less than those for binary complexes. Starch-protein-FA complexes presented lower in vitro enzymatic digestibility compared with starch-FAs complexes. We conclude that shorter chain and lower unsaturation FAs favor the formation of ternary complexes but decrease the thermal stability of these complexes. FAs had a smaller effect on the ordered structures of ternary complexes than on those of binary complexes and little effect on enzymatic digestibility of both binary and ternary complexes.

  20. Tidal effects in twin-degenerate binaries

    International Nuclear Information System (INIS)

    Campbell, C.G.

    1984-01-01

    The tidal velocity field is calculated for an initially non-rotating low mass white dwarf secondary in a twin-degenerate binary. These motions are used to find the tidal torque on the secondary, to first order in the orbital frequency, and an expression is derived for the synchronization time. For a lobe-filling secondary the synchronization time has a weak dependence on the mass and luminosity of the star, and for the binary G61-29 is found to be of the same order as the estimated lifetime of the system. It is emphasized, however, that tidal excitation of non-radial oscillatory modes in the secondary may significantly shorten the synchronization time. (author)

  1. Image Steganalysis with Binary Similarity Measures

    Directory of Open Access Journals (Sweden)

    Kharrazi Mehdi

    2005-01-01

    Full Text Available We present a novel technique for steganalysis of images that have been subjected to embedding by steganographic algorithms. The seventh and eighth bit planes in an image are used for the computation of several binary similarity measures. The basic idea is that the correlation between the bit planes as well as the binary texture characteristics within the bit planes will differ between a stego image and a cover image. These telltale marks are used to construct a classifier that can distinguish between stego and cover images. We also provide experimental results using some of the latest steganographic algorithms. The proposed scheme is found to have complementary performance vis-à-vis Farid's scheme in that they outperform each other in alternate embedding techniques.

  2. EXOSAT and IUE observations of contact binaries

    International Nuclear Information System (INIS)

    Vilhu, O.; Heise, J.; Laboratorium voor Ruimteonderzoek, Utrecht, Netherlands)

    1986-01-01

    EXOSAT observations are reported of the contact binaries W UMa, VW Cep, 44t Boo, XY Leo, and V566 Oph and the detached short-period RS CVn stars ER Vul and HD 209943. Complete X-ray light curves were obtained for W UMa, VW Cep and 44t Boo. Nearly simultaneous IUE observations of VW Cep provide important comparisons of the Mg II emission, the UV continuum, and the FES light curve, pointing to extra hot gas at phase 0.75. The observations indicate that contact binaries have highly structured (in temperature and geometry) and highly variable coronae, not preferentially connected with either of the component stars. The observed dips can be interpreted as due to cool absorbing clouds above localized X-ray emitting regions. For VW Cep, 44t Boo, and XY Leo there is evidence that the neck regions are sites for X-ray-emitting hot gas. 66 references

  3. On the dynamics of binary galaxies

    International Nuclear Information System (INIS)

    Verner, D.A.; Chernin, A.D.

    1987-01-01

    The dynamics of close noncontact binary galaxies is investigated. It is demonsrated that the tidal interaction is ineffective for circularization of galaxy orbits. Nonsphericity of galaxies develops a torque in a binary system. For a pair of elliptical galaxies this torque leads to swinging of the galaxies with respect to the orbital plane (which can be observed as a rotation about the minor axis) and to the excitation of internal degrees of freedom. Besides, this pendulum effect may be effective for elliptical galaxies in clusters due to the presence of the torque produced by a cluster as a whole. In the case of spiral galaxies the torque leads to the precession of their rotational axes. However this effect seems to be too weak to be observable

  4. Memory Vulnerability Diagnosis for Binary Program

    Directory of Open Access Journals (Sweden)

    Tang Feng-Yi

    2016-01-01

    Full Text Available Vulnerability diagnosis is important for program security analysis. It is a further step to understand the vulnerability after it is detected, as well as a preparatory step for vulnerability repair or exploitation. This paper mainly analyses the inner theories of major memory vulnerabilities and the threats of them. And then suggests some methods to diagnose several types of memory vulnerabilities for the binary programs, which is a difficult task due to the lack of source code. The diagnosis methods target at buffer overflow, use after free (UAF and format string vulnerabilities. We carried out some tests on the Linux platform to validate the effectiveness of the diagnosis methods. It is proved that the methods can judge the type of the vulnerability given a binary program.

  5. The design of supply chains

    DEFF Research Database (Denmark)

    Bøge Sørensen, Lars

    2004-01-01

    Keywords Supply Chain Management, Supply Chain Design, Literature studyAbstract Argues stability is a design objective for supply chain design alongside cost, leadtime and responsiveness. Performs an extensive literature study on supply chain design,identifies methods, theories and objectives...... in the existing literature. Describes the conceptexternal specificity and how it's used to design supply chains. Using the concept upstream,archetypes of risk minimal and maximal design are identified. Downstream the conceptdescribes two viable scenarios, one minimizing the impact, the other minimizing...... theprobability of (intended) departure of a supply chain partner. Finally, principles for supplychain design are described and managerial outlined....

  6. THE ELM SURVEY. V. MERGING MASSIVE WHITE DWARF BINARIES

    International Nuclear Information System (INIS)

    Brown, Warren R.; Kenyon, Scott J.; Kilic, Mukremin; Gianninas, A.; Allende Prieto, Carlos

    2013-01-01

    We present the discovery of 17 low-mass white dwarfs (WDs) in short-period (P ≤ 1 day) binaries. Our sample includes four objects with remarkable log g ≅ 5 surface gravities and orbital solutions that require them to be double degenerate binaries. All of the lowest surface gravity WDs have metal lines in their spectra implying long gravitational settling times or ongoing accretion. Notably, six of the WDs in our sample have binary merger times 0.9 M ☉ companions. If the companions are massive WDs, these four binaries will evolve into stable mass transfer AM CVn systems and possibly explode as underluminous supernovae. If the companions are neutron stars, then these may be millisecond pulsar binaries. These discoveries increase the number of detached, double degenerate binaries in the ELM Survey to 54; 31 of these binaries will merge within a Hubble time.

  7. Detectability of Gravitational Waves from High-Redshift Binaries.

    Science.gov (United States)

    Rosado, Pablo A; Lasky, Paul D; Thrane, Eric; Zhu, Xingjiang; Mandel, Ilya; Sesana, Alberto

    2016-03-11

    Recent nondetection of gravitational-wave backgrounds from pulsar timing arrays casts further uncertainty on the evolution of supermassive black hole binaries. We study the capabilities of current gravitational-wave observatories to detect individual binaries and demonstrate that, contrary to conventional wisdom, some are, in principle, detectable throughout the Universe. In particular, a binary with rest-frame mass ≳10^{10}M_{⊙} can be detected by current timing arrays at arbitrarily high redshifts. The same claim will apply for less massive binaries with more sensitive future arrays. As a consequence, future searches for nanohertz gravitational waves could be expanded to target evolving high-redshift binaries. We calculate the maximum distance at which binaries can be observed with pulsar timing arrays and other detectors, properly accounting for redshift and using realistic binary waveforms.

  8. THE ELM SURVEY. V. MERGING MASSIVE WHITE DWARF BINARIES

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Warren R.; Kenyon, Scott J. [Smithsonian Astrophysical Observatory, 60 Garden St, Cambridge, MA 02138 (United States); Kilic, Mukremin; Gianninas, A. [Homer L. Dodge Department of Physics and Astronomy, University of Oklahoma, 440 W. Brooks St., Norman, OK, 73019 (United States); Allende Prieto, Carlos, E-mail: wbrown@cfa.harvard.edu, E-mail: skenyon@cfa.harvard.edu, E-mail: kilic@ou.edu, E-mail: alexg@nhn.ou.edu, E-mail: callende@iac.es [Instituto de Astrofisica de Canarias, E-38205, La Laguna, Tenerife (Spain)

    2013-05-20

    We present the discovery of 17 low-mass white dwarfs (WDs) in short-period (P {<=} 1 day) binaries. Our sample includes four objects with remarkable log g {approx_equal} 5 surface gravities and orbital solutions that require them to be double degenerate binaries. All of the lowest surface gravity WDs have metal lines in their spectra implying long gravitational settling times or ongoing accretion. Notably, six of the WDs in our sample have binary merger times <10 Gyr. Four have {approx}>0.9 M{sub Sun} companions. If the companions are massive WDs, these four binaries will evolve into stable mass transfer AM CVn systems and possibly explode as underluminous supernovae. If the companions are neutron stars, then these may be millisecond pulsar binaries. These discoveries increase the number of detached, double degenerate binaries in the ELM Survey to 54; 31 of these binaries will merge within a Hubble time.

  9. Decision-Making for Supply Chain Integration Supply Chain Integration

    CERN Document Server

    Lettice, Fiona; Durowoju, Olatunde

    2012-01-01

    Effective supply chain integration, and the tight co-ordination it creates, is an essential pre-requisite for successful supply chain management.  Decision-Making for Supply Chain Integration is a practical reference on recent research in the area of supply chain integration focusing on distributed decision-making problems. Recent applications of various decision-making tools for integrating supply chains are covered including chapters focusing on: •Supplier selection, pricing strategy and inventory decisions in multi-level supply chains, •RFID-enabled distributed decision-making, •Operational risk issues and time-critical decision-making for sensitive logistics nodes, Modelling end to end processes to improve supply chain integration, and •Integrated systems to improve service delivery and optimize resource use. Decision-Making for Supply Chain Integration provides an insight into the tools and methodologies of this field with support from real-life case studies demonstrating successful application ...

  10. Stochastic simulation of nucleation in binary alloys

    Science.gov (United States)

    L’vov, P. E.; Svetukhin, V. V.

    2018-06-01

    In this study, we simulate nucleation in binary alloys with respect to thermal fluctuations of the alloy composition. The simulation is based on the Cahn–Hilliard–Cook equation. We have considered the influence of some fluctuation parameters (wave vector cutoff and noise amplitude) on the kinetics of nucleation and growth of minority phase precipitates. The obtained results are validated by the example of iron–chromium alloys.

  11. Evaporative lithographic patterning of binary colloidal films.

    Science.gov (United States)

    Harris, Daniel J; Conrad, Jacinta C; Lewis, Jennifer A

    2009-12-28

    Evaporative lithography offers a promising new route for patterning a broad array of soft materials. In this approach, a mask is placed above a drying film to create regions of free and hindered evaporation, which drive fluid convection and entrained particles to regions of highest evaporative flux. We show that binary colloidal films exhibit remarkable pattern formation when subjected to a periodic evaporative landscape during drying.

  12. Digitizing Villanova University's Eclipsing Binary Card Catalogue

    Science.gov (United States)

    Guzman, Giannina; Dalton, Briana; Conroy, Kyle; Prsa, Andrej

    2018-01-01

    Villanova University’s Department of Astrophysics and Planetary Science has years of hand-written archival data on Eclipsing Binaries at its disposal. This card catalog began at Princeton in the 1930’s with notable contributions from scientists such as Henry Norris Russel. During World War II, the archive was moved to the University of Pennsylvania, which was one of the world centers for Eclipsing Binary research, consequently, the contributions to the catalog during this time were immense. It was then moved to University of Florida at Gainesville before being accepted by Villanova in the 1990’s. The catalog has been kept in storage since then. The objective of this project is to digitize this archive and create a fully functional online catalog that contains the information available on the cards, along with the scan of the actual cards. Our group has built a database using a python-powered infrastructure to contain the collected data. The team also built a prototype web-based searchable interface as a front-end to the catalog. Following the data-entry process, information like the Right Ascension and Declination will be run against SIMBAD and any differences between values will be noted as part of the catalog. Information published online from the card catalog and even discrepancies in information for a star, could be a catalyst for new studies on these Eclipsing Binaries. Once completed, the database-driven interface will be made available to astronomers worldwide. The group will also acquire, from the database, a list of referenced articles that have yet to be found online in order to further pursue their digitization. This list will be comprised of references in the cards that were neither found on ADS nor online during the data-entry process. Pursuing the integration of these references to online queries such as ADS will be an ongoing process that will contribute and further facilitate studies on Eclipsing Binaries.

  13. Unstable mass outflow from a binary system

    Energy Technology Data Exchange (ETDEWEB)

    Nariai, K [Tokyo Univ., Mitaka (Japan). Tokyo Astronomical Observatory; Sugimoto, D

    1976-12-01

    A contact binary system which fills the outer Lagrangian lobe is unstable against the mass loss from the second Lagrangian point. The effect of the mass loss on the remaining system is studied for several typical cases. It is shown that the separation between the components at the periastron decreases with a high rate in most cases; therefore, the system continues to lose mass once gas begins to flow out from the second Lagrangian point.

  14. Minimum degree and density of binary sequences

    DEFF Research Database (Denmark)

    Brandt, Stephan; Müttel, J.; Rautenbach, D.

    2010-01-01

    For d,k∈N with k ≤ 2d, let g(d,k) denote the infimum density of binary sequences (x)∈{0,1} which satisfy the minimum degree condition σ(x+) ≥ k for all i∈Z with xi=1. We reduce the problem of computing g(d,k) to a combinatorial problem related to the generalized k-girth of a graph G which...

  15. Composition profile determination in isomorphous binary alloys

    International Nuclear Information System (INIS)

    An, C.Y.; Bandeira, I.N.

    1983-07-01

    The inhomogeneity along the growth axis of the pseudo-binary alloys is due to the segregation of the solute which will be mixed in the melt due to convective and diffusive flows. A process for determination of the exact composition profile by measurements of the crystal density, for alloys of the type A sub(1-x) B sub(x), is shown. (Author) [pt

  16. Relativistic apsidal motion in eccentric eclipsing binaries

    Czech Academy of Sciences Publication Activity Database

    Wolf, M.; Claret, L.; Kotková, Lenka; Kučáková, Hana; Kocián, R.; Brát, L.; Svoboda, P.; Šmelcer, L.

    2010-01-01

    Roč. 509, January (2010), A18/1-A18/14 ISSN 0004-6361 Grant - others:GA ČR(CZ) GA205/04/2063; GA ČR(CZ) GA205/06/0217 Institutional research plan: CEZ:AV0Z10030501 Keywords : binaries eclipsing Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.410, year: 2010

  17. Degradation behavior of polymer blend of isotactic polypropylenes with and without unsaturated chain end group

    International Nuclear Information System (INIS)

    Nakatani, Hisayuki; Kurniawan, Dodik; Taniike, Toshiaki; Terano, Minoru

    2008-01-01

    In this work, the relationship between the unsaturated chain end group content and the thermal oxidative degradation rate was systematically studied with binary polymer blends of isotactic polypropylene (iPP) with and without the unsaturated chain end group. The iPPs with and without the unsaturated chain end group were synthesized by a metallocene catalyst in the absence of hydrogen and by a Ziegler catalyst in the presence of one, respectively. The thermal oxidative degradation rate of the binary iPP blends was estimated from the molecular weight and the apparent activation energy (ΔE), which were obtained through size exclusion chromatography (SEC) and thermogravimetric analysis (TGA) measurements, respectively. These values exhibited a negative correlation against the mole content of the unsaturated chain end group. The thermal oxidative degradation rate apparently depends on the content of the unsaturated chain end group. This tendency suggests that the unsaturated chain end acts as a radical initiator of the iPP degradation reaction.

  18. Formation and Evolution of Contact Binaries

    Directory of Open Access Journals (Sweden)

    Peter P. Eggleton

    2012-06-01

    Full Text Available describe a series of processes, including hierarchical fragmentation, gravitational scattering, Kozai cycles within triple systems, tidal friction and magnetic braking, that I believe are responsible for producing the modest but significant fraction of stars that are observed as contact binaries. I also discuss further processes, namely heat transport, mass transport, nuclear evolution, thermal relaxation oscillations, and further magnetic braking with tidal friction, that influence the evolution during contact. The endpoint, for contact, is that the two components merge into a single star, as recently was observed in the remarkable system V1309 Sco. The single star probably throws off some mass and rotates rapidly at first, and then slows by magnetic braking to become a rather inconspicuous but normal dwarf or subgiant. If however the contact binary was part of a triple system originally–as I suggested above was rather likely–then the result could be a widish binary with apparently non-coeval components. There are several such known.

  19. ORBITAL EVOLUTION OF COMPACT WHITE DWARF BINARIES

    Energy Technology Data Exchange (ETDEWEB)

    Kaplan, David L. [Physics Department, University of Wisconsin-Milwaukee, Milwaukee, WI 53211 (United States); Bildsten, Lars [Kavli Institute for Theoretical Physics and Department of Physics, Kohn Hall, University of California, Santa Barbara, CA 93106 (United States); Steinfadt, Justin D. R., E-mail: kaplan@uwm.edu, E-mail: bildsten@kitp.ucsb.edu, E-mail: jdrsteinfadt@gmail.com [Department of Physics, Broida Hall, University of California, Santa Barbara, CA 93106 (United States)

    2012-10-10

    The newfound prevalence of extremely low mass (ELM, M{sub He} < 0.2 M{sub Sun }) helium white dwarfs (WDs) in tight binaries with more massive WDs has raised our interest in understanding the nature of their mass transfer. Possessing small (M{sub env} {approx} 10{sup -3} M{sub Sun }) but thick hydrogen envelopes, these objects have larger radii than cold WDs and so initiate mass transfer of H-rich material at orbital periods of 6-10 minutes. Building on the original work of D'Antona et al., we confirm the 10{sup 6} yr period of continued inspiral with mass transfer of H-rich matter and highlight the fact that the inspiraling direct-impact double WD binary HM Cancri likely has an ELM WD donor. The ELM WDs have less of a radius expansion under mass loss, thus enabling a larger range of donor masses that can stably transfer matter and become a He mass transferring AM CVn binary. Even once in the long-lived AM CVn mass transferring stage, these He WDs have larger radii due to their higher entropy from the prolonged H-burning stage.

  20. Constraining the Statistics of Population III Binaries

    Science.gov (United States)

    Stacy, Athena; Bromm, Volker

    2012-01-01

    We perform a cosmological simulation in order to model the growth and evolution of Population III (Pop III) stellar systems in a range of host minihalo environments. A Pop III multiple system forms in each of the ten minihaloes, and the overall mass function is top-heavy compared to the currently observed initial mass function in the Milky Way. Using a sink particle to represent each growing protostar, we examine the binary characteristics of the multiple systems, resolving orbits on scales as small as 20 AU. We find a binary fraction of approx. 36, with semi-major axes as large as 3000 AU. The distribution of orbital periods is slightly peaked at approx. < 900 yr, while the distribution of mass ratios is relatively flat. Of all sink particles formed within the ten minihaloes, approx. 50 are lost to mergers with larger sinks, and 50 of the remaining sinks are ejected from their star-forming disks. The large binary fraction may have important implications for Pop III evolution and nucleosynthesis, as well as the final fate of the first stars.

  1. Study of zirconium-addition binary systems

    International Nuclear Information System (INIS)

    Wozniakova, B.; Kuchar, L.

    1975-01-01

    The curves are given of the solid and the liquid of binary zirconium-addition systems. Most additions reduce the melting temperature of zirconium. The only known additions to increase the melting temperature are nitrogen, oxygen and hafnium. Also given are the transformation curves of the systems and the elements are given which reduce or raise the temperature of α-β transformation. From the Mendeleev table into which are plotted the curves of the solid and the liquid of binary systems it is possible to predict the properties of unknown binary systems. For the calculations of the curves of the solid and the liquid, 1860 degC was taken as the temperature of zirconium melting. For the calculations of transformation curves, 865 degC was taken as the temperature of α-β transformation. The equations are given of the curves of the solid and the liquid and of the transformation curves of some Zr-addition systems. Also given are the calculated equilibrium distribution coefficients and the equilibrium distribution coefficients of the transformation of additions in Zr and their limit values for temperatures approximating the melting point or the temperature of the transformation of pure Zr, and the values pertaining to eutectic and peritectic or eutectoid and peritectoid temperatures. (J.B.)

  2. On the binary expansions of algebraic numbers

    Energy Technology Data Exchange (ETDEWEB)

    Bailey, David H.; Borwein, Jonathan M.; Crandall, Richard E.; Pomerance, Carl

    2003-07-01

    Employing concepts from additive number theory, together with results on binary evaluations and partial series, we establish bounds on the density of 1's in the binary expansions of real algebraic numbers. A central result is that if a real y has algebraic degree D > 1, then the number {number_sign}(|y|, N) of 1-bits in the expansion of |y| through bit position N satisfies {number_sign}(|y|, N) > CN{sup 1/D} for a positive number C (depending on y) and sufficiently large N. This in itself establishes the transcendency of a class of reals {summation}{sub n{ge}0} 1/2{sup f(n)} where the integer-valued function f grows sufficiently fast; say, faster than any fixed power of n. By these methods we re-establish the transcendency of the Kempner--Mahler number {summation}{sub n{ge}0}1/2{sup 2{sup n}}, yet we can also handle numbers with a substantially denser occurrence of 1's. Though the number z = {summation}{sub n{ge}0}1/2{sup n{sup 2}} has too high a 1's density for application of our central result, we are able to invoke some rather intricate number-theoretical analysis and extended computations to reveal aspects of the binary structure of z{sup 2}.

  3. Circumstellar disks around binary stars in Taurus

    International Nuclear Information System (INIS)

    Akeson, R. L.; Jensen, E. L. N.

    2014-01-01

    We have conducted a survey of 17 wide (>100 AU) young binary systems in Taurus with the Atacama Large Millimeter Array (ALMA) at two wavelengths. The observations were designed to measure the masses of circumstellar disks in these systems as an aid to understanding the role of multiplicity in star and planet formation. The ALMA observations had sufficient resolution to localize emission within the binary system. Disk emission was detected around all primaries and 10 secondaries, with disk masses as low as 10 –4 M ☉ . We compare the properties of our sample to the population of known disks in Taurus and find that the disks from this binary sample match the scaling between stellar mass and millimeter flux of F mm ∝M ∗ 1.5--2.0 to within the scatter found in previous studies. We also compare the properties of the primaries to those of the secondaries and find that the secondary/primary stellar and disk mass ratios are not correlated; in three systems, the circumsecondary disk is more massive than the circumprimary disk, counter to some theoretical predictions.

  4. Circumstellar disks around binary stars in Taurus

    Energy Technology Data Exchange (ETDEWEB)

    Akeson, R. L. [NASA Exoplanet Science Institute, IPAC/Caltech, Pasadena, CA 91125 (United States); Jensen, E. L. N. [Swarthmore College, Department of Physics and Astronomy, Swarthmore, PA 19081 (United States)

    2014-03-20

    We have conducted a survey of 17 wide (>100 AU) young binary systems in Taurus with the Atacama Large Millimeter Array (ALMA) at two wavelengths. The observations were designed to measure the masses of circumstellar disks in these systems as an aid to understanding the role of multiplicity in star and planet formation. The ALMA observations had sufficient resolution to localize emission within the binary system. Disk emission was detected around all primaries and 10 secondaries, with disk masses as low as 10{sup –4} M {sub ☉}. We compare the properties of our sample to the population of known disks in Taurus and find that the disks from this binary sample match the scaling between stellar mass and millimeter flux of F{sub mm}∝M{sub ∗}{sup 1.5--2.0} to within the scatter found in previous studies. We also compare the properties of the primaries to those of the secondaries and find that the secondary/primary stellar and disk mass ratios are not correlated; in three systems, the circumsecondary disk is more massive than the circumprimary disk, counter to some theoretical predictions.

  5. Observations of binary stars by speckle interferometry

    International Nuclear Information System (INIS)

    Morgan, B.L.; Beckmann, G.K.; Scaddan, R.J.

    1980-01-01

    This is the second paper in a series describing observations of binary stars using the technique of speckle interferometry. Observations were made using the 2.5-m Isaac Newton Telescope and the 1-m telescope of the Royal Greenwich Observatory and the 1.9-m telescope of the South African Astronomical Observatory. The classical Rayleigh diffraction limits are 0.050 arcsec for the 2.5-m telescope, 0.065 arcsec for the 1.9-m telescope and 0.125 arcsec for the 1-m telescope, at a wavelength of 500 nm. The results of 29 measurements of 26 objects are presented. The objects include long period spectroscopic binaries from the 6th Catalogue of Batten, close visual binary systems from the 3rd Catalogue of Finsen and Worley and variable stars. Nine of the objects have not been previously resolved by speckle interferometry. New members are detected in the systems β Cep, p Vel and iota UMa. (author)

  6. Orbital Decay in Binaries with Evolved Stars

    Science.gov (United States)

    Sun, Meng; Arras, Phil; Weinberg, Nevin N.; Troup, Nicholas; Majewski, Steven R.

    2018-01-01

    Two mechanisms are often invoked to explain tidal friction in binary systems. The ``dynamical tide” is the resonant excitation of internal gravity waves by the tide, and their subsequent damping by nonlinear fluid processes or thermal diffusion. The ``equilibrium tide” refers to non-resonant excitation of fluid motion in the star’s convection zone, with damping by interaction with the turbulent eddies. There have been numerous studies of these processes in main sequence stars, but less so on the subgiant and red giant branches. Motivated by the newly discovered close binary systems in the Apache Point Observatory Galactic Evolution Experiment (APOGEE-1), we have performed calculations of both the dynamical and equilibrium tide processes for stars over a range of mass as the star’s cease core hydrogen burning and evolve to shell burning. Even for stars which had a radiative core on the main sequence, the dynamical tide may have very large amplitude in the newly radiative core in post-main sequence, giving rise to wave breaking. The resulting large dynamical tide dissipation rate is compared to the equilibrium tide, and the range of secondary masses and orbital periods over which rapid orbital decay may occur will be discussed, as well as applications to close APOGEE binaries.

  7. Simulations of nearly extremal binary black holes

    Science.gov (United States)

    Giesler, Matthew; Scheel, Mark; Hemberger, Daniel; Lovelace, Geoffrey; Kuper, Kevin; Boyle, Michael; Szilagyi, Bela; Kidder, Lawrence; SXS Collaboration

    2015-04-01

    Astrophysical black holes could have nearly extremal spins; therefore, nearly extremal black holes could be among the binaries that current and future gravitational-wave observatories will detect. Predicting the gravitational waves emitted by merging black holes requires numerical-relativity simulations, but these simulations are especially challenging when one or both holes have mass m and spin S exceeding the Bowen-York limit of S /m2 = 0 . 93 . Using improved methods we simulate an unequal-mass, precessing binary black hole coalescence, where the larger black hole has S /m2 = 0 . 99 . We also use these methods to simulate a nearly extremal non-precessing binary black hole coalescence, where both black holes have S /m2 = 0 . 994 , nearly reaching the Novikov-Thorne upper bound for holes spun up by thin accretion disks. We demonstrate numerical convergence and estimate the numerical errors of the waveforms; we compare numerical waveforms from our simulations with post-Newtonian and effective-one-body waveforms; and we compare the evolution of the black-hole masses and spins with analytic predictions.

  8. Accreting Binary Populations in the Earlier Universe

    Science.gov (United States)

    Hornschemeier, Ann

    2010-01-01

    It is now understood that X-ray binaries dominate the hard X-ray emission from normal star-forming galaxies. Thanks to the deepest (2-4 Ms) Chandra surveys, such galaxies are now being studied in X-rays out to z approximates 4. Interesting X-ray stacking results (based on 30+ galaxies per redshift bin) suggest that the mean rest-frame 2-10 keV luminosity from z=3-4 Lyman break galaxies (LBGs), is comparable to the most powerful starburst galaxies in the local Universe. This result possibly indicates a similar production mechanism for accreting binaries over large cosmological timescales. To understand and constrain better the production of X-ray binaries in high-redshift LBGs, we have utilized XMM-Newton observations of a small sample of z approximates 0.1 GALEX-selected Ultraviolet-Luminous Galaxies (UVLGs); local analogs to high-redshift LBGs. Our observations enable us to study the X-ray emission from LBG-like galaxies on an individual basis, thus allowing us to constrain object-to-object variances in this population. We supplement these results with X-ray stacking constraints using the new 3.2 Ms Chandra Deep Field-South (completed spring 2010) and LBG candidates selected from HST, Swift UVOT, and ground-based data. These measurements provide new X-ray constraints that sample well the entire z=0-4 baseline

  9. Evolution of massive close binary stars

    International Nuclear Information System (INIS)

    Masevich, A.G.; Tutukov, A.V.

    1982-01-01

    Some problems of the evolution of massive close binary stars are discussed. Most of them are nonevolutionized stars with close masses of components. After filling the Roche cavity and exchange of matter between the components the Wolf-Rayet star is formed. As a result of the supernovae explosion a neutron star or a black hole is formed in the system. The system does not disintegrate but obtains high space velocity owing to the loss of the supernovae envelope. The satellite of the neutron star or black hole - the star of the O or B spectral class loses about 10 -6 of the solar mass for a year. Around the neighbouring component a disc of this matter is formed the incidence of which on a compact star leads to X radiation appearance. The neutron star cannot absorb the whole matter of the widening component and the binary system submerges into the common envelope. As a result of the evolution of massive close binary systems single neutron stars can appear which after the lapse of some time become radiopulsars. Radiopulsars with such high space velocities have been found in our Galaxy [ru

  10. The IASI detection chain

    Science.gov (United States)

    Nicol, Patrick; Fleury, Joel; Le Naour, Claire; Bernard, Frédéric

    2017-11-01

    IASI (Infrared Atmospheric Sounding Interferometer) is an infrared atmospheric sounder. It will provide meteorologist and scientific community with atmospheric spectra. The instrument is composed of a Fourier transform spectrometer and an associated infrared imager. The presentation will describe the spectrometer detection chain architecture, composed by three different detectors cooled in a passive cryo-cooler (so called CBS : Cold Box Subsystem) and associated analog electronics up to digital conversion. It will mainly focus on design choices with regards to environment constraints, implemented technologies, and associated performances. CNES is leading the IASI program in collaboration with EUMETSAT. The instrument Prime is ALCATEL SPACE responsible, notably, of the detection chain architecture. SAGEM SA provides the detector package (so called CAU : Cold Acquisition Unit).

  11. Sympathetic chain Schwannoma

    International Nuclear Information System (INIS)

    Al-Mashat, Faisal M.

    2009-01-01

    Schwannomas are rare, benign, slowly growing tumors arising from Schwann cells that line nerve sheaths. Schwannomas arising from the cervical sympathetic chain are extremely rare. Here, we report a case of a 70-year-old man who presented with only an asymptomatic neck mass. Physical examination revealed a left sided Horner syndrome and a neck mass with transmitted pulsation and anterior displacement of the carotid artery. Computed tomography (CT) showed a well-defined non-enhancing mass with vascular displacement. The nerve of origin of this encapsulated tumor was the sympathetic chain. The tumor was excised completely intact. The pathologic diagnosis was Schwannoma (Antoni type A and Antoni type B). The patient has been well and free of tumor recurrence for 14 months with persistence of asymptomatic left sided Horner syndrome. The clinical, radiological and pathological evaluations, therapy and postoperative complications of this tumor are discussed. (author)

  12. Extended linear chain compounds

    CERN Document Server

    Linear chain substances span a large cross section of contemporary chemistry ranging from covalent polymers, to organic charge transfer com­ plexes to nonstoichiometric transition metal coordination complexes. Their commonality, which coalesced intense interest in the theoretical and exper­ imental solid state physics/chemistry communities, was based on the obser­ vation that these inorganic and organic polymeric substrates exhibit striking metal-like electrical and optical properties. Exploitation and extension of these systems has led to the systematic study of both the chemistry and physics of highly and poorly conducting linear chain substances. To gain a salient understanding of these complex materials rich in anomalous aniso­ tropic electrical, optical, magnetic, and mechanical properties, the conver­ gence of diverse skills and talents was required. The constructive blending of traditionally segregated disciplines such as synthetic and physical organic, inorganic, and polymer chemistry, crystallog...

  13. Environmental Retail Supply Chains

    DEFF Research Database (Denmark)

    Kotzab, Herbert; Munch, Hilde; de Faultrier, Birgitte

    2011-01-01

    which were grouped into eight categories; they refer to “fundamental environmental attitude”, “use of energy”, “use of input material”, “product”, “packaging”, “transport”, “consumption” and “waste”. The level of environmental supply chain management can be characterised as very operational and very...... short-term oriented (green operations). Long-term oriented green design initiatives were hardly observed. Furthermore, the specific environmental activities of three retailers from Denmark, France and the UK were compared. Research limitations/implications – The empirical study investigates supply chain...... operations of retailers and excludes other areas of retail management. The results are based on material that is published by the respective companies and thus do not include internal reports. Originality/value – The main contribution of this paper is to test the proposition that global retailers follow...

  14. Towards Intelligent Supply Chains

    DEFF Research Database (Denmark)

    Siurdyban, Artur; Møller, Charles

    2012-01-01

    applied to the context of organizational processes can increase the success rate of business operations. The framework is created using a set of theoretical based constructs grounded in a discussion across several streams of research including psychology, pedagogy, artificial intelligence, learning...... of deploying inapt operations leading to deterioration of profits. To address this problem, we propose a unified business process design framework based on the paradigm of intelligence. Intelligence allows humans and human-designed systems cope with environmental volatility, and we argue that its principles......, business process management and supply chain management. It outlines a number of system tasks combined in four integrated management perspectives: build, execute, grow and innovate, put forward as business process design propositions for Intelligent Supply Chains....

  15. Port supply chain integration : analyzing biofuel supply chains

    NARCIS (Netherlands)

    Stevens, Leonie C. E.; Vis, Iris F. A.

    2016-01-01

    This paper focuses on port supply chain integration to strengthen operational and business performance. We provide a structured and comprehensive method to enable port supply chain integration and demonstrate its applicability to the biofuel supply chain. We define the value proposition, role,

  16. The innovation value chain.

    Science.gov (United States)

    Hansen, Morten T; Birkinshaw, Julian

    2007-06-01

    The challenges of coming up with fresh ideas and realizing profits from them are different for every company. One firm may excel at finding good ideas but may have weak systems for bringing them to market. Another organization may have a terrific process for funding and rolling out new products and services but a shortage of concepts to develop. In this article, Hansen and Birkinshaw caution executives against using the latest and greatest innovation approaches and tools without understanding the unique deficiencies in their companies' innovation systems. They offer a framework for evaluating innovation performance: the innovation value chain. It comprises the three main phases of innovation (idea generation, conversion, and diffusion) as well as the critical activities performed during those phases (looking for ideas inside your unit; looking for them in other units; looking for them externally; selecting ideas; funding them; and promoting and spreading ideas companywide). Using this framework, managers get an end-to-end view of their innovation efforts. They can pinpoint their weakest links and tailor innovation best practices appropriately to strengthen those links. Companies typically succumb to one of three broad "weakest-link" scenarios. They are idea poor, conversion poor, or diffusion poor. The article looks at the ways smart companies - including Intuit, P&G, Sara Lee, Shell, and Siemens- modify the best innovation practices and apply them to address those organizations' individual needs and flaws. The authors warn that adopting the chain-based view of innovation requires new measures of what can be delivered by each link in the chain. The approach also entails new roles for employees "external scouts" and "internal evangelists," for example. Indeed, in their search for new hires, companies should seek out those candidates who can help address particular weaknesses in the innovation value chain.

  17. Supply Chain Initiatives Database

    Energy Technology Data Exchange (ETDEWEB)

    None

    2012-11-01

    The Supply Chain Initiatives Database (SCID) presents innovative approaches to engaging industrial suppliers in efforts to save energy, increase productivity and improve environmental performance. This comprehensive and freely-accessible database was developed by the Institute for Industrial Productivity (IIP). IIP acknowledges Ecofys for their valuable contributions. The database contains case studies searchable according to the types of activities buyers are undertaking to motivate suppliers, target sector, organization leading the initiative, and program or partnership linkages.

  18. Supply chain finance

    Directory of Open Access Journals (Sweden)

    Kasavica Petar

    2014-01-01

    Full Text Available The concept of supply chain finance is a response to global illiquidity, intensified through the global economic crisis and globalization of commercial and financial flows. The growing illiquidity undermines credit ratings of economic entities, thereby reducing the potential for achieving the projected goals (profitability and portfolio quality. In order to overcome this, banks have introduced certain products flexible to the requirements of specific transactions. The concerned products redirect the focus from a client's credit rating and risk to the credit rating and risk of a business partner (buyer, resulting in benefits for all transaction participants ('win-win-win'. Moreover, the activities are targeted at transaction analysis, i.e. the isolation and protection of the cash flow as the source of financial instrument's repayment. On the other hand, there has been an increasing number of transactions based on the risk of the commercial bank of the client's business partner, or on the risk of collateral (inventory. The focus is actually placed on the financing of adequate supply chain stages, given that counterparty relationship management has been proven to be crucial for efficient management of one's own business. The tensions existing in the relations between partners (increasingly long payment deadlines are in the basis of the supply chain finance concept. Decisions made by banks are based on the entire supply chain (wide information basis, thereby shifting the focus from the product (as was the case before the crisis to the client's needs. Thus, decisions become increasingly comprehensive, quicker, and more precise, and portfolios less risky. Through the individual portfolio of banks, the market of national economies also becomes safer and more liquid. These are rather profitable transactions, because, due to the risk transfer, financing is enabled to companies to whom classic crediting in most cases is not available.

  19. Pairwise Choice Markov Chains

    OpenAIRE

    Ragain, Stephen; Ugander, Johan

    2016-01-01

    As datasets capturing human choices grow in richness and scale---particularly in online domains---there is an increasing need for choice models that escape traditional choice-theoretic axioms such as regularity, stochastic transitivity, and Luce's choice axiom. In this work we introduce the Pairwise Choice Markov Chain (PCMC) model of discrete choice, an inferentially tractable model that does not assume any of the above axioms while still satisfying the foundational axiom of uniform expansio...

  20. Distinguishing Hidden Markov Chains

    OpenAIRE

    Kiefer, Stefan; Sistla, A. Prasad

    2015-01-01

    Hidden Markov Chains (HMCs) are commonly used mathematical models of probabilistic systems. They are employed in various fields such as speech recognition, signal processing, and biological sequence analysis. We consider the problem of distinguishing two given HMCs based on an observation sequence that one of the HMCs generates. More precisely, given two HMCs and an observation sequence, a distinguishing algorithm is expected to identify the HMC that generates the observation sequence. Two HM...

  1. Probing the low-stellar-mass domain with Kepler and APOGEE observations of eclipsing binaries

    Science.gov (United States)

    Prsa, Andrej; Hambleton, Kelly

    2018-01-01

    Observations of low-mass stars (M models, where observed radii can be inflated by as much as 5-15% as compared to model predictions. One of the proposed explanations for this discrepancy that is gaining traction are stellar magnetic fields impeding the onset of convection and the subsequent bloating of the star. Here we present modeling analysis results of two benchmark eclipsing binaries, KIC 3003991 and KIC 2445134, with low mass companions (M ~ 0.2 MSun and M ~ 0.5 MSun, respectively). The models are based on Kepler photometry and APOGEE spectroscopy. APOGEE is a part of the Sloan spectroscopic survey that observes in the near-infrared, providing greater sensitivity towards fainter, red companions. We combine the binary modeling software PHOEBE with emcee, an affine invariant Markov chain Monte Carlo sampler; celerite, a Gaussian process library; and our own codes to create a modeling suite capable of modeling correlated noise, shot noise, nuisance astrophysical signals (such as spots) and the full set of eclipsing binary parameters. The results are obtained within a probabilistic framework, with robust mass and radius uncertainties ~1-4%. We overplot the derived masses, radii and temperatures over evolutionary models and note stellar size bloating w.r.t. model predictions for both systems. This work has been funded by the NSF grant #1517460.

  2. Approximate quantum Markov chains

    CERN Document Server

    Sutter, David

    2018-01-01

    This book is an introduction to quantum Markov chains and explains how this concept is connected to the question of how well a lost quantum mechanical system can be recovered from a correlated subsystem. To achieve this goal, we strengthen the data-processing inequality such that it reveals a statement about the reconstruction of lost information. The main difficulty in order to understand the behavior of quantum Markov chains arises from the fact that quantum mechanical operators do not commute in general. As a result we start by explaining two techniques of how to deal with non-commuting matrices: the spectral pinching method and complex interpolation theory. Once the reader is familiar with these techniques a novel inequality is presented that extends the celebrated Golden-Thompson inequality to arbitrarily many matrices. This inequality is the key ingredient in understanding approximate quantum Markov chains and it answers a question from matrix analysis that was open since 1973, i.e., if Lieb's triple ma...

  3. The coprime quantum chain

    Science.gov (United States)

    Mussardo, G.; Giudici, G.; Viti, J.

    2017-03-01

    In this paper we introduce and study the coprime quantum chain, i.e. a strongly correlated quantum system defined in terms of the integer eigenvalues n i of the occupation number operators at each site of a chain of length M. The n i ’s take value in the interval [2,q] and may be regarded as S z eigenvalues in the spin representation j  =  (q  -  2)/2. The distinctive interaction of the model is based on the coprimality matrix \\boldsymbolΦ : for the ferromagnetic case, this matrix assigns lower energy to configurations where occupation numbers n i and n i+1 of neighbouring sites share a common divisor, while for the anti-ferromagnetic case it assigns a lower energy to configurations where n i and n i+1 are coprime. The coprime chain, both in the ferro and anti-ferromagnetic cases, may present an exponential number of ground states whose values can be exactly computed by means of graph theoretical tools. In the ferromagnetic case there are generally also frustration phenomena. A fine tuning of local operators may lift the exponential ground state degeneracy and, according to which operators are switched on, the system may be driven into different classes of universality, among which the Ising or Potts universality class. The paper also contains an appendix by Don Zagier on the exact eigenvalues and eigenvectors of the coprimality matrix in the limit q\\to ∞ .

  4. The formation of eccentric compact binary inspirals and the role of gravitational wave emission in binary-single stellar encounters

    International Nuclear Information System (INIS)

    Samsing, Johan; MacLeod, Morgan; Ramirez-Ruiz, Enrico

    2014-01-01

    The inspiral and merger of eccentric binaries leads to gravitational waveforms distinct from those generated by circularly merging binaries. Dynamical environments can assemble binaries with high eccentricity and peak frequencies within the LIGO band. In this paper, we study binary-single stellar scatterings occurring in dense stellar systems as a source of eccentrically inspiraling binaries. Many interactions between compact binaries and single objects are characterized by chaotic resonances in which the binary-single system undergoes many exchanges before reaching a final state. During these chaotic resonances, a pair of objects has a non-negligible probability of experiencing a very close passage. Significant orbital energy and angular momentum are carried away from the system by gravitational wave (GW) radiation in these close passages, and in some cases this implies an inspiral time shorter than the orbital period of the bound third body. We derive the cross section for such dynamical inspiral outcomes through analytical arguments and through numerical scattering experiments including GW losses. We show that the cross section for dynamical inspirals grows with increasing target binary semi-major axis a and that for equal-mass binaries it scales as a 2/7 . Thus, we expect wide target binaries to predominantly contribute to the production of these relativistic outcomes. We estimate that eccentric inspirals account for approximately 1% of dynamically assembled non-eccentric merging binaries. While these events are rare, we show that binary-single scatterings are a more effective formation channel than single-single captures for the production of eccentrically inspiraling binaries, even given modest binary fractions.

  5. Adjustable chain trees for proteins

    DEFF Research Database (Denmark)

    Winter, Pawel; Fonseca, Rasmus

    2012-01-01

    A chain tree is a data structure for changing protein conformations. It enables very fast detection of clashes and free energy potential calculations. A modified version of chain trees that adjust themselves to the changing conformations of folding proteins is introduced. This results in much...... tighter bounding volume hierarchies and therefore fewer intersection checks. Computational results indicate that the efficiency of the adjustable chain trees is significantly improved compared to the traditional chain trees....

  6. All-optical conversion scheme: Binary to quaternary and quaternary to binary number

    Science.gov (United States)

    Chattopadhyay, Tanay; Roy, Jitendra Nath

    2009-04-01

    To achieve the inherent parallelism in optics a suitable number system and efficient encoding/decoding scheme for handling the data are very much essential. Binary number is accepted as the best representing number system in almost all types of existing electronic computers. But, binary number (0 and 1) is insufficient in respect to the demand of the coming generation. Multi-valued logic (with radix >2) can be viewed as an alternative approach to solve many problems in transmission, storage and processing of large amount of information in digital signal processing. Here, in this paper all-optical scheme for the conversion of binary to quaternary number and vice versa have been proposed and described. Simulation has also been done. In this all-optical scheme the numbers are represented by different discrete polarized state of light.

  7. A chain of FPU cells

    NARCIS (Netherlands)

    Verhulst, F.

    2015-01-01

    In contrast to the classical Fermi-Pasta-Ulam (FPU) chain, the inhomogeneous FPU chain shows nearly all the principal resonances. Using this fact, we can construct a periodic FPU chain of low dimension, for instance a FPU cell of four degrees-of-freedom, that can be used as a building block for a

  8. Designing structural supply chain flexibility

    NARCIS (Netherlands)

    Mulinski, Ksawery Jan

    2012-01-01

    In a continuously changing business environment the role of supply chain flexibility is constantly increasing. A flexible supply chain can ensure survival in quickly changing market conditions as well as enable sustainable growth. This thesis explores the topic of supply chain flexibility with focus

  9. Process Algebra and Markov Chains

    NARCIS (Netherlands)

    Brinksma, Hendrik; Hermanns, H.; Brinksma, Hendrik; Hermanns, H.; Katoen, Joost P.

    This paper surveys and relates the basic concepts of process algebra and the modelling of continuous time Markov chains. It provides basic introductions to both fields, where we also study the Markov chains from an algebraic perspective, viz. that of Markov chain algebra. We then proceed to study

  10. Process algebra and Markov chains

    NARCIS (Netherlands)

    Brinksma, E.; Hermanns, H.; Brinksma, E.; Hermanns, H.; Katoen, J.P.

    2001-01-01

    This paper surveys and relates the basic concepts of process algebra and the modelling of continuous time Markov chains. It provides basic introductions to both fields, where we also study the Markov chains from an algebraic perspective, viz. that of Markov chain algebra. We then proceed to study

  11. Risk Management in Logystics Chains

    OpenAIRE

    Butrin, Andrey; Vikulov, Vladimir

    2013-01-01

    Article is devoted to risk management of supply chain. The authors considered indicators of supply chain risks, including risks caused by supplier. Authors formed a method of optimizing the level of supply chain risk in the integration with suppliers and customers.

  12. Academic Education Chain Operation Model

    OpenAIRE

    Ruskov, Petko; Ruskov, Andrey

    2007-01-01

    This paper presents an approach for modelling the educational processes as a value added chain. It is an attempt to use a business approach to interpret and compile existing business and educational processes towards reference models and suggest an Academic Education Chain Operation Model. The model can be used to develop an Academic Chain Operation Reference Model.

  13. Massive binaries in the vicinity of Sgr A*

    Energy Technology Data Exchange (ETDEWEB)

    Pfuhl, O.; Gillessen, S.; Genzel, R.; Eisenhauer, F.; Fritz, T. K.; Ott, T. [Max-Planck-Institut für Extraterrestrische Physik, D-85748 Garching (Germany); Alexander, T. [Faculty of Physics, Weizmann Institute of Science, P.O. Box 26, Rehovot 76100 (Israel); Martins, F., E-mail: pfuhl@mpe.mpg.de [LUPM, Université Montpelier 2, CNRS, Place Eugéne Bataillon, F-34095, Montpellier (France)

    2014-02-20

    A long-term spectroscopic and photometric survey of the most luminous and massive stars in the vicinity of the supermassive black hole Sgr A* revealed two new binaries: a long-period Ofpe/WN9 binary, IRS 16NE, with a modest eccentricity of 0.3 and a period of 224 days, and an eclipsing Wolf-Rayet binary with a period of 2.3 days. Together with the already identified binary IRS 16SW, there are now three confirmed OB/WR binaries in the inner 0.2 pc of the Galactic center. Using radial velocity change upper limits, we were able to constrain the spectroscopic binary fraction in the Galactic center to F{sub SB}=0.30{sub −0.21}{sup +0.34} at a confidence level of 95%, a massive binary fraction close to that observed in dense clusters. The fraction of eclipsing binaries with photometric amplitudes Δm > 0.4 is F{sub EB}{sup GC}=3%±2%, which is consistent with local OB star clusters (F {sub EB} = 1%). Overall, the Galactic center binary fraction seems to be similar to the binary fraction in comparable young clusters.

  14. Rotational properties of the binary and non-binary populations in the Trans-Neptunian belt

    Science.gov (United States)

    Thirouin, Audrey; Noll, Keith S.; Ortiz Moreno, Jose Luis; Morales , Nicolas

    2014-11-01

    An exhaustive study about short-term variability as well as derived properties from lightcurves allowed us to draw some conclusions for the Trans-Neptunian belt binary population. Based on Maxwellian fit distributions of the spin rate, we suggested that the binary population rotates slower than the non-binary one. This slowing-down can be attributed to tidal effects between the satellite and the primary, as expected. We showed that no system in this work is tidally locked, but the primary despinning process may have already affected the primary rate (as well as the satellite rotational rate). We used the Gladman et al. (1996) formula to compute the time required to tidally lock the systems, but this formula is based on several assumptions and approximations that do not always hold. The computed times are reasonable in most cases and confirm that none of the systems is tidally locked, assuming that the satellite densities are low and have a high rigidity or have a higher dissipation than usually assumed. The rotational properties of small bodies provide information about important physical properties, such as shape, density, and cohesion (Pravec & Harris 2000; Holsapple 2001, 2004; Thirouin et al. 2010, 2012). For binaries it is also possible to derive several physical parameters of the system components, such as diameters of the primary/secondary and albedo under some assumptions. We compare our results as well as our technique for deriving this information from the lightcurve with other methods, such as: i) thermal or thermophysical modeling, ii) from the mutual orbit of the binary component, iii) from direct imaging or iv) from stellar occultation by Trans-Neptunian Objects (TNOs). Finally, by studying the specific angular momentum of the sample, we proposed possible formation models for several binary TNOs. In several cases, we obtained hints of the formation mechanism from the angular momentum, but for other cases we do not have enough information about the

  15. Binary Cepheids: Separations and Mass Ratios in 5 M ⊙ Binaries

    Science.gov (United States)

    Evans, Nancy Evans; Bond, Howard E.; Schaefer, Gail H.; Mason, Brian D.; Karovska, Margarita; Tingle, Evan

    2013-10-01

    Deriving the distribution of binary parameters for a particular class of stars over the full range of orbital separations usually requires the combination of results from many different observing techniques (radial velocities, interferometry, astrometry, photometry, direct imaging), each with selection biases. However, Cepheids—cool, evolved stars of ~5 M ⊙—are a special case because ultraviolet (UV) spectra will immediately reveal any companion star hotter than early type A, regardless of the orbital separation. We have used International Ultraviolet Explorer UV spectra of a complete sample of all 76 Cepheids brighter than V = 8 to create a list of all 18 Cepheids with companions more massive than 2.0 M ⊙. Orbital periods of many of these binaries are available from radial-velocity studies, or can be estimated for longer-period systems from detected velocity variability. In an imaging survey with the Hubble Space Telescope Wide Field Camera 3, we resolved three of the companions (those of η Aql, S Nor, and V659 Cen), allowing us to make estimates of the periods out to the long-period end of the distribution. Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations, orbital periods, and mass ratios. The distribution of orbital periods shows that the 5 M ⊙ binaries have systematically shorter periods than do 1 M ⊙ stars. Our data also suggest that the distribution of mass ratios depends on both binary separation and system multiplicity. The distribution of mass ratios as a function of orbital separation, however, does not depend on whether a system is a binary or a triple. Based in part on observations made with the NASA/ESA Hubble Space Telescope, obtained by the Space Telescope Science Institute. STScI is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS5-26555.

  16. BINARY CEPHEIDS: SEPARATIONS AND MASS RATIOS IN 5 M ☉ BINARIES

    International Nuclear Information System (INIS)

    Evans, Nancy Remage; Karovska, Margarita; Tingle, Evan; Bond, Howard E.; Schaefer, Gail H.; Mason, Brian D.

    2013-01-01

    Deriving the distribution of binary parameters for a particular class of stars over the full range of orbital separations usually requires the combination of results from many different observing techniques (radial velocities, interferometry, astrometry, photometry, direct imaging), each with selection biases. However, Cepheids—cool, evolved stars of ∼5 M ☉ —are a special case because ultraviolet (UV) spectra will immediately reveal any companion star hotter than early type A, regardless of the orbital separation. We have used International Ultraviolet Explorer UV spectra of a complete sample of all 76 Cepheids brighter than V = 8 to create a list of all 18 Cepheids with companions more massive than 2.0 M ☉ . Orbital periods of many of these binaries are available from radial-velocity studies, or can be estimated for longer-period systems from detected velocity variability. In an imaging survey with the Hubble Space Telescope Wide Field Camera 3, we resolved three of the companions (those of η Aql, S Nor, and V659 Cen), allowing us to make estimates of the periods out to the long-period end of the distribution. Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations, orbital periods, and mass ratios. The distribution of orbital periods shows that the 5 M ☉ binaries have systematically shorter periods than do 1 M ☉ stars. Our data also suggest that the distribution of mass ratios depends on both binary separation and system multiplicity. The distribution of mass ratios as a function of orbital separation, however, does not depend on whether a system is a binary or a triple

  17. BINARY CEPHEIDS: SEPARATIONS AND MASS RATIOS IN 5 M {sub ☉} BINARIES

    Energy Technology Data Exchange (ETDEWEB)

    Evans, Nancy Remage; Karovska, Margarita; Tingle, Evan [Smithsonian Astrophysical Observatory, MS 4, 60 Garden Street, Cambridge, MA 02138 (United States); Bond, Howard E. [Department of Astronomy and Astrophysics, Pennsylvania State University, University Park, PA 16802 (United States); Schaefer, Gail H. [The CHARA Array, Georgia State University, P.O. Box 3965, Atlanta, GA 30302-3965 (United States); Mason, Brian D., E-mail: nevans@cfa.harvard.edu, E-mail: heb11@psu.edu, E-mail: schaefer@chara-array.org [US Naval Observatory, 3450 Massachusetts Avenue, NW, Washington, DC 20392-5420 (United States)

    2013-10-01

    Deriving the distribution of binary parameters for a particular class of stars over the full range of orbital separations usually requires the combination of results from many different observing techniques (radial velocities, interferometry, astrometry, photometry, direct imaging), each with selection biases. However, Cepheids—cool, evolved stars of ∼5 M {sub ☉}—are a special case because ultraviolet (UV) spectra will immediately reveal any companion star hotter than early type A, regardless of the orbital separation. We have used International Ultraviolet Explorer UV spectra of a complete sample of all 76 Cepheids brighter than V = 8 to create a list of all 18 Cepheids with companions more massive than 2.0 M {sub ☉}. Orbital periods of many of these binaries are available from radial-velocity studies, or can be estimated for longer-period systems from detected velocity variability. In an imaging survey with the Hubble Space Telescope Wide Field Camera 3, we resolved three of the companions (those of η Aql, S Nor, and V659 Cen), allowing us to make estimates of the periods out to the long-period end of the distribution. Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations, orbital periods, and mass ratios. The distribution of orbital periods shows that the 5 M {sub ☉} binaries have systematically shorter periods than do 1 M {sub ☉} stars. Our data also suggest that the distribution of mass ratios depends on both binary separation and system multiplicity. The distribution of mass ratios as a function of orbital separation, however, does not depend on whether a system is a binary or a triple.

  18. Accuracy of binary black hole waveform models for aligned-spin binaries

    Science.gov (United States)

    Kumar, Prayush; Chu, Tony; Fong, Heather; Pfeiffer, Harald P.; Boyle, Michael; Hemberger, Daniel A.; Kidder, Lawrence E.; Scheel, Mark A.; Szilagyi, Bela

    2016-05-01

    Coalescing binary black holes are among the primary science targets for second generation ground-based gravitational wave detectors. Reliable gravitational waveform models are central to detection of such systems and subsequent parameter estimation. This paper performs a comprehensive analysis of the accuracy of recent waveform models for binary black holes with aligned spins, utilizing a new set of 84 high-accuracy numerical relativity simulations. Our analysis covers comparable mass binaries (mass-ratio 1 ≤q ≤3 ), and samples independently both black hole spins up to a dimensionless spin magnitude of 0.9 for equal-mass binaries and 0.85 for unequal mass binaries. Furthermore, we focus on the high-mass regime (total mass ≳50 M⊙ ). The two most recent waveform models considered (PhenomD and SEOBNRv2) both perform very well for signal detection, losing less than 0.5% of the recoverable signal-to-noise ratio ρ , except that SEOBNRv2's efficiency drops slightly for both black hole spins aligned at large magnitude. For parameter estimation, modeling inaccuracies of the SEOBNRv2 model are found to be smaller than systematic uncertainties for moderately strong GW events up to roughly ρ ≲15 . PhenomD's modeling errors are found to be smaller than SEOBNRv2's, and are generally irrelevant for ρ ≲20 . Both models' accuracy deteriorates with increased mass ratio, and when at least one black hole spin is large and aligned. The SEOBNRv2 model shows a pronounced disagreement with the numerical relativity simulation in the merger phase, for unequal masses and simultaneously both black hole spins very large and aligned. Two older waveform models (PhenomC and SEOBNRv1) are found to be distinctly less accurate than the more recent PhenomD and SEOBNRv2 models. Finally, we quantify the bias expected from all four waveform models during parameter estimation for several recovered binary parameters: chirp mass, mass ratio, and effective spin.

  19. COSMIC probes into compact binary formation and evolution

    Science.gov (United States)

    Breivik, Katelyn

    2018-01-01

    The population of compact binaries in the galaxy represents the final state of all binaries that have lived up to the present epoch. Compact binaries present a unique opportunity to probe binary evolution since many of the interactions binaries experience can be imprinted on the compact binary population. By combining binary evolution simulations with catalogs of observable compact binary systems, we can distill the dominant physical processes that govern binary star evolution, as well as predict the abundance and variety of their end products.The next decades herald a previously unseen opportunity to study compact binaries. Multi-messenger observations from telescopes across all wavelengths and gravitational-wave observatories spanning several decades of frequency will give an unprecedented view into the structure of these systems and the composition of their components. Observations will not always be coincident and in some cases may be separated by several years, providing an avenue for simulations to better constrain binary evolution models in preparation for future observations.I will present the results of three population synthesis studies of compact binary populations carried out with the Compact Object Synthesis and Monte Carlo Investigation Code (COSMIC). I will first show how binary-black-hole formation channels can be understood with LISA observations. I will then show how the population of double white dwarfs observed with LISA and Gaia could provide a detailed view of mass transfer and accretion. Finally, I will show that Gaia could discover thousands black holes in the Milky Way through astrometric observations, yielding view into black-hole astrophysics that is complementary to and independent from both X-ray and gravitational-wave astronomy.

  20. "Binary" and "non-binary" detection tasks: are current performance measures optimal?

    Science.gov (United States)

    Gur, David; Rockette, Howard E; Bandos, Andriy I

    2007-07-01

    We have observed that a very large fraction of responses for several detection tasks during the performance of observer studies are in the extreme ranges of lower than 11% or higher than 89% regardless of the actual presence or absence of the abnormality in question or its subjectively rated "subtleness." This observation raises questions regarding the validity and appropriateness of using multicategory rating scales for such detection tasks. Monte Carlo simulation of binary and multicategory ratings for these tasks demonstrate that the use of the former (binary) often results in a less biased and more precise summary index and hence may lead to a higher statistical power for determining differences between modalities.

  1. THE VERY SHORT PERIOD M DWARF BINARY SDSS J001641-000925

    Energy Technology Data Exchange (ETDEWEB)

    Davenport, James R. A.; Becker, Andrew C.; Hawley, Suzanne L.; Gunning, Heather C.; Munshi, Ferah A.; Albright, Meagan [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States); West, Andrew A. [Astronomy Department, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Bochanski, John J. [Astronomy and Astrophysics Department, Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Holtzman, Jon [Department of Astronomy, New Mexico State University, Box 30001, Las Cruces, NM 88003 (United States); Hilton, Eric J., E-mail: jrad@astro.washington.edu [Department of Geology and Geophysics and Institute for Astronomy, University of Hawaii at Manoa, Honolulu, HI 96822 (United States)

    2013-02-10

    We present follow-up observations and analysis of the recently discovered short period low-mass eclipsing binary, SDSS J001641-000925. With an orbital period of 0.19856 days, this system has one of the shortest known periods for an M dwarf binary system. Medium-resolution spectroscopy and multi-band photometry for the system are presented. Markov Chain Monte Carlo modeling of the light curves and radial velocities yields estimated masses for the stars of M {sub 1} = 0.54 {+-} 0.07 M {sub Sun} and M {sub 2} = 0.34 {+-} 0.04 M {sub Sun }, and radii of R {sub 1} = 0.68 {+-} 0.03 R {sub Sun} and R {sub 2} = 0.58 {+-} 0.03 R {sub Sun }, respectively. This solution places both components above the critical Roche overfill limit, providing strong evidence that SDSS J001641-000925 is the first verified M-dwarf contact binary system. Within the follow-up spectroscopy we find signatures of non-solid body rotation velocities, which we interpret as evidence for mass transfer or loss within the system. In addition, our photometry samples the system over nine years, and we find strong evidence for period decay at the rate of P-dot {approx} 8 s yr{sup -1}. Both of these signatures raise the intriguing possibility that the system is in over-contact, and actively losing angular momentum, likely through mass loss. This places SDSS J001641-000925 as not just the first M-dwarf over-contact binary, but one of the few systems of any spectral type known to be actively undergoing coalescence. Further study of SDSS J001641-000925 is ongoing to verify the nature of the system, which may prove to be a unique astrophysical laboratory.

  2. Radiology's value chain.

    Science.gov (United States)

    Enzmann, Dieter R

    2012-04-01

    A diagnostic radiology value chain is constructed to define its main components, all of which are vulnerable to change, because digitization has caused disaggregation of the chain. Some components afford opportunities to improve productivity, some add value, while some face outsourcing to lower labor cost and to information technology substitutes, raising commoditization risks. Digital image information, because it can be competitive at smaller economies of scale, allows faster, differential rates of technological innovation of components, initiating a centralization-to-decentralization technology trend. Digitization, having triggered disaggregation of radiology's professional service model, may soon usher in an information business model. This means moving from a mind-set of "reading images" to an orientation of creating and organizing information for greater accuracy, faster speed, and lower cost in medical decision making. Information businesses view value chain investments differently than do small professional services. In the former model, producing a better business product will extend image interpretation beyond a radiologist's personal fund of knowledge to encompass expanding external imaging databases. A follow-on expansion with integration of image and molecular information into a report will offer new value in medical decision making. Improved interpretation plus new integration will enrich and diversify radiology's key service products, the report and consultation. A more robust, information-rich report derived from a "systems" and "computational" radiology approach will be facilitated by a transition from a professional service to an information business. Under health care reform, radiology will transition its emphasis from volume to greater value. Radiology's future brightens with the adoption of a philosophy of offering information rather than "reads" for decision making. Staunchly defending the status quo via turf wars is unlikely to constitute a

  3. Musical Markov Chains

    Science.gov (United States)

    Volchenkov, Dima; Dawin, Jean René

    A system for using dice to compose music randomly is known as the musical dice game. The discrete time MIDI models of 804 pieces of classical music written by 29 composers have been encoded into the transition matrices and studied by Markov chains. Contrary to human languages, entropy dominates over redundancy, in the musical dice games based on the compositions of classical music. The maximum complexity is achieved on the blocks consisting of just a few notes (8 notes, for the musical dice games generated over Bach's compositions). First passage times to notes can be used to resolve tonality and feature a composer.

  4. Chains of securitization

    Directory of Open Access Journals (Sweden)

    Marieke de Goede

    2017-12-01

    Full Text Available Securitization has a dual rationality that twins a financial sense to one of modern statecraft and national security. This forum contribution advocates a focus on material practices as a means of further exploring the entanglement of finance and security. In particular, it advances a notion of ‘chains of securitization’, arguing that such a concept provides researchers with a concrete way to analyze how ‘financial’ objects, such as derivatives, are assembled to generate (insecurities, as well as how ‘security’ objects, such as suspicious transactions, are assembled across public/private domains.

  5. Detox fashion supply chain

    CERN Document Server

    2017-01-01

    This first volume on detox fashion discusses various interesting topics including a Toxic-Free Supply Chain for Textiles and Clothing; Environmental Issues in Textiles; Global Regulations, Restrictions & Research; Making the Change: Consumer Adoption of Sustainable Fashion; and Strategies for Detoxing Your Wardrobe. It provides an overview of the chemical-related issues confronting the fashion sector, summarizes global regulations, and discusses how to make the change by changing consumers’ attitude towards adopting sustainable fashion, as well as the best strategies for detoxing our wardrobes.

  6. 6d string chains

    Science.gov (United States)

    Gadde, Abhijit; Haghighat, Babak; Kim, Joonho; Kim, Seok; Lockhart, Guglielmo; Vafa, Cumrun

    2018-02-01

    We consider bound states of strings which arise in 6d (1,0) SCFTs that are realized in F-theory in terms of linear chains of spheres with negative self-intersections 1,2, and 4. These include the strings associated to N small E 8 instantons, as well as the ones associated to M5 branes probing A and D type singularities in M-theory or D5 branes probing ADE singularities in Type IIB string theory. We find that these bound states of strings admit (0,4) supersymmetric quiver descriptions and show how one can compute their elliptic genera.

  7. Shared Value Chain Design

    DEFF Research Database (Denmark)

    Bals, Lydia; Tate, Wendy L.

    In Sustainable Supply Chain Management (SSCM) research still the classic economic perspective is the dominating perspective, although the triple bottom line (including economic, social and ecological) is well accepted. The theoretical foundation for the paper is Stakeholder Theory. Case studies...... of social businesses funded by the Germany-based company Yunus Social Business (YSB; http://www.yunussb.com) are presented, extracting the basic model types and how they involve and affect the stakeholders. These models reveal innovative approaches to enable positive economic, social and ecological impacts...

  8. Small angle neutron scattering study on short and long chain phosphatidylcholine mixture in trehalose solution

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroshi [Department of Physics, Gunma University, Maebashi, Gunma (Japan)

    2001-03-01

    Trehalose protects cells and proteins against various stresses due to low temperatures or dryness. In order to clarify the molecular mechanism of cryoprotective function of trehalose, we have studied the interaction between trehalose and phosphatidylcholine (PC) which is a main lipid component of cell membranes. In this study, the structural change of a binary PC mixture by the presence of trehalose was investigated by means of small angle neutron scattering. The PC binary mixture studied contains dihexanoyl-PC (diC{sub 6}PC) and dihexadecy-PC (DHPC). The former has short hydrocarbon chains and the latter has long hydrocarbon chains. The scattering profiles from the DHPC/diC{sub 6}PC mixture were changed, depending on trehalose concentrations. This change can be interpreted as suggesting that the presence of trehalose reduces the interfacial area between water and PCs. (author)

  9. Eclipsing binaries observed with the WIRE satellite I. Discovery and photometric analysis of the new bright A0 IV eclipsing binary psi centauri

    DEFF Research Database (Denmark)

    Bruntt, Hans; Southworth, J.; Penny, A. J.

    2006-01-01

    Stars: fundamental parameters, binaries: close, eclipsing, techniques: photometric Udgivelsesdato: Sep.......Stars: fundamental parameters, binaries: close, eclipsing, techniques: photometric Udgivelsesdato: Sep....

  10. Concurrent Product & Supply Chain Creation

    DEFF Research Database (Denmark)

    Gubi, Ebbe

    it is a structural premise. We also know that logistics costs generally are estimated 15-20% of total product costs. Accordingly, it stands to reason that a company can reduce costs, and thereby gain an edge on its competitors, by tailoring the supply chain in question to an individual product or product family; i.......e. by creating Focused Supply Chains. At the same time, customer satisfaction can be increased. As a second means to achieving a better fit between product and supply chain, the firm can deploy Design for Logistics, the discipline of considering the supply chain during product creation. The thesis sets out...... and supply chains should be created concurrently and integrated. The concept of Concurrent Product & Supply Chain Creation is introduced, and the two main components Focused Supply Chains and Design For Logistics are explained and exemplified by use of Bang & Olufsen....

  11. Self-lacing atom chains

    International Nuclear Information System (INIS)

    Zandvliet, Harold J W; Van Houselt, Arie; Poelsema, Bene

    2009-01-01

    The structural and electronic properties of self-lacing atomic chains on Pt modified Ge(001) surfaces have been studied using low-temperature scanning tunnelling microscopy and spectroscopy. The self-lacing chains have a cross section of only one atom, are perfectly straight, thousands of atoms long and virtually defect free. The atomic chains are composed of dimers that have their bonds aligned in a direction parallel to the chain direction. At low temperatures the atomic chains undergo a Peierls transition: the periodicity of the chains doubles from a 2 x to a 4 x periodicity and an energy gap opens up. Furthermore, at low temperatures (T<80 K) novel quasi-one-dimensional electronic states are found. These quasi-one-dimensional electronic states originate from an electronic state of the underlying terrace that is confined between the atomic chains.

  12. Binary pairs of supermassive black holes - Formation in merging galaxies

    Energy Technology Data Exchange (ETDEWEB)

    Valtaoja, L.; Valtonen, M.J.; Byrd, G.G. (Turku Univ. (Finland); Alabama Univ., Tuscaloosa (USA))

    1989-08-01

    A process in which supermassive binary blackholes are formed in nuclei of supergiant galaxies due to galaxy mergers is examined. There is growing evidence that mergers of galaxies are common and that supermassive black holes in center of galaxies are also common. Consequently, it is expected that binary black holes should arise in connection with galaxy mergers. The merger process in a galaxy modeled after M87 is considered. The capture probability of a companion is derived as a function of its mass. Assuming a correlation between the galaxy mass and the blackholes mass, the expected mass ratio in binary black holes is calculated. The binary black holes formed in this process are long lived, surviving longer than the Hubble time unless they are perturbed by black holes from successive mergers. The properties of these binaries agree with Gaskell's (1988) observational work on quasars and its interpretation in terms of binary black holes. 39 refs.

  13. Formation and Evolution of Binary Asteroids

    Science.gov (United States)

    Walsh, K. J.; Jacobson, S. A.

    Satellites of asteroids have been discovered in nearly every known small-body population, and a remarkable aspect of the known satellites is the diversity of their properties. They tell a story of vast differences in formation and evolution mechanisms that act as a function of size, distance from the Sun, and the properties of their nebular environment at the beginning of solar system history and their dynamical environment over the next 4.5 G.y. The mere existence of these systems provides a laboratory to study numerous types of physical processes acting on asteroids, and their dynamics provide a valuable probe of their physical properties otherwise possible only with spacecraft. Advances in understanding the formation and evolution of binary systems have been assisted by (1) the growing catalog of known systems, increasing from 33 to ~250 between the Merline et al. (2002) chapter in Asteroids III and now; (2) the detailed study and long-term monitoring of individual systems such as 1999 KW4 and 1996 FG3, (3) the discovery of new binary system morphologies and triple systems, (4) and the discovery of unbound systems that appear to be end-states of binary dynamical evolutionary paths. Specifically for small bodies (diameter smaller than 10 km), these observations and discoveries have motivated theoretical work finding that thermal forces can efficiently drive the rotational disruption of small asteroids. Long-term monitoring has allowed studies to constrain the system's dynamical evolution by the combination of tides, thermal forces, and rigid-body physics. The outliers and split pairs have pushed the theoretical work to explore a wide range of evolutionary end-states.

  14. The Fate of Neutron Star Binary Mergers

    Energy Technology Data Exchange (ETDEWEB)

    Piro, Anthony L. [The Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Giacomazzo, Bruno [Physics Department, University of Trento, via Sommarive 14, I-38123 Trento (Italy); Perna, Rosalba, E-mail: piro@carnegiescience.edu [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States)

    2017-08-01

    Following merger, a neutron star (NS) binary can produce roughly one of three different outcomes: (1) a stable NS, (2) a black hole (BH), or (3) a supramassive, rotationally supported NS, which then collapses to a BH following angular momentum losses. Which of these fates occur and in what proportion has important implications for the electromagnetic transient associated with the mergers and the expected gravitational wave (GW) signatures, which in turn depend on the high density equation of state (EOS). Here we combine relativistic calculations of NS masses using realistic EOSs with Monte Carlo population synthesis based on the mass distribution of NS binaries in our Galaxy to predict the distribution of fates expected. For many EOSs, a significant fraction of the remnants are NSs or supramassive NSs. This lends support to scenarios in which a quickly spinning, highly magnetized NS may be powering an electromagnetic transient. This also indicates that it will be important for future GW observatories to focus on high frequencies to study the post-merger GW emission. Even in cases where individual GW events are too low in signal to noise to study the post merger signature in detail, the statistics of how many mergers produce NSs versus BHs can be compared with our work to constrain the EOS. To match short gamma-ray-burst (SGRB) X-ray afterglow statistics, we find that the stiffest EOSs are ruled out. Furthermore, many popular EOSs require a significant fraction of ∼60%–70% of SGRBs to be from NS–BH mergers rather than just binary NSs.

  15. Electronic band structures of binary skutterudites

    International Nuclear Information System (INIS)

    Khan, Banaras; Aliabad, H.A. Rahnamaye; Saifullah; Jalali-Asadabadi, S.; Khan, Imad; Ahmad, Iftikhar

    2015-01-01

    The electronic properties of complex binary skutterudites, MX 3 (M = Co, Rh, Ir; X = P, As, Sb) are explored, using various density functional theory (DFT) based theoretical approaches including Green's Function (GW) as well as regular and non-regular Tran Blaha modified Becke Jhonson (TB-mBJ) methods. The wide range of calculated bandgap values for each compound of this skutterudites family confirm that they are theoretically as challenging as their experimental studies. The computationally expensive GW method, which is generally assume to be efficient in the reproduction of the experimental bandgaps, is also not very successful in the calculation of bandgaps. In this article, the issue of the theoretical bandgaps of these compounds is resolved by reproducing the accurate experimental bandgaps, using the recently developed non-regular TB-mBJ approach, based on DFT. The effectiveness of this technique is due to the fact that a large volume of the binary skutterudite crystal is empty and hence quite large proportion of electrons lie outside of the atomic spheres, where unlike LDA and GGA which are poor in the treatment of these electrons, this technique properly treats these electrons and hence reproduces the clear electronic picture of these compounds. - Highlights: • Theoretical and experimental electronic band structures of binary skutterudites are reviewed. • The literature reveals that none of the existing theoretical results are consistent with the experiments. • GW, regular and non-regular TB-mBJ methods are used to reproduce the correct results. • The GW and regular TB-mBJ results are better than the available results in literature. • However, non-regular TB-mBJ reproduces the correct experimental band structures

  16. Green binary and phase shifting mask

    Science.gov (United States)

    Shy, S. L.; Hong, Chao-Sin; Wu, Cheng-San; Chen, S. J.; Wu, Hung-Yu; Ting, Yung-Chiang

    2009-12-01

    SixNy/Ni thin film green mask blanks were developed , and are now going to be used to replace general chromium film used for binary mask as well as to replace molydium silicide embedded material for AttPSM for I-line (365 nm), KrF (248 nm), ArF (193 nm) and Contact/Proximity lithography. A bilayer structure of a 1 nm thick opaque, conductive nickel layer and a SixNy layer is proposed for binary and phase-shifting mask. With the good controlling of plasma CVD of SixNy under silane (50 sccm), ammonia (5 sccm) and nitrogen (100 sccm), the pressure is 250 mTorr. and RF frequency 13.56 MHz and power 50 W. SixNy has enough deposition latitude to meet the requirements as an embedded layer for required phase shift 180 degree, and the T% in 193, 248 and 365 nm can be adjusted between 2% to 20% for binary and phase shifting mask usage. Ni can be deposited by E-gun, its sheet resistance Rs is less than 1.435 kΩ/square. Jeol e-beam system and I-line stepper are used to evaluate these thin film green mask blanks, feature size less than 200 nm half pitch pattern and 0.558 μm pitch contact hole can be printed. Transmission spectrums of various thickness of SixNy film are inspected by using UV spectrometer and FTIR. Optical constants of the SixNy film are measured by n & k meter and surface roughness is inspected by using Atomic Force Microscope (AFM).

  17. Binary Classification Method of Social Network Users

    Directory of Open Access Journals (Sweden)

    I. A. Poryadin

    2017-01-01

    Full Text Available The subject of research is a binary classification method of social network users based on the data analysis they have placed. Relevance of the task to gain information about a person by examining the content of his/her pages in social networks is exemplified. The most common approach to its solution is a visual browsing. The order of the regional authority in our country illustrates that its using in school education is needed. The article shows restrictions on the visual browsing of pupil’s pages in social networks as a tool for the teacher and the school psychologist and justifies that a process of social network users’ data analysis should be automated. Explores publications, which describe such data acquisition, processing, and analysis methods and considers their advantages and disadvantages. The article also gives arguments to support a proposal to study the classification method of social network users. One such method is credit scoring, which is used in banks and credit institutions to assess the solvency of clients. Based on the high efficiency of the method there is a proposal for significant expansion of its using in other areas of society. The possibility to use logistic regression as the mathematical apparatus of the proposed method of binary classification has been justified. Such an approach enables taking into account the different types of data extracted from social networks. Among them: the personal user data, information about hobbies, friends, graphic and text information, behaviour characteristics. The article describes a number of existing methods of data transformation that can be applied to solve the problem. An experiment of binary gender-based classification of social network users is described. A logistic model obtained for this example includes multiple logical variables obtained by transforming the user surnames. This experiment confirms the feasibility of the proposed method. Further work is to define a system

  18. Electronic band structures of binary skutterudites

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Banaras [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan); Aliabad, H.A. Rahnamaye [Department of Physics, Hakim Sabzevari University, Sabzevar (Iran, Islamic Republic of); Saifullah [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan); Jalali-Asadabadi, S. [Department of Physics, Faculty of Science, University of Isfahan (UI), 81744 Isfahan (Iran, Islamic Republic of); Khan, Imad [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan); Ahmad, Iftikhar, E-mail: ahma5532@gmail.com [Center for Computational Materials Science, University of Malakand, Chakdara (Pakistan); Department of Physics, University of Malakand, Chakdara (Pakistan)

    2015-10-25

    The electronic properties of complex binary skutterudites, MX{sub 3} (M = Co, Rh, Ir; X = P, As, Sb) are explored, using various density functional theory (DFT) based theoretical approaches including Green's Function (GW) as well as regular and non-regular Tran Blaha modified Becke Jhonson (TB-mBJ) methods. The wide range of calculated bandgap values for each compound of this skutterudites family confirm that they are theoretically as challenging as their experimental studies. The computationally expensive GW method, which is generally assume to be efficient in the reproduction of the experimental bandgaps, is also not very successful in the calculation of bandgaps. In this article, the issue of the theoretical bandgaps of these compounds is resolved by reproducing the accurate experimental bandgaps, using the recently developed non-regular TB-mBJ approach, based on DFT. The effectiveness of this technique is due to the fact that a large volume of the binary skutterudite crystal is empty and hence quite large proportion of electrons lie outside of the atomic spheres, where unlike LDA and GGA which are poor in the treatment of these electrons, this technique properly treats these electrons and hence reproduces the clear electronic picture of these compounds. - Highlights: • Theoretical and experimental electronic band structures of binary skutterudites are reviewed. • The literature reveals that none of the existing theoretical results are consistent with the experiments. • GW, regular and non-regular TB-mBJ methods are used to reproduce the correct results. • The GW and regular TB-mBJ results are better than the available results in literature. • However, non-regular TB-mBJ reproduces the correct experimental band structures.

  19. Diffusive flux of energy in binary mixtures

    International Nuclear Information System (INIS)

    Sampaio, R.S.

    1976-04-01

    The diffusive flux of energy j tilde is studied through the reduced diffusive flux of energy K tilde, which obeys equations of the form: sim(delta K tilde/delta grad rho sub(α))= sim(delta K tilde/delta grad theta)=0. By a representation theorem, herein proved, is obtained a general representation for K tilde which is simplified, for the case of binary mixtures, using the principle of objectivity. Some consequences of this representation are discussed such as the symmetry of the partial stresses T 1 tilde and T 2 tilde and the difference between the normal stresses [pt

  20. Energy transfer in contact binary systems

    International Nuclear Information System (INIS)

    Robertson, J.A.

    1980-01-01

    A simple model for the transfer of energy by steady circulation within the envelope of a contact binary system is presented. The model describes the fully compressible, two-dimensional flow of a perfect gas within a rectangular region in a uniform gravitational field. The region is heated non-uniformly from below. Coriolis forces are neglected but the interaction of the circulation with convection is discussed briefly. Numerical solutions of the linearized equations of the problem are discussed in detail, and the results of some non-linear calculations are also presented. The influence of alternative boundary conditions is examined. (author)

  1. Burnup characteristics of binary breeder reactors

    International Nuclear Information System (INIS)

    Dias, A.F.; Nascimento, J.A. do; Ishiguro, Y.

    1983-01-01

    Burnup calculations of a binary breeder reactor have been done for two cases of fueling. In one case the U 233 /TH fueled inner core and the Pu/U-fueled outer core have the same number of fuel assemblies. In the other case two outermost rings in the inner core are Pu/U-fueled. The second case is considered for an initial phase of thorim cycle introduction when the supply of U 233 could be limited. Results show an efficient breeding on the thorium cycle in both cases. (Author) [pt

  2. Disordered multihyperuniformity derived from binary plasmas

    Science.gov (United States)

    Lomba, Enrique; Weis, Jean-Jacques; Torquato, Salvatore

    2018-01-01

    Disordered multihyperuniform many-particle systems are exotic amorphous states that allow exquisite color sensing capabilities due to their anomalous suppression of density fluctuations for distinct subsets of particles, as recently evidenced in photoreceptor mosaics in avian retina. Motivated by this biological finding, we present a statistical-mechanical model that rigorously achieves disordered multihyperuniform many-body systems by tuning interactions in binary mixtures of nonadditive hard-disk plasmas. We demonstrate that multihyperuniformity competes with phase separation and stabilizes a clustered phase. Our work provides a systematic means to generate disordered multihyperuniform solids, and hence lays the groundwork to explore their potentially unique photonic, phononic, electronic, and transport properties.

  3. NONLINEAR TIDES IN CLOSE BINARY SYSTEMS

    International Nuclear Information System (INIS)

    Weinberg, Nevin N.; Arras, Phil; Quataert, Eliot; Burkart, Josh

    2012-01-01

    We study the excitation and damping of tides in close binary systems, accounting for the leading-order nonlinear corrections to linear tidal theory. These nonlinear corrections include two distinct physical effects: three-mode nonlinear interactions, i.e., the redistribution of energy among stellar modes of oscillation, and nonlinear excitation of stellar normal modes by the time-varying gravitational potential of the companion. This paper, the first in a series, presents the formalism for studying nonlinear tides and studies the nonlinear stability of the linear tidal flow. Although the formalism we present is applicable to binaries containing stars, planets, and/or compact objects, we focus on non-rotating solar-type stars with stellar or planetary companions. Our primary results include the following: (1) The linear tidal solution almost universally used in studies of binary evolution is unstable over much of the parameter space in which it is employed. More specifically, resonantly excited internal gravity waves in solar-type stars are nonlinearly unstable to parametric resonance for companion masses M' ∼> 10-100 M ⊕ at orbital periods P ≈ 1-10 days. The nearly static 'equilibrium' tidal distortion is, however, stable to parametric resonance except for solar binaries with P ∼ 3 [P/10 days] for a solar-type star) and drives them as a single coherent unit with growth rates that are a factor of ≈N faster than the standard three-wave parametric instability. These are local instabilities viewed through the lens of global analysis; the coherent global growth rate follows local rates in the regions where the shear is strongest. In solar-type stars, the dynamical tide is unstable to this collective version of the parametric instability for even sub-Jupiter companion masses with P ∼< a month. (4) Independent of the parametric instability, the dynamical and equilibrium tides excite a wide range of stellar p-modes and g-modes by nonlinear inhomogeneous forcing

  4. Dynamic Binary Modification Tools, Techniques and Applications

    CERN Document Server

    Hazelwood, Kim

    2011-01-01

    Dynamic binary modification tools form a software layer between a running application and the underlying operating system, providing the powerful opportunity to inspect and potentially modify every user-level guest application instruction that executes. Toolkits built upon this technology have enabled computer architects to build powerful simulators and emulators for design-space exploration, compiler writers to analyze and debug the code generated by their compilers, software developers to fully explore the features, bottlenecks, and performance of their software, and even end-users to extend

  5. X-ray binaries, part 1

    International Nuclear Information System (INIS)

    Hammerschlag-Hensberge, G.C.M.J.

    1977-01-01

    Optical observations of X-ray binaries and their interpretation are described. A number of early-type stars which are identified as companions of X-ray sources are photometrically and spectroscopically observed. The spectra were obtained with the coude spectrograph attached to the 1.5 m telescope of the European Southern Observatory, La Silla, Chile. Registrations of the spectra were made with the Faul-Coradi microphotometer of the Observatory at Utrecht. To study radial velocity variations, the positions of the spectral lines were measured with the Grant comparator of the University of Groningen

  6. Is the Coma cluster binary dominated?

    International Nuclear Information System (INIS)

    The, L.S.; White, S.D.M.

    1990-01-01

    It is investigated whether the model of an expanding cluster dominated by a massive binary galaxy, first suggested by Valtonen and Byrd (1979), is consistent with optical data on the surface density and velocity dispersion of the Coma cluster. The evolution of this model is simulated for a wide variety of initial conditions. It is found that galaxy counts in the model can be made to agree with observation, but that the observed velocity dispersion profile cannot be reproduced. A number of other arguments suggest that the central galaxies in Coma cannot be as massive as required by the model. This model is not a viable representation of the Coma cluster. 25 refs

  7. A unified kinetic approach to binary nucleation

    Energy Technology Data Exchange (ETDEWEB)

    Kevrekidis, P.G. [Department of Physics, Rutgers University, 136 Frelinghuysen Road]|[E.O.H.S.I., Rutgers University]|[UMDNJ, 170 Frelinghuysen Road, Piscataway, New Jersey 08854-8019 (United States); Lazaridis, M. [Norwegian Institute for Air Research (NILU), Instittutvein 18, P. O. Box 100, N-2007 Kjeller (Norway); Drossinos, Y. [European Commission, Joint Research Centre, I-21020 Ispra (Vatican City State, Holy See) (Italy); Georgopoulos, P.G. [E.O.H.S.I., Rutgers University]|[UMDNJ, 170 Frelinghuysen Road, Piscataway, New Jersey 08854 (United States)

    1999-11-01

    Two different methods to calculate the steady-state nucleation rate in heteromolecular systems proposed by Stauffer (1976) and Langer (1969) are analyzed. Their mathematical equivalence is explicitly demonstrated, thereby obtaining a generic expression for the rate of binary nucleation. Its numerical evaluation does not entail rotation of the coordinate system at the saddle point, but it only requires data in the natural coordinate system of number fluctuations, namely molecular impingement rates, the droplet free energy and its second order derivatives at the saddle point, and the total density of condensible vapors. {copyright} {ital 1999 American Institute of Physics.}

  8. in Binary Liquid Mixtures of Ethyl benzoate

    Directory of Open Access Journals (Sweden)

    Shaik Babu

    2012-01-01

    Full Text Available Ultrasonic velocity is measured at 2MHz frequency in the binary mixtures of Ethyl Benzoate with 1-Propanol, 1-Butanol, 1-Pentanol and theoretical values of ultrasonic velocity have been evaluated at 303K using Nomoto's relation, Impedance relation, Ideal mixture relation, Junjie's method and free length theory. Theoretical values are compared with the experimental values and the validity of the theories is checked by applying the chi-square test for goodness of fit and by calculating the average percentage error (APE. A good agreement has been found between experimental and Nomoto’s ultrasonic velocity.

  9. Clonal sets of a binary relation

    Science.gov (United States)

    Zedam, Lemnaouar; Pérez-Fernández, Raúl; Bouremel, Hassane; De Baets, Bernard

    2018-05-01

    In a recent paper, we have introduced the notion of clone relation of a given binary relation. Intuitively, two elements are said to be "clones" if they are related in the same way w.r.t. every other element. In this paper, we generalize this notion from pairs of elements to sets of elements of any cardinality, resulting in the introduction of clonal sets. We investigate the most important properties of clonal sets, paying particular attention to the introduction of the clonal closure operator, to the analysis of the (lattice) structure of the set of clonal sets and to a distance metric expressing how close two elements are to being clones.

  10. Pycnonuclear reaction rates for binary ionic mixtures

    Science.gov (United States)

    Ichimaru, S.; Ogata, S.; Van Horn, H. M.

    1992-01-01

    Through a combination of compositional scaling arguments and examinations of Monte Carlo simulation results for the interparticle separations in binary-ionic mixture (BIM) solids, we have derived parameterized expressions for the BIM pycnonuclear rates as generalizations of those in one-component solids obtained previously by Salpeter and Van Horn and by Ogata et al. We have thereby discovered a catalyzing effect of the heavier elements, which enhances the rates of reactions among the lighter elements when the charge ratio exceeds a critical value of approximately 2.3.

  11. HD 161306: a radiatively interacting Be binary?

    Czech Academy of Sciences Publication Activity Database

    Koubský, Pavel; Kotková, Lenka; Kraus, Michaela; Yang, S.; Šlechta, Miroslav; Harmanec, P.; Wolf, M.; Votruba, Viktor; Kubát, Jiří; Kubátová, Brankica; Niemczura, E.; Škoda, Petr

    2014-01-01

    Roč. 567, July (2014), A57/1-A57/4 ISSN 0004-6361 R&D Projects: GA ČR(CZ) GA14-21373S; GA MŠk LG14026 Grant - others:ESA(XE) ESA- PECS project no. 98058; GA ČR(CZ) GAP209/10/0715 Program:GA Institutional support: RVO:67985815 Keywords : binaries: spectroscopic * stars: emission-line * Be: stars Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.378, year: 2014

  12. Automatic target detection using binary template matching

    Science.gov (United States)

    Jun, Dong-San; Sun, Sun-Gu; Park, HyunWook

    2005-03-01

    This paper presents a new automatic target detection (ATD) algorithm to detect targets such as battle tanks and armored personal carriers in ground-to-ground scenarios. Whereas most ATD algorithms were developed for forward-looking infrared (FLIR) images, we have developed an ATD algorithm for charge-coupled device (CCD) images, which have superior quality to FLIR images in daylight. The proposed algorithm uses fast binary template matching with an adaptive binarization, which is robust to various light conditions in CCD images and saves computation time. Experimental results show that the proposed method has good detection performance.

  13. Thirty New Low-mass Spectroscopic Binaries

    Science.gov (United States)

    Shkolnik, Evgenya L.; Hebb, Leslie; Liu, Michael C.; Reid, I. Neill; Collier Cameron, Andrew

    2010-06-01

    As part of our search for young M dwarfs within 25 pc, we acquired high-resolution spectra of 185 low-mass stars compiled by the NStars project that have strong X-ray emission. By cross-correlating these spectra with radial velocity standard stars, we are sensitive to finding multi-lined spectroscopic binaries. We find a low-mass spectroscopic binary fraction of 16% consisting of 27 SB2s, 2 SB3s, and 1 SB4, increasing the number of known low-mass spectroscopic binaries (SBs) by 50% and proving that strong X-ray emission is an extremely efficient way to find M-dwarf SBs. WASP photometry of 23 of these systems revealed two low-mass eclipsing binaries (EBs), bringing the count of known M-dwarf EBs to 15. BD-22 5866, the ESB4, was fully described in 2008 by Shkolnik et al. and CCDM J04404+3127 B consists of two mid-M stars orbiting each other every 2.048 days. WASP also provided rotation periods for 12 systems, and in the cases where the synchronization time scales are short, we used P rot to determine the true orbital parameters. For those with no P rot, we used differential radial velocities to set upper limits on orbital periods and semimajor axes. More than half of our sample has near-equal-mass components (q > 0.8). This is expected since our sample is biased toward tight orbits where saturated X-ray emission is due to tidal spin-up rather than stellar youth. Increasing the samples of M-dwarf SBs and EBs is extremely valuable in setting constraints on current theories of stellar multiplicity and evolution scenarios for low-mass multiple systems. Based on observations collected at the W. M. Keck Observatory, the Canada-France-Hawaii Telescope and by the WASP Consortium. The Keck Observatory is operated as a scientific partnership between the California Institute of Technology, the University of California, and NASA, and was made possible by the generous financial support of the W. M. Keck Foundation. The CFHT is operated by the National Research Council of Canada

  14. Physical Structure of Four Symbiotic Binaries

    Science.gov (United States)

    Kenyon, Scott J. (Principal Investigator)

    1997-01-01

    Disk accretion powers many astronomical objects, including pre-main sequence stars, interacting binary systems, and active galactic nuclei. Unfortunately, models developed to explain the behavior of disks and their surroundings - boundary layers, jets, and winds - lack much predictive power, because the physical mechanism driving disk evolution - the viscosity - is not understood. Observations of many types of accreting systems are needed to constrain the basic physics of disks and provide input for improved models. Symbiotic stars are an attractive laboratory for studying physical phenomena associated with disk accretion. These long period binaries (P(sub orb) approx. 2-3 yr) contain an evolved red giant star, a hot companion, and an ionized nebula. The secondary star usually is a white dwarf accreting material from the wind of its red giant companion. A good example of this type of symbiotic is BF Cygni: our analysis shows that disk accretion powers the nuclear burning shell of the hot white dwarf and also manages to eject material perpendicular to the orbital plane (Mikolajewska, Kenyon, and Mikolajewski 1989). The hot components in other symbiotic binaries appear powered by tidal overflow from a very evolved red giant companion. We recently completed a study of CI Cygni and demonstrated that the accreting secondary is a solar-type main sequence star, rather than a white dwarf (Kenyon et aL 1991). This project continued our study of symbiotic binary systems. Our general plan was to combine archival ultraviolet and optical spectrophotometry with high quality optical radial velocity observations to determine the variation of line and continuum sources as functions of orbital phase. We were very successful in generating orbital solutions and phasing UV+optical spectra for five systems: AG Dra, V443 Her, RW Hya, AG Peg, and AX Per. Summaries of our main results for these systems appear below. A second goal of our project was to consider general models for the

  15. Abnormal scattering of polymer in binary solvent

    Science.gov (United States)

    To, Kiwing; Kim, Chul A.; Choi, Hyoung J.

    The behavior of a high molecular weight polymer (polyethylene-oxide, PEO) in a binary liquid mixture (nitroethane/3-methyl-pentane, NE/MP) is studied at the one-phase temperature of NE/MP by static and dynamic light scattering methods. We found that the scattering intensity increased abruptly near the critical composition of NE/MP although the sample was very far from the critical temperature of NE/MP. Explanations in terms of critical opalescence and wetting layer inversion are discussed.

  16. UBV photometry of binary galaxies. The cataloque

    International Nuclear Information System (INIS)

    Demin, V.V.; Dibaj, Eh.A.; Tomov, A.N.

    1981-01-01

    The catalogue of photometric UDV-magnitudes and colours of 105 binary galaxies is presented. The integral B magnitudes and (B-V) and (U-B) colours are reduced to the standard UBV system. The observations are corrected for the atmospheric extinction, galactic absorption, red shift, internal absorption and galaxy declination reddening. The data are reduced to the standard D(0) diameter. Fully corrected observations are compared with the data of the RC2 catalogue. On the basis of the obtained catalogue for 210 individual galaxies, the correlation between the colours of the components is discussed. The strong correlation (Holmberg effect) is shown to exist for EE and SS systems [ru

  17. Computer Vision Using Local Binary Patterns

    CERN Document Server

    Pietikainen, Matti; Zhao, Guoying; Ahonen, Timo

    2011-01-01

    The recent emergence of Local Binary Patterns (LBP) has led to significant progress in applying texture methods to various computer vision problems and applications. The focus of this research has broadened from 2D textures to 3D textures and spatiotemporal (dynamic) textures. Also, where texture was once utilized for applications such as remote sensing, industrial inspection and biomedical image analysis, the introduction of LBP-based approaches have provided outstanding results in problems relating to face and activity analysis, with future scope for face and facial expression recognition, b

  18. Astronomical Plate Archives and Binary Blazars Studies

    Czech Academy of Sciences Publication Activity Database

    Hudec, René

    2011-01-01

    Roč. 32, 1-2 (2011), s. 91-95 ISSN 0250-6335. [Conference on Multiwavelength Variability of Blazars. Guangzhou, 22,09,2010-24,09,2010] R&D Projects: GA ČR GA205/08/1207 Grant - others:GA ČR(CZ) GA102/09/0997; MŠMT(CZ) ME09027 Institutional research plan: CEZ:AV0Z10030501 Keywords : astronomical plates * plate archives archives * binary blazars Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 0.400, year: 2011

  19. A chain of microphones

    International Nuclear Information System (INIS)

    1994-07-01

    In order to discover a more accurate and selective measuring method for the identification of individual flow-noise pollution sources on wind turbines blades, measuring equipment based on a chain of microphones was developed. The principle underlying the design of this equipment is that signals from a number of microphones can be interpreted. Thus the microphones can register noise from sections of the rotary blade and unwished-for noise is eliminated. The gating technique ensures that noises from individual blades can be separated and that clarity is improved. In addition to this, noise can be determined close to the source. The chain consists of 8 microphones placed in a row at adjustable distances. Measurements are registered on tapes as are the trigger signals for the blade passage. The computer processes the measurement results and unnecessary noise is depressed. The listening angles can also be changed electronically so that the doppler effect can be corrected. Results confirmed that the equipment operated satisfactorily and could also be used in relation to noise pollution in power plants as it is especially effective in depressing excess, and cutting out outside, noise and registers accurately individual sources of noise helped by its ability to ''listen '' at varying angles to the source. (AB)

  20. Improvement of Binary Analysis Components in Automated Malware Analysis Framework

    Science.gov (United States)

    2017-02-21

    AFRL-AFOSR-JP-TR-2017-0018 Improvement of Binary Analysis Components in Automated Malware Analysis Framework Keiji Takeda KEIO UNIVERSITY Final...TYPE Final 3. DATES COVERED (From - To) 26 May 2015 to 25 Nov 2016 4. TITLE AND SUBTITLE Improvement of Binary Analysis Components in Automated Malware ...analyze malicious software ( malware ) with minimum human interaction. The system autonomously analyze malware samples by analyzing malware binary program

  1. WIYN Open Cluster Study: Tidal Interactions in Solar type Binaries

    OpenAIRE

    Meibom, S.; Mathieu, R. D.

    2003-01-01

    We present an ongoing study on tidal interactions in late-type close binary stars. New results on tidal circularization are combined with existing data to test and constrain theoretical predictions of tidal circularization in the pre-main-sequence (PMS) phase and throughout the main-sequence phase of stellar evolution. Current data suggest that tidal circularization during the PMS phase sets the tidal cutoff period for binary populations younger than ~1 Gyr. Binary populations older than ~1 G...

  2. The Discovery of the Most Accelerated Binary Pulsar

    OpenAIRE

    Cameron, A. D.; Champion, D. J.; Kramer, M.; Bailes, M.; Barr, E. D.; Bassa, C. G.; Bhandari, S.; Bhat, N. D. R.; Burgay, M.; Burke-Spolaor, S.; Eatough, R. P.; Flynn, C. M. L.; Freire, P. C. C.; Jameson, A.; Johnston, S.

    2018-01-01

    Pulsars in relativistic binary systems have emerged as fantastic natural laboratories for testing theories of gravity, the most prominent example being the double pulsar, PSR J0737$-$3039. The HTRU-South Low Latitude pulsar survey represents one of the most sensitive blind pulsar surveys taken of the southern Galactic plane to date, and its primary aim has been the discovery of new relativistic binary pulsars. Here we present our binary pulsar searching strategy and report on the survey's fla...

  3. Viscosity and surface tension of binary systems of N,N-dimethylformamide with alkan-1-ols at different temperatures

    International Nuclear Information System (INIS)

    Mohammad, Abubaker A.; Alkhaldi, Khaled H.A.E.; AlTuwaim, Mohammad S.; Al-Jimaz, Adel S.

    2013-01-01

    Highlights: ► Physical properties of binary mixtures of DMF+1-pentanol, 1-hexanol, or 1-heptanol. ► Viscosity and surface tension were measured. ►Δη, Δσ σ and G ∗E were calculated using the experimental data. ► H σ and S σ were determined using the surface tension data. ► Semi-empirical relations were used to estimate the viscosity of liquid mixtures. - Abstract: Viscosity η and surface tension σ were measured for binary mixtures of N,N-dimethylformamide DMF with pentan-1-ol, hexan-1-ol, and heptan-1-ol at T = (298.15, 303.15, 308.15, and 313.15) K and atmospheric pressure over the entire mole fraction range. Deviations in viscosity Δη and surface tension Δσ were calculated using experimental results. Moreover, the values of the excess Gibbs free energy of activation G ∗E , surface enthalpy H σ and surface entropy S σ of these mixtures were determined. Viscosity measurements of the binary systems were correlated with Grunberg and Nissan, the three-body and four-body McAllister expressions. Viscosity deviation, surface tension deviation and excess Gibbs energy of activation functions were fitted to the method of Redlich–Kister (R–K) polynomial to estimate the coefficients and standard deviations. The effects of chain length of alkan-1-ols and temperature on the thermodynamic properties of binary systems were studied.

  4. A novel hybrid method of beta-turn identification in protein using binary logistic regression and neural network.

    Science.gov (United States)

    Asghari, Mehdi Poursheikhali; Hayatshahi, Sayyed Hamed Sadat; Abdolmaleki, Parviz

    2012-01-01

    From both the structural and functional points of view, β-turns play important biological roles in proteins. In the present study, a novel two-stage hybrid procedure has been developed to identify β-turns in proteins. Binary logistic regression was initially used for the first time to select significant sequence parameters in identification of β-turns due to a re-substitution test procedure. Sequence parameters were consisted of 80 amino acid positional occurrences and 20 amino acid percentages in sequence. Among these parameters, the most significant ones which were selected by binary logistic regression model, were percentages of Gly, Ser and the occurrence of Asn in position i+2, respectively, in sequence. These significant parameters have the highest effect on the constitution of a β-turn sequence. A neural network model was then constructed and fed by the parameters selected by binary logistic regression to build a hybrid predictor. The networks have been trained and tested on a non-homologous dataset of 565 protein chains. With applying a nine fold cross-validation test on the dataset, the network reached an overall accuracy (Qtotal) of 74, which is comparable with results of the other β-turn prediction methods. In conclusion, this study proves that the parameter selection ability of binary logistic regression together with the prediction capability of neural networks lead to the development of more precise models for identifying β-turns in proteins.

  5. Creative industries value chain: The value chain logic in supply chain relationships

    OpenAIRE

    Emilia Madudová

    2017-01-01

    The purpose of this paper is to provide a deeper look into value chain logic in supply chain relationships in a creative industries value chains. In recent years, value has been recognized as a key factor in better understanding of consumer behavior and gaining a competitive advantage. In a value chain, added value should be defined at every step of the chain. There should be defined activity which adds value as well as the activity that subtracts any value. The total value can be then calcul...

  6. Absolute Dimensions of Contact Binary Stars in Baade Window

    Directory of Open Access Journals (Sweden)

    Young Woon Kang

    1999-12-01

    Full Text Available The light curves of the representative 6 contact binary stars observed by OGLE Project of searching for dark matter in our Galaxy have been analyzed by the method of the Wilson and Devinney Differential Correction to find photometric solutions. The orbital inclinations of these binaries are in the range of 52 deg - 69 deg which is lower than that of the solar neighborhood binaries. The Roche lobe filling factor of these binaries are distributed in large range of 0.12 - 0.90. Since absence of spectroscopic observations for these binaries we have found masses of the 6 binary systems based on the intersection between Kepler locus and locus derived from Vandenberg isochrones in the mass - luminosity plane. Then absolute dimensions and distances have been found by combining the masses and the photometric solutions. The distances of the 6 binary systems are distributed in the range of 1 kpc - 6 kpc. This distance range is the limiting range where the contact binaries which have period shorter than a day are visible. Most contact binaries discovered in the Baade window do not belong to the Galactic bulge.

  7. Non-binary Entanglement-assisted Stabilizer Quantum Codes

    OpenAIRE

    Riguang, Leng; Zhi, Ma

    2011-01-01

    In this paper, we show how to construct non-binary entanglement-assisted stabilizer quantum codes by using pre-shared entanglement between the sender and receiver. We also give an algorithm to determine the circuit for non-binary entanglement-assisted stabilizer quantum codes and some illustrated examples. The codes we constructed do not require the dual-containing constraint, and many non-binary classical codes, like non-binary LDPC codes, which do not satisfy the condition, can be used to c...

  8. A Survey of Binary Similarity and Distance Measures

    Directory of Open Access Journals (Sweden)

    Seung-Seok Choi

    2010-02-01

    Full Text Available The binary feature vector is one of the most common representations of patterns and measuring similarity and distance measures play a critical role in many problems such as clustering, classification, etc. Ever since Jaccard proposed a similarity measure to classify ecological species in 1901, numerous binary similarity and distance measures have been proposed in various fields. Applying appropriate measures results in more accurate data analysis. Notwithstanding, few comprehensive surveys on binary measures have been conducted. Hence we collected 76 binary similarity and distance measures used over the last century and reveal their correlations through the hierarchical clustering technique.

  9. An Economic Evaluation of Binary Cycle Geothermal Electricity Production

    National Research Council Canada - National Science Library

    Fitzgerald, Crissie

    2003-01-01

    .... Variables such as well flow rate, geothermal gradient and electricity prices were varied to study their influence on the economic payback period for binary cycle geothermal electricity production...

  10. Improving geothermal power plants with a binary cycle

    Science.gov (United States)

    Tomarov, G. V.; Shipkov, A. A.; Sorokina, E. V.

    2015-12-01

    The recent development of binary geothermal technology is analyzed. General trends in the introduction of low-temperature geothermal sources are summarized. The use of single-phase low-temperature geothermal fluids in binary power plants proves possible and expedient. The benefits of power plants with a binary cycle in comparison with traditional systems are shown. The selection of the working fluid is considered, and the influence of the fluid's physicochemical properties on the design of the binary power plant is discussed. The design of binary power plants is based on the chemical composition and energy potential of the geothermal fluids and on the landscape and climatic conditions at the intended location. Experience in developing a prototype 2.5 MW Russian binary power unit at Pauzhetka geothermal power plant (Kamchatka) is outlined. Most binary systems are designed individually for a specific location. Means of improving the technology and equipment at binary geothermal power plants are identified. One option is the development of modular systems based on several binary systems that employ the heat from the working fluid at different temperatures.

  11. A binary neutron star GRB model

    International Nuclear Information System (INIS)

    Wilson, J.R.; Salmonson, J.D.; Wilson, J.R.; Mathews, G.J.

    1998-01-01

    In this paper we present the preliminary results of a model for the production of gamma-ray bursts (GRBs) through the compressional heating of binary neutron stars near their last stable orbit prior to merger. Recent numerical studies of the general relativistic (GR) hydrodynamics in three spatial dimensions of close neutron star binaries (NSBs) have uncovered evidence for the compression and heating of the individual neutron stars (NSs) prior to merger 12. This effect will have significant effect on the production of gravitational waves, neutrinos and, ultimately, energetic photons. The study of the production of these photons in close NSBs and, in particular, its correspondence to observed GRBs is the subject of this paper. The gamma-rays arise as follows. Compressional heating causes the neutron stars to emit neutrino pairs which, in turn, annihilate to produce a hot electron-positron pair plasma. This pair-photon plasma expands rapidly until it becomes optically thin, at which point the photons are released. We show that this process can indeed satisfy three basic requirements of a model for cosmological gamma-ray bursts: (1) sufficient gamma-ray energy release (>10 51 ergs) to produce observed fluxes, (2) a time-scale of the primary burst duration consistent with that of a 'classical' GRB (∼10 seconds), and (3) the peak of the photon number spectrum matches that of 'classical' GRB (∼300 keV). copyright 1998 American Institute of Physics

  12. Binary operators and their Green's functions

    International Nuclear Information System (INIS)

    Sheff, J.R.

    1982-01-01

    Three topics are considered. First, the Langevin approach to neutron noise is used as a basis and guide to develop solutions and solution techniques for the ChapmanKolmogorov forward equation approach to neutron noise. The approach followed throughout this first part is that of solution by means of Green's functions. A particular form for the binary operator Green's function was picked on the basis of the Langevin method. Second, the basic solution technique using the particular Green's function form mentioned above is proven to be a correct and a general result. It is proven that the binary operator is always separable and that the Green's function could be written as the product of two single operator Green's functions. This is a new result. Third and finally, the forward equation approach of Chapman-Kolmogorov is generalized to include time allowing differential equations for second and higher order correlation functions to be developed directly. The principal result of the last section, the differential equation for correlation function of the neutron density, is new. Its derivation is really outside of or broader than the scope indicated by the title of the paper

  13. Binary rf pulse compression experiment at SLAC

    International Nuclear Information System (INIS)

    Lavine, T.L.; Spalek, G.; Farkas, Z.D.; Menegat, A.; Miller, R.H.; Nantista, C.; Wilson, P.B.

    1990-06-01

    Using rf pulse compression it will be possible to boost the 50- to 100-MW output expected from high-power microwave tubes operating in the 10- to 20-GHz frequency range, to the 300- to 1000-MW level required by the next generation of high-gradient linacs for linear for linear colliders. A high-power X-band three-stage binary rf pulse compressor has been implemented and operated at the Stanford Linear Accelerator Center (SLAC). In each of three successive stages, the rf pulse-length is compressed by half, and the peak power is approximately doubled. The experimental results presented here have been obtained at low-power (1-kW) and high-power (15-MW) input levels in initial testing with a TWT and a klystron. Rf pulses initially 770 nsec long have been compressed to 60 nsec. Peak power gains of 1.8 per stage, and 5.5 for three stages, have been measured. This corresponds to a peak power compression efficiency of about 90% per stage, or about 70% for three stages, consistent with the individual component losses. The principle of operation of a binary pulse compressor (BPC) is described in detail elsewhere. We recently have implemented and operated at SLAC a high-power (high-vacuum) three-stage X-band BPC. First results from the high-power three-stage BPC experiment are reported here

  14. GRAVITATIONAL MEMORY IN BINARY BLACK HOLE MERGERS

    International Nuclear Information System (INIS)

    Pollney, Denis; Reisswig, Christian

    2011-01-01

    In addition to the dominant oscillatory gravitational wave signals produced during binary inspirals, a non-oscillatory component arises from the nonlinear 'memory' effect, sourced by the emitted gravitational radiation. The memory grows significantly during the late-inspiral and merger, modifying the signal by an almost step-function profile, and making it difficult to model by approximate methods. We use numerical evolutions of binary black holes (BHs) to evaluate the nonlinear memory during late-inspiral, merger, and ringdown. We identify two main components of the signal: the monotonically growing portion corresponding to the memory, and an oscillatory part which sets in roughly at the time of merger and is due to the BH ringdown. Counterintuitively, the ringdown is most prominent for models with the lowest total spin. Thus, the case of maximally spinning BHs anti-aligned to the orbital angular momentum exhibits the highest signal-to-noise ratio (S/N) for interferometric detectors. The largest memory offset, however, occurs for highly spinning BHs, with an estimated value of h tot 20 ≅ 0.24 in the maximally spinning case. These results are central to determining the detectability of nonlinear memory through pulsar timing array measurements.

  15. BINARY NEUTRON STARS IN QUASI-EQUILIBRIUM

    International Nuclear Information System (INIS)

    Taniguchi, Keisuke; Shibata, Masaru

    2010-01-01

    Quasi-equilibrium sequences of binary neutron stars are constructed for a variety of equations of state in general relativity. Einstein's constraint equations in the Isenberg-Wilson-Mathews approximation are solved together with the relativistic equations of hydrostationary equilibrium under the assumption of irrotational flow. We focus on unequal-mass sequences as well as equal-mass sequences, and compare those results. We investigate the behavior of the binding energy and total angular momentum along a quasi-equilibrium sequence, the endpoint of sequences, and the orbital angular velocity as a function of time, changing the mass ratio, the total mass of the binary system, and the equation of state of a neutron star. It is found that the orbital angular velocity at the mass-shedding limit can be determined by an empirical formula derived from an analytic estimation. We also provide tables for 160 sequences, which will be useful as a guideline of numerical simulations for the inspiral and merger performed in the near future.

  16. Speakers' choice of frame in binary choice

    Directory of Open Access Journals (Sweden)

    Marc van Buiten

    2009-02-01

    Full Text Available A distinction is proposed between extit{recommending for} preferred choice options and extit{recommending against} non-preferred choice options. In binary choice, both recommendation modes are logically, though not psychologically, equivalent. We report empirical evidence showing that speakers recommending for preferred options predominantly select positive frames, which are less common when speakers recommend against non-preferred options. In addition, option attractiveness is shown to affect speakers' choice of frame, and adoption of recommendation mode. The results are interpreted in terms of three compatibility effects, (i extit{recommendation mode---valence framing compatibility}: speakers' preference for positive framing is enhanced under extit{recommending for} and diminished under extit{recommending against} instructions, (ii extit{option attractiveness---valence framing compatibility}: speakers' preference for positive framing is more pronounced for attractive than for unattractive options, and (iii extit{recommendation mode---option attractiveness compatibility}: speakers are more likely to adopt a extit{recommending for} approach for attractive than for unattractive binary choice pairs.

  17. Gravitational redshift from a binary system

    Energy Technology Data Exchange (ETDEWEB)

    Steklain, Andre [Universidade Tecnologica Federal do Parana (UTFPR), PR (Brazil)

    2011-07-01

    Full text: In this work we study the gravitational redshift of a binary system in general relativity. We employ a mixed metric obtained from the matching of a 1PN metric with two perturbed Schwarzschild metrics, based on previous works [Alvi, Phys. Rev. D, 61, 124013 (2000)]. This metric is well known, and has been considered for several applications [Steklain et al, Phys. Lett. A, 373, 188, (2009)]. We consider a massless observer in a timelike geodesic of this metric measuring the redshift of the system. The observer concentrates the redshift measurements in one of the massive bodies and is influenced by the mass of the second body. We find that there is a substantial contribution of the second mass in some cases. We compare with experimental data obtained for real binary systems of white dwarfs [Vennes et al, Astroph. J., L37 (1991)]. We also discuss these results for more massive systems, and make some predictions for very massive systems, like black holes, although it extrapolates the limit of the 1PN approximation used. Is well known that the major contribution of the observed redshift is from the universe expansion, but these results indicate that the influence of the gravitational redshift may be underestimated at some systems. (author)

  18. TIDAL INTERACTIONS IN MERGING WHITE DWARF BINARIES

    International Nuclear Information System (INIS)

    Piro, Anthony L.

    2011-01-01

    The recently discovered system J0651 is the tightest known detached white dwarf (WD) binary. Since it has not yet initiated Roche-lobe overflow, it provides a relatively clean environment for testing our understanding of tidal interactions. I investigate the tidal heating of each WD, parameterized in terms of its tidal Q parameter. Assuming that the heating can be radiated efficiently, the current luminosities are consistent with Q 1 ∼ 7 x 10 10 and Q 2 ∼ 2 x 10 7 , for the He and C/O WDs, respectively. Conversely, if the observed luminosities are merely from the cooling of the WDs, these estimated values of Q represent the upper limits. A large Q 1 for the He WD means its spin velocity will be slower than that expected if it was tidally locked, which, since the binary is eclipsing, may be measurable via the Rossiter-McLaughlin effect. After one year, gravitational wave emission shifts the time of eclipses by 5.5 s, but tidal interactions cause the orbit to shrink more rapidly, changing the time by up to an additional 0.3 s after a year. Future eclipse timing measurements may therefore infer the degree of tidal locking.

  19. A measurement of disorder in binary sequences

    Science.gov (United States)

    Gong, Longyan; Wang, Haihong; Cheng, Weiwen; Zhao, Shengmei

    2015-03-01

    We propose a complex quantity, AL, to characterize the degree of disorder of L-length binary symbolic sequences. As examples, we respectively apply it to typical random and deterministic sequences. One kind of random sequences is generated from a periodic binary sequence and the other is generated from the logistic map. The deterministic sequences are the Fibonacci and Thue-Morse sequences. In these analyzed sequences, we find that the modulus of AL, denoted by |AL | , is a (statistically) equivalent quantity to the Boltzmann entropy, the metric entropy, the conditional block entropy and/or other quantities, so it is a useful quantitative measure of disorder. It can be as a fruitful index to discern which sequence is more disordered. Moreover, there is one and only one value of |AL | for the overall disorder characteristics. It needs extremely low computational costs. It can be easily experimentally realized. From all these mentioned, we believe that the proposed measure of disorder is a valuable complement to existing ones in symbolic sequences.

  20. ACOUSTIC EFFECTS ON BINARY AEROELASTICITY MODEL

    Directory of Open Access Journals (Sweden)

    Kok Hwa Yu

    2011-10-01

    Full Text Available Acoustics is the science concerned with the study of sound. The effects of sound on structures attract overwhelm interests and numerous studies were carried out in this particular area. Many of the preliminary investigations show that acoustic pressure produces significant influences on structures such as thin plate, membrane and also high-impedance medium like water (and other similar fluids. Thus, it is useful to investigate the structure response with the presence of acoustics on aircraft, especially on aircraft wings, tails and control surfaces which are vulnerable to flutter phenomena. The present paper describes the modeling of structural-acoustic interactions to simulate the external acoustic effect on binary flutter model. Here, the binary flutter model which illustrated as a rectangular wing is constructed using strip theory with simplified unsteady aerodynamics involving flap and pitch degree of freedom terms. The external acoustic excitation, on the other hand, is modeled using four-node quadrilateral isoparametric element via finite element approach. Both equations then carefully coupled and solved using eigenvalue solution. The mentioned approach is implemented in MATLAB and the outcome of the simulated result are later described, analyzed and illustrated in this paper.