Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Aperiodic-metamaterial-based absorber
Directory of Open Access Journals (Sweden)
Quanlong Yang
2017-09-01
Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.
PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)
Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj
2010-04-01
Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews
A Bayesian model for binary Markov chains
Directory of Open Access Journals (Sweden)
Belkheir Essebbar
2004-02-01
Full Text Available This note is concerned with Bayesian estimation of the transition probabilities of a binary Markov chain observed from heterogeneous individuals. The model is founded on the Jeffreys' prior which allows for transition probabilities to be correlated. The Bayesian estimator is approximated by means of Monte Carlo Markov chain (MCMC techniques. The performance of the Bayesian estimates is illustrated by analyzing a small simulated data set.
Mathematics of aperiodic order
Lenz, Daniel; Savinien, Jean
2015-01-01
What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...
Grimm, Uwe
2017-01-01
Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.
Superlattice configurations in linear chain hydrocarbon binary mixtures
Indian Academy of Sciences (India)
Unknown
Long-chain alkanes; binary mixtures; superlattices; discrete orientational changes. 1. Introduction ... tem and a model of superlattice configuration was proposed4, in terms of .... C18 system,4 the angle with value = 3⋅3° was seen to play an ...
Gerke, Tim D.
Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics.
Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L
2012-01-02
We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.
Markov Chain Monte Carlo Methods
Indian Academy of Sciences (India)
Keywords. Markov chain; state space; stationary transition probability; stationary distribution; irreducibility; aperiodicity; stationarity; M-H algorithm; proposal distribution; acceptance probability; image processing; Gibbs sampler.
Simulation of aperiodic bipedal sprinting.
Celik, Huseyin; Piazza, Stephen J
2013-08-01
Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized
Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.
Lin, Chenxi; Povinelli, Michelle L
2011-09-12
We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.
Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams
Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović
2017-08-01
We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.
Renormalization group decimation technique for disordered binary harmonic chains
International Nuclear Information System (INIS)
Wiecko, C.; Roman, E.
1983-10-01
The density of states of disordered binary harmonic chains is calculated using the Renormalization Group Decimation technique on the displacements of the masses from their equilibrium positions. The results are compared with numerical simulation data and with those obtained with the current method of Goncalves da Silva and Koiller. The advantage of our procedure over other methods is discussed. (author)
A method to identify aperiodic disturbances in the ionosphere
Wang, J.-S.; Chen, Z.; Huang, C.-M.
2014-05-01
In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.
Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices
Directory of Open Access Journals (Sweden)
Enrique Maciá
2015-05-01
Full Text Available Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.
Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments
Directory of Open Access Journals (Sweden)
Liu Xue
2011-01-01
Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.
SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES
Energy Technology Data Exchange (ETDEWEB)
Findeisen, Krzysztof; Hillenbrand, Lynne [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Cody, Ann Marie, E-mail: krzys@astro.caltech.edu [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States)
2015-01-10
Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs.
SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES
International Nuclear Information System (INIS)
Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie
2015-01-01
Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs
Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation
International Nuclear Information System (INIS)
Xie Yong; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin
2004-01-01
An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells
Some remarks about the thermodynamics of discrete finite Markov chains
Energy Technology Data Exchange (ETDEWEB)
Siboni, S. [Trento Univ. (Italy). Facolta` di Ingegneria, Dip. di Ingegneria dei Materiali
1998-08-01
The Author propose a simple way to define a Hamiltonian for aperiodic Markov chains and to apply these chains in a thermodynamical context. The basic thermodynamic functions are correspondingly calculated. A quite intriguing and nontrivial application to stochastic automata is also pointed out.
Kwak, Jongheon; Han, Sunghyun; Kim, Jin Kon
2014-03-01
A binary mixture of two block copolymers whose blocks are capable of forming the hydrogen bonding allows one to obtain various microdomains that could not be expected for neat block copolymer. For instance, the binary blend of symmetric polystyrene-block-poly(2-vinylpyridine) copolymer (PS-b-P2VP) and polystyrene-block-polyhydroxystyrene copolymer (PS-b-PHS) blends where the hydrogen bonding occurred between P2VP and PHS showed hexagonally packed (HEX) cylindrical and body centered cubic (BCC) spherical microdomains. To know the exact location of short block copolymer chains at the interface, we synthesized deuterated polystyrene-block-polyhydroxystyrene copolymer (dPS-b-PHS) and prepared a binary mixture with PS-b-P2VP. We investigate, via small angle X-ray scattering (SAXS) and neutron reflectivity (NR), the exact location of shorter dPS block chain near the interface of the microdomains.
Kumar, Pawan; Parmananda, P.
2018-04-01
Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.
Time variability of X-ray binaries: observations with INTEGRAL. Modeling
International Nuclear Information System (INIS)
Cabanac, Clement
2007-01-01
The exact origin of the observed X and Gamma ray variability in X-ray binaries is still an open debate in high energy astrophysics. Among others, these objects are showing aperiodic and quasi-periodic luminosity variations on timescales as small as the millisecond. This erratic behavior must put constraints on the proposed emission processes occurring in the vicinity of the neutrons star or the stellar mass black-hole held by these objects. We propose here to study their behavior following 3 different ways: first we examine the evolution of a particular X-ray source discovered by INTEGRAL, IGR J19140+0951. Using timing and spectral data given by different instruments, we show that the source type is plausibly consistent with a High Mass X-ray Binary hosting a neutrons star. Subsequently, we propose a new method dedicated to the study of timing data coming from coded mask aperture instruments. Using it on INTEGRAL/ISGRI real data, we detect the presence of periodic and quasi-periodic features in some pulsars and micro-quasars at energies as high as a hundred keV. Finally, we suggest a model designed to describe the low frequency variability of X-ray binaries in their hardest state. This model is based on thermal comptonization of soft photons by a warm corona in which a pressure wave is propagating in cylindrical geometry. By computing both numerical simulations and analytical solution, we show that this model should be suitable to describe some of the typical features observed in X-ray binaries power spectra in their hard state and their evolution such as aperiodic noise and low frequency quasi-periodic oscillations. (author) [fr
Weak universality in inhomogeneous Ising quantum chains
International Nuclear Information System (INIS)
Karevski, Dragi
2006-01-01
The Ising quantum chain with arbitrary coupling distribution {λ i } leading to an anisotropic scaling is considered. The smallest gap of the chain is connected to the surface magnetization by the relation Λ 1 = m s ({λ i })m s ({λ -1 i }). For some aperiodic distribution {λ i }, a weak universality of the critical behaviour is found. (letter to the editor)
Agarwal, Mukul
2018-01-01
It is proved that the limit of the normalized rate-distortion functions of block independent approximations of an irreducible, aperiodic Markoff chain is independent of the initial distribution of the Markoff chain and thus, is also equal to the rate-distortion function of the Markoff chain.
Band structures and localization properties of aperiodic layered phononic crystals
Energy Technology Data Exchange (ETDEWEB)
Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)
2012-03-15
The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.
Energy Technology Data Exchange (ETDEWEB)
Hayashi, Kenta [Department of Mechanical Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu-shi, Shiga 525-8577 (Japan); Department of Chemistry, Biology, and Biotechnology, University of Perugia, 06123 Perugia (Italy); Gotoda, Hiroshi [Department of Mechanical Engineering, Tokyo University of Science, 6-3-1 Niijuku, Katsushika-ku, Tokyo 125-8585 (Japan); Gentili, Pier Luigi, E-mail: pierluigi.gentili@unipg.it [Department of Chemistry, Biology, and Biotechnology, University of Perugia, 06123 Perugia (Italy)
2016-05-15
The convective motions within a solution of a photochromic spiro-oxazine being irradiated by UV only on the bottom part of its volume, give rise to aperiodic spectrophotometric dynamics. In this paper, we study three nonlinear properties of the aperiodic time series: permutation entropy, short-term predictability and long-term unpredictability, and degree distribution of the visibility graph networks. After ascertaining the extracted chaotic features, we show how the aperiodic time series can be exploited to implement all the fundamental two-inputs binary logic functions (AND, OR, NAND, NOR, XOR, and XNOR) and some basic arithmetic operations (half-adder, full-adder, half-subtractor). This is possible due to the wide range of states a nonlinear system accesses in the course of its evolution. Therefore, the solution of the convective photochemical oscillator results in hardware for chaos-computing alternative to conventional complementary metal-oxide semiconductor-based integrated circuits.
International Nuclear Information System (INIS)
Dash, S.K.; Swain, B.B.
1993-01-01
Dielectric constant (ε) of Tri-n-butyl phosphate (TBP), in binary mixtures with five long-chain primary alcohols viz; 1-butanol, 1-pentanol, 1-hexanol, 1-heptanol and 1-octanol has been measured at ν = 455 kHz and at temperature 302 K. The data is used to evaluate mutual correlation factor g ab , excess molar polarization ΔP and excess free energy of mixing ΔF ab by using Winkelmann-Quitzsch eqn. for binary mixtures to assess the suitability of the alcohols as modifiers. The trend of variation of these parameters exhibit marked dependence on chain-length of the alcohols indicating 1-heptanol to be an efficient modifier. (author)
Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure
International Nuclear Information System (INIS)
Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B
2013-01-01
We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)
Prediction of the Flash Point of Binary and Ternary Straight-Chain Alkane Mixtures
Directory of Open Access Journals (Sweden)
X. Li
2014-01-01
Full Text Available The flash point is an important physical property used to estimate the fire hazard of a flammable liquid. To avoid the occurrence of fire or explosion, many models are used to predict the flash point; however, these models are complex, and the calculation process is cumbersome. For pure flammable substances, the research for predicting the flash point is systematic and comprehensive. For multicomponent mixtures, especially a hydrocarbon mixture, the current research is insufficient to predict the flash point. In this study, a model was developed to predict the flash point of straight-chain alkane mixtures using a simple calculation process. The pressure, activity coefficient, and other associated physicochemical parameters are not required for the calculation in the proposed model. A series of flash points of binary and ternary mixtures of straight-chain alkanes were determined. The results of the model present consistent experimental results with an average absolute deviation for the binary mixtures of 0.7% or lower and an average absolute deviation for the ternary mixtures of 1.03% or lower.
Directory of Open Access Journals (Sweden)
Yongmei Hu
2014-01-01
Full Text Available In this work the gelation behaviors of binary organogels composed of azobenzene amino derivatives and alkyloxybenzoic acids with different lengths of alkyl chains in various organic solvents were investigated and characterized. The corresponding gelation behaviors in 20 solvents were characterized and shown as new binary organic systems. It showed that the lengths of substituent alkyl chains in compounds have played an important role in the gelation formation of gelator mixtures in present tested organic solvents. Longer methylene chains in molecular skeletons in these gelators seem more suitable for the gelation of present solvents. Morphological characterization showed that these gelator molecules have the tendency to self-assemble into various aggregates from lamella, wrinkle, and belt to dot with change of solvents and gelator mixtures. Spectral characterization demonstrated different H-bond formation and hydrophobic force existing in gels, depending on different substituent chains in molecular skeletons. Meanwhile, these organogels can self-assemble to form monomolecular or multilayer nanostructures owing to the different lengths of due to alkyl substituent chains. Possible assembly modes for present xerogels were proposed. The present investigation is perspective to provide new clues for the design of new nanomaterials and functional textile materials with special microstructures.
Indian Academy of Sciences (India)
be obtained as a limiting value of a sample path of a suitable ... makes a mathematical model of chance and deals with the problem by .... Is the Markov chain aperiodic? It is! Here is how you can see it. Suppose that after you do the cut, you hold the top half in your right hand, and the bottom half in your left. Then there.
Aperiodicity Correction for Rotor Tip Vortex Measurements
Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.
2011-01-01
The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.
International Nuclear Information System (INIS)
Li Jianlong; Zeng Lingzao
2010-01-01
We discuss in detail the effects of the multi-time-delayed feedback driven by an aperiodic signal on the output of a stochastic resonance (SR) system. The effective potential function and dynamical probability density function (PDF) are derived. To measure the performance of the SR system in the presence of a binary random signal, the bit error rate (BER) defined by the dynamical PDF is employed, as is commonly used in digital communications. We find that the delay time, strength of the feedback, and number of time-delayed terms can change the effective potential function and the effective amplitude of the signal, and then affect the BER of the SR system. The numerical simulations strongly support the theoretical results. The goal of this investigation is to explore the effects of the multi-time-delayed feedback on SR and give a guidance to nonlinear systems in the application of information processing.
Weber, Juliane; Zachow, Christopher; Witthaut, Dirk
2018-03-01
Wind power generation exhibits a strong temporal variability, which is crucial for system integration in highly renewable power systems. Different methods exist to simulate wind power generation but they often cannot represent the crucial temporal fluctuations properly. We apply the concept of additive binary Markov chains to model a wind generation time series consisting of two states: periods of high and low wind generation. The only input parameter for this model is the empirical autocorrelation function. The two-state model is readily extended to stochastically reproduce the actual generation per period. To evaluate the additive binary Markov chain method, we introduce a coarse model of the electric power system to derive backup and storage needs. We find that the temporal correlations of wind power generation, the backup need as a function of the storage capacity, and the resting time distribution of high and low wind events for different shares of wind generation can be reconstructed.
Weber, Juliane; Zachow, Christopher; Witthaut, Dirk
2018-03-01
Wind power generation exhibits a strong temporal variability, which is crucial for system integration in highly renewable power systems. Different methods exist to simulate wind power generation but they often cannot represent the crucial temporal fluctuations properly. We apply the concept of additive binary Markov chains to model a wind generation time series consisting of two states: periods of high and low wind generation. The only input parameter for this model is the empirical autocorrelation function. The two-state model is readily extended to stochastically reproduce the actual generation per period. To evaluate the additive binary Markov chain method, we introduce a coarse model of the electric power system to derive backup and storage needs. We find that the temporal correlations of wind power generation, the backup need as a function of the storage capacity, and the resting time distribution of high and low wind events for different shares of wind generation can be reconstructed.
Energy Technology Data Exchange (ETDEWEB)
Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)
2017-10-01
For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.
An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.
Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell
Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.
2016-08-01
In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.
Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing
DEFF Research Database (Denmark)
Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina
2016-01-01
Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...
Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu
This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.
The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles
Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.
2017-12-01
The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness
Non-commutative Chern numbers for generic aperiodic discrete systems
Bourne, Chris; Prodan, Emil
2018-06-01
The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.
Topological aperiodicity for product systems over semigroups of Ore type
DEFF Research Database (Denmark)
Kwasniewski, Bartosz; Szymanski, Wojciech
2016-01-01
aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...
Aperiodic spin state ordering of bistable molecules and its photoinducede erasing
Czech Academy of Sciences Publication Activity Database
Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.
2012-01-01
Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012
Study and realisation of chaining operators
International Nuclear Information System (INIS)
Khan, Mohd Solaiman
1970-01-01
Within the frame of researches in the field of binary analysis performed in the nuclear instrumentation department of the Saclay Nuclear Centre, this research thesis belongs to the field of applications of binary analysis theories, and more particularly to the development and study of a chaining operator (chaining operators are used to develop complex automatic systems with a clear separation between information processing and program-based management of this processing). The author first recalls some notions of binary analysis: algebraic binary sets, products and their specific properties, and practical realisation of binary functions by means of logical circuits. He recalls methods for the general study of sequential systems; generalities, base functions, elementary reflex functions, graphical study of sequential systems, search for and removal of commutation variations. He discusses the present organisation of electronic computers: software, hardware, synchronous and asynchronous control. He presents chaining operators: generalities, computation of a chaining operator, static aspect of chaining operators. He reports and comments the practical realisation of chaining operators: components, measurements performed on elaborated chaining operators, simulation experimental set-up [fr
Diffuse scattering from periodic and aperiodic crystals
International Nuclear Information System (INIS)
Frey, F.
1997-01-01
A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)
Near-to far-field transformation in the aperiodic Fourier modal method
Rook, R.; Pisarenco, M.; Setija, I.D.
2013-01-01
This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by
Directory of Open Access Journals (Sweden)
Xuefeng Li
2014-04-01
Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.
Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time
DEFF Research Database (Denmark)
Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob
2013-01-01
This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...
Wang, Pengfei; Jin, Wei; Su, Huan
2018-04-01
This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.
International Nuclear Information System (INIS)
Trias, Miquel; Vecchio, Alberto; Veitch, John
2009-01-01
Bayesian analysis of Laser Interferometer Space Antenna (LISA) data sets based on Markov chain Monte Carlo methods has been shown to be a challenging problem, in part due to the complicated structure of the likelihood function consisting of several isolated local maxima that dramatically reduces the efficiency of the sampling techniques. Here we introduce a new fully Markovian algorithm, a delayed rejection Metropolis-Hastings Markov chain Monte Carlo method, to efficiently explore these kind of structures and we demonstrate its performance on selected LISA data sets containing a known number of stellar-mass binary signals embedded in Gaussian stationary noise.
International Nuclear Information System (INIS)
Bagheri, Ahmad; Fazli, Mostafa; Bakhshaei, Malihe
2016-01-01
Highlights: • Surface tension of DMSO + alcohol (methanol, ethanol and isopropanol) at various temperatures was measured. • The surface tension data of binary mixtures were correlated with four equations. • Intermolecular interaction of DMSO with alcohol was discussed. • The surface mole fraction of alcohol increase with increasing the length of alcohol chain. - Abstract: Surface tension of binary mixtures of methanol, ethanol and isopropanol with DMSO (dimethyl sulfoxide) was measured over the whole range of composition at atmospheric pressure of 82.5 kPa within the temperatures between (298.15 and 328.15) K. The experimental measurements were used to calculate in surface tension deviations (Δσ). The sign of Δσ for all temperatures is negative (except of methanol/DMSO system) because of the factors of hydrogen bonding and dipole–dipole interactions in the DMSO-alcohol systems. Surface tension values of the binary systems were correlated with FLW, MS, RK and LWW models. The mean standard deviation obtained from the comparison of experimental and calculated surface tension values for binary systems with three models (FLW, MS and RK) at various temperatures is less than 0.83. Also, the results of the LWW model were used to account for the interaction energy between alcohols and DMSO in binary mixtures. The temperature dependence of σ (surface tension) at fixed composition of solutions was used to estimate surface enthalpy, H s , and surface entropy, S s . The results obtained show that the values of the thermodynamic parameters for alcohol/DMSO mixtures decrease with increasing alkyl chain length of alcohol. Finally, the results are discussed in terms of surface mole fraction and lyophobicity using the extended Langmuir (EL) isotherm.
Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates
Yu, Yisheng
This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.
Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances
Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong
2017-11-01
Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.
Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time
DEFF Research Database (Denmark)
Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob
2014-01-01
in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...
Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators
DEFF Research Database (Denmark)
Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde
2014-01-01
and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...
Combinations of response-reinforcer relations in periodic and aperiodic schedules.
Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E
2013-03-01
Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.
Investigation of aperiodic W/C multi-layer mirror for X-ray optics
International Nuclear Information System (INIS)
Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan
2011-01-01
Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.
International Nuclear Information System (INIS)
Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng
2011-01-01
The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.
Composite Binary Sequences with a Large Ensemble and Zero Correlation Zone
Directory of Open Access Journals (Sweden)
S. S. Yudachev
2015-01-01
Full Text Available The article considers a proposed class of derived signals such as composite binary sequences for application in advanced spread spectrum radio systems of various purposes, using signals based on spectrum spreading by direct sequence method. Considered composite sequences, having a representative set of lengths and unique correlation properties, compares favorably with the widely used at present large ensembles formed on a single algorithmic basis. To evaluate the properties of the composite sequences generated on the basis of two components - the Barker code and Kerdock sequences, expressions of periodic and aperiodic correlation functions are given.An algorithm for generating practical ensembles of composite sequences is presented. On the basis of the algorithm and its software implementation in C #, the samples of the sequence ensembles of various lengths were obtained and their periodic and aperiodic correlation functions and statistical characteristics were studied in detail. As an illustration, some of the most typical correlation functions are presented. The most remarkable characteristics allowing a ssessing the feasibility of using this type of sequences in the design of specific types of radio systems are considered.On the basis of the proposed program and the performed calculations the conclusions can be drawn about the possibility of using the sequences of these classes, with the aim of reducing intra-system disturbance in the projected spread spectrum CDMA.
Shape control in wafer-based aperiodic 3D nanostructures
International Nuclear Information System (INIS)
Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen
2014-01-01
Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)
Kato, N.
2017-12-01
Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.
International Nuclear Information System (INIS)
Mohammad, Abubaker A.; Alkhaldi, Khaled H.A.E.; AlTuwaim, Mohammad S.; Al-Jimaz, Adel S.
2014-01-01
Highlights: • Effect of temperature and chain length on η and σ of DMF + 1-alkanol binary systems. • Viscosity and surface tension were obtained. • Δη, Δσ and G ∗E were calculated using the experimental data. • H σ and S σ were determined using the surface tension data. • Semi-empirical relations were used to estimate the viscosity of liquid mixtures. - Abstract: Viscosity and surface tension of binary systems of N,N-dimethylformamide DMF with higher 1-alkanols (C 8 –C 10 ) were measured at atmospheric pressure and four different temperatures over the entire range of mole fraction. The experimental measurements were used to calculate the deviations in viscosity and surface tension. Furthermore, the excess Gibbs free energy of activation, surface enthalpy and surface entropy of the (DMF + 1-alkanols) binary mixtures were determined. In addition, the deviation and excess properties were fitted to the method of Redlich–Kister (R–K) polynomial. Viscosity data of the binary systems were correlated with three different expressions (Grunberg and Nissan, the three-body, and four-body McAllister). The effects of the chain length of the higher 1-alkanols and temperature were investigated
International Nuclear Information System (INIS)
Zhong Ming; Tong Peiqing
2011-01-01
The Loschmidt echo (LE) of a central two-level qubit coupled to nonuniform anisotropic XY chains in a transverse field is studied. A general formula for LE is derived, which we use to discuss the influence of the criticality of the environment on LE. It is found that for the periodic XY chain the behaviors of LE in the vicinity of the critical points are similar to those of the uniform case. It is different for the disordered transverse Ising chains. For the aperiodic chains, if the surrounding systems are bounded chains, the behaviors of LE are similar to those of the uniform case, while if the surrounding systems are unbounded chains, they are similar to those of the disordered case.
Optimized emission in nanorod arrays through quasi-aperiodic inverse design.
Anderson, P Duke; Povinelli, Michelle L
2015-06-01
We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.
Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel
2015-05-27
One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.
Directory of Open Access Journals (Sweden)
Carlos Santos
2015-05-01
Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.
Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J
2008-05-01
We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.
Skuk, Verena G.; Schweinberger, Stefan R.
2014-01-01
Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…
Radiation-disorder and aperiodicity in irradiated ceramics
International Nuclear Information System (INIS)
Hobbs, L.W.
1992-01-01
This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates
International Nuclear Information System (INIS)
Papović, Snežana; Bešter-Rogač, Marija; Vraneš, Milan; Gadžurić, Slobodan
2016-01-01
Highlights: • Influence of alkyl substituent length on IL properties was studied. • Nature of interactions between studied [C_nC_1im][NTf_2] and GBL were discussed. • Angell strength parameter indicates [C_nC_1im][NTf_2] are fragile liquids. • ILs properties regularly change with increase of the alkyl chain length. • Absence of GBL self-association upon addition of IL is observed. - Abstract: Densities and viscosities were determined and analysed for γ-butyrolactone (GBL) binary mixtures with 1-alkyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ionic liquids (where alkyl = ethyl, hexyl, octyl) as a function of temperature at atmospheric pressure (p = 0.1 MPa) and over the whole composition range. Excess molar volumes have been calculated from the experimental densities and were fitted using Redlich–Kister’s polynomial equation. Other volumetric parameters have been also calculated in order to obtain information about interactions between GBL and imidazolium based ionic liquids with different alkyl chain length. From the viscosity measurements, the Angell strength parameter was calculated for pure ionic liquids indicating that all investigated electrolytes are “fragile” liquids.
A binary plasmid system for shuffling combinatorial antibody libraries.
Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A
1992-01-01
We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind a...
International Nuclear Information System (INIS)
Liao, Wei-Chen; Lin, Ho-mu; Lee, Ming-Jer
2011-01-01
Research highlights: → An isothermal titration calorimeter was used for enthalpy data measurment. → The investigated systems are 2-decanone or dipentyl ether with long-chain n-alkanes. → The excess enthalpies are all positive over entire composition range. → The Patel-Teja equation of state with two parameters gives the best representation. - Abstract: Excess molar enthalpies (H E ) of binary mixtures of 2-decanone or dipentyl ether with n-alkanes, including n-dodecane, n-tetradecane, and n-hexadecane, were measured with an isothermal titration calorimeter (ITC) at T = 298.15 K under atmospheric pressure. All the measured H E values are positive over the entire range of composition, indicating that all these mixing processes are endothermic. The H E values varying with composition are found to be nearly symmetric for each binary system. It was also shown that the H E values follow the order of n-hexadecane > n-tetradecane > n-dodecane at a given composition in either the 2-decanone or dipentyl ether binary systems. An empirical Redlich-Kister equation correlated quantitatively these new H E data. The Peng-Robinson and the Patel-Teja equations of state, and the NRTL model were also applied to fit the H E results. Among these tested correlative models, the Patel-Teja equation of state with two adjustable binary interaction parameters generally yielded the best representation.
du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe
2018-02-01
The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.
International Nuclear Information System (INIS)
Olivieri, E.; Scoppola, E.
1996-01-01
In this paper we consider aperiodic ergodic Markov chains with transition probabilities exponentially small in a large parameter β. We extend to the general, not necessarily reversible case the analysis, started in part I of this work, of the first exit problem from a general domain Q containing many stable equilibria (attracting equilibrium points for the β = ∞ dynamics). In particular we describe the tube of typical trajectories during the first excursion outside Q
Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D
2017-11-01
A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed
Aperiodic nanoplasmonic devices for directional colour filtering and sensing.
Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit
2017-11-07
Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.
Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue
2016-02-01
Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.
Mendez, Rene A.; Claveria, Ruben M.; Orchard, Marcos E.; Silva, Jorge F.
2017-11-01
We present orbital elements and mass sums for 18 visual binary stars of spectral types B to K (five of which are new orbits) with periods ranging from 20 to more than 500 yr. For two double-line spectroscopic binaries with no previous orbits, the individual component masses, using combined astrometric and radial velocity data, have a formal uncertainty of ˜ 0.1 {M}⊙ . Adopting published photometry and trigonometric parallaxes, plus our own measurements, we place these objects on an H-R diagram and discuss their evolutionary status. These objects are part of a survey to characterize the binary population of stars in the Southern Hemisphere using the SOAR 4 m telescope+HRCAM at CTIO. Orbital elements are computed using a newly developed Markov chain Monte Carlo (MCMC) algorithm that delivers maximum-likelihood estimates of the parameters, as well as posterior probability density functions that allow us to evaluate the uncertainty of our derived parameters in a robust way. For spectroscopic binaries, using our approach, it is possible to derive a self-consistent parallax for the system from the combined astrometric and radial velocity data (“orbital parallax”), which compares well with the trigonometric parallaxes. We also present a mathematical formalism that allows a dimensionality reduction of the feature space from seven to three search parameters (or from 10 to seven dimensions—including parallax—in the case of spectroscopic binaries with astrometric data), which makes it possible to explore a smaller number of parameters in each case, improving the computational efficiency of our MCMC code. Based on observations obtained at the Southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inovação (MCTI) da República Federativa do Brasil, the U.S. National Optical Astronomy Observatory (NOAO), the University of North Carolina at Chapel Hill (UNC), and Michigan State University (MSU).
PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS
International Nuclear Information System (INIS)
Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.
2014-01-01
Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism
PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS
Energy Technology Data Exchange (ETDEWEB)
Parks, J. Robert; Plavchan, Peter; Gee, Alan H. [Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); White, Russel J., E-mail: parksj@chara.gsu.edu [Georgia State University, Department of Physics and Astronomy, 25 Park Place, Room 605, Atlanta, GA 30303 (United States)
2014-03-01
Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K{sub s} -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK{sub s} -band amplitudes from 0.044 to 2.31 mag and Δ(J – K{sub s} ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K{sub s} time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief
Real-time remedial action against aperiodic small signal rotor angle instability
DEFF Research Database (Denmark)
Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob
2016-01-01
This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...
Testing the relativistic Doppler boost hypothesis for supermassive black hole binary candidates
Charisi, Maria; Haiman, Zoltán; Schiminovich, David; D'Orazio, Daniel J.
2018-06-01
Supermassive black hole binaries (SMBHBs) should be common in galactic nuclei as a result of frequent galaxy mergers. Recently, a large sample of sub-parsec SMBHB candidates was identified as bright periodically variable quasars in optical surveys. If the observed periodicity corresponds to the redshifted binary orbital period, the inferred orbital velocities are relativistic (v/c ≈ 0.1). The optical and ultraviolet (UV) luminosities are expected to arise from gas bound to the individual BHs, and would be modulated by the relativistic Doppler effect. The optical and UV light curves should vary in tandem with relative amplitudes which depend on the respective spectral slopes. We constructed a control sample of 42 quasars with aperiodic variability, to test whether this Doppler colour signature can be distinguished from intrinsic chromatic variability. We found that the Doppler signature can arise by chance in ˜20 per cent (˜37 per cent) of quasars in the nUV (fUV) band. These probabilities reflect the limited quality of the control sample and represent upper limits on how frequently quasars mimic the Doppler brightness+colour variations. We performed separate tests on the periodic quasar candidates, and found that for the majority, the Doppler boost hypothesis requires an unusually steep UV spectrum or an unexpectedly large BH mass and orbital velocity. We conclude that at most approximately one-third of these periodic candidates can harbor Doppler-modulated SMBHBs.
Two methods for studying the X-ray variability
Yan, Shu-Ping; Ji, Li; Méndez, Mariano; Wang, Na; Liu, Siming; Li, Xiang-Dong
2016-01-01
The X-ray aperiodic variability and quasi-periodic oscillation (QPO) are the important tools to study the structure of the accretion flow of X-ray binaries. However, the origin of the complex X-ray variability from X-ray binaries remains yet unsolved. We proposed two methods for studying the X-ray
Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene
Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel
2016-01-01
We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.
Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.
Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S
2016-01-15
Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.
Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.
2018-03-01
We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.
Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number
Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.
2017-09-01
Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.
Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals
Energy Technology Data Exchange (ETDEWEB)
Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)
2012-02-01
The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.
Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit
2018-05-01
We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.
Energy Technology Data Exchange (ETDEWEB)
Kobulnicky, Henry A.; Lundquist, Michael J.; Burke, Jamison; Chapman, James; Keller, Erica; Lester, Kathryn; Rolen, Emily K.; Topel, Eric; Bhattacharjee, Anirban; Smullen, Rachel A.; Álvarez, Carlos A. Vargas; Runnoe, Jessie C.; Dale, Daniel A.; Brotherton, Michael M. [Department of Physics and Astronomy, University of Wyoming, Laramie, WY 82070 (United States); Kiminki, Daniel C., E-mail: chipk@uwyo.edu, E-mail: jburke2@swarthmore.edu, E-mail: jc6380@mcla.edu, E-mail: kelle22e@mtholyoke.edu, E-mail: kvl214@lehigh.edu, E-mail: emily.k.rolen@vanderbilt.edu, E-mail: topel@stolaf.edu [Department of Astronomy, University of Arizona, Tucson, AZ 85721 (United States)
2014-08-01
We analyze orbital solutions for 48 massive multiple-star systems in the Cygnus OB2 association, 23 of which are newly presented here, to find that the observed distribution of orbital periods is approximately uniform in log P for P < 45 days, but it is not scale-free. Inflections in the cumulative distribution near 6 days, 14 days, and 45 days suggest key physical scales of ≅0.2, ≅0.4, and ≅1 A.U. where yet-to-be-identified phenomena create distinct features. No single power law provides a statistically compelling prescription, but if features are ignored, a power law with exponent β ≅ –0.22 provides a crude approximation over P = 1.4-2000 days, as does a piece-wise linear function with a break near 45 days. The cumulative period distribution flattens at P > 45 days, even after correction for completeness, indicating either a lower binary fraction or a shift toward low-mass companions. A high degree of similarity (91% likelihood) between the Cyg OB2 period distribution and that of other surveys suggests that the binary properties at P ≲ 25 days are determined by local physics of disk/clump fragmentation and are relatively insensitive to environmental and evolutionary factors. Fully 30% of the unbiased parent sample is a binary with period P < 45 days. Completeness corrections imply a binary fraction near 55% for P < 5000 days. The observed distribution of mass ratios 0.2 < q < 1 is consistent with uniform, while the observed distribution of eccentricities 0.1 < e < 0.6 is consistent with uniform plus an excess of e ≅ 0 systems. We identify six stars, all supergiants, that exhibit aperiodic velocity variations of ∼30 km s{sup –1} attributed to atmospheric fluctuations.
On the algebraic characterization of aperiodic tilings related to ADE-root systems
International Nuclear Information System (INIS)
Kellendonk, J.
1992-09-01
The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)
The DNA electronic specific heat at low temperature: The role of aperiodicity
Energy Technology Data Exchange (ETDEWEB)
Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)
2012-07-16
The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.
Koju, Vijay
Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi
Many-Body Potentials For Binary Immiscible liquid Metal Alloys
International Nuclear Information System (INIS)
Karaguelle, H.
2004-01-01
The modified analytic embedded atom method (MAEAM) type many- body potentials have been constructed for three binary liquid immiscible alloy systems: Al-Pb, Ag-Ni, Ag- Cu. The MAEAM potential functions are fitted to both solid and liquid state properties for only liquid pure metals which consist the immiscible alloy. In order to test the reliability of the constructed MAEAM effective potentials, partial structure factors and pair distribution functions of these binary liquid metal alloys have been calculated using the thermodynamically self-consistent variational modified hypernetted chain (VMHNC) theory of liquids. A good agreement with the available experimental data for structure has
Formation of the wide asynchronous binary asteroid population
International Nuclear Information System (INIS)
Jacobson, Seth A.; Scheeres, Daniel J.; McMahon, Jay
2014-01-01
We propose and analyze a new mechanism for the formation of the wide asynchronous binary population. These binary asteroids have wide semimajor axes relative to most near-Earth and main belt asteroid systems. Confirmed members have rapidly rotating primaries and satellites that are not tidally locked. Previously suggested formation mechanisms from impact ejecta, from planetary flybys, and directly from rotational fission events cannot satisfy all of the observations. The newly hypothesized mechanism works as follows: (1) these systems are formed from rotational fission, (2) their satellites are tidally locked, (3) their orbits are expanded by the binary Yarkovsky-O'Keefe-Radzievskii-Paddack (BYORP) effect, (4) their satellites desynchronize as a result of the adiabatic invariance between the libration of the secondary and the mutual orbit, and (5) the secondary avoids resynchronization because of the YORP effect. This seemingly complex chain of events is a natural pathway for binaries with satellites that have particular shapes, which define the BYORP effect torque that acts on the system. After detailing the theory, we analyze each of the wide asynchronous binary members and candidates to assess their most likely formation mechanism. Finally, we suggest possible future observations to check and constrain our hypothesis.
Volumetric properties under pressure for the binary system ethanol plus toluene
DEFF Research Database (Denmark)
Zeberg-Mikkelsen, Claus Kjær; Lugo, Luis; García, Josefa
2005-01-01
. The VLE behavior of this binary system within the considered temperature range is represented satisfactory by the perturbed-chain statistical association fluid theory (PC-SAFT) equation of state with a single interaction parameter, although no cross association between ethanol and toluene is taken...... into account. The densities of this binary system (pure compounds and mixtures) are satisfactory predicted by PC-SAFT with an overall AAD of 0.8%, but the behavior of the excess molar volume is not described correctly....
Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.
2018-03-01
Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.
Corrections for frequency domain transformations of Winfrith binary cross correlator responses
International Nuclear Information System (INIS)
Cummins, J.D.
1968-04-01
This report considers the corrections for frequency domain transformations of Winfrith binary cross correlator responses; (i) for the finite bandwidth of the equivalent input signal; (2) for the finite time required for the actuator to move between the two positions appropriate to the two levels of the periodic binary chain code input and (3) for the averaging of experimental determinations of the system frequency response and calculations of the standard deviations of the modulus and phase of the frequency responses determined from the cross correlator responses. (author)
On the Convergence of Biogeography-Based Optimization for Binary Problems
Directory of Open Access Journals (Sweden)
Haiping Ma
2014-01-01
Full Text Available Biogeography-based optimization (BBO is an evolutionary algorithm inspired by biogeography, which is the study of the migration of species between habitats. A finite Markov chain model of BBO for binary problems was derived in earlier work, and some significant theoretical results were obtained. This paper analyzes the convergence properties of BBO on binary problems based on the previously derived BBO Markov chain model. Analysis reveals that BBO with only migration and mutation never converges to the global optimum. However, BBO with elitism, which maintains the best candidate in the population from one generation to the next, converges to the global optimum. In spite of previously published differences between genetic algorithms (GAs and BBO, this paper shows that the convergence properties of BBO are similar to those of the canonical GA. In addition, the convergence rate estimate of BBO with elitism is obtained in this paper and is confirmed by simulations for some simple representative problems.
Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers
Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.
2018-02-01
Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.
International Nuclear Information System (INIS)
Nakatani, Hisayuki; Kurniawan, Dodik; Taniike, Toshiaki; Terano, Minoru
2008-01-01
In this work, the relationship between the unsaturated chain end group content and the thermal oxidative degradation rate was systematically studied with binary polymer blends of isotactic polypropylene (iPP) with and without the unsaturated chain end group. The iPPs with and without the unsaturated chain end group were synthesized by a metallocene catalyst in the absence of hydrogen and by a Ziegler catalyst in the presence of one, respectively. The thermal oxidative degradation rate of the binary iPP blends was estimated from the molecular weight and the apparent activation energy (ΔE), which were obtained through size exclusion chromatography (SEC) and thermogravimetric analysis (TGA) measurements, respectively. These values exhibited a negative correlation against the mole content of the unsaturated chain end group. The thermal oxidative degradation rate apparently depends on the content of the unsaturated chain end group. This tendency suggests that the unsaturated chain end acts as a radical initiator of the iPP degradation reaction.
International Nuclear Information System (INIS)
Eggleton, P.P.; Pringle, J.E.
1985-01-01
This volume contains 15 review articles in the field of binary stars. The subjects reviewed span considerably, from the shortest period of interacting binaries to the longest, symbiotic stars. Also included are articles on Algols, X-ray binaries and Wolf-Rayet stars (single and binary). Contents: Preface. List of Participants. Activity of Contact Binary Systems. Wolf-Rayet Stars and Binarity. Symbiotic Stars. Massive X-ray Binaries. Stars that go Hump in the Night: The SU UMa Stars. Interacting Binaries - Summing Up
Classical diffusion, Anderson localization, and spectral statistics in billiard chains
International Nuclear Information System (INIS)
Dittrich, T.; Doron, E.; Smilansky, U.
1993-03-01
We study spectral properties of quasi one-dimensional extended systems that show deterministic diffusion on the classical level and Anderson localization in the quantal description. Using semiclassical arguments, we relate to universal aspects of the spectral fluctuations to features of the set of classical periodic orbits, expressed in terms of probability to perform periodic motion, that are likewise universal. This allows to derive an analytical expression for the spectral form factor which reflects the diffusive nature of the corresponding classical dynamics. It defines a novel spectral universality class which covers the transition between GOE statistics in the limit of a small ratio of the system size to the localization length, corresponding to the metallic regime of disordered systems, to Poissonian level fluctuations in the opposite limit. Our semiclassical predictions are illustrated and confirmed by a numerical investigation of aperiodic chains of chaotic billiards. (authors)
Directory of Open Access Journals (Sweden)
Fred Lunnon
2009-06-01
Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.
Variable Stars Observed in the Galactic Disk by AST3-1 from Dome A, Antarctica
Energy Technology Data Exchange (ETDEWEB)
Wang, Lingzhi; Ma, Bin; Hu, Yi; Liu, Qiang; Shang, Zhaohui [Key Laboratory of Optical Astronomy, National Astronomical Observatories, Chinese Academy of Sciences, Beijing 100012 (China); Li, Gang; Fu, Jianning [Department of Astronomy, Beijing Normal University, Beijing, 100875 (China); Wang, Lifan; Cui, Xiangqun; Du, Fujia; Gong, Xuefei; Li, Xiaoyan; Li, Zhengyang; Yuan, Xiangyan; Zhou, Jilin [Chinese Center for Antarctic Astronomy, Nanjing 210008 (China); Ashley, Michael C. B. [School of Physics, University of New South Wales, NSW 2052 (Australia); Pennypacker, Carl R. [Center for Astrophysics, Lawrence Berkeley National Laboratory, Berkeley, CA (United States); York, Donald G., E-mail: wanglingzhi@bao.ac.cn [Department of Astronomy and Astrophysics and Enrico Fermi Institute, University of Chicago, Chicago, IL 60637 (United States)
2017-03-01
AST3-1 is the second-generation wide-field optical photometric telescope dedicated to time-domain astronomy at Dome A, Antarctica. Here, we present the results of an i -band images survey from AST3-1 toward one Galactic disk field. Based on time-series photometry of 92,583 stars, 560 variable stars were detected with i magnitude ≤16.5 mag during eight days of observations; 339 of these are previously unknown variables. We tentatively classify the 560 variables as 285 eclipsing binaries (EW, EB, and EA), 27 pulsating variable stars ( δ Scuti, γ Doradus, δ Cephei variable, and RR Lyrae stars), and 248 other types of variables (unclassified periodic, multiperiodic, and aperiodic variable stars). Of the eclipsing binaries, 34 show O’Connell effects. One of the aperiodic variables shows a plateau light curve and another variable shows a secondary maximum after peak brightness. We also detected a complex binary system with an RS CVn-like light-curve morphology; this object is being followed-up spectroscopically using the Gemini South telescope.
Characterization of binary string statistics for syntactic landmine detection
Nasif, Ahmed O.; Mark, Brian L.; Hintz, Kenneth J.
2011-06-01
Syntactic landmine detection has been proposed to detect and classify non-metallic landmines using ground penetrating radar (GPR). In this approach, the GPR return is processed to extract characteristic binary strings for landmine and clutter discrimination. In our previous work, we discussed the preprocessing methodology by which the amplitude information of the GPR A-scan signal can be effectively converted into binary strings, which identify the impedance discontinuities in the signal. In this work, we study the statistical properties of the binary string space. In particular, we develop a Markov chain model to characterize the observed bit sequence of the binary strings. The state is defined as the number of consecutive zeros between two ones in the binarized A-scans. Since the strings are highly sparse (the number of zeros is much greater than the number of ones), defining the state this way leads to fewer number of states compared to the case where each bit is defined as a state. The number of total states is further reduced by quantizing the number of consecutive zeros. In order to identify the correct order of the Markov model, the mean square difference (MSD) between the transition matrices of mine strings and non-mine strings is calculated up to order four using training data. The results show that order one or two maximizes this MSD. The specification of the transition probabilities of the chain can be used to compute the likelihood of any given string. Such a model can be used to identify characteristic landmine strings during the training phase. These developments on modeling and characterizing the string statistics can potentially be part of a real-time landmine detection algorithm that identifies landmine and clutter in an adaptive fashion.
The True Ultracool Binary Fraction Using Spectral Binaries
Bardalez Gagliuffi, Daniella; Burgasser, Adam J.; Schmidt, Sarah J.; Gagné, Jonathan; Faherty, Jacqueline K.; Cruz, Kelle; Gelino, Chris
2018-01-01
Brown dwarfs bridge the gap between stars and giant planets. While the essential mechanisms governing their formation are not well constrained, binary statistics are a direct outcome of the formation process, and thus provide a means to test formation theories. Observational constraints on the brown dwarf binary fraction place it at 10 ‑ 20%, dominated by imaging studies (85% of systems) with the most common separation at 4 AU. This coincides with the resolution limit of state-of-the-art imaging techniques, suggesting that the binary fraction is underestimated. We have developed a separation-independent method to identify and characterize tightly-separated (dwarfs as spectral binaries by identifying traces of methane in the spectra of late-M and early-L dwarfs. Imaging follow-up of 17 spectral binaries yielded 3 (18%) resolved systems, corroborating the observed binary fraction, but 5 (29%) known binaries were missed, reinforcing the hypothesis that the short-separation systems are undercounted. In order to find the true binary fraction of brown dwarfs, we have compiled a volume-limited, spectroscopic sample of M7-L5 dwarfs and searched for T dwarf companions. In the 25 pc volume, 4 candidates were found, three of which are already confirmed, leading to a spectral binary fraction of 0.95 ± 0.50%, albeit for a specific combination of spectral types. To extract the true binary fraction and determine the biases of the spectral binary method, we have produced a binary population simulation based on different assumptions of the mass function, age distribution, evolutionary models and mass ratio distribution. Applying the correction fraction resulting from this method to the observed spectral binary fraction yields a true binary fraction of 27 ± 4%, which is roughly within 1σ of the binary fraction obtained from high resolution imaging studies, radial velocity and astrometric monitoring. This method can be extended to identify giant planet companions to young brown
Direct current hopping conductance along DNA chain
Institute of Scientific and Technical Information of China (English)
Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Li Ming-Jun
2007-01-01
This paper proposes a model of direct current(DC) electron hopping transport in DNA,in which DNA is considered as a binary one-dimensional disordered system.To quantitatively study the DC conductivity in DNA,it numerically calculates the DC conductivity of DNA chains with difierent parameter values.The result shows that the DC conductivity of DNA chain increases with the increase of temperature.And the conductivity of DNA chain is depended on the probability P.which represents the degree of compositional disorder in a DNA sequence to some extent.For P<0.5,the conductivity of DNA chain decreases with the increase of P,while for P≥0.5,the conductivity increases with the increase of p.The DC conductivity in DNA chain also varies with the change of the electric field,it presents non-Ohm's law conductivity characteristics.
Learning to assign binary weights to binary descriptor
Huang, Zhoudi; Wei, Zhenzhong; Zhang, Guangjun
2016-10-01
Constructing robust binary local feature descriptors are receiving increasing interest due to their binary nature, which can enable fast processing while requiring significantly less memory than their floating-point competitors. To bridge the performance gap between the binary and floating-point descriptors without increasing the computational cost of computing and matching, optimal binary weights are learning to assign to binary descriptor for considering each bit might contribute differently to the distinctiveness and robustness. Technically, a large-scale regularized optimization method is applied to learn float weights for each bit of the binary descriptor. Furthermore, binary approximation for the float weights is performed by utilizing an efficient alternatively greedy strategy, which can significantly improve the discriminative power while preserve fast matching advantage. Extensive experimental results on two challenging datasets (Brown dataset and Oxford dataset) demonstrate the effectiveness and efficiency of the proposed method.
A binary plasmid system for shuffling combinatorial antibody libraries.
Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A
1992-11-01
We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind antigen varied from 43% to 100% and depended strongly on the heavy-chain sequence. Such productive crosses resulted in a set of Fab fragments of similar apparent binding constants, which seemed to differ mainly in the amount of active Fab fragment produced in the bacterial cell. The dominance of the heavy chain in the antibody-antigen interaction was further explored in a set of directed crosses, in which heavy and light chains derived from antigen-specific clones were crossed with nonrelated heavy and light chains. In these crosses, an Fab fragment retained antigen binding only if it contained a heavy chain from an antigen-specific clone. In no case did the light chain confer detectable affinity when paired with indifferent heavy chains. The surprising promiscuity of heavy chains has ramifications for the evaluation of the diversity of combinatorial libraries made against protein antigens and should allow the combination of one such promiscuous heavy chain with an engineered light chain to form an Fab fragment carrying synthetic cofactors to assist in antibody catalysis.
Binary Linear-Time Erasure Decoding for Non-Binary LDPC codes
Savin, Valentin
2009-01-01
In this paper, we first introduce the extended binary representation of non-binary codes, which corresponds to a covering graph of the bipartite graph associated with the non-binary code. Then we show that non-binary codewords correspond to binary codewords of the extended representation that further satisfy some simplex-constraint: that is, bits lying over the same symbol-node of the non-binary graph must form a codeword of a simplex code. Applied to the binary erasure channel, this descript...
Evolution of massive close binaries and formation of neutron stars and black holes
International Nuclear Information System (INIS)
Massevitch, A.G.; Tutukov, A.V.; Yungelson, L.R.
1976-01-01
Main results of computations of evolution for massive close binaries (10 M(Sun)+9.4 M(Sun), 16 M(Sun)+15 M(Sun), 32 M(Sun)+30 M(Sun), 64 M(Sun)+60 M(Sun)) up to oxygen exhaustion in the core are described. Mass exchange starting in core hydrogen, shell hydrogen and core helium burning stages was studied. Computations were performed assuming both the Ledoux and Schwarzschild stability criteria for semiconvection. The influence of UFI-neutrino emission on evolution of close binaries was investigated. The results obtained allow to outline the following evolutionary chain: two detached Main-Sequence stars - mass exchange - Wolf-Rayet star or blue supergiant plus main sequence star - explosion of the initially more massive star appearing as a supernova event - collapsed or neutron star plus Main-Sequence star, that may be observed as a 'runaway star' - mass exchange leading to X-rays emission - collapsed or neutron star plus WR-star or blue supergiant - second explosion of supernova that preferentially disrupts the system and gives birth to two single high spatial velocity pulsars. Numerical estimates concerning the number and properties of WR-stars, pulsars and X-ray sources are presented. The results are in favour of the existence of UFI-neutrino and of the Ledoux criterion for describing semiconvection. Properties of several well-known X-ray sources and the binary pulsar are discussed on base of evolutionary chain of close binaries. (Auth.)
Bucci, Davide; Martin, Bruno; Morand, Alain
2012-03-01
This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.
DEFF Research Database (Denmark)
Keiding, Hans; Peleg, Bezalel
2006-01-01
is binary if it is rationalized by an acyclic binary relation. The foregoing result motivates our definition of a binary effectivity rule as the effectivity rule of some binary SCR. A binary SCR is regular if it satisfies unanimity, monotonicity, and independence of infeasible alternatives. A binary...
The search for massive black hole binaries with LISA
International Nuclear Information System (INIS)
Cornish, Neil J; Porter, Edward K
2007-01-01
In this work we focus on the search and detection of massive black hole binary (MBHB) systems, including systems at high redshift. As well as expanding on previous works where we used a variant of Markov chain Monte Carlo (MCMC), called Metropolis-Hastings Monte Carlo, with simulated annealing, we introduce a new search method based on frequency annealing which leads to a more rapid and robust detection. We compare the two search methods on systems where we do and do not see the merger of the black holes. In the non-merger case, we also examine the posterior distribution exploration using a 7D MCMC algorithm. We demonstrate that this method is effective in dealing with the high correlations between parameters, has a higher acceptance rate than previously proposed methods and produces posterior distribution functions that are close to the prediction from the Fisher information matrix. Finally, after carrying out searches where there is only one binary in the data stream, we examine the case where two black hole binaries are present in the same data stream. We demonstrate that our search algorithm can accurately recover both binaries, and more importantly showing that we can safely extract the MBHB sources without contaminating the rest of the data stream
Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups
Ward, Jonathan A.; Grindrod, Peter
2014-07-01
Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance
A methodology for stochastic analysis of share prices as Markov chains with finite states.
Mettle, Felix Okoe; Quaye, Enoch Nii Boi; Laryea, Ravenhill Adjetey
2014-01-01
Price volatilities make stock investments risky, leaving investors in critical position when uncertain decision is made. To improve investor evaluation confidence on exchange markets, while not using time series methodology, we specify equity price change as a stochastic process assumed to possess Markov dependency with respective state transition probabilities matrices following the identified state pace (i.e. decrease, stable or increase). We established that identified states communicate, and that the chains are aperiodic and ergodic thus possessing limiting distributions. We developed a methodology for determining expected mean return time for stock price increases and also establish criteria for improving investment decision based on highest transition probabilities, lowest mean return time and highest limiting distributions. We further developed an R algorithm for running the methodology introduced. The established methodology is applied to selected equities from Ghana Stock Exchange weekly trading data.
Gabriel, N E; Agman, N V; Roberts, M F
1987-11-17
Short-chain lecithin/long-chain phospholipid unilamellar vesicles (SLUVs), unlike pure long-chain lecithin vesicles, are excellent substrates for water-soluble phospholipases. Hemolysis assays show that greater than 99.5% of the short-chain lecithin is partitioned in the bilayer. In these binary component vesicles, the short-chain species is the preferred substrate, while the long-chain phospholipid can be treated as an inhibitor (phospholipase C) or poor substrate (phospholipase A2). For phospholipase C Bacillus cereus, apparent Km and Vmax values show that bilayer-solubilized diheptanoylphosphatidylcholine (diheptanoyl-PC) is nearly as good a substrate as pure micellar diheptanoyl-PC, although the extent of short-chain lecithin hydrolysis depends on the phase state of the long-chain lipid. For phospholipase A2 Naja naja naja, both Km and Vmax values show a greater range: in a gel-state matrix, diheptanoyl-PC is hydrolyzed with micellelike kinetic parameters; in a liquid-crystalline matrix, the short-chain lecithin becomes comparable to the long-chain component. Both enzymes also show an anomalous increase in specific activity toward diheptanoyl-PC around the phase transition temperature of the long-chain phospholipid. Since the short-chain lecithin does not exhibit a phase transition, this must reflect fluctuations in head-group area or vertical motions of the short-chain lecithin caused by surrounding long-chain lecithin molecules. These results are discussed in terms of a specific model for SLUV hydrolysis and a general explanation for the "interfacial activation" observed with water-soluble phospholipases.
The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns
Duarte, Fabiola; Lemus, Luis
2017-01-01
The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406
OPTIMIZATION-BASED APPROACH TO TILING OF FINITE AREAS WITH ARBITRARY SETS OF WANG TILES
Directory of Open Access Journals (Sweden)
Marek Tyburec
2017-11-01
Full Text Available Wang tiles proved to be a convenient tool for the design of aperiodic tilings in computer graphics and in materials engineering. While there are several algorithms for generation of finite-sized tilings, they exploit the specific structure of individual tile sets, which prevents their general usage. In this contribution, we reformulate the NP-complete tiling generation problem as a binary linear program, together with its linear and semidefinite relaxations suitable for the branch and bound method. Finally, we assess the performance of the established formulations on generations of several aperiodic tilings reported in the literature, and conclude that the linear relaxation is better suited for the problem.
A novel scenario of aperiodical impacts appearance in the turbine draft tube
Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.
2016-11-01
The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.
A New Algorithm of Shape Boundaries Based on Chain Coding
Directory of Open Access Journals (Sweden)
Zhao Xin
2017-01-01
Full Text Available A new method to obtain connected component in binary images is presented. The method uses DFA automaton to obtain chain code and label the component boundary. It is theoretically proved that the algorithm improves the image encoding efficiency closer to the lowest time consumption.
Simulation methods for multiperiodic and aperiodic nanostructured dielectric waveguides
DEFF Research Database (Denmark)
Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina
2017-01-01
on Rudin–Shapiro, Fibonacci, and Thue–Morse binary sequences. The near-field and far-field properties are computed employing the finite-element method (FEM), the finite-difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). The results show that all three methods...
Simulation Methods for Multiperiodic and Aperiodic Nanostructured Dielectric Waveguides
DEFF Research Database (Denmark)
Paulsen, Moritz; Neustock, Lars Thorben; Jahns, Sabrina
on Rudin-Shapiro, Fibonacci, and Thue-Morse binary sequences. The near-field and far-field properties are calculated employing the finite-element method (FEM), the finite- difference time-domain (FDTD) method as well as a rigorous coupled wave algorithm (RCWA). References [1] S. V. Boriskina, A. Gopinath...
Isometries and binary images of linear block codes over ℤ4 + uℤ4 and ℤ8 + uℤ8
Sison, Virgilio; Remillion, Monica
2017-10-01
Let {{{F}}}2 be the binary field and ℤ2 r the residue class ring of integers modulo 2 r , where r is a positive integer. For the finite 16-element commutative local Frobenius non-chain ring ℤ4 + uℤ4, where u is nilpotent of index 2, two weight functions are considered, namely the Lee weight and the homogeneous weight. With the appropriate application of these weights, isometric maps from ℤ4 + uℤ4 to the binary spaces {{{F}}}24 and {{{F}}}28, respectively, are established via the composition of other weight-based isometries. The classical Hamming weight is used on the binary space. The resulting isometries are then applied to linear block codes over ℤ4+ uℤ4 whose images are binary codes of predicted length, which may or may not be linear. Certain lower and upper bounds on the minimum distances of the binary images are also derived in terms of the parameters of the ℤ4 + uℤ4 codes. Several new codes and their images are constructed as illustrative examples. An analogous procedure is performed successfully on the ring ℤ8 + uℤ8, where u 2 = 0, which is a commutative local Frobenius non-chain ring of order 64. It turns out that the method is possible in general for the class of rings ℤ2 r + uℤ2 r , where u 2 = 0, for any positive integer r, using the generalized Gray map from ℤ2 r to {{{F}}}2{2r-1}.
Ordering Strategy Analysis of Prefabricated Component Manufacturer in Construction Supply Chain
Yang, Hongxiong; Chung, Jacky K. H.; Chen, Yuhong; Pan, Yifan; Mei, Zhiling; Sun, Xiongle
2018-01-01
Firstly, the characteristics and present situations of the prefabricated construction supply chain are analyzed; inventory cost models for construction material of every phase order, one-off order, and fractionated order are built based on traditional EOQ model and construction supply chain theory. Next, the order decision is represented in binary numbers 0 and 1, in which 0 stands for “no order” and 1 for “order.” The analysis uses the genetic algorithm, sets the objective function, and unde...
Pulsars in binary systems: probing binary stellar evolution and general relativity.
Stairs, Ingrid H
2004-04-23
Radio pulsars in binary orbits often have short millisecond spin periods as a result of mass transfer from their companion stars. They therefore act as very precise, stable, moving clocks that allow us to investigate a large set of otherwise inaccessible astrophysical problems. The orbital parameters derived from high-precision binary pulsar timing provide constraints on binary evolution, characteristics of the binary pulsar population, and the masses of neutron stars with different mass-transfer histories. These binary systems also test gravitational theories, setting strong limits on deviations from general relativity. Surveys for new pulsars yield new binary systems that increase our understanding of all these fields and may open up whole new areas of physics, as most spectacularly evidenced by the recent discovery of an extremely relativistic double-pulsar system.
Renormalization group treatment for spin waves in the randomly disordered Heisenberg chain
International Nuclear Information System (INIS)
Chaves, C.M.; Koiller, B.
1983-03-01
Local densities of states in the randomly disordered binary quantum Heisenberg chain using a generalization of a recently developed approach based on renormalization group ideas are calculated. It envolves decimating alternate apins along the chain in such a way as to obtain recursion relations to describe the renormalized set of Green's function equations of motion. The densities of states are richly structured, indicating that the method takes into account compositional fluctuations of arbitrary range. (Author) [pt
Memory functions and correlations in additive binary Markov chains
Energy Technology Data Exchange (ETDEWEB)
Melnyk, S S [A Ya Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Usatenko, O V [A Ya Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Yampol' skii, V A [A Ya Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Apostolov, S S [V N Karazin Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine); Maiselis, Z A [V N Karazin Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine)
2006-11-17
A theory of additive Markov chains with a long-range memory, proposed earlier in Usatenko et al (2003 Phys. Rev. E 68 061107), is developed and used to describe statistical properties of long-range correlated systems. The convenient characteristics of such systems, memory functions and their relation to the correlation properties of the systems are examined. Various methods for finding the memory function via the correlation function are proposed. The inverse problem (calculation of the correlation function by means of the prescribed memory function) is also solved. This is demonstrated for the analytically solvable model of the system with a step-wise memory function.
Memory functions and correlations in additive binary Markov chains
International Nuclear Information System (INIS)
Melnyk, S S; Usatenko, O V; Yampol'skii, V A; Apostolov, S S; Maiselis, Z A
2006-01-01
A theory of additive Markov chains with a long-range memory, proposed earlier in Usatenko et al (2003 Phys. Rev. E 68 061107), is developed and used to describe statistical properties of long-range correlated systems. The convenient characteristics of such systems, memory functions and their relation to the correlation properties of the systems are examined. Various methods for finding the memory function via the correlation function are proposed. The inverse problem (calculation of the correlation function by means of the prescribed memory function) is also solved. This is demonstrated for the analytically solvable model of the system with a step-wise memory function
Noll, K. S.
2017-12-01
The Jupiter Trojans, in the context of giant planet migration models, can be thought of as an extension of the small body populations found beyond Neptune in the Kuiper Belt. Binaries are a distinctive feature of small body populations in the Kuiper Belt with an especially high fraction apparent among the brightest Cold Classicals. The binary fraction, relative sizes, and separations in the dynamically excited populations (Scattered, Resonant) reflects processes that may have eroded a more abundant initial population. This trend continues in the Centaurs and Trojans where few binaries have been found. We review new evidence including a third resolved Trojan binary and lightcurve studies to understand how the Trojans are related to the small body populations that originated in the outer protoplanetary disk.
Testing the Binary Black Hole Nature of a Compact Binary Coalescence.
Krishnendu, N V; Arun, K G; Mishra, Chandra Kant
2017-09-01
We propose a novel method to test the binary black hole nature of compact binaries detectable by gravitational wave (GW) interferometers and, hence, constrain the parameter space of other exotic compact objects. The spirit of the test lies in the "no-hair" conjecture for black holes where all properties of a Kerr black hole are characterized by its mass and spin. The method relies on observationally measuring the quadrupole moments of the compact binary constituents induced due to their spins. If the compact object is a Kerr black hole (BH), its quadrupole moment is expressible solely in terms of its mass and spin. Otherwise, the quadrupole moment can depend on additional parameters (such as the equation of state of the object). The higher order spin effects in phase and amplitude of a gravitational waveform, which explicitly contains the spin-induced quadrupole moments of compact objects, hence, uniquely encode the nature of the compact binary. Thus, we argue that an independent measurement of the spin-induced quadrupole moment of the compact binaries from GW observations can provide a unique way to distinguish binary BH systems from binaries consisting of exotic compact objects.
Binary Masking & Speech Intelligibility
DEFF Research Database (Denmark)
Boldt, Jesper
The purpose of this thesis is to examine how binary masking can be used to increase intelligibility in situations where hearing impaired listeners have difficulties understanding what is being said. The major part of the experiments carried out in this thesis can be categorized as either experime......The purpose of this thesis is to examine how binary masking can be used to increase intelligibility in situations where hearing impaired listeners have difficulties understanding what is being said. The major part of the experiments carried out in this thesis can be categorized as either...... experiments under ideal conditions or as experiments under more realistic conditions useful for real-life applications such as hearing aids. In the experiments under ideal conditions, the previously defined ideal binary mask is evaluated using hearing impaired listeners, and a novel binary mask -- the target...... binary mask -- is introduced. The target binary mask shows the same substantial increase in intelligibility as the ideal binary mask and is proposed as a new reference for binary masking. In the category of real-life applications, two new methods are proposed: a method for estimation of the ideal binary...
Sahade, Jorge; Ter Haar, D
1978-01-01
Interacting Binary Stars deals with the development, ideas, and problems in the study of interacting binary stars. The book consolidates the information that is scattered over many publications and papers and gives an account of important discoveries with relevant historical background. Chapters are devoted to the presentation and discussion of the different facets of the field, such as historical account of the development in the field of study of binary stars; the Roche equipotential surfaces; methods and techniques in space astronomy; and enumeration of binary star systems that are studied
Zheng, Mengge; Chao, Chen; Yu, Jinglin; Copeland, Les; Wang, Shuo; Wang, Shujun
2018-02-28
The effects of chain length and degree of unsaturation of fatty acids (FAs) on structure and in vitro digestibility of starch-protein-FA complexes were investigated in model systems. Studies with the rapid visco analyzer (RVA) showed that the formation of ternary complex resulted in higher viscosities than those of binary complex during the cooling and holding stages. The results of differential scanning calorimetry (DSC), Raman, and X-ray diffraction (XRD) showed that the structural differences for ternary complexes were much less than those for binary complexes. Starch-protein-FA complexes presented lower in vitro enzymatic digestibility compared with starch-FAs complexes. We conclude that shorter chain and lower unsaturation FAs favor the formation of ternary complexes but decrease the thermal stability of these complexes. FAs had a smaller effect on the ordered structures of ternary complexes than on those of binary complexes and little effect on enzymatic digestibility of both binary and ternary complexes.
Shivokhin, Maksim E.
2017-05-30
We propose and verify methods based on the slip-spring (SSp) model [ Macromolecules 2005, 38, 14 ] for predicting the effect of any monodisperse, binary, or ternary environment of topological constraints on the relaxation of the end-to-end vector of a linear probe chain. For this purpose we first validate the ability of the model to consistently predict both the viscoelastic and dielectric response of monodisperse and binary mixtures of type A polymers, based on published experimental data. We also report the synthesis of new binary and ternary polybutadiene systems, the measurement of their linear viscoelastic response, and the prediction of these data by the SSp model. We next clarify the relaxation mechanisms of probe chains in these constraint release (CR) environments by analyzing a set of "toy" SSp models with simplified constraint release rates, by examining fluctuations of the end-to-end vector. In our analysis, the longest relaxation time of the probe chain is determined by a competition between the longest relaxation times of the effective CR motions of the fat and thin tubes and the motion of the chain itself in the thin tube. This picture is tested by the analysis of four model systems designed to separate and estimate every single contribution involved in the relaxation of the probe\\'s end-to-end vector in polydisperse systems. We follow the CR picture of Viovy et al. [ Macromolecules 1991, 24, 3587 ] and refine the effective chain friction in the thin and fat tubes based on Read et al. [ J. Rheol. 2012, 56, 823 ]. The derived analytical equations form a basis for generalizing the proposed methodology to polydisperse mixtures of linear and branched polymers. The consistency between the SSp model and tube model predictions is a strong indicator of the compatibility between these two distinct mesoscopic frameworks.
Entropy of finite random binary sequences with weak long-range correlations.
Melnik, S S; Usatenko, O V
2014-11-01
We study the N-step binary stationary ergodic Markov chain and analyze its differential entropy. Supposing that the correlations are weak we express the conditional probability function of the chain through the pair correlation function and represent the entropy as a functional of the pair correlator. Since the model uses the two-point correlators instead of the block probability, it makes it possible to calculate the entropy of strings at much longer distances than using standard methods. A fluctuation contribution to the entropy due to finiteness of random chains is examined. This contribution can be of the same order as its regular part even at the relatively short lengths of subsequences. A self-similar structure of entropy with respect to the decimation transformations is revealed for some specific forms of the pair correlation function. Application of the theory to the DNA sequence of the R3 chromosome of Drosophila melanogaster is presented.
Excess Molar Volume of Binary Mixtures of Methylheptenone+Alkanols at 298.15 K
Institute of Scientific and Technical Information of China (English)
无
2002-01-01
Excess molar volume(VE) data on binary liquid mixtures of methylheptenone (MHO) with methanol, ethanol, n-propanol or n-butanol have been determined from the density measurements at 298.15 K and atmospheric pressure. The values of VE in all the systems over the entire composition range are quantified by the Redlich-Kister equation. The effects of the chain length of alkanols on VE are discussed.
Full Ionisation In Binary-Binary Encounters With Small Positive Energies
Sweatman, W. L.
2006-08-01
Interactions between binary stars and single stars and binary stars and other binary stars play a key role in the dynamics of a dense stellar system. Energy can be transferred between the internal dynamics of a binary and the larger scale dynamics of the interacting objects. Binaries can be destroyed and created by the interaction. In a binary-binary encounter, full ionisation occurs when both of the binary stars are destroyed in the interaction to create four single stars. This is only possible when the total energy of the system is positive. For very small energies the probability of this occurring is very low and it tends towards zero as the total energy tends towards zero. Here the case is considered for which all the stars have equal masses. An asymptotic power law is predicted relating the probability of full ionisation with the total energy when this latter quantity is small. The exponent, which is approximately 2.31, is compared with the results from numerical scattering experiments. The theoretical approach taken is similar to one used previously in the three-body problem. It makes use of the fact that the most dramatic changes in scale and energies of a few-body system occur when its components pass near to a central configuration. The position, and number, of these configurations is not known for the general four-body problem, however, with equal masses there are known to be exactly five different cases. Separate consideration and comparison of the properties of orbits close to each of these five central configurations enables the prediction of the form of the cross-section for full ionisation for the case of small positive total energy. This is the relation between total energy and the probability of total ionisation described above.
CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. I. S-TYPE BINARIES
Energy Technology Data Exchange (ETDEWEB)
Kaltenegger, Lisa [MPIA, Koenigstuhl 17, D-69117 Heidelberg (Germany); Haghighipour, Nader, E-mail: kaltenegger@mpia.de [Institute for Astronomy and NASA Astrobiology Institute, University of Hawaii-Manoa, Honolulu, HI 96822 (United States)
2013-11-10
We have developed a comprehensive methodology for calculating the boundaries of the habitable zone (HZ) of planet-hosting S-type binary star systems. Our approach is general and takes into account the contribution of both stars to the location and extent of the binary HZ with different stellar spectral types. We have studied how the binary eccentricity and stellar energy distribution affect the extent of the HZ. Results indicate that in binaries where the combination of mass-ratio and orbital eccentricity allows planet formation around a star of the system to proceed successfully, the effect of a less luminous secondary on the location of the primary's HZ is generally negligible. However, when the secondary is more luminous, it can influence the extent of the HZ. We present the details of the derivations of our methodology and discuss its application to the binary HZ around the primary and secondary main-sequence stars of an FF, MM, and FM binary, as well as two known planet-hosting binaries α Cen AB and HD 196886.
CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. I. S-TYPE BINARIES
International Nuclear Information System (INIS)
Kaltenegger, Lisa; Haghighipour, Nader
2013-01-01
We have developed a comprehensive methodology for calculating the boundaries of the habitable zone (HZ) of planet-hosting S-type binary star systems. Our approach is general and takes into account the contribution of both stars to the location and extent of the binary HZ with different stellar spectral types. We have studied how the binary eccentricity and stellar energy distribution affect the extent of the HZ. Results indicate that in binaries where the combination of mass-ratio and orbital eccentricity allows planet formation around a star of the system to proceed successfully, the effect of a less luminous secondary on the location of the primary's HZ is generally negligible. However, when the secondary is more luminous, it can influence the extent of the HZ. We present the details of the derivations of our methodology and discuss its application to the binary HZ around the primary and secondary main-sequence stars of an FF, MM, and FM binary, as well as two known planet-hosting binaries α Cen AB and HD 196886
Inference on white dwarf binary systems using the first round Mock LISA Data Challenges data sets
International Nuclear Information System (INIS)
Stroeer, Alexander; Veitch, John; Roever, Christian; Bloomer, Ed; Clark, James; Christensen, Nelson; Hendry, Martin; Messenger, Chris; Meyer, Renate; Pitkin, Matthew; Toher, Jennifer; Umstaetter, Richard; Vecchio, Alberto; Woan, Graham
2007-01-01
We report on the analysis of selected single source data sets from the first round of the mock LISA data challenges (MLDC) for white dwarf binaries. We implemented an end-to-end pipeline consisting of a grid-based coherent pre-processing unit for signal detection and an automatic Markov Chain Monte Carlo (MCMC) post-processing unit for signal evaluation. We demonstrate that signal detection with our coherent approach is secure and accurate, and is increased in accuracy and supplemented with additional information on the signal parameters by our Markov Chain Monte Carlo approach. We also demonstrate that the Markov Chain Monte Carlo routine is additionally able to determine accurately the noise level in the frequency window of interest
Black holes and neutron stars: evolution of binary systems
International Nuclear Information System (INIS)
Kraft, R.P.
1975-01-01
Evidence for the existence of neutron stars and black holes in binary systems has been reviewed, and the following summarizes the current situation: (1) No statistically significant case has been made for the proposition that black holes and/or neutron stars contribute to the population of unseen companions of ordinary spectroscopic binaries; (2) Plausible evolutionary scenarios can be advanced that place compact X-ray sources into context as descendants of several common types of mass-exchange binaries. The collapse object may be a black hole, a neutron star, or a white dwarf, depending mostly on the mass of the original primary; (3) The rotating neutron star model for the pulsating X-ray sources Her X-1 and Cen X-3 is the simplest interpretation of these objects, but the idea that the pulsations result from the non-radial oscillations of a white dwarf cannot be altogether dismissed. The latter is particularly attractive in the case of Her X-1 because the total mass of the system is small; (4) The black hole picture for Cyg X-1 represents the simplest model that can presently be put forward to explain the observations. This does not insure its correctness, however. The picture depends on a long chain of inferences, some of which are by no means unassailable. (Auth.)
Shore, S N; van den Heuvel, EPJ
1994-01-01
This volume contains lecture notes presented at the 22nd Advanced Course of the Swiss Society for Astrophysics and Astronomy. The contributors deal with symbiotic stars, cataclysmic variables, massive binaries and X-ray binaries, in an attempt to provide a better understanding of stellar evolution.
The structure of n-alkane binary mixtures adsorbed on graphite
International Nuclear Information System (INIS)
Espeau, Philippe; White, John W.; Papoular, Robert J.
2005-01-01
The thermodynamics and structure of the surface adsorbed phase in binary C15-C16 and C15-C17 n-alkane mixtures confined in graphite pores have been studied by differential scanning calorimetry and small-angle X-ray scattering. The previously observed selective adsorption of the longer alkane for chain length differences greater than five carbon atoms is verified but reduced for chain length differences less than or equal to two. With a difference in chain length of one carbon atom, Vegard's law is followed for the melting points of the adsorbed mixture and the (0 2) d-spacing is a continuous function of the mole fraction x. With a two-carbon atom difference, samples aged for 1 week have a lamellar structure for which the entities A 1-x B x try to be commensurate with the substrate. The same samples aged for 1 month show a continuous parabolic x-dependence for both the melting points and the d-spacings. An explanation in terms of selective probability of adsorption is proposed based on crystallographic considerations
The structure of n-alkane binary mixtures adsorbed on graphite
Energy Technology Data Exchange (ETDEWEB)
Espeau, Philippe [Laboratoire de Chimie Physique et Minerale, Faculte de Pharmacie, Universite Rene Descartes-Paris V, F-75006 Paris (France)]. E-mail: philippe.espeau@univ-paris5.fr; White, John W. [Research School of Chemistry, Australian National University, Canberra, ACT 0200 (Australia); Papoular, Robert J. [Laboratoire Leon Brillouin, CEA-CEN Saclay, F-91191 Gif-sur-Yvette Cedex (France)
2005-12-15
The thermodynamics and structure of the surface adsorbed phase in binary C15-C16 and C15-C17 n-alkane mixtures confined in graphite pores have been studied by differential scanning calorimetry and small-angle X-ray scattering. The previously observed selective adsorption of the longer alkane for chain length differences greater than five carbon atoms is verified but reduced for chain length differences less than or equal to two. With a difference in chain length of one carbon atom, Vegard's law is followed for the melting points of the adsorbed mixture and the (0 2) d-spacing is a continuous function of the mole fraction x. With a two-carbon atom difference, samples aged for 1 week have a lamellar structure for which the entities A{sub 1-x}B {sub x} try to be commensurate with the substrate. The same samples aged for 1 month show a continuous parabolic x-dependence for both the melting points and the d-spacings. An explanation in terms of selective probability of adsorption is proposed based on crystallographic considerations.
Energy Technology Data Exchange (ETDEWEB)
Takahashi, Hiroshi [Department of Physics, Gunma University, Maebashi, Gunma (Japan)
2001-03-01
Trehalose protects cells and proteins against various stresses due to low temperatures or dryness. In order to clarify the molecular mechanism of cryoprotective function of trehalose, we have studied the interaction between trehalose and phosphatidylcholine (PC) which is a main lipid component of cell membranes. In this study, the structural change of a binary PC mixture by the presence of trehalose was investigated by means of small angle neutron scattering. The PC binary mixture studied contains dihexanoyl-PC (diC{sub 6}PC) and dihexadecy-PC (DHPC). The former has short hydrocarbon chains and the latter has long hydrocarbon chains. The scattering profiles from the DHPC/diC{sub 6}PC mixture were changed, depending on trehalose concentrations. This change can be interpreted as suggesting that the presence of trehalose reduces the interfacial area between water and PCs. (author)
Eclipsing binaries in open clusters
DEFF Research Database (Denmark)
Southworth, John; Clausen, J.V.
2006-01-01
Stars: fundamental parameters - Stars : binaries : eclipsing - Stars: Binaries: spectroscopic - Open clusters and ass. : general Udgivelsesdato: 5 August......Stars: fundamental parameters - Stars : binaries : eclipsing - Stars: Binaries: spectroscopic - Open clusters and ass. : general Udgivelsesdato: 5 August...
CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. II. P-TYPE BINARIES
International Nuclear Information System (INIS)
Haghighipour, Nader; Kaltenegger, Lisa
2013-01-01
We have developed a comprehensive methodology for calculating the circumbinary habitable zone (HZ) in planet-hosting P-type binary star systems. We present a general formalism for determining the contribution of each star of the binary to the total flux received at the top of the atmosphere of an Earth-like planet and use the Sun's HZ to calculate the inner and outer boundaries of the HZ around a binary star system. We apply our calculations to the Kepler's currently known circumbinary planetary systems and show the combined stellar flux that determines the boundaries of their HZs. We also show that the HZ in P-type systems is dynamic and, depending on the luminosity of the binary stars, their spectral types, and the binary eccentricity, its boundaries vary as the stars of the binary undergo their orbital motion. We present the details of our calculations and discuss the implications of the results
CALCULATING THE HABITABLE ZONE OF BINARY STAR SYSTEMS. II. P-TYPE BINARIES
Energy Technology Data Exchange (ETDEWEB)
Haghighipour, Nader [Institute for Astronomy and NASA Astrobiology Institute, University of Hawaii-Manoa, Honolulu, HI 96822 (United States); Kaltenegger, Lisa [MPIA, Koenigstuhl 17, Heidelberg, D-69117 (Germany)
2013-11-10
We have developed a comprehensive methodology for calculating the circumbinary habitable zone (HZ) in planet-hosting P-type binary star systems. We present a general formalism for determining the contribution of each star of the binary to the total flux received at the top of the atmosphere of an Earth-like planet and use the Sun's HZ to calculate the inner and outer boundaries of the HZ around a binary star system. We apply our calculations to the Kepler's currently known circumbinary planetary systems and show the combined stellar flux that determines the boundaries of their HZs. We also show that the HZ in P-type systems is dynamic and, depending on the luminosity of the binary stars, their spectral types, and the binary eccentricity, its boundaries vary as the stars of the binary undergo their orbital motion. We present the details of our calculations and discuss the implications of the results.
MCMC exploration of supermassive black hole binary inspirals
International Nuclear Information System (INIS)
Cornish, Neil J; Porter, Edward K
2006-01-01
The Laser Interferometer Space Antenna will be able to detect the inspiral and merger of super massive black hole binaries (SMBHBs) anywhere in the universe. Standard matched filtering techniques can be used to detect and characterize these systems. Markov Chain Monte Carlo (MCMC) methods are ideally suited to this and other LISA data analysis problems as they are able to efficiently handle models with large dimensions. Here we compare the posterior parameter distributions derived by an MCMC algorithm with the distributions predicted by the Fisher information matrix. We find excellent agreement for the extrinsic parameters, while the Fisher matrix slightly overestimates errors in the intrinsic parameters
VISCOSITY OF BINARY NON-ELECTROLYTE LIQUID MIXTURES: PREDICTION AND CORRELATION
Directory of Open Access Journals (Sweden)
Mirjana Lj. Kijevčanin
2008-11-01
Full Text Available The viscosity of 31 binary liquid mixtures containing diverse groups of organic compounds, determined at atmospheric pressure: alcohols, alkanes (cyclo and aliphatic, esters, aromatics, ketones etc., were calculated using two different approaches, correlative (with Teja-Rice and McAllister models and predictive by group contribution models (UNIFAC-VISCO, ASOG-VISCO and Grunberg-Nissan. The obtained results were analysed in terms of the applied approach and model, the structure of the investigated mixtures, the nature of components of the mixtures and the influence of alkyl chain length of the alcohol molecule.
International Nuclear Information System (INIS)
Larsson-Leander, G.
1979-01-01
Studies of close binary stars are being persued more vigorously than ever, with about 3000 research papers and notes pertaining to the field being published during the triennium 1976-1978. Many major advances and spectacular discoveries were made, mostly due to increased observational efficiency and precision, especially in the X-ray, radio, and ultraviolet domains. Progress reports are presented in the following areas: observational techniques, methods of analyzing light curves, observational data, physical data, structure and models of close binaries, statistical investigations, and origin and evolution of close binaries. Reports from the Coordinates Programs Committee, the Committee for Extra-Terrestrial Observations and the Working Group on RS CVn binaries are included. (Auth./C.F.)
Massive Black Hole Binary Evolution
Directory of Open Access Journals (Sweden)
Merritt David
2005-11-01
Full Text Available Coalescence of binary supermassive black holes (SBHs would constitute the strongest sources of gravitational waves to be observed by LISA. While the formation of binary SBHs during galaxy mergers is almost inevitable, coalescence requires that the separation between binary components first drop by a few orders of magnitude, due presumably to interaction of the binary with stars and gas in a galactic nucleus. This article reviews the observational evidence for binary SBHs and discusses how they would evolve. No completely convincing case of a bound, binary SBH has yet been found, although a handful of systems (e.g. interacting galaxies; remnants of galaxy mergers are now believed to contain two SBHs at projected separations of <~ 1kpc. N-body studies of binary evolution in gas-free galaxies have reached large enough particle numbers to reproduce the slow, “diffusive” refilling of the binary’s loss cone that is believed to characterize binary evolution in real galactic nuclei. While some of the results of these simulations - e.g. the binary hardening rate and eccentricity evolution - are strongly N-dependent, others - e.g. the “damage” inflicted by the binary on the nucleus - are not. Luminous early-type galaxies often exhibit depleted cores with masses of ~ 1-2 times the mass of their nuclear SBHs, consistent with the predictions of the binary model. Studies of the interaction of massive binaries with gas are still in their infancy, although much progress is expected in the near future. Binary coalescence has a large influence on the spins of SBHs, even for mass ratios as extreme as 10:1, and evidence of spin-flips may have been observed.
Predicting the Solubility of 1,1-Difluoroethane in Polystyrene Using the Perturbed Soft Chain Theory
DEFF Research Database (Denmark)
Pretel, Eduardo; Hong, Seong-Uk
1998-01-01
In this study, the solubility of 1,1-difluoroethane in polystyrene was correlated and predicted using the Perturbed Soft Chain Theory (PSCT) and compared with experimental data from the literature. For correlation, a binary interaction parameter was determined by using experimental solubility data...
The phase behavior of a hard sphere chain model of a binary n-alkane mixture
International Nuclear Information System (INIS)
Malanoski, A. P.; Monson, P. A.
2000-01-01
Monte Carlo computer simulations have been used to study the solid and fluid phase properties as well as phase equilibrium in a flexible, united atom, hard sphere chain model of n-heptane/n-octane mixtures. We describe a methodology for calculating the chemical potentials for the components in the mixture based on a technique used previously for atomic mixtures. The mixture was found to conform accurately to ideal solution behavior in the fluid phase. However, much greater nonidealities were seen in the solid phase. Phase equilibrium calculations indicate a phase diagram with solid-fluid phase equilibrium and a eutectic point. The components are only miscible in the solid phase for dilute solutions of the shorter chains in the longer chains. (c) 2000 American Institute of Physics
Shivokhin, Maksim E.; Read, Daniel J.; Kouloumasis, Dimitris; Kocen, Rok; Zhuge, Flanco; Bailly, Christian; Hadjichristidis, Nikolaos; Likhtman, Alexei E.
2017-01-01
of a linear probe chain. For this purpose we first validate the ability of the model to consistently predict both the viscoelastic and dielectric response of monodisperse and binary mixtures of type A polymers, based on published experimental data. We
International Nuclear Information System (INIS)
An Lingling; Jing Min; Xiao Bo; Bai Xiao-Yan; Zhao Ke-Qing; Zeng Qing-Dao
2016-01-01
Disk-like liquid crystals (DLCs) can self-assemble to ordered columnar mesophases and are intriguing one-dimensional organic semiconductors with high charge carrier mobility. To improve their applicable property of mesomorphic temperature ranges, we exploit the binary mixtures of electronic donor-acceptor DLC materials. The electron-rich 2,3,6,7,10,11-hexakis(alkoxy)triphenylenes (C4, C6, C8, C10, C12) and an electron-deficient tetrapentyl triphenylene-2,3,6,10-tetracarboxylate have been prepared and their binary mixtures have been investigated. The mesomorphism of the 1:1 (molar ratio) mixtures has been characterized by polarizing optical microscopy (POM), differential scanning calorimetry (DSC), and small angel x-ray scattering (SAXS). The self-assembled monolayer structure of a discogen on a solid-liquid interface has been imaged by the high resolution scanning tunneling microscopy (STM). The match of peripheral chain length has important influence on the mesomorphism of the binary mixtures. (special topic)
Transportation and concentration inequalities for bifurcating Markov chains
DEFF Research Database (Denmark)
Penda, S. Valère Bitseki; Escobar-Bach, Mikael; Guillin, Arnaud
2017-01-01
We investigate the transportation inequality for bifurcating Markov chains which are a class of processes indexed by a regular binary tree. Fitting well models like cell growth when each individual gives birth to exactly two offsprings, we use transportation inequalities to provide useful...... concentration inequalities.We also study deviation inequalities for the empirical means under relaxed assumptions on the Wasserstein contraction for the Markov kernels. Applications to bifurcating nonlinear autoregressive processes are considered for point-wise estimates of the non-linear autoregressive...
The fate of close encounters between binary stars and binary supermassive black holes
Wang, Yi-Han; Leigh, Nathan; Yuan, Ye-Fei; Perna, Rosalba
2018-04-01
The evolution of main-sequence binaries that reside in the Galactic Centre can be heavily influenced by the central supermassive black hole (SMBH). Due to these perturbative effects, the stellar binaries in dense environments are likely to experience mergers, collisions, or ejections through secular and/or non-secular interactions. More direct interactions with the central SMBH are thought to produce hypervelocity stars (HVSs) and tidal disruption events (TDEs). In this paper, we use N-body simulations to study the dynamics of stellar binaries orbiting a central SMBH primary with an outer SMBH secondary orbiting this inner triple. The effects of the secondary SMBH on the event rates of HVSs, TDEs, and stellar mergers are investigated, as a function of the SMBH-SMBH binary mass ratio. Our numerical experiments reveal that, relative to the isolated SMBH case, the TDE and HVS rates are enhanced for, respectively, the smallest and largest mass ratio SMBH-SMBH binaries. This suggests that the observed event rates of TDEs and HVSs have the potential to serve as a diagnostic of the mass ratio of a central SMBH-SMBH binary. The presence of a secondary SMBH also allows for the creation of hypervelocity binaries. Observations of these systems could thus constrain the presence of a secondary SMBH in the Galactic Centre.
Utomo, P.H.; Makarim, R.H.
2017-01-01
A Binary puzzle is a Sudoku-like puzzle with values in each cell taken from the set {0,1} {0,1}. Let n≥4 be an even integer, a solved binary puzzle is an n×n binary array that satisfies the following conditions: (1) no three consecutive ones and no three consecutive zeros in each row and each
Microcontroller-based binary integrator for millimeter-wave radar experiments.
Eskelinen, Pekka; Ruoskanen, Jukka; Peltonen, Jouni
2010-05-01
An easily on-site reconfigurable multiple binary integrator for millimeter radar experiments has been constructed of static random access memories, an eight bit microcontroller, and high speed video operational amplifiers. The design uses a raw comparator path and two adjustable m-out-of-n chains in a wired-OR configuration. Standard high speed memories allow the use of pulse widths below 100 ns. For eight pulse repetition intervals it gives a maximum improvement of 6.6 dB for stationary low-level target echoes. The doubled configuration enhances the capability against fluctuating targets. Because of the raw comparator path, also single return pulses of relatively high amplitude are processed.
Ramanaiah, S.; Rao, C. Narasimha; Nagaraja, P.; Venkateswarlu, P.
2015-11-01
Exces volumes, VE, and excess isentropic compressibilities, κSE, have been reported as a function of composition for binary liquid mixtures of trichloroethylene with ethyl acetate, n-propyl acetate, and n-butyl acetate at 303.15 K. Isentropic compressibilities are calculated using measured sound speeds and density data for pure components and for binary mixtures. Excess volumes and excess isentropic compressibilities are found to be negative for the three systems studied over the entire composition range at 303.15 K, whereas these values become more negative with an increase of carbon chain length. The results are discussed in terms of intermolecular interactions between unlike molecules.
Relativistic Binaries in Globular Clusters
Directory of Open Access Journals (Sweden)
Matthew J. Benacquista
2013-03-01
Full Text Available Galactic globular clusters are old, dense star systems typically containing 10^4 – 10^6 stars. As an old population of stars, globular clusters contain many collapsed and degenerate objects. As a dense population of stars, globular clusters are the scene of many interesting close dynamical interactions between stars. These dynamical interactions can alter the evolution of individual stars and can produce tight binary systems containing one or two compact objects. In this review, we discuss theoretical models of globular cluster evolution and binary evolution, techniques for simulating this evolution that leads to relativistic binaries, and current and possible future observational evidence for this population. Our discussion of globular cluster evolution will focus on the processes that boost the production of tight binary systems and the subsequent interaction of these binaries that can alter the properties of both bodies and can lead to exotic objects. Direct N-body integrations and Fokker–Planck simulations of the evolution of globular clusters that incorporate tidal interactions and lead to predictions of relativistic binary populations are also discussed. We discuss the current observational evidence for cataclysmic variables, millisecond pulsars, and low-mass X-ray binaries as well as possible future detection of relativistic binaries with gravitational radiation.
DEFF Research Database (Denmark)
Brodal, Gerth Stølting; Moruz, Gabriel
2006-01-01
It is well-known that to minimize the number of comparisons a binary search tree should be perfectly balanced. Previous work has shown that a dominating factor over the running time for a search is the number of cache faults performed, and that an appropriate memory layout of a binary search tree...... can reduce the number of cache faults by several hundred percent. Motivated by the fact that during a search branching to the left or right at a node does not necessarily have the same cost, e.g. because of branch prediction schemes, we in this paper study the class of skewed binary search trees....... For all nodes in a skewed binary search tree the ratio between the size of the left subtree and the size of the tree is a fixed constant (a ratio of 1/2 gives perfect balanced trees). In this paper we present an experimental study of various memory layouts of static skewed binary search trees, where each...
Binary optics: Trends and limitations
Farn, Michael W.; Veldkamp, Wilfrid B.
1993-01-01
We describe the current state of binary optics, addressing both the technology and the industry (i.e., marketplace). With respect to the technology, the two dominant aspects are optical design methods and fabrication capabilities, with the optical design problem being limited by human innovation in the search for new applications and the fabrication issue being limited by the availability of resources required to improve fabrication capabilities. With respect to the industry, the current marketplace does not favor binary optics as a separate product line and so we expect that companies whose primary purpose is the production of binary optics will not represent the bulk of binary optics production. Rather, binary optics' more natural role is as an enabling technology - a technology which will directly result in a competitive advantage in a company's other business areas - and so we expect that the majority of binary optics will be produced for internal use.
Spread-spectrum communication using binary spatiotemporal chaotic codes
International Nuclear Information System (INIS)
Wang Xingang; Zhan Meng; Gong Xiaofeng; Lai, C.H.; Lai, Y.-C.
2005-01-01
We propose a scheme to generate binary code for baseband spread-spectrum communication by using a chain of coupled chaotic maps. We compare the performances of this type of spatiotemporal chaotic code with those of a conventional code used frequently in digital communication, the Gold code, and demonstrate that our code is comparable or even superior to the Gold code in several key aspects: security, bit error rate, code generation speed, and the number of possible code sequences. As the field of communicating with chaos faces doubts in terms of performance comparison with conventional digital communication schemes, our work gives a clear message that communicating with chaos can be advantageous and it deserves further attention from the nonlinear science community
Wijers, R.A.M.J.
1996-01-01
Introduction Distinguishing neutron stars and black holes Optical companions and dynamical masses X-ray signatures of the nature of a compact object Structure and evolution of black-hole binaries High-mass black-hole binaries Low-mass black-hole binaries Low-mass black holes Formation of black holes
Coevolution of Binaries and Circumbinary Gaseous Disks
Fleming, David; Quinn, Thomas R.
2018-04-01
The recent discoveries of circumbinary planets by Kepler raise questions for contemporary planet formation models. Understanding how these planets form requires characterizing their formation environment, the circumbinary protoplanetary disk, and how the disk and binary interact. The central binary excites resonances in the surrounding protoplanetary disk that drive evolution in both the binary orbital elements and in the disk. To probe how these interactions impact both binary eccentricity and disk structure evolution, we ran N-body smooth particle hydrodynamics (SPH) simulations of gaseous protoplanetary disks surrounding binaries based on Kepler 38 for 10^4 binary orbital periods for several initial binary eccentricities. We find that nearly circular binaries weakly couple to the disk via a parametric instability and excite disk eccentricity growth. Eccentric binaries strongly couple to the disk causing eccentricity growth for both the disk and binary. Disks around sufficiently eccentric binaries strongly couple to the disk and develop an m = 1 spiral wave launched from the 1:3 eccentric outer Lindblad resonance (EOLR). This wave corresponds to an alignment of gas particle longitude of periastrons. We find that in all simulations, the binary semi-major axis decays due to dissipation from the viscous disk.
BINARY CEPHEIDS: SEPARATIONS AND MASS RATIOS IN 5 M ☉ BINARIES
International Nuclear Information System (INIS)
Evans, Nancy Remage; Karovska, Margarita; Tingle, Evan; Bond, Howard E.; Schaefer, Gail H.; Mason, Brian D.
2013-01-01
Deriving the distribution of binary parameters for a particular class of stars over the full range of orbital separations usually requires the combination of results from many different observing techniques (radial velocities, interferometry, astrometry, photometry, direct imaging), each with selection biases. However, Cepheids—cool, evolved stars of ∼5 M ☉ —are a special case because ultraviolet (UV) spectra will immediately reveal any companion star hotter than early type A, regardless of the orbital separation. We have used International Ultraviolet Explorer UV spectra of a complete sample of all 76 Cepheids brighter than V = 8 to create a list of all 18 Cepheids with companions more massive than 2.0 M ☉ . Orbital periods of many of these binaries are available from radial-velocity studies, or can be estimated for longer-period systems from detected velocity variability. In an imaging survey with the Hubble Space Telescope Wide Field Camera 3, we resolved three of the companions (those of η Aql, S Nor, and V659 Cen), allowing us to make estimates of the periods out to the long-period end of the distribution. Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations, orbital periods, and mass ratios. The distribution of orbital periods shows that the 5 M ☉ binaries have systematically shorter periods than do 1 M ☉ stars. Our data also suggest that the distribution of mass ratios depends on both binary separation and system multiplicity. The distribution of mass ratios as a function of orbital separation, however, does not depend on whether a system is a binary or a triple
Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N
2001-04-01
Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.
Spectral properties of binary asteroids
Pajuelo, Myriam; Birlan, Mirel; Carry, Benoît; DeMeo, Francesca E.; Binzel, Richard P.; Berthier, Jérôme
2018-04-01
We present the first attempt to characterize the distribution of taxonomic class among the population of binary asteroids (15% of all small asteroids). For that, an analysis of 0.8-2.5{μ m} near-infrared spectra obtained with the SpeX instrument on the NASA/IRTF is presented. Taxonomic class and meteorite analog is determined for each target, increasing the sample of binary asteroids with known taxonomy by 21%. Most binary systems are bound in the S-, X-, and C- classes, followed by Q and V-types. The rate of binary systems in each taxonomic class agrees within uncertainty with the background population of small near-Earth objects and inner main belt asteroids, but for the C-types which are under-represented among binaries.
International Nuclear Information System (INIS)
Macias-Diaz, J.E.; Puri, A.
2007-01-01
In the present Letter, we simulate the propagation of binary signals in semi-infinite, mechanical chains of coupled oscillators harmonically driven at the end, by making use of the recently discovered process of nonlinear supratransmission. Our numerical results-which are based on a brand-new computational technique with energy-invariant properties-show an efficient and reliable transmission of information
Diverging conductance at the contact between random and pure quantum XX spin chains
Chatelain, Christophe
2017-11-01
A model consisting of two quantum XX spin chains, one homogeneous and the second with random couplings drawn from a binary distribution, is considered. The two chains are coupled to two different non-local thermal baths and their dynamics is governed by a Lindblad equation. In the steady state, a current J is induced between the two chains by coupling them together by their edges and imposing different chemical potentials μ to the two baths. While a regime of linear characteristics J versus Δμ is observed in the absence of randomness, a gap opens as the disorder strength is increased. In the infinite-randomness limit, this behavior is related to the density of states of the localized states contributing to the current. The conductance is shown to diverge in this limit.
Binary Cepheids: Separations and Mass Ratios in 5 M ⊙ Binaries
Evans, Nancy Evans; Bond, Howard E.; Schaefer, Gail H.; Mason, Brian D.; Karovska, Margarita; Tingle, Evan
2013-10-01
Deriving the distribution of binary parameters for a particular class of stars over the full range of orbital separations usually requires the combination of results from many different observing techniques (radial velocities, interferometry, astrometry, photometry, direct imaging), each with selection biases. However, Cepheids—cool, evolved stars of ~5 M ⊙—are a special case because ultraviolet (UV) spectra will immediately reveal any companion star hotter than early type A, regardless of the orbital separation. We have used International Ultraviolet Explorer UV spectra of a complete sample of all 76 Cepheids brighter than V = 8 to create a list of all 18 Cepheids with companions more massive than 2.0 M ⊙. Orbital periods of many of these binaries are available from radial-velocity studies, or can be estimated for longer-period systems from detected velocity variability. In an imaging survey with the Hubble Space Telescope Wide Field Camera 3, we resolved three of the companions (those of η Aql, S Nor, and V659 Cen), allowing us to make estimates of the periods out to the long-period end of the distribution. Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations, orbital periods, and mass ratios. The distribution of orbital periods shows that the 5 M ⊙ binaries have systematically shorter periods than do 1 M ⊙ stars. Our data also suggest that the distribution of mass ratios depends on both binary separation and system multiplicity. The distribution of mass ratios as a function of orbital separation, however, does not depend on whether a system is a binary or a triple. Based in part on observations made with the NASA/ESA Hubble Space Telescope, obtained by the Space Telescope Science Institute. STScI is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS5-26555.
International Nuclear Information System (INIS)
Samsing, Johan; MacLeod, Morgan; Ramirez-Ruiz, Enrico
2014-01-01
The inspiral and merger of eccentric binaries leads to gravitational waveforms distinct from those generated by circularly merging binaries. Dynamical environments can assemble binaries with high eccentricity and peak frequencies within the LIGO band. In this paper, we study binary-single stellar scatterings occurring in dense stellar systems as a source of eccentrically inspiraling binaries. Many interactions between compact binaries and single objects are characterized by chaotic resonances in which the binary-single system undergoes many exchanges before reaching a final state. During these chaotic resonances, a pair of objects has a non-negligible probability of experiencing a very close passage. Significant orbital energy and angular momentum are carried away from the system by gravitational wave (GW) radiation in these close passages, and in some cases this implies an inspiral time shorter than the orbital period of the bound third body. We derive the cross section for such dynamical inspiral outcomes through analytical arguments and through numerical scattering experiments including GW losses. We show that the cross section for dynamical inspirals grows with increasing target binary semi-major axis a and that for equal-mass binaries it scales as a 2/7 . Thus, we expect wide target binaries to predominantly contribute to the production of these relativistic outcomes. We estimate that eccentric inspirals account for approximately 1% of dynamically assembled non-eccentric merging binaries. While these events are rare, we show that binary-single scatterings are a more effective formation channel than single-single captures for the production of eccentrically inspiraling binaries, even given modest binary fractions.
Searching for massive black hole binaries in the first Mock LISA Data Challenge
International Nuclear Information System (INIS)
Cornish, Neil J; Porter, Edward K
2007-01-01
The Mock LISA Data Challenge is a worldwide effort to solve the LISA data analysis problem. We present here our results for the massive black hole binary (BBH) section of round 1. Our results cover challenge 1.2.1, where the coalescence of the binary is seen, and challenge 1.2.2, where the coalescence occurs after the simulated observational period. The data stream is composed of Gaussian instrumental noise plus an unknown BBH waveform. Our search algorithm is based on a variant of the Markov chain Monte Carlo method that uses Metropolis-Hastings sampling and thermostated frequency annealing. We present results from the training data sets where we know the parameter values a priori and the blind data sets where we were informed of the parameter values after the challenge had finished. We demonstrate that our algorithm is able to rapidly locate the sources, accurately recover the source parameters and provide error estimates for the recovered parameters
Tcheng, Ping
1989-01-01
Binary resistors in series tailored to precise value of resistance. Desired value of resistance obtained by cutting appropriate traces across resistors. Multibit, binary-based, adjustable resistor with high resolution used in many applications where precise resistance required.
CHAIN-WISE GENERALIZATION OF ROAD NETWORKS USING MODEL SELECTION
Directory of Open Access Journals (Sweden)
D. Bulatov
2017-05-01
Full Text Available Streets are essential entities of urban terrain and their automatized extraction from airborne sensor data is cumbersome because of a complex interplay of geometric, topological and semantic aspects. Given a binary image, representing the road class, centerlines of road segments are extracted by means of skeletonization. The focus of this paper lies in a well-reasoned representation of these segments by means of geometric primitives, such as straight line segments as well as circle and ellipse arcs. We propose the fusion of raw segments based on similarity criteria; the output of this process are the so-called chains which better match to the intuitive perception of what a street is. Further, we propose a two-step approach for chain-wise generalization. First, the chain is pre-segmented using circlePeucker and finally, model selection is used to decide whether two neighboring segments should be fused to a new geometric entity. Thereby, we consider both variance-covariance analysis of residuals and model complexity. The results on a complex data-set with many traffic roundabouts indicate the benefits of the proposed procedure.
THE VERY SHORT PERIOD M DWARF BINARY SDSS J001641-000925
Energy Technology Data Exchange (ETDEWEB)
Davenport, James R. A.; Becker, Andrew C.; Hawley, Suzanne L.; Gunning, Heather C.; Munshi, Ferah A.; Albright, Meagan [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States); West, Andrew A. [Astronomy Department, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Bochanski, John J. [Astronomy and Astrophysics Department, Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Holtzman, Jon [Department of Astronomy, New Mexico State University, Box 30001, Las Cruces, NM 88003 (United States); Hilton, Eric J., E-mail: jrad@astro.washington.edu [Department of Geology and Geophysics and Institute for Astronomy, University of Hawaii at Manoa, Honolulu, HI 96822 (United States)
2013-02-10
We present follow-up observations and analysis of the recently discovered short period low-mass eclipsing binary, SDSS J001641-000925. With an orbital period of 0.19856 days, this system has one of the shortest known periods for an M dwarf binary system. Medium-resolution spectroscopy and multi-band photometry for the system are presented. Markov Chain Monte Carlo modeling of the light curves and radial velocities yields estimated masses for the stars of M {sub 1} = 0.54 {+-} 0.07 M {sub Sun} and M {sub 2} = 0.34 {+-} 0.04 M {sub Sun }, and radii of R {sub 1} = 0.68 {+-} 0.03 R {sub Sun} and R {sub 2} = 0.58 {+-} 0.03 R {sub Sun }, respectively. This solution places both components above the critical Roche overfill limit, providing strong evidence that SDSS J001641-000925 is the first verified M-dwarf contact binary system. Within the follow-up spectroscopy we find signatures of non-solid body rotation velocities, which we interpret as evidence for mass transfer or loss within the system. In addition, our photometry samples the system over nine years, and we find strong evidence for period decay at the rate of P-dot {approx} 8 s yr{sup -1}. Both of these signatures raise the intriguing possibility that the system is in over-contact, and actively losing angular momentum, likely through mass loss. This places SDSS J001641-000925 as not just the first M-dwarf over-contact binary, but one of the few systems of any spectral type known to be actively undergoing coalescence. Further study of SDSS J001641-000925 is ongoing to verify the nature of the system, which may prove to be a unique astrophysical laboratory.
Some properties of spectral binary stars
International Nuclear Information System (INIS)
Krajcheva, Z.T.; Popova, E.I.; Tutukov, A.V.; Yungel'son, L.R.; AN SSSR, Moscow. Astronomicheskij Sovet)
1978-01-01
Statistical investigations of spectra binary stars are carried out. Binary systems consisting of main sequence stars are considered. For 826 binary stars masses of components, ratios of component masses, semiaxes of orbits and orbital angular momenta are calculated. The distributions of these parameters and their correlations are analyzed. The dependences of statistical properties of spectral binary stars on their origin and evolution are discussed
Microlensing Binaries Discovered through High-magnification Channel
DEFF Research Database (Denmark)
Shin, I.-G.; Choi, J.-Y.; Park, S.-Y.
2012-01-01
Microlensing can provide a useful tool to probe binary distributions down to low-mass limits of binary companions. In this paper, we analyze the light curves of eight binary-lensing events detected through the channel of high-magnification events during the seasons from 2007 to 2010. The perturba......Microlensing can provide a useful tool to probe binary distributions down to low-mass limits of binary companions. In this paper, we analyze the light curves of eight binary-lensing events detected through the channel of high-magnification events during the seasons from 2007 to 2010...
Performance analysis and binary working fluid selection of combined flash-binary geothermal cycle
International Nuclear Information System (INIS)
Zeyghami, Mehdi
2015-01-01
Performance of the combined flash-binary geothermal power cycle for geofluid temperatures between 150 and 250 °C is studied. A thermodynamic model is developed, and the suitable binary working fluids for different geofluid temperatures are identified from a list of thirty working fluid candidates, consisting environmental friendly refrigerants and hydrocarbons. The overall system exergy destruction and Vapor Expansion Ratio across the binary cycle turbine are selected as key performance indicators. The results show that for low-temperature heat sources using refrigerants as binary working fluids result in higher overall cycle efficiency and for medium and high-temperature resources, hydrocarbons are more suitable. For combined flash-binary cycle, secondary working fluids; R-152a, Butane and Cis-butane show the best performances at geofluid temperatures 150, 200 and 250 °C respectively. The overall second law efficiency is calculated as high as 0.48, 0.55 and 0.58 for geofluid temperatures equal 150, 200 and 250 °C respectively. The flash separator pressure found to has important effects on cycle operation and performance. Separator pressure dictates the work production share of steam and binary parts of the system. And there is an optimal separator pressure at which overall exergy destruction of the cycle achieves its minimum value. - Highlights: • Performance of the combined flash-binary geothermal cycle is investigated. • Thirty different fluids are screened to find the most suitable ORC working fluid. • Optimum cycle operation conditions presented for geofluids between 150 °C and 250 °C. • Refrigerants are more suitable for the ORC at geothermal sources temperature ≤200 °C. • Hydrocarbons are more suitable for the ORC at geothermal sources temperature >200 °C
BINARY CEPHEIDS: SEPARATIONS AND MASS RATIOS IN 5 M {sub ☉} BINARIES
Energy Technology Data Exchange (ETDEWEB)
Evans, Nancy Remage; Karovska, Margarita; Tingle, Evan [Smithsonian Astrophysical Observatory, MS 4, 60 Garden Street, Cambridge, MA 02138 (United States); Bond, Howard E. [Department of Astronomy and Astrophysics, Pennsylvania State University, University Park, PA 16802 (United States); Schaefer, Gail H. [The CHARA Array, Georgia State University, P.O. Box 3965, Atlanta, GA 30302-3965 (United States); Mason, Brian D., E-mail: nevans@cfa.harvard.edu, E-mail: heb11@psu.edu, E-mail: schaefer@chara-array.org [US Naval Observatory, 3450 Massachusetts Avenue, NW, Washington, DC 20392-5420 (United States)
2013-10-01
Deriving the distribution of binary parameters for a particular class of stars over the full range of orbital separations usually requires the combination of results from many different observing techniques (radial velocities, interferometry, astrometry, photometry, direct imaging), each with selection biases. However, Cepheids—cool, evolved stars of ∼5 M {sub ☉}—are a special case because ultraviolet (UV) spectra will immediately reveal any companion star hotter than early type A, regardless of the orbital separation. We have used International Ultraviolet Explorer UV spectra of a complete sample of all 76 Cepheids brighter than V = 8 to create a list of all 18 Cepheids with companions more massive than 2.0 M {sub ☉}. Orbital periods of many of these binaries are available from radial-velocity studies, or can be estimated for longer-period systems from detected velocity variability. In an imaging survey with the Hubble Space Telescope Wide Field Camera 3, we resolved three of the companions (those of η Aql, S Nor, and V659 Cen), allowing us to make estimates of the periods out to the long-period end of the distribution. Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations, orbital periods, and mass ratios. The distribution of orbital periods shows that the 5 M {sub ☉} binaries have systematically shorter periods than do 1 M {sub ☉} stars. Our data also suggest that the distribution of mass ratios depends on both binary separation and system multiplicity. The distribution of mass ratios as a function of orbital separation, however, does not depend on whether a system is a binary or a triple.
International Nuclear Information System (INIS)
Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.
1998-01-01
The binary character of the heavy ion collisions at intermediate energies in the exit channel has been observed under 30 MeV/n in medium and heavy systems. Measurements in light systems at energies approaching ∼ 100 MeV/nucleon as well as in very heavy systems have allowed to extend considerably the investigations of this binary process. Thus, the study of the Pb + Au system showed that the complete charge events indicated two distinct sources: the quasi-projectile and the quasi-target. The characteristics of these two sources are rather well reproduced by a trajectory computation which takes into account the Coulomb and nuclear forces and the friction appearing from the projectile-target interaction. The Wilczynski diagram is used to probe the correlation between the kinetic energy quenching and the deflecting angle. In case of the system Pb + Au at 29 MeV/nucleon the diagram indicate dissipative binary collisions typical for low energies. This binary aspect was also detected in the systems Xe + Ag at 44 MeV/nucleon, 36 Ar + 27 Al and 64 Zn + nat Ti. Thus, it was possible to reconstruct the quasi-projectile and to study its mass and excitation energy evolution as a function of the impact parameter. The dissipative binary collisions represent for the systems and energies under considerations the main contribution to the cross section. This does not implies that there are not other processes; particularly, the more or less complete fusion is also observed but with a low cross section which decreases with the increase of bombardment energy. More exclusive measurements with the INDRA detector on quasi-symmetric systems as Ar + KCl and Xe + Sn seem to confirm the importance of the binary collisions. The two source reconstruction of the Xe + Sn data at 50 MeV/nucleon reproduces the same behaviour as that observed in the system Pb + Au at 29 MeV/nucleon
Contact Binaries on Their Way Towards Merging
Gazeas, K.
2015-07-01
Contact binaries are the most frequently observed type of eclipsing star system. They are small, cool, low-mass binaries belonging to a relatively old stellar population. They follow certain empirical relationships that closely connect a number of physical parameters with each other, largely because of constraints coming from the Roche geometry. As a result, contact binaries provide an excellent test of stellar evolution, specifically for stellar merger scenarios. Observing campaigns by many authors have led to the cataloging of thousands of contact binaries and enabled statistical studies of many of their properties. A large number of contact binaries have been found to exhibit extraordinary behavior, requiring follow-up observations to study their peculiarities in detail. For example, a doubly-eclipsing quadruple system consisting of a contact binary and a detached binary is a highly constrained system offering an excellent laboratory to test evolutionary theories for binaries. A new observing project was initiated at the University of Athens in 2012 in order to investigate the possible lower limit for the orbital period of binary systems before coalescence, prior to merging.
Permutation Entropy for Random Binary Sequences
Directory of Open Access Journals (Sweden)
Lingfeng Liu
2015-12-01
Full Text Available In this paper, we generalize the permutation entropy (PE measure to binary sequences, which is based on Shannon’s entropy, and theoretically analyze this measure for random binary sequences. We deduce the theoretical value of PE for random binary sequences, which can be used to measure the randomness of binary sequences. We also reveal the relationship between this PE measure with other randomness measures, such as Shannon’s entropy and Lempel–Ziv complexity. The results show that PE is consistent with these two measures. Furthermore, we use PE as one of the randomness measures to evaluate the randomness of chaotic binary sequences.
Binary Systems and the Initial Mass Function
Malkov, O. Yu.
2017-07-01
In the present paper we discuss advantages and disadvantages of binary stars, which are important for star formation history determination. We show that to make definite conclusions of the initial mass function shape, it is necessary to study binary population well enough to correct the luminosity function for unresolved binaries; to construct the mass-luminosity relation based on wide binaries data, and to separate observational mass functions of primaries, of secondaries, and of unresolved binaries.
Accuracy of binary black hole waveform models for aligned-spin binaries
Kumar, Prayush; Chu, Tony; Fong, Heather; Pfeiffer, Harald P.; Boyle, Michael; Hemberger, Daniel A.; Kidder, Lawrence E.; Scheel, Mark A.; Szilagyi, Bela
2016-05-01
Coalescing binary black holes are among the primary science targets for second generation ground-based gravitational wave detectors. Reliable gravitational waveform models are central to detection of such systems and subsequent parameter estimation. This paper performs a comprehensive analysis of the accuracy of recent waveform models for binary black holes with aligned spins, utilizing a new set of 84 high-accuracy numerical relativity simulations. Our analysis covers comparable mass binaries (mass-ratio 1 ≤q ≤3 ), and samples independently both black hole spins up to a dimensionless spin magnitude of 0.9 for equal-mass binaries and 0.85 for unequal mass binaries. Furthermore, we focus on the high-mass regime (total mass ≳50 M⊙ ). The two most recent waveform models considered (PhenomD and SEOBNRv2) both perform very well for signal detection, losing less than 0.5% of the recoverable signal-to-noise ratio ρ , except that SEOBNRv2's efficiency drops slightly for both black hole spins aligned at large magnitude. For parameter estimation, modeling inaccuracies of the SEOBNRv2 model are found to be smaller than systematic uncertainties for moderately strong GW events up to roughly ρ ≲15 . PhenomD's modeling errors are found to be smaller than SEOBNRv2's, and are generally irrelevant for ρ ≲20 . Both models' accuracy deteriorates with increased mass ratio, and when at least one black hole spin is large and aligned. The SEOBNRv2 model shows a pronounced disagreement with the numerical relativity simulation in the merger phase, for unequal masses and simultaneously both black hole spins very large and aligned. Two older waveform models (PhenomC and SEOBNRv1) are found to be distinctly less accurate than the more recent PhenomD and SEOBNRv2 models. Finally, we quantify the bias expected from all four waveform models during parameter estimation for several recovered binary parameters: chirp mass, mass ratio, and effective spin.
Radial Velocities of 41 Kepler Eclipsing Binaries
Matson, Rachel A.; Gies, Douglas R.; Guo, Zhao; Williams, Stephen J.
2017-12-01
Eclipsing binaries are vital for directly determining stellar parameters without reliance on models or scaling relations. Spectroscopically derived parameters of detached and semi-detached binaries allow us to determine component masses that can inform theories of stellar and binary evolution. Here we present moderate resolution ground-based spectra of stars in close binary systems with and without (detected) tertiary companions observed by NASA’s Kepler mission and analyzed for eclipse timing variations. We obtain radial velocities and spectroscopic orbits for five single-lined and 35 double-lined systems, and confirm one false positive eclipsing binary. For the double-lined spectroscopic binaries, we also determine individual component masses and examine the mass ratio {M}2/{M}1 distribution, which is dominated by binaries with like-mass pairs and semi-detached classical Algol systems that have undergone mass transfer. Finally, we constrain the mass of the tertiary component for five double-lined binaries with previously detected companions.
Planets in Binary Star Systems
Haghighipour, Nader
2010-01-01
The discovery of extrasolar planets over the past decade has had major impacts on our understanding of the formation and dynamical evolution of planetary systems. There are features and characteristics unseen in our solar system and unexplainable by the current theories of planet formation and dynamics. Among these new surprises is the discovery of planets in binary and multiple-star systems. The discovery of such "binary-planetary" systems has confronted astrodynamicists with many new challenges, and has led them to re-examine the theories of planet formation and dynamics. Among these challenges are: How are planets formed in binary star systems? What would be the notion of habitability in such systems? Under what conditions can binary star systems have habitable planets? How will volatiles necessary for life appear on such planets? This volume seeks to gather the current research in the area of planets in binary and multistar systems and to familiarize readers with its associated theoretical and observation...
International Nuclear Information System (INIS)
Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo
2012-01-01
We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.
Crystallisation and chain conformation of long chain n-alkanes
International Nuclear Information System (INIS)
Gorce, J.
2000-06-01
the increase of the tilt angle as a function of the temperature was not detected due to a perfecting of the crystals. Indeed, due to successive heating and cooling to -173 deg. C, the concentration of non all-trans conformers was found to decrease within the crystals. Their numbers were found to be up to six times higher in n-C 198 H 398 crystallised in once folded form than when crystallised in extended form. The C-C stretching mode region of the spectra was used to identify the chain conformation and to estimate the length of the all-trans stem passing through the crystal layers at -173 deg. C. The transition between once folded and extended form crystals was indicated by the presence of additional bands in this region at 1089 cm -1 , 1078 cm -1 and 1064 cm -1 . Some of those bands may be related to the fold itself. At the same time, a strong decrease of the intensity of the infrared bands present in the wagging mode region was observed. Finally, the triple layered structure proposed on the basis of X-ray measurements obtained from the crystals of a binary mixture of long chain n-alkanes, namely n-C 162 H 326 and n-C 246 H 494 , was confirmed from the study of the C-C stretching mode region of the infrared spectra. (author)
Theoretical studies of binaries in astrophysics
Dischler, Johann Sebastian
This thesis introduces and summarizes four papers dealing with computer simulations of astrophysical processes involving binaries. The first part gives the rational and theoretical background to these papers. In paper I and II a statistical approach to studying eclipsing binaries is described. By using population synthesis models for binaries the probabilities for eclipses are calculated for different luminosity classes of binaries. These are compared with Hipparcos data and they agree well if one uses a standard input distribution for the orbit sizes. If one uses a random pairing model, where both companions are independently picked from an IMF, one finds too feclipsing binaries by an order of magnitude. In paper III we investigate a possible scenario for the origin of the stars observed close to the centre of our galaxy, called S stars. We propose that a cluster falls radially cowards the central black hole. The binaries within the cluster can then, if they have small impact parameters, be broken up by the black hole's tidal held and one of the components of the binary will be captured by the black hole. Paper IV investigates how the onset of mass transfer in eccentric binaries depends on the eccentricity. To do this we have developed a new two-phase SPH scheme where very light particles are at tire outer edge of our simulated star. This enables us to get a much better resolution of the very small mass that is transferred in close binaries. Our simulations show that the minimum required distance between the stars to have mass transfer decreases with the eccentricity.
Mining frequent binary expressions
Calders, T.; Paredaens, J.; Kambayashi, Y.; Mohania, M.K.; Tjoa, A.M.
2000-01-01
In data mining, searching for frequent patterns is a common basic operation. It forms the basis of many interesting decision support processes. In this paper we present a new type of patterns, binary expressions. Based on the properties of a specified binary test, such as reflexivity, transitivity
Survival of planets around shrinking stellar binaries.
Muñoz, Diego J; Lai, Dong
2015-07-28
The discovery of transiting circumbinary planets by the Kepler mission suggests that planets can form efficiently around binary stars. None of the stellar binaries currently known to host planets has a period shorter than 7 d, despite the large number of eclipsing binaries found in the Kepler target list with periods shorter than a few days. These compact binaries are believed to have evolved from wider orbits into their current configurations via the so-called Lidov-Kozai migration mechanism, in which gravitational perturbations from a distant tertiary companion induce large-amplitude eccentricity oscillations in the binary, followed by orbital decay and circularization due to tidal dissipation in the stars. Here we explore the orbital evolution of planets around binaries undergoing orbital decay by this mechanism. We show that planets may survive and become misaligned from their host binary, or may develop erratic behavior in eccentricity, resulting in their consumption by the stars or ejection from the system as the binary decays. Our results suggest that circumbinary planets around compact binaries could still exist, and we offer predictions as to what their orbital configurations should be like.
Close-binary central stars of planetary nebulae
International Nuclear Information System (INIS)
Bond, H.E.; Grauer, A.D.
1987-01-01
Recent observations of PN central stars identified as binary systems are reviewed. The theoretical significance of binary central stars is discussed, and the characteristics of UU Sge, V 477 Lyr, MT Ser, LSS 2018, VW Pyx, and the central star of HFG 1 are briefly summarized. All of these binaries are shown to have periods less than 1 day, and it is estimated that about 10 percent of all binary central stars are close binaries. 27 references
Bondi-Hoyle-Lyttleton Accretion onto Binaries
Antoni, Andrea; MacLeod, Morgan; Ramírez-Ruiz, Enrico
2018-01-01
Binary stars are not rare. While only close binary stars will eventually interact with one another, even the widest binary systems interact with their gaseous surroundings. The rates of accretion and the gaseous drag forces arising in these interactions are the key to understanding how these systems evolve. This poster examines accretion flows around a binary system moving supersonically through a background gas. We perform three-dimensional hydrodynamic simulations of Bondi-Hoyle-Lyttleton accretion using the adaptive mesh refinement code FLASH. We simulate a range of values of semi-major axis of the orbit relative to the gravitational focusing impact parameter of the pair. On large scales, gas is gravitationally focused by the center-of-mass of the binary, leading to dynamical friction drag and to the accretion of mass and momentum. On smaller scales, the orbital motion imprints itself on the gas. Notably, the magnitude and direction of the forces acting on the binary inherit this orbital dependence. The long-term evolution of the binary is determined by the timescales for accretion, slow down of the center-of-mass, and decay of the orbit. We use our simulations to measure these timescales and to establish a hierarchy between them. In general, our simulations indicate that binaries moving through gaseous media will slow down before the orbit decays.
Formation and Evolution of X-ray Binaries
Shao, Y.
2017-07-01
X-ray binaries are a class of binary systems, in which the accretor is a compact star (i.e., black hole, neutron star, or white dwarf). They are one of the most important objects in the universe, which can be used to study not only binary evolution but also accretion disks and compact stars. Statistical investigations of these binaries help to understand the formation and evolution of galaxies, and sometimes provide useful constraints on the cosmological models. The goal of this thesis is to investigate the formation and evolution processes of X-ray binaries including Be/X-ray binaries, low-mass X-ray binaries (LMXBs), ultraluminous X-ray sources (ULXs), and cataclysmic variables. In Chapter 1 we give a brief review on the basic knowledge of the binary evolution. In Chapter 2 we discuss the formation of Be stars through binary interaction. In this chapter we investigate the formation of Be stars resulting from mass transfer in binaries in the Galaxy. Using binary evolution and population synthesis calculations, we find that in Be/neutron star binaries the Be stars have a lower limit of mass ˜ 8 M⊙ if they are formed by a stable (i.e., without the occurrence of common envelope evolution) and nonconservative mass transfer. We demonstrate that the isolated Be stars may originate from both mergers of two main-sequence stars and disrupted Be binaries during the supernova explosions of the primary stars, but mergers seem to play a much more important role. Finally the fraction of Be stars produced by binary interactions in all B type stars can be as high as ˜ 13%-30% , implying that most of Be stars may result from binary interaction. In Chapter 3 we show the evolution of intermediate- and low-mass X-ray binaries (I/LMXBs) and the formation of millisecond pulsars. Comparing the calculated results with the observations of binary radio pulsars, we report the following results: (1) The allowed parameter space for forming binary pulsars in the initial orbital period
Collett, David
2002-01-01
INTRODUCTION Some Examples The Scope of this Book Use of Statistical Software STATISTICAL INFERENCE FOR BINARY DATA The Binomial Distribution Inference about the Success Probability Comparison of Two Proportions Comparison of Two or More Proportions MODELS FOR BINARY AND BINOMIAL DATA Statistical Modelling Linear Models Methods of Estimation Fitting Linear Models to Binomial Data Models for Binomial Response Data The Linear Logistic Model Fitting the Linear Logistic Model to Binomial Data Goodness of Fit of a Linear Logistic Model Comparing Linear Logistic Models Linear Trend in Proportions Comparing Stimulus-Response Relationships Non-Convergence and Overfitting Some other Goodness of Fit Statistics Strategy for Model Selection Predicting a Binary Response Probability BIOASSAY AND SOME OTHER APPLICATIONS The Tolerance Distribution Estimating an Effective Dose Relative Potency Natural Response Non-Linear Logistic Regression Models Applications of the Complementary Log-Log Model MODEL CHECKING Definition of Re...
Conformational dynamics of Rouse chains during creep/recovery processes: a review
International Nuclear Information System (INIS)
Watanabe, Hiroshi; Inoue, Tadashi
2005-01-01
The Rouse model is a well-established model for non-entangled polymer chains and also serves as a fundamental model for entangled chains. The dynamic behaviour of this model under strain-controlled conditions has been fully analysed in the literature. However, despite the importance of the Rouse model, no analysis has been made so far of the orientational anisotropy of the Rouse eigenmodes during the stress-controlled, creep and recovery processes. For completeness of the analysis of the model, the Rouse equation of motion is solved to calculate this anisotropy for monodisperse chains and their binary blends during the creep/recovery processes. The calculation is simple and straightforward, but the result is intriguing in the sense that each Rouse eigenmode during these processes has a distribution in the retardation times. This behaviour, reflecting the interplay/correlation among the Rouse eigenmodes of different orders (and for different chains in the blends) under the constant stress condition, is quite different from the behaviour under rate-controlled flow (where each eigenmode exhibits retardation/relaxation associated with a single characteristic time). Furthermore, the calculation indicates that the Rouse chains exhibit affine deformation on sudden imposition/removal of the stress and the magnitude of this deformation is inversely proportional to the number of bond vectors per chain. In relation to these results, a difference between the creep and relaxation properties is also discussed for chains obeying multiple relaxation mechanisms (Rouse and reptation mechanisms). (topical review)
Formation and evolution of compact binaries
Sluijs, Marcel Vincent van der
2006-01-01
In this thesis we investigate the formation and evolution of compact binaries. Chapters 2 through 4 deal with the formation of luminous, ultra-compact X-ray binaries in globular clusters. We show that the proposed scenario of magnetic capture produces too few ultra-compact X-ray binaries to explain
Reiter, Megan
2017-08-01
Fewer wide-separation binaries are found in dense stellar clusters than in looser stellar associations. It is therefore unclear whether feedback in clusters prevents the formation of multiple systems or dynamical interactions destroy them. Measuring the prevalence of close, bound binary systems provide a key test to distinguish between these possibilities. Systems with separations of 10-50 AU will survive interactions in the cluster environment, and therefore are more representative of the natal population of multiple systems. By fitting a double-star PSF, we will identify visual binaries in the Orion Nebula with separations as small as 0.03. At the distance of Orion, this corresponds to a physical separation of 12 AU, effectively closing the observational gap in the binary separation distribution left between known visual and spectroscopic binaries (>65 AU or PhD thesis.
Origin of very-short orbital-period binary systems
International Nuclear Information System (INIS)
Miyaji, S.
1983-01-01
Recent observations of four close binaries have established that there is a group of very-short orbital-period (VSOP) binaries whose orbital periods are less than 60 minutes. The VSOP binaries consist of both X-ray close binaries and cataclysmic variables. Their orbital periods are too short to have a main-sequence companion. However, four binaries, none of which belongs to any globular cluster, are too abundant to be explained by the capturing mechanism of a white dwarf. Therefore it seemed to be worthwhile to present an evolutionary scenario from an original binary system which can be applied for all VSOP binaries. (Auth.)
Steen Magnussen
2009-01-01
Areas burned annually in 29 Canadian forest fire regions show a patchy and irregular correlation structure that significantly influences the distribution of annual totals for Canada and for groups of regions. A binary Monte Carlo Markov Chain (MCMC) is constructed for the purpose of joint simulation of regional areas burned in forest fires. For each year the MCMC...
Evans, Nancy R.; Bond, H. E.; Schaefer, G.; Mason, B. D.; Karovska, M.; Tingle, E.
2013-01-01
Cepheids (5 Msun stars) provide an excellent sample for determining the binary properties of fairly massive stars. International Ultraviolet Explorer (IUE) observations of Cepheids brighter than 8th magnitude resulted in a list of ALL companions more massive than 2.0 Msun uniformly sensitive to all separations. Hubble Space Telescope Wide Field Camera 3 (WFC3) has resolved three of these binaries (Eta Aql, S Nor, and V659 Cen). Combining these separations with orbital data in the literature, we derive an unbiased distribution of binary separations for a sample of 18 Cepheids, and also a distribution of mass ratios. The distribution of orbital periods shows that the 5 Msun binaries prefer shorter periods than 1 Msun stars, reflecting differences in star formation processes.
Astronomy of binary and multiple stars
International Nuclear Information System (INIS)
Tokovinin, A.A.
1984-01-01
Various types of binary stars and methods for their observation are described in a popular form. Some models of formation and evolution of binary and multiple star systems are presented. It is concluded that formation of binary and multiple stars is a regular stage in the process of star production
A ROSAT Survey of Contact Binary Stars
Geske, M. T.; Gettel, S. J.; McKay, T. A.
2006-01-01
Contact binary stars are common variable stars that are all believed to emit relatively large fluxes of X-rays. In this work we combine a large new sample of contact binary stars derived from the ROTSE-I telescope with X-ray data from the ROSAT All Sky Survey (RASS) to estimate the X-ray volume emissivity of contact binary stars in the Galaxy. We obtained X-ray fluxes for 140 contact binaries from the RASS, as well as two additional stars observed by the XMM-Newton observatory. From these data we confirm the emission of X-rays from all contact binary systems, with typical luminosities of approximately 1.0×1030 ergs s-1. Combining calculated luminosities with an estimated contact binary space density, we find that contact binaries do not have strong enough X-ray emission to account for a significant portion of the Galactic X-ray background.
GALAXY ROTATION AND RAPID SUPERMASSIVE BINARY COALESCENCE
Energy Technology Data Exchange (ETDEWEB)
Holley-Bockelmann, Kelly [Vanderbilt University, Nashville, TN (United States); Khan, Fazeel Mahmood, E-mail: k.holley@vanderbilt.edu [Institute of Space Technology (IST), Islamabad (Pakistan)
2015-09-10
Galaxy mergers usher the supermassive black hole (SMBH) in each galaxy to the center of the potential, where they form an SMBH binary. The binary orbit shrinks by ejecting stars via three-body scattering, but ample work has shown that in spherical galaxy models, the binary separation stalls after ejecting all the stars in its loss cone—this is the well-known final parsec problem. However, it has been shown that SMBH binaries in non-spherical galactic nuclei harden at a nearly constant rate until reaching the gravitational wave regime. Here we use a suite of direct N-body simulations to follow SMBH binary evolution in both corotating and counterrotating flattened galaxy models. For N > 500 K, we find that the evolution of the SMBH binary is convergent and is independent of the particle number. Rotation in general increases the hardening rate of SMBH binaries even more effectively than galaxy geometry alone. SMBH binary hardening rates are similar for co- and counterrotating galaxies. In the corotating case, the center of mass of the SMBH binary settles into an orbit that is in corotation resonance with the background rotating model, and the coalescence time is roughly a few 100 Myr faster than a non-rotating flattened model. We find that counterrotation drives SMBHs to coalesce on a nearly radial orbit promptly after forming a hard binary. We discuss the implications for gravitational wave astronomy, hypervelocity star production, and the effect on the structure of the host galaxy.
GALAXY ROTATION AND RAPID SUPERMASSIVE BINARY COALESCENCE
International Nuclear Information System (INIS)
Holley-Bockelmann, Kelly; Khan, Fazeel Mahmood
2015-01-01
Galaxy mergers usher the supermassive black hole (SMBH) in each galaxy to the center of the potential, where they form an SMBH binary. The binary orbit shrinks by ejecting stars via three-body scattering, but ample work has shown that in spherical galaxy models, the binary separation stalls after ejecting all the stars in its loss cone—this is the well-known final parsec problem. However, it has been shown that SMBH binaries in non-spherical galactic nuclei harden at a nearly constant rate until reaching the gravitational wave regime. Here we use a suite of direct N-body simulations to follow SMBH binary evolution in both corotating and counterrotating flattened galaxy models. For N > 500 K, we find that the evolution of the SMBH binary is convergent and is independent of the particle number. Rotation in general increases the hardening rate of SMBH binaries even more effectively than galaxy geometry alone. SMBH binary hardening rates are similar for co- and counterrotating galaxies. In the corotating case, the center of mass of the SMBH binary settles into an orbit that is in corotation resonance with the background rotating model, and the coalescence time is roughly a few 100 Myr faster than a non-rotating flattened model. We find that counterrotation drives SMBHs to coalesce on a nearly radial orbit promptly after forming a hard binary. We discuss the implications for gravitational wave astronomy, hypervelocity star production, and the effect on the structure of the host galaxy
Hidden slow pulsars in binaries
Tavani, Marco; Brookshaw, Leigh
1993-01-01
The recent discovery of the binary containing the slow pulsar PSR 1718-19 orbiting around a low-mass companion star adds new light on the characteristics of binary pulsars. The properties of the radio eclipses of PSR 1718-19 are the most striking observational characteristics of this system. The surface of the companion star produces a mass outflow which leaves only a small 'window' in orbital phase for the detection of PSR 1718-19 around 400 MHz. At this observing frequency, PSR 1718-19 is clearly observable only for about 1 hr out of the total 6.2 hr orbital period. The aim of this Letter is twofold: (1) to model the hydrodynamical behavior of the eclipsing material from the companion star of PSR 1718-19 and (2) to argue that a population of binary slow pulsars might have escaped detection in pulsar surveys carried out at 400 MHz. The possible existence of a population of partially or totally hidden slow pulsars in binaries will have a strong impact on current theories of binary evolution of neutron stars.
Pablos Martin, X; Deltenre, P; Hoonhorst, I; Markessis, E; Rossion, B; Colin, C
2007-12-01
Rhythm perception appears to be non-linear as human subjects are better at discriminating, categorizing and reproducing rhythms containing binary vs non-binary (e.a. 1:2 vs 1:3) as well as metrical vs non-metrical (e.a. 1:2 vs 1:2.5) interval ratios. This study examined the representation of binary and non-binary interval ratios within the sensory memory, thus yielding a truly sensory, pre-motor, attention-independent neural representation of rhythmical intervals. Five interval ratios, one binary, flanked by four non-binary ones, were compared on the basis of the MMN they evoked when contrasted against a common standard interval. For all five intervals, the larger the contrast was, the larger the MMN amplitude was. The binary interval evoked a significantly much shorter (by at least 23 ms) MMN latency than the other intervals, whereas no latency difference was observed between the four non-binary intervals. These results show that the privileged perceptual status of binary rhythmical intervals is already present in the sensory representations found in echoic memory at an early, automatic, pre-perceptual and pre-motor level. MMN latency can be used to study rhythm perception at a truly sensory level, without any contribution from the motor system.
International Nuclear Information System (INIS)
Prodan, Snezana; Antonini, Fabio; Perets, Hagai B.
2015-01-01
Here we discuss the evolution of binaries around massive black holes (MBHs) in nuclear stellar clusters. We focus on their secular evolution due to the perturbation by the MBHs, while simplistically accounting for their collisional evolution. Binaries with highly inclined orbits with respect to their orbits around MBHs are strongly affected by secular processes, which periodically change their eccentricities and inclinations (e.g., Kozai-Lidov cycles). During periapsis approach, dissipative processes such as tidal friction may become highly efficient, and may lead to shrinkage of a binary orbit and even to its merger. Binaries in this environment can therefore significantly change their orbital evolution due to the MBH third-body perturbative effects. Such orbital evolution may impinge on their later stellar evolution. Here we follow the secular dynamics of such binaries and its coupling to tidal evolution, as well as the stellar evolution of such binaries on longer timescales. We find that stellar binaries in the central parts of nuclear stellar clusters (NSCs) are highly likely to evolve into eccentric and/or short-period binaries, and become strongly interacting binaries either on the main sequence (at which point they may even merge), or through their later binary stellar evolution. The central parts of NSCs therefore catalyze the formation and evolution of strongly interacting binaries, and lead to the enhanced formation of blue stragglers, X-ray binaries, gravitational wave sources, and possible supernova progenitors. Induced mergers/collisions may also lead to the formation of G2-like cloud-like objects such as the one recently observed in the Galactic center
Nelemans, G.
2013-01-01
I review what eLISA will see from Galactic binaries -- double stars with orbital periods less than a few hours and white dwarf (or neutron star/black hole) components. I discuss the currently known binaries that are guaranteed (or verification) sources and explain why the expected total number of eLISA Galactic binaries is several thousand, even though there are large uncertainties in our knowledge of this population, in particular that of the interacting AM CVn systems. I very briefly sketch...
The origin of the RS CVn binaries
International Nuclear Information System (INIS)
Biermann, P.
1976-01-01
Six possible origins for the RS CVn binaries are considered based on the following possibilities. RS CVn binaries might now be either pre-main-sequence or post-main-sequence. A pre-main-sequence binary might not always have been a binary but might have resulted from fission of a rapidly rotating single pre-main-sequence star. The main-sequence counterparts might be either single stars or binaries. To decide which of the six origins is possible, the following observed data for the RS CVn binaries are considered: total mass, total angular momentum, lack of observed connection with regions of star formation, large space density, kinematical age, and the visual companion of WW Dra. In addition lifetimes and space densities of single stars and other types of binaries are considered. The only origin possible is that the RS CVn binaries are in a thermal phase following fission of a main-sequence single star. In this explanation the single star had a rapidly rotating core which became unstable due to the core contraction which made it begin to evolve off the main sequence. The present Be stars might be examples of such parent single stars. (Auth.)
Adjoint sensitivity analysis of dynamic reliability models based on Markov chains - I: Theory
International Nuclear Information System (INIS)
Cacuci, D. G.; Cacuci, D. G.; Ionescu-Bujor, M.
2008-01-01
The development of the adjoint sensitivity analysis procedure (ASAP) for generic dynamic reliability models based on Markov chains is presented, together with applications of this procedure to the analysis of several systems of increasing complexity. The general theory is presented in Part I of this work and is accompanied by a paradigm application to the dynamic reliability analysis of a simple binary component, namely a pump functioning on an 'up/down' cycle until it fails irreparably. This paradigm example admits a closed form analytical solution, which permits a clear illustration of the main characteristics of the ASAP for Markov chains. In particular, it is shown that the ASAP for Markov chains presents outstanding computational advantages over other procedures currently in use for sensitivity and uncertainty analysis of the dynamic reliability of large-scale systems. This conclusion is further underscored by the large-scale applications presented in Part II. (authors)
Adjoint sensitivity analysis of dynamic reliability models based on Markov chains - I: Theory
Energy Technology Data Exchange (ETDEWEB)
Cacuci, D. G. [Commiss Energy Atom, Direct Energy Nucl, Saclay, (France); Cacuci, D. G. [Univ Karlsruhe, Inst Nucl Technol and Reactor Safety, D-76021 Karlsruhe, (Germany); Ionescu-Bujor, M. [Forschungszentrum Karlsruhe, Fus Program, D-76021 Karlsruhe, (Germany)
2008-07-01
The development of the adjoint sensitivity analysis procedure (ASAP) for generic dynamic reliability models based on Markov chains is presented, together with applications of this procedure to the analysis of several systems of increasing complexity. The general theory is presented in Part I of this work and is accompanied by a paradigm application to the dynamic reliability analysis of a simple binary component, namely a pump functioning on an 'up/down' cycle until it fails irreparably. This paradigm example admits a closed form analytical solution, which permits a clear illustration of the main characteristics of the ASAP for Markov chains. In particular, it is shown that the ASAP for Markov chains presents outstanding computational advantages over other procedures currently in use for sensitivity and uncertainty analysis of the dynamic reliability of large-scale systems. This conclusion is further underscored by the large-scale applications presented in Part II. (authors)
International Nuclear Information System (INIS)
Tutukov, A.V.; Fedorova, A.V.; Yungel'son, L.R.
1982-01-01
The conditions of mass exchange in close binary systems with masses of components less or equal to one solar mass have been analysed for the case, when the system radiates gravitational waves. It has been shown that the mass exchange rate depends in a certain way on the mass ratio of components and on the mass of component that fills its inner critical lobe. The comparison of observed periods, masses of contact components, and mass exchange rates of observed cataclysmic binaries have led to the conclusion that the evolution of close binaries WZ Sge, OY Car, Z Cha, TT Ari, 2A 0311-227, and G 61-29 may be driven by the emission of gravitational waves [ru
Impact of Consumer Preferences on Food Chain Choice: An empirical study of consumers in Bratislava
Directory of Open Access Journals (Sweden)
Pavol Kita
2017-01-01
Full Text Available The objective of this paper is to highlight the use of multiple criteria evaluation methods as a tool for the rating and selection of retail chains from the customers and suppliers perspective. We provide an assessment on the attractiveness of active retail chains on the Slovak market through multiple criteria methods used for the analysis of customer preferences. An analysis was conducted on a sample of consumers in Bratislava involving 11 389 respondents interviewed. The multi-attribute decision-making methods PROMETHEE II and V were used to assess the variants. In the first part of analysis the collected data uncover customers’ preferences in the selection of retail chains. Findings suggest a ranking of evaluated retail chains and thus of customer preferences. Based on the obtained evaluation, in the second part of analysis, a set of retail chains was chosen under constraints concerning the effectiveness of advertising, market share of sales and the maximum number of chosen retail chains and a binary linear programming model was formulated as an outcome. Proposed procedure aims to assist the decision maker in selecting which retail chain to choose for distribution of supplier’s products, and thus maximize benefits, which will result from consumer preferences and service satisfaction level in retail chain.
Massive binaries in the vicinity of Sgr A*
Energy Technology Data Exchange (ETDEWEB)
Pfuhl, O.; Gillessen, S.; Genzel, R.; Eisenhauer, F.; Fritz, T. K.; Ott, T. [Max-Planck-Institut für Extraterrestrische Physik, D-85748 Garching (Germany); Alexander, T. [Faculty of Physics, Weizmann Institute of Science, P.O. Box 26, Rehovot 76100 (Israel); Martins, F., E-mail: pfuhl@mpe.mpg.de [LUPM, Université Montpelier 2, CNRS, Place Eugéne Bataillon, F-34095, Montpellier (France)
2014-02-20
A long-term spectroscopic and photometric survey of the most luminous and massive stars in the vicinity of the supermassive black hole Sgr A* revealed two new binaries: a long-period Ofpe/WN9 binary, IRS 16NE, with a modest eccentricity of 0.3 and a period of 224 days, and an eclipsing Wolf-Rayet binary with a period of 2.3 days. Together with the already identified binary IRS 16SW, there are now three confirmed OB/WR binaries in the inner 0.2 pc of the Galactic center. Using radial velocity change upper limits, we were able to constrain the spectroscopic binary fraction in the Galactic center to F{sub SB}=0.30{sub −0.21}{sup +0.34} at a confidence level of 95%, a massive binary fraction close to that observed in dense clusters. The fraction of eclipsing binaries with photometric amplitudes Δm > 0.4 is F{sub EB}{sup GC}=3%±2%, which is consistent with local OB star clusters (F {sub EB} = 1%). Overall, the Galactic center binary fraction seems to be similar to the binary fraction in comparable young clusters.
EVOLUTION OF THE BINARY FRACTION IN DENSE STELLAR SYSTEMS
International Nuclear Information System (INIS)
Fregeau, John M.; Ivanova, Natalia; Rasio, Frederic A.
2009-01-01
Using our recently improved Monte Carlo evolution code, we study the evolution of the binary fraction in globular clusters. In agreement with previous N-body simulations, we find generally that the hard binary fraction in the core tends to increase with time over a range of initial cluster central densities for initial binary fractions ∼<90%. The dominant processes driving the evolution of the core binary fraction are mass segregation of binaries into the cluster core and preferential destruction of binaries there. On a global scale, these effects and the preferential tidal stripping of single stars tend to roughly balance, leading to overall cluster binary fractions that are roughly constant with time. Our findings suggest that the current hard binary fraction near the half-mass radius is a good indicator of the hard primordial binary fraction. However, the relationship between the true binary fraction and the fraction of main-sequence stars in binaries (which is typically what observers measure) is nonlinear and rather complicated. We also consider the importance of soft binaries, which not only modify the evolution of the binary fraction, but can also drastically change the evolution of the cluster as a whole. Finally, we briefly describe the recent addition of single and binary stellar evolution to our cluster evolution code.
Activity coefficients of solutes in binary solvents
International Nuclear Information System (INIS)
Gokcen, N.A.
1982-01-01
The activity coefficients in dilute ternary systems are discussed in detail by using the Margules equations. Analyses of some relevant data at high temperatures show that the sparingly dissolved solutes in binary solvents follow complex behavior even when the binary solvents are very nearly ideal. It is shown that the activity data on the solute or the binary system cannot permit computation of the remaining activities except for the regular solutions. It is also shown that a fourth-order equation is usually adequate in expressing the activity coefficient of a solute in binary solvents at high temperatures. When the activity data for a binary solvent are difficult to obtain in a certain range of composition, the activity data for a sparingly dissolved solute can be used to supplement determination of the binary activities
All-optical conversion scheme: Binary to quaternary and quaternary to binary number
Chattopadhyay, Tanay; Roy, Jitendra Nath
2009-04-01
To achieve the inherent parallelism in optics a suitable number system and efficient encoding/decoding scheme for handling the data are very much essential. Binary number is accepted as the best representing number system in almost all types of existing electronic computers. But, binary number (0 and 1) is insufficient in respect to the demand of the coming generation. Multi-valued logic (with radix >2) can be viewed as an alternative approach to solve many problems in transmission, storage and processing of large amount of information in digital signal processing. Here, in this paper all-optical scheme for the conversion of binary to quaternary number and vice versa have been proposed and described. Simulation has also been done. In this all-optical scheme the numbers are represented by different discrete polarized state of light.
International Nuclear Information System (INIS)
Chang, J.; Sandler, S.I.
1995-01-01
We have extended the Wertheim integral equation theory to mixtures of hard spheres with two attraction sites in order to model homonuclear hard-sphere chain fluids, and then solved these equations with the polymer-Percus--Yevick closure and the ideal chain approximation to obtain the average intermolecular and overall radial distribution functions. We obtain explicit expressions for the contact values of these distribution functions and a set of one-dimensional integral equations from which the distribution functions can be calculated without iteration or numerical Fourier transformation. We compare the resulting predictions for the distribution functions with Monte Carlo simulation results we report here for five selected binary mixtures. It is found that the accuracy of the prediction of the structure is the best for dimer mixtures and declines with increasing chain length and chain-length asymmetry. For the equation of state, we have extended the dimer version of the thermodynamic perturbation theory to the hard-sphere chain mixture by introducing the dimer mixture as an intermediate reference system. The Helmholtz free energy of chain fluids is then expressed in terms of the free energy of the hard-sphere mixture and the contact values of the correlation functions of monomer and dimer mixtures. We compared with the simulation results, the resulting equation of state is found to be the most accurate among existing theories with a relative average error of 1.79% for 4-mer/8-mer mixtures, which is the worst case studied in this work. copyright 1995 American Institute of Physics
COSMIC probes into compact binary formation and evolution
Breivik, Katelyn
2018-01-01
The population of compact binaries in the galaxy represents the final state of all binaries that have lived up to the present epoch. Compact binaries present a unique opportunity to probe binary evolution since many of the interactions binaries experience can be imprinted on the compact binary population. By combining binary evolution simulations with catalogs of observable compact binary systems, we can distill the dominant physical processes that govern binary star evolution, as well as predict the abundance and variety of their end products.The next decades herald a previously unseen opportunity to study compact binaries. Multi-messenger observations from telescopes across all wavelengths and gravitational-wave observatories spanning several decades of frequency will give an unprecedented view into the structure of these systems and the composition of their components. Observations will not always be coincident and in some cases may be separated by several years, providing an avenue for simulations to better constrain binary evolution models in preparation for future observations.I will present the results of three population synthesis studies of compact binary populations carried out with the Compact Object Synthesis and Monte Carlo Investigation Code (COSMIC). I will first show how binary-black-hole formation channels can be understood with LISA observations. I will then show how the population of double white dwarfs observed with LISA and Gaia could provide a detailed view of mass transfer and accretion. Finally, I will show that Gaia could discover thousands black holes in the Milky Way through astrometric observations, yielding view into black-hole astrophysics that is complementary to and independent from both X-ray and gravitational-wave astronomy.
Almog, Assaf; Garlaschelli, Diego
2014-09-01
The dynamics of complex systems, from financial markets to the brain, can be monitored in terms of multiple time series of activity of the constituent units, such as stocks or neurons, respectively. While the main focus of time series analysis is on the magnitude of temporal increments, a significant piece of information is encoded into the binary projection (i.e. the sign) of such increments. In this paper we provide further evidence of this by showing strong nonlinear relations between binary and non-binary properties of financial time series. These relations are a novel quantification of the fact that extreme price increments occur more often when most stocks move in the same direction. We then introduce an information-theoretic approach to the analysis of the binary signature of single and multiple time series. Through the definition of maximum-entropy ensembles of binary matrices and their mapping to spin models in statistical physics, we quantify the information encoded into the simplest binary properties of real time series and identify the most informative property given a set of measurements. Our formalism is able to accurately replicate, and mathematically characterize, the observed binary/non-binary relations. We also obtain a phase diagram allowing us to identify, based only on the instantaneous aggregate return of a set of multiple time series, a regime where the so-called ‘market mode’ has an optimal interpretation in terms of collective (endogenous) effects, a regime where it is parsimoniously explained by pure noise, and a regime where it can be regarded as a combination of endogenous and exogenous factors. Our approach allows us to connect spin models, simple stochastic processes, and ensembles of time series inferred from partial information.
International Nuclear Information System (INIS)
Almog, Assaf; Garlaschelli, Diego
2014-01-01
The dynamics of complex systems, from financial markets to the brain, can be monitored in terms of multiple time series of activity of the constituent units, such as stocks or neurons, respectively. While the main focus of time series analysis is on the magnitude of temporal increments, a significant piece of information is encoded into the binary projection (i.e. the sign) of such increments. In this paper we provide further evidence of this by showing strong nonlinear relations between binary and non-binary properties of financial time series. These relations are a novel quantification of the fact that extreme price increments occur more often when most stocks move in the same direction. We then introduce an information-theoretic approach to the analysis of the binary signature of single and multiple time series. Through the definition of maximum-entropy ensembles of binary matrices and their mapping to spin models in statistical physics, we quantify the information encoded into the simplest binary properties of real time series and identify the most informative property given a set of measurements. Our formalism is able to accurately replicate, and mathematically characterize, the observed binary/non-binary relations. We also obtain a phase diagram allowing us to identify, based only on the instantaneous aggregate return of a set of multiple time series, a regime where the so-called ‘market mode’ has an optimal interpretation in terms of collective (endogenous) effects, a regime where it is parsimoniously explained by pure noise, and a regime where it can be regarded as a combination of endogenous and exogenous factors. Our approach allows us to connect spin models, simple stochastic processes, and ensembles of time series inferred from partial information. (paper)
PERIODIC SIGNALS IN BINARY MICROLENSING EVENTS
International Nuclear Information System (INIS)
Guo, Xinyi; Stefano, Rosanne Di; Esin, Ann; Taylor, Jeffrey
2015-01-01
Gravitational microlensing events are powerful tools for the study of stellar populations. In particular, they can be used to discover and study a variety of binary systems. A large number of binary lenses have already been found through microlensing surveys and a few of these systems show strong evidence of orbital motion on the timescale of the lensing event. We expect that more binary lenses of this kind will be detected in the future. For binaries whose orbital period is comparable to the event duration, the orbital motion can cause the lensing signal to deviate drastically from that of a static binary lens. The most striking property of such light curves is the presence of quasi-periodic features, which are produced as the source traverses the same regions in the rotating lens plane. These repeating features contain information about the orbital period of the lens. If this period can be extracted, then much can be learned about the lensing system even without performing time-consuming, detailed light-curve modeling. However, the relative transverse motion between the source and the lens significantly complicates the problem of period extraction. To resolve this difficulty, we present a modification of the standard Lomb–Scargle periodogram analysis. We test our method for four representative binary lens systems and demonstrate its efficiency in correctly extracting binary orbital periods
Improving geothermal power plants with a binary cycle
Tomarov, G. V.; Shipkov, A. A.; Sorokina, E. V.
2015-12-01
The recent development of binary geothermal technology is analyzed. General trends in the introduction of low-temperature geothermal sources are summarized. The use of single-phase low-temperature geothermal fluids in binary power plants proves possible and expedient. The benefits of power plants with a binary cycle in comparison with traditional systems are shown. The selection of the working fluid is considered, and the influence of the fluid's physicochemical properties on the design of the binary power plant is discussed. The design of binary power plants is based on the chemical composition and energy potential of the geothermal fluids and on the landscape and climatic conditions at the intended location. Experience in developing a prototype 2.5 MW Russian binary power unit at Pauzhetka geothermal power plant (Kamchatka) is outlined. Most binary systems are designed individually for a specific location. Means of improving the technology and equipment at binary geothermal power plants are identified. One option is the development of modular systems based on several binary systems that employ the heat from the working fluid at different temperatures.
Special frequencies and Lifshitz singularities in binary random harmonic chains
International Nuclear Information System (INIS)
Nieuwenhuizen, T.M.; Luck, J.M.; Canisius, J.; van Hemmen, J.L.; Ventevogel, W.J.
1986-01-01
The authors consider a one-dimensional chain of coupled harmonic oscillators; the mass of each atom is a random variable taking only two values (M or 1). They investigate the integrated density of states H(omega 2 ) near special frequencies: a given frequency omega/sub s/ with rational wavelength becomes special if the mass ratio M exceeds a certain critical value M/sub c/. They show that H has essential singularities of the types H/sub sg/∼ exp(-C 1 absolute value of omega 2 -omega/sub s/ 2 /sup 1/2/) or exp(-C 2 absolute value of omega 2 -omega/sub s/ 2 -1 ), according to the value of M and the sign of (omega 2 -omega/sub s/ 2 ). The Lifshitz singularity at the band edge is analyzed in the same way. In each case, the constant C 1 or C 2 is evaluated explicitly and compared with a vast amount of numerical work. All these exponential singularities are modulated by periodic amplitudes. The properties of the eigenfunctions with frequencies close to the special values are also discussed, and are illustrated by numerical data
Probing the low-stellar-mass domain with Kepler and APOGEE observations of eclipsing binaries
Prsa, Andrej; Hambleton, Kelly
2018-01-01
Observations of low-mass stars (M models, where observed radii can be inflated by as much as 5-15% as compared to model predictions. One of the proposed explanations for this discrepancy that is gaining traction are stellar magnetic fields impeding the onset of convection and the subsequent bloating of the star. Here we present modeling analysis results of two benchmark eclipsing binaries, KIC 3003991 and KIC 2445134, with low mass companions (M ~ 0.2 MSun and M ~ 0.5 MSun, respectively). The models are based on Kepler photometry and APOGEE spectroscopy. APOGEE is a part of the Sloan spectroscopic survey that observes in the near-infrared, providing greater sensitivity towards fainter, red companions. We combine the binary modeling software PHOEBE with emcee, an affine invariant Markov chain Monte Carlo sampler; celerite, a Gaussian process library; and our own codes to create a modeling suite capable of modeling correlated noise, shot noise, nuisance astrophysical signals (such as spots) and the full set of eclipsing binary parameters. The results are obtained within a probabilistic framework, with robust mass and radius uncertainties ~1-4%. We overplot the derived masses, radii and temperatures over evolutionary models and note stellar size bloating w.r.t. model predictions for both systems. This work has been funded by the NSF grant #1517460.
Topological and categorical properties of binary trees
Directory of Open Access Journals (Sweden)
H. Pajoohesh
2008-04-01
Full Text Available Binary trees are very useful tools in computer science for estimating the running time of so-called comparison based algorithms, algorithms in which every action is ultimately based on a prior comparison between two elements. For two given algorithms A and B where the decision tree of A is more balanced than that of B, it is known that the average and worst case times of A will be better than those of B, i.e., ₸A(n ≤₸B(n and TWA (n≤TWB (n. Thus the most balanced and the most imbalanced binary trees play a main role. Here we consider them as semilattices and characterize the most balanced and the most imbalanced binary trees by topological and categorical properties. Also we define the composition of binary trees as a commutative binary operation, *, such that for binary trees A and B, A * B is the binary tree obtained by attaching a copy of B to any leaf of A. We show that (T,* is a commutative po-monoid and investigate its properties.
Optimally cloned binary coherent states
Müller, C. R.; Leuchs, G.; Marquardt, Ch.; Andersen, U. L.
2017-10-01
Binary coherent state alphabets can be represented in a two-dimensional Hilbert space. We capitalize this formal connection between the otherwise distinct domains of qubits and continuous variable states to map binary phase-shift keyed coherent states onto the Bloch sphere and to derive their quantum-optimal clones. We analyze the Wigner function and the cumulants of the clones, and we conclude that optimal cloning of binary coherent states requires a nonlinearity above second order. We propose several practical and near-optimal cloning schemes and compare their cloning fidelity to the optimal cloner.
Binaries and triples among asteroid pairs
Pravec, Petr; Scheirich, Peter; Kušnirák, Peter; Hornoch, Kamil; Galád, Adrián
2015-08-01
Despite major achievements obtained during the past two decades, our knowledge of the population and properties of small binary and multiple asteroid systems is still far from advanced. There is a numerous indirect evidence for that most small asteroid systems were formed by rotational fission of cohesionless parent asteroids that were spun up to the critical frequency presumably by YORP, but details of the process are lacking. Furthermore, as we proceed with observations of more and more binary and paired asteroids, we reveal new facts that substantially refine and sometimes change our understanding of the asteroid systems. One significant new finding we have recently obtained is that primaries of many asteroid pairs are actually binary or triple systems. The first such case found is (3749) Balam (Vokrouhlický, ApJL 706, L37, 2009). We have found 9 more binary systems among asteroid pairs within our ongoing NEOSource photometric project since October 2012. They are (6369) 1983 UC, (8306) Shoko, (9783) Tensho-kan, (10123) Fideoja, (21436) Chaoyichi, (43008) 1999 UD31, (44620) 1999 RS43, (46829) 1998 OS14 and (80218) 1999 VO123. We will review their characteristics. These paired binaries as we call them are mostly similar to binaries in the general ("background") population (of unpaired asteroids), but there are a few trends. The paired binaries tend to have larger secondaries with D_2/D_1 = 0.3 to 0.5 and they also tend to be wider systems with 8 of the 10 having orbital periods between 30 and 81 hours, than average among binaries in the general population. There may be also a larger fraction of triples; (3749) Balam is a confirmed triple, having a larger close and a smaller distant satellite, and (8306) Shoko and (10123) Fideoja are suspect triples as they show additional rotational lightcurve components with periods of 61 and 38.8 h that differ from the orbital period of 36.2 and 56.5 h, respectively. The unbound secondaries tend to be of the same size or
Detecting Malicious Code by Binary File Checking
Directory of Open Access Journals (Sweden)
Marius POPA
2014-01-01
Full Text Available The object, library and executable code is stored in binary files. Functionality of a binary file is altered when its content or program source code is changed, causing undesired effects. A direct content change is possible when the intruder knows the structural information of the binary file. The paper describes the structural properties of the binary object files, how the content can be controlled by a possible intruder and what the ways to identify malicious code in such kind of files. Because the object files are inputs in linking processes, early detection of the malicious content is crucial to avoid infection of the binary executable files.
Mass Transfer in Mira-Type Binaries
Directory of Open Access Journals (Sweden)
Mohamed S.
2012-06-01
Full Text Available Detached, symbiotic binaries are generally assumed to interact via Bondi-Hoyle-Littleton (BHL wind accretion. However, the accretion rates and outflow geometries that result from this mass-transfer mechanism cannot adequately explain the observations of the nearest and best studied symbiotic binary, Mira, or the formation of some post-AGB binaries, e.g. barium stars. We propose a new mass-transfer mode for Mira-type binaries, which we call ‘wind Roche-lobe overflow’ (WRLOF, and which we demonstrate with 3D hydrodynamic simulations. Importantly, we show that the circumstellar outflows which result from WRLOF tend to be highly aspherical and strongly focused towards the binary orbital plane. Furthermore, the subsequent mass-transfer rates are at least an order of magnitude greater than the analogous BHL values. We discuss the implications of these results for the shaping of bipolar (proto-planetary nebulae and other related systems.
RADIAL VELOCITY STUDIES OF CLOSE BINARY STARS. XIV
International Nuclear Information System (INIS)
Pribulla, Theodor; Rucinski, Slavek M.; DeBond, Heide; De Ridder, Archie; Karmo, Toomas; Thomson, J. R.; Croll, Bryce; Ogloza, Waldemar; Pilecki, Bogumil; Siwak, Michal
2009-01-01
Radial velocity (RV) measurements and sine curve fits to the orbital RV variations are presented for 10 close binary systems: TZ Boo, VW Boo, EL Boo, VZ CVn, GK Cep, RW Com, V2610 Oph, V1387 Ori, AU Ser, and FT UMa. Our spectroscopy revealed two quadruple systems, TZ Boo and V2610 Oph, while three stars showing small photometric amplitudes, EL Boo, V1387 Ori, and FT UMa, were found to be triple systems. GK Cep is a close binary with a faint third component. While most of the studied eclipsing systems are contact binaries, VZ CVn and GK Cep are detached or semidetached double-lined binaries, and EL Boo, V1387 Ori, and FT UMa are close binaries of uncertain binary type. The large fraction of triple and quadruple systems found in this sample supports the hypothesis of formation of close binaries in multiple stellar systems; it also demonstrates that low photometric amplitude binaries are a fertile ground for further discoveries of multiple systems.
Microlensing Signature of Binary Black Holes
Schnittman, Jeremy; Sahu, Kailash; Littenberg, Tyson
2012-01-01
We calculate the light curves of galactic bulge stars magnified via microlensing by stellar-mass binary black holes along the line-of-sight. We show the sensitivity to measuring various lens parameters for a range of survey cadences and photometric precision. Using public data from the OGLE collaboration, we identify two candidates for massive binary systems, and discuss implications for theories of star formation and binary evolution.
Formation and Evolution of X-ray Binaries
Fragkos, Anastasios
X-ray binaries - mass-transferring binary stellar systems with compact object accretors - are unique astrophysical laboratories. They carry information about many complex physical processes such as star formation, compact object formation, and evolution of interacting binaries. My thesis work involves the study of the formation and evolution of Galactic and extra-galacticX-ray binaries using both detailed and realistic simulation tools, and population synthesis techniques. I applied an innovative analysis method that allows the reconstruction of the full evolutionary history of known black hole X-ray binaries back to the time of compact object formation. This analysis takes into account all the available observationally determined properties of a system, and models in detail four of its evolutionary evolutionary phases: mass transfer through the ongoing X-ray phase, tidal evolution before the onset of Roche-lobe overflow, motion through the Galactic potential after the formation of the black hole, and binary orbital dynamics at the time of core collapse. Motivated by deep extra-galactic Chandra survey observations, I worked on population synthesis models of low-mass X-ray binaries in the two elliptical galaxies NGC3379 and NGC4278. These simulations were targeted at understanding the origin of the shape and normalization of the observed X-ray luminosity functions. In a follow up study, I proposed a physically motivated prescription for the modeling of transient neutron star low-mass X-ray binary properties, such as duty cycle, outburst duration and recurrence time. This prescription enabled the direct comparison of transient low-mass X-ray binary population synthesis models to the Chandra X-ray survey of the two ellipticals NGC3379 and NGC4278. Finally, I worked on population synthesismodels of black holeX-ray binaries in the MilkyWay. This work was motivated by recent developments in observational techniques for the measurement of black hole spin magnitudes in
Detectability of Gravitational Waves from High-Redshift Binaries.
Rosado, Pablo A; Lasky, Paul D; Thrane, Eric; Zhu, Xingjiang; Mandel, Ilya; Sesana, Alberto
2016-03-11
Recent nondetection of gravitational-wave backgrounds from pulsar timing arrays casts further uncertainty on the evolution of supermassive black hole binaries. We study the capabilities of current gravitational-wave observatories to detect individual binaries and demonstrate that, contrary to conventional wisdom, some are, in principle, detectable throughout the Universe. In particular, a binary with rest-frame mass ≳10^{10}M_{⊙} can be detected by current timing arrays at arbitrarily high redshifts. The same claim will apply for less massive binaries with more sensitive future arrays. As a consequence, future searches for nanohertz gravitational waves could be expanded to target evolving high-redshift binaries. We calculate the maximum distance at which binaries can be observed with pulsar timing arrays and other detectors, properly accounting for redshift and using realistic binary waveforms.
Non-binary Entanglement-assisted Stabilizer Quantum Codes
Riguang, Leng; Zhi, Ma
2011-01-01
In this paper, we show how to construct non-binary entanglement-assisted stabilizer quantum codes by using pre-shared entanglement between the sender and receiver. We also give an algorithm to determine the circuit for non-binary entanglement-assisted stabilizer quantum codes and some illustrated examples. The codes we constructed do not require the dual-containing constraint, and many non-binary classical codes, like non-binary LDPC codes, which do not satisfy the condition, can be used to c...
Transport and selective chaining of bidisperse particles in a travelling wave potential.
Tierno, Pietro; Straube, Arthur V
2016-05-01
We combine experiments, theory and numerical simulation to investigate the dynamics of a binary suspension of paramagnetic colloidal particles dispersed in water and transported above a stripe-patterned magnetic garnet film. The substrate generates a one-dimensional periodic energy landscape above its surface. The application of an elliptically polarized rotating magnetic field causes the landscape to translate, inducing direct transport of paramagnetic particles placed above the film. The ellipticity of the applied field can be used to control and tune the interparticle interactions, from net repulsive to net attractive. When considering particles of two distinct sizes, we find that, depending on their elevation above the surface of the magnetic substrate, the particles feel effectively different potentials, resulting in different mobilities. We exploit this feature to induce selective chaining for certain values of the applied field parameters. In particular, when driving two types of particles, we force only one type to condense into travelling parallel chains. These chains confine the movement of the other non-chaining particles within narrow colloidal channels. This phenomenon is explained by considering the balance of pairwise magnetic forces between the particles and their individual coupling with the travelling landscape.
Mesoscopic model for binary fluids
Echeverria, C.; Tucci, K.; Alvarez-Llamoza, O.; Orozco-Guillén, E. E.; Morales, M.; Cosenza, M. G.
2017-10-01
We propose a model for studying binary fluids based on the mesoscopic molecular simulation technique known as multiparticle collision, where the space and state variables are continuous, and time is discrete. We include a repulsion rule to simulate segregation processes that does not require calculation of the interaction forces between particles, so binary fluids can be described on a mesoscopic scale. The model is conceptually simple and computationally efficient; it maintains Galilean invariance and conserves the mass and energy in the system at the micro- and macro-scale, whereas momentum is conserved globally. For a wide range of temperatures and densities, the model yields results in good agreement with the known properties of binary fluids, such as the density profile, interface width, phase separation, and phase growth. We also apply the model to the study of binary fluids in crowded environments with consistent results.
International Nuclear Information System (INIS)
Conroy, Kyle E.; Stassun, Keivan G.; Prša, Andrej; Orosz, Jerome A.; Welsh, William F.; Fabrycky, Daniel C.
2014-01-01
We present a catalog of precise eclipse times and analysis of third-body signals among 1279 close binaries in the latest Kepler Eclipsing Binary Catalog. For these short-period binaries, Kepler's 30 minute exposure time causes significant smearing of light curves. In addition, common astrophysical phenomena such as chromospheric activity, as well as imperfections in the light curve detrending process, can create systematic artifacts that may produce fictitious signals in the eclipse timings. We present a method to measure precise eclipse times in the presence of distorted light curves, such as in contact and near-contact binaries which exhibit continuously changing light levels in and out of eclipse. We identify 236 systems for which we find a timing variation signal compatible with the presence of a third body. These are modeled for the light travel time effect and the basic properties of the third body are derived. This study complements J. A. Orosz et al. (in preparation), which focuses on eclipse timing variations of longer period binaries with flat out-of-eclipse regions. Together, these two papers provide comprehensive eclipse timings for all binaries in the Kepler Eclipsing Binary Catalog, as an ongoing resource freely accessible online to the community.
International Nuclear Information System (INIS)
De Moura, F A B F; Leao, F F S; Lyra, M L
2011-01-01
In this work, we study a tight-binding Hamiltonian model system of a binary correlated ladder with diluted disorder. We introduce intra-chain correlations between the on-site potentials by imposing that ε i, s = - ε i,-s where s = ± 1 indexes the two ladder chains. Further, we consider each ladder chain as composed of inter-penetrating ordered and random sub-chains. We show that the presence of a random on-site distribution in one of the inter-penetrating chains leads to Anderson localization except at a specific symmetric pair of energy eigenmodes. Further, by integrating the time-dependent Schroedinger equation, we follow the time-evolution of an initially localized one-electron wavepacket. We report that the remaining delocalized resonant modes are responsible for a super-diffusive spread of the wavepacket dispersion while the wavepacket participation function remains finite. A scaling analysis of the wavepacket distribution shows that it obeys a universal scaling form with the development of a power-law tail followed by a super-diffusively evolving cutoff. We obtain three exponents characterizing this super-diffusive dynamics and show that they satisfy a simple scaling relation.
CIRCUMBINARY MAGNETOHYDRODYNAMIC ACCRETION INTO INSPIRALING BINARY BLACK HOLES
Energy Technology Data Exchange (ETDEWEB)
Noble, Scott C.; Mundim, Bruno C.; Nakano, Hiroyuki; Campanelli, Manuela; Zlochower, Yosef [Center for Computational Relativity and Gravitation, Rochester Institute of Technology, Rochester, NY 14623 (United States); Krolik, Julian H. [Physics and Astronomy Department, Johns Hopkins University, Baltimore, MD 21218 (United States); Yunes, Nicolas, E-mail: scn@astro.rit.edu [Department of Physics, Montana State University, Bozeman, MT 59717 (United States)
2012-08-10
We have simulated the magnetohydrodynamic evolution of a circumbinary disk surrounding an equal-mass binary comprising two non-spinning black holes during the period in which the disk inflow time is comparable to the binary evolution time due to gravitational radiation. Both the changing spacetime and the binary orbital evolution are described by an innovative technique utilizing high-order post-Newtonian approximations. Prior to the beginning of the inspiral, the structure of the circumbinary disk is predicted well by extrapolation from Newtonian results: a gap of roughly two binary separation radii is cleared, and matter piles up at the outer edge of this gap as inflow is retarded by torques exerted by the binary; the accretion rate is roughly half its value at large radius. During inspiral, the inner edge of the disk initially moves inward in coordination with the shrinking binary, but-as the orbital evolution accelerates-the inward motion of the disk edge falls behind the rate of binary compression. In this stage, the binary torque falls substantially, but the accretion rate decreases by only 10%-20%. When the binary separation is tens of gravitational radii, the rest-mass efficiency of disk radiation is a few percent, suggesting that supermassive binary black holes could be very luminous at this stage of their evolution. Inner disk heating is modulated at a beat frequency comparable to the binary orbital frequency. However, a disk with sufficient surface density to be luminous may be optically thick, suppressing periodic modulation of the luminosity.
Binary and Millisecond Pulsars
Directory of Open Access Journals (Sweden)
Lorimer Duncan R.
2008-11-01
Full Text Available We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1800. There are now 83 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 140 pulsars in 26 of the Galactic globular clusters. Recent highlights include the discovery of the young relativistic binary system PSR J1906+0746, a rejuvination in globular cluster pulsar research including growing numbers of pulsars with masses in excess of 1.5M_⊙, a precise measurement of relativistic spin precession in the double pulsar system and a Galactic millisecond pulsar in an eccentric (e = 0.44 orbit around an unevolved companion.
Observations of new Wolf-Rayet binaries
International Nuclear Information System (INIS)
Niemela, V.S.
1982-01-01
The author reports here preliminary results of spectrographic observations for three southern WR stars, whose binary nature had not been previously verified: HDE 320102, CD -45 0 4482, HD 62910. The observations were carried out at the Cerro Tololo Inter-American Observatory, Chile, mostly with the Cassegrain spectrograph with IT attached to the 1-m reflector. These spectrograms were secured on Kodak IIIaJ emulsion, and have a dispersion of 45 A/mm. The results suggest that HDE 320102 must be a double-lined 05-7 + WN3 spectroscopic binary, that CD -45 0 4482 appears to be a single-lined spectroscopic binary and that HD 62910 may be a binary. (Auth.)
Asghari, Mehdi Poursheikhali; Hayatshahi, Sayyed Hamed Sadat; Abdolmaleki, Parviz
2012-01-01
From both the structural and functional points of view, β-turns play important biological roles in proteins. In the present study, a novel two-stage hybrid procedure has been developed to identify β-turns in proteins. Binary logistic regression was initially used for the first time to select significant sequence parameters in identification of β-turns due to a re-substitution test procedure. Sequence parameters were consisted of 80 amino acid positional occurrences and 20 amino acid percentages in sequence. Among these parameters, the most significant ones which were selected by binary logistic regression model, were percentages of Gly, Ser and the occurrence of Asn in position i+2, respectively, in sequence. These significant parameters have the highest effect on the constitution of a β-turn sequence. A neural network model was then constructed and fed by the parameters selected by binary logistic regression to build a hybrid predictor. The networks have been trained and tested on a non-homologous dataset of 565 protein chains. With applying a nine fold cross-validation test on the dataset, the network reached an overall accuracy (Qtotal) of 74, which is comparable with results of the other β-turn prediction methods. In conclusion, this study proves that the parameter selection ability of binary logistic regression together with the prediction capability of neural networks lead to the development of more precise models for identifying β-turns in proteins.
Asteroseismic effects in close binary stars
Springer, Ofer M.; Shaviv, Nir J.
2013-09-01
Turbulent processes in the convective envelopes of the Sun and stars have been shown to be a source of internal acoustic excitations. In single stars, acoustic waves having frequencies below a certain cut-off frequency propagate nearly adiabatically and are effectively trapped below the photosphere where they are internally reflected. This reflection essentially occurs where the local wavelength becomes comparable to the pressure scale height. In close binary stars, the sound speed is a constant on equipotentials, while the pressure scale height, which depends on the local effective gravity, varies on equipotentials and may be much greater near the inner Lagrangian point (L1). As a result, waves reaching the vicinity of L1 may propagate unimpeded into low-density regions, where they tend to dissipate quickly due to non-linear and radiative effects. We study the three-dimensional propagation and enhanced damping of such waves inside a set of close binary stellar models using a WKB approximation of the acoustic field. We find that these waves can have much higher damping rates in close binaries, compared to their non-binary counterparts. We also find that the relative distribution of acoustic energy density at the visible surface of close binaries develops a ring-like feature at specific acoustic frequencies and binary separations.
Directory of Open Access Journals (Sweden)
M.I. Baranov
2016-03-01
Full Text Available Purpose. Experimental researches of electro-thermal resistibility of cable-explorer products, applied in the power electric circuits of objects of electric-power industry, to action on its copper and aluminum parts bearings a current rationed on the International Standard of IEC 62305-1-2010 aperiodic impulse 10/350 μs of current of artificial lightning. Methodology. Electrophysics bases of technique of high tensions and high pulsed currents (HPC, and also scientific and technical bases of planning of devices of high-voltage impulsive technique and measuring HPC in them. Results. Experimental a way the quantitative levels of maximal values maximum of possible and critical closenesses of aperiodic impulse 10/350 μs of current of artificial lightning with rationed on the international standard of IEC 62305-1-2010 peak-temporal parameters and admittances on them in copper (aluminum parts bearings a current of send-offs and cables with a polyethylene (PET and polyvinylchloride (PVCH isolation. Originality. First in world practice on the unique powerful high-voltage generator of HPC of artificial lightning experimental researches of resistibility to lightning of pre-production models of send-offs (cables are conducted with copper (aluminum tendons, PET and PVCH by an isolation, in-use in power electric circuits of electric-power industry objects. Practical value. The use in practice of protecting from lightning of the got results will allow substantially to promote functional and fire-prevention safety of engineering communications of objects of industrial electroenergy in the conditions of action on them of short shots of linear lightning.
International Nuclear Information System (INIS)
Trinh, Thi-Kim-Hoang; Passarello, Jean-Philippe; Hemptinne, Jean-Charles de; Lugo, Rafael; Lachet, Veronique
2016-01-01
This work consists of the adaptation of a non-additive hard sphere theory inspired by Malakhov and Volkov [Polym. Sci., Ser. A 49(6), 745–756 (2007)] to a square-well chain. Using the thermodynamic perturbation theory, an additional term is proposed that describes the effect of perturbing the chain of square well spheres by a non-additive parameter. In order to validate this development, NPT Monte Carlo simulations of thermodynamic and structural properties of the non-additive square well for a pure chain and a binary mixture of chains are performed. Good agreements are observed between the compressibility factors originating from the theory and those from molecular simulations.
Logistic chaotic maps for binary numbers generations
International Nuclear Information System (INIS)
Kanso, Ali; Smaoui, Nejib
2009-01-01
Two pseudorandom binary sequence generators, based on logistic chaotic maps intended for stream cipher applications, are proposed. The first is based on a single one-dimensional logistic map which exhibits random, noise-like properties at given certain parameter values, and the second is based on a combination of two logistic maps. The encryption step proposed in both algorithms consists of a simple bitwise XOR operation of the plaintext binary sequence with the keystream binary sequence to produce the ciphertext binary sequence. A threshold function is applied to convert the floating-point iterates into binary form. Experimental results show that the produced sequences possess high linear complexity and very good statistical properties. The systems are put forward for security evaluation by the cryptographic committees.
Phase Behavior of Binary Blends of AB+AC Block Copolymers with compatible B and C blocks
Pryamitsyn, Victor; Ganesan, Venkat
2012-02-01
Recently the experimental studies of phase behavior of binary blends of PS-b-P2VP and PS-b-PHS demonstrated an interesting effect: blends of symmetric PS-b-P2VP and shorter symmetric (PS-b-PHS) formed cylindrical HEX and spherical BCC phases, while each pure component formed lamellas. The miscibility of P2VP and PHS is caused by the hydrogen bonding between P2VP and PHS,which can be described as a negative Flory ?-parameter between P2VP and PHS. We developed a theory of the microphase segregation of AB+AC blends of diblock copolymers based on strong stretching theory. The main result of our theory is that in the copolymer brush-like layer formed by longer B chain and shorter C chains, the attraction between B and shorter C chains causes relative stretching of short C chains and compression of longer B chains. The latter manifests in an excessive bending force towards the grafting surface (BC|AA interface). Such bending force causes a transition from a symmetric lamella phase to a HEX cylinder or BCC spherical phases with the BC phase being a ``matrix'' component. In a blend of asymmetric BCC sphere forming copolymers (where B and C segments are the minor components), such bending force may unfold BCC spherical phase to a HEX cylinder phase, or even highly uneven lamella phases.
Leportier, Thibault; Park, Min Chul; Kim, You Seok; Kim, Taegeun
2015-02-09
In this paper, we present a three-dimensional holographic imaging system. The proposed approach records a complex hologram of a real object using optical scanning holography, converts the complex form to binary data, and then reconstructs the recorded hologram using a spatial light modulator (SLM). The conversion from the recorded hologram to a binary hologram is achieved using a direct binary search algorithm. We present experimental results that verify the efficacy of our approach. To the best of our knowledge, this is the first time that a hologram of a real object has been reconstructed using a binary SLM.
EXTRASOLAR BINARY PLANETS. II. DETECTABILITY BY TRANSIT OBSERVATIONS
International Nuclear Information System (INIS)
Lewis, K. M.; Ida, S.; Ochiai, H.; Nagasawa, M.
2015-01-01
We discuss the detectability of gravitationally bound pairs of gas-giant planets (which we call “binary planets”) in extrasolar planetary systems that are formed through orbital instability followed by planet–planet dynamical tides during their close encounters, based on the results of N-body simulations by Ochiai et al. (Paper I). Paper I showed that the formation probability of a binary is as much as ∼10% for three giant planet systems that undergo orbital instability, and after post-capture long-term tidal evolution, the typical binary separation is three to five times the sum of the physical radii of the planets. The binary planets are stable during the main-sequence lifetime of solar-type stars, if the stellarcentric semimajor axis of the binary is larger than 0.3 AU. We show that detecting modulations of transit light curves is the most promising observational method to detect binary planets. Since the likely binary separations are comparable to the stellar diameter, the shape of the transit light curve is different from transit to transit, depending on the phase of the binary’s orbit. The transit durations and depth for binary planet transits are generally longer and deeper than those for the single planet case. We point out that binary planets could exist among the known inflated gas-giant planets or objects classified as false positive detections at orbital radii ≳0.3 AU, propose a binary planet explanation for the CoRoT candidate SRc01 E2 1066, and show that binary planets are likely to be present in, and could be detected using, Kepler-quality data
Sesana, Alberto; Haardt, Francesco; Madau, Piero
2007-05-01
We study the long-term evolution of massive black hole binaries (MBHBs) at the centers of galaxies using detailed scattering experiments to solve the full three-body problem. Ambient stars drawn from an isotropic Maxwellian distribution unbound to the binary are ejected by the gravitational slingshot. We construct a minimal, hybrid model for the depletion of the loss cone and the orbital decay of the binary and show that secondary slingshots-stars returning on small-impact parameter orbits to have a second superelastic scattering with the MBHB-may considerably help the shrinking of the pair in the case of large binary mass ratios. In the absence of loss cone refilling by two-body relaxation or other processes, the mass ejected before the stalling of a MBHB is half the binary reduced mass. About 50% of the ejected stars are expelled in a ``burst'' lasting ~104 yr M1/46, where M6 is the binary mass in units of 106 Msolar. The loss cone is completely emptied in a few bulge crossing timescales, ~107 yr M1/46. Even in the absence of two-body relaxation or gas dynamical processes, unequal mass and/or eccentric binaries with M6>~0.1 can shrink to the gravitational wave emission regime in less than a Hubble time and are therefore ``safe'' targets for the planned Laser Interferometer Space Antenna.
A Hamiltonian Monte–Carlo method for Bayesian inference of supermassive black hole binaries
International Nuclear Information System (INIS)
Porter, Edward K; Carré, Jérôme
2014-01-01
We investigate the use of a Hamiltonian Monte–Carlo to map out the posterior density function for supermassive black hole binaries. While previous Markov Chain Monte–Carlo (MCMC) methods, such as Metropolis–Hastings MCMC, have been successfully employed for a number of different gravitational wave sources, these methods are essentially random walk algorithms. The Hamiltonian Monte–Carlo treats the inverse likelihood surface as a ‘gravitational potential’ and by introducing canonical positions and momenta, dynamically evolves the Markov chain by solving Hamilton's equations of motion. This method is not as widely used as other MCMC algorithms due to the necessity of calculating gradients of the log-likelihood, which for most applications results in a bottleneck that makes the algorithm computationally prohibitive. We circumvent this problem by using accepted initial phase-space trajectory points to analytically fit for each of the individual gradients. Eliminating the waveform generation needed for the numerical derivatives reduces the total number of required templates for a 10 6 iteration chain from ∼10 9 to ∼10 6 . The result is in an implementation of the Hamiltonian Monte–Carlo that is faster, and more efficient by a factor of approximately the dimension of the parameter space, than a Hessian MCMC. (paper)
International Nuclear Information System (INIS)
Raymond, V; Mandel, I; Kalogera, V; Van der Sluys, M V; Roever, C; Christensen, N
2010-01-01
Gravitational-wave signals from inspirals of binary compact objects (black holes and neutron stars) are primary targets of the ongoing searches by ground-based gravitational-wave (GW) interferometers (LIGO, Virgo and GEO-600). We present parameter estimation results from our Markov-chain Monte Carlo code SPINspiral on signals from binaries with precessing spins. Two data sets are created by injecting simulated GW signals either into synthetic Gaussian noise or into LIGO detector data. We compute the 15-dimensional probability-density functions (PDFs) for both data sets, as well as for a data set containing LIGO data with a known, loud artefact ('glitch'). We show that the analysis of the signal in detector noise yields accuracies similar to those obtained using simulated Gaussian noise. We also find that while the Markov chains from the glitch do not converge, the PDFs would look consistent with a GW signal present in the data. While our parameter estimation results are encouraging, further investigations into how to differentiate an actual GW signal from noise are necessary.
Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R
2013-07-23
Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.
Merger rate of primordial black-hole binaries
Ali-Haïmoud, Yacine; Kovetz, Ely D.; Kamionkowski, Marc
2017-12-01
Primordial black holes (PBHs) have long been a candidate for the elusive dark matter (DM), and remain poorly constrained in the ˜20 - 100 M⊙ mass range. PBH binaries were recently suggested as the possible source of LIGO's first detections. In this paper, we thoroughly revisit existing estimates of the merger rate of PBH binaries. We compute the probability distribution of orbital parameters for PBH binaries formed in the early Universe, accounting for tidal torquing by all other PBHs, as well as standard large-scale adiabatic perturbations. We then check whether the orbital parameters of PBH binaries formed in the early Universe can be significantly affected between formation and merger. Our analytic estimates indicate that the tidal field of halos and interactions with other PBHs, as well as dynamical friction by unbound standard DM particles, do not do significant work on nor torque PBH binaries. We estimate the torque due to baryon accretion to be much weaker than previous calculations, albeit possibly large enough to significantly affect the eccentricity of typical PBH binaries. We also revisit the PBH-binary merger rate resulting from gravitational capture in present-day halos, accounting for Poisson fluctuations. If binaries formed in the early Universe survive to the present time, as suggested by our analytic estimates, they dominate the total PBH merger rate. Moreover, this merger rate would be orders of magnitude larger than LIGO's current upper limits if PBHs make a significant fraction of the dark matter. As a consequence, LIGO would constrain ˜10 - 300 M⊙ PBHs to constitute no more than ˜1 % of the dark matter. To make this conclusion fully robust, though, numerical study of several complex astrophysical processes—such as the formation of the first PBH halos and how they may affect PBH binaries, as well as the accretion of gas onto an extremely eccentric binary—is needed.
International Nuclear Information System (INIS)
Morton, David W.; Lui, Matthew P.W.; Young, Colin L.
2003-01-01
Previously, the investigation of the (gas + liquid) critical properties of (alkanol + alkane) mixtures has focussed on (primary alkanol + straight chain alkane) mixtures. The experimental data available for (alkanol + alkane) mixtures, which include secondary or tertiary alcohols and/or branched chain alkanes, are extremely limited. This work extends the existing body of data on (alkanol + alkane) mixtures to include mixtures containing these components. Here the (gas + liquid) critical temperatures of 29 {alkanol (C 2 -C 5 ) + alkane (C 5 -C 12 )} mixtures are reported. All the (gas + liquid) critical lines for the binary mixtures studied are continuous, indicating they obey either Type I or Type II phase behaviour
MICROLENSING BINARIES DISCOVERED THROUGH HIGH-MAGNIFICATION CHANNEL
Energy Technology Data Exchange (ETDEWEB)
Shin, I.-G.; Choi, J.-Y.; Park, S.-Y.; Han, C. [Department of Physics, Institute for Astrophysics, Chungbuk National University, Cheongju 371-763 (Korea, Republic of); Gould, A.; Gaudi, B. S. [Department of Astronomy, Ohio State University, 140 W. 18th Ave., Columbus, OH 43210 (United States); Sumi, T. [Department of Earth and Space Science, Osaka University, Osaka 560-0043 (Japan); Udalski, A. [Warsaw University Observatory, Al. Ujazdowskie 4, 00-478 Warszawa (Poland); Beaulieu, J.-P. [Institut d' Astrophysique de Paris, UMR7095 CNRS-Universite Pierre and Marie Curie, 98 bis Boulevard Arago, 75014 Paris (France); Dominik, M. [School of Physics and Astronomy, SUPA, University of St. Andrews, North Haugh, St. Andrews, KY16 9SS (United Kingdom); Allen, W. [Vintage Lane Observatory, Blenheim (New Zealand); Bos, M. [Molehill Astronomical Observatory, North Shore (New Zealand); Christie, G. W. [Auckland Observatory, P.O. Box 24-180, Auckland (New Zealand); Depoy, D. L. [Department of Physics, Texas A and M University, College Station, TX (United States); Dong, S. [Institute for Advanced Study, Einstein Drive, Princeton, NJ 08540 (United States); Drummond, J. [Possum Observatory, Patutahi (New Zealand); Gal-Yam, A. [Benoziyo Center for Astrophysics, the Weizmann Institute (Israel); Hung, L.-W. [Department of Physics and Astronomy, University of California Los Angeles, Los Angeles, CA 90095 (United States); Janczak, J. [Department of Physics, Ohio State University, 191 W. Woodruff, Columbus, OH 43210 (United States); Kaspi, S. [School of Physics and Astronomy, Tel-Aviv University, Tel Aviv 69978 (Israel); Collaboration: muFUN Collaboration; MOA Collaboration; OGLE Collaboration; PLANET Collaboration; RoboNet Collaboration; MiNDSTEp Consortium; and others
2012-02-20
Microlensing can provide a useful tool to probe binary distributions down to low-mass limits of binary companions. In this paper, we analyze the light curves of eight binary-lensing events detected through the channel of high-magnification events during the seasons from 2007 to 2010. The perturbations, which are confined near the peak of the light curves, can be easily distinguished from the central perturbations caused by planets. However, the degeneracy between close and wide binary solutions cannot be resolved with a 3{sigma} confidence level for three events, implying that the degeneracy would be an important obstacle in studying binary distributions. The dependence of the degeneracy on the lensing parameters is consistent with a theoretical prediction that the degeneracy becomes severe as the binary separation and the mass ratio deviate from the values of resonant caustics. The measured mass ratio of the event OGLE-2008-BLG-510/MOA-2008-BLG-369 is q {approx} 0.1, making the companion of the lens a strong brown dwarf candidate.
Concentration fluctuations in miscible polymer blends: Influence of temperature and chain rigidity
International Nuclear Information System (INIS)
Dudowicz, Jacek; Freed, Karl F.; Douglas, Jack F.
2014-01-01
In contrast to binary mixtures of small molecule fluids, homogeneous polymer blends exhibit relatively large concentration fluctuations that can strongly affect the transport properties of these complex fluids over wide ranges of temperatures and compositions. The spatial scale and intensity of these compositional fluctuations are studied by applying Kirkwood-Buff theory to model blends of linear semiflexible polymer chains with upper critical solution temperatures. The requisite quantities for determining the Kirkwood-Buff integrals are generated from the lattice cluster theory for the thermodynamics of the blend and from the generalization of the random phase approximation to compressible polymer mixtures. We explore how the scale and intensity of composition fluctuations in binary blends vary with the reduced temperature τ ≡ (T − T c )/T (where T c is the critical temperature) and with the asymmetry in the rigidities of the components. Knowledge of these variations is crucial for understanding the dynamics of materials fabricated from polymer blends, and evidence supporting these expectations is briefly discussed
Energy Technology Data Exchange (ETDEWEB)
Oelkers, Ryan J.; Stassun, Keivan G.; Dhital, Saurav, E-mail: ryan.j.oelkers@vanderbilt.edu [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN 37235 (United States)
2017-06-01
The formation and evolution of binary star systems are some of the remaining key questions in modern astronomy. Wide binary pairs (separations >10{sup 3} au) are particularly intriguing because their low binding energies make it difficult for the stars to stay gravitationally bound over extended timescales, and thus to probe the dynamics of binary formation and dissolution. Our previous SLoWPoKES catalogs, I and II, provided the largest and most complete sample of wide-binary pairs of low masses. Here we present an extension of these catalogs to a broad range of stellar masses: the Gaia Assorted Mass Binaries Long Excluded from SloWPoKES (GAMBLES), comprising 8660 statistically significant wide pairs that we make available in a living online database. Within this catalog we identify a subset of 543 long-lived (dissipation timescale >1.5 Gyr) candidate binary pairs, of assorted mass, with typical separations between 10{sup 3} and 10{sup 5.5} au (0.002–1.5 pc), using the published distances and proper motions from the Tycho -Gaia Astrometric Solution and Sloan Digital Sky Survey photometry. Each pair has at most a false positive probability of 0.05; the total expectation is 2.44 false binaries in our sample. Among these, we find 22 systems with 3 components, 1 system with 4 components, and 15 pairs consisting of at least 1 possible red giant. We find the largest long-lived binary separation to be nearly 3.2 pc; even so, >76% of GAMBLES long-lived binaries have large binding energies and dissipation lifetimes longer than 1.5 Gyr. Finally, we find that the distribution of binary separations is clearly bimodal, corroborating the findings from SloWPoKES and suggesting multiple pathways for the formation and dissipation of the widest binaries in the Galaxy.
International Nuclear Information System (INIS)
Oelkers, Ryan J.; Stassun, Keivan G.; Dhital, Saurav
2017-01-01
The formation and evolution of binary star systems are some of the remaining key questions in modern astronomy. Wide binary pairs (separations >10 3 au) are particularly intriguing because their low binding energies make it difficult for the stars to stay gravitationally bound over extended timescales, and thus to probe the dynamics of binary formation and dissolution. Our previous SLoWPoKES catalogs, I and II, provided the largest and most complete sample of wide-binary pairs of low masses. Here we present an extension of these catalogs to a broad range of stellar masses: the Gaia Assorted Mass Binaries Long Excluded from SloWPoKES (GAMBLES), comprising 8660 statistically significant wide pairs that we make available in a living online database. Within this catalog we identify a subset of 543 long-lived (dissipation timescale >1.5 Gyr) candidate binary pairs, of assorted mass, with typical separations between 10 3 and 10 5.5 au (0.002–1.5 pc), using the published distances and proper motions from the Tycho -Gaia Astrometric Solution and Sloan Digital Sky Survey photometry. Each pair has at most a false positive probability of 0.05; the total expectation is 2.44 false binaries in our sample. Among these, we find 22 systems with 3 components, 1 system with 4 components, and 15 pairs consisting of at least 1 possible red giant. We find the largest long-lived binary separation to be nearly 3.2 pc; even so, >76% of GAMBLES long-lived binaries have large binding energies and dissipation lifetimes longer than 1.5 Gyr. Finally, we find that the distribution of binary separations is clearly bimodal, corroborating the findings from SloWPoKES and suggesting multiple pathways for the formation and dissipation of the widest binaries in the Galaxy.
International Nuclear Information System (INIS)
Petrov, D.A.
1986-01-01
Conditions for thermodynamical equilibrium in binary and ternary systems are considered. Main types of binary and ternary system phase diagrams are sequently constructed on the basis of general regularities on the character of transition from one equilibria to others. New statements on equilibrium line direction in the diagram triple points and their isothermal cross sections are developed. New represenations on equilibria in case of monovariant curve minimum and maximum on three-phase equilibrium formation in ternary system are introduced
Thebault, Ph.; Haghighipour, N.
2014-01-01
Spurred by the discovery of numerous exoplanets in multiple systems, binaries have become in recent years one of the main topics in planet formation research. Numerous studies have investigated to what extent the presence of a stellar companion can affect the planet formation process. Such studies have implications that can reach beyond the sole context of binaries, as they allow to test certain aspects of the planet formation scenario by submitting them to extreme environments. We review her...
International Nuclear Information System (INIS)
Mohammad, Abubaker A.; Alkhaldi, Khaled H.A.E.; AlTuwaim, Mohammad S.; Al-Jimaz, Adel S.
2013-01-01
Highlights: ► Physical properties of binary mixtures of DMF+1-pentanol, 1-hexanol, or 1-heptanol. ► Viscosity and surface tension were measured. ►Δη, Δσ σ and G ∗E were calculated using the experimental data. ► H σ and S σ were determined using the surface tension data. ► Semi-empirical relations were used to estimate the viscosity of liquid mixtures. - Abstract: Viscosity η and surface tension σ were measured for binary mixtures of N,N-dimethylformamide DMF with pentan-1-ol, hexan-1-ol, and heptan-1-ol at T = (298.15, 303.15, 308.15, and 313.15) K and atmospheric pressure over the entire mole fraction range. Deviations in viscosity Δη and surface tension Δσ were calculated using experimental results. Moreover, the values of the excess Gibbs free energy of activation G ∗E , surface enthalpy H σ and surface entropy S σ of these mixtures were determined. Viscosity measurements of the binary systems were correlated with Grunberg and Nissan, the three-body and four-body McAllister expressions. Viscosity deviation, surface tension deviation and excess Gibbs energy of activation functions were fitted to the method of Redlich–Kister (R–K) polynomial to estimate the coefficients and standard deviations. The effects of chain length of alkan-1-ols and temperature on the thermodynamic properties of binary systems were studied.
Non-negative Matrix Factorization for Binary Data
DEFF Research Database (Denmark)
Larsen, Jacob Søgaard; Clemmensen, Line Katrine Harder
We propose the Logistic Non-negative Matrix Factorization for decomposition of binary data. Binary data are frequently generated in e.g. text analysis, sensory data, market basket data etc. A common method for analysing non-negative data is the Non-negative Matrix Factorization, though...... this is in theory not appropriate for binary data, and thus we propose a novel Non-negative Matrix Factorization based on the logistic link function. Furthermore we generalize the method to handle missing data. The formulation of the method is compared to a previously proposed method (Tome et al., 2015). We compare...... the performance of the Logistic Non-negative Matrix Factorization to Least Squares Non-negative Matrix Factorization and Kullback-Leibler (KL) Non-negative Matrix Factorization on sets of binary data: a synthetic dataset, a set of student comments on their professors collected in a binary term-document matrix...
Binary and Millisecond Pulsars.
Lorimer, Duncan R
2008-01-01
We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1800. There are now 83 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 140 pulsars in 26 of the Galactic globular clusters. Recent highlights include the discovery of the young relativistic binary system PSR J1906+0746, a rejuvination in globular cluster pulsar research including growing numbers of pulsars with masses in excess of 1.5 M ⊙ , a precise measurement of relativistic spin precession in the double pulsar system and a Galactic millisecond pulsar in an eccentric ( e = 0.44) orbit around an unevolved companion. Supplementary material is available for this article at 10.12942/lrr-2008-8.
Flip-flopping binary black holes.
Lousto, Carlos O; Healy, James
2015-04-10
We study binary spinning black holes to display the long term individual spin dynamics. We perform a full numerical simulation starting at an initial proper separation of d≈25M between equal mass holes and evolve them down to merger for nearly 48 orbits, 3 precession cycles, and half of a flip-flop cycle. The simulation lasts for t=20 000M and displays a total change in the orientation of the spin of one of the black holes from an initial alignment with the orbital angular momentum to a complete antialignment after half of a flip-flop cycle. We compare this evolution with an integration of the 3.5 post-Newtonian equations of motion and spin evolution to show that this process continuously flip flops the spin during the lifetime of the binary until merger. We also provide lower order analytic expressions for the maximum flip-flop angle and frequency. We discuss the effects this dynamics may have on spin growth in accreting binaries and on the observational consequences for galactic and supermassive binary black holes.
Binary Star Fractions from the LAMOST DR4
Tian, Zhi-Jia; Liu, Xiao-Wei; Yuan, Hai-Bo; Chen, Bing-Qiu; Xiang, Mao-Sheng; Huang, Yang; Wang, Chun; Zhang, Hua-Wei; Guo, Jin-Cheng; Ren, Juan-Juan; Huo, Zhi-Ying; Yang, Yong; Zhang, Meng; Bi, Shao-Lan; Yang, Wu-Ming; Liu, Kang; Zhang, Xian-Fei; Li, Tan-Da; Wu, Ya-Qian; Zhang, Jing-Hua
2018-05-01
Stellar systems composed of single, double, triple or higher-order systems are rightfully regarded as the fundamental building blocks of the Milky Way. Binary stars play an important role in formation and evolution of the Galaxy. Through comparing the radial velocity variations from multi-epoch observations, we analyze the binary fraction of dwarf stars observed with LAMOST. Effects of different model assumptions, such as orbital period distributions on the estimate of binary fractions, are investigated. The results based on log-normal distribution of orbital periods reproduce the previous complete analyses better than the power-law distribution. We find that the binary fraction increases with T eff and decreases with [Fe/H]. We first investigate the relation between α-elements and binary fraction in such a large sample as provided by LAMOST. The old stars with high [α/Fe] dominate with a higher binary fraction than young stars with low [α/Fe]. At the same mass, earlier forming stars possess a higher binary fraction than newly forming ones, which may be related with evolution of the Galaxy.
Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.
Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.
WHITE-LIGHT FLARES ON CLOSE BINARIES OBSERVED WITH KEPLER
International Nuclear Information System (INIS)
Gao, Qing; Xin, Yu; Liu, Ji-Feng; Zhang, Xiao-Bin; Gao, Shuang
2016-01-01
Based on Kepler data, we present the results of a search for white light flares on 1049 close binaries. We identify 234 flare binaries, of which 6818 flares are detected. We compare the flare-binary fraction in different binary morphologies (“detachedness”). The result shows that the fractions in over-contact and ellipsoidal binaries are approximately 10%–20% lower than those in detached and semi-detached systems. We calculate the binary flare activity level (AL) of all the flare binaries, and discuss its variations along the orbital period ( P orb ) and rotation period ( P rot , calculated for only detached binaries). We find that the AL increases with decreasing P orb or P rot , up to the critical values at P orb ∼ 3 days or P rot ∼ 1.5 days, and thereafter the AL starts decreasing no matter how fast the stars rotate. We examine the flaring rate as a function of orbital phase in two eclipsing binaries on which a large number of flares are detected. It appears that there is no correlation between flaring rate and orbital phase in these two binaries. In contrast, when we examine the function with 203 flares on 20 non-eclipse ellipsoidal binaries, bimodal distribution of amplitude-weighted flare numbers shows up at orbital phases 0.25 and 0.75. Such variation could be larger than what is expected from the cross section modification.
A fast search strategy for gravitational waves from low-mass x-ray binaries
International Nuclear Information System (INIS)
Messenger, C; Woan, G
2007-01-01
We present a new type of search strategy designed specifically to find continuously emitting gravitational wave sources in known binary systems. A component of this strategy is based on the incoherent summation of frequency-modulated binary signal sidebands, a method previously employed in the detection of electromagnetic pulsar signals from radio observations. The search pipeline can be divided into three stages: the first is a wide bandwidth, F-statistic search demodulated for sky position. This is followed by a fast second stage in which areas in frequency space are identified as signal candidates through the frequency domain convolution of the F-statistic with an approximate signal template. For this second stage only precise information on the orbit period and approximate information on the orbital semi-major axis are required a priori. For the final stage we propose a fully coherent Markov chain Monte Carlo based follow-up search on the frequency subspace defined by the candidates identified by the second stage. This search is particularly suited to the low-mass x-ray binaries, for which orbital period and sky position are typically well known and additional orbital parameters and neutron star spin frequency are not. We note that for the accreting x-ray millisecond pulsars, for which spin frequency and orbital parameters are well known, the second stage can be omitted and the fully coherent search stage can be performed. We describe the search pipeline with respect to its application to a simplified phase model and derive the corresponding sensitivity of the search
Evolution and merging of binaries with compact objects
International Nuclear Information System (INIS)
Bethe, Hans A.; Brown, Gerald E.; Lee, Chang-Hwan
2007-01-01
In the light of recent observations in which short γ-ray bursts are interpreted as arising from black-hole(BH), neutron-star(NS) or NS-NS mergings we would like to review our research on the evolution of compact binaries, especially those containing NS's. These were carried out with predictions for LIGO in mind, but are directly applicable to short γ-ray bursts in the interpretation above. Most important in our review is that we show that the standard scenario for evolving NS-NS binaries always ends up with a low-mass BH (LMBH), NS binary. Bethe and Brown [1998, Astrophys. J. 506, 780] showed that this fate could be avoided if the two giants in the progenitor binary burned He at the same time, and that in this way the binary could avoid the common envelope evolution of the NS with red giant companion which sends the first born NS into a BH in the standard scenario. The burning of He at the same time requires, for the more massive giants such as the progenitors of the Hulse-Taylor binary NS that the two giants be within 4% of each other in zero age main sequence (ZAMS) mass. Applying this criterion to all binaries results in a factor ∼5 of LMBH-NS binaries as compared with NS-NS binaries. Although this factor is substantially less than the originally claimed factor of 20 which Bethe and Brown (1998) estimated, largely because a careful evolution has been carried through here, our factor 5 is augmented by a factor of ∼8 arising from the higher rate of star formation in the earlier Galaxy from which the BH-NS binaries came from. Furthermore, here we calculate the mergers for short-hard gamma-ray bursts, whereas Bethe and Brown's factor 20 included a factor of 2 for the higher chirp masses in a BH-NS binary as compared with NS-NS one. In short, we end up with an estimate of factor ∼40 over that calculated with NS-NS binary mergers in our Galaxy alone. Our total rate is estimated to be about one merging of compact objects per year. Our scenario of NS-NS binaries
Rotational properties of the binary and non-binary populations in the Trans-Neptunian belt
Thirouin, Audrey; Noll, Keith S.; Ortiz Moreno, Jose Luis; Morales , Nicolas
2014-11-01
An exhaustive study about short-term variability as well as derived properties from lightcurves allowed us to draw some conclusions for the Trans-Neptunian belt binary population. Based on Maxwellian fit distributions of the spin rate, we suggested that the binary population rotates slower than the non-binary one. This slowing-down can be attributed to tidal effects between the satellite and the primary, as expected. We showed that no system in this work is tidally locked, but the primary despinning process may have already affected the primary rate (as well as the satellite rotational rate). We used the Gladman et al. (1996) formula to compute the time required to tidally lock the systems, but this formula is based on several assumptions and approximations that do not always hold. The computed times are reasonable in most cases and confirm that none of the systems is tidally locked, assuming that the satellite densities are low and have a high rigidity or have a higher dissipation than usually assumed. The rotational properties of small bodies provide information about important physical properties, such as shape, density, and cohesion (Pravec & Harris 2000; Holsapple 2001, 2004; Thirouin et al. 2010, 2012). For binaries it is also possible to derive several physical parameters of the system components, such as diameters of the primary/secondary and albedo under some assumptions. We compare our results as well as our technique for deriving this information from the lightcurve with other methods, such as: i) thermal or thermophysical modeling, ii) from the mutual orbit of the binary component, iii) from direct imaging or iv) from stellar occultation by Trans-Neptunian Objects (TNOs). Finally, by studying the specific angular momentum of the sample, we proposed possible formation models for several binary TNOs. In several cases, we obtained hints of the formation mechanism from the angular momentum, but for other cases we do not have enough information about the
Texture classification by texton: statistical versus binary.
Directory of Open Access Journals (Sweden)
Zhenhua Guo
Full Text Available Using statistical textons for texture classification has shown great success recently. The maximal response 8 (Statistical_MR8, image patch (Statistical_Joint and locally invariant fractal (Statistical_Fractal are typical statistical texton algorithms and state-of-the-art texture classification methods. However, there are two limitations when using these methods. First, it needs a training stage to build a texton library, thus the recognition accuracy will be highly depended on the training samples; second, during feature extraction, local feature is assigned to a texton by searching for the nearest texton in the whole library, which is time consuming when the library size is big and the dimension of feature is high. To address the above two issues, in this paper, three binary texton counterpart methods were proposed, Binary_MR8, Binary_Joint, and Binary_Fractal. These methods do not require any training step but encode local feature into binary representation directly. The experimental results on the CUReT, UIUC and KTH-TIPS databases show that binary texton could get sound results with fast feature extraction, especially when the image size is not big and the quality of image is not poor.
Absolute Dimensions of Contact Binary Stars in Baade Window
Directory of Open Access Journals (Sweden)
Young Woon Kang
1999-12-01
Full Text Available The light curves of the representative 6 contact binary stars observed by OGLE Project of searching for dark matter in our Galaxy have been analyzed by the method of the Wilson and Devinney Differential Correction to find photometric solutions. The orbital inclinations of these binaries are in the range of 52 deg - 69 deg which is lower than that of the solar neighborhood binaries. The Roche lobe filling factor of these binaries are distributed in large range of 0.12 - 0.90. Since absence of spectroscopic observations for these binaries we have found masses of the 6 binary systems based on the intersection between Kepler locus and locus derived from Vandenberg isochrones in the mass - luminosity plane. Then absolute dimensions and distances have been found by combining the masses and the photometric solutions. The distances of the 6 binary systems are distributed in the range of 1 kpc - 6 kpc. This distance range is the limiting range where the contact binaries which have period shorter than a day are visible. Most contact binaries discovered in the Baade window do not belong to the Galactic bulge.
Orbital motion in pre-main sequence binaries
Energy Technology Data Exchange (ETDEWEB)
Schaefer, G. H. [The CHARA Array of Georgia State University, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Prato, L. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Simon, M. [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States); Patience, J., E-mail: schaefer@chara-array.org [Astrophysics Group, School of Physics, University of Exeter, Exeter, EX4 4QL (United Kingdom)
2014-06-01
We present results from our ongoing program to map the visual orbits of pre-main sequence (PMS) binaries in the Taurus star forming region using adaptive optics imaging at the Keck Observatory. We combine our results with measurements reported in the literature to analyze the orbital motion for each binary. We present preliminary orbits for DF Tau, T Tau S, ZZ Tau, and the Pleiades binary HBC 351. Seven additional binaries show curvature in their relative motion. Currently, we can place lower limits on the orbital periods for these systems; full solutions will be possible with more orbital coverage. Five other binaries show motion that is indistinguishable from linear motion. We suspect that these systems are bound and might show curvature with additional measurements in the future. The observations reported herein lay critical groundwork toward the goal of measuring precise masses for low-mass PMS stars.
Binary catalogue of exoplanets
Schwarz, Richard; Bazso, Akos; Zechner, Renate; Funk, Barbara
2016-02-01
Since 1995 there is a database which list most of the known exoplanets (The Extrasolar Planets Encyclopaedia at http://exoplanet.eu/). With the growing number of detected exoplanets in binary and multiple star systems it became more important to mark and to separate them into a new database, which is not available in the Extrasolar Planets Encyclopaedia. Therefore we established an online database (which can be found at: http://www.univie.ac.at/adg/schwarz/multiple.html) for all known exoplanets in binary star systems and in addition for multiple star systems, which will be updated regularly and linked to the Extrasolar Planets Encyclopaedia. The binary catalogue of exoplanets is available online as data file and can be used for statistical purposes. Our database is divided into two parts: the data of the stars and the planets, given in a separate list. We describe also the different parameters of the exoplanetary systems and present some applications.
Serial binary interval ratios improve rhythm reproduction
Directory of Open Access Journals (Sweden)
Xiang eWu
2013-08-01
Full Text Available Musical rhythm perception is a natural human ability that involves complex cognitive processes. Rhythm refers to the organization of events in time, and musical rhythms have an underlying hierarchical metrical structure. The metrical structure induces the feeling of a beat and the extent to which a rhythm induces the feeling of a beat is referred to as its metrical strength. Binary ratios are the most frequent interval ratio in musical rhythms. Rhythms with hierarchical binary ratios are better discriminated and reproduced than rhythms with hierarchical non-binary ratios. However, it remains unclear whether a superiority of serial binary over non-binary ratios in rhythm perception and reproduction exists. In addition, how different types of serial ratios influence the metrical strength of rhythms remains to be elucidated. The present study investigated serial binary vs. non-binary ratios in a reproduction task. Rhythms formed with exclusively binary (1:2:4:8, non-binary integer (1:3:5:6, and non-integer (1:2.3:5.3:6.4 ratios were examined within a constant meter. The results showed that the 1:2:4:8 rhythm type was more accurately reproduced than the 1:3:5:6 and 1:2.3:5.3:6.4 rhythm types, and the 1:2.3:5.3:6.4 rhythm type was more accurately reproduced than the 1:3:5:6 rhythm type. Further analyses showed that reproduction performance was better predicted by the distribution pattern of event occurrences within an inter-beat interval, than by the coincidence of events with beats, or the magnitude and complexity of interval ratios. Whereas rhythm theories and empirical data emphasize the role of the coincidence of events with beats in determining metrical strength and predicting rhythm performance, the present results suggest that rhythm processing may be better understood when the distribution pattern of event occurrences is taken into account. These results provide new insights into the mechanisms underlining musical rhythm perception.
Serial binary interval ratios improve rhythm reproduction.
Wu, Xiang; Westanmo, Anders; Zhou, Liang; Pan, Junhao
2013-01-01
Musical rhythm perception is a natural human ability that involves complex cognitive processes. Rhythm refers to the organization of events in time, and musical rhythms have an underlying hierarchical metrical structure. The metrical structure induces the feeling of a beat and the extent to which a rhythm induces the feeling of a beat is referred to as its metrical strength. Binary ratios are the most frequent interval ratio in musical rhythms. Rhythms with hierarchical binary ratios are better discriminated and reproduced than rhythms with hierarchical non-binary ratios. However, it remains unclear whether a superiority of serial binary over non-binary ratios in rhythm perception and reproduction exists. In addition, how different types of serial ratios influence the metrical strength of rhythms remains to be elucidated. The present study investigated serial binary vs. non-binary ratios in a reproduction task. Rhythms formed with exclusively binary (1:2:4:8), non-binary integer (1:3:5:6), and non-integer (1:2.3:5.3:6.4) ratios were examined within a constant meter. The results showed that the 1:2:4:8 rhythm type was more accurately reproduced than the 1:3:5:6 and 1:2.3:5.3:6.4 rhythm types, and the 1:2.3:5.3:6.4 rhythm type was more accurately reproduced than the 1:3:5:6 rhythm type. Further analyses showed that reproduction performance was better predicted by the distribution pattern of event occurrences within an inter-beat interval, than by the coincidence of events with beats, or the magnitude and complexity of interval ratios. Whereas rhythm theories and empirical data emphasize the role of the coincidence of events with beats in determining metrical strength and predicting rhythm performance, the present results suggest that rhythm processing may be better understood when the distribution pattern of event occurrences is taken into account. These results provide new insights into the mechanisms underlining musical rhythm perception.
BHDD: Primordial black hole binaries code
Kavanagh, Bradley J.; Gaggero, Daniele; Bertone, Gianfranco
2018-06-01
BHDD (BlackHolesDarkDress) simulates primordial black hole (PBH) binaries that are clothed in dark matter (DM) halos. The software uses N-body simulations and analytical estimates to follow the evolution of PBH binaries formed in the early Universe.
Tidal and magnetic interactions in close binary stars
International Nuclear Information System (INIS)
Campbell, C.G.
1983-03-01
The thesis investigates the nature of non-synchronous motions in members of close binary stars under the influence of gravitational and magnetic fields existing in these systems, and the evolution of such motions in different classes of binaries. Largely convective stars are considered and a solution is found for the fluid flow associated with the non-synchronous rotation of such a secondary in a close binary system, taking tidal and rotational forces into account. The tidal velocity field is calculated for a low mass white dwarf secondary star in a twin - degenerate binary. It is found that the synchronisation times can be comparable to the lifetime of the binary so that some asynchronism may remain present. (U.K.)
Dynamical Formation and Merger of Binary Black Holes
Stone, Nicholas
2017-01-01
The advent of gravitational wave (GW) astronomy began with Advanced LIGO's 2015 discovery of GWs from coalescing black hole (BH) binaries. GW astronomy holds great promise for testing general relativity, but also for investigating open astrophysical questions not amenable to traditional electromagnetic observations. One such question concerns the origin of stellar mass BH binaries in the universe: do these form primarily from evolution of isolated binaries of massive stars, or do they form through more exotic dynamical channels? The best studied dynamical formation channel involves multibody interactions of BHs and stars in dense globular cluster environments, but many other dynamical scenarios have recently been proposed, ranging from the Kozai effect in hierarchical triple systems to BH binary formation in the outskirts of Toomre-unstable accretion disks surrounding supermassive black holes. The BH binaries formed through these processes will have different distributions of observable parameters (e.g. mass ratios, spins) than BH binaries formed through the evolution of isolated binary stars. In my talk I will overview these and other dynamical formation scenarios, and summarize the key observational tests that will enable Advanced LIGO or other future detectors to determine what formation pathway creates the majority of binary BHs in the universe. NCS thanks NASA, which has funded his work through Einstein postdoctoral grant PF5-160145.
Black Hole/Pulsar Binaries in the Galaxy
Shao, Yong; Li, Xiang-Dong
2018-04-01
We have performed population synthesis calculation on the formation of binaries containing a black hole (BH) and a neutron star (NS) in the Galactic disk. Some of important input parameters, especially for the treatment of common envelope evolution, are updated in the calculation. We have discussed the uncertainties from the star formation rate of the Galaxy and the velocity distribution of NS kicks on the birthrate (˜ 0.6-13 Myr^{-1}) of BH/NS binaries. From incident BH/NS binaries, by modelling the orbital evolution duo to gravitational wave radiation and the NS evolution as radio pulsars, we obtain the distributions of the observable parameters such as the orbital period, eccentricity and pulse period of the BH/pulsar binaries. We estimate that there may be ˜3 - 80 BH/pulsar binaries in the Galactic disk and around 10% of them could be detected by the Five-hundred-meter Aperture Spherical radio Telescope.
Investigating Dark Energy with Black Hole Binaries
International Nuclear Information System (INIS)
Mersini-Houghton, Laura; Kelleher, Adam
2009-01-01
The accelerated expansion of the universe is ascribed to the existence of dark energy. Black holes accrete dark energy. The accretion induces a mass change proportional to the energy density and pressure of the background dark energy fluid. The time scale during which the mass of black holes changes considerably is long relative to the age of the universe, thus beyond detection possibilities. We propose to take advantage of the modified black hole masses for exploring the equation of state w[z] of dark energy, by investigating the evolution of supermassive black hole binaries on a dark energy background. Deriving the signatures of dark energy accretion on the evolution of binaries, we find that dark energy imprints on the emitted gravitational radiation and on the changes in the orbital radius of the binary can be within detection limits for certain supermassive black hole binaries. This talk describes how binaries can provide a useful tool in obtaining complementary information on the nature of dark energy.
Black hole/pulsar binaries in the Galaxy
Shao, Yong; Li, Xiang-Dong
2018-06-01
We have performed population synthesis calculation on the formation of binaries containing a black hole (BH) and a neutron star (NS) in the Galactic disc. Some of important input parameters, especially for the treatment of common envelope evolution, are updated in the calculation. We have discussed the uncertainties from the star formation rate of the Galaxy and the velocity distribution of NS kicks on the birthrate (˜ 0.6-13 M yr^{-1}) of BH/NS binaries. From incident BH/NS binaries, by modelling the orbital evolution due to gravitational wave radiation and the NS evolution as radio pulsars, we obtain the distributions of the observable parameters such as the orbital period, eccentricity, and pulse period of the BH/pulsar binaries. We estimate that there may be ˜3-80 BH/pulsar binaries in the Galactic disc and around 10 per cent of them could be detected by the Five-hundred-metre Aperture Spherical radio Telescope.
Star formation history: Modeling of visual binaries
Gebrehiwot, Y. M.; Tessema, S. B.; Malkov, O. Yu.; Kovaleva, D. A.; Sytov, A. Yu.; Tutukov, A. V.
2018-05-01
Most stars form in binary or multiple systems. Their evolution is defined by masses of components, orbital separation and eccentricity. In order to understand star formation and evolutionary processes, it is vital to find distributions of physical parameters of binaries. We have carried out Monte Carlo simulations in which we simulate different pairing scenarios: random pairing, primary-constrained pairing, split-core pairing, and total and primary pairing in order to get distributions of binaries over physical parameters at birth. Next, for comparison with observations, we account for stellar evolution and selection effects. Brightness, radius, temperature, and other parameters of components are assigned or calculated according to approximate relations for stars in different evolutionary stages (main-sequence stars, red giants, white dwarfs, relativistic objects). Evolutionary stage is defined as a function of system age and component masses. We compare our results with the observed IMF, binarity rate, and binary mass-ratio distributions for field visual binaries to find initial distributions and pairing scenarios that produce observed distributions.
THE ELM SURVEY. V. MERGING MASSIVE WHITE DWARF BINARIES
International Nuclear Information System (INIS)
Brown, Warren R.; Kenyon, Scott J.; Kilic, Mukremin; Gianninas, A.; Allende Prieto, Carlos
2013-01-01
We present the discovery of 17 low-mass white dwarfs (WDs) in short-period (P ≤ 1 day) binaries. Our sample includes four objects with remarkable log g ≅ 5 surface gravities and orbital solutions that require them to be double degenerate binaries. All of the lowest surface gravity WDs have metal lines in their spectra implying long gravitational settling times or ongoing accretion. Notably, six of the WDs in our sample have binary merger times 0.9 M ☉ companions. If the companions are massive WDs, these four binaries will evolve into stable mass transfer AM CVn systems and possibly explode as underluminous supernovae. If the companions are neutron stars, then these may be millisecond pulsar binaries. These discoveries increase the number of detached, double degenerate binaries in the ELM Survey to 54; 31 of these binaries will merge within a Hubble time.
THE ELM SURVEY. V. MERGING MASSIVE WHITE DWARF BINARIES
Energy Technology Data Exchange (ETDEWEB)
Brown, Warren R.; Kenyon, Scott J. [Smithsonian Astrophysical Observatory, 60 Garden St, Cambridge, MA 02138 (United States); Kilic, Mukremin; Gianninas, A. [Homer L. Dodge Department of Physics and Astronomy, University of Oklahoma, 440 W. Brooks St., Norman, OK, 73019 (United States); Allende Prieto, Carlos, E-mail: wbrown@cfa.harvard.edu, E-mail: skenyon@cfa.harvard.edu, E-mail: kilic@ou.edu, E-mail: alexg@nhn.ou.edu, E-mail: callende@iac.es [Instituto de Astrofisica de Canarias, E-38205, La Laguna, Tenerife (Spain)
2013-05-20
We present the discovery of 17 low-mass white dwarfs (WDs) in short-period (P {<=} 1 day) binaries. Our sample includes four objects with remarkable log g {approx_equal} 5 surface gravities and orbital solutions that require them to be double degenerate binaries. All of the lowest surface gravity WDs have metal lines in their spectra implying long gravitational settling times or ongoing accretion. Notably, six of the WDs in our sample have binary merger times <10 Gyr. Four have {approx}>0.9 M{sub Sun} companions. If the companions are massive WDs, these four binaries will evolve into stable mass transfer AM CVn systems and possibly explode as underluminous supernovae. If the companions are neutron stars, then these may be millisecond pulsar binaries. These discoveries increase the number of detached, double degenerate binaries in the ELM Survey to 54; 31 of these binaries will merge within a Hubble time.
Eliciting Subjective Probabilities with Binary Lotteries
DEFF Research Database (Denmark)
Harrison, Glenn W.; Martínez-Correa, Jimmy; Swarthout, J. Todd
objective probabilities. Drawing a sample from the same subject population, we find evidence that the binary lottery procedure induces linear utility in a subjective probability elicitation task using the Quadratic Scoring Rule. We also show that the binary lottery procedure can induce direct revelation...
Variance in binary stellar population synthesis
Breivik, Katelyn; Larson, Shane L.
2016-03-01
In the years preceding LISA, Milky Way compact binary population simulations can be used to inform the science capabilities of the mission. Galactic population simulation efforts generally focus on high fidelity models that require extensive computational power to produce a single simulated population for each model. Each simulated population represents an incomplete sample of the functions governing compact binary evolution, thus introducing variance from one simulation to another. We present a rapid Monte Carlo population simulation technique that can simulate thousands of populations in less than a week, thus allowing a full exploration of the variance associated with a binary stellar evolution model.
"Binary" and "non-binary" detection tasks: are current performance measures optimal?
Gur, David; Rockette, Howard E; Bandos, Andriy I
2007-07-01
We have observed that a very large fraction of responses for several detection tasks during the performance of observer studies are in the extreme ranges of lower than 11% or higher than 89% regardless of the actual presence or absence of the abnormality in question or its subjectively rated "subtleness." This observation raises questions regarding the validity and appropriateness of using multicategory rating scales for such detection tasks. Monte Carlo simulation of binary and multicategory ratings for these tasks demonstrate that the use of the former (binary) often results in a less biased and more precise summary index and hence may lead to a higher statistical power for determining differences between modalities.
MARVELS Radial Velocity Solutions to Seven Kepler Eclipsing Binaries
Heslar, Michael Francis; Thomas, Neil B.; Ge, Jian; Ma, Bo; Herczeg, Alec; Reyes, Alan; SDSS-III MARVELS Team
2016-01-01
Eclipsing binaries serve momentous purposes to improve the basis of understanding aspects of stellar astrophysics, such as the accurate calculation of the physical parameters of stars and the enigmatic mass-radius relationship of M and K dwarfs. We report the investigation results of 7 eclipsing binary candidates, initially identified by the Kepler mission, overlapped with the radial velocity observations from the SDSS-III Multi-Object APO Radial-Velocity Exoplanet Large-Area Survey (MARVELS). The RV extractions and spectroscopic solutions of these eclipsing binaries were generated by the University of Florida's 1D data pipeline with a median RV precision of ~60-100 m/s, which was utilized for the DR12 data release. We performed the cross-reference fitting of the MARVELS RV data and the Kepler photometric fluxes obtained from the Kepler Eclipsing Binary Catalog (V2) and modelled the 7 eclipsing binaries in the BinaryMaker3 and PHOEBE programs. This analysis accurately determined the absolute physical and orbital parameters of each binary. Most of the companion stars were determined to have masses of K and M dwarf stars (0.3-0.8 M⊙), and allowed for an investigation into the mass-radius relationship of M and K dwarfs. Among the cases are KIC 9163796, a 122.2 day period "heartbeat star", a recently-discovered class of eccentric binaries known for tidal distortions and pulsations, with a high eccentricity (e~0.75) and KIC 11244501, a 0.29 day period, contact binary with a double-lined spectrum and mass ratio (q~0.45). We also report on the possible reclassification of 2 Kepler eclipsing binary candidates as background eclipsing binaries based on the analysis of the flux measurements, flux ratios of the spectroscopic and photometric solutions, the differences in the FOVs, the image processing of Kepler, and RV and spectral analysis of MARVELS.
Renormalization transformation of periodic and aperiodic lattices
International Nuclear Information System (INIS)
Macia, Enrique; Rodriguez-Oliveros, Rogelio
2006-01-01
In this work we introduce a similarity transformation acting on transfer matrices describing the propagation of elementary excitations through either periodic or Fibonacci lattices. The proposed transformation can act at two different scale lengths. At the atomic scale the transformation allows one to express the systems' global transfer matrix in terms of an equivalent on-site model one. Correlation effects among different hopping terms are described by a series of local phase factors in that case. When acting on larger scale lengths, corresponding to short segments of the original lattice, the similarity transformation can be properly regarded as describing an effective renormalization of the chain. The nature of the resulting renormalized lattice significantly depends on the kind of order (i.e., periodic or quasiperiodic) of the original lattice, expressing a delicate balance between chemical complexity and topological order as a consequence of the renormalization process
Compact stars and the evolution of binary systems
van den Heuvel, E.P.J.
2011-01-01
The Chandrasekhar limit is of key importance for the evolution of white dwarfs in binary systems and for the formation of neutron stars and black holes in binaries. Mass transfer can drive a white dwarf in a binary over the Chandrasekhar limit, which may lead to a Type Ia supernova (in case of a CO
Discovery of a New AM CVn System with the Kepler Satellite
DEFF Research Database (Denmark)
Fontaine, G.; Brassard, P.; Green, Elizabeth M.
2011-01-01
004547333) has turned out to be a high-state AM CVn star showing the He-dominated spectrum of its accretion disk significantly reddened by interstellar absorption. We constructed new grids of NLTE synthetic spectra for accretion disks in order to analyze our spectroscopic observations. From this analysis...... analysis also suggests the likely presence of a quasi-periodic oscillation similar to those already observed in some high-state AM CVn systems. Furthermore, some very low-frequency, low-amplitude aperiodic photometric activity is likely present, which is in line with what is expected in accreting binary...
WHITE-DWARF-MAIN-SEQUENCE BINARIES IDENTIFIED FROM THE LAMOST PILOT SURVEY
International Nuclear Information System (INIS)
Ren Juanjuan; Luo Ali; Li Yinbi; Wei Peng; Zhao Jingkun; Zhao Yongheng; Song Yihan; Zhao Gang
2013-01-01
We present a set of white-dwarf-main-sequence (WDMS) binaries identified spectroscopically from the Large sky Area Multi-Object fiber Spectroscopic Telescope (LAMOST, also called the Guo Shou Jing Telescope) pilot survey. We develop a color selection criteria based on what is so far the largest and most complete Sloan Digital Sky Survey (SDSS) DR7 WDMS binary catalog and identify 28 WDMS binaries within the LAMOST pilot survey. The primaries in our binary sample are mostly DA white dwarfs except for one DB white dwarf. We derive the stellar atmospheric parameters, masses, and radii for the two components of 10 of our binaries. We also provide cooling ages for the white dwarf primaries as well as the spectral types for the companion stars of these 10 WDMS binaries. These binaries tend to contain hot white dwarfs and early-type companions. Through cross-identification, we note that nine binaries in our sample have been published in the SDSS DR7 WDMS binary catalog. Nineteen spectroscopic WDMS binaries identified by the LAMOST pilot survey are new. Using the 3σ radial velocity variation as a criterion, we find two post-common-envelope binary candidates from our WDMS binary sample
BROWN DWARF BINARIES FROM DISINTEGRATING TRIPLE SYSTEMS
Energy Technology Data Exchange (ETDEWEB)
Reipurth, Bo [Institute for Astronomy and NASA Astrobiology Institute University of Hawaii, 640 N. Aohoku Place, Hilo, HI 96720 (United States); Mikkola, Seppo, E-mail: reipurth@ifa.hawaii.edu, E-mail: Seppo.Mikkola@utu.fi [Tuorla Observatory, University of Turku, Väisäläntie 20, Piikkiö (Finland)
2015-04-15
Binaries in which both components are brown dwarfs (BDs) are being discovered at an increasing rate, and their properties may hold clues to their origin. We have carried out 200,000 N-body simulations of three identical stellar embryos with masses drawn from a Chabrier IMF and embedded in a molecular core. The bodies are initially non-hierarchical and undergo chaotic motions within the cloud core, while accreting using Bondi–Hoyle accretion. The coupling of dynamics and accretion often leads to one or two dominant bodies controlling the center of the cloud core, while banishing the other(s) to the lower-density outskirts, leading to stunted growth. Eventually each system transforms either to a bound hierarchical configuration or breaks apart into separate single and binary components. The orbital motion is followed for 100 Myr. In order to illustrate 200,000 end-states of such dynamical evolution with accretion, we introduce the “triple diagnostic diagram,” which plots two dimensionless numbers against each other, representing the binary mass ratio and the mass ratio of the third body to the total system mass. Numerous freefloating BD binaries are formed in these simulations, and statistical properties are derived. The separation distribution function is in good correspondence with observations, showing a steep rise at close separations, peaking around 13 AU and declining more gently, reaching zero at separations greater than 200 AU. Unresolved BD triple systems may appear as wider BD binaries. Mass ratios are strongly peaked toward unity, as observed, but this is partially due to the initial assumptions. Eccentricities gradually increase toward higher values, due to the lack of viscous interactions in the simulations, which would both shrink the orbits and decrease their eccentricities. Most newborn triple systems are unstable and while there are 9209 ejected BD binaries at 1 Myr, corresponding to about 4% of the 200,000 simulations, this number has grown to
BROWN DWARF BINARIES FROM DISINTEGRATING TRIPLE SYSTEMS
International Nuclear Information System (INIS)
Reipurth, Bo; Mikkola, Seppo
2015-01-01
Binaries in which both components are brown dwarfs (BDs) are being discovered at an increasing rate, and their properties may hold clues to their origin. We have carried out 200,000 N-body simulations of three identical stellar embryos with masses drawn from a Chabrier IMF and embedded in a molecular core. The bodies are initially non-hierarchical and undergo chaotic motions within the cloud core, while accreting using Bondi–Hoyle accretion. The coupling of dynamics and accretion often leads to one or two dominant bodies controlling the center of the cloud core, while banishing the other(s) to the lower-density outskirts, leading to stunted growth. Eventually each system transforms either to a bound hierarchical configuration or breaks apart into separate single and binary components. The orbital motion is followed for 100 Myr. In order to illustrate 200,000 end-states of such dynamical evolution with accretion, we introduce the “triple diagnostic diagram,” which plots two dimensionless numbers against each other, representing the binary mass ratio and the mass ratio of the third body to the total system mass. Numerous freefloating BD binaries are formed in these simulations, and statistical properties are derived. The separation distribution function is in good correspondence with observations, showing a steep rise at close separations, peaking around 13 AU and declining more gently, reaching zero at separations greater than 200 AU. Unresolved BD triple systems may appear as wider BD binaries. Mass ratios are strongly peaked toward unity, as observed, but this is partially due to the initial assumptions. Eccentricities gradually increase toward higher values, due to the lack of viscous interactions in the simulations, which would both shrink the orbits and decrease their eccentricities. Most newborn triple systems are unstable and while there are 9209 ejected BD binaries at 1 Myr, corresponding to about 4% of the 200,000 simulations, this number has grown to
Directory of Open Access Journals (Sweden)
Arbutina Bojan
2011-01-01
Full Text Available AM CVn-type stars and ultra-compact X-ray binaries are extremely interesting semi-detached close binary systems in which the Roche lobe filling component is a white dwarf transferring mass to another white dwarf, neutron star or a black hole. Earlier theoretical considerations show that there is a maximum mass ratio of AM CVn-type binary systems (qmax ≈ 2/3 below which the mass transfer is stable. In this paper we derive slightly different value for qmax and more interestingly, by applying the same procedure, we find the maximum expected white dwarf mass in ultra-compact X-ray binaries.
[Hyp-Au-Sn9(Hyp)3-Au-Sn9(Hyp)3-Au-Hyp]-: the longest intermetalloid chain compound of tin.
Binder, Mareike; Schrenk, Claudio; Block, Theresa; Pöttgen, Rainer; Schnepf, Andreas
2017-10-12
The reaction of the metalloid tin cluster [Sn 10 (Hyp) 4 ] 2- with (Ph 3 P)Au-SHyp (Hyp = Si(SiMe 3 ) 3 ) gave an intermetalloid cluster [Au 3 Sn 18 (Hyp) 8 ] - 1, which is the longest intermetalloid chain compound of tin to date. 1 shows a structural resemblance to binary AuSn phases, which is expected for intermetalloid clusters.
Non-binary or genderqueer genders.
Richards, Christina; Bouman, Walter Pierre; Seal, Leighton; Barker, Meg John; Nieder, Timo O; T'Sjoen, Guy
2016-01-01
Some people have a gender which is neither male nor female and may identify as both male and female at one time, as different genders at different times, as no gender at all, or dispute the very idea of only two genders. The umbrella terms for such genders are 'genderqueer' or 'non-binary' genders. Such gender identities outside of the binary of female and male are increasingly being recognized in legal, medical and psychological systems and diagnostic classifications in line with the emerging presence and advocacy of these groups of people. Population-based studies show a small percentage--but a sizable proportion in terms of raw numbers--of people who identify as non-binary. While such genders have been extant historically and globally, they remain marginalized, and as such--while not being disorders or pathological in themselves--people with such genders remain at risk of victimization and of minority or marginalization stress as a result of discrimination. This paper therefore reviews the limited literature on this field and considers ways in which (mental) health professionals may assist the people with genderqueer and non-binary gender identities and/or expressions they may see in their practice. Treatment options and associated risks are discussed.
The Young Visual Binary Survey
Prato, Lisa; Avilez, Ian; Lindstrom, Kyle; Graham, Sean; Sullivan, Kendall; Biddle, Lauren; Skiff, Brian; Nofi, Larissa; Schaefer, Gail; Simon, Michal
2018-01-01
Differences in the stellar and circumstellar properties of the components of young binaries provide key information about star and disk formation and evolution processes. Because objects with separations of a few to a few hundred astronomical units share a common environment and composition, multiple systems allow us to control for some of the factors which play into star formation. We are completing analysis of a rich sample of about 100 pre-main sequence binaries and higher order multiples, primarily located in the Taurus and Ophiuchus star forming regions. This poster will highlight some of out recent, exciting results. All reduced spectra and the results of our analysis will be publicly available to the community at http://jumar.lowell.edu/BinaryStars/. Support for this research was provided in part by NSF award AST-1313399 and by NASA Keck KPDA funding.
A distribution planning model for natural gas supply chain: A case study
International Nuclear Information System (INIS)
Hamedi, Maryam; Zanjirani Farahani, Reza; Husseini, Mohammad Moattar; Esmaeilian, Gholam Reza
2009-01-01
In this paper, a real-world case study of a natural gas supply chain is investigated. By using concepts related to natural gas industry and the relations among the components of transmission and distribution network, a six-level supply chain has been introduced and presented schematically. The defined supply chain is a single-objective, multi-period, and single-product problem that is formulated as a mixed integer non-linear programming model, which can easily be linearized. The objective of this model is to minimize direct or indirect distribution costs. There are six groups of constraints including capacity, input and output balancing, demand satisfaction, network flow continuity, and relative constraints to the required binary variables. The solution algorithm of the problem is hierarchical; in each step, one section of the problem is solved using an exact method; the outputs of this section are passed to the next relative section as inputs. Finally, it is shown that the problem has been solved in a reasonable time and desirable results are attained. The use of proposed model and its solution approach have been studied in two gas trunk lines, to present the priority of its cost saving
A Survey of Binary Similarity and Distance Measures
Directory of Open Access Journals (Sweden)
Seung-Seok Choi
2010-02-01
Full Text Available The binary feature vector is one of the most common representations of patterns and measuring similarity and distance measures play a critical role in many problems such as clustering, classification, etc. Ever since Jaccard proposed a similarity measure to classify ecological species in 1901, numerous binary similarity and distance measures have been proposed in various fields. Applying appropriate measures results in more accurate data analysis. Notwithstanding, few comprehensive surveys on binary measures have been conducted. Hence we collected 76 binary similarity and distance measures used over the last century and reveal their correlations through the hierarchical clustering technique.
The binary white dwarf LHS 3236
Energy Technology Data Exchange (ETDEWEB)
Harris, Hugh C.; Dahn, Conard C.; Canzian, Blaise; Guetter, Harry H.; Levine, Stephen E.; Luginbuhl, Christian B.; Monet, Alice K. B.; Stone, Ronald C.; Subasavage, John P.; Tilleman, Trudy; Walker, Richard L. [US Naval Observatory, 10391 West Naval Observatory Road, Flagstaff, AZ 86001-8521 (United States); Dupuy, Trent J.; Liu, Michael C. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Hartkopf, William I. [US Naval Observatory, 3450 Massachusetts Avenue, N.W., Washington, DC 20392-5420 (United States); Ireland, Michael J. [Department of Physics and Astronomy, Macquarie University, New South Wales, NSW 2109 (Australia); Leggett, S. K., E-mail: hch@nofs.navy.mil [Gemini Observatory, 670 N. Aohoku Place, Hilo, HI 96720 (United States)
2013-12-10
The white dwarf LHS 3236 (WD1639+153) is shown to be a double-degenerate binary, with each component having a high mass. Astrometry at the U.S. Naval Observatory gives a parallax and distance of 30.86 ± 0.25 pc and a tangential velocity of 98 km s{sup –1}, and reveals binary orbital motion. The orbital parameters are determined from astrometry of the photocenter over more than three orbits of the 4.0 yr period. High-resolution imaging at the Keck Observatory resolves the pair with a separation of 31 and 124 mas at two epochs. Optical and near-IR photometry give a set of possible binary components. Consistency of all data indicates that the binary is a pair of DA stars with temperatures near 8000 and 7400 K and with masses of 0.93 and 0.91 M {sub ☉}; also possible is a DA primary and a helium DC secondary with temperatures near 8800 and 6000 K and with masses of 0.98 and 0.69 M {sub ☉}. In either case, the cooling ages of the stars are ∼3 Gyr and the total ages are <4 Gyr. The combined mass of the binary (1.66-1.84 M {sub ☉}) is well above the Chandrasekhar limit; however, the timescale for coalescence is long.
Ranganathaiah, C.
2015-06-01
A miscible blend is a single-phase system with compact packing of the polymeric chains/segments due configuration/conformational changes upon blending. Differential Scanning Calorimetry (DSC) is the most employed method to ascertain whether the blend is miscible or immiscible. Positron Lifetime Spectroscopy (PLS) has been employed in recent times to study miscibility properties of polymer blends by monitoring the ortho-Positronium annihilation lifetimes as function of composition. However, just free volume monitoring and the DSC methods fail to provide the composition dependent miscibility of blends. To overcome this limitation, an alternative approach based on hydrodynamic interactions has been developed to derive this information using the same o-Ps lifetime measurements. This has led to the development of a new method of measuring composition dependent miscibility level in binary and ternary polymer blends. Further, the new method also provides interface characteristics for immiscible blends. The interactions between the blend components has a direct bearing on the strength of adhesion at the interface and hence the hydrodynamic interaction. Understanding the characteristic of interfaces which decides the miscibility level of the blend and their end applications is made easy by the present method. The efficacy of the present method is demonstrated for few binary and ternary blends.
Binary and Millisecond Pulsars
Directory of Open Access Journals (Sweden)
Lorimer Duncan R.
2005-11-01
Full Text Available We review the main properties, demographics and applications of binary and millisecond radio pulsars. Our knowledge of these exciting objects has greatly increased in recent years, mainly due to successful surveys which have brought the known pulsar population to over 1700. There are now 80 binary and millisecond pulsars associated with the disk of our Galaxy, and a further 103 pulsars in 24 of the Galactic globular clusters. Recent highlights have been the discovery of the first ever double pulsar system and a recent flurry of discoveries in globular clusters, in particular Terzan 5.
Eclipsing binary stars with a δ Scuti component
Kahraman Aliçavuş, F.; Soydugan, E.; Smalley, B.; Kubát, J.
2017-09-01
Eclipsing binaries with a δ Sct component are powerful tools to derive the fundamental parameters and probe the internal structure of stars. In this study, spectral analysis of six primary δ Sct components in eclipsing binaries has been performed. Values of Teff, v sin I, and metallicity for the stars have been derived from medium-resolution spectroscopy. Additionally, a revised list of δ Sct stars in eclipsing binaries is presented. In this list, we have only given the δ Sct stars in eclipsing binaries to show the effects of the secondary components and tidal-locking on the pulsations of primary δ Sct components. The stellar pulsation, atmospheric and fundamental parameters (e.g. mass, radius) of 92 δ Sct stars in eclipsing binaries have been gathered. Comparison of the properties of single and eclipsing binary member δ Sct stars has been made. We find that single δ Sct stars pulsate in longer periods and with higher amplitudes than the primary δ Sct components in eclipsing binaries. The v sin I of δ Sct components is found to be significantly lower than that of single δ Sct stars. Relationships between the pulsation periods, amplitudes and stellar parameters in our list have been examined. Significant correlations between the pulsation periods and the orbital periods, Teff, log g, radius, mass ratio, v sin I and the filling factor have been found.
Tidal Disruption of Inclined or Eccentric Binaries by Massive Black Holes
Brown, Harriet; Kobayashi, Shiho; Rossi, Elena M.; Sari, Re'em
2018-04-01
Binary stars that are on close orbits around massive black holes (MBH) such as Sgr A* in the centre of the Milky Way are liable to undergo tidal disruption and eject a hypervelocity star. We study the interaction between such a MBH and circular binaries for general binary orientations and penetration depths (i.e. binaries penetrate into the tidal radius around the BH). We show that for very deep penetrators, almost all binaries are disrupted when the binary rotation axis is roughly oriented toward the BH or it is in the opposite direction. The surviving chance becomes significant when the angle between the binary rotation axis and the BH direction is between 0.15π and 0.85π. The surviving chance is as high as ˜20% when the binary rotation axis is perpendicular to the BH direction. However, for shallow penetrators, the highest disruption chance is found in such a perpendicular case, especially in the prograde case. This is because the dynamics of shallow penetrators is more sensitive to the relative orientation of the binary and orbital angular momenta. We provide numerical fits to the disruption probability and energy gain at the the BH encounter as a function of the penetration depth. The latter can be simply rescaled in terms of binary masses, their initial separation and the binary-to-BH mass ratio to evaluate the ejection velocity of a binary members in various systems. We also investigate the disruption of coplanar, eccentric binaries by a MBH. It is shown that for highly eccentric binaries retrograde orbits have a significantly increased disruption probability and ejection velocities compared to the circular binaries.
Evolution of binaries with compact objects in globular clusters
Ivanova, Natalia
2017-01-01
Dynamical interactions that take place between objects in dense stellar systems lead to frequent formation of exotic stellar objects, unusual binaries, and systems of higher multiplicity. They are most important for the formation of binaries with neutron stars and black holes, which are usually observationally revealed in mass-transferring binaries. Here we review the current understanding of compact object's retention, of the metallicity dependence on the formation of low-mass X-ray binaries...
Non-Binary Protograph-Based LDPC Codes: Analysis,Enumerators and Designs
Sun, Yizeng
2013-01-01
Non-binary LDPC codes can outperform binary LDPC codes using sum-product algorithm with higher computation complexity. Non-binary LDPC codes based on protographs have the advantage of simple hardware architecture. In the first part of this thesis, we will use EXIT chart analysis to compute the thresholds of different protographs over GF(q). Based on threshold computation, some non-binary protograph-based LDPC codes are designed and their frame error rates are compared with binary LDPC codes. ...
Reconciliation with non-binary species trees.
Vernot, Benjamin; Stolzer, Maureen; Goldman, Aiton; Durand, Dannie
2008-10-01
Reconciliation extracts information from the topological incongruence between gene and species trees to infer duplications and losses in the history of a gene family. The inferred duplication-loss histories provide valuable information for a broad range of biological applications, including ortholog identification, estimating gene duplication times, and rooting and correcting gene trees. While reconciliation for binary trees is a tractable and well studied problem, there are no algorithms for reconciliation with non-binary species trees. Yet a striking proportion of species trees are non-binary. For example, 64% of branch points in the NCBI taxonomy have three or more children. When applied to non-binary species trees, current algorithms overestimate the number of duplications because they cannot distinguish between duplication and incomplete lineage sorting. We present the first algorithms for reconciling binary gene trees with non-binary species trees under a duplication-loss parsimony model. Our algorithms utilize an efficient mapping from gene to species trees to infer the minimum number of duplications in O(|V(G) | x (k(S) + h(S))) time, where |V(G)| is the number of nodes in the gene tree, h(S) is the height of the species tree and k(S) is the size of its largest polytomy. We present a dynamic programming algorithm which also minimizes the total number of losses. Although this algorithm is exponential in the size of the largest polytomy, it performs well in practice for polytomies with outdegree of 12 or less. We also present a heuristic which estimates the minimal number of losses in polynomial time. In empirical tests, this algorithm finds an optimal loss history 99% of the time. Our algorithms have been implemented in NOTUNG, a robust, production quality, tree-fitting program, which provides a graphical user interface for exploratory analysis and also supports automated, high-throughput analysis of large data sets.
Influence of non-binary effects on intranuclear cascade method
International Nuclear Information System (INIS)
Gomes, E.H.C.
1985-01-01
The importance of non binary process effects in the intranuclear cascade method is analysed. It is shown that, in the higher density steps, the non binary collisions lead to baryon density distribution and rapidity differents from the one obtained using the usual intranuclear cascade method (limited to purely binary collisions). The validity of the applications of binary intranuclear cascade method to the simulation of the thermal equilibrium, nuclear transparency and particle production, is discussed. (M.C.K.) [pt
Schwahn, D
2002-01-01
Binary blends of statistical polybutadiene copolymers of different vinyl content and molar volume were explored by small-angle neutron scattering. These samples represent the most simple class of statistical copolymer mixtures. In spite of this simplicity, changes in vinyl content, molar volume, and deuterium and hydrogen content of the chains give rise to strong effects; phase separation occurs from minus 230 C to more than plus 200 C and can even reverse from an enthalpically driven one at low temperatures to an entropically driven one at high temperatures. The entropic and enthalpic terms of the Flory-Huggins parameter as determined from the experiment are in excellent agreement with lattice cluster theory calculations. (orig.)
THE CLOSE BINARY FRACTION OF DWARF M STARS
International Nuclear Information System (INIS)
Clark, Benjamin M.; Blake, Cullen H.; Knapp, Gillian R.
2012-01-01
We describe a search for close spectroscopic dwarf M star binaries using data from the Sloan Digital Sky Survey to address the question of the rate of occurrence of multiplicity in M dwarfs. We use a template-fitting technique to measure radial velocities from 145,888 individual spectra obtained for a magnitude-limited sample of 39,543 M dwarfs. Typically, the three or four spectra observed for each star are separated in time by less than four hours, but for ∼17% of the stars, the individual observations span more than two days. In these cases we are sensitive to large-amplitude radial velocity variations on timescales comparable to the separation between the observations. We use a control sample of objects having observations taken within a four-hour period to make an empirical estimate of the underlying radial velocity error distribution and simulate our detection efficiency for a wide range of binary star systems. We find the frequency of binaries among the dwarf M stars with a < 0.4 AU to be 3%-4%. Comparison with other samples of binary stars demonstrates that the close binary fraction, like the total binary fraction, is an increasing function of primary mass.
THE CLOSE BINARY FRACTION OF DWARF M STARS
Energy Technology Data Exchange (ETDEWEB)
Clark, Benjamin M. [Penn Manor High School, 100 East Cottage Avenue, Millersville, PA 17551 (United States); Blake, Cullen H.; Knapp, Gillian R. [Princeton University, Department of Astrophysical Sciences, Peyton Hall, Ivy Lane, Princeton, NJ 08544 (United States)
2012-01-10
We describe a search for close spectroscopic dwarf M star binaries using data from the Sloan Digital Sky Survey to address the question of the rate of occurrence of multiplicity in M dwarfs. We use a template-fitting technique to measure radial velocities from 145,888 individual spectra obtained for a magnitude-limited sample of 39,543 M dwarfs. Typically, the three or four spectra observed for each star are separated in time by less than four hours, but for {approx}17% of the stars, the individual observations span more than two days. In these cases we are sensitive to large-amplitude radial velocity variations on timescales comparable to the separation between the observations. We use a control sample of objects having observations taken within a four-hour period to make an empirical estimate of the underlying radial velocity error distribution and simulate our detection efficiency for a wide range of binary star systems. We find the frequency of binaries among the dwarf M stars with a < 0.4 AU to be 3%-4%. Comparison with other samples of binary stars demonstrates that the close binary fraction, like the total binary fraction, is an increasing function of primary mass.
Binary Cockroach Swarm Optimization for Combinatorial Optimization Problem
Directory of Open Access Journals (Sweden)
Ibidun Christiana Obagbuwa
2016-09-01
Full Text Available The Cockroach Swarm Optimization (CSO algorithm is inspired by cockroach social behavior. It is a simple and efficient meta-heuristic algorithm and has been applied to solve global optimization problems successfully. The original CSO algorithm and its variants operate mainly in continuous search space and cannot solve binary-coded optimization problems directly. Many optimization problems have their decision variables in binary. Binary Cockroach Swarm Optimization (BCSO is proposed in this paper to tackle such problems and was evaluated on the popular Traveling Salesman Problem (TSP, which is considered to be an NP-hard Combinatorial Optimization Problem (COP. A transfer function was employed to map a continuous search space CSO to binary search space. The performance of the proposed algorithm was tested firstly on benchmark functions through simulation studies and compared with the performance of existing binary particle swarm optimization and continuous space versions of CSO. The proposed BCSO was adapted to TSP and applied to a set of benchmark instances of symmetric TSP from the TSP library. The results of the proposed Binary Cockroach Swarm Optimization (BCSO algorithm on TSP were compared to other meta-heuristic algorithms.
A binary mixture operated heat pump
International Nuclear Information System (INIS)
Hihara, E.; Saito, T.
1991-01-01
This paper evaluates the performance of possible binary mixtures as working fluids in high- temperature heat pump applications. The binary mixtures, which are potential alternatives of fully halogenated hydrocarbons, include HCFC142b/HCFC22, HFC152a/HCFC22, HFC134a/HCFC22. The performance of the mixtures is estimated by a thermodynamic model and a practical model in which the heat transfer is considered in heat exchangers. One of the advantages of binary mixtures is a higher coefficient of performance, which is caused by the small temperature difference between the heat-sink/-source fluid and the refrigerant. The mixture HCFC142b/HCFC22 is promising from the stand point of thermodynamic performance
Wide- and contact-binary formation in substructured young stellar clusters
Dorval, J.; Boily, C. M.; Moraux, E.; Roos, O.
2017-02-01
We explore with collisional gravitational N-body models the evolution of binary stars in initially fragmented and globally subvirial clusters of stars. Binaries are inserted in the (initially) clumpy configurations so as to match the observed distributions of the field-binary-stars' semimajor axes a and binary fraction versus primary mass. The dissolution rate of wide binaries is very high at the start of the simulations, and is much reduced once the clumps are eroded by the global infall. The transition between the two regimes is sharper as the number of stars N is increased, from N = 1.5 k up to 80 k. The fraction of dissolved binary stars increases only mildly with N, from ≈15 per cent to ≈25 per cent for the same range in N. We repeated the calculation for two initial system mean number densities of 6 per pc3 (low) and 400 per pc3 (high). We found that the longer free-fall time of the low-density runs allows for prolonged binary-binary interactions inside clumps and the formation of very tight (a ≈ 0.01 au) binaries by exchange collisions. This is an indication that the statistics of such compact binaries bear a direct link to their environment at birth. We also explore the formation of wide (a ≳ 5 × 104 au) binaries and find a low (≈0.01 per cent) fraction mildly bound to the central star cluster. The high-precision astrometric mission Gaia could identify them as outflowing shells or streams.
An Efficient Binary Differential Evolution with Parameter Adaptation
Directory of Open Access Journals (Sweden)
Dongli Jia
2013-04-01
Full Text Available Differential Evolution (DE has been applied to many scientific and engineering problems for its simplicity and efficiency. However, the standard DE cannot be used in a binary search space directly. This paper proposes an adaptive binary Differential Evolution algorithm, or ABDE, that has a similar framework as the standard DE but with an improved binary mutation strategy in which the best individual participates. To further enhance the search ability, the parameters of the ABDE are slightly disturbed in an adaptive manner. Experiments have been carried out by comparing ABDE with two binary DE variants, normDE and BDE, and the most used binary search technique, GA, on a set of 13 selected benchmark functions and the classical 0-1 knapsack problem. Results show that the ABDE performs better than, or at least comparable to, the other algorithms in terms of search ability, convergence speed, and solution accuracy.
Beyond binaries : a way forward for comparativeeducation
Directory of Open Access Journals (Sweden)
Marianne Larsen
2012-09-01
Full Text Available Binary discourses shape and produce the stories we construct about the field of comparative education. In the first part of this article, I review a set of binary discourses that have characterized social science research since the Enlightenment, including: quantitative-qualitative, nomotheticidiographic, inductive-deductive, and practice-theory. We can think of each of these binaries at opposite ends of a set of spectrums. In the second section of the paper, I show some of the ways in which these binaries have influenced the ways that we write and talk about research within the field of comparative education. I refer to the notion of binary discourses and the productive capacity of these discourses to shape our field. I then outline some critiques of these binaries to demonstrate the inherent limitations of binary discourses, and why we need to move beyond binaries in our research, and in the histories about our field. Finally, I present some tentative conclusions on ways to get ourselves out of the trap of binary thinking.Los discursos binarios moldean y producen los argumentos que construimos sobre la disciplina de la Educación Comparada. En la primera parte de este artículo, analizo un conjunto de discursos binarios que han caracterizado la investigación en Ciencias Sociales desde la Ilustración, incluyendo la cuantitativa-cualitativa, nomotética-idiográfica, inductivadeductiva, y la práctica-teoría. Podemos pensar sobre cada uno de estos discursos binarios como argumentos en los polos de un conjunto de posibilidades. En la segunda sección del artículo, revelo algunos modos en los que estos discursos binarios han influenciado las formas a través de las cuales escribimos y analizamos la investigación en el ámbito de la Educación Comparada. Analizo la noción de discursos binarios y la capacidad productiva de estos discursos de impactar nuestra ciencia. Seguidamente expongo algunas críticas de estos discursos binarios con el
Grammar-Based Specification and Parsing of Binary File Formats
Directory of Open Access Journals (Sweden)
William Underwood
2012-03-01
Full Text Available The capability to validate and view or play binary file formats, as well as to convert binary file formats to standard or current file formats, is critically important to the preservation of digital data and records. This paper describes the extension of context-free grammars from strings to binary files. Binary files are arrays of data types, such as long and short integers, floating-point numbers and pointers, as well as characters. The concept of an attribute grammar is extended to these context-free array grammars. This attribute grammar has been used to define a number of chunk-based and directory-based binary file formats. A parser generator has been used with some of these grammars to generate syntax checkers (recognizers for validating binary file formats. Among the potential benefits of an attribute grammar-based approach to specification and parsing of binary file formats is that attribute grammars not only support format validation, but support generation of error messages during validation of format, validation of semantic constraints, attribute value extraction (characterization, generation of viewers or players for file formats, and conversion to current or standard file formats. The significance of these results is that with these extensions to core computer science concepts, traditional parser/compiler technologies can potentially be used as a part of a general, cost effective curation strategy for binary file formats.
Comments on the evolution and origin of cataclysmic binaries
International Nuclear Information System (INIS)
Whyte, C.A.; Eggleton, P.P.
1980-01-01
Aspects of the observational data on cataclysmic binaries are discussed and possible correlations between type of behaviour and binary period are noted. A gap between 2 and 3 hr in binary periods is judged to be real. A simple numerical procedure for evolving Roche-lobe-filling stars is described, and applied to white dwarf-red dwarf binaries for various mass loss and angular momentum loss mechanisms, and initial conditions. The results, in which the short-time-scale behaviour of the systems is ignored, are classified into four modes of evolution: normal, nuclear evolution dominated, angular momentum loss dominated and hydrodynamical. The clustering below 2 hr is interpreted in terms of evolution following the hydrodynamical mode, and it is suggested that both stars in such systems are of low mass. This may be the commonest type of cataclysmic binary. A possible explanation for the apparent clustering of classical novae to periods of 3 to 5 hr is given, and evolutionary schemes for cataclysmic binaries outlined. It is suggested that the short-period systems (approximately < 2 hr) arise mainly from late case B mass transfer in the original binary and the longer period systems mainly from case C. (author)
Non-binary or genderqueer genders
Richards, Christina; Bouman, Walter Pierre; Seal, Leighton; Barker, Meg John; Nieder, Timo O; T'Sjoen, Guy
2016-01-01
Some people have a gender which is neither male nor female and may identify as both male and female at one time, as different genders at different times, as no gender at all, or dispute the very idea of only two genders. The umbrella terms for such genders are genderqueer' or non-binary' genders. Such gender identities outside of the binary of female and male are increasingly being recognized in legal, medical and psychological systems and diagnostic classifications in line with the emerging ...
Directory of Open Access Journals (Sweden)
Chin-Fen Lee
2018-01-01
Full Text Available Mixed Pluronic micelles from very hydrophobic and very hydrophilic copolymers were selected to scrutinize the synergistic effect on the self-assembly process as well as the solubilization capacity of ibuprofen. The tendency of mixing behavior between parent copolymers was systematically examined from two perspectives: different block chain lengths at same hydrophilicity (L92 + F108, +F98, +F88, and +F68, as well as various hydrophobicities at the same PPO moiety (L92 + F88, +F87, and +P84. Temperature-dependent micellization in these binary systems was clearly inspected by the combined use of high sensitivity differential scanning calorimeter (HSDSC and dynamic light scattering (DLS. Changes in heat capacity and size of aggregates at different temperatures during the whole micellization process were simultaneously observed and examined. While distinction of block chain length between parent copolymers increases, the monodispersity of the binary Pluronic systems decreases. However, parent copolymers with distinct PPO moieties do not affirmatively lead to non-cooperative binding, such as the L92 + P84 system. The addition of ibuprofen promotes micellization as well as stabilizes aggregates in the solution. The partial replacement of the hydrophilic Pluronic by a more hydrophobic Pluronic L92 would increase the total hydrophobicity of mixed Pluronics used in the system to substantially enhance the solubility of ibuprofen. The solubility of ibuprofen in the 0.5 wt % L92 + 0.368 wt % P84 system is as high as 4.29 mg/mL, which is 1.4 times more than that of the 0.868 wt % P84 system and 147 times more than that in pure water at 37 °C.
Statistical Analysis of a Comprehensive List of Visual Binaries
Directory of Open Access Journals (Sweden)
Kovaleva D.
2015-12-01
Full Text Available Visual binary stars are the most abundant class of observed binaries. The most comprehensive list of data on visual binaries compiled recently by cross-matching the largest catalogues of visual binaries allowed a statistical investigation of observational parameters of these systems. The dataset was cleaned by correcting uncertainties and misclassifications, and supplemented with available parallax data. The refined dataset is free from technical biases and contains 3676 presumably physical visual pairs of luminosity class V with known angular separations, magnitudes of the components, spectral types, and parallaxes. We also compiled a restricted sample of 998 pairs free from observational biases due to the probability of binary discovery. Certain distributions of observational and physical parameters of stars of our dataset are discussed.
Main Memory Implementations for Binary Grouping
May, Norman; Moerkotte, Guido
2005-01-01
An increasing number of applications depend on efficient storage and analysis features for XML data. Hence, query optimization and efficient evaluation techniques for the emerging XQuery standard become more and more important. Many XQuery queries require nested expressions. Unnesting them often introduces binary grouping. We introduce several algorithms implementing binary grouping and analyze their time and space complexity. Experiments demonstrate their performance.
Energy Technology Data Exchange (ETDEWEB)
Hong, Soon Kang; Park, Yoon Kook [Hongik University, Sejong (Korea, Republic of)
2016-01-15
Using a high-pressure variable-volume view cell, the vapor-liquid equilibria of the binary system CO{sub 2} and 1-butyl-3-methylimidazolium tridecafluorohexylsulfonate ([BMIM][TDfO]) were determined. The CO{sub 2} mole fraction ranged from 0.104 to 0.952 over a temperature range of 298.2-323.2 K. Both the Peng-Robinson and Soave-Redlich- Kwong equations of state were applied with two different mixing rules to correlate with the experimentally obtained results. Increasing the alkyl chain length in perfluorinated sulfonate anion mother structure from methyl to hexyl markedly increased the CO{sub 2} solubility. To investigate the effect of the number of fluorine atoms in the anion on the phase behavior of imidazolium-based ionic liquid, these experimental results were then compared with those reported in previous experimental studies of 1-alkyl-3-methylimidazolium cations-including ionic liquid+CO{sub 2} binary system.
International Nuclear Information System (INIS)
Hong, Soon Kang; Park, Yoon Kook
2016-01-01
Using a high-pressure variable-volume view cell, the vapor-liquid equilibria of the binary system CO 2 and 1-butyl-3-methylimidazolium tridecafluorohexylsulfonate ([BMIM][TDfO]) were determined. The CO 2 mole fraction ranged from 0.104 to 0.952 over a temperature range of 298.2-323.2 K. Both the Peng-Robinson and Soave-Redlich- Kwong equations of state were applied with two different mixing rules to correlate with the experimentally obtained results. Increasing the alkyl chain length in perfluorinated sulfonate anion mother structure from methyl to hexyl markedly increased the CO 2 solubility. To investigate the effect of the number of fluorine atoms in the anion on the phase behavior of imidazolium-based ionic liquid, these experimental results were then compared with those reported in previous experimental studies of 1-alkyl-3-methylimidazolium cations-including ionic liquid+CO 2 binary system.
Circuit topology of self-interacting chains: implications for folding and unfolding dynamics.
Mugler, Andrew; Tans, Sander J; Mashaghi, Alireza
2014-11-07
Understanding the relationship between molecular structure and folding is a central problem in disciplines ranging from biology to polymer physics and DNA origami. Topology can be a powerful tool to address this question. For a folded linear chain, the arrangement of intra-chain contacts is a topological property because rearranging the contacts requires discontinuous deformations. Conversely, the topology is preserved when continuously stretching the chain while maintaining the contact arrangement. Here we investigate how the folding and unfolding of linear chains with binary contacts is guided by the topology of contact arrangements. We formalize the topology by describing the relations between any two contacts in the structure, which for a linear chain can either be in parallel, in series, or crossing each other. We show that even when other determinants of folding rate such as contact order and size are kept constant, this 'circuit' topology determines folding kinetics. In particular, we find that the folding rate increases with the fractions of parallel and crossed relations. Moreover, we show how circuit topology constrains the conformational phase space explored during folding and unfolding: the number of forbidden unfolding transitions is found to increase with the fraction of parallel relations and to decrease with the fraction of series relations. Finally, we find that circuit topology influences whether distinct intermediate states are present, with crossed contacts being the key factor. The approach presented here can be more generally applied to questions on molecular dynamics, evolutionary biology, molecular engineering, and single-molecule biophysics.
The Very Short Period M Dwarf Binary SDSS J001641-000925
Davenport, James R. A.; Becker, Andrew C.; West, Andrew A.; Bochanski, John J.; Hawley, Suzanne L.; Holtzman, Jon; Gunning, Heather C.; Hilton, Eric J.; Munshi, Ferah A.; Albright, Meagan
2013-02-01
We present follow-up observations and analysis of the recently discovered short period low-mass eclipsing binary, SDSS J001641-000925. With an orbital period of 0.19856 days, this system has one of the shortest known periods for an M dwarf binary system. Medium-resolution spectroscopy and multi-band photometry for the system are presented. Markov Chain Monte Carlo modeling of the light curves and radial velocities yields estimated masses for the stars of M 1 = 0.54 ± 0.07 M ⊙ and M 2 = 0.34 ± 0.04 M ⊙, and radii of R 1 = 0.68 ± 0.03 R ⊙ and R 2 = 0.58 ± 0.03 R ⊙, respectively. This solution places both components above the critical Roche overfill limit, providing strong evidence that SDSS J001641-000925 is the first verified M-dwarf contact binary system. Within the follow-up spectroscopy we find signatures of non-solid body rotation velocities, which we interpret as evidence for mass transfer or loss within the system. In addition, our photometry samples the system over nine years, and we find strong evidence for period decay at the rate of \\dot{P}\\sim 8 s yr-1. Both of these signatures raise the intriguing possibility that the system is in over-contact, and actively losing angular momentum, likely through mass loss. This places SDSS J001641-000925 as not just the first M-dwarf over-contact binary, but one of the few systems of any spectral type known to be actively undergoing coalescence. Further study of SDSS J001641-000925 is ongoing to verify the nature of the system, which may prove to be a unique astrophysical laboratory. Based on observations obtained with the Apache Point Observatory 3.5 m telescope, which is owned and operated by the Astrophysical Research Consortium. This paper includes data gathered with the 6.5 m Magellan Telescopes located at Las Campanas Observatory, Chile. Support for the design and construction of the Magellan Echellette Spectrograph was received from the Observatories of the Carnegie Institution of Washington, the
Distinguishing Between Formation Channels for Binary Black Holes with LISA
Breivik, Katelyn; Rodriguez, Carl L.; Larson, Shane L.; Kalogera, Vassiliki; Rasio, Frederic A.
2017-01-01
The recent detections of GW150914 and GW151226 imply an abundance of stellar-mass binary-black-hole mergers in the local universe. While ground-based gravitational-wave detectors are limited to observing the final moments before a binary merges, space-based detectors, such as the Laser Interferometer Space Antenna (LISA), can observe binaries at lower orbital frequencies where such systems may still encode information about their formation histories. In particular, the orbital eccentricity and mass of binary black holes in the LISA frequency band can be used together to discriminate between binaries formed in isolation in galactic fields and those formed in dense stellar environments such as globular clusters. In this letter, we explore the orbital eccentricity and mass of binary-black-hole populations as they evolve through the LISA frequency band. Overall we find that there are two distinct populations discernible by LISA. We show that up to ~90% of binaries formed either dynamically or in isolation have eccentricities measurable by LISA. Finally, we note how measured eccentricities of low-mass binary black holes evolved in isolation could provide detailed constraints on the physics of black-hole natal kicks and common-envelope evolution.
Optical three-step binary-logic-gate-based MSD arithmetic
Fyath, R. S.; Alsaffar, A. A. W.; Alam, M. S.
2003-11-01
A three-step modified signed-digit (MSD) adder is proposed which can be optically implmented using binary logic gates. The proposed scheme depends on encoding each MSD digits into a pair of binary digits using a two-state and multi-position based encoding scheme. The design algorithm depends on constructing the addition truth table of binary-coded MSD numbers and then using Karnaugh map to achieve output minimization. The functions associated with the optical binary logic gates are achieved by simply programming the decoding masks of an optical shadow-casting logic system.
The cool surfaces of binary near-Earth asteroids
Delbo, Marco; Walsh, Kevin; Mueller, Michael; Harris, Alan W.; Howell, Ellen S.
2011-03-01
Here we show results from thermal-infrared observations of km-sized binary near-Earth asteroids (NEAs). We combine previously published thermal properties for NEAs with newly derived values for three binary NEAs. The η value derived from the near-Earth asteroid thermal model (NEATM) for each object is then used to estimate an average thermal inertia for the population of binary NEAs and compared against similar estimates for the population of non-binaries. We find that these objects have, in general, surface temperatures cooler than the average values for non-binary NEAs as suggested by elevated η values. We discuss how this may be evidence of higher-than-average surface thermal inertia. This latter physical parameter is a sensitive indicator of the presence or absence of regolith: bodies covered with fine regolith, such as the Earth’s moon, have low thermal inertia, whereas a surface with little or no regolith displays high thermal inertia. Our results are suggestive of a binary formation mechanism capable of altering surface properties, possibly removing regolith: an obvious candidate is the YORP effect. We present also newly determined sizes and geometric visible albedos derived from thermal-infrared observations of three binary NEAs: (5381) Sekhmet, (153591) 2001 SN263, and (164121) 2003 YT1. The diameters of these asteroids are 1.41 ± 0.21 km, 1.56 ± 0.31 km, and 2.63 ± 0.40 km, respectively. Their albedos are 0.23 ± 0.13, 0.24 ± 0.16, and 0.048 ± 0.015, respectively.
Dynamic Inertia Weight Binary Bat Algorithm with Neighborhood Search
Directory of Open Access Journals (Sweden)
Xingwang Huang
2017-01-01
Full Text Available Binary bat algorithm (BBA is a binary version of the bat algorithm (BA. It has been proven that BBA is competitive compared to other binary heuristic algorithms. Since the update processes of velocity in the algorithm are consistent with BA, in some cases, this algorithm also faces the premature convergence problem. This paper proposes an improved binary bat algorithm (IBBA to solve this problem. To evaluate the performance of IBBA, standard benchmark functions and zero-one knapsack problems have been employed. The numeric results obtained by benchmark functions experiment prove that the proposed approach greatly outperforms the original BBA and binary particle swarm optimization (BPSO. Compared with several other heuristic algorithms on zero-one knapsack problems, it also verifies that the proposed algorithm is more able to avoid local minima.
CHAINS-PC, Decay Chain Atomic Densities
International Nuclear Information System (INIS)
1994-01-01
1 - Description of program or function: CHAINS computes the atom density of members of a single radioactive decay chain. The linearity of the Bateman equations allows tracing of interconnecting chains by manually accumulating results from separate calculations of single chains. Re-entrant loops can be treated as extensions of a single chain. Losses from the chain are also tallied. 2 - Method of solution: The Bateman equations are solved analytically using double-precision arithmetic. Poles are avoided by small alterations of the loss terms. Multigroup fluxes, cross sections, and self-shielding factors entered as input are used to compute the effective specific reaction rates. The atom densities are computed at any specified times. 3 - Restrictions on the complexity of the problem: Maxima of 100 energy groups, 100 time values, 50 members in a chain
Asymmetric supernova explosions and the origin of binary pulsars
International Nuclear Information System (INIS)
Sutantyo, W.
1978-01-01
The author investigates the effect of asymmetric supernova explosions on the orbital parameters of binary systems with a compact component. Such explosions are related to the origin of binary pulsars. The degree of asymmetry of the explosion is represented by the kick velocity gained by the exploding star due to the asymmetric mass ejection. The required kick velocity to produce the observed parameters of the binary pulsar PSR 1913 + 16 should be larger than approximately 80 km s -1 if the mass of the exploding star is larger than approximately 4 solar masses. The mean survival probability of the binary system ( ) is examined for various degrees of asymmetry in the explosion. The rare occurrence of a binary pulsar does not neccessarily imply that such a probability is low since not all pulsars have originated in a binary system. Assuming the birth rate of pulsars by Taylor and Manchester (1977), it is derived that would be as high as 0.25. Such values of can be obtained if the mass of the exploding stars is, in general, not large (< approximately 10 solar masses). (Auth.)
General simulation algorithm for autocorrelated binary processes.
Serinaldi, Francesco; Lombardo, Federico
2017-02-01
The apparent ubiquity of binary random processes in physics and many other fields has attracted considerable attention from the modeling community. However, generation of binary sequences with prescribed autocorrelation is a challenging task owing to the discrete nature of the marginal distributions, which makes the application of classical spectral techniques problematic. We show that such methods can effectively be used if we focus on the parent continuous process of beta distributed transition probabilities rather than on the target binary process. This change of paradigm results in a simulation procedure effectively embedding a spectrum-based iterative amplitude-adjusted Fourier transform method devised for continuous processes. The proposed algorithm is fully general, requires minimal assumptions, and can easily simulate binary signals with power-law and exponentially decaying autocorrelation functions corresponding, for instance, to Hurst-Kolmogorov and Markov processes. An application to rainfall intermittency shows that the proposed algorithm can also simulate surrogate data preserving the empirical autocorrelation.
Mass loss from interacting close binary systems
Plavec, M. J.
1981-01-01
The three well-defined classes of evolved binary systems that show evidence of present and/or past mass loss are the cataclysmic variables, the Algols, and Wolf-Rayet stars. It is thought that the transformation of supergiant binary systems into the very short-period cataclysmic variables must have been a complex process. The new evidence that has recently been obtained from the far ultraviolet spectra that a certain subclass of the Algols (the Serpentids) are undergoing fairly rapid evolution is discussed. It is thought probable that the remarkable mass outflow observed in them is connected with a strong wind powered by accretion. The origin of the circumbinary clouds or flat disks that probably surround many strongly interacting binaries is not clear. Attention is also given to binary systems with hot white dwarf or subdwarf components, such as the symbiotic objects and the BQ stars; it is noted that in them both components may be prone to an enhanced stellar wind.
General simulation algorithm for autocorrelated binary processes
Serinaldi, Francesco; Lombardo, Federico
2017-02-01
The apparent ubiquity of binary random processes in physics and many other fields has attracted considerable attention from the modeling community. However, generation of binary sequences with prescribed autocorrelation is a challenging task owing to the discrete nature of the marginal distributions, which makes the application of classical spectral techniques problematic. We show that such methods can effectively be used if we focus on the parent continuous process of beta distributed transition probabilities rather than on the target binary process. This change of paradigm results in a simulation procedure effectively embedding a spectrum-based iterative amplitude-adjusted Fourier transform method devised for continuous processes. The proposed algorithm is fully general, requires minimal assumptions, and can easily simulate binary signals with power-law and exponentially decaying autocorrelation functions corresponding, for instance, to Hurst-Kolmogorov and Markov processes. An application to rainfall intermittency shows that the proposed algorithm can also simulate surrogate data preserving the empirical autocorrelation.
The Discovery of the Most Accelerated Binary Pulsar
Cameron, A. D.; Champion, D. J.; Kramer, M.; Bailes, M.; Barr, E. D.; Bassa, C. G.; Bhandari, S.; Bhat, N. D. R.; Burgay, M.; Burke-Spolaor, S.; Eatough, R. P.; Flynn, C. M. L.; Freire, P. C. C.; Jameson, A.; Johnston, S.
2018-01-01
Pulsars in relativistic binary systems have emerged as fantastic natural laboratories for testing theories of gravity, the most prominent example being the double pulsar, PSR J0737$-$3039. The HTRU-South Low Latitude pulsar survey represents one of the most sensitive blind pulsar surveys taken of the southern Galactic plane to date, and its primary aim has been the discovery of new relativistic binary pulsars. Here we present our binary pulsar searching strategy and report on the survey's fla...
Shrinking of Binaries in a WIMPY Background at the Galactic Center
Hills, J. G.
2001-12-01
The nature of the dark matter in the Galactic Halo is still not clear. Constraints can be placed on it; e.g., it cannot be in baryons less massive than about 1022 grams (Hills, 1986, Astron. J. 92, 595). It may be in elementary weakly interacting massive particles, WIMPS. Apart from providing most of the mass of the Galaxy, the only known significant dynamical effect of WIMPS is to cause a gradual shrinking of tightly bound binaries (Hills 1983, Astron. J. 88, 1269) as they interact with the background soup of WIMPS. This effect may be observable in binaries close to the Galactic Center if a significant fraction of the mass density near the central black hole is from WIMPS. The requisite binaries would have to have orbital velocities greater than the local velocity dispersion of the WIMPS relative to the binary. The velocity dispersion increases near the black hole. The binary cannot be too close to the black hole or its tidal field will breakup the binary. If the local WIMP density is 107 g/cm3, the fractional rate of reduction in the binary orbital period is about 5 x 10-10/yr for a binary having a semimajor axis equal to 3 solar radii in a soup of WIMPS having a velocity dispersion of 200 km/s relative to the binary. This gradual erosion of the binary period may be detectable, particularly, if one of the binary components is a pulsar.
Optimized reversible binary-coded decimal adders
DEFF Research Database (Denmark)
Thomsen, Michael Kirkedal; Glück, Robert
2008-01-01
Abstract Babu and Chowdhury [H.M.H. Babu, A.R. Chowdhury, Design of a compact reversible binary coded decimal adder circuit, Journal of Systems Architecture 52 (5) (2006) 272-282] recently proposed, in this journal, a reversible adder for binary-coded decimals. This paper corrects and optimizes...... their design. The optimized 1-decimal BCD full-adder, a 13 × 13 reversible logic circuit, is faster, and has lower circuit cost and less garbage bits. It can be used to build a fast reversible m-decimal BCD full-adder that has a delay of only m + 17 low-power reversible CMOS gates. For a 32-decimal (128-bit....... Keywords: Reversible logic circuit; Full-adder; Half-adder; Parallel adder; Binary-coded decimal; Application of reversible logic synthesis...
Malleville, Marie-Alicia; Benoît, Aurélien; Dauliat, Romain; Leconte, Baptiste; Darwich, Dia; du Jeu, Rémi; Jamier, Raphaël.; Schwuchow, Anka; Schuster, Kay; Roy, Philippe
2018-02-01
Over the last decade, significant work has been carried out in order to increase the energy/peak power provided by fiber lasers. Indeed, new microstructured fibers with large (or very large) mode area cores (LMA) such as Distributed Mode Filtering (DMF) fibers and Large-Pitch Fibers (LPF) have been developed to address this concern. These technologies have allowed diffraction-limited emission with core diameters higher than 80 μm, and have state-of-the-art performances in terms of pulse energy or peak power while keeping an excellent spatial beam quality. Although these fibers were designed to reach high power levels while maintaining a single transverse mode propagation, power scaling becomes quickly limited by the onset of transverse modal instabilities (TMI). This effect suddenly arises when a certain average power threshold is exceeded, drastically degrading the emitted beam quality. In this work, we investigate the influence of the core dimensions and the refractive index mismatch between the active core and the background cladding material, on the TMI power threshold in rod-type Fully-Aperiodic-LPF. This fiber structure was specifically designed to enhance the higher-order modes (HOMs) delocalization out of the gain region and thus push further the onset of modal instabilities. Using a 400W pump diode at 976 nm, the power scaling, as well as the spatial beam quality and its temporal behavior were investigated in laser configuration, which theoretically provides a lower TMI power threshold than the amplifier one due to the lack of selective excitation of the fundamental mode.
PROSPECTS FOR DETECTING ASTEROSEISMIC BINARIES IN KEPLER DATA
Energy Technology Data Exchange (ETDEWEB)
Miglio, A.; Chaplin, W. J.; Elsworth, Y.; Handberg, R. [School of Physics and Astronomy, University of Birmingham, Edgbaston, Birmingham, B15 2TT (United Kingdom); Farmer, R.; Kolb, U. [Department of Physical Sciences, The Open University, Walton Hall, Milton Keynes MK7 6AA (United Kingdom); Girardi, L. [INAF-Osservatorio Astronomico di Padova, Vicolo dell' Osservatorio 5, I-35122 Padova (Italy); Appourchaux, T. [Institut d' Astrophysique Spatiale, UMR8617, Université Paris XI, Bâtiment 121, F-91405 Orsay Cedex (France)
2014-03-20
Asteroseismology may in principle be used to detect unresolved stellar binary systems comprised of solar-type stars and/or red giants. This novel method relies on the detection of the presence of two solar-like oscillation spectra in the frequency spectrum of a single light curve. Here, we make predictions of the numbers of systems that may be detectable in data already collected by the NASA Kepler Mission. Our predictions, which are based upon TRILEGAL and BiSEPS simulations of the Kepler field of view, indicate that as many as 200 or more ''asteroseismic binaries'' may be detectable in this manner. Most of these binaries should be comprised of two He-core-burning red giants. Owing largely to the limited numbers of targets with the requisite short-cadence Kepler data, we expect only a small number of detected binaries containing solar-type stars. The predicted yield of detections is sensitive to the assumed initial mass ratio distribution (IMRD) of the binary components and therefore represents a sensitive calibration of the much debated IMRD near mass ratio unity.
Van Pelt, A.
1992-01-01
I. INTRODUCTION AND THEORY This PhD research is mainly concerned with the global phase behaviour, that is calculated from the Simplified-Perturbed-Hard-Chain equation. This equation distinguishes itself from many other equations of state by a sound theoretical background. We enter the field of the
FORMATION OF BLACK HOLE X-RAY BINARIES IN GLOBULAR CLUSTERS
International Nuclear Information System (INIS)
Ivanova, N.; Heinke, C. O.; Woods, T. E.; Chaichenets, S.; Fregeau, J.; Lombardi, J. C.
2010-01-01
Inspired by the recent identification in extragalactic globular clusters of the first candidate black hole-white dwarf (BH-WD) X-ray binaries, where the compact accretors may be stellar-mass black holes (BHs), we explore how such binaries could be formed in a dynamical environment. We provide analyses of the formation rates via well-known formation channels like binary exchange and physical collisions and propose that the only possibility of forming BH-WD binaries is via coupling these usual formation channels with subsequent hardening and/or triple formation. In particular, we find that the most important mechanism for the creation of a BH-WD X-ray binary from an initially dynamically formed BH-WD binary is mass transfer induced in a triple system via the Kozai mechanism. Furthermore, we find that BH-WD binaries that evolve into X-ray sources can be formed by exchanges of a BH into a WD-WD binary or possibly by collisions of a BH and a giant star. If BHs undergo significant evaporation from the cluster or form a completely detached subcluster of BHs, then we cannot match the observationally inferred production rates even using the most optimistic estimates of formation rates. To explain the observations with stellar-mass BH-WD binaries, at least 1% of all formed BHs, or presumably 10% of the BHs present in the core now, must be involved in interactions with the rest of the core stellar population.
Evolution in close binary systems
International Nuclear Information System (INIS)
Yungel'son, L.R.; Masevich, A.G.
1983-01-01
Duality is the property most typical of stars. If one investigates how prevalent double stars are, making due allowance for selection effects, one finds that as many as 90 percent of all stars are paired. Contrary to tradition it is single stars that are out of the ordinary, and as will be shown presently even some of these may have been formed by coalescence of the members of binary systems. This review deals with the evolution of close binaries, defined as double-star systems whose evolution entails exchange of material between the two components
The gravitational-wave memory from eccentric binaries
International Nuclear Information System (INIS)
Favata, Marc
2011-01-01
The nonlinear gravitational-wave memory causes a time-varying but nonoscillatory correction to the gravitational-wave polarizations. It arises from gravitational-waves that are sourced by gravitational-waves. Previous considerations of the nonlinear memory effect have focused on quasicircular binaries. Here I consider the nonlinear memory from Newtonian orbits with arbitrary eccentricity. Expressions for the waveform polarizations and spin-weighted spherical-harmonic modes are derived for elliptic, hyperbolic, parabolic, and radial orbits. In the hyperbolic, parabolic, and radial cases the nonlinear memory provides a 2.5 post-Newtonian (PN) correction to the leading-order waveforms. This is in contrast to the elliptical and quasicircular cases, where the nonlinear memory corrects the waveform at leading (0PN) order. This difference in PN order arises from the fact that the memory builds up over a short ''scattering'' time scale in the hyperbolic case, as opposed to a much longer radiation-reaction time scale in the elliptical case. The nonlinear memory corrections presented here complete our knowledge of the leading-order (Peters-Mathews) waveforms for elliptical orbits. These calculations are also relevant for binaries with quasicircular orbits in the present epoch which had, in the past, large eccentricities. Because the nonlinear memory depends sensitively on the past evolution of a binary, I discuss the effect of this early-time eccentricity on the value of the late-time memory in nearly circularized binaries. I also discuss the observability of large ''memory jumps'' in a binary's past that could arise from its formation in a capture process. Lastly, I provide estimates of the signal-to-noise ratio of the linear and nonlinear memories from hyperbolic and parabolic binaries.
Proposed experiment to test fundamentally binary theories
Kleinmann, Matthias; Vértesi, Tamás; Cabello, Adán
2017-09-01
Fundamentally binary theories are nonsignaling theories in which measurements of many outcomes are constructed by selecting from binary measurements. They constitute a sensible alternative to quantum theory and have never been directly falsified by any experiment. Here we show that fundamentally binary theories are experimentally testable with current technology. For that, we identify a feasible Bell-type experiment on pairs of entangled qutrits. In addition, we prove that, for any n , quantum n -ary correlations are not fundamentally (n -1 ) -ary. For that, we introduce a family of inequalities that hold for fundamentally (n -1 ) -ary theories but are violated by quantum n -ary correlations.
Coalescence of Black Hole-Neutron Star Binaries
Directory of Open Access Journals (Sweden)
Masaru Shibata
2011-08-01
Full Text Available We review the current status of general relativistic studies for the coalescence of black hole-neutron star (BH-NS binaries. First, procedures for a solution of BH-NS binaries in quasi-equilibrium circular orbits and the numerical results, such as quasi-equilibrium sequence and mass-shedding limit, of the high-precision computation, are summarized. Then, the current status of numerical-relativity simulations for the merger of BH-NS binaries is described. We summarize our understanding for the merger and/or tidal disruption processes, the criterion for tidal disruption, the properties of the remnant formed after the tidal disruption, gravitational waveform, and gravitational-wave spectrum.
Dielectric properties of binary solutions a data handbook
Akhadov, Y Y
1980-01-01
Dielectric Properties of Binary Solutions focuses on the investigation of the dielectric properties of solutions, as well as the molecular interactions and mechanisms of molecular processes that occur in liquids. The book first discusses the fundamental formulas describing the dielectric properties of liquids and dielectric data for binary systems of non-aqueous solutions. Topics include permittivity and dielectric dispersion parameters of non-aqueous solutions of organic and inorganic compounds. The text also tackles dielectric data for binary systems of aqueous solutions, including permittiv
RELATIONSHIP BETWEEN FLASH POINTS OF SOME BINARY ...
African Journals Online (AJOL)
B. S. Chandravanshi
Miscellaneous binary blends containing solvent neutral-150 (SN-150), ... viscosity, the flash point test has always been a standard part of a lubricant's specification. ... between structure and flash points of organic compounds [5-12] and fuels [13, 14]. ... in binary mixtures, the gaps between flash points would be high enough.
Short-term variability of binary and non-binary Trans-Neptunian Objects
Thirouin, Audrey; Noll, K. S.; Campo Bagatin, A.; Ortiz Moreno, J. L.; Morales, N.
2013-10-01
Since 1992, more than 1400 Trans-Neptunian Objects (TNOs) have been discovered. Our approach to understand such objects is to study their rotations by monitoring their brightness variations. By studying the rotational properties of the TNOs a wealth of information can be obtained on their physics. So, the study of the spins and shapes of TNOs is a powerful method of gaining information on the formation and evolution of our Solar System. We have observed most of the brightest TNOs and centaurs, and compiled one of the largest lightcurves samples. The main purpose was to increase the number of objects whose short-term variability has been studied and present a homogeneous dataset trying to avoid observational biases. A dataset composed of 54 TNOs/Centaurs is reported and analyzed. Amplitudes and rotational periods have been derived for 45 of them with different degrees of reliability. For 9 objects, only an estimation of the amplitude is reported. Because most of the TNOs/Centaurs have low amplitude lightcurves, it is difficult to distinguish between single- and double-peaked lightcurves. Based on our results and the literature, following Binzel et al. (1989) study about asteroids rotational frequency distribution, we studied the TNOs spin rate distributions. We performed several Maxwellian fits to various histograms obtained considering that the lightcurves are single- or double-peaked. We tested lightcurve amplitude limits to distinguish if the lightcurve is albedo- or shape-dominated. Such a consideration introduces important changes in the distribution. We derived that an amplitude limit of 0.15mag gave a good fit to Maxwellian distribution. So, it seems that 0.15mag is a good measure of the typical variability caused by albedo. We studied the short-term variability of binary TNOs thanks to unresolved lightcurves. Based on our results and those from the literature, we come up with a sample of 32 systems with a rotational period and/or lightcurve amplitude value
Binary Black Hole Mergers from Globular Clusters: Implications for Advanced LIGO.
Rodriguez, Carl L; Morscher, Meagan; Pattabiraman, Bharath; Chatterjee, Sourav; Haster, Carl-Johan; Rasio, Frederic A
2015-07-31
The predicted rate of binary black hole mergers from galactic fields can vary over several orders of magnitude and is extremely sensitive to the assumptions of stellar evolution. But in dense stellar environments such as globular clusters, binary black holes form by well-understood gravitational interactions. In this Letter, we study the formation of black hole binaries in an extensive collection of realistic globular cluster models. By comparing these models to observed Milky Way and extragalactic globular clusters, we find that the mergers of dynamically formed binaries could be detected at a rate of ∼100 per year, potentially dominating the binary black hole merger rate. We also find that a majority of cluster-formed binaries are more massive than their field-formed counterparts, suggesting that Advanced LIGO could identify certain binaries as originating from dense stellar environments.
Prša, Andrej; Batalha, Natalie; Slawson, Robert W.; Doyle, Laurance R.; Welsh, William F.; Orosz, Jerome A.; Seager, Sara; Rucker, Michael; Mjaseth, Kimberly; Engle, Scott G.; Conroy, Kyle; Jenkins, Jon; Caldwell, Douglas; Koch, David; Borucki, William
2011-03-01
The Kepler space mission is devoted to finding Earth-size planets orbiting other stars in their habitable zones. Its large, 105 deg2 field of view features over 156,000 stars that are observed continuously to detect and characterize planet transits. Yet, this high-precision instrument holds great promise for other types of objects as well. Here we present a comprehensive catalog of eclipsing binary stars observed by Kepler in the first 44 days of operation, the data being publicly available through MAST as of 2010 June 15. The catalog contains 1879 unique objects. For each object, we provide its Kepler ID (KID), ephemeris (BJD0, P 0), morphology type, physical parameters (T eff, log g, E(B - V)), the estimate of third light contamination (crowding), and principal parameters (T 2/T 1, q, fillout factor, and sin i for overcontacts, and T 2/T 1, (R 1 + R 2)/a, esin ω, ecos ω, and sin i for detached binaries). We present statistics based on the determined periods and measure the average occurrence rate of eclipsing binaries to be ~1.2% across the Kepler field. We further discuss the distribution of binaries as a function of galactic latitude and thoroughly explain the application of artificial intelligence to obtain principal parameters in a matter of seconds for the whole sample. The catalog was envisioned to serve as a bridge between the now public Kepler data and the scientific community interested in eclipsing binary stars.
International Nuclear Information System (INIS)
Prsa, Andrej; Engle, Scott G.; Conroy, Kyle; Batalha, Natalie; Rucker, Michael; Mjaseth, Kimberly; Slawson, Robert W.; Doyle, Laurance R.; Welsh, William F.; Orosz, Jerome A.; Seager, Sara; Jenkins, Jon; Caldwell, Douglas; Koch, David; Borucki, William
2011-01-01
The Kepler space mission is devoted to finding Earth-size planets orbiting other stars in their habitable zones. Its large, 105 deg 2 field of view features over 156,000 stars that are observed continuously to detect and characterize planet transits. Yet, this high-precision instrument holds great promise for other types of objects as well. Here we present a comprehensive catalog of eclipsing binary stars observed by Kepler in the first 44 days of operation, the data being publicly available through MAST as of 2010 June 15. The catalog contains 1879 unique objects. For each object, we provide its Kepler ID (KID), ephemeris (BJD 0 , P 0 ), morphology type, physical parameters (T eff , log g, E(B - V)), the estimate of third light contamination (crowding), and principal parameters (T 2 /T 1 , q, fillout factor, and sin i for overcontacts, and T 2 /T 1 , (R 1 + R 2 )/a, esin ω, ecos ω, and sin i for detached binaries). We present statistics based on the determined periods and measure the average occurrence rate of eclipsing binaries to be ∼1.2% across the Kepler field. We further discuss the distribution of binaries as a function of galactic latitude and thoroughly explain the application of artificial intelligence to obtain principal parameters in a matter of seconds for the whole sample. The catalog was envisioned to serve as a bridge between the now public Kepler data and the scientific community interested in eclipsing binary stars.
ENERGY-DEPENDENT POWER SPECTRAL STATES AND ORIGIN OF APERIODIC VARIABILITY IN BLACK HOLE BINARIES
International Nuclear Information System (INIS)
Yu Wenfei; Zhang Wenda
2013-01-01
We found that the black hole candidate MAXI J1659–152 showed distinct power spectra, i.e., power-law noise (PLN) versus band-limited noise (BLN) plus quasi-periodic oscillations (QPOs) below and above about 2 keV, respectively, in observations with Swift and the Rossi X-ray Timing Explorer during the 2010 outburst, indicating a high energy cutoff of the PLN and a low energy cutoff of the BLN and QPOs around 2 keV. The emergence of the PLN and the fading of the BLN and QPOs initially took place below 2 keV when the source entered the hard intermediate state and settled in the soft state three weeks later. The evolution was accompanied by the emergence of the disk spectral component and decreases in the amplitudes of variability in the soft and hard X-ray bands. Our results indicate that the PLN is associated with an optically thick disk in both hard and intermediate states, and the power spectral state is independent of the X-ray energy spectral state in a broadband view. We suggest that in the hard or intermediate state, the BLN and QPOs emerge from the innermost hot flow subjected to Comptonization, while the PLN originates from the optically thick disk farther out. The energy cutoffs of the PLN and the BLN or QPOs then follow the temperature of the seed photons from the inner edge of the optically thick disk, while the high frequency cutoff of the PLN follows the orbital frequency of the inner edge of the optically thick disk as well.
Binary evolution and observational constraints
International Nuclear Information System (INIS)
Loore, C. de
1984-01-01
The evolution of close binaries is discussed in connection with problems concerning mass and angular momentum losses. Theoretical and observational evidence for outflow of matter, leaving the system during evolution is given: statistics on total masses and mass ratios, effects of the accretion of the mass gaining component, the presence of streams, disks, rings, circumstellar envelopes, period changes, abundance changes in the atmosphere. The effects of outflowing matter on the evolution is outlined, and estimates of the fraction of matter expelled by the loser, and leaving the system, are given. The various time scales involved with evolution and observation are compared. Examples of non conservative evolution are discussed. Problems related to contact phases, on mass and energy losses, in connection with entropy changes are briefly analysed. For advanced stages the disruption probabilities for supernova explosions are examined. A global picture is given for the evolution of massive close binaries, from ZAMS, through WR phases, X-ray phases, leading to runaway pulsars or to a binary pulsar and later to a millisecond pulsar. (Auth.)
International Nuclear Information System (INIS)
Apparao, K.M.V.
1977-01-01
Reference is made to the radio binary systems CC Cas, AR Lac, β Per (Algol), β Lyr, b Per and Cyg X-1. It is stated that a thermal interpretation of the radiation from Algol requires a much larger x-ray flux than the observed value of 3.8 x 10 -11 erg/cm 2 /sec/keV in the 2 to 6 keV energy range. Observations of some non-thermal flares, together with the small size of the radio source in Algol, indicate that the radio emission is non-thermal in nature. The radio emission is interpreted as synchrotron radiation and it is suggested that the observed x-ray emission is due to inverse Compton scattering of the light of the primary star by the radio electrons. The x-ray emission from other radio binaries is also calculated using this model. The energy for the radio electrons can arise from annihilation of magnetic lines connecting the binary stars, twisted by the rotation of the stars. (U.K.)
Binary Relations as a Foundation of Mathematics
Kuper, Jan; Barendsen, E.; Capretta, V.; Geuvers, H.; Niqui, M.
2007-01-01
We describe a theory for binary relations in the Zermelo-Fraenkel style. We choose for ZFCU, a variant of ZFC Set theory in which the Axiom of Foundation is replaced by an axiom allowing for non-wellfounded sets. The theory of binary relations is shown to be equi-consistent ZFCU by constructing a
DEFF Research Database (Denmark)
Bruntt, Hans; Southworth, J.; Penny, A. J.
2006-01-01
Stars: fundamental parameters, binaries: close, eclipsing, techniques: photometric Udgivelsesdato: Sep.......Stars: fundamental parameters, binaries: close, eclipsing, techniques: photometric Udgivelsesdato: Sep....
Hybrid Black-Hole Binary Initial Data
Mundim, Bruno C.; Kelly, Bernard J.; Nakano, Hiroyuki; Zlochower, Yosef; Campanelli, Manuela
2010-01-01
"Traditional black-hole binary puncture initial data is conformally flat. This unphysical assumption is coupled with a lack of radiation signature from the binary's past life. As a result, waveforms extracted from evolutions of this data display an abrupt jump. In Kelly et al. [Class. Quantum Grav. 27:114005 (2010)], a new binary black-hole initial data with radiation contents derived in the post-Newtonian (PN) calculations was adapted to puncture evolutions in numerical relativity. This data satisfies the constraint equations to the 2.5PN order, and contains a transverse-traceless "wavy" metric contribution, violating the standard assumption of conformal flatness. Although the evolution contained less spurious radiation, there were undesired features; the unphysical horizon mass loss and the large initial orbital eccentricity. Introducing a hybrid approach to the initial data evaluation, we significantly reduce these undesired features."
ADDITIONAL MASSIVE BINARIES IN THE CYGNUS OB2 ASSOCIATION
International Nuclear Information System (INIS)
Kiminki, Daniel C.; Kobulnicky, Henry A.; Ewing, Ian; Lundquist, Michael; Alexander, Michael; Vargas-Alvarez, Carlos; Choi, Heather; Bagley Kiminki, Megan M.; Henderson, C. B.
2012-01-01
We report the discovery and orbital solutions for two new OB binaries in the Cygnus OB2 Association, MT311 (B2V + B3V) and MT605 (B0.5V + B2.5:V). We also identify the system MT429 as a probable triple system consisting of a tight eclipsing 2.97 day B3V+B6V pair and a B0V at a projected separation of 138 AU. We further provide the first spectroscopic orbital solutions to the eclipsing, double-lined, O-star binary MT696 (O9.5V + B1:V), the double-lined, early B binary MT720 (B0-1V + B1-2V), and the double-lined, O-star binary MT771 (O7V + O9V). These systems exhibit orbital periods between 1.5 days and 12.3 days, with the majority having P <6 days. The two new binary discoveries and six spectroscopic solutions bring the total number of known massive binaries in the central region of the Cygnus OB2 Association to 20, with all but two having full orbital solutions.
ADDITIONAL MASSIVE BINARIES IN THE CYGNUS OB2 ASSOCIATION
Energy Technology Data Exchange (ETDEWEB)
Kiminki, Daniel C.; Kobulnicky, Henry A.; Ewing, Ian; Lundquist, Michael; Alexander, Michael; Vargas-Alvarez, Carlos; Choi, Heather [Department of Physics and Astronomy, University of Wyoming, Laramie, WY 82070 (United States); Bagley Kiminki, Megan M. [Department of Astronomy, University of Arizona, Tucson, AZ 85721 (United States); Henderson, C. B. [Department of Astronomy, Ohio State University, Columbus, OH 43210 (United States)
2012-03-01
We report the discovery and orbital solutions for two new OB binaries in the Cygnus OB2 Association, MT311 (B2V + B3V) and MT605 (B0.5V + B2.5:V). We also identify the system MT429 as a probable triple system consisting of a tight eclipsing 2.97 day B3V+B6V pair and a B0V at a projected separation of 138 AU. We further provide the first spectroscopic orbital solutions to the eclipsing, double-lined, O-star binary MT696 (O9.5V + B1:V), the double-lined, early B binary MT720 (B0-1V + B1-2V), and the double-lined, O-star binary MT771 (O7V + O9V). These systems exhibit orbital periods between 1.5 days and 12.3 days, with the majority having P <6 days. The two new binary discoveries and six spectroscopic solutions bring the total number of known massive binaries in the central region of the Cygnus OB2 Association to 20, with all but two having full orbital solutions.
Physics of Relativistic Objects in Compact Binaries: From Birth to Coalescence
Colpi, Monica; Gorini, Vittorio; Moschella, Ugo; Possenti, Andrea
2009-01-01
This book provides a comprehensive, authoritative and timely review of the astrophysical approach to the investigation of gravity theories. Particular attention is paid to strong-field tests of general relativity and alternative theories of gravity, performed using collapsed objects (neutron stars, black holes and white dwarfs) in relativistic binaries as laboratories. The book starts with an introduction which gives the background linking experimental gravity in cosmic laboratories to astrophysics and fundamental physics. Subsequent chapters cover observational and theoretical aspects of the following topics: from binaries as test-beds of gravity theories to binary pulsars as cosmic laboratories; from binary star evolution to the formation of relativistic binaries; from short gamma-ray bursts to low mass X-ray binaries; from stellar-mass black hole binaries to coalescing super-massive black holes in galaxy mergers. The book will be useful to researchers, PhD and graduate students in Astrophysics, Cosmology, ...
Optical studies of massive X-ray binaries
International Nuclear Information System (INIS)
Zuiderwijk, E.J.
1979-01-01
Photometric and spectroscopic studies of several optical counterparts of massive X-ray binaries are presented. Subjects of study were the binary systems:HD77581/4U0900-40 (Vela X-1), HD153919/4U1700-37, Wray 977/4U1223-62 and Sk160/4U0115-74 (=SMC X-1). (Auth.)
Binary pairs of supermassive black holes - Formation in merging galaxies
Energy Technology Data Exchange (ETDEWEB)
Valtaoja, L.; Valtonen, M.J.; Byrd, G.G. (Turku Univ. (Finland); Alabama Univ., Tuscaloosa (USA))
1989-08-01
A process in which supermassive binary blackholes are formed in nuclei of supergiant galaxies due to galaxy mergers is examined. There is growing evidence that mergers of galaxies are common and that supermassive black holes in center of galaxies are also common. Consequently, it is expected that binary black holes should arise in connection with galaxy mergers. The merger process in a galaxy modeled after M87 is considered. The capture probability of a companion is derived as a function of its mass. Assuming a correlation between the galaxy mass and the blackholes mass, the expected mass ratio in binary black holes is calculated. The binary black holes formed in this process are long lived, surviving longer than the Hubble time unless they are perturbed by black holes from successive mergers. The properties of these binaries agree with Gaskell's (1988) observational work on quasars and its interpretation in terms of binary black holes. 39 refs.
Creative industries value chain: The value chain logic in supply chain relationships
Emilia Madudová
2017-01-01
The purpose of this paper is to provide a deeper look into value chain logic in supply chain relationships in a creative industries value chains. In recent years, value has been recognized as a key factor in better understanding of consumer behavior and gaining a competitive advantage. In a value chain, added value should be defined at every step of the chain. There should be defined activity which adds value as well as the activity that subtracts any value. The total value can be then calcul...
International Nuclear Information System (INIS)
Geier, S.; Schaffenroth, V.; Drechsel, H.; Heber, U.; Kupfer, T.; Tillich, A.; Oestensen, R. H.; Smolders, K.; Degroote, P.; Maxted, P. F. L.; Barlow, B. N.; Gaensicke, B. T.; Marsh, T. R.; Napiwotzki, R.
2011-01-01
Hot subdwarf B stars (sdBs) are extreme horizontal branch stars believed to originate from close binary evolution. Indeed about half of the known sdB stars are found in close binaries with periods ranging from a few hours to a few days. The enormous mass loss required to remove the hydrogen envelope of the red-giant progenitor almost entirely can be explained by common envelope ejection. A rare subclass of these binaries are the eclipsing HW Vir binaries where the sdB is orbited by a dwarf M star. Here, we report the discovery of an HW Vir system in the course of the MUCHFUSS project. A most likely substellar object (≅0.068 M sun ) was found to orbit the hot subdwarf J08205+0008 with a period of 0.096 days. Since the eclipses are total, the system parameters are very well constrained. J08205+0008 has the lowest unambiguously measured companion mass yet found in a subdwarf B binary. This implies that the most likely substellar companion has not only survived the engulfment by the red-giant envelope, but also triggered its ejection and enabled the sdB star to form. The system provides evidence that brown dwarfs may indeed be able to significantly affect late stellar evolution.
Binaries traveling through a gaseous medium: dynamical drag forces and internal torques
Energy Technology Data Exchange (ETDEWEB)
Sánchez-Salcedo, F. J. [Instituto de Astronomía, Universidad Nacional Autónoma de México, Ciudad Universitaria, Apt. Postal 70 264, C.P. 04510, Mexico City (Mexico); Chametla, Raul O., E-mail: jsanchez@astro.unam.mx [Escuela Superior de Física y Matemáticas, Instituto Politécnico Nacional, UP Adolfo López Mateos, Mexico City (Mexico)
2014-10-20
Using time-dependent linear theory, we investigate the morphology of the gravitational wake induced by a binary, whose center of mass moves at velocity V{sub cm} against a uniform background of gas. For simplicity, we assume that the components of the binary are on circular orbits about their common center of mass. The consequences of dynamical friction is twofold. First, gas dynamical friction may drag the center of mass of the binary and cause the binary to migrate. Second, drag forces also induce a braking torque, which causes the orbits of the components of the binary to shrink. We compute the drag forces acting on one component of the binary due to the gravitational interaction with its own wake. We show that the dynamical friction force responsible for decelerating the center of mass of the binary is smaller than it is in the point-mass case because of the loss of gravitational focusing. We show that the braking internal torque depends on the Mach numbers of each binary component about their center of mass, and also on the Mach number of the center of mass of the binary. In general, the internal torque decreases with increasing the velocity of the binary relative to the ambient gas cloud. However, this is not always the case. We also mention the relevance of our results to the period distribution of binaries.
Close Binaries in the 21st Century: New Opportunities and Challenges
Giménez, Àlvaro; Niarchos, Panagiotis; Rucinski, Slavek
2006-01-01
An International Conference entitled "Close Binaries in the 21st Century: New Opportunities and Challenges", was held in Syros island, Greece, from 27 to 30 June, 2005. There are many binary star systems whose components are so close together, that they interact in various ways. Stars in such systems do not pass through all stages of their evolution independently of each other; in fact their evolutionary path is significantly affected by their companions. Processes of interaction include gravitational effects, mutual irradiation, mass exchange, mass loss from the system, phenomena of extended atmospheres, semi-transparent atmospheric clouds, variable thickness disks and gas streams. The zoo of Close Binary Systems includes: Close Eclipsing Binaries (Detached, Semi-detached, Contact), High and Low-Mass X-ray Binaries, Cataclysmic Variables, RS CVn systems, Pulsar Binaries and Symbiotic Stars. The study of these binaries triggered the development of new branches of astrophysics dealing with the structure and ev...
A DEEPLY ECLIPSING DETACHED DOUBLE HELIUM WHITE DWARF BINARY
International Nuclear Information System (INIS)
Parsons, S. G.; Marsh, T. R.; Gaensicke, B. T.; Drake, A. J.; Koester, D.
2011-01-01
Using Liverpool Telescope+RISE photometry we identify the 2.78 hr period binary star CSS 41177 as a detached eclipsing double white dwarf binary with a 21,100 K primary star and a 10,500 K secondary star. This makes CSS 41177 only the second known eclipsing double white dwarf binary after NLTT 11748. The 2 minute long primary eclipse is 40% deep and the secondary eclipse 10% deep. From Gemini+GMOS spectroscopy, we measure the radial velocities of both components of the binary from the Hα absorption line cores. These measurements, combined with the light curve information, yield white dwarf masses of M 1 = 0.283 ± 0.064 M sun and M 2 = 0.274 ± 0.034 M sun , making them both helium core white dwarfs. As an eclipsing, double-lined spectroscopic binary, CSS 41177 is ideally suited to measuring precise, model-independent masses and radii. The two white dwarfs will merge in roughly 1.1 Gyr to form a single sdB star.
Binary Biometric Representation through Pairwise Adaptive Phase Quantization
Chen, C.; Veldhuis, Raymond N.J.
Extracting binary strings from real-valued biometric templates is a fundamental step in template compression and protection systems, such as fuzzy commitment, fuzzy extractor, secure sketch, and helper data systems. Quantization and coding is the straightforward way to extract binary representations
Diffusion in ordered binary solid systems
International Nuclear Information System (INIS)
Stolwijk, N.A.
1980-01-01
This thesis contains contributions to the field of diffusion in ordered binary solid systems. An extensive experimental investigation of the self diffusion in CoGa is presented. The results of these diffusion measurements strongly suggest that a substantial part of the atomic migration is caused by a new type of defect. A quantitative description of the atomic displacements via this defect is given. Finally computer simulations are presented of diffusion and ordering in binary solid systems. (Auth.)
An Introduction to Binary Decision Diagrams
DEFF Research Database (Denmark)
Andersen, Henrik Reif
1996-01-01
This note is a short introduction to Binary Decision Diagrams (BDDs). It provides some background knowledge and describes the core algorithms. It is used in the course "C4340 Advanced Algorithms" at the Technical University of Denmark, autumn 1996.......This note is a short introduction to Binary Decision Diagrams (BDDs). It provides some background knowledge and describes the core algorithms. It is used in the course "C4340 Advanced Algorithms" at the Technical University of Denmark, autumn 1996....
Energy Technology Data Exchange (ETDEWEB)
Hrivnak, Bruce J.; Lu, Wenxian [Department of Physics and Astronomy, Valparaiso University, Valparaiso, IN 46383 (United States); Steene, Griet Van de [Royal Observatory of Belgium, Astronomy and Astrophysics, Ringlaan 3, Brussels (Belgium); Winckel, Hans Van [Instituut voor Sterrenkunde, K.U. Leuven University, Celestijnenlaan 200 D, B-3001 Leuven (Belgium); Sperauskas, Julius [Vilnius University Observatory, Ciurlionio 29 Vilnius 2009 (Lithuania); Bohlender, David, E-mail: bruce.hrivnak@valpo.edu, E-mail: wen.lu@valpo.edu, E-mail: g.vandesteene@oma.be, E-mail: Hans.VanWinckel@ster.kuleuven.be, E-mail: julius.sperauskas@ff.vu.lt, E-mail: David.Bohlender@nrc-cnrc.gc.ca [National Research Council of Canada, Herzberg Astronomy and Astrophysics, 5071 West Saanich Road, Victoria, BC V9E 2E7 (Canada)
2017-09-10
We present the results of an expanded, long-term radial velocity search (25 years) for evidence of binarity in a sample of seven bright proto-planetary nebulae (PPNe). The goal is to investigate the widely held view that the bipolar or point-symmetric shapes of planetary nebulae (PNe) and PPNe are due to binary interactions. Observations from three observatories were combined from 2007 to 2015 to search for variations on the order of a few years and then combined with earlier observations from 1991 to 1995 to search for variations on the order of decades. All seven show velocity variations due to periodic pulsation in the range of 35–135 days. However, in only one PPN, IRAS 22272+5435, did we find even marginal evidence for multi-year variations that might be due to a binary companion. This object shows marginally significant evidence of a two-year period of low semi-amplitude, which could be due to a low-mass companion, and it also displays some evidence of a much longer period of >30 years. The absence of evidence in the other six objects for long-period radial velocity variations due to a binary companion sets significant constraints on the properties of any undetected binary companions: they must be of low mass, ≤0.2 M {sub ⊙}, or long period, >30 years. Thus the present observations do not provide direct support for the binary hypothesis to explain the shapes of PNe and PPNe and severely constrains the properties of any such undetected companions.
Gravitational waves from spinning eccentric binaries
Csizmadia, Péter; Debreczeni, Gergely; Rácz, István; Vasúth, Mátyás
2012-12-01
This paper is to introduce a new software called CBwaves which provides a fast and accurate computational tool to determine the gravitational waveforms yielded by generic spinning binaries of neutron stars and/or black holes on eccentric orbits. This is done within the post-Newtonian (PN) framework by integrating the equations of motion and the spin precession equations, while the radiation field is determined by a simultaneous evaluation of the analytic waveforms. In applying CBwaves various physically interesting scenarios have been investigated. In particular, we have studied the appropriateness of the adiabatic approximation, and justified that the energy balance relation is indeed insensitive to the specific form of the applied radiation reaction term. By studying eccentric binary systems, it is demonstrated that circular template banks are very ineffective in identifying binaries even if they possess tiny residual orbital eccentricity, thus confirming a similar result obtained by Brown and Zimmerman (2010 Phys. Rev. D 81 024007). In addition, by investigating the validity of the energy balance relation we show that, contrary to the general expectations, the PN approximation should not be applied once the PN parameter gets beyond the critical value ˜0.08 - 0.1. Finally, by studying the early phase of the gravitational waves emitted by strongly eccentric binary systems—which could be formed e.g. in various many-body interactions in the galactic halo—we have found that they possess very specific characteristics which may be used to identify these type of binary systems. This paper is dedicated to the memory of our colleague and friend Péter Csizmadia a young physicist, computer expert and one of the best Hungarian mountaineers who disappeared in China’s Sichuan near the Ren Zhong Feng peak of the Himalayas on 23 Oct. 2009. We started to develop CBwaves jointly with Péter a couple of months before he left for China.
Rotation invariant deep binary hashing for fast image retrieval
Dai, Lai; Liu, Jianming; Jiang, Aiwen
2017-07-01
In this paper, we study how to compactly represent image's characteristics for fast image retrieval. We propose supervised rotation invariant compact discriminative binary descriptors through combining convolutional neural network with hashing. In the proposed network, binary codes are learned by employing a hidden layer for representing latent concepts that dominate on class labels. A loss function is proposed to minimize the difference between binary descriptors that describe reference image and the rotated one. Compared with some other supervised methods, the proposed network doesn't have to require pair-wised inputs for binary code learning. Experimental results show that our method is effective and achieves state-of-the-art results on the CIFAR-10 and MNIST datasets.
Electronic structure of disordered binary alloys with short range correlation in Bethe lattice
International Nuclear Information System (INIS)
Moreno, I.F.
1987-01-01
The determination of the electronic structure of a disordered material along the tight-binding model when applied to a Bethe lattice. The diagonal as well as off-diagonal disorder, are considered. The coordination number on the Bethe is fixed lattice to four (Z=4) that occurs in most compound semiconductors. The main proposal was to study the conditions under which a relatively simple model of a disordered material, i.e, a binary alloy, could account for the basic properties of transport or more specifically for the electronic states in such systems. By using a parametrization of the pair probability the behaviour of the electronic density of states (DOS) for different values of the short range order parameter, σ, which makes possible to treat the segregated, random and alternating cases, was analysed. In solving the problem via the Green function technique in the Wannier representation a linear chain of atoms was considered and using the solution of such a 1-D system the problem of the Bethe lattice which is constructed using such renormalized chains as elements, was solved. The results indicate that the obtained DOS are strongly dependent on the correlation assumed for the occupancy in the lattice. (author) [pt
The Frequency of Binary Stars in the Globular Cluster M71
Barden, S. C.; Armandroff, T. E.; Pryor, C. P.
1994-12-01
The frequency of binary stars is a fundamental property of a stellar population. A comparison of the frequency of binaries in globular clusters with those in the field halo and disk populations tests the similarity of star formation in those environments. Binary stars in globular clusters also act as an energy source which ``heats" the cluster through super-elastic encounters with other stars and binaries. Such encounters can not only profoundly affect the dynamical evolution of the cluster, they can disrupt the widely separated binaries and catalyze the formation of exotic objects such as blue stragglers, x-ray binaries, and milli-second pulsars. We have used the KPNO 4-m and the multi-fiber instruments Nessie and Hydra to measure radial velocities at 4 epochs over two years for a sample of 126 stars in the globular cluster M71. Velocity errors are under 1 km s(-1) for the brighter stars and under 2 km s(-1) for the majority of our data set. These velocities will be valuable for studying the kinematics of M71, but here we focus on searching for binaries. The faintest stars are at V=17, or just above the main sequence turnoff. Our sample is thus deeper than any published globular cluster binary search utilizing spectroscopic techniques. By observing smaller stars, we double the number of decades of binary periods sampled compared to previous studies and come within a factor of 4 of the shortest possible periods for turnoff stars. This wider period window has produced the largest known sample of binaries in a globular cluster. Four stars show velocity ranges larger than 20 km s(-1) , nine have ranges larger than 10 km s(-1) , and others are clearly variable. We will compare the radial distribution of these stars to that predicted by theory and derive the main-sequence binary fraction.
Binary black holes on a budget: simulations using workstations
International Nuclear Information System (INIS)
Marronetti, Pedro; Tichy, Wolfgang; Bruegmann, Bernd; Gonzalez, Jose; Hannam, Mark; Husa, Sascha; Sperhake, Ulrich
2007-01-01
Binary black hole simulations have traditionally been computationally very expensive: current simulations are performed in supercomputers involving dozens if not hundreds of processors, thus systematic studies of the parameter space of binary black hole encounters still seem prohibitive with current technology. Here we show how the multi-layered refinement level code BAM can be used on dual processor workstations to simulate certain binary black hole systems. BAM, based on the moving punctures method, provides grid structures composed of boxes of increasing resolution near the centre of the grid. In the case of binaries, the highest resolution boxes are placed around each black hole and they track them in their orbits until the final merger when a single set of levels surrounds the black hole remnant. This is particularly useful when simulating spinning black holes since the gravitational fields gradients are larger. We present simulations of binaries with equal mass black holes with spins parallel to the binary axis and intrinsic magnitude of S/m 2 = 0.75. Our results compare favourably to those of previous simulations of this particular system. We show that the moving punctures method produces stable simulations at maximum spatial resolutions up to M/160 and for durations of up to the equivalent of 20 orbital periods
Compact Binary Progenitors of Short Gamma-Ray Bursts
Giacomazzo, Bruno; Perna, Rosalba; Rezzolla, Luciano; Troja, Eleonora; Lazzati, Davide
2013-01-01
In recent years, detailed observations and accurate numerical simulations have provided support to the idea that mergers of compact binaries containing either two neutron stars (NSs) or an NS and a black hole (BH) may constitute the central engine of short gamma-ray bursts (SGRBs). The merger of such compact binaries is expected to lead to the production of a spinning BH surrounded by an accreting torus. Several mechanisms can extract energy from this system and power the SGRBs. Here we connect observations and numerical simulations of compact binary mergers, and use the current sample of SGRBs with measured energies to constrain the mass of their powering tori. By comparing the masses of the tori with the results of fully general-relativistic simulations, we are able to infer the properties of the binary progenitors that yield SGRBs. By assuming a constant efficiency in converting torus mass into jet energy epsilon(sub jet) = 10%, we find that most of the tori have masses smaller than 0.01 Solar M, favoring "high-mass" binary NSs mergers, i.e., binaries with total masses approx >1.5 the maximum mass of an isolated NS. This has important consequences for the gravitational wave signals that may be detected in association with SGRBs, since "high-mass" systems do not form a long-lived hypermassive NS after the merger. While NS-BH systems cannot be excluded to be the engine of at least some of the SGRBs, the BH would need to have an initial spin of approx. 0.9 or higher.
Young and Waltzing Binary Stars
2001-10-01
ADONIS Observes Low-mass Eclipsing System in Orion Summary A series of very detailed images of a binary system of two young stars have been combined into a movie . In merely 3 days, the stars swing around each other. As seen from the earth, they pass in front of each other twice during a full revolution, producing eclipses during which their combined brightness diminishes . A careful analysis of the orbital motions has now made it possible to deduce the masses of the two dancing stars . Both turn out to be about as heavy as our Sun. But while the Sun is about 4500 million years old, these two stars are still in their infancy. They are located some 1500 light-years away in the Orion star-forming region and they probably formed just 10 million years ago . This is the first time such an accurate determination of the stellar masses could be achieved for a young binary system of low-mass stars . The new result provides an important piece of information for our current understanding of how young stars evolve. The observations were obtained by a team of astronomers from Italy and ESO [1] using the ADaptive Optics Near Infrared System (ADONIS) on the 3.6-m telescope at the ESO La Silla Observatory. PR Photo 29a/01 : The RXJ 0529.4+0041 system before primary eclipse PR Photo 29b/01 : The RXJ 0529.4+0041 system at mid-primary eclipse PR Photo 29c/01 : The RXJ 0529.4+0041 system after primary eclipse PR Photo 29d/01 : The RXJ 0529.4+0041 system before secondary eclipse PR Photo 29e/01 : The RXJ 0529.4+0041 system at mid-secondary eclipse PR Photo 29f/01 : The RXJ 0529.4+0041 system after secondary eclipse PR Video Clip 06/01 : Video of the RXJ 0529.4+0041 system Binary stars and stellar masses Since some time, astronomers have noted that most stars seem to form in binary or multiple systems. This is quite fortunate, as the study of binary stars is the only way in which it is possible to measure directly one of the most fundamental quantities of a star, its mass. The mass of a
Long-term captures of low-mass intruders by binary stars
International Nuclear Information System (INIS)
Hills, J.G.
1983-01-01
Intensive computer simulations were made of three families of encounters between a binary star and a low-mass intruder which previous work indicated have a high probability of producing long-lived triple-star systems. For comparison, a fourth family which produces few long-lived trinaries was also studied. In the first two families, the binary components are equally massive and the closest approach of the intruder to the center of mass of the binary is about two times its semimajor axis, a 0 . In Family 1, the orbit of the original binary is circular, e = 0, while in Family 2, e 0 = 0.95. In Family 3 one binary component is 100 times as massive as the other, the orbit is circular, and the low-mass intruder enters the binary at nearly zero impact parameter. The probability that the intruder is trapped for at least one revolution around the binary is 0.24, 0.46, and 0.51, respectively, for these three families of encounters. The fraction of the intruders surviving successive revolutions drops rapidly. However, one encounter in Family 1 and two in Family 3 resulted in the intruder making more than 300 revolutions around the inner binary before escaping. Some intruders remained bound for more than 20 000 revolutions of the inner binary. The longest duration captures occur when the intruder is thrown into an orbit with a very large semimajor axis. About 20% of the encounters in the three families result in the intruder being thrown into an orbit with a semimajor axis a>100 a 0 , while about 2% result in the intruder going into an orbit with a>1000 a 0 . Intruders thrown into these large semimajor axis orbits have the best chance of having their orbits stabilized by passing stars
Interfacial free energy governs single polystyrene chain collapse in water and aqueous solutions.
Li, Isaac T S; Walker, Gilbert C
2010-05-12
The hydrophobic interaction is significantly responsible for driving protein folding and self-assembly. To understand it, the thermodynamics, the role of water structure, the dewetting process surrounding hydrophobes, and related aspects have undergone extensive investigations. Here, we examine the hypothesis that polymer-solvent interfacial free energy is adequate to describe the energetics of the collapse of a hydrophobic homopolymer chain at fixed temperature, which serves as a much simplified model for studying the hydrophobic collapse of a protein. This implies that changes in polymer-solvent interfacial free energy should be directly proportional to the force to extend a collapsed polymer into a bad solvent. To test this hypothesis, we undertook single-molecule force spectroscopy on a collapsed, single, polystyrene chain in water-ethanol and water-salt mixtures where we measured the monomer solvation free energy from an ensemble average conformations. Different proportions within the binary mixture were used to create solvents with different interfacial free energies with polystyrene. In these mixed solvents, we observed a linear correlation between the interfacial free energy and the force required to extend the chain into solution, which is a direct measure of the solvation free energy per monomer on a single chain at room temperature. A simple analytical model compares favorably with the experimental results. This knowledge supports a common assumption that explicit water solvent may not be necessary for cases whose primary concerns are hydrophobic interactions and hydrophobic hydration.
THE BINARY FRACTION OF LOW-MASS WHITE DWARFS
International Nuclear Information System (INIS)
Brown, Justin M.; Kilic, Mukremin; Brown, Warren R.; Kenyon, Scott J.
2011-01-01
We describe spectroscopic observations of 21 low-mass (≤0.45 M sun ) white dwarfs (WDs) from the Palomar-Green survey obtained over four years. We use both radial velocities and infrared photometry to identify binary systems, and find that the fraction of single, low-mass WDs is ≤30%. We discuss the potential formation channels for these single stars including binary mergers of lower-mass objects. However, binary mergers are not likely to explain the observed number of single low-mass WDs. Thus, additional formation channels, such as enhanced mass loss due to winds or interactions with substellar companions, are likely.
Construction of binary status information system using PC network
International Nuclear Information System (INIS)
Kurnianto, K.; Azriani, A.; Teddy, S.
1998-01-01
Binary status information system is a part of establishing reactor parameter with Pc that function as MPR-30 Process Computer. Binary Alarm system, consist of interface hardware and input binary module terminal, prepare the information that be displayed in text message and graphical form. Monitor software give facilities that binary status of RSG-GAS components can be monitored using computer network (LAN). This program consist of two part : reside in server computer and reside in user computer. Program in server acquire data from interface and than store it in data base (Access file). Than, user computer read this file and display it in Dynamic Process and Instrumentation Diagram. The number of user computer can be more then one because data base was designed for multi-user operation
Massive Black-Hole Binary Mergers: Dynamics, Environments & Expected Detections
Kelley, Luke Zoltan
2018-05-01
This thesis studies the populations and dynamics of massive black-hole binaries and their mergers, and explores the implications for electromagnetic and gravitational-wave signals that will be detected in the near future. Massive black-holes (MBH) reside in the centers of galaxies, and when galaxies merge, their MBH interact and often pair together. We base our study on the populations of MBH and galaxies from the `Illustris' cosmological hydrodynamic simulations. The bulk of the binary merger dynamics, however, are unresolved in cosmological simulations. We implement a suite of comprehensive physical models for the merger process, like dynamical friction and gravitational wave emission, which are added in post-processing. Contrary to many previous studies, we find that the most massive binaries with near equal-mass companions are the most efficient at coalescing; though the process still typically takes gigayears.From the data produced by these MBH binary populations and their dynamics, we calculate the expected gravitational wave (GW) signals: both the stochastic, GW background of countless unresolved sources, and the GW foreground of individually resolvable binaries which resound above the noise. Ongoing experiments, called pulsar timing arrays, are sensitive to both of these types of signals. We find that, while the current lack of detections is unsurprising, both the background and foreground will plausibly be detected in the next decade. Unlike previous studies which have predicted the foreground to be significantly harder to detect than the background, we find their typical amplitudes are comparable.With traditional electromagnetic observations, there has also been a dearth of confirmed detections of MBH binary systems. We use our binaries, combined with models of emission from accreting MBH systems, to make predictions for the occurrence rate of systems observable using photometric, periodic-variability surveys. These variables should be detectable in
Formation and Evolution of Contact Binaries
Directory of Open Access Journals (Sweden)
Peter P. Eggleton
2012-06-01
Full Text Available describe a series of processes, including hierarchical fragmentation, gravitational scattering, Kozai cycles within triple systems, tidal friction and magnetic braking, that I believe are responsible for producing the modest but significant fraction of stars that are observed as contact binaries. I also discuss further processes, namely heat transport, mass transport, nuclear evolution, thermal relaxation oscillations, and further magnetic braking with tidal friction, that influence the evolution during contact. The endpoint, for contact, is that the two components merge into a single star, as recently was observed in the remarkable system V1309 Sco. The single star probably throws off some mass and rotates rapidly at first, and then slows by magnetic braking to become a rather inconspicuous but normal dwarf or subgiant. If however the contact binary was part of a triple system originally–as I suggested above was rather likely–then the result could be a widish binary with apparently non-coeval components. There are several such known.
Compact binary hashing for music retrieval
Seo, Jin S.
2014-03-01
With the huge volume of music clips available for protection, browsing, and indexing, there is an increased attention to retrieve the information contents of the music archives. Music-similarity computation is an essential building block for browsing, retrieval, and indexing of digital music archives. In practice, as the number of songs available for searching and indexing is increased, so the storage cost in retrieval systems is becoming a serious problem. This paper deals with the storage problem by extending the supervector concept with the binary hashing. We utilize the similarity-preserving binary embedding in generating a hash code from the supervector of each music clip. Especially we compare the performance of the various binary hashing methods for music retrieval tasks on the widely-used genre dataset and the in-house singer dataset. Through the evaluation, we find an effective way of generating hash codes for music similarity estimation which improves the retrieval performance.
Standard handbook of chains chains for power transmission and material handling
2005-01-01
A BRIEF HISTORY OF THE DEVELOPMENT OF CHAINEarly DevelopmentsCog ChainCast Detachable ChainCast Pintle ChainPrecision Roller ChainEngineering Steel ChainSilent ChainFlat-Top ChainTerminologyA CHAIN OVERVIEW: USES AND ADVANTAGESGeneralTypes of ChainScope of Chains CoveredStyles and Forms of ChainsStraight and Offset Link ChainsChains With and Without RollersUses of ChainStandard Chains and Their UsesThe Advantages of Chains in ApplicationsAdvantages of Roller Chains in DrivesAdvantages of Silent Chain Drives
Receptive fields selection for binary feature description.
Fan, Bin; Kong, Qingqun; Trzcinski, Tomasz; Wang, Zhiheng; Pan, Chunhong; Fua, Pascal
2014-06-01
Feature description for local image patch is widely used in computer vision. While the conventional way to design local descriptor is based on expert experience and knowledge, learning-based methods for designing local descriptor become more and more popular because of their good performance and data-driven property. This paper proposes a novel data-driven method for designing binary feature descriptor, which we call receptive fields descriptor (RFD). Technically, RFD is constructed by thresholding responses of a set of receptive fields, which are selected from a large number of candidates according to their distinctiveness and correlations in a greedy way. Using two different kinds of receptive fields (namely rectangular pooling area and Gaussian pooling area) for selection, we obtain two binary descriptors RFDR and RFDG .accordingly. Image matching experiments on the well-known patch data set and Oxford data set demonstrate that RFD significantly outperforms the state-of-the-art binary descriptors, and is comparable with the best float-valued descriptors at a fraction of processing time. Finally, experiments on object recognition tasks confirm that both RFDR and RFDG successfully bridge the performance gap between binary descriptors and their floating-point competitors.
Planetary Formation and Dynamics in Binary Systems
Xie, J. W.
2013-01-01
As of today, over 500 exoplanets have been detected since the first exoplanet was discovered around a solar-like star in 1995. The planets in binaries could be common as stars are usually born in binary or multiple star systems. Although current observations show that the planet host rate in multiple star systems is around 17%, this fraction should be considered as a lower limit because of noticeable selection effects against binaries in planet searches. Most of the current known planet-bearing binary systems are S-types, meaning the companion star acts as a distant satellite, typically orbiting the inner star-planet system over 100 AU away. Nevertheless, there are four systems with a smaller separation of 20 AU, including the Gamma Cephei, GJ 86, HD 41004, and HD 196885. In addition to the planets in circumprimary (S-type) orbits discussed above, planets in circumbinary (P-type) orbits have been found in only two systems. In this thesis, we mainly study the planet formation in the S-type binary systems. In chapter 1, we first summarize current observational facts of exoplanets both in single-star and binary systems, then review the theoretical models of planet formation, with special attention to the application in binary systems. Perturbative effects from stellar companions render the planet formation process in binary systems even more complex than that in single-star systems. The perturbations from a binary companion can excite planetesimal orbits, and increase their mutual impact velocities to the values that might exceed their escape velocity or even the critical velocity for the onset of eroding collisions. The intermediate stage of the formation process---from planetesimals to planetary embryos---is thus the most problematic. In the following chapters, we investigate whether and how the planet formation goes through such a problematic stage. In chapter 2, we study the effects of gas dissipation on the planetesimals' mutual accretion. We find that in a
International Nuclear Information System (INIS)
Mayzelis, Z.A.; Apostolov, S.S.; Melnyk, S.S.; Usatenko, O.V.; Yampol'skii, V.A.
2007-01-01
A theory of symbolic dynamic systems with long-range correlations based on the consideration of the binary N-step Markov chains developed earlier in Phys Rev Lett 2003;90:110601 is generalized to the biased case (non-equal numbers of zeros and unities in the chain). In the model, the conditional probability that the ith symbol in the chain equals zero (or unity) is a linear function of the number of unities (zeros) among the preceding N symbols. The correlation and distribution functions as well as the variance of number of symbols in the words of arbitrary length L are obtained analytically and verified by numerical simulations. A self-similarity of the studied stochastic process is revealed and the similarity group transformation of the chain parameters is presented. The diffusion Fokker-Planck equation governing the distribution function of the L-words is explored. If the persistent correlations are not extremely strong, the distribution function is shown to be the Gaussian with the variance being nonlinearly dependent on L. An equation connecting the memory and correlation function of the additive Markov chain is presented. This equation allows reconstructing a memory function using a correlation function of the system. Effectiveness and robustness of the proposed method is demonstrated by simple model examples. Memory functions of concrete coarse-grained literary texts are found and their universal power-law behavior at long distances is revealed
Energy Technology Data Exchange (ETDEWEB)
Mayzelis, Z.A. [Department of Physics, Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine); Apostolov, S.S. [Department of Physics, Kharkov National University, 4 Svoboda Sq., Kharkov 61077 (Ukraine); Melnyk, S.S. [A. Ya. Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine); Usatenko, O.V. [A. Ya. Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine)]. E-mail: usatenko@ire.kharkov.ua; Yampol' skii, V.A. [A. Ya. Usikov Institute for Radiophysics and Electronics, Ukrainian Academy of Science, 12 Proskura Street, 61085 Kharkov (Ukraine)
2007-10-15
A theory of symbolic dynamic systems with long-range correlations based on the consideration of the binary N-step Markov chains developed earlier in Phys Rev Lett 2003;90:110601 is generalized to the biased case (non-equal numbers of zeros and unities in the chain). In the model, the conditional probability that the ith symbol in the chain equals zero (or unity) is a linear function of the number of unities (zeros) among the preceding N symbols. The correlation and distribution functions as well as the variance of number of symbols in the words of arbitrary length L are obtained analytically and verified by numerical simulations. A self-similarity of the studied stochastic process is revealed and the similarity group transformation of the chain parameters is presented. The diffusion Fokker-Planck equation governing the distribution function of the L-words is explored. If the persistent correlations are not extremely strong, the distribution function is shown to be the Gaussian with the variance being nonlinearly dependent on L. An equation connecting the memory and correlation function of the additive Markov chain is presented. This equation allows reconstructing a memory function using a correlation function of the system. Effectiveness and robustness of the proposed method is demonstrated by simple model examples. Memory functions of concrete coarse-grained literary texts are found and their universal power-law behavior at long distances is revealed.
Binary classification posed as a quadratically constrained quadratic ...
Indian Academy of Sciences (India)
Binary classification is posed as a quadratically constrained quadratic problem and solved using the proposed method. Each class in the binary classification problem is modeled as a multidimensional ellipsoid to forma quadratic constraint in the problem. Particle swarms help in determining the optimal hyperplane or ...
The Cool Surfaces of Binaries Near-Earth Asteroids
Delbo, Marco; Walsh, K.; Mueller, M.
2008-01-01
We present results from thermal-infrared observations of binary near-Earth asteroids (NEAs). These objects, in general, have surface temperatures cooler than the average values for non-binary NEAs. We discuss how this may be evidence of higher-than-average surface thermal inertia. The comparison of
The Mass-Ratio Distribution of Visual Binary Stars
Hogeveen, S.J.
1990-01-01
The selection effects that govern the observations of Visual Binary Stars are in- vestigated, in order to obtain a realistic statistical distribution of the mass-ratio q = Msec=Mprim. To this end a numerical simulation programme has been developed, which `generates' binary stars and `looks' at
Evolution of close binaries and the formation of pulsars
International Nuclear Information System (INIS)
Van Den Heuvel, E.P.J.
1981-01-01
The various ways in which compact objects (neutron stars and black holes) may be formed in interacting binary systems are examined. Attention is given to the final evolution of the primary star in a close binary system as a function of the time of Roche-lobe overflow relative to the onset of helium burning, and conditions on primary mass and orbital period leading to the appearance of a compact remnant are noted. Consideration of the fate of the stellar envelope in stars that directly evolve to core collapse indicates that binaries that evolve with conservation of total mass and orbital angular momentum will eventually become systems of two runaway pulsars. In cases of nonconservative evolution, the final state is expected to be a young runaway pulsar with a low- or moderate mass runaway star companion, or a low-mass population I X-ray binary with high space velocity. Compact objects may also be formed when a white dwarf of suitable chemical composition is driven over the Chandrasehkar limit by accretion, resulting in a low-mass X-ray binary
Designing reliable supply chain network with disruption risk
Directory of Open Access Journals (Sweden)
Ali Bozorgi Amiri
2013-01-01
Full Text Available Although supply chains disruptions rarely occur, their negative effects are prolonged and severe. In this paper, we propose a reliable capacitated supply chain network design (RSCND model by considering random disruptions in both distribution centers and suppliers. The proposed model determines the optimal location of distribution centers (DC with the highest reliability, the best plan to assign customers to opened DCs and assigns opened DCs to suitable suppliers with lowest transportation cost. In this study, random disruption occurs at the location, capacity of the distribution centers (DCs and suppliers. It is assumed that a disrupted DC and a disrupted supplier may lose a portion of their capacities, and the rest of the disrupted DC's demand can be supplied by other DCs. In addition, we consider shortage in DCs, which can occur in either normal or disruption conditions and DCs, can support each other in such circumstances. Unlike other studies in the extent of literature, we use new approach to model the reliability of DCs; we consider a range of reliability instead of using binary variables. In order to solve the proposed model for real-world instances, a Non-dominated Sorting Genetic Algorithm-II (NSGA-II is applied. Preliminary results of testing the proposed model of this paper on several problems with different sizes provide seem to be promising.
Binary classification of items of interest in a repeatable process
Abell, Jeffrey A.; Spicer, John Patrick; Wincek, Michael Anthony; Wang, Hui; Chakraborty, Debejyo
2014-06-24
A system includes host and learning machines in electrical communication with sensors positioned with respect to an item of interest, e.g., a weld, and memory. The host executes instructions from memory to predict a binary quality status of the item. The learning machine receives signals from the sensor(s), identifies candidate features, and extracts features from the candidates that are more predictive of the binary quality status relative to other candidate features. The learning machine maps the extracted features to a dimensional space that includes most of the items from a passing binary class and excludes all or most of the items from a failing binary class. The host also compares the received signals for a subsequent item of interest to the dimensional space to thereby predict, in real time, the binary quality status of the subsequent item of interest.
Minimum period and the gap in periods of Cataclysmic binaries
International Nuclear Information System (INIS)
Paczynski, B.; Sienkiewicz, R.
1983-01-01
The 81 minute cutoff to the orbital periods of hydrogen-rich cataclysmic binaries is consistent with evolution of those systems being dominated by angular momentum losses due to gravitational radiation. Unfortunately, many uncertainties, mainly poorly known atmospheric opacities below 2000 K, make is physically impossible to verify the quadrupole formula for gravitational radiation by using the observed cutoff at 81 minutes. The upper boundary of the gap in orbital periods observed at about 3 hours is almost certainly due to enhanced angular momentum losses from cataclysmic binaries which have longer periods. The physical mechanism of those losses is not identified, but a possible importance of stellar winds is pointed out. The lower boundary of the gap may be explained with the oldest cataclysmic binaries, whose periods evolved past the minimum at 81 minutes and reached the value of 2 hours within about 12 x 10 9 years after the binary had formed. Those binaries should have secondary components of only 0.02 solar masses, and their periods could be used to estimate ages of the oldest cataclysmic stars, and presumably the age of Galaxy. An alternative explanation for the gap requires that binaries should be detached while crossing the gap. A possible mechanism for this phenomenon is discussed. It requires the secondary components to be about 0.2 solar masses in the binaries just below the gap
Directory of Open Access Journals (Sweden)
Bruce J. Hrivnak
2012-03-01
Full Text Available Binary companions are often invoked to explain the axial and point symmetry seen in the majority of planetary nebulae and proto-planetary nebulae (PPNs. To explore this hypothesis, we have undertaken a long-term (20 year study of light and velocity variations in PPNs. From the photometric study of 24 PPNs, we find that all vary in brightness, and from a subset of 12 carbon-rich PPNs of F-G spectral type we find periods of 35-155 days, with the cooler having the longer periods. The variations are seen to be due to pulsation; no photometric evidence for binarity is seen. A radial velocity study of a sub-sample of seven of the brightest of these shows that they all vary with the pulsation periods. Only one shows evidence of a longer-term variation that we tentatively identify as being due to a binary companion. We conclude that the present evidence for the binary nature of these PPNs is meager and that any undetected companions of these PPNs must be of low mass ( 30 years.
International Nuclear Information System (INIS)
Vallee, R.L.
1968-01-01
The study of binary groups under their mathematical aspects constitutes the matter of binary analysis, the purpose of which consists in developing altogether simple, rigorous and practical methods needed by the technicians, the engineers and all those who may be mainly concerned by digital processing. This subject, fast extending if not determining, however tends actually to play a main part in nuclear electronics as well as in several other research areas. (authors) [fr
Excess molar volumes and isentropic compressibilities of binary
Indian Academy of Sciences (India)
Excess molar volumes (E) and deviation in isentropic compressibilities (s) have been investigated from the density and speed of sound measurements of six binary liquid mixtures containing -alkanes over the entire range of composition at 298.15 K. Excess molar volume exhibits inversion in sign in one binary ...
Misaligned disks in the binary protostar IRS 43
DEFF Research Database (Denmark)
Brinch, Christian; Jørgensen, Jes Kristian; Hogerheijde, Michiel R.
2016-01-01
and position angle and also with respect to the binary orbital plane. Each stellar component has an associated circumstellar disk while the binary is surrounded by a circumbinary disk. Together with archival VLA measurements of the stellar positions over 25 years, and assuming a circular orbit, we use our...
IUE observations of the eclipsing binary Epsilon Aurigae
International Nuclear Information System (INIS)
Hack, M.; Selvelli, P.L.
1978-01-01
It is stated that the eclipsing binary Epsilon Aur is a most peculiar binary system and it has not been explained satisfactorily. Observations of this system using the International Ultraviolet Explorer (IUE) collected at the Villafranca Satellite Tracking Station of the European Space Agency are here reported. (author)
Binary spectral minutiae representation with multi-sample fusion for fingerprint recognition
Xu, H.; Veldhuis, Raymond N.J.
Biometric fusion is the approach to improve the biometric system performance by combining multiple sources of biometric information. The binary spectral minutiae representation is a method to represent a fingerprint minutiae set as a fixed-length binary string. This binary representation has the
A Search for Exoplanets in Short-Period Binary Star Systems
Directory of Open Access Journals (Sweden)
Ronald Kaitchuck
2012-03-01
Full Text Available This paper reports the progress of a search for exoplanets with S-type orbits in short-period binary star systems. The selected targets have stellar orbital periods of just a few days. These systems are eclipsing binaries so that exoplanet transits, if planets exist, will be highly likely. We report the results for seven binary star systems.
International Nuclear Information System (INIS)
AlTuwaim, Mohammad S.; Alkhaldi, Khaled H.A.E.; Al-Jimaz, Adel S.; Mohammad, Abubaker A.
2013-01-01
Highlights: ► Physical properties of binary mixtures of DMF+1-octanol, 1-nonanol or 1-decanol at different temperatures were investigated. ► Densities, refractive indices and speed of sound were measured. ► V E , K s E , u D and n D E were calculated using the experimental data. ► Speed of sound data were analyzed using different theories and relations. -- Abstract: The density, refractive index and speed of sound for binary mixtures of N,N-dimethylformamide with 1-octanol, 1-nonanol and 1-decanol were measured at several temperatures and atmospheric pressure over the entire range of mole fraction. Excess molar volumes, isentropic and excess isentropic compressibilities, excess refractive indices and deviations in speed of sound for the above systems were calculated from the experimental results. Furthermore, excess properties and deviations in speed of sound were fitted to the Redlich–Kister polynomial. The Lorentz–Lorenz, Dale–Gladstone, Eykman and Arago–Biot mixing rules were used to calculate the refractive indices of the binary mixtures. The speeds of sound have been analyzed in term of Schaaffs’ collision factor theory, Jacobson’s intermolecular free length theory of solutions, Nomoto relation and Van Deal ideal mixture relation. The calculated excess molar properties have been qualitatively used to explain the intermolecular interaction between the mixed components as well as the effects of n-alkanol chain length
KIC 7177553: A QUADRUPLE SYSTEM OF TWO CLOSE BINARIES
Energy Technology Data Exchange (ETDEWEB)
Lehmann, H. [Thüringer Landessternwarte Tautenburg, Sternwarte 5, D-07778 Tautenburg (Germany); Borkovits, T. [Baja Astronomical Observatory of Szeged University, H-6500 Baja, Szegedi út, Kt. 766 (Hungary); Rappaport, S. A. [Massachusetts Institute of Technology, Department of Physics, 77 Massachusetts Avenue, Cambridge, MA 02139-4307 (United States); Ngo, H. [California Institute of Technology, Division of Geological and Planetary Sciences, 1200 E. California Boulevard, MC 150-21, Pasadena, CA 91125 (United States); Mawet, D. [California Institute of Technology, Astronomy Dept. MC 249-17, 1200 E. California Boulevard, Pasadena, CA 91125 (United States); Csizmadia, Sz. [German Aerospace Center (DLR), Institut für Planeten-forschung, Rutherfordstraße 2, D-12489 Berlin (Germany); Forgács-Dajka, E., E-mail: lehm@tls-tautenburg.de, E-mail: borko@electra.bajaobs.hu, E-mail: sar@mit.edu, E-mail: hngo@caltech.edu, E-mail: dmawet@astro.caltech.edu, E-mail: szilard.csizmadia@dlr.de, E-mail: e.forgacs-dajka@astro.elte.hu [Astronomical Department, Eötvös University, H-1118 Budapest, Pázmány Péter stny. 1/A (Hungary)
2016-03-01
KIC 7177553 was observed by the Kepler satellite to be an eclipsing eccentric binary star system with an 18-day orbital period. Recently, an eclipse timing study of the Kepler binaries has revealed eclipse timing variations (ETVs) in this object with an amplitude of ∼100 s and an outer period of 529 days. The implied mass of the third body is that of a super-Jupiter, but below the mass of a brown dwarf. We therefore embarked on a radial velocity (RV) study of this binary to determine its system configuration and to check the hypothesis that it hosts a giant planet. From the RV measurements, it became immediately obvious that the same Kepler target contains another eccentric binary, this one with a 16.5-day orbital period. Direct imaging using adaptive optics reveals that the two binaries are separated by 0.″4 (∼167 AU) and have nearly the same magnitude (to within 2%). The close angular proximity of the two binaries and very similar γ velocities strongly suggest that KIC 7177553 is one of the rare SB4 systems consisting of two eccentric binaries where at least one system is eclipsing. Both systems consist of slowly rotating, nonevolved, solar-like stars of comparable masses. From the orbital separation and the small difference in γ velocity, we infer that the period of the outer orbit most likely lies in the range of 1000–3000 yr. New images taken over the next few years, as well as the high-precision astrometry of the Gaia satellite mission, will allow us to set much narrower constraints on the system geometry. Finally, we note that the observed ETVs in the Kepler data cannot be produced by the second binary. Further spectroscopic observations on a longer timescale will be required to prove the existence of the massive planet.
Geier, S.; Heber, U.; Kupfer, T.; Napiwotzki, R.
2010-01-01
Aims. The ESO SN Ia Progenitor Survey (SPY) aims at finding merging double degenerate binaries as candidates for supernova type Ia (SN Ia) explosions. A white dwarf merger has also been suggested to explain the formation of rare types of stars like R CrB, extreme helium or He sdO stars. Here we present the hot subdwarf B binary GD 687, which will merge in less than a Hubble time. Methods. The orbital parameters of the close binary have been determined from time resolved spectroscopy. Since GD...
Adaptation of Chain Event Graphs for use with Case-Control Studies in Epidemiology.
Keeble, Claire; Thwaites, Peter Adam; Barber, Stuart; Law, Graham Richard; Baxter, Paul David
2017-09-26
Case-control studies are used in epidemiology to try to uncover the causes of diseases, but are a retrospective study design known to suffer from non-participation and recall bias, which may explain their decreased popularity in recent years. Traditional analyses report usually only the odds ratio for given exposures and the binary disease status. Chain event graphs are a graphical representation of a statistical model derived from event trees which have been developed in artificial intelligence and statistics, and only recently introduced to the epidemiology literature. They are a modern Bayesian technique which enable prior knowledge to be incorporated into the data analysis using the agglomerative hierarchical clustering algorithm, used to form a suitable chain event graph. Additionally, they can account for missing data and be used to explore missingness mechanisms. Here we adapt the chain event graph framework to suit scenarios often encountered in case-control studies, to strengthen this study design which is time and financially efficient. We demonstrate eight adaptations to the graphs, which consist of two suitable for full case-control study analysis, four which can be used in interim analyses to explore biases, and two which aim to improve the ease and accuracy of analyses. The adaptations are illustrated with complete, reproducible, fully-interpreted examples, including the event tree and chain event graph. Chain event graphs are used here for the first time to summarise non-participation, data collection techniques, data reliability, and disease severity in case-control studies. We demonstrate how these features of a case-control study can be incorporated into the analysis to provide further insight, which can help to identify potential biases and lead to more accurate study results.
Development Value Chains meet Business Supply Chains : The concept of Global Value Chains unraveled
S. Drost (Sarah); J.C.A.C. van Wijk (Jeroen); S.R. Vellema (Sietze)
2011-01-01
textabstractValue chain promotion is considered a key element of private sector development strategies and pro-poor growth. However, (value) chain concepts are rather complex and unclear. This paper unravels the concept of global value chains and studies the diversity of key value chain-related
Control of broadband optically generated ultrasound pulses using binary amplitude holograms.
Brown, Michael D; Jaros, Jiri; Cox, Ben T; Treeby, Bradley E
2016-04-01
In this work, the use of binary amplitude holography is investigated as a mechanism to focus broadband acoustic pulses generated by high peak-power pulsed lasers. Two algorithms are described for the calculation of the binary holograms; one using ray-tracing, and one using an optimization based on direct binary search. It is shown using numerical simulations that when a binary amplitude hologram is excited by a train of laser pulses at its design frequency, the acoustic field can be focused at a pre-determined distribution of points, including single and multiple focal points, and line and square foci. The numerical results are validated by acoustic field measurements from binary amplitude holograms, excited by a high peak-power laser.
Binary black hole in a double magnetic monopole field
Rodriguez, Maria J.
2018-01-01
Ambient magnetic fields are thought to play a critical role in black hole jet formation. Furthermore, dual electromagnetic signals could be produced during the inspiral and merger of binary black hole systems. In this paper, we derive the exact solution for the electromagnetic field occurring when a static, axisymmetric binary black hole system is placed in the field of two magnetic or electric monopoles. As a by-product of this derivation, we also find the exact solution of the binary black hole configuration in a magnetic or electric dipole field. The presence of conical singularities in the static black hole binaries represent the gravitational attraction between the black holes that also drag the external two monopole field. We show that these off-balance configurations generate no energy outflows.
Binary black hole in a double magnetic monopole field
Energy Technology Data Exchange (ETDEWEB)
Rodriguez, Maria J. [Utah State University, Department of Physics, Logan, UT (United States); Max Planck Institute for Gravitational Physics, Potsdam (Germany)
2018-01-15
Ambient magnetic fields are thought to play a critical role in black hole jet formation. Furthermore, dual electromagnetic signals could be produced during the inspiral and merger of binary black hole systems. In this paper, we derive the exact solution for the electromagnetic field occurring when a static, axisymmetric binary black hole system is placed in the field of two magnetic or electric monopoles. As a by-product of this derivation, we also find the exact solution of the binary black hole configuration in a magnetic or electric dipole field. The presence of conical singularities in the static black hole binaries represent the gravitational attraction between the black holes that also drag the external two monopole field. We show that these off-balance configurations generate no energy outflows. (orig.)
Population of Nuclei Via 7Li-Induced Binary Reactions
International Nuclear Information System (INIS)
Clark, Rodney M.; Phair, Larry W.; Descovich, M.; Cromaz, Mario; Deleplanque, M.A.; Fall on, Paul; Lee, I-Yang; Macchiavelli, A.O.; McMahan, Margaret A.; Moretto, Luciano G.; Rodriguez-Vieitez, E.; Sinha, Shrabani; Stephens, Frank S.; Ward, David; Wiedeking, Mathis
2005-01-01
The authors have investigated the population of nuclei formed in binary reactions involving 7 Li beams on targets of 160 Gd and 184 W. The 7 Li + 184 W data were taken in the first experiment using the LIBERACE Ge-array in combination with the STARS Si ΔE-E telescope system at the 88-Inch Cyclotron of the Lawrence Berkeley National Laboratory. By using the Wilczynski binary transfer model, in combination with a standard evaporation model, they are able to reproduce the experimental results. This is a useful method for predicting the population of neutron-rich heavy nuclei formed in binary reactions involving beams of weakly bound nuclei formed in binary reactions involving beams of weakly bound nuclei and will be of use in future spectroscopic studies
Numerical Simulations of Wind Accretion in Symbiotic Binaries
de Val-Borro, M.; Karovska, M.; Sasselov, D.
2009-08-01
About half of the binary systems are close enough to each other for mass to be exchanged between them at some point in their evolution, yet the accretion mechanism in wind accreting binaries is not well understood. We study the dynamical effects of gravitational focusing by a binary companion on winds from late-type stars. In particular, we investigate the mass transfer and formation of accretion disks around the secondary in detached systems consisting of an asymptotic giant branch (AGB) mass-losing star and an accreting companion. The presence of mass outflows is studied as a function of mass-loss rate, wind temperature, and binary orbital parameters. A two-dimensional hydrodynamical model is used to study the stability of mass transfer in wind accreting symbiotic binary systems. In our simulations we use an adiabatic equation of state and a modified version of the isothermal approximation, where the temperature depends on the distance from the mass losing star and its companion. The code uses a block-structured adaptive mesh refinement method that allows us to have high resolution at the position of the secondary and resolve the formation of bow shocks and accretion disks. We explore the accretion flow between the components and formation of accretion disks for a range of orbital separations and wind parameters. Our results show the formation of stream flow between the stars and accretion disks of various sizes for certain orbital configurations. For a typical slow and massive wind from an AGB star the flow pattern is similar to a Roche lobe overflow with accretion rates of 10% of the mass loss from the primary. Stable disks with exponentially decreasing density profiles and masses of the order 10-4 solar masses are formed when wind acceleration occurs at several stellar radii. The disks are geometrically thin with eccentric streamlines and close to Keplerian velocity profiles. The formation of tidal streams and accretion disks is found to be weakly dependent on
NUMERICAL SIMULATIONS OF WIND ACCRETION IN SYMBIOTIC BINARIES
International Nuclear Information System (INIS)
De Val-Borro, M.; Karovska, M.; Sasselov, D.
2009-01-01
About half of the binary systems are close enough to each other for mass to be exchanged between them at some point in their evolution, yet the accretion mechanism in wind accreting binaries is not well understood. We study the dynamical effects of gravitational focusing by a binary companion on winds from late-type stars. In particular, we investigate the mass transfer and formation of accretion disks around the secondary in detached systems consisting of an asymptotic giant branch (AGB) mass-losing star and an accreting companion. The presence of mass outflows is studied as a function of mass-loss rate, wind temperature, and binary orbital parameters. A two-dimensional hydrodynamical model is used to study the stability of mass transfer in wind accreting symbiotic binary systems. In our simulations we use an adiabatic equation of state and a modified version of the isothermal approximation, where the temperature depends on the distance from the mass losing star and its companion. The code uses a block-structured adaptive mesh refinement method that allows us to have high resolution at the position of the secondary and resolve the formation of bow shocks and accretion disks. We explore the accretion flow between the components and formation of accretion disks for a range of orbital separations and wind parameters. Our results show the formation of stream flow between the stars and accretion disks of various sizes for certain orbital configurations. For a typical slow and massive wind from an AGB star the flow pattern is similar to a Roche lobe overflow with accretion rates of 10% of the mass loss from the primary. Stable disks with exponentially decreasing density profiles and masses of the order 10 -4 solar masses are formed when wind acceleration occurs at several stellar radii. The disks are geometrically thin with eccentric streamlines and close to Keplerian velocity profiles. The formation of tidal streams and accretion disks is found to be weakly dependent
Dynamical evolution of a fictitious population of binary Neptune Trojans
Brunini, Adrián
2018-03-01
We present numerical simulations of the evolution of a synthetic population of Binary Neptune Trojans, under the influence of the solar perturbations and tidal friction (the so-called Kozai cycles and tidal friction evolution). Our model includes the dynamical influence of the four giant planets on the heliocentric orbit of the binary centre of mass. In this paper, we explore the evolution of initially tight binaries around the Neptune L4 Lagrange point. We found that the variation of the heliocentric orbital elements due to the libration around the Lagrange point introduces significant changes in the orbital evolution of the binaries. Collisional processes would not play a significant role in the dynamical evolution of Neptune Trojans. After 4.5 × 109 yr of evolution, ˜50 per cent of the synthetic systems end up separated as single objects, most of them with slow diurnal rotation rate. The final orbital distribution of the surviving binary systems is statistically similar to the one found for Kuiper Belt Binaries when collisional evolution is not included in the model. Systems composed by a primary and a small satellite are more fragile than the ones composed by components of similar sizes.
EFFICIENT MERGER OF BINARY SUPERMASSIVE BLACK HOLES IN MERGING GALAXIES
International Nuclear Information System (INIS)
Khan, Fazeel Mahmood; Just, Andreas; Merritt, David
2011-01-01
In spherical galaxies, binary supermassive black holes (SMBHs) have difficulty reaching sub-parsec separations due to depletion of stars on orbits that intersect the massive binary-the 'final parsec problem'. Galaxies that form via major mergers are substantially non-spherical, and it has been argued that the centrophilic orbits in triaxial galaxies might provide stars to the massive binary at a high enough rate to avoid stalling. Here we test that idea by carrying out fully self-consistent merger simulations of galaxies containing central SMBHs. We find hardening rates of the massive binaries that are indeed much higher than in spherical models and essentially independent of the number of particles used in the simulations. Binary eccentricities remain high throughout the simulations. Our results constitute a fully stellar-dynamical solution to the final parsec problem and imply a potentially high rate of events for low-frequency gravitational wave detectors like LISA.
Applications Of Binary Image Analysis Techniques
Tropf, H.; Enderle, E.; Kammerer, H. P.
1983-10-01
After discussing the conditions where binary image analysis techniques can be used, three new applications of the fast binary image analysis system S.A.M. (Sensorsystem for Automation and Measurement) are reported: (1) The human view direction is measured at TV frame rate while the subject's head is free movable. (2) Industrial parts hanging on a moving conveyor are classified prior to spray painting by robot. (3) In automotive wheel assembly, the eccentricity of the wheel is minimized by turning the tyre relative to the rim in order to balance the eccentricity of the components.
UNUSUALLY WIDE BINARIES: ARE THEY WIDE OR UNUSUAL?
International Nuclear Information System (INIS)
Kraus, Adam L.; Hillenbrand, Lynne A.
2009-01-01
We describe an astrometric and spectroscopic campaign to confirm the youth and association of a complete sample of candidate wide companions in Taurus and Upper Sco. Our survey found 15 new binary systems (three in Taurus and 12 in Upper Sco) with separations of 3''-30'' (500-5000 AU) among all of the known members with masses of 2.5-0.012 M sun . The total sample of 49 wide systems in these two regions conforms to only some expectations from field multiplicity surveys. Higher mass stars have a higher frequency of wide binary companions, and there is a marked paucity of wide binary systems near the substellar regime. However, the separation distribution appears to be log-flat, rather than declining as in the field, and the mass ratio distribution is more biased toward similar-mass companions than the initial mass function or the field G-dwarf distribution. The maximum separation also shows no evidence of a limit at ∼ sun . We attribute this result to the post-natal dynamical sculpting that occurs for most field systems; our binary systems will escape to the field intact, but most field stars are formed in denser clusters and undergo significant dynamical evolution. In summary, only wide binary systems with total masses ∼ sun appear to be 'unusually wide'.
High-energy gamma-ray emission in compact binaries
International Nuclear Information System (INIS)
Cerutti, Benoit
2010-01-01
Four gamma-ray sources have been associated with binary systems in our Galaxy: the micro-quasar Cygnus X-3 and the gamma-ray binaries LS I +61 degrees 303, LS 5039 and PSR B1259-63. These systems are composed of a massive companion star and a compact object of unknown nature, except in PSR B1259-63 where there is a young pulsar. I propose a comprehensive theoretical model for the high-energy gamma-ray emission and variability in gamma-ray emitting binaries. In this model, the high-energy radiation is produced by inverse Compton scattering of stellar photons on ultra-relativistic electron-positron pairs injected by a young pulsar in gamma-ray binaries and in a relativistic jet in micro-quasars. Considering anisotropic inverse Compton scattering, pair production and pair cascade emission, the TeV gamma-ray emission is well explained in LS 5039. Nevertheless, this model cannot account for the gamma-ray emission in LS I +61 degrees 303 and PSR B1259-63. Other processes should dominate in these complex systems. In Cygnus X-3, the gamma-ray radiation is convincingly reproduced by Doppler-boosted Compton emission of pairs in a relativistic jet. Gamma-ray binaries and micro-quasars provide a novel environment for the study of pulsar winds and relativistic jets at very small spatial scales. (author)
International Nuclear Information System (INIS)
Bardalez Gagliuffi, Daniella C.; Burgasser, Adam J.; Nicholls, Christine P.; Gelino, Christopher R.; Looper, Dagny L.; Schmidt, Sarah J.; Cruz, Kelle; West, Andrew A.; Gizis, John E.; Metchev, Stanimir
2014-01-01
Multiplicity is a key statistic for understanding the formation of very low mass (VLM) stars and brown dwarfs. Currently, the separation distribution of VLM binaries remains poorly constrained at small separations (≤1 AU), leading to uncertainty in the overall binary fraction. We approach this problem by searching for late-M/early-L plus T dwarf spectral binaries whose combined light spectra exhibit distinct peculiarities, allowing for separation-independent identification. We define a set of spectral indices designed to identify these systems, and we use a spectral template fitting method to confirm and characterize spectral binary candidates from a library of 815 spectra from the SpeX Prism Spectral Libraries. We present 11 new binary candidates, confirm 3 previously reported candidates, and rule out 2 previously identified candidates, all with primary and secondary spectral types in the range M7-L7 and T1-T8, respectively. We find that subdwarfs and blue L dwarfs are the primary contaminants in our sample and propose a method for segregating these sources. If confirmed by follow-up observations, these systems may add to the growing list of tight separation binaries, whose orbital properties may yield further insight into brown dwarf formation scenarios.
Gravitational waveforms for neutron star binaries from binary black hole simulations
Barkett, Kevin; Scheel, Mark; Haas, Roland; Ott, Christian; Bernuzzi, Sebastiano; Brown, Duncan; Szilagyi, Bela; Kaplan, Jeffrey; Lippuner, Jonas; Muhlberger, Curran; Foucart, Francois; Duez, Matthew
2016-03-01
Gravitational waves from binary neutron star (BNS) and black-hole/neutron star (BHNS) inspirals are primary sources for detection by the Advanced Laser Interferometer Gravitational-Wave Observatory. The tidal forces acting on the neutron stars induce changes in the phase evolution of the gravitational waveform, and these changes can be used to constrain the nuclear equation of state. Current methods of generating BNS and BHNS waveforms rely on either computationally challenging full 3D hydrodynamical simulations or approximate analytic solutions. We introduce a new method for computing inspiral waveforms for BNS/BHNS systems by adding the post-Newtonian (PN) tidal effects to full numerical simulations of binary black holes (BBHs), effectively replacing the non-tidal terms in the PN expansion with BBH results. Comparing a waveform generated with this method against a full hydrodynamical simulation of a BNS inspiral yields a phase difference of < 1 radian over ~ 15 orbits. The numerical phase accuracy required of BNS simulations to measure the accuracy of the method we present here is estimated as a function of the tidal deformability parameter λ.
Creation of an anti-imaging system using binary optics
Wang, Haifeng; Lin, Jian; Zhang, Dawei; Wang, Yang; Gu, Min; Urbach, H. P.; Gan, Fuxi; Zhuang, Songlin
2016-01-01
We present a concealing method in which an anti-point spread function (APSF) is generated using binary optics, which produces a large-scale dark area in the focal region that can hide any object located within it. This result is achieved by generating two identical PSFs of opposite signs, one consisting of positive electromagnetic waves from the zero-phase region of the binary optical element and the other consisting of negative electromagnetic waves from the pi-phase region of the binary optical element. PMID:27620068
Non-binary Hybrid LDPC Codes: Structure, Decoding and Optimization
Sassatelli, Lucile; Declercq, David
2007-01-01
In this paper, we propose to study and optimize a very general class of LDPC codes whose variable nodes belong to finite sets with different orders. We named this class of codes Hybrid LDPC codes. Although efficient optimization techniques exist for binary LDPC codes and more recently for non-binary LDPC codes, they both exhibit drawbacks due to different reasons. Our goal is to capitalize on the advantages of both families by building codes with binary (or small finite set order) and non-bin...
Improvement of Binary Analysis Components in Automated Malware Analysis Framework
2017-02-21
AFRL-AFOSR-JP-TR-2017-0018 Improvement of Binary Analysis Components in Automated Malware Analysis Framework Keiji Takeda KEIO UNIVERSITY Final...TYPE Final 3. DATES COVERED (From - To) 26 May 2015 to 25 Nov 2016 4. TITLE AND SUBTITLE Improvement of Binary Analysis Components in Automated Malware ...analyze malicious software ( malware ) with minimum human interaction. The system autonomously analyze malware samples by analyzing malware binary program
ILLUMINATING BLACK HOLE BINARY FORMATION CHANNELS WITH SPINS IN ADVANCED LIGO
Energy Technology Data Exchange (ETDEWEB)
Rodriguez, Carl L. [MIT-Kavli Institute for Astrophysics and Space Research, 77 Massachusetts Avenue, 37-664H, Cambridge, MA 02139 (United States); Zevin, Michael; Pankow, Chris; Kalogera, Vasilliki; Rasio, Frederic A. [Center for Interdisciplinary Exploration and Research in Astrophysics (CIERA) and Department of Physics and Astronomy, Northwestern University, 2145 Sheridan Road, Evanston, IL 60208 (United States)
2016-11-20
The recent detections of the binary black hole mergers GW150914 and GW151226 have inaugurated the field of gravitational-wave astronomy. For the two main formation channels that have been proposed for these sources, isolated binary evolution in galactic fields and dynamical formation in dense star clusters, the predicted masses and merger rates overlap significantly, complicating any astrophysical claims that rely on measured masses alone. Here, we examine the distribution of spin–orbit misalignments expected for binaries from the field and from dense star clusters. Under standard assumptions for black hole natal kicks, we find that black hole binaries similar to GW150914 could be formed with significant spin–orbit misalignment only through dynamical processes. In particular, these heavy-black hole binaries can only form with a significant spin–orbit anti -alignment in the dynamical channel. Our results suggest that future detections of merging black hole binaries with measurable spins will allow us to identify the main formation channel for these systems.
White dwarf-red dwarf binaries in the Galaxy
Besselaar, E.J.M. van den
2007-01-01
This PhD thesis shows several studies on white dwarf - red dwarf binaries. White dwarfs are the end products of most stars and red dwarfs are normal hydrogen burning low-mass stars. White dwarf - red dwarf binaries are both blue (white dwarf) and red (red dwarf). Together with the fact that they are
Kalogera, Vassiliki; Webbink, Ronald F.
1998-01-01
We study the formation of low-mass X-ray binaries (LMXBs) through helium star supernovae in binary systems that have each emerged from a common envelope phase. LMXB progenitors must satisfy a large number of evolutionary and structural constraints, including survival through common envelope evolution, through the post-common envelope phase, where the precursor of the neutron star becomes a Wolf-Rayet star, and survival through the supernova event. Furthermore, the binaries that survive the explosion must reach interaction within a Hubble time and must satisfy stability criteria for mass transfer. These constraints, imposed under the assumption of a symmetric supernova explosion, prohibit the formation of short-period LMXBs transferring mass at sub-Eddington rates through any channel in which the intermediate progenitor of the neutron star is not completely degenerate. Barring accretion-induced collapse, the existence of such systems therefore requires that natal kicks be imparted to neutron stars. We use an analytical method to synthesize the distribution of nascent LMXBs over donor masses and orbital periods and evaluate their birthrate and systemic velocity dispersion. Within the limitations imposed by observational incompleteness and selection effects, and our neglect of secular evolution in the LMXB state, we compare our results with observations. However, our principal objective is to evaluate how basic model parameters (common envelope ejection efficiency, rms kick velocity, primordial mass ratio distribution) influence these results. We conclude that the characteristics of newborn LMXBs are primarily determined by age and stability constraints and the efficiency of magnetic braking and are largely independent of the primordial binary population and the evolutionary history of LMXB progenitors (except for extreme values of the average kick magnitude or of the common envelope ejection efficiency). Theoretical estimates of total LMXB birthrates are not credible
Multi-Messenger Astronomy: White Dwarf Binaries, LISA and GAIA
Bueno, Michael; Breivik, Katelyn; Larson, Shane L.
2017-01-01
The discovery of gravitational waves has ushered in a new era in astronomy. The low-frequency band covered by the future LISA detector provides unprecedented opportunities for multi-messenger astronomy. With the Global Astrometric Interferometer for Astrophysics (GAIA) mission, we expect to discover about 1,000 eclipsing binary systems composed of a WD and a main sequence star - a sizeable increase from the approximately 34 currently known binaries of this type. In advance of the first GAIA data release and the launch of LISA within the next decade, we used the Binary Stellar Evolution (BSE) code simulate the evolution of White Dwarf Binaries (WDB) in a fixed galaxy population of about 196,000 sources. Our goal is to assess the detectability of a WDB by LISA and GAIA using the parameters from our population synthesis, we calculate GW strength h, and apparent GAIA magnitude G. We can then use a scale factor to make a prediction of how many multi- messenger sources we expect to be detectable by both LISA and GAIA in a galaxy the size of the Milky Way. We create binaries 10 times to ensure randomness in distance assignment and average our results. We then determined whether or not astronomical chirp is the difference between the total chirp and the GW chirp. With Astronomical chirp and simulations of mass transfer and tides, we can gather more information about the internal astrophysics of stars in ultra-compact binary systems.
STRUCTURE AND EVOLUTION OF CIRCUMBINARY DISKS AROUND SUPERMASSIVE BLACK HOLE BINARIES
International Nuclear Information System (INIS)
Rafikov, Roman R.
2013-01-01
We explore properties of circumbinary disks around supermassive black hole (SMBH) binaries in centers of galaxies by reformulating standard viscous disk evolution in terms of the viscous angular momentum flux F J . If the binary stops gas inflow and opens a cavity in the disk, then the inner disk evolves toward a constant-F J (rather than a constant M-dot ) state. We compute disk properties in different physical regimes relevant for SMBH binaries, focusing on the gas-assisted evolution of systems starting at separations 10 –4 – 10 –2 pc, and find the following. (1) Mass pileup at the inner disk edge caused by the tidal barrier accelerates binary inspiral. (2) Binaries can be forced to merge even by a disk with a mass below that of the secondary. (3) Torque on the binary is set non-locally, at radii far larger than the binary semi-major axis; its magnitude does not reflect disk properties in the vicinity of the binary. (4) Binary inspiral exhibits hysteresis—it depends on the past evolution of the disk. (5) The Eddington limit can be important for circumbinary disks even if they accrete at sub-Eddington rates, but only at late stages of the inspiral. (6) Gas overflow across the orbit of the secondary can be important for low secondary mass, high- M-dot systems, but mainly during the inspiral phase dominated by the gravitational wave emission. (7) Circumbinary disks emit more power and have harder spectra than constant M-dot disks; their spectra are very sensitive to the amount of overflow across the secondary orbit
DOUBLE-LINED SPECTROSCOPIC BINARY STARS IN THE RAVE SURVEY
International Nuclear Information System (INIS)
Matijevic, G.; Zwitter, T.; Munari, U.; Siviero, A.; Bienayme, O.; Siebert, A.; Binney, J.; Bland-Hawthorn, J.; Boeche, C.; Steinmetz, M.; Campbell, R.; Freeman, K. C.; Gibson, B.; Gilmore, G.; Grebel, E. K.; Helmi, A.; Navarro, J. F.; Parker, Q. A.; Seabroke, G. M.; Watson, F. G.
2010-01-01
We devise a new method for the detection of double-lined binary stars in a sample of the Radial Velocity Experiment (RAVE) survey spectra. The method is both tested against extensive simulations based on synthetic spectra and compared to direct visual inspection of all RAVE spectra. It is based on the properties and shape of the cross-correlation function, and is able to recover ∼80% of all binaries with an orbital period of order 1 day. Systems with periods up to 1 yr are still within the detection reach. We have applied the method to 25,850 spectra of the RAVE second data release and found 123 double-lined binary candidates, only eight of which are already marked as binaries in the SIMBAD database. Among the candidates, there are seven that show spectral features consistent with the RS CVn type (solar type with active chromosphere) and seven that might be of W UMa type (over-contact binaries). One star, HD 101167, seems to be a triple system composed of three nearly identical G-type dwarfs. The tested classification method could also be applicable to the data of the upcoming Gaia mission.
EVOLUTION OF A RING AROUND THE PLUTO–CHARON BINARY
Energy Technology Data Exchange (ETDEWEB)
Bromley, Benjamin C. [Department of Physics and Astronomy, University of Utah, 115 S 1400 E, Rm 201, Salt Lake City, UT 84112 (United States); Kenyon, Scott J., E-mail: bromley@physics.utah.edu, E-mail: skenyon@cfa.harvard.edu [Smithsonian Astrophysical Observatory, 60 Garden St., Cambridge, MA 02138 (United States)
2015-08-10
We consider the formation of satellites around the Pluto–Charon binary. An early collision between the two partners likely produced the binary and a narrow ring of debris, out of which arose the moons Styx, Nix, Kerberos, and Hydra. How the satellites emerged from the compact ring is uncertain. Here we show that a particle ring spreads from physical collisions and collective gravitational scattering, similar to migration. Around a binary, these processes take place in the reference frames of “most circular” orbits, akin to circular ones in a Keplerian potential. Ring particles damp to these orbits and avoid destructive collisions. Damping and diffusion also help particles survive dynamical instabilities driven by resonances with the binary. In some situations, particles become trapped near resonances that sweep outward with the tidal evolution of the Pluto–Charon binary. With simple models and numerical experiments, we show how the Pluto–Charon impact ring may have expanded into a broad disk, out of which grew the circumbinary moons. In some scenarios, the ring can spread well beyond the orbit of Hydra, the most distant moon, to form a handful of smaller satellites. If these small moons exist, New Horizons will find them.
SUPPLY CHAIN STRATEGIES IN THE CONTEXT OF AN E-COMMERCE CHAIN (E-CHAIN
Directory of Open Access Journals (Sweden)
João Gilberto Mendes do Reis
2014-05-01
Full Text Available This paper purpose to explore the relationships between supply chain strategies and product performance in retail e-commerce. In this case, we concern that in current, in order to bear up under competition, organizations have to manage their supply chains so that they meet the needs of their final customers. With this concept in mind, the research presented in this study focuses on establishing the right strategy for supply chains according to their product segment. Thus, after a Literature Review, the paper explain a methodology based in different authors studies. Finally the article focuses on a pratical case in e-commerce retail that describes its application in this field. The research shows that it is possible to use a methodology for classifying supply chains using chain strategies and product features. The use of the right strategy for supply chains will improve the competitive advantage of businesses. One limitation is that the methodology study focuses on only two e-commerce segment; future studies may go further in refining the proposed framework for other segments. The aim of this research is to offer businesses a model for evaluating supply chains, allowing them to improve the performance of their products and services by using the right strategy for supply chains. The classification proposal of this paper presents an original model for classification of supply chains based on different studies on the theme.
Wide Binaries in TGAS: Search Method and First Results
Andrews, Jeff J.; Chanamé, Julio; Agüeros, Marcel A.
2018-04-01
Half of all stars reside in binary systems, many of which have orbital separations in excess of 1000 AU. Such binaries are typically identified in astrometric catalogs by matching the proper motions vectors of close stellar pairs. We present a fully Bayesian method that properly takes into account positions, proper motions, parallaxes, and their correlated uncertainties to identify widely separated stellar binaries. After applying our method to the >2 × 106 stars in the Tycho-Gaia astrometric solution from Gaia DR1, we identify over 6000 candidate wide binaries. For those pairs with separations less than 40,000 AU, we determine the contamination rate to be ~5%. This sample has an orbital separation (a) distribution that is roughly flat in log space for separations less than ~5000 AU and follows a power law of a -1.6 at larger separations.
Detecting unresolved binary stars in Euclid VIS images
Kuntzer, T.; Courbin, F.
2017-10-01
Measuring a weak gravitational lensing signal to the level required by the next generation of space-based surveys demands exquisite reconstruction of the point-spread function (PSF). However, unresolved binary stars can significantly distort the PSF shape. In an effort to mitigate this bias, we aim at detecting unresolved binaries in realistic Euclid stellar populations. We tested methods in numerical experiments where (I) the PSF shape is known to Euclid requirements across the field of view; and (II) the PSF shape is unknown. We drew simulated catalogues of PSF shapes for this proof-of-concept paper. Following the Euclid survey plan, the objects were observed four times. We propose three methods to detect unresolved binary stars. The detection is based on the systematic and correlated biases between exposures of the same object. One method is a simple correlation analysis, while the two others use supervised machine-learning algorithms (random forest and artificial neural network). In both experiments, we demonstrate the ability of our methods to detect unresolved binary stars in simulated catalogues. The performance depends on the level of prior knowledge of the PSF shape and the shape measurement errors. Good detection performances are observed in both experiments. Full complexity, in terms of the images and the survey design, is not included, but key aspects of a more mature pipeline are discussed. Finding unresolved binaries in objects used for PSF reconstruction increases the quality of the PSF determination at arbitrary positions. We show, using different approaches, that we are able to detect at least binary stars that are most damaging for the PSF reconstruction process. The code corresponding to the algorithms used in this work and all scripts to reproduce the results are publicly available from a GitHub repository accessible via http://lastro.epfl.ch/software
What fraction of white dwarfs are members of binary systems?
International Nuclear Information System (INIS)
Holberg, J B
2009-01-01
White dwarfs were originally discovered as the subordinate faint companions of bright nearby stars (i.e. Sirius B and 40 Eri B). Several general categories of binary systems involving white dwarfs are recognized: Sirius-like systems, where the white dwarf may be difficult to detect, binary systems containing white dwarfs and low mass stars, where the white dwarf is often readily discerned; and double degenerate systems. Different modes of white dwarf discovery influence our perception of both the overall binary fraction and the nature of these systems; proper motion surveys emphasize resolved systems, while photometric surveys emphasize unresolved systems containing relatively hot white dwarfs. Recent studies of the local white dwarf population offer some hope of achieving realistic estimates of the relative number of binary systems containing white dwarfs. A sample of 132 white dwarfs within 20 pc indicates that an individual white dwarf has a probability of 32 ± 8% of occurring within a binary or multiple star system.
Near-Infrared Polarimetry of the GG Tauri A Binary System
Itoh, Yoichi; Oasa, Yumiko; Kudo, Tomoyuki; Kusakabe, Nobuhiko; Hashimoto, Jun; Abe, Lyu; Brandner, Wolfgang; Brandt, Timothy D.; Carson, Joseph C.; Egner, Sebastian;
2014-01-01
A high angular resolution near-infrared image that shows the intensity of polarization for the GG Tau A binary system was obtained with the Subaru Telescope. The image shows a circumbinary disk scattering the light from the central binary. The azimuthal profile of the intensity of polarization for the circumbinary disk is roughly reproduced by a simple disk model with the Henyey-Greenstein phase function and the Rayleigh function, indicating there are small dust grains at the surface of the disk. Combined with a previous observation of the circumbinary disk, our image indicates that the gap structure in the circumbinary disk orbits counterclockwise, but material in the disk orbits clockwise. We propose that there is a shadow caused by material located between the central binary and the circumbinary disk. The separations and position angles of the stellar components of the binary in the past 20 yr are consistent with the binary orbit with a = 33.4 AU and e = 0.34.
Presence of mixed modes in red giants in binary systems
Directory of Open Access Journals (Sweden)
Themeßl Nathalie
2017-01-01
Full Text Available The frequencies of oscillation modes in stars contain valueable information about the stellar properties. In red giants the frequency spectrum also contains mixed modes, with both pressure (p and gravity (g as restoring force, which are key to understanding the physical conditions in the stellar core. We observe a high fraction of red giants in binary systems, for which g-dominated mixed modes are not pronounced. This trend leads us to investigate whether this is specific for binary systems or a more general feature. We do so by comparing the fraction of stars with only p-dominated mixed modes in binaries and in a larger set of stars from the APOKASC sample. We find only p-dominated mixed modes in about 50% of red giants in detached eclipsing binaries compared to about 4% in the large sample. This could indicate that this phenomenon is tightly related to binarity and that the binary fraction in the APOKASC sample is about 8%.
Estimation of the Ideal Binary Mask using Directional Systems
DEFF Research Database (Denmark)
Boldt, Jesper; Kjems, Ulrik; Pedersen, Michael Syskind
2008-01-01
The ideal binary mask is often seen as a goal for time-frequency masking algorithms trying to increase speech intelligibility, but the required availability of the unmixed signals makes it difficult to calculate the ideal binary mask in any real-life applications. In this paper we derive the theory...... and the requirements to enable calculations of the ideal binary mask using a directional system without the availability of the unmixed signals. The proposed method has a low complexity and is verified using computer simulation in both ideal and non-ideal setups showing promising results....
Directory of Open Access Journals (Sweden)
M. I. Baranov
2017-10-01
Full Text Available Purpose. Description of construction and basic technical descriptions developed and created in Research & Design Institute «Molniya» National Technical University «Kharkiv Polytechnic Institute» high-voltage heavy-current coaxial disk shunt of type of SC-300M2, allowing reliably to measure the peak-temporal parameters (PTP of impulses of current of artificial lightning in wide peak and temporal ranges with the integral of their action to 15·106 J/Ohm. Methodology. Electrophysics bases of high-voltage impulsive technique, scientific and technical bases of development and creation of high-voltage heavy-current impulsive electrical equipment, including the powerful generators of current of lightning (GCL, and also measuring methods in bit chains powerful high-voltage GCL AVP large impulsive currents of micro- and millisecond temporal ranges. Results. Offered and described new construction of measuring high-voltage heavy-current shunt, containing a measuring round disk from stainless steel easily soiled a 12Х18Н10Т thickness 2 mm and external diameter 80 mm. Experimental a way impulsive active resistance of RS≈0,08 mOhm of the indicated measuring disk and on his basis a calculation coefficient transformation is found of SS of coaxial disk shunt of type of SC-300M2, numeral equal in the concerted mode of operations of his coaxial cable line (CCL SS≈2/RS≈25·103 A/V. It is rotined that it is expedient to use this value SS for measuring in the heavy-current bit chain of GCL ATP impulsive A- and repeated impulsive D- component of current of artificial lightning, and also ATP of aperiodic impulse of current of artificial lightning of temporal form 10 μc/350 μc. It is set that taking into account application in the end CCL of shunt of a co-ordinate divizor of voltage with two output coaxial sockets 1:1 (for SSA≈25·103 A/V and 1:2 (SSC≈12,5·103 A/V at measuring of ATP intermediate B-, protracted C- and shortened protracted C
Binary Stochastic Representations for Large Multi-class Classification
Gerald, Thomas
2017-10-23
Classification with a large number of classes is a key problem in machine learning and corresponds to many real-world applications like tagging of images or textual documents in social networks. If one-vs-all methods usually reach top performance in this context, these approaches suffer of a high inference complexity, linear w.r.t. the number of categories. Different models based on the notion of binary codes have been proposed to overcome this limitation, achieving in a sublinear inference complexity. But they a priori need to decide which binary code to associate to which category before learning using more or less complex heuristics. We propose a new end-to-end model which aims at simultaneously learning to associate binary codes with categories, but also learning to map inputs to binary codes. This approach called Deep Stochastic Neural Codes (DSNC) keeps the sublinear inference complexity but do not need any a priori tuning. Experimental results on different datasets show the effectiveness of the approach w.r.t. baseline methods.
A BiCMOS Binary Hysteresis Chaos Generator
Ahmadi, S.; Newcomb, R. W.
A previous op-amp RC circuit which was proven to give chaotic signals is converted to a BiCMOS design more suitable to integrated circuit realization. The structure results from a degree two differential equation which includes binary hysteresis as its nonlinearity. The circuit is realized by differential (voltage to current) pairs feeding two capacitors, which carry the dynamics, with the key component being a (voltage to current) binary hysteresis circuit due to Linares.
BINARY CANDIDATES IN THE JOVIAN TROJAN AND HILDA POPULATIONS FROM NEOWISE LIGHT CURVES
Energy Technology Data Exchange (ETDEWEB)
Sonnett, S.; Mainzer, A.; Masiero, J.; Bauer, J. [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Grav, T., E-mail: Sarah.Sonnett@jpl.nasa.gov [Planetary Science Institute, Tucson, AZ (United States)
2015-02-01
Determining the binary fraction for a population of asteroids, particularly as a function of separation between the two components, helps describe the dynamical environment at the time the binaries formed, which in turn offers constraints on the dynamical evolution of the solar system. We searched the NEOWISE archival data set for close and contact binary Trojans and Hildas via their diagnostically large light curve amplitudes. We present 48 out of 554 Hilda and 34 out of 953 Trojan binary candidates in need of follow-up to confirm their large light curve amplitudes and subsequently constrain the binary orbit and component sizes. From these candidates, we calculate a preliminary estimate of the binary fraction without confirmation or debiasing of 14%-23% for Trojans larger than ∼12 km and 30%-51% for Hildas larger than ∼4 km. Once the binary candidates have been confirmed, it should be possible to infer the underlying, debiased binary fraction through estimation of survey biases.
Binary encounter electron production in ion-atom collisions
International Nuclear Information System (INIS)
Grabbe, S.; Bhalla, C.P.; Shingal, R.
1993-01-01
The binary encounter electrons are produced by hard collisions between the target electrons and the energetic projectiles. Richard et al. found the measured double differential cross section for BEe production at zero degree laboratory scattering angle, in collisions of F q+ with H 2 and He targets, to increase as the charge state of the projectile was decreased. The binary encounter electron production has recently been a subject of detailed investigations. We have calculated the differential elastic scattering cross sections of electrons from several ions incorporating the exchange contribution of the continuum and the bound orbitals in addition to the static potential. The double differential binary encounter electron production cross sections are presented using the impulse approximation
DSIbin : Identifying dynamic data structures in C/C++ binaries
Rupprecht, Thomas; Chen, Xi; White, David H.; Boockmann, Jan H.; Luttgen, Gerald; Bos, Herbert
2017-01-01
Reverse engineering binary code is notoriously difficult and, especially, understanding a binary's dynamic data structures. Existing data structure analyzers are limited wrt. program comprehension: they do not detect complex structures such as skip lists, or lists running through nodes of different
Particle acceleration in binaries
Directory of Open Access Journals (Sweden)
Sinitsyna V.G.
2017-01-01
Full Text Available Cygnus X-3 massive binary system is one of the powerful sources of radio and X-ray emission consisting of an accreting compact object, probably a black hole, with a Wolf-Rayet star companion. Based on the detections of ultra high energy gamma-rays by Kiel and Havera Park, Cygnus X-3 has been proposed to be one of the most powerful sources of charged cosmic ray particles in the Galaxy. The results of long-term observations of the Cyg X-3 binary at energies 800 GeV–85 TeV detected by SHALON in 1995 are presented with images, integral spectra and spectral energy distribution. The identification of source with Cygnus X-3 detected by SHALON was secured by the detection of its 4.8 hour orbital period in TeV gamma-rays. During the whole observation period of Cyg X-3 with SHALON significant flux increases were detected at energies above 0.8 TeV. These TeV flux increases are correlated with flaring activity at a lower energy range of X-ray and/or at observations of Fermi LAT as well as with radio emission from the relativistic jets of Cygnus X-3. The variability of very high-energy gamma-radiation and correlation of radiation activity in the wide energy range can provide essential information on particle mechanism production up to very high energies. Whereas, modulation of very high energy emission connected to the orbital motion of the binary system, provides an understanding of the emission processes, nature and location of particle acceleration.
Photometric Analysis and Modeling of Five Mass-Transferring Binary Systems
Geist, Emily; Beaky, Matthew; Jamison, Kate
2018-01-01
In overcontact eclipsing binary systems, both stellar components have overfilled their Roche lobes, resulting in a dumbbell-shaped shared envelope. Mass transfer is common in overcontact binaries, which can be observed as a slow change on the rotation period of the system.We studied five overcontact eclipsing binary systems with evidence of period change, and thus likely mass transfer between the components, identified by Nelson (2014): V0579 Lyr, KN Vul, V0406 Lyr, V2240 Cyg, and MS Her. We used the 31-inch NURO telescope at Lowell Observatory in Flagstaff, Arizona to obtain images in B,V,R, and I filters for V0579 Lyr, and the 16-inch Meade LX200GPS telescope with attached SBIG ST-8XME CCD camera at Juniata College in Huntingdon, Pennsylvania to image KN Vul, V0406 Lyr, V2240 Cyg, and MS Her, also in B,V,R, and I.After data reduction, we created light curves for each of the systems and modeled the eclipsing binaries using the BinaryMaker3 and PHOEBE programs to determine their fundamental physical parameters for the first time. Complete light curves and preliminary models for each of these neglected eclipsing binary systems will be presented.
A New Orbit for the Eclipsing Binary V577 Oph
Energy Technology Data Exchange (ETDEWEB)
Jeffery, Elizabeth J. [Physics Department, California Polytechnic State University, San Luis Obispo, CA 93407 (United States); Barnes, Thomas G. III; Montemayor, Thomas J. [The University of Texas at Austin, McDonald Observatory, 1 University Station, C1402, Austin, TX 78712-0259 (United States); Skillen, Ian, E-mail: ejjeffer@calpoly.edu, E-mail: tgb@astro.as.utexas.edu, E-mail: tm@astro.as.utexas.edu, E-mail: wji@ing.iac.es [Isaac Newton Group, Apartado de Correos 321, E-38700 Santa Cruz de La Palma, Canary Islands (Spain)
2017-09-01
Pulsating stars in eclipsing binary systems are unique objects for providing constraints on stellar models. To fully leverage the information available from the binary system, full orbital radial velocity curves must be obtained. We report 23 radial velocities for components of the eclipsing binary V577 Oph, whose primary star is a δ Sct variable. The velocities cover a nearly complete orbit and a time base of 20 years. We computed orbital elements for the binary and compared them to the ephemeris computed by Creevey et al. The comparison shows marginally different results. In particular, a change in the systemic velocity by −2 km s{sup −1} is suggested by our results. We compare this systemic velocity difference to that expected due to reflex motion of the binary in response to the third body in the system. The systemic velocity difference is consistent with reflex motion, given our mass determination for the eclipsing binary and the orbital parameters determined by Volkov and Volkova for the three-body orbit. We see no evidence for the third body in our spectra, but we do see strong interstellar Na D lines that are consistent in strength with the direction and expected distance of V577 Oph.
A New Orbit for the Eclipsing Binary V577 Oph
Jeffery, Elizabeth J.; Barnes, Thomas G., III; Skillen, Ian; Montemayor, Thomas J.
2017-09-01
Pulsating stars in eclipsing binary systems are unique objects for providing constraints on stellar models. To fully leverage the information available from the binary system, full orbital radial velocity curves must be obtained. We report 23 radial velocities for components of the eclipsing binary V577 Oph, whose primary star is a δ Sct variable. The velocities cover a nearly complete orbit and a time base of 20 years. We computed orbital elements for the binary and compared them to the ephemeris computed by Creevey et al. The comparison shows marginally different results. In particular, a change in the systemic velocity by -2 km s-1 is suggested by our results. We compare this systemic velocity difference to that expected due to reflex motion of the binary in response to the third body in the system. The systemic velocity difference is consistent with reflex motion, given our mass determination for the eclipsing binary and the orbital parameters determined by Volkov & Volkova for the three-body orbit. We see no evidence for the third body in our spectra, but we do see strong interstellar Na D lines that are consistent in strength with the direction and expected distance of V577 Oph.
Expanding the catalog of binary black-hole simulations: aligned-spin configurations
Chu, Tony; Pfeiffer, Harald; Scheel, Mark; Szilagyi, Bela; SXS Collaboration
2015-04-01
A major goal of numerical relativity is to model the inspiral and merger of binary black holes through sufficiently accurate and long simulations, to enable the successful detection of gravitational waves. However, covering the full parameter space of binary configurations is a computationally daunting task. The SXS Collaboration has made important progress in this direction recently, with a catalog of 174 publicly available binary black-hole simulations [black-holes.org/waveforms]. Nevertheless, the parameter-space coverage remains sparse, even for non-precessing binaries. In this talk, I will describe an addition to the SXS catalog to improve its coverage, consisting of 95 new simulations of aligned-spin binaries with moderate mass ratios and dimensionless spins as high as 0.9. Some applications of these new simulations will also be mentioned.
A Bayesian network meta-analysis for binary outcome: how to do it.
Greco, Teresa; Landoni, Giovanni; Biondi-Zoccai, Giuseppe; D'Ascenzo, Fabrizio; Zangrillo, Alberto
2016-10-01
This study presents an overview of conceptual and practical issues of a network meta-analysis (NMA), particularly focusing on its application to randomised controlled trials with a binary outcome of interest. We start from general considerations on NMA to specifically appraise how to collect study data, structure the analytical network and specify the requirements for different models and parameter interpretations, with the ultimate goal of providing physicians and clinician-investigators a practical tool to understand pros and cons of NMA. Specifically, we outline the key steps, from the literature search to sensitivity analysis, necessary to perform a valid NMA of binomial data, exploiting Markov Chain Monte Carlo approaches. We also apply this analytical approach to a case study on the beneficial effects of volatile agents compared to total intravenous anaesthetics for surgery to further clarify the statistical details of the models, diagnostics and computations. Finally, datasets and models for the freeware WinBUGS package are presented for the anaesthetic agent example. © The Author(s) 2013.
Nikzad-Langerodi, Ramin; Lughofer, Edwin; Saminger-Platz, Susanne; Zahel, Thomas; Sagmeister, Patrick; Herwig, Christoph
2017-08-22
In this paper, we propose a new strategy for retrospective identification of feed phases from online sensor-data enriched feed profiles of an Escherichia Coli (E. coli) fed-batch fermentation process. In contrast to conventional (static), data-driven multi-class machine learning (ML), we exploit process knowledge in order to constrain our classification system yielding more parsimonious models compared to static ML approaches. In particular, we enforce unidirectionality on a set of binary, multivariate classifiers trained to discriminate between adjacent feed phases by linking the classifiers through a one-way switch. The switch is activated when the actual classifier output changes. As a consequence, the next binary classifier in the classifier chain is used for the discrimination between the next feed phase pair etc. We allow activation of the switch only after a predefined number of consecutive predictions of a transition event in order to prevent premature activation of the switch and undertake a sensitivity analysis regarding the optimal choice of the (time) lag parameter. From a complexity/parsimony perspective the benefit of our approach is three-fold: i) The multi-class learning task is broken down into binary subproblems which usually have simpler decision surfaces and tend to be less susceptible to the class-imbalance problem. ii) We exploit the fact that the process follows a rigid feed cycle structure (i.e. batch-feed-batch-feed) which allows us to focus on the subproblems involving phase transitions as they occur during the process while discarding off-transition classifiers and iii) only one binary classifier is active at the time which keeps effective model complexity low. We further use a combination of logistic regression and Lasso (i.e. regularized logistic regression, RLR) as a wrapper to extract the most relevant features for individual subproblems from the whole set of high-dimensional sensor data. We train different soft computing classifiers
Directory of Open Access Journals (Sweden)
Bushra Munawar
2016-07-01
Full Text Available The aim of this research study is to apply Structuralism (a Linguistic movement related to scientific study of words as signs as a theoretical framework on the poem “The Stone Chat” by Taufiq Rafat, a prominent Pakistani poet. The study focuses on, presenting Structuralistic analysis (relation between sign and signifier of the selected text, as proposed by the Swiss Structuralist, De Saussure. Besides, this paper particularly is a textual analysis of a Pakistani piece of poetry by application of linguistic concept of binary opposites (paired opposite as proposed by a Linguist Levi-Strauss (a linguist in his book Structuralist Anthropology, (1950. The searching of text for binary oppositions is the targeted endeavor of this study with the focus to analyze how far they are skillfully and contextually positioned in this poem. Hence, the researchers intend to focus on the antithetical forces and binary ideas present in the text. The close textual analysis of the poem is aimed at in this context, since The Stone Chat has antithetical ideas in abundance. Furthermore, the proposed study underhand, focuses upon bringing to foreground the syntagmatic relation (concept of chain between signifiers as they are employed in linguistic framework or pattern of this poem. Besides, to the fact how text (signifiers acts and reacts (contradicts to its linguistic framework, this paper aims to analyze the variations in tone, attitude and thinking perspectives of speaker in the poem. Furthermore, the close textual analysis, descriptive and interpretive methods as research techniques have been utilized in this study. This research study is likely to contribute to fields of Linguistics, Literary theory and Pakistani literature as a distinct genre.
Absolute dimensions of eclipsing binaries XXVII. V1130 tauri
DEFF Research Database (Denmark)
Clausen, Jens Viggo; Olsen, E, H.; Helt, B. E.
2010-01-01
stars: evolution / stars: fundamental parameters / stars: individual: V1130¿Tau / binaries: eclipsing / techniques: photometric / techniques: radial velocities Udgivelsesdato: 17 Feb.......stars: evolution / stars: fundamental parameters / stars: individual: V1130¿Tau / binaries: eclipsing / techniques: photometric / techniques: radial velocities Udgivelsesdato: 17 Feb....
APPLICATION OF GAS DYNAMICAL FRICTION FOR PLANETESIMALS. II. EVOLUTION OF BINARY PLANETESIMALS
Energy Technology Data Exchange (ETDEWEB)
Grishin, Evgeni; Perets, Hagai B. [Physics Department, Technion—Israel Institute of Technology, Haifa, 3200003 (Israel)
2016-04-01
One of the first stages of planet formation is the growth of small planetesimals and their accumulation into large planetesimals and planetary embryos. This early stage occurs long before the dispersal of most of the gas from the protoplanetary disk. At this stage gas–planetesimal interactions play a key role in the dynamical evolution of single intermediate-mass planetesimals (m{sub p} ∼ 10{sup 21}–10{sup 25} g) through gas dynamical friction (GDF). A significant fraction of all solar system planetesimals (asteroids and Kuiper-belt objects) are known to be binary planetesimals (BPs). Here, we explore the effects of GDF on the evolution of BPs embedded in a gaseous disk using an N-body code with a fiducial external force accounting for GDF. We find that GDF can induce binary mergers on timescales shorter than the disk lifetime for masses above m{sub p} ≳ 10{sup 22} g at 1 au, independent of the binary initial separation and eccentricity. Such mergers can affect the structure of merger-formed planetesimals, and the GDF-induced binary inspiral can play a role in the evolution of the planetesimal disk. In addition, binaries on eccentric orbits around the star may evolve in the supersonic regime, where the torque reverses and the binary expands, which would enhance the cross section for planetesimal encounters with the binary. Highly inclined binaries with small mass ratios, evolve due to the combined effects of Kozai–Lidov (KL) cycles with GDF which lead to chaotic evolution. Prograde binaries go through semi-regular KL evolution, while retrograde binaries frequently flip their inclination and ∼50% of them are destroyed.
Sputtering yield calculation for binary target
International Nuclear Information System (INIS)
Jimenez-Rodriguez, J.J.; Rodriguez-Vidal, M.; Valles-Abarca, J.A.
1979-01-01
The generalization for binary targets, of the ideas proposed by Sigmund for monoatomic targets, leads to a set of coupled intergrodifferential equations for the sputtering functions. After moment decomposition, the final formulae are obtained by the standard method based on the Laplace Transform, where the inverse transform is made with the aid of asymptotic expansions in the limit of very high projectile energy as compared to the surface binding energy. The possible loss of stoichiometry for binary targets is analyzed. Comparison of computed values of sputtering yield for normal incidence, with experimental results shows good agreement. (author)
Pulsed Accretion in the T Tauri Binary TWA 3A
Energy Technology Data Exchange (ETDEWEB)
Tofflemire, Benjamin M.; Mathieu, Robert D. [Department of Astronomy, University of Wisconsin–Madison, 475 North Charter Street, Madison, WI 53706 (United States); Herczeg, Gregory J. [The Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Akeson, Rachel L.; Ciardi, David R. [NASA Exoplanet Science Institute, IPAC/Caltech, Pasadena, CA 91125 (United States)
2017-06-20
TWA 3A is the most recent addition to a small group of young binary systems that both actively accrete from a circumbinary disk and have spectroscopic orbital solutions. As such, it provides a unique opportunity to test binary accretion theory in a well-constrained setting. To examine TWA 3A’s time-variable accretion behavior, we have conducted a two-year, optical photometric monitoring campaign, obtaining dense orbital phase coverage (∼20 observations per orbit) for ∼15 orbital periods. From U -band measurements we derive the time-dependent binary mass accretion rate, finding bursts of accretion near each periastron passage. On average, these enhanced accretion events evolve over orbital phases 0.85 to 1.05, reaching their peak at periastron. The specific accretion rate increases above the quiescent value by a factor of ∼4 on average but the peak can be as high as an order of magnitude in a given orbit. The phase dependence and amplitude of TWA 3A accretion is in good agreement with numerical simulations of binary accretion with similar orbital parameters. In these simulations, periastron accretion bursts are fueled by periodic streams of material from the circumbinary disk that are driven by the binary orbit. We find that TWA 3A’s average accretion behavior is remarkably similar to DQ Tau, another T Tauri binary with similar orbital parameters, but with significantly less variability from orbit to orbit. This is only the second clear case of orbital-phase-dependent accretion in a T Tauri binary.
On the Lack of Circumbinary Planets Orbiting Isolated Binary Stars
Fleming, David P.; Barnes, Rory; Graham, David E.; Luger, Rodrigo; Quinn, Thomas R.
2018-05-01
We outline a mechanism that explains the observed lack of circumbinary planets (CBPs) via coupled stellar–tidal evolution of isolated binary stars. Tidal forces between low-mass, short-period binary stars on the pre-main sequence slow the stellar rotations transferring rotational angular momentum to the orbit as the stars approach the tidally locked state. This transfer increases the binary orbital period, expanding the region of dynamical instability around the binary, and destabilizing CBPs that tend to preferentially orbit just beyond the initial dynamical stability limit. After the stars tidally lock, we find that angular momentum loss due to magnetic braking can significantly shrink the binary orbit, and hence the region of dynamical stability, over time, impacting where surviving CBPs are observed relative to the boundary. We perform simulations over a wide range of parameter space and find that the expansion of the instability region occurs for most plausible initial conditions and that, in some cases, the stability semimajor axis doubles from its initial value. We examine the dynamical and observable consequences of a CBP falling within the dynamical instability limit by running N-body simulations of circumbinary planetary systems and find that, typically, at least one planet is ejected from the system. We apply our theory to the shortest-period Kepler binary that possesses a CBP, Kepler-47, and find that its existence is consistent with our model. Under conservative assumptions, we find that coupled stellar–tidal evolution of pre-main sequence binary stars removes at least one close-in CBP in 87% of multi-planet circumbinary systems.
Effect of binary fraction on color-magnitude diagram of NGC 1904
Li, Zhongmu; Deng, Yangyang
2018-05-01
The age of a southern globular cluster in Milky Way, NGC 1904, was shown to be larger than the typical age of the universe, around 13.7 Gyr, by some photometric studies which assumed all stars as single stars. Besides the uncertainties in photometry, isochrone and fitting technique, the neglect of binary stars possibly distorted the result. We study the effect of binary fraction on the color-magnitude diagram (CMD) of NGC 1904, via a new tool for CMD studies, Powerful CMD, which can determine binary fraction, age, metallicity, distance modulus, color excess, rotating star fraction and star formation history simultaneously. We finally obtain the youngest age of 14.1±2.1 Gyr with a zero-age binary fraction of 60 percent for cluster NGC 1904. The result is consistent with the age of the universe. Although our result suggests that binary fraction affects the determination of age slightly, it can improve the fitting to observed CMD, in particular blue stragglers. This suggests us to consider the effect of binaries in the studies of star clusters.
Microlensing discovery of a population of very tight, very low mass binary brown dwarfs
DEFF Research Database (Denmark)
Choi, J.-Y.; Han, C.; Udalski, A.
2013-01-01
the discovery via gravitational microlensing of two very low mass, very tight binary systems. These binaries have directly and precisely measured total system masses of 0.025 M ☉ and 0.034 M ☉, and projected separations of 0.31 AU and 0.19 AU, making them the lowest-mass and tightest field BD binaries known....... The discovery of a population of such binaries indicates that BD binaries can robustly form at least down to masses of ~0.02 M ☉. Future microlensing surveys will measure a mass-selected sample of BD binary systems, which can then be directly compared to similar samples of stellar binaries....
International Nuclear Information System (INIS)
Morales Mendoza, N.; Goyanes, S.; Chiliotte, C.; Bekeris, V.; Rubiolo, G.; Candal, R.
2012-01-01
Magnetic binary nanofillers containing multiwall carbon nanotubes (MWCNT) and hercynite were synthesized by Chemical Vapor Deposition (CVD) on Fe/AlOOH prepared by the sol-gel method. The catalyst precursor was fired at 450 °C, ground and sifted through different meshes. Two powders were obtained with different particle sizes: sample A (50-75 μm) and sample B (smaller than 50 μm). These powders are composed of iron oxide particles widely dispersed in the non-crystalline matrix of aluminum oxide and they are not ferromagnetic. After reduction process the powders are composed of α-Fe nanoparticles inside hercynite matrix. These nanofillers are composed of hercynite containing α-Fe nanoparticles and MWCNT. The binary magnetic nanofillers were slightly ferromagnetic. The saturation magnetization of the nanofillers depended on the powder particle size. The nanofiller obtained from powder particles in the range 50-75 μm showed a saturation magnetization 36% higher than the one formed from powder particles smaller than 50 μm. The phenomenon is explained in terms of changes in the magnetic environment of the particles as consequence of the presence of MWCNT.
Energy Technology Data Exchange (ETDEWEB)
Morales Mendoza, N. [INQUIMAE, CONICET-UBA, Ciudad Universitaria, Pab2, (C1428EHA) Bs As (Argentina); LPyMC, Dep. De Fisica, FCEN-UBA and IFIBA -CONICET, Ciudad Universitaria, Cap. Fed. (Argentina); Goyanes, S. [LPyMC, Dep. De Fisica, FCEN-UBA and IFIBA -CONICET, Ciudad Universitaria, Cap. Fed. (Argentina); Chiliotte, C.; Bekeris, V. [LBT, Dep. De Fisica, FCEN-UBA. Ciudad Universitaria, Pab1, C1428EGA CABA (Argentina); Rubiolo, G. [LPyMC, Dep. De Fisica, FCEN-UBA and IFIBA -CONICET, Ciudad Universitaria, Cap. Fed. (Argentina); Unidad de Actividad Materiales, CNEA, Av Gral. Paz 1499, San Martin (1650), Prov. de Bs As (Argentina); Candal, R., E-mail: candal@qi.fcen.uba.ar [INQUIMAE, CONICET-UBA, Ciudad Universitaria, Pab2, (C1428EHA) Bs As (Argentina); Escuela de Ciencia y Tecnologia, 3iA, Universidad de Gral. San Martin, San Martin, Prov. Bs As (Argentina)
2012-08-15
Magnetic binary nanofillers containing multiwall carbon nanotubes (MWCNT) and hercynite were synthesized by Chemical Vapor Deposition (CVD) on Fe/AlOOH prepared by the sol-gel method. The catalyst precursor was fired at 450 Degree-Sign C, ground and sifted through different meshes. Two powders were obtained with different particle sizes: sample A (50-75 {mu}m) and sample B (smaller than 50 {mu}m). These powders are composed of iron oxide particles widely dispersed in the non-crystalline matrix of aluminum oxide and they are not ferromagnetic. After reduction process the powders are composed of {alpha}-Fe nanoparticles inside hercynite matrix. These nanofillers are composed of hercynite containing {alpha}-Fe nanoparticles and MWCNT. The binary magnetic nanofillers were slightly ferromagnetic. The saturation magnetization of the nanofillers depended on the powder particle size. The nanofiller obtained from powder particles in the range 50-75 {mu}m showed a saturation magnetization 36% higher than the one formed from powder particles smaller than 50 {mu}m. The phenomenon is explained in terms of changes in the magnetic environment of the particles as consequence of the presence of MWCNT.
Performance Analysis of Binary Search Algorithm in RFID
Directory of Open Access Journals (Sweden)
Xiangmei SONG
2014-12-01
Full Text Available Binary search algorithm (BS is a kind of important anti-collision algorithm in the Radio Frequency Identification (RFID, is also one of the key technologies which determine whether the information in the tag is identified by the reader-writer fast and reliably. The performance of BS directly affects the quality of service in Internet of Things. This paper adopts an automated formal technology: probabilistic model checking to analyze the performance of BS algorithm formally. Firstly, according to the working principle of BS algorithm, its dynamic behavior is abstracted into a Discrete Time Markov Chains which can describe deterministic, discrete time and the probability selection. And then on the model we calculate the probability of the data sent successfully and the expected time of tags completing the data transmission. Compared to the another typical anti-collision protocol S-ALOHA in RFID, experimental results show that with an increase in the number of tags the BS algorithm has a less space and time consumption, the average number of conflicts increases slower than the S-ALOHA protocol standard, BS algorithm needs fewer expected time to complete the data transmission, and the average speed of the data transmission in BS is as 1.6 times as the S-ALOHA protocol.
White dwarf-main sequence binaries from LAMOST: the DR5 catalogue
Ren, J.-J.; Rebassa-Mansergas, A.; Parsons, S. G.; Liu, X.-W.; Luo, A.-L.; Kong, X.; Zhang, H.-T.
2018-03-01
We present the data release (DR) 5 catalogue of white dwarf-main sequence (WDMS) binaries from the Large Area Multi-Object fiber Spectroscopic Telescope (LAMOST). The catalogue contains 876 WDMS binaries, of which 757 are additions to our previous LAMOST DR1 sample and 357 are systems that have not been published before. We also describe a LAMOST-dedicated survey that aims at obtaining spectra of photometrically-selected WDMS binaries from the Sloan Digital Sky Survey (SDSS) that are expected to contain cool white dwarfs and/or early type M dwarf companions. This is a population under-represented in previous SDSS WDMS binary catalogues. We determine the stellar parameters (white dwarf effective temperatures, surface gravities and masses, and M dwarf spectral types) of the LAMOST DR5 WDMS binaries and make use of the parameter distributions to analyse the properties of the sample. We find that, despite our efforts, systems containing cool white dwarfs remain under-represented. Moreover, we make use of LAMOST DR5 and SDSS DR14 (when available) spectra to measure the Na I λλ 8183.27, 8194.81 absorption doublet and/or Hα emission radial velocities of our systems. This allows identifying 128 binaries displaying significant radial velocity variations, 76 of which are new. Finally, we cross-match our catalogue with the Catalina Surveys and identify 57 systems displaying light curve variations. These include 16 eclipsing systems, two of which are new, and nine binaries that are new eclipsing candidates. We calculate periodograms from the photometric data and measure (estimate) the orbital periods of 30 (15) WDMS binaries.
Studying Variance in the Galactic Ultra-compact Binary Population
Larson, Shane; Breivik, Katelyn
2017-01-01
In the years preceding LISA, Milky Way compact binary population simulations can be used to inform the science capabilities of the mission. Galactic population simulation efforts generally focus on high fidelity models that require extensive computational power to produce a single simulated population for each model. Each simulated population represents an incomplete sample of the functions governing compact binary evolution, thus introducing variance from one simulation to another. We present a rapid Monte Carlo population simulation technique that can simulate thousands of populations on week-long timescales, thus allowing a full exploration of the variance associated with a binary stellar evolution model.
Formation of planetary nebulae with close binary nuclei
Energy Technology Data Exchange (ETDEWEB)
Livio, M; Salzman, J; Shaviv, G [Tel Aviv Univ. (Israel). Dept. of Physics and Astronomy
1979-07-01
A model for the formation of planetary nebulae with a close binary as a nucleus is presented. The model is based on mass loss instability at L/sub 2/. The instability is demonstrated. The conditions on the mass loss are formulated and analysed. The observational consequence of the model is described briefly and its relation to symbiotic stars and cataclysmic binaries discussed.
Context based Coding of Binary Shapes by Object Boundary Straightness Analysis
DEFF Research Database (Denmark)
Aghito, Shankar Manuel; Forchhammer, Søren
2004-01-01
A new lossless compression scheme for bilevel images targeted at binary shapes of image and video objects is presented. The scheme is based on a local analysis of the digital straightness of the causal part of the object boundary, which is used in the context definition for arithmetic encoding....... Tested on individual images of binary shapes and binary layers of digital maps the algorithm outperforms PWC, JBIG and MPEG-4 CAE. On the binary shapes the code lengths are reduced by 21%, 25%, and 42%, respectively. On the maps the reductions are 34%, 32%, and 59%, respectively. The algorithm is also...
A Catalog of 1022 Bright Contact Binary Stars
Gettel, S. J.; Geske, M. T.; McKay, T. A.
2006-01-01
In this work we describe a large new sample of contact binary stars extracted in a uniform manner from sky patrol data taken by the ROTSE-I telescope. Extensive ROTSE-I light-curve data are combined with J-, H-, and K-band near-infrared data taken from the Two Micron All Sky Survey to add color information. Contact binary candidates are selected using the observed period-color relation. Candidates are confirmed by visual examination of the light curves. To enhance the utility of this catalog, we derive a new J-H period-color-luminosity relation and use this to estimate distances for the entire catalog. From these distance estimates we derive an estimated contact binary space density of (1.7+/-0.6)×10-5 pc-3.
Microstructure and properties of Mg-Al binary alloys
Directory of Open Access Journals (Sweden)
ZHENG Wei-chao
2006-11-01
Full Text Available The effects of different amounts of added Al, ranging from 1 % to 9 %, on the microstructure and properties of Mg-Al binary alloys were investigated. The results showed that when the amount of added Al is less than 5%, the grain size of the Mg-Al binary alloys decreases dramatically from 3 097 μm to 151 μm with increasing addition of Al. Further addition of Al up to 9% makes the grain size decrease slowly to 111 μm. The α-Mg dendrite arms are also refined. Increasing the amount of added Al decreases the hot cracking susceptibility of the Mg-Al binary alloys remarkably, and enhances the micro-hardness of the α-Mg matrix.
WIYN Open Cluster Study: Tidal Interactions in Solar type Binaries
Meibom, S.; Mathieu, R. D.
2003-01-01
We present an ongoing study on tidal interactions in late-type close binary stars. New results on tidal circularization are combined with existing data to test and constrain theoretical predictions of tidal circularization in the pre-main-sequence (PMS) phase and throughout the main-sequence phase of stellar evolution. Current data suggest that tidal circularization during the PMS phase sets the tidal cutoff period for binary populations younger than ~1 Gyr. Binary populations older than ~1 G...
Magnetic braking in Solar-type close binaries
Maceroni, C.; Rucinski, S. M.
In tidally locked binaries the angular momentum loss by magnetic braking affects the orbital period. While this effect is too small to be detected in individual systems, its signature can be seen in shape of the orbital period distribution of suitable samples. As a consequence information on the braking mechanisms can be obtained - at least in principle - from the analysis of the distributions, the main problems being the selection of a large and homogeneous sample of binaries and the appropriate treatment of the observational biases. New large databases of variable stars are becoming available as by-products of microlensing projects, which have the advantage of joining, for the first time, sample richness and homogeneity. We report the main results of the analysis of the eclipsing binaries in OGLE-I catalog, that contains several thousands variables detected in a pencil-beam search volume towards the Baade's Window. By means of an automatic filtering algorithm we extracted a sample of 74 detached, equal-mass, main-sequence binary stars with short orbital periods (i.e., in the range 0.19 braking law. The results suggest an AML braking law very close to the "saturated" one, with a very weak dependence on the period. However we are still far from constraining the precise value of the slope, because of the important role played by the observational bias.
Face Alignment via Regressing Local Binary Features.
Ren, Shaoqing; Cao, Xudong; Wei, Yichen; Sun, Jian
2016-03-01
This paper presents a highly efficient and accurate regression approach for face alignment. Our approach has two novel components: 1) a set of local binary features and 2) a locality principle for learning those features. The locality principle guides us to learn a set of highly discriminative local binary features for each facial landmark independently. The obtained local binary features are used to jointly learn a linear regression for the final output. This approach achieves the state-of-the-art results when tested on the most challenging benchmarks to date. Furthermore, because extracting and regressing local binary features are computationally very cheap, our system is much faster than previous methods. It achieves over 3000 frames per second (FPS) on a desktop or 300 FPS on a mobile phone for locating a few dozens of landmarks. We also study a key issue that is important but has received little attention in the previous research, which is the face detector used to initialize alignment. We investigate several face detectors and perform quantitative evaluation on how they affect alignment accuracy. We find that an alignment friendly detector can further greatly boost the accuracy of our alignment method, reducing the error up to 16% relatively. To facilitate practical usage of face detection/alignment methods, we also propose a convenient metric to measure how good a detector is for alignment initialization.
ON NEUTRAL ABSORPTION AND SPECTRAL EVOLUTION IN X-RAY BINARIES
International Nuclear Information System (INIS)
Miller, J. M.; Cackett, E. M.; Reis, R. C.
2009-01-01
Current X-ray observatories make it possible to follow the evolution of transient and variable X-ray binaries across a broad range in luminosity and source behavior. In such studies, it can be unclear whether evolution in the low-energy portion of the spectrum should be attributed to evolution in the source, or instead to evolution in neutral photoelectric absorption. Dispersive spectrometers make it possible to address this problem. We have analyzed a small but diverse set of X-ray binaries observed with the Chandra High Energy Transmission Grating Spectrometer across a range in luminosity and different spectral states. The column density in individual photoelectric absorption edges remains constant with luminosity, both within and across source spectral states. This finding suggests that absorption in the interstellar medium strongly dominates the neutral column density observed in spectra of X-ray binaries. Consequently, evolution in the low-energy spectrum of X-ray binaries should properly be attributed to evolution in the source spectrum. We discuss our results in the context of X-ray binary spectroscopy with current and future X-ray missions.
Absolute dimensions of solar-type eclipsing binaries III. EW orionis
DEFF Research Database (Denmark)
Clausen, Jens Viggo; Bruntt, H.; Olsen, E. H.
2010-01-01
stars: evolution / stars: fundamental parameters / stars: abundances / binaries: eclipsing / techniques: photometric / techniques: spectroscopic Udgivelsesdato: 23 Feb.......stars: evolution / stars: fundamental parameters / stars: abundances / binaries: eclipsing / techniques: photometric / techniques: spectroscopic Udgivelsesdato: 23 Feb....
Binary Sparse Phase Retrieval via Simulated Annealing
Directory of Open Access Journals (Sweden)
Wei Peng
2016-01-01
Full Text Available This paper presents the Simulated Annealing Sparse PhAse Recovery (SASPAR algorithm for reconstructing sparse binary signals from their phaseless magnitudes of the Fourier transform. The greedy strategy version is also proposed for a comparison, which is a parameter-free algorithm. Sufficient numeric simulations indicate that our method is quite effective and suggest the binary model is robust. The SASPAR algorithm seems competitive to the existing methods for its efficiency and high recovery rate even with fewer Fourier measurements.
ON THE APPARENT LACK OF Be X-RAY BINARIES WITH BLACK HOLES
International Nuclear Information System (INIS)
Belczynski, Krzysztof; Ziolkowski, Janusz
2009-01-01
In our Galaxy there are 64 Be X-ray binaries known to date. Out of these, 42 host a neutron star (NS), and for the remainder the nature of the companion is unknown. None, so far, are known to host a black hole (BH). There seems to be no apparent mechanism that would prevent formation or detection of Be stars with BHs. This disparity is referred to as a missing Be-BH X-ray binary problem. We point out that current evolutionary scenarios that lead to the formation of Be X-ray binaries predict that the ratio of binaries with NSs to the ones with BHs is rather high, F NStoBH ∼ 10-50, with the more likely formation models providing the values at the high end. The ratio is a natural outcome of (1) the stellar initial mass function that produces more NSs than BHs and (2) common envelope evolution (i.e., a major mechanism involved in the formation of interacting binaries) that naturally selects progenitors of Be X-ray binaries with NSs (binaries with comparable mass components have more likely survival probabilities) over ones with BHs (which are much more likely to be common envelope mergers). A comparison of this ratio (i.e., F NStoBH ∼ 30) with the number of confirmed Be-NS X-ray binaries (42) indicates that the expected number of Be-BH X-ray binaries is of the order of only ∼0-2. This is entirely consistent with the observed Galactic sample.
A New Equilibrium State for Singly Synchronous Binary Asteroids
Golubov, Oleksiy; Unukovych, Vladyslav; Scheeres, Daniel J.
2018-04-01
The evolution of rotation states of small asteroids is governed by the Yarkovsky–O’Keefe–Radzievskii–Paddack (YORP) effect, nonetheless some asteroids can stop their YORP evolution by attaining a stable equilibrium. The same is true for binary asteroids subjected to the binary YORP (BYORP) effect. Here we discuss a new type of equilibrium that combines these two, which is possible in a singly synchronous binary system. This equilibrium occurs when the normal YORP, the tangential YORP, and the BYORP compensate each other, and tidal torques distribute the angular momentum between the components of the system and dissipate energy. If unperturbed, such a system would remain singly synchronous in perpetuity with constant spin and orbit rates, as the tidal torques dissipate the incoming energy from impinging sunlight at the same rate. The probability of the existence of this kind of equilibrium in a binary system is found to be on the order of a few percent.
Modeling AGN outbursts from supermassive black hole binaries
Directory of Open Access Journals (Sweden)
Tanaka T.
2012-12-01
Full Text Available When galaxies merge to assemble more massive galaxies, their nuclear supermassive black holes (SMBHs should form bound binaries. As these interact with their stellar and gaseous environments, they will become increasingly compact, culminating in inspiral and coalescence through the emission of gravitational radiation. Because galaxy mergers and interactions are also thought to fuel star formation and nuclear black hole activity, it is plausible that such binaries would lie in gas-rich environments and power active galactic nuclei (AGN. The primary difference is that these binaries have gravitational potentials that vary – through their orbital motion as well as their orbital evolution – on humanly tractable timescales, and are thus excellent candidates to give rise to coherent AGN variability in the form of outbursts and recurrent transients. Although such electromagnetic signatures would be ideally observed concomitantly with the binary’s gravitational-wave signatures, they are also likely to be discovered serendipitously in wide-field, high-cadence surveys; some may even be confused for stellar tidal disruption events. I discuss several types of possible “smoking gun” AGN signatures caused by the peculiar geometry predicted for accretion disks around SMBH binaries.
Graph theory and binary alloys passivated by nickel
International Nuclear Information System (INIS)
McCafferty, E.
2005-01-01
The passivity of a nickel binary alloy is considered in terms of a network of -Ni-O-Ni- bridges in the oxide film, where Ni is the component of the binary alloy which produces passivity. The structure of the oxide is represented by a mathematical graph, and graph theory is used to calculate the connectivity of the oxide, given by the product of the number of edges in the graph and the Randic index. A stochastic calculation is employed to insert ions of the second metal into the oxide film so as to disrupt the connectivity of the -Ni-O-Ni- network. This disruption occurs at a critical ionic concentration of the oxide film. Mathematical relationships are developed for the introduction of a general ion B +n into the oxide film, and critical ionic compositions are calculated for oxide films on the nickel binary alloys. The notation B refers to any metal B which produces B +n ions in the oxide film, where +n is the oxidation number of the ion. The results of this analysis for Fe-Ni and Cu-Ni binary alloys are in good agreement with experimental results
Searching for Signatures of Supermassive Black Hole Binaries
Ayers, Megan; Gezari, Suvi; Liu, Tingting
2018-01-01
Theoretical studies suggest that supermassive black hole binaries (SMBHBs) are an inevitable consequence of major galaxy mergers. Additionally, as SMBHBs coalesce they are expected to be sources of tremendous gravitational wave emission. Interest in these sources motivates the search for detection of the first definitive SMBHB and observational signatures to methodize the search. We present spectral energy distributions (SEDs) for a sample of candidate SMBHBs selected from quasars demonstrating optical periodic variability from the Pan-STARRS1 Medium Deep Survey. The SEDs were constructed using existing archival data spanning from radio to X-ray emission. For each candidate SMBHB, we also present models of the theoretical spectrum emitted from the circumbinary and minidisks of the SMBHB system using the predictions of Roedig et al. (2014) and inferred parameters of the candidates (combined mass, mass ratio, binary separation, accretion rate). We compare the observational SED for each source to its respective binary model as well as to the expected mean SED of a normal non-binary system quasar to look for supporting evidence of a SMBHB system. This project was supported in part by the NSF REU grant AST-1358980 and by the Nantucket Maria Mitchell Association.
HD271791: dynamical versus binary-supernova ejection scenario
Gvaramadze, V. V.
2009-05-01
The atmosphere of the extremely high-velocity (530-920kms-1) early B-type star HD271791 is enriched in α-process elements, which suggests that this star is a former secondary component of a massive tight binary system and that its surface was polluted by the nucleosynthetic products after the primary star exploded in a supernova. It was proposed that the (asymmetric) supernova explosion unbind the system and that the secondary star (HD271791) was released at its orbital velocity in the direction of Galactic rotation. In this Letter, we show that to explain the Galactic rest-frame velocity of HD271791 within the framework of the binary-supernova scenario, the stellar remnant of the supernova explosion (a =750-1200kms-1. We therefore consider the binary-supernova scenario as highly unlikely and instead propose that HD271791 attained its peculiar velocity in the course of a strong dynamical three- or four-body encounter in the dense core of the parent star cluster. Our proposal implies that by the moment of encounter HD271791 was a member of a massive post-supernova binary.
Decision-Making for Supply Chain Integration Supply Chain Integration
Lettice, Fiona; Durowoju, Olatunde
2012-01-01
Effective supply chain integration, and the tight co-ordination it creates, is an essential pre-requisite for successful supply chain management. Decision-Making for Supply Chain Integration is a practical reference on recent research in the area of supply chain integration focusing on distributed decision-making problems. Recent applications of various decision-making tools for integrating supply chains are covered including chapters focusing on: •Supplier selection, pricing strategy and inventory decisions in multi-level supply chains, •RFID-enabled distributed decision-making, •Operational risk issues and time-critical decision-making for sensitive logistics nodes, Modelling end to end processes to improve supply chain integration, and •Integrated systems to improve service delivery and optimize resource use. Decision-Making for Supply Chain Integration provides an insight into the tools and methodologies of this field with support from real-life case studies demonstrating successful application ...
Broekhuis, H.; Verkuyl, H.J
2014-01-01
The present paper adopts as its point of departure the claim by Te Winkel (1866) and Verkuyl (2008) that mental temporal representations are built on the basis of three binary oppositions: Present/Past, Synchronous/Posterior and Imperfect/Perfect. Te Winkel took the second opposition in terms of the
Equational binary decision diagrams
J.F. Groote (Jan Friso); J.C. van de Pol (Jaco)
2000-01-01
textabstractWe incorporate equations in binary decision diagrams (BDD). The resulting objects are called EQ-BDDs. A straightforward notion of ordered EQ-BDDs (EQ-OBDD) is defined, and it is proved that each EQ-BDD is logically equivalent to an EQ-OBDD. Moreover, on EQ-OBDDs satisfiability and
TIDAL NOVAE IN COMPACT BINARY WHITE DWARFS
International Nuclear Information System (INIS)
Fuller, Jim; Lai Dong
2012-01-01
Compact binary white dwarfs (WDs) undergoing orbital decay due to gravitational radiation can experience significant tidal heating prior to merger. In these WDs, the dominant tidal effect involves the excitation of outgoing gravity waves in the inner stellar envelope and the dissipation of these waves in the outer envelope. As the binary orbit decays, the WDs are synchronized from outside in (with the envelope synchronized first, followed by the core). We examine the deposition of tidal heat in the envelope of a carbon-oxygen WD and study how such tidal heating affects the structure and evolution of the WD. We show that significant tidal heating can occur in the star's degenerate hydrogen layer. This layer heats up faster than it cools, triggering runaway nuclear fusion. Such 'tidal novae' may occur in all WD binaries containing a CO WD, at orbital periods between 5 minutes and 20 minutes, and precede the final merger by 10 5 -10 6 years.